Compositions and methods for treating neurological disorders associated with glucosylceramidase beta 1 deficiency

AAV-based Gcase gene delivery using optimized nucleotide sequences addresses Gcase protein deficiency, enhancing GBA1 activity and metabolism to treat Parkinson's disease and Gaucher disease.

JP2026504367APending Publication Date: 2026-02-05VOYAGER THERAPEUTICS INC
View PDF 0 Cites 0 Cited by

Patent Information

Application Number
JP2025542175
Authority / Receiving Office
JP · JP
Patent Type
Applications
Current Assignee / Owner
Priority Date
2023-02-02
Filing Date
2024-02-01
Publication Date
2026-02-05

AI Technical Summary

Technical Problem

There is a need for effective pharmaceutical compositions and methods to treat Parkinson's disease and other GBA1-related disorders by restoring Gcase protein deficiency in patients.

Method used

AAV-based compositions and methods for Gcase gene delivery are provided to restore Gcase protein function and improve lysosomal glycolipid metabolism, using nucleotide sequences with altered GC content and reduced CpG motifs to enhance GBA1 expression and activity in specific brain regions while minimizing immunogenicity.

Benefits of technology

The AAV-based methods improve GBA1 activity and reduce substrate accumulation, slowing or reversing neurodegenerative symptoms in GBA1-related disorders such as Parkinson's disease and Gaucher disease.

✦ Generated by Eureka AI based on patent content.

Smart Images

  • Figure 2026504367000001_ABST
    Figure 2026504367000001_ABST
Patent Text Reader

Abstract

The present disclosure relates to compositions and methods for modifying, e.g., enhancing, expression of GCase protein, whether in vitro and / or in vivo. Such compositions include delivery of adeno-associated virus (AAV) particles. The compositions and methods of the present disclosure are useful for treating subjects diagnosed with or suspected of having Parkinson's disease (PD), Gaucher disease (GD), dementia with Lewy bodies (DLB), or related conditions resulting from deficiencies in the amount and / or function of the GBA1 gene product or associated with reduced expression or protein levels of GCase protein.
Need to check novelty before this filing date? Find Prior Art

Description

[Technical Field]

[0001] Sequence Listing This application is submitted with an electronic Sequence Listing. The Sequence Listing file, named 14640-0070-01304_SL.xml, was created on January 31, 2024, and is 5,007,704 bytes in size. The information in the electronic format of the Sequence Listing is incorporated herein by reference in its entirety.

[0002] Described herein are compositions and methods relating to polynucleotides, e.g., polynucleotides encoding glucosylceramidase beta 1 (GBA1) proteins and peptides, for use in treating Parkinson's disease (PD) and other GBA-associated disorders, including Gaucher disease and dementia with Lewy bodies (collectively "GBA-associated disorders"). In some embodiments, the compositions may be delivered by adeno-associated viral (AAV) vectors. In other embodiments, the compositions described herein may be used to treat a subject in need thereof, such as a human subject diagnosed with a GBA1-associated disorder or other condition resulting from a deficiency in the amount and / or function of GBA1 protein, or may be used as a research tool in the study of such diseases or conditions in cellular or animal models of the disease or condition. [Background technology]

[0003] Lysosomal acid glucosylceramidase, commonly known as glucosylcerebrosidase or Gcase, is a D-glucosyl-N-acylsphingosine monocohydrolase and is a key lysosomal membrane protein in glycolipid metabolism. This enzyme is encoded by the glucosylceramidase β1 (GBA1) gene (Ensembl Gene ID No. ENSG00000177628). Together with saposin A and saposin C, this enzyme catalyzes the hydrolysis of glucosylceramide to ceramide and glucose. See, e.g., J. Am. Chem. Soc. 1999, 144:1117-1120 (the contents of which are incorporated herein by reference in their entirety).

[0004] Mutations in GBA1 are known to cause disease in human subjects. Homozygous or compound heterozygous GBA1 mutations lead to Gaucher disease (GD). See (Non-Patent Document 2), the contents of which are incorporated herein by reference in their entirety. Gaucher disease is listed as the most prevalent lysosomal storage disorder, with a standardized birth incidence estimate in the general population of 0.4 to 5.8 per 100,000. Heterozygous GBA1 mutations can lead to PD. In fact, GBA1 mutations are found in 7 to 10% of all PD patients, making GBA1 mutations the most important genetic risk factor for PD. PD-GBA1 patients have reduced levels of the lysosomal enzyme β-glucocerebrosidase (Gcase), resulting in increased accumulation of the glycosphingolipid glucosylceramide (GluCer), which is therefore correlated with α-synuclein aggregation and the associated worsening of neurological symptoms. Gaucher disease and PD, as well as other lysosomal storage disorders or Lewy body diseases and related disorders, such as dementia with Lewy bodies, share a common etiology in the GBA1 gene in some cases. See, e.g., J. Med. J. Neurol. 2004, 103:1111-1122 (2004), the contents of which are incorporated by reference in their entirety. Only limited treatment options exist for such diseases. [Prior art documents] [Non-patent literature]

[0005] [Non-Patent Document 1] Vaccaro, Anna Maria et al., Journal of Biological Chemistry, Vol. 272, No. 27, 1997, pp. 16862-16867 [Non-patent document 2] Sardi, S. Pablo, Jesse M. Cedarbaum, and Patrik Brundin, Movement Disorders, Vol. 33, No. 5, 2018, pp. 684-696 [Non-patent document 3] Sidransky, E. and Lopez, G., Lancet Neurol., November 2012, Vol. 11, No. 11, pp. 986-998 Summary of the Invention [Problem to be solved by the invention]

[0006] Therefore, there remains a long-felt need to develop pharmaceutical compositions and methods for the treatment of PD and other GBA1-related disorders and to restore Gcase protein deficiency in patients suffering from GBA1-related disorders. [Means for solving the problem]

[0007] The present disclosure addresses these challenges by providing AAV-based compositions and methods for treating Gcase deficiency in patients. Disclosed herein are compositions and methods for AAV-based Gcase gene delivery to restore loss of function and improve intracellular lipid trafficking. The compositions and methods improve lysosomal glycolipid metabolism in a subject (e.g., a subject with a mutation in the GBA1 gene, e.g., a subject with a mutation in the GBA1 gene) and are useful for slowing, halting, or reversing neurodegenerative and other symptoms of PD and other GBA1-related disorders (e.g., dementia with Lewy Bodies (DLB), Gaucher disease (GD)). Unless otherwise specified, the terms GBA1 protein, GBA1 protein, and Gcase protein are synonymous and used interchangeably to refer to the protein encoded by the GBA1 gene.

[0008] In some embodiments, the present disclosure provides a nucleotide sequence encoding a wild-type GBA1 protein, which GBA1-encoding nucleotide sequence comprises altered GC content and / or a reduced number of CpG motifs (e.g., lacking all CpG motifs) compared to a wild-type GBA1 coding sequence (e.g., comprising the nucleotide sequence of SEQ ID NO: 1776 or 1777). In some embodiments, the GBA1-encoding nucleotide sequence unexpectedly provides increased GBA1 expression in the brain (e.g., cortex, striatum, and brainstem), increased GBA1 activity in the brain (e.g., increased glucosylceramide and glucosylsphingosine substrate clearance), and reduced immunogenicity, for example, compared to a wild-type GBA1 coding sequence (e.g., comprising the nucleotide sequence of SEQ ID NO: 1776 or 1777). In some embodiments, the GBA1-encoding nucleotide sequences described herein unexpectedly provide reduced GBA1 expression in the dorsal root ganglion (DRG), while retaining high GBA1 activity in other regions of the brain (e.g., the brainstem), compared to, for example, a wild-type GBA1 coding sequence (e.g., comprising the nucleotide sequence of SEQ ID NO: 1776 or 1777). In some embodiments, the nucleotide sequences encoding the wild-type GBA1 proteins described herein can be administered to subjects with a GBA1-associated disorder, such as Parkinson's disease.

[0009] In some embodiments, the GBA1-encoding nucleotide sequence comprises SEQ ID NO:2001, or a sequence at least 94% (e.g., at least 94%, at least 95%, at least 96%, at least 97%, at least 98%, or at least 99%) identical thereto. In some embodiments, the GBA1-encoding nucleotide sequence comprises SEQ ID NO:2002, or a sequence at least 93% (e.g., at least 93%, at least 94%, at least 95%, at least 96%, at least 97%, at least 98%, or at least 99%) identical thereto.

[0010] In some embodiments, the GBA1-encoding nucleotide sequence is contained in an AAV viral genome comprising the nucleotide sequence of SEQ ID NO: 2006 or SEQ ID NO: 2007, or a sequence that is at least 97% (e.g., at least 97%, at least 98%, or at least 99%) identical thereto.

[0011] In some embodiments, the GBA1-encoding nucleotide sequence (e.g., SEQ ID NO: 2001 or SEQ ID NO: 2002 or a sequence at least 94% (e.g., at least 94%, at least 95%, at least 96%, at least 97%, at least 98% or at least 99%) identical thereto) comprises a lower GC content than the nucleotide sequence of SEQ ID NO: 1772, 1773, 1780 or 1781.

[0012] In some embodiments, administration of a GBA1-encoding nucleotide sequence (e.g., a sequence comprising the nucleotide sequence of SEQ ID NO: 2001 or SEQ ID NO: 2002, or a sequence that is at least 94% (e.g., at least 94%, at least 95%, at least 96%, at least 97%, at least 98%, or at least 99%) identical thereto) to a subject results in higher GBA1 activity, e.g., higher glucosylceramide and glucosylsphingosine substrate reduction, in the subject's brain compared to administration of a sequence comprising the nucleotide sequence of SEQ ID NO: 1772 or 1773.

[0013] In some embodiments, administration of AAV particles comprising a GBA1-encoding nucleotide sequence (e.g., a nucleotide sequence comprising SEQ ID NO: 2007 or a sequence at least 97% (e.g., at least 97%, at least 98%, or at least 99%) identical thereto) to a subject results in reduced GBA1 expression in the DRG compared to administration of a sequence comprising the nucleotide sequence of SEQ ID NO: 1772 or 1773, while GBA1 activity in other brain regions (e.g., the brainstem) is not significantly reduced compared to administration of a sequence comprising the nucleotide sequence of SEQ ID NO: 1772 or 1773.

[0014] In some embodiments, the disclosure provides an isolated nucleic acid comprising a transgene encoding a GBA1 protein, wherein the nucleotide sequence encoding the GBA1 protein comprises a codon-optimized nucleotide sequence that is at least 93% identical (e.g., at least 93%, at least 94%, at least 95%, at least 96%, at least 97%, at least 98%, at least 99%, or 100% identical) to the nucleotide sequence of SEQ ID NO: 2002. In some embodiments, the nucleotide sequence encoding the GBA1 protein comprises the nucleotide sequence of SEQ ID NO: 2002. In some embodiments, the isolated nucleic acid is or is comprised in a viral genome.

[0015] In some embodiments, the disclosure provides an isolated nucleic acid that encodes a β-glucocerebrosidase 1 (GBA1) protein and comprises a nucleotide sequence that is at least 93% identical (e.g., at least 93%, at least 94%, at least 95%, at least 96%, at least 97%, at least 98%, at least 99%, or 100% identical) to the nucleotide sequence of SEQ ID NO: 2002. In some embodiments, the isolated nucleic acid encoding the GBA1 protein comprises the nucleotide sequence of SEQ ID NO: 2002. In some embodiments, the isolated nucleic acid is or is comprised in a viral genome.

[0016] In some embodiments, the disclosure provides an isolated nucleic acid comprising a transgene encoding a GBA1 protein, wherein the nucleotide sequence encoding the GBA1 protein comprises a codon-optimized nucleotide sequence that is at least 94% identical (e.g., at least 94%, at least 95%, at least 96%, at least 97%, at least 98%, at least 99%, or 100% identical) to the nucleotide sequence of SEQ ID NO: 2001. In some embodiments, the nucleotide sequence encoding the GBA1 protein comprises the nucleotide sequence of SEQ ID NO: 2001. In some embodiments, the nucleotide sequence encoding the GBA1 protein consists of the nucleotide sequence of SEQ ID NO: 2001. In some embodiments, the isolated nucleic acid is or is comprised in a viral genome.

[0017] In some embodiments, the disclosure provides an isolated nucleic acid that encodes a β-glucocerebrosidase 1 (GBA1) protein and comprises a nucleotide sequence that is at least 94% identical (e.g., at least 94%, at least 95%, at least 96%, at least 97%, at least 98%, at least 99%, or 100% identical) to the nucleotide sequence of SEQ ID NO: 2001. In some embodiments, the isolated nucleic acid encoding the GBA1 protein comprises the nucleotide sequence of SEQ ID NO: 2001. In some embodiments, the isolated nucleic acid encoding the GBA1 protein consists of the nucleotide sequence of SEQ ID NO: 2001. In some embodiments, the isolated nucleic acid is or is comprised in a viral genome.

[0018] In some embodiments, the disclosure provides an isolated nucleic acid comprising a transgene encoding a GBA1 protein and an enhancing element, wherein the encoded enhancing element optionally comprises a saposin C polypeptide or functional fragment or variant thereof comprising the amino acid sequence of SEQ ID NO: 1789 or 1758 or an amino acid sequence at least 85% identical thereto (e.g., at least 85%, at least 90%, at least 91%, at least 92%, at least 93%, at least 94%, at least 95%, at least 96%, at least 97%, at least 98%, at least 99%, or 100% identical). a cell penetrating peptide comprising the amino acid sequence of any of SEQ ID NOs: 1794, 1796 or 1798, or an amino acid sequence having one, two, three or more, but not more than four modifications, e.g., substitutions (e.g., conservative substitutions) compared to SEQ ID NOs: 1794, 1796 or 1798, and / or a lysosomal targeting sequence optionally comprising the amino acid sequence of any of SEQ ID NOs: 1800, 1802, 1804, 1806 or 1808, or an amino acid sequence having one, two, three or more, but not more than four modifications, e.g., substitutions (e.g., conservative substitutions) compared to SEQ ID NOs: 1800, 1802, 1804, 1806 or 1808. In some embodiments, the isolated nucleic acid is or is comprised in a viral genome.

[0019] In some embodiments, the present disclosure provides a recombinant viral genome comprising a nucleic acid comprising a transgene encoding a GBA1 protein, and further comprising a nucleotide sequence encoding an miR binding site that regulates, e.g., reduces, expression of the encoded GBA1 protein in cells or tissues of the DRG, liver, hematopoietic lineage, or a combination thereof. In some embodiments, the encoded miR binding site comprises a miR183 binding site. In some embodiments, the viral genome encodes multiple miR binding sites, e.g., four miR183 binding sites. In some embodiments, the viral genome further encodes an enhancing element, e.g., an enhancing element described herein.

[0020] In some embodiments, the present disclosure provides a recombinant viral genome comprising a promoter operably linked to a nucleic acid comprising a transgene encoding a GBA1 protein described herein. In some embodiments, the viral genome comprises an internal terminal repeat (ITR) sequence (e.g., an ITR region described herein), an enhancer (e.g., an enhancer described herein), an intron region (e.g., an intron region described herein), a Kozak sequence (e.g., a Kozak sequence described herein), an exon region (e.g., an exon region described herein), a nucleotide sequence encoding an miR binding site (e.g., an miR binding site described herein), and / or a polyA signal region (e.g., a polyA signal sequence described herein). In some embodiments, the viral genome comprises the nucleotide sequence of SEQ ID NO: 2006 or 2007, or a nucleotide sequence at least 97% identical thereto (e.g., at least 97%, at least 98, or 99% identical thereto). In some embodiments, the viral genome comprises the nucleotide sequence of SEQ ID NO: 2006, or a nucleotide sequence at least 97% identical thereto (e.g., at least 97%, at least 98, or 99% identical thereto). In some embodiments, the viral genome comprises the nucleotide sequence of SEQ ID NO: 2007, or a nucleotide sequence at least 97% identical thereto (e.g., at least 97%, at least 98, or 99% identical thereto).

[0021] In some embodiments, the present disclosure provides recombinant AAV particles comprising a capsid protein and a viral genome comprising a promoter (e.g., a promoter described herein) operably linked to a transgene encoding a GBA1 protein described herein. In some embodiments, the capsid protein comprises an AAV capsid protein. In some embodiments, the capsid protein comprises a VOY101 capsid protein, an AAV5 capsid protein, an AAV9 capsid protein, or a functional variant thereof. In some embodiments, the recombinant AAV particle is an isolated AAV particle.

[0022] In some embodiments, the present disclosure provides methods of generating a viral genome described herein, hi some embodiments, the method of generating a viral genome includes providing nucleic acid encoding a viral genome described herein and a backbone region suitable for replication of the viral genome in a cell, e.g., a bacterial cell (e.g., the backbone region includes one or both of a bacterial origin of replication and a selectable marker), and excising the virus from the backbone region, e.g., by cleaving nucleic acid molecules upstream and downstream of the viral genome.

[0023] In some embodiments, the present disclosure provides a method for producing a recombinant AAV particle. In some embodiments, the method for producing a recombinant AAV particle includes providing a host cell containing a viral genome described herein and incubating the host cell under conditions suitable for packaging the viral genome into an AAV particle, such as a VOY101 capsid protein, thereby producing an isolated AAV particle.

[0024] In some embodiments, the present disclosure provides a method for delivering a nucleic acid encoding a GBA1 protein to a subject, the method comprising administering an effective amount of an AAV particle or a plurality of AAV particles described herein, the AAV particles comprising a viral genome described herein, e.g., a viral genome comprising a nucleic acid comprising a transgene encoding a GBA1 protein described herein.

[0025] In some embodiments, the present disclosure provides methods of treating a subject having or diagnosed with a disease, neurological disorder, or neuromuscular disorder associated with GBA1 expression. In some embodiments, the method comprises administering an effective amount of an AAV particle or a plurality of AAV particles described herein, the AAV particles comprising a viral genome described herein, e.g., a viral genome comprising a nucleic acid comprising a transgene encoding a GBA1 protein described herein. In some embodiments, the disease or neurodegenerative or neuromuscular disorder associated with GBA1 expression comprises Parkinson's disease (PD) (e.g., PD associated with one or more mutations in the GBA1 gene), dementia with Lewy bodies (DLB), Gaucher disease (GD) (e.g., GD type 1 (GD1) or GD type 3 (GD3)), spinal muscular atrophy (SMA), multiple system atrophy (MSA), or multiple sclerosis (MS).

[0026] In some embodiments, the present disclosure provides an AAV viral genome comprising at least one inverted terminal repeat (ITR) and a payload region, wherein the payload region encodes one or more GBA1 proteins. In some embodiments, the AAV viral genome comprises a 5' ITR, a promoter, a payload region comprising a nucleotide sequence encoding a GBA1 protein, and a 3' ITR. The encoded protein can be human (Homo sapiens) GBA1, cynomolgus monkey (Macaca fascicularis) GBA1, rhesus monkey (Macaca mulatta) GBA1, synthetic (non-naturally occurring) GBA1, or a derivative thereof, such as a mutant that retains one or more functions of the wild-type GBA1 protein. In some embodiments, the GBA1 can be at least partially humanized. In some embodiments, the encoded protein is a wild-type human GBA1 protein.

[0027] The GCase of the present disclosure can be co-expressed with a saposin protein. In some embodiments, the transgene encoding the GCase comprises a nucleotide sequence encoding a saposin protein. In some embodiments, the saposin protein is saposin A (SapA). In some embodiments, the saposin protein is saposin C (SapC).

[0028] The viral genome can be incorporated into an AAV particle, which comprises the viral genome and a capsid. In some embodiments, the capsid comprises a sequence as shown in Table 1. In some embodiments, the AAV particles described herein may be used in a pharmaceutical composition. This pharmaceutical composition may be used to treat a disorder or condition associated with decreased GBA1 expression, activity, or protein levels. In some embodiments, the disorder or condition is a lysosomal lipid storage disorder. In some embodiments, the disorder or condition associated with decreased GBA1 protein levels is PD (e.g., PD associated with one or more mutations in the GBA1 gene), Gaucher disease (e.g., type 1 GD (e.g., non-neuronopathic GD (GD1)), type 2 GD (e.g., acute neuronopathic GD (GD2)), or type 3 GD (GD3)), or other GBA1-related disorder (e.g., dementia with Lewy bodies (DLB)). In some embodiments, the disorder or condition associated with decreased GBA1 protein levels is PD. In some embodiments, the disorder or condition associated with decreased GBA1 protein levels is GD. In some embodiments, the GD is GD1 or GD3. In some embodiments, the disorder or condition associated with decreased GBA1 protein levels is DLB.

[0029] In some embodiments, administration of the AAV particles results in enhanced GBA1 expression in target cells. In some aspects, the present disclosure provides methods for increasing GCase enzyme activity in patients using AAV-mediated gene transfer of an optimized GBA1 transgene cassette. AAV-mediated gene transfer can be delivered to the CNS, thereby reducing substrate glycosphingolipid glucosylceramide / GluCer levels and α-synuclein pathology, thereby delaying or reversing disease onset in patients with GBA1-related disorders, including GBA1 patients with Parkinson's disease (GBA1-PD), Gaucher disease (e.g., GD type 2 or 3), and dementia with Lewy bodies. In some embodiments, the methods involve intrastriatal (ISTR) or intracisternal (ICM) administration of an AAV vector packaging an optimized GBA1 gene replacement transgene cassette as described herein to achieve widespread cell-autonomous transduction and cross-correction of the therapeutic GBA1 enzyme.

[0030] Those skilled in the art will recognize, or be able to ascertain using no more than routine experimentation, many equivalents to the specific embodiments of the invention described herein which equivalents are intended to be encompassed by the following recited embodiments.

[0031] Enumerated Embodiments 1. An isolated nucleic acid that encodes a β-glucocerebrosidase 1 (GBA1) protein and that is at least 93% (e.g., 93, 94, 95, 96, 97, 98, 99, or 100% identical) to the nucleotide sequence of SEQ ID NO:2002.

[0032] 2. The isolated nucleic acid of embodiment 1, wherein the nucleotide sequence encoding the GBA1 protein comprises a nucleotide sequence that is at least 93% identical to SEQ ID NO: 2002. 3. The isolated nucleic acid of embodiment 1 or 2, wherein the nucleotide sequence encoding the GBA1 protein comprises a nucleotide sequence that is at least 95% identical to SEQ ID NO: 2002.

[0033] 4. The isolated nucleic acid of any one of embodiments 1 to 3, wherein the nucleotide sequence encoding the GBA1 protein comprises the nucleotide sequence of SEQ ID NO: 2002. 5. The isolated nucleic acid of any one of embodiments 1 to 4, further comprising an enhancing element.

[0034] 6. An isolated nucleic acid, e.g., a recombinant nucleic acid, comprising a transgene encoding a β-glucocerebrosidase 1 (GBA1) protein and an enhancer element, wherein the encoded enhancer element is (a) optionally, a saposin C polypeptide comprising the amino acid sequence of SEQ ID NO: 1789 or 1758, or an amino acid sequence at least 85% (e.g., at least 90%, 92%, 95%, 97%, 98%, or 99%) identical thereto, or a functional fragment or variant thereof; (b) optionally a cell-penetrating peptide comprising the amino acid sequence of any of SEQ ID NOs: 1794, 1796, or 1798, or an amino acid sequence having one, two, or three or more, but not more than four, modifications, e.g., substitutions (e.g., conservative substitutions), relative to SEQ ID NOs: 1794, 1796, or 1798; and / or (c) optionally, a lysosomal targeting sequence comprising the amino acid sequence of any of SEQ ID NOs: 1800, 1802, 1804, 1806, or 1808, or an amino acid sequence having one, two, or more, but not more than four modifications, e.g., substitutions (e.g., conservative substitutions), relative to SEQ ID NOs: 1800, 1802, 1804, 1806, or 1808; A nucleic acid comprising:

[0035] 7. A recombinant viral genome comprising a nucleic acid encoding a β-glucocerebrosidase 1 (GBA1) protein, further comprising a nucleotide sequence encoding an miR binding site that regulates, e.g., reduces, expression of the encoded GBA1 protein in cells or tissues of the DRG, liver, hematopoietic lineage, or a combination thereof, and optionally comprising the nucleic acid described in any one of embodiments 1 to 6.

[0036] 8. The viral genome of embodiment 7, wherein the nucleic acid further encodes an enhancing element. 9. The isolated nucleic acid of embodiment 5 or 6, or the viral genome of embodiment 8, wherein the encoded enhancing element comprises a saposin C polypeptide, or a functional fragment or variant thereof.

[0037] 10. (i) the encoded saposin C polypeptide, or functional fragment or variant thereof, comprises, at least the amino acid sequence of SEQ ID NO: 1789 or 1758, or an amino acid sequence at least 85% (e.g., at least 90%, 92%, 95%, 97%, 98%, or 99%) identical thereto; and / or (ii) The isolated nucleic acid of any one of embodiments 5 to 6 or 9, or the viral genome of embodiment 8 or 9, wherein the nucleotide sequence encoding the encoded saposin C polypeptide or functional fragment or variant thereof comprises the nucleotide sequence of SEQ ID NO: 1787 or 1791, or a nucleotide sequence that is at least 85% (e.g., at least 90%, 92%, 95%, 97%, 98% or 99%) identical thereto.

[0038] 11. (i) the encoded enhancing element comprises the amino acid sequence of any of SEQ ID NOs: 1750, 1752, 1754, 1756-1758, 1784, or 1785, an amino acid sequence having one, two, or more but not more than four modifications, e.g., substitutions (e.g., conservative substitutions), compared to SEQ ID NOs: 1750, 1752, 1754, 1756-1758, 1784, or 1785, or an amino acid sequence at least 85% (e.g., at least 90%, 92%, 95%, 97%, 98%, or 99%) identical thereto; and / or (ii) the isolated nucleic acid of embodiment 5 or the viral genome of embodiment 8, wherein the nucleotide sequence encoding the enhancing element comprises the nucleotide sequence of any one of SEQ ID NOs: 1751, 1753, 1755, 1858, or 1859, or a nucleotide sequence at least 85% (e.g., at least 90%, 92%, 95%, 97%, 98%, or 99%) identical thereto.

[0039] 12. The isolated nucleic acid of any one of embodiments 5-6 or 9-11, or the viral genome of any one of embodiments 8-11, wherein the encoded enhancing element comprises a cell-penetrating peptide.

[0040] 13. (i) the cell-penetrating peptide comprises the amino acid sequence of any of SEQ ID NOs: 1794, 1796, or 1798, or an amino acid sequence having one, two, or more, but not more than four modifications, e.g., substitutions (e.g., conservative substitutions), relative to SEQ ID NOs: 1794, 1796, or 1798; (ii) the isolated nucleic acid of embodiment 6 or 12, or the viral genome of embodiment 12, wherein the nucleotide sequence encoding the cell-penetrating peptide comprises the nucleotide sequence of any one of SEQ ID NOs: 1793, 1795, or 1797, or a nucleotide sequence that is at least 80% (e.g., 85%, 90%, 92%, 95%, 96%, 97%, 98% or 99%) identical thereto.

[0041] 14. The isolated nucleic acid of any one of embodiments 5-6 or 9-13, or the viral genome of any one of embodiments 8-13, wherein the encoded enhancing element comprises a lysosomal targeting sequence.

[0042] 15. (i) the encoded lysosomal targeting sequence comprises the amino acid sequence of any of SEQ ID NOs: 1800, 1802, 1804, 1806, or 1808, or an amino acid sequence having one, two, or more, but not more than four modifications, e.g., substitutions (e.g., conservative substitutions), relative to SEQ ID NOs: 1800, 1802, 1804, 1806, or 1808; (ii) the isolated nucleic acid of embodiment 6 or 14 or the viral genome of any one of embodiment 14, wherein the nucleotide sequence encoding the lysosomal targeting sequence comprises the nucleotide sequence of any one of SEQ ID NOs: 1799, 1801, 1803, 1805, or 1807, or a nucleotide sequence having one, two, or more, but not more than four modifications, e.g., substitutions (e.g., conservative substitutions), compared to SEQ ID NOs: 1799, 1801, 1803, 1805, or 1807.

[0043] 16. The isolated nucleic acid of any one of embodiments 5-6 or 9-15, or the viral genome of any one of embodiments 8-15, wherein the nucleic acid encodes at least two, three, four or more enhancing elements.

[0044] 17. The nucleic acid encodes two enhancer elements; (i) the first enhancing element comprises a lysosomal targeting sequence, and optionally the lysosomal targeting sequence comprises the amino acid sequence of SEQ ID NO: 1802 or an amino acid sequence having one, two, or three or more, but not more than four modifications, e.g., substitutions (e.g., conservative substitutions), relative to SEQ ID NO: 1802; and (ii) The isolated nucleic acid of any one of embodiments 5-6 or 9-16 or the viral genome of any one of embodiments 8-16, wherein the second enhancing element comprises a saposin C polypeptide or a functional fragment or variant thereof, and optionally the saposin C polypeptide or functional fragment or variant thereof comprises the amino acid sequence of SEQ ID NO: 1789 or an amino acid sequence having one, two, or three or more, but not more than four modifications, e.g., substitutions (e.g., conservative substitutions), relative to SEQ ID NO: 1789.

[0045] 18. The isolated nucleic acid or viral genome of embodiment 17, wherein the nucleic acid encoding the first enhancing element and the second enhancing element comprises the nucleotide sequence of 1801 and 1787, a nucleotide sequence that is at least 85% (e.g., at least 90%, 92%, 95%, 97%, 98%, or 99%) identical to SEQ ID NOs: 1801 and 1787, or a nucleotide sequence that has one, two, or three or more, but not more than four, modifications, e.g., substitutions (e.g., conservative substitutions), compared to SEQ ID NOs: 1801 and 1787.

[0046] 19. The nucleic acid encodes a first enhancing element and a second enhancing element; (i) a first enhancing element, a cell-penetrating peptide, optionally wherein the cell-penetrating peptide comprises the amino acid sequence of SEQ ID NO: 1798 or an amino acid sequence having one, two, or more, but not more than four modifications, e.g., substitutions (e.g., conservative substitutions), relative to SEQ ID NO: 1798; and (ii) The isolated nucleic acid of any one of embodiments 5-6 or 9-17 or the viral genome of any one of embodiments 8-18, wherein the second enhancing element comprises a lysosomal targeting sequence, and optionally the lysosomal targeting sequence comprises the amino acid sequence of SEQ ID NO: 1802 or an amino acid sequence having one, two, or three or more, but not more than four modifications, e.g., substitutions (e.g., conservative substitutions), compared to SEQ ID NO: 1802.

[0047] 20. The isolated nucleic acid or viral genome of embodiment 19, wherein the nucleic acid encoding the first enhancing element and the second enhancing element comprises the nucleotide sequence of 1797 and 1801, a nucleotide sequence that is at least 85% (e.g., at least 90%, 92%, 95%, 97%, 98%, or 99%) identical to SEQ ID NOs: 1797 and 1801, or a nucleotide sequence that has one, two, or three or more, but not more than four, modifications, e.g., substitutions (e.g., conservative substitutions), compared to SEQ ID NOs: 1797 and 1801.

[0048] 21. The nucleic acid encodes a first enhancing element, a second enhancing element, and a third enhancing element; (i) the first enhancing element comprises a lysosomal targeting sequence, and optionally the lysosomal targeting sequence comprises the amino acid sequence of SEQ ID NO: 1802 or an amino acid sequence having one, two, or more, but not more than four modifications, e.g., substitutions (e.g., conservative substitutions), relative to SEQ ID NO: 1802; (ii) the second enhancing element comprises a cell-penetrating peptide, and optionally the cell-penetrating peptide comprises the amino acid sequence of SEQ ID NO: 1798 or an amino acid sequence having one, two, or more, but not more than four modifications, e.g., substitutions (e.g., conservative substitutions), relative to SEQ ID NO: 1798; and (iii) The isolated nucleic acid of any one of embodiments 5-6 or 9-20 or the viral genome of any one of embodiments 8-20, wherein the third enhancing element comprises a saposin C polypeptide or a functional fragment or variant thereof, and optionally the saposin C polypeptide or functional fragment or variant thereof comprises the amino acid sequence of SEQ ID NO: 1789 or an amino acid sequence having one, two, or three or more, but not more than four modifications, e.g., substitutions (e.g., conservative substitutions), relative to SEQ ID NO: 1789.

[0049] 22. The isolated nucleic acid or viral genome of embodiment 21, wherein the nucleic acid encoding the first enhancing element, the second enhancing element, and the third enhancing element comprises the nucleotide sequence of 1801, 1797, and 1787, a nucleotide sequence that is at least 85% (e.g., at least 90%, 92%, 95%, 97%, 98%, or 99%) identical to SEQ ID NOs: 1801, 1797, and 1787, or a nucleotide sequence that has one, two, or more, but not more than four modifications, e.g., substitutions (e.g., conservative substitutions), compared to SEQ ID NOs: 1801, 1797, and 1787.

[0050] 23. The isolated nucleic acid of any one of embodiments 1 to 6 or 9 to 22, or the viral genome of any one of embodiments 7 to 22, wherein the nucleic acid further encodes a linker. 24. The isolated nucleic acid of any one of embodiments 5 to 6 or 9 to 22, or the viral genome of any one of embodiments 8 to 22, wherein the encoded enhancing element and the encoded GBA1 protein are directly linked, for example, without a linker.

[0051] 25. The isolated nucleic acid of any one of embodiments 5 to 6 or 9 to 23, or the viral genome of any one of embodiments 8 to 23, wherein the encoded enhancing element and the encoded GBA1 protein are linked via an encoded linker.

[0052] 26. (i) the encoded linker comprises the amino acid sequence of any of SEQ ID NOs: 1854, 1855, 1843, or 1845, or an amino acid sequence having one, two, or more, but not more than four modifications, e.g., substitutions (e.g., conservative substitutions), relative to SEQ ID NOs: 1854, 1855, 1843, or 1845; (ii) the nucleotide sequence encoding the linker comprises the nucleotide sequence of any one of SEQ ID NOs: 1724, 1726, 1729, or 1730, or a nucleotide sequence having one, two, or more, but not more than four modifications, e.g., substitutions (e.g., conservative substitutions), relative to SEQ ID NOs: 1724, 1726, 1729, or 1730; (iii) the encoded linker comprises a furin cleavage site; (iv) the encoded linker comprises a T2A polypeptide; (v) the encoded linker comprises a (Gly4Ser)n linker (SEQ ID NO: 1871), where n is 1 to 10, e.g., n is 3, 4, or 5; and / or (vi) The isolated nucleic acid or viral genome of any one of embodiments 23 to 25, wherein the encoded linker comprises a (Gly4Ser)3 linker (SEQ ID NO: 1845).

[0053] 27. (i) the encoded linker comprises the amino acid sequence of SEQ ID NO: 1854 and / or the amino acid sequence of SEQ ID NO: 1855 or an amino acid sequence having one, two, or three or more, but not more than four, modifications, e.g., substitutions, relative to SEQ ID NOs: 1854 and / or 1855; and / or (ii) The isolated nucleic acid or viral genome of any one of embodiments 23 or 25-26, wherein the nucleotide sequence encoding the linker comprises the nucleotide sequence of SEQ ID NO: 1724 and / or the nucleotide sequence of SEQ ID NO: 1726, or a nucleotide sequence having one, two, or three or more, but not more than four modifications, e.g., substitutions, compared to SEQ ID NO: 1724 and / or 1726.

[0054] 28. (i) the encoded linker comprises the amino acid sequence of SEQ ID NO: 1845 or an amino acid sequence having one, two, or three or more, but not more than four, modifications, e.g., substitutions, relative to SEQ ID NO: 1845; (ii) The isolated nucleic acid of any one of embodiments 23 or 25 to 27, or the viral genome of any one of embodiments 23 or 25 to 26, wherein the nucleotide sequence encoding the linker comprises the nucleotide sequence of SEQ ID NO: 1730 or a nucleotide sequence having one, two, or three or more, but not more than four modifications, e.g., substitutions, compared to SEQ ID NO: 1730.

[0055] 29. The isolated nucleic acid of any one of embodiments 5 to 6 or 9 to 28, or the viral genome of any one of embodiments 8 to 28, wherein the encoded GBA1 protein and the encoded enhancing element are expressed as a single polypeptide.

[0056] 30. The isolated nucleic acid of any one of embodiments 5-6 or 9-28, or the viral genome of any one of embodiments 8-28, wherein the single polypeptide comprises a cleavage site located between the encoded GBA1 protein and the encoded enhancing element, and optionally the cleavage site is a T2A and / or furin cleavage site.

[0057] 31. (i) the nucleotide sequence encoding the enhancing element is located 5' to the nucleotide sequence encoding the GBA1 protein; and / or (ii) The isolated nucleic acid of any one of embodiments 5 to 6 or 9 to 30, or the viral genome of any one of embodiments 8 to 30, wherein the nucleotide sequence encoding the enhancing element is located 3' to the nucleotide sequence encoding the GBA1 protein.

[0058] 32. The isolated nucleic acid of any one of embodiments 1 to 6 or 9 to 31, or the viral genome of any one of embodiments 7 to 31, wherein the encoded GBA1 protein comprises the amino acid sequence of SEQ ID NO: 1775 or an amino acid sequence that is at least 70% (e.g., at least 75%, 80%, 85%, 90%, 92%, 95%, 97%, 98% or 99%) identical thereto.

[0059] 33. The isolated nucleic acid of any one of embodiments 6 or 9 to 32, or the viral genome of any one of embodiments 7 to 32, wherein the nucleotide sequence encoding the GBA1 protein comprises the nucleotide sequence of SEQ ID NO: 2002 or a nucleotide sequence that is at least 93% (e.g., at least 94%, 95%, 96%, 97%, 98% or 99%) identical thereto.

[0060] 34. The isolated nucleic acid of any one of embodiments 1 to 6 or 9 to 33, or the viral genome of any one of embodiments 7 to 33, wherein the nucleotide sequence encoding the GBA1 protein comprises the nucleotide sequence of SEQ ID NO: 2002.

[0061] 35. The isolated nucleic acid of any one of embodiments 1 to 6 or 9 to 34, or the viral genome of any one of embodiments 7 to 37, further encoding a signal sequence comprising any one of SEQ ID NOs: 1850 to 1853, 1856, 1857, or 2005.

[0062] 36. The isolated nucleic acid or viral genome of embodiment 35, wherein the encoded signal sequence comprises the amino acid sequence of SEQ ID NO: 2005. 37. The nucleotide sequence encoding the signal sequence is (i) 5' to the nucleotide sequence encoding the GBA1 protein, and / or (ii) 5′ to the encoded enhancer element 37. The isolated nucleic acid or viral genome of embodiment 35 or 36, wherein the isolated nucleic acid or viral genome is located in

[0063] 38. The isolated nucleic acid or viral genome of embodiment 35 or 36, wherein the nucleotide sequence encoding the GBA1 protein comprises the nucleotide sequence of SEQ ID NO: 2001 or a nucleotide sequence that is at least 97% (e.g., 97%, 98%, 99% or 100% identical) thereto.

[0064] 39. The isolated nucleic acid or viral genome of embodiment 38, wherein the nucleotide sequence encoding the GBA1 protein comprises the nucleotide sequence of SEQ ID NO: 2001. 40. The isolated nucleic acid or viral genome according to embodiment 38 or 39, wherein the nucleotide sequence encoding the GBA1 protein consists of the nucleotide sequence of SEQ ID NO: 2001.

[0065] 39. An isolated nucleic acid or viral genome comprising a nucleotide sequence encoding a β-glucocerebrosidase 1 (GBA1) protein, wherein the GBA1-encoding nucleotide sequence comprises a nucleotide sequence encoding a signal sequence comprising the nucleotide sequence of SEQ ID NO: 2005 or a nucleotide sequence that is at least 85% (e.g., 85%, 88%, 90%, 92%, 95%, 96%, 97%, 98%, 99% or 100% identical) thereto, and a nucleotide sequence encoding the GBA1 protein comprising the nucleotide sequence of SEQ ID NO: 2002 or a nucleotide sequence that is at least 93% (e.g., 93%, 94%, 95%, 96%, 97%, 98%, 99% or 100% identical) thereto.

[0066] 40. The isolated nucleic acid or viral genome of embodiment 39, wherein the nucleotide sequence encoding the signal sequence comprises the nucleotide sequence of SEQ ID NO: 2005 or a nucleotide sequence that is at least 99% identical thereto.

[0067] 41. An isolated nucleic acid or viral genome comprising the nucleotide sequence of SEQ ID NO: 2001 or a nucleotide sequence at least 94% (e.g., 94%, 95%, 96%, 97%, 98%, 99% or 100% identical) thereto, wherein the nucleotide sequence encodes a β-glucocerebrosidase 1 (GBA1) protein.

[0068] 42. The isolated nucleic acid or viral genome according to embodiment 41, wherein the nucleotide sequence encoding the GBA1 protein comprises or consists of the nucleotide sequence of SEQ ID NO: 2001.

[0069] 43. An isolated viral genome, e.g., a recombinant viral genome, comprising a promoter operably linked to a nucleic acid of any one of embodiments 1-6 or 9-42. 44. The viral genome of any one of embodiments 7 to 43, further comprising a promoter operably linked to the nucleic acid encoding the GBA1 protein.

[0070] 45. The viral genome of any one of embodiments 7 to 44, further comprising an enhancer. 46. ​​The viral genome of embodiment 45, wherein the enhancer comprises a CMVie enhancer.

[0071] 47. The viral genome of embodiment 45 or 46, wherein the enhancer comprises the nucleotide sequence of SEQ ID NO: 1831 or a nucleotide sequence that is at least 95% identical thereto.

[0072] 48. The viral genome of any one of embodiments 43 to 47, wherein the promoter comprises a tissue-specific promoter. 49. The viral genome of any one of embodiments 43 to 47, wherein the promoter comprises a ubiquitous promoter.

[0073] 50. The Promoter shall: (i) EF-1a promoter, chicken β-actin (CBA) promoter and / or its derivative CAG, CMV immediate early enhancer and / or promoter, β-glucuronidase (GUSB) promoter, ubiquitin C (UBC) promoter, neuron-specific enolase (NSE), platelet-derived growth factor (PDGF) promoter, platelet-derived growth factor B chain (PDGF-β) promoter, intercellular adhesion molecule 2 (ICAM-2) promoter, synapsin (Syn) promoter, methyl-CpG-binding protein 2 (MeCP2) promoter, Ca2+ / calmodulin-dependent protein kinase II (CaMKII) promoter, metabotropic glutamate receptor 2 (mGluR2) promoter, neurofilament light chain (NFL) or heavy chain (NFH) promoter, β-globin minigene nβ2 promoter, preproenkephalin (PPE) promoter, enkephalin (Enk) and excitatory amino acid transporter 2 (EAAT2), glial fibrillary acidic protein (GFAP) promoter, myelin basic protein (MBP) promoter, cardiovascular promoters (e.g., αMHC, cTnT and CMV-MLC2k), liver promoters (e.g., hAAT, TBG), skeletal muscle promoters (e.g., desmin, MCK, C512) or fragments thereof, e.g., truncations or functional variants, and / or (ii) the nucleotide sequence of any one of SEQ ID NOs: 1832, 1833, 1834, 1835, 1836, 1839, and 1840, or a nucleotide sequence at least 95% identical thereto. 50. The viral genome of any one of embodiments 43 to 49, comprising:

[0074] 51. The viral genome of any one of embodiments 43 to 47, wherein the promoter comprises a CB promoter or a functional variant thereof. 52. The viral genome of embodiment 51, wherein the CB promoter or a functional variant thereof comprises the nucleotide sequence of SEQ ID NO: 1834 or a nucleotide sequence at least 95% identical thereto.

[0075] 53. The viral genome of embodiment 51 or 52, wherein the promoter comprises a CMVie enhancer and a CB promoter. 54. The viral genome of embodiment 53, wherein the CMVie enhancer comprises the nucleotide sequence of SEQ ID NO: 1831 or a nucleotide sequence that is at least 95% identical thereto, and the CB promoter comprises the nucleotide sequence of SEQ ID NO: 1834 or a nucleotide sequence that is at least 95% identical thereto.

[0076] 55. The viral genome of embodiment 50, wherein the promoter comprises the EF-1α promoter or a functional variant thereof. 56. The viral genome according to embodiment 55, wherein the EF-1α promoter or a functional variant thereof comprises the nucleotide sequence of SEQ ID NO: 1839 or 1840 or a nucleotide sequence at least 95% identical thereto.

[0077] 57. A viral genome according to embodiment 55 or 56, wherein the EF-1α promoter or a functional variant thereof comprises an intron, for example an intron comprising the nucleotide sequence of positions 242 to 1180 of SEQ ID NO: 1839 or an intron comprising the nucleotide sequence of SEQ ID NO: 1841 or an intron comprising a nucleotide sequence at least 95% identical thereto.

[0078] 58. A viral genome according to any one of embodiments 55 to 57, wherein the EF-1α promoter or a functional variant thereof does not contain an intron, for example an intron comprising the nucleotide sequence of positions 242 to 1180 of SEQ ID NO: 1839 or an intron comprising the nucleotide sequence of SEQ ID NO: 1841 or an intron comprising a nucleotide sequence at least 95% identical thereto.

[0079] 59. The viral genome of embodiment 50, wherein the promoter comprises a CBA promoter or a functional variant thereof. 60. The viral genome of embodiment 59, wherein the CBA promoter, a functional variant thereof, comprises the nucleotide sequence of SEQ ID NO: 1836 or a nucleotide sequence at least 95% identical thereto.

[0080] 61. A viral genome according to any one of embodiments 43 to 47, wherein the promoter comprises a CMVie enhancer, a CBA promoter or a functional variant thereof, and an intron.

[0081] 62. (i) the CMVie enhancer comprises the nucleotide sequence of SEQ ID NO: 1831 or a nucleotide sequence at least 95% identical thereto; (ii) the CBA promoter or a functional variant thereof comprises the nucleotide sequence of SEQ ID NO: 1836 or a nucleotide sequence at least 95% identical thereto; and (iii) The viral genome of embodiment 61, wherein the intron comprises the nucleotide sequence of SEQ ID NO: 1837 or a nucleotide sequence at least 95% identical thereto.

[0082] 63. The viral genome of embodiment 50, wherein the promoter comprises a CAG promoter region. 64. The Promoter shall: (i) the CMVie enhancer, the CBA promoter or a functional variant thereof and an intron, and / or (ii) the nucleotide sequence of SEQ ID NO: 1835 or a nucleotide sequence at least 95% identical thereto 64. The viral genome of any one of embodiments 43 to 47 or 63, comprising a CAG promoter region comprising:

[0083] 65. The viral genome of any one of embodiments 43 to 47, wherein the promoter comprises a CMV promoter or a functional variant thereof. 66. The viral genome of embodiment 67, wherein the CMV promoter or a functional variant thereof comprises the nucleotide sequence of SEQ ID NO: 1832 or a nucleotide sequence which is at least 95% identical thereto.

[0084] 67. A viral genome according to any one of embodiments 43 to 47, wherein the promoter comprises a CMVie enhancer and a CMV promoter or a functional variant thereof, and optionally, the CMVie enhancer comprises the nucleotide sequence of SEQ ID NO: 1831 or a nucleotide sequence that is at least 95% identical thereto, and the CMV promoter or a functional variant thereof comprises the nucleotide sequence of SEQ ID NO: 1832 or a nucleotide sequence that is at least 95% identical thereto.

[0085] 68. The viral genome of any one of embodiments 43 to 47, wherein the promoter comprises a CMV promoter region. 69. The CMV promoter region is (i) a CMV enhancer and a CMV promoter or a functional variant thereof; (ii) the nucleotide sequence of SEQ ID NO: 1833 or a nucleotide sequence at least 95% identical thereto 69. The viral genome of embodiment 68, comprising:

[0086] 70. The viral genome of any one of embodiments 7 to 69, further comprising an inverted terminal repeat (ITR) sequence. 71. The viral genome of embodiment 70, wherein the ITR sequence is located 5' to the nucleic acid encoding the GBA1 protein.

[0087] 72. The viral genome of embodiment 70 or 71, wherein the ITR sequence is located 3' to the nucleic acid encoding the GBA1 protein. 73. A viral genome according to any one of embodiments 7 to 72, comprising an ITR located 5' to the nucleic acid encoding the GBA1 protein and an ITR located 3' to the nucleic acid encoding the GBA1 protein.

[0088] 74. The viral genome of any one of embodiments 70 to 73, wherein the ITR comprises the nucleic acid sequence of SEQ ID NO: 1829, 1830 or 1862 or a nucleotide sequence that is at least 95% identical thereto.

[0089] 75. A viral genome according to any one of embodiments 70 to 74, wherein the ITR comprises the nucleotide sequence of SEQ ID NO: 1860 and / or 1861 or a nucleotide sequence having one, two or more, but not more than four modifications of SEQ ID NO: 1860 and / or 1861.

[0090] 76. A viral genome according to any one of embodiments 70 to 75, wherein the ITR is located 5' to the nucleic acid encoding the GBA1 protein and comprises the nucleotide sequence of SEQ ID NO: 1860 and / or 1861 or a nucleotide sequence having one, two or more, but not more than four modifications of SEQ ID NO: 1860 or 1861.

[0091] 77. A viral genome according to any one of embodiments 70 to 76, wherein the ITR is located 3' to the nucleic acid encoding the GBA1 protein and comprises the nucleotide sequence of SEQ ID NO: 1860 or 1861 or a nucleotide sequence having one, two or more, but not more than four modifications of SEQ ID NO: 1860 and / or 1861.

[0092] 78. (i) the ITR located 5' to the nucleic acid encoding the GBA1 protein comprises the nucleotide sequence of SEQ ID NO: 1829 or a nucleotide sequence at least 95% identical thereto; and / or (ii) A viral genome described in any one of embodiments 70 to 77, wherein the ITR located 3' to the nucleic acid encoding the GBA1 protein comprises the nucleotide sequence of SEQ ID NO: 1830 or a nucleotide sequence that is at least 95% identical thereto.

[0093] 79. The viral genome of any one of embodiments 7 to 78, further comprising a polyadenylation (polyA) signal region. 80. The viral genome of embodiment 79, wherein the polyA signal region comprises the nucleotide sequence of SEQ ID NO: 1846 or a nucleotide sequence at least 95% identical thereto.

[0094] 81. The viral genome of any one of embodiments 7 to 80, further comprising an intron region. 82. The viral genome of embodiment 81, wherein the intron comprises a β-globin intron.

[0095] 83. The viral genome of embodiment 81 or 82, wherein the intron comprises the nucleotide sequence of SEQ ID NO: 1842 or a nucleotide sequence that is at least 95% identical thereto. 84. The viral genome of any one of embodiments 7 to 83, further comprising an exon region, such as at least 1, 2, or 3 exon regions.

[0096] 85. The viral genome of any one of embodiments 7 to 84, further comprising a Kozak sequence. 86. A viral genome described in any one of embodiments 7 to 85, further comprising a nucleotide sequence encoding an miRNA (miR) binding site, e.g., an miR binding site that regulates, e.g., reduces, the expression of the GBA1 protein encoded by the viral genome in cells or tissues in which the corresponding miRNA is expressed.

[0097] 87. The viral genome of embodiment 86, wherein the encoded miR binding site is fully or partially complementary to a miRNA expressed in cells or tissues of the DRG, liver, hematopoietic lineage, or a combination thereof.

[0098] 88. A viral genome according to embodiment 87, wherein the encoded miR binding site regulates, e.g., reduces, the expression of the encoded GBA1 protein in cells or tissues of the DRG, liver, hematopoietic lineage, or a combination thereof.

[0099] 89. The viral genome according to any one of embodiments 86 to 88, comprising at least 1, 2, 3, 4 or 5 copies of a nucleotide sequence encoding a miR binding site. 90. The viral genome of any one of embodiments 86 to 89, comprising at least four copies of a nucleotide sequence encoding a miR binding site, optionally wherein all four copies encode the same miR binding site.

[0100] 91. The viral genome of embodiment 90, wherein the four copies of the nucleic acid encoding the miR binding site are contiguous. 92. The viral genome of embodiment 90, wherein the four copies of the nucleic acid encoding the miR binding site are separated by a spacer.

[0101] 93. The viral genome of embodiment 92, wherein the spacer comprises a nucleotide sequence of SEQ ID NO: 1848 or a nucleotide sequence having one, two, or more, but not more than four, modifications of SEQ ID NO: 1848.

[0102] 94. The encoded miR binding site comprises a miR183 binding site, a miR122 binding site, miR-142-3p, or a combination thereof, and optionally (i) the encoded miR183 binding site comprises the nucleotide sequence of SEQ ID NO: 1847, or a nucleotide sequence substantially identical thereto (e.g., having at least 70%, 75%, 80%, 85%, 90%, 92%, 95%, 97%, 98%, or 99% sequence identity, e.g., 100% sequence identity), or a nucleotide sequence having one, two, three, four, five, six, or more, but not more than ten, modifications of SEQ ID NO: 1847; (ii) the encoded miR122 binding site comprises the nucleotide sequence of SEQ ID NO: 1865 or a nucleotide sequence substantially identical thereto (e.g., having at least 70%, 75%, 80%, 85%, 90%, 92%, 95%, 97%, 98%, or 99% sequence identity, e.g., 100% sequence identity), or a nucleotide sequence having one, two, three, four, five, six, or more, but not more than ten, modifications of SEQ ID NO: 1865; and / or (iii) the viral genome of any one of embodiments 86 to 93, wherein the encoded miR-142-3p binding site comprises the nucleotide sequence of SEQ ID NO: 1869 or a nucleotide sequence substantially identical thereto (e.g., having at least 70%, 75%, 80%, 85%, 90%, 92%, 95%, 97%, 98% or 99% sequence identity, e.g., 100% sequence identity), or a nucleotide sequence having one, two, three, four, five, six, or more, but not more than ten, modifications of SEQ ID NO: 1869.

[0103] 95. The viral genome of any one of embodiments 86 to 94, wherein the viral genome comprises a nucleotide sequence encoding a miR183 binding site. 96. The viral genome of embodiment 95, wherein the viral genome encodes at least 1 to 5 copies, for example 4 copies, of the miR183 binding site.

[0104] 97. The viral genome of embodiment 96, wherein each copy is contiguous. 98. The viral genome of embodiment 96, wherein each copy is separated by a spacer.

[0105] 99. The viral genome of any one of embodiments 95 to 98, wherein the encoded miR183 binding site comprises the nucleotide sequence of SEQ ID NO: 1847 or a nucleotide sequence substantially identical thereto (e.g., having at least 70%, 75%, 80%, 85%, 90%, 92%, 95%, 97%, 98% or 99% sequence identity, e.g., 100% sequence identity), or a nucleotide sequence having one, two, three, four, five, six, or more, but not more than ten, modifications of SEQ ID NO: 1847.

[0106] 100. The viral genome is (i) a first encoded miR183 binding site comprising the nucleotide sequence of SEQ ID NO: 1847, or a nucleotide sequence substantially identical thereto (e.g., having at least 70%, 75%, 80%, 85%, 90%, 92%, 95%, 97%, 98%, or 99% sequence identity, e.g., 100% sequence identity), or a nucleotide sequence having one, two, three, four, five, six, or more modifications of SEQ ID NO: 1847, but not more than ten modifications; (ii) a first spacer sequence comprising the nucleotide sequence of SEQ ID NO: 1848 or a nucleotide sequence having one, two, or more, but not more than four, modifications of SEQ ID NO: 1848; (iii) a second encoded miR183 binding site comprising the nucleotide sequence of SEQ ID NO: 1847 or a nucleotide sequence substantially identical thereto (e.g., having at least 70%, 75%, 80%, 85%, 90%, 92%, 95%, 97%, 98%, or 99% sequence identity, e.g., 100% sequence identity), or a nucleotide sequence having one, two, three, four, five, six, or more modifications of SEQ ID NO: 1847, but not more than ten modifications; (iv) a second spacer sequence comprising the nucleotide sequence of SEQ ID NO: 1848 or a nucleotide sequence having one, two, or more, but not more than four, modifications of SEQ ID NO: 1848; (v) a third encoded miR183 binding site comprising the nucleotide sequence of SEQ ID NO: 1847 or a nucleotide sequence substantially identical thereto (e.g., having at least 70%, 75%, 80%, 85%, 90%, 92%, 95%, 97%, 98%, or 99% sequence identity, e.g., 100% sequence identity), or a nucleotide sequence having one, two, three, four, five, six, or more modifications of SEQ ID NO: 1847, but not more than ten modifications; (vi) a third spacer sequence comprising the nucleotide sequence of SEQ ID NO: 1848 or a nucleotide sequence having one, two, or more, but not more than four, modifications of SEQ ID NO: 1848; and (vii) a fourth encoded miR183 binding site comprising the nucleotide sequence of SEQ ID NO: 1847 or a nucleotide sequence substantially identical thereto (e.g., having at least 70%, 75%, 80%, 85%, 90%, 92%, 95%, 97%, 98%, or 99% sequence identity, e.g., 100% sequence identity), or a nucleotide sequence having one, two, three, four, five, six, or more, but not more than ten, modifications of SEQ ID NO: 1847. 99. The viral genome of embodiment 98, comprising:

[0107] 101. A viral genome according to any one of embodiments 7 to 100, comprising a miR183 binding site series comprising four copies of the miR183 binding site, wherein each copy of the miR binding site in the series is separated by a spacer.

[0108] 102. The viral genome of embodiment 101, wherein the encoded miR183 binding site sequence comprises the nucleotide sequence of SEQ ID NO: 1849 or a nucleotide sequence at least 95% identical thereto.

[0109] 103. The viral genome of embodiment 102, wherein the encoded miR183 binding site sequence comprises or consists of the nucleotide sequence of SEQ ID NO: 1849. 104. The viral genome of any one of embodiments 7 to 103, which is self-complementary.

[0110] 105. The viral genome of any one of embodiments 7 to 103, which is single-stranded. In order from 106.5' to 3', (i) a 5' adeno-associated (AAV) ITR (optionally, the 5' AAV ITR comprises the nucleotide sequence of SEQ ID NO: 1829, or a nucleotide sequence at least 95% identical thereto); (ii) a CMVie enhancer (optionally, the CMVie enhancer comprises the nucleotide sequence of SEQ ID NO: 1831, or a nucleotide sequence at least 95% identical thereto); (iii) a CB promoter or a functional variant thereof (optionally, the CB promoter or functional variant thereof comprises the nucleotide sequence of SEQ ID NO: 1834 or a nucleotide sequence at least 95% identical thereto); (iv) an intron (optionally, the intron comprises the nucleotide sequence of SEQ ID NO: 1842, or a nucleotide sequence at least 95% identical thereto); (v) a nucleotide sequence encoding a signal sequence (optionally, the nucleotide sequence encoding the signal sequence comprises the nucleotide sequence of SEQ ID NO: 2005 or a nucleotide sequence at least 95% identical thereto); (vi) a nucleotide sequence encoding a GBA1 protein (the nucleotide sequence encoding the GBA1 protein comprises the nucleotide sequence of SEQ ID NO: 2002 or a nucleotide sequence that is at least 93% identical to the nucleotide sequence of SEQ ID NO: 2002); (vii) a polyA signal region (optionally, the polyA signal region comprises the nucleotide sequence of SEQ ID NO: 1846, or a nucleotide sequence at least 95% identical thereto); and (viii) 3' AAV ITRs (optionally, the 3' AAV ITRs comprise the nucleotide sequence of SEQ ID NO: 1830, or a nucleotide sequence at least 95% identical thereto). A recombinant viral genome comprising:

[0111] 107. (i) the 5' AAV ITR comprises the nucleotide sequence of SEQ ID NO: 1829 or a nucleotide sequence at least 95% identical thereto; (ii) the CMVie enhancer comprises the nucleotide sequence of SEQ ID NO: 1831, or a nucleotide sequence at least 95% identical thereto; (iii) the CB promoter or a functional variant thereof comprises the nucleotide sequence of SEQ ID NO: 1834 or a nucleotide sequence at least 95% identical thereto; (iv) the nucleotide sequence of SEQ ID NO: 1842 or a nucleotide sequence at least 95% identical thereto; (v) the nucleotide sequence encoding the signal sequence comprises the nucleotide sequence of SEQ ID NO: 2005 or a nucleotide sequence at least 95% identical thereto; (vi) the nucleotide sequence encoding the GBA1 protein comprises the nucleotide sequence of SEQ ID NO: 2002 or a nucleotide sequence that is at least 93% identical to the nucleotide sequence of SEQ ID NO: 2002; (vii) the poly A signal region comprises the nucleotide sequence of SEQ ID NO: 1846 or a nucleotide sequence at least 95% identical thereto; and (viii) The recombinant viral genome of embodiment 106, wherein the 3' AAV ITR comprises the nucleotide sequence of SEQ ID NO: 1830 or a nucleotide sequence at least 95% identical thereto.

[0112] 108. (i) the 5' AAV ITR comprises the nucleotide sequence of SEQ ID NO: 1829; (ii) the CMVie enhancer comprises the nucleotide sequence of SEQ ID NO: 1831; (iii) the CB promoter or a functional variant thereof comprises the nucleotide sequence of SEQ ID NO: 1834; (iv) the intron comprises the nucleotide sequence of SEQ ID NO: 1842; (v) the nucleotide sequence encoding the signal sequence comprises the nucleotide sequence of SEQ ID NO: 2005; (vi) the nucleotide sequence encoding the GBA1 protein comprises the nucleotide sequence of SEQ ID NO: 2002; (vii) the poly A signal region comprises the nucleotide sequence of SEQ ID NO: 1846, and (viii) The recombinant viral genome of embodiment 106 or 107, wherein the 3' AAV ITR comprises the nucleotide sequence of SEQ ID NO: 1830.

[0113] 109. The recombinant viral genome of embodiment 108, comprising the nucleotide sequence of SEQ ID NO: 2006 or a nucleotide sequence that is at least 97% identical thereto. 110. The recombinant viral genome of embodiment 108 or 109, comprising the nucleotide sequence of SEQ ID NO: 2006.

[0114] 111. The recombinant viral genome of embodiment 108 or 109, consisting of the nucleotide sequence of SEQ ID NO: 2006. In order from 112.5' ​​to 3', (i) a 5' adeno-associated (AAV) ITR (optionally, the 5' AAV ITR comprises the nucleotide sequence of SEQ ID NO: 1829, or a nucleotide sequence at least 95% identical thereto); (ii) a CMVie enhancer (optionally, the CMVie enhancer comprises the nucleotide sequence of SEQ ID NO: 1831, or a nucleotide sequence at least 95% identical thereto); (iii) a CB promoter or a functional variant thereof (optionally, the CB promoter or functional variant thereof comprises the nucleotide sequence of SEQ ID NO: 1834 or a nucleotide sequence at least 95% identical thereto); (iv) an intron (optionally, the intron comprises the nucleotide sequence of SEQ ID NO: 1842, or a nucleotide sequence at least 95% identical thereto); (v) a nucleotide sequence encoding a signal sequence (optionally, the nucleotide sequence encoding the signal sequence comprises the nucleotide sequence of SEQ ID NO: 2005 or a nucleotide sequence at least 95% identical thereto); (vi) a nucleotide sequence encoding a GBA1 protein (optionally, the nucleotide sequence encoding the GBA1 protein comprises the nucleotide sequence of SEQ ID NO: 2002 or a nucleotide sequence that is at least 93% identical to the nucleotide sequence of SEQ ID NO: 2002); (vii) miR183 binding site series, (viii) a polyA signal region (optionally, the polyA signal region comprises the nucleotide sequence of SEQ ID NO: 1846, or a nucleotide sequence at least 95% identical thereto), and (ix) 3' AAV ITRs (optionally, the 3' AAV ITRs comprise the nucleotide sequence of SEQ ID NO: 1830, or a nucleotide sequence at least 95% identical thereto). A recombinant viral genome comprising: The miR183 binding site series (a) a miR183 binding site comprising the nucleotide sequence of SEQ ID NO: 1847 or a nucleotide sequence having one, two, three, four, five, six, or seven or more, but not more than ten, modifications of SEQ ID NO: 1847; (b) a spacer sequence comprising the nucleotide sequence of SEQ ID NO: 1848 or a nucleotide sequence having one, two, or more, but not more than four, modifications of SEQ ID NO: 1848; (c) a miR183 binding site comprising the nucleotide sequence of SEQ ID NO: 1847 or a nucleotide sequence having one, two, three, four, five, six, or seven or more, but not more than ten, modifications of SEQ ID NO: 1847; (d) a spacer sequence comprising the nucleotide sequence of SEQ ID NO: 1848 or a nucleotide sequence having one, two, or more, but not more than four, modifications of SEQ ID NO: 1848; (e) a miR183 binding site comprising the nucleotide sequence of SEQ ID NO: 1847 or a nucleotide sequence having one, two, three, four, five, six, or seven or more, but not more than ten, modifications of SEQ ID NO: 1847; (f) a spacer sequence comprising the nucleotide sequence of SEQ ID NO: 1848 or a nucleotide sequence having one, two, or more, but not more than four, modifications of SEQ ID NO: 1848; (g) a miR183 binding site comprising the nucleotide sequence of SEQ ID NO: 1847 or a nucleotide sequence having one, two, three, four, five, six, or seven or more, but not more than ten, modifications of SEQ ID NO: 1847. A recombinant viral genome comprising:

[0115] 113. (i) the 5' AAV ITR comprises the nucleotide sequence of SEQ ID NO: 1829 or a nucleotide sequence at least 95% identical thereto; (ii) the CMVie enhancer comprises the nucleotide sequence of SEQ ID NO: 1831, or a nucleotide sequence at least 95% identical thereto; (iii) the CB promoter or a functional variant thereof comprises the nucleotide sequence of SEQ ID NO: 1834 or a nucleotide sequence at least 95% identical thereto; (iv) the nucleotide sequence of SEQ ID NO: 1842 or a nucleotide sequence at least 95% identical thereto; (v) the nucleotide sequence encoding the signal sequence comprises the nucleotide sequence of SEQ ID NO: 2005 or a nucleotide sequence at least 95% identical thereto; (vi) the nucleotide sequence encoding the GBA1 protein comprises the nucleotide sequence of SEQ ID NO: 2002 or a nucleotide sequence that is at least 93% identical to the nucleotide sequence of SEQ ID NO: 2002; (vii) miR183 binding site series (a) a miR183 binding site comprising the nucleotide sequence of SEQ ID NO: 1847 or a nucleotide sequence having one, two, three, four, five, six, or seven or more, but not more than ten, modifications of SEQ ID NO: 1847; (b) a spacer sequence comprising the nucleotide sequence of SEQ ID NO: 1848 or a nucleotide sequence having one, two, or more, but not more than four, modifications of SEQ ID NO: 1848; (c) a miR183 binding site comprising the nucleotide sequence of SEQ ID NO: 1847 or a nucleotide sequence having one, two, three, four, five, six, or seven or more, but not more than ten, modifications of SEQ ID NO: 1847; (d) a spacer sequence comprising the nucleotide sequence of SEQ ID NO: 1848 or a nucleotide sequence having one, two, or more, but not more than four, modifications of SEQ ID NO: 1848; (e) a miR183 binding site comprising the nucleotide sequence of SEQ ID NO: 1847 or a nucleotide sequence having one, two, three, four, five, six, or seven or more, but not more than ten, modifications of SEQ ID NO: 1847; (f) a spacer sequence comprising the nucleotide sequence of SEQ ID NO: 1848 or a nucleotide sequence having one, two, or more, but not more than four, modifications of SEQ ID NO: 1848; (g) a miR183 binding site comprising the nucleotide sequence of SEQ ID NO: 1847 or a nucleotide sequence having one, two, three, four, five, six, or seven or more, but not more than ten, modifications of SEQ ID NO: 1847. Including, (viii) the poly A signal region comprises the nucleotide sequence of SEQ ID NO: 1846 or a nucleotide sequence at least 95% identical thereto; and (ix) The recombinant viral genome of embodiment 112, wherein the 3′ AAV ITR comprises the nucleotide sequence of SEQ ID NO: 1830 or a nucleotide sequence at least 95% identical thereto.

[0116] 114. The recombinant viral genome of any one of embodiments 106, 107, 112 or 113, wherein the nucleotide sequence encoding the GBA1 protein comprises the nucleotide sequence of SEQ ID NO: 2002 or a nucleotide sequence that is at least 95% identical thereto.

[0117] 115. (i) the 5' AAV ITR comprises the nucleotide sequence of SEQ ID NO: 1829; (ii) the CMVie enhancer comprises the nucleotide sequence of SEQ ID NO: 1831; (iii) the CB promoter or a functional variant thereof comprises the nucleotide sequence of SEQ ID NO: 1834; (iv) the intron comprises the nucleotide sequence of SEQ ID NO: 1842; (v) the nucleotide sequence encoding the signal sequence comprises the nucleotide sequence of SEQ ID NO: 2005; (vi) the nucleotide sequence encoding the GBA1 protein comprises the nucleotide sequence of SEQ ID NO: 2002; (vii) the miR183 binding site sequence comprises the nucleotide sequence of SEQ ID NO: 1849; (viii) the poly A signal region comprises the nucleotide sequence of SEQ ID NO: 1846, and (ix) The recombinant viral genome of embodiment 113 or 114, wherein the 3' AAV ITR comprises the nucleotide sequence of SEQ ID NO: 1830.

[0118] 116. The recombinant viral genome of embodiment 115, comprising the nucleotide sequence of SEQ ID NO: 2007 or a nucleotide sequence that is at least 97% identical thereto. 117. The recombinant viral genome of embodiment 115 or 116, comprising or consisting of the nucleotide sequence of SEQ ID NO: 2007.

[0119] 118. The recombinant viral genome of any one of embodiments 7 to 117, further comprising a nucleic acid encoding a capsid protein, wherein the capsid protein comprises a VP1 polypeptide, a VP2 polypeptide, and / or a VP3 polypeptide.

[0120] 119. The recombinant viral genome of embodiment 118, wherein the VP1 polypeptide, the VP2 polypeptide and / or the VP3 polypeptide are encoded by at least one Cap gene.

[0121] 120. The viral genome according to any one of embodiments 7 to 119, further comprising a nucleic acid encoding a Rep protein, wherein the Rep protein comprises a Rep78 protein, a Rep68 protein, a Rep52 protein and / or a Rep40 protein.

[0122] 121. The viral genome according to embodiment 120, wherein the Rep78, Rep68, Rep52 and / or Rep40 proteins are encoded by at least one Rep gene.

[0123] 122.(i) Capsid protein and (ii) a viral genome according to any one of embodiments 7 to 121; AAV particles containing

[0124] 123. (i) the capsid protein comprises the amino acid sequence of SEQ ID NO: 138 or an amino acid sequence having at least 80% (e.g., at least about 85, 90, 95, 96, 97, 98, or 99%) sequence identity thereto; (ii) the capsid protein comprises an amino acid sequence having one, two, or three or more modifications, but not more than 30, 20, or 10 modifications, of the amino acid sequence of SEQ ID NO: 138; (iii) the capsid protein comprises the amino acid sequence of SEQ ID NO: 11, or an amino acid sequence having at least 80% (e.g., at least about 85, 90, 95, 96, 97, 98, or 99%) sequence identity thereto; (iv) the capsid protein comprises an amino acid sequence having one, two, or three or more modifications, but not more than 30, 20, or 10 modifications, of the amino acid sequence of SEQ ID NO: 11; (v) the capsid protein comprises an amino acid sequence encoded by the nucleotide sequence of SEQ ID NO: 137 or a sequence having at least 80% (e.g., at least about 85, 90, 95, 96, 97, 98, or 99%) sequence identity thereto; and / or (vi) The AAV particle described in embodiment 122, wherein the nucleotide sequence encoding the capsid protein comprises the nucleotide sequence of SEQ ID NO: 137 or a sequence having at least 80% (e.g., at least about 85, 90, 95, 96, 97, 98, or 99%) sequence identity thereto.

[0125] 124. Capsid proteins are (i) an amino acid substitution at position K449 numbered according to SEQ ID NO: 138, e.g., a K449R substitution; (ii) an insertion containing the amino acid sequence of TLAVPFK (SEQ ID NO: 1262) relative to a reference sequence numbered according to SEQ ID NO: 138, optionally located immediately after position 588; (iii) an amino acid other than "A" at position 587 and / or an amino acid other than "Q" at position 588, numbered according to SEQ ID NO: 138; (iv) an amino acid substitution of A587D and / or Q588G, numbered according to SEQ ID NO: 138 124. The AAV particle of embodiment 122 or 123, comprising:

[0126] 125. An AAV particle described in any one of embodiments 122 to 124, wherein the capsid protein comprises (i) an amino acid substitution of K449R numbered according to SEQ ID NO: 138, and (ii) an insertion comprising the amino acid sequence of TLAVPFK (SEQ ID NO: 1262), optionally located immediately after position 588 of SEQ ID NO: 138.

[0127] 126. An AAV particle according to any one of embodiments 122 to 124, wherein the capsid protein comprises (i) an amino acid substitution of K449R as numbered according to SEQ ID NO: 138, (ii) an insertion comprising the amino acid sequence of TLAVPFK (SEQ ID NO: 1262) relative to the reference sequence numbered according to SEQ ID NO: 138, optionally located immediately after position 588, and (iii) amino acid substitutions of A587D and Q588G as numbered according to SEQ ID NO: 138.

[0128] 127. An AAV particle described in any one of embodiments 122 to 124, wherein the capsid protein comprises (i) an insertion comprising the amino acid sequence of TLAVPFK (SEQ ID NO: 1262) compared to the reference sequence numbered according to SEQ ID NO: 138, optionally located immediately after position 588, and (ii) amino acid substitutions A587D and Q588G numbered according to SEQ ID NO: 138.

[0129] 128. An AAV particle described in any one of embodiments 122 to 127, wherein the capsid protein comprises any of the capsid proteins listed in Table 1 or a functional variant thereof. 129. The AAV particle of any one of embodiments 122 to 128, wherein the capsid protein comprises VOY101, VOY201, AAVPHP.N (PHP.N), AAVPHP.B (PHP.B), AAVPHP.A (PHP.A), PHP.B2, PHP.B3, G2B4, G2B5, AAV5, AAV9, AAVrhlO, or a functional variant thereof (e.g., an AAV9 capsid or variant thereof, or an AAV5 capsid or variant thereof).

[0130] 130. (i) the capsid protein comprises the amino acid sequence of SEQ ID NO: 1 or an amino acid sequence substantially identical thereto (e.g., having at least 70%, 75%, 80%, 85%, 90%, 92%, 95%, 97%, 98%, or 99% sequence identity); (ii) the capsid protein comprises an amino acid sequence that contains one, two, or three or more modifications, e.g., substitutions, but not more than 30, 20, or 10 modifications, e.g., substitutions, relative to the amino acid sequence of SEQ ID NO:1; (iii) the capsid protein comprises an amino acid sequence encoded by the nucleotide sequence of SEQ ID NO:2 or a nucleotide sequence substantially identical thereto (e.g., having at least 70%, 75%, 80%, 85%, 90%, 92%, 95%, 97%, 98%, or 99% sequence identity); and / or (iv) An AAV particle described in any one of embodiments 122 to 129, wherein the nucleotide sequence encoding the capsid protein comprises the nucleotide sequence of SEQ ID NO: 2 or a nucleotide sequence substantially identical thereto (e.g., having at least 70%, 75%, 80%, 85%, 90%, 92%, 95%, 97%, 98% or 99% sequence identity).

[0131] 131. Capsid proteins are (i) a VP1 polypeptide, a VP2 polypeptide, a VP3 polypeptide, or a combination thereof; (ii) an amino acid sequence corresponding to positions 138 to 743 of SEQ ID NO: 1, for example, VP2, or a sequence having at least 80% (e.g., at least about 85, 90, 92, 95, 96, 97, 98, or 99%) sequence identity thereto; (iii) an amino acid sequence corresponding to positions 203 to 743 of SEQ ID NO: 1, e.g., VP3, or a sequence having at least 80% (e.g., at least about 85, 90, 92, 95, 96, 97, 98, or 99%) sequence identity thereto; and / or (iv) an amino acid sequence corresponding to positions 1 to 743 of SEQ ID NO: 1, for example, VP1, or a sequence having at least 80% (e.g., at least about 85, 90, 92, 95, 96, 97, 98, or 99%) sequence identity thereto 131. An AAV particle described in any one of embodiments 122 to 130, comprising:

[0132] 132. The nucleotide sequence encoding the capsid protein is (i) a CTG start codon, and / or (ii) the nucleotide sequence of SEQ ID NO: 137 comprising 3 to 20 mutations, e.g., substitutions, e.g., 3 to 15 mutations, 3 to 10 mutations, 3 to 5 mutations, 5 to 20 mutations, 5 to 15 mutations, 5 to 10 mutations, 10 to 20 mutations, 10 to 15 mutations, 15 to 20 mutations, 3 mutations, 5 mutations, 10 mutations, 12 mutations, 15 mutations, 18 mutations, or 20 mutations. 132. An AAV particle according to any one of embodiments 122 to 131, comprising:

[0133] 133. A vector comprising the isolated nucleic acid according to any one of embodiments 1 to 6 or the viral genome according to any one of embodiments 7 to 121. 134. A cell comprising a viral genome according to any one of embodiments 7 to 11, a viral particle according to any one of embodiments 122 to 132, or a vector according to embodiment 133.

[0134] 135. The cell of embodiment 134, which is a mammalian cell (e.g., a HEK293 cell), an insect cell (e.g., an Sf9 cell), or a bacterial cell. 136. A nucleic acid comprising a viral genome according to any one of embodiments 7 to 121 and a scaffold region suitable for replication of the viral genome in a cell, e.g., a bacterial cell (e.g., the scaffold region comprises one or both of a bacterial origin of replication and a selectable marker).

[0135] 137. The nucleic acid of embodiment 136, wherein the viral genome comprises the nucleotide sequence of SEQ ID NO: 2006 or SEQ ID NO: 2007, or a sequence that is at least 97% identical thereto.

[0136] 138. A method for producing a viral genome, comprising: (i) providing a nucleic acid molecule comprising a viral genome according to embodiment 136 or 137 or a nucleic acid encoding a viral genome according to any one of embodiments 7 to 121; (ii) excising the viral genome from the backbone region, for example, by cleaving nucleic acid molecules upstream and downstream of the viral genome; A method comprising:

[0137] 139. A method for producing recombinant AAV particles, comprising: (i) providing a host cell comprising a nucleic acid encoding the viral genome of any one of embodiments 7 to 122 or the viral genome of embodiment 136 or 137; (ii) incubating the host cells under conditions suitable for packaging the viral genome into a capsid protein, such as a VOY101 capsid protein, an AAV9 capsid protein or a mutant thereof, or an AAV5 capsid protein or a mutant thereof; thereby producing isolated AAV particles.

[0138] 140. The method of embodiment 139, further comprising, prior to step (i), introducing into the host cell a first nucleic acid molecule comprising a viral genome. 141. The method of embodiment 139 or 140, wherein the host cell comprises a second nucleic acid encoding a capsid protein, such as a VOY101 capsid protein.

[0139] 142. The method of embodiment 140, further comprising introducing a second nucleic acid into the cell. 143. The method of embodiment 141 or 142, wherein the second nucleic acid molecule is introduced into the host cell before, simultaneously with, or after the first nucleic acid molecule.

[0140] 144. The method of any one of embodiments 139 to 143, wherein the host cell comprises a mammalian cell (e.g., a HEK293 cell), an insect cell (e.g., an Sf9 cell), or a bacterial cell.

[0141] 145. A pharmaceutical composition comprising an AAV particle according to any one of embodiments 122 to 132 or an AAV particle comprising a viral genome according to any one of embodiments 7 to 121, and a pharmaceutically acceptable excipient.

[0142] 146. A method for delivering a nucleic acid sequence encoding a GBA1 protein to a subject, comprising administering an effective amount of a pharmaceutical composition described in embodiment 145, an AAV particle described in any one of embodiments 122 to 132, an AAV particle comprising a viral genome described in any one of embodiments 7 to 121, or an AAV particle comprising a viral genome comprising a nucleic acid described in any one of embodiments 1 to 6, thereby delivering the nucleic acid encoding a GBA1 protein to a subject.

[0143] 147. The method of embodiment 146, wherein the subject has, has been diagnosed with, or is at risk of having a disease associated with GBA expression, such as abnormal or reduced GBA1 expression, such as expression of the GBA1 gene, GBA1 mRNA and / or GBA1 protein.

[0144] 148. The method of embodiment 146 or 147, wherein the subject has, has been diagnosed with, or is at risk of having a neurodegenerative or neuromuscular disorder. 149. A method for treating a subject having or diagnosed as having a disease associated with GBA1 expression, comprising administering an effective amount of a pharmaceutical composition described in embodiment 145, an AAV particle described in any one of embodiments 122 to 132, an AAV particle comprising a viral genome described in any one of embodiments 7 to 121, or an AAV particle comprising a viral genome comprising a nucleic acid described in any one of embodiments 1 to 6, thereby treating the disease associated with GBA1 expression in the subject.

[0145] 150. A method for treating a subject having or diagnosed as having a neurodegenerative or neuromuscular disorder, comprising administering an effective amount of the pharmaceutical composition of embodiment 145, the AAV particle of any one of embodiments 122 to 132, the AAV particle comprising a viral genome of any one of embodiments 7 to 121, or the AAV particle comprising a viral genome comprising a nucleic acid of any one of embodiments 1 to 6, thereby treating the neurodegenerative or neuromuscular disorder in the subject.

[0146] 151. The method of any one of embodiments 147-150, wherein the disease or neurodegenerative or neuromuscular disorder associated with expression of GBA1 comprises Parkinson's disease (PD), dementia with Lewy bodies (DLB), Gaucher disease (GD), spinal muscular atrophy (SMA), multiple system atrophy (MSA) or multiple sclerosis (MS).

[0147] 152. A method for treating a subject having or diagnosed as having Parkinson's disease (PD) (e.g., PD associated with a mutation in the GBA1 gene), comprising administering an effective amount of a pharmaceutical composition described in embodiment 145, an AAV particle described in any one of embodiments 122 to 132, an AAV particle comprising a viral genome described in any one of embodiments 7 to 121, or an AAV particle comprising a viral genome comprising a nucleic acid described in any one of embodiments 1 to 6, thereby treating PD in the subject.

[0148] 153. The method of embodiment 151 or 152, wherein the subject has one or more mutations in GBA1. 154. The method of any one of embodiments 151-153, wherein the PD is early-onset PD (e.g., before age 50) or early-onset PD (e.g., before age 20).

[0149] 155. The method of any one of embodiments 151-154, wherein the PD is tremor-predominant, postural instability gait-delayed PD (PIGD) or sporadic PD (e.g., PD not associated with a mutation).

[0150] 156. A method for treating a subject having or diagnosed as having Gaucher disease (GD), comprising administering an effective amount of the pharmaceutical composition of embodiment 145, the AAV particle of any one of embodiments 122-132, the AAV particle comprising a viral genome of any one of embodiments 7-121, or the AAV particle comprising a viral genome comprising a nucleic acid of any one of embodiments 1-6, thereby treating GD in the subject.

[0151] 157. The method of any one of embodiments 151-156, wherein the GD is neuronopathic GD (e.g., cells or tissues of the CNS, such as cells or tissues of the brain and / or spinal cord, are affected), non-neuronopathic GD (e.g., cells or tissues of the CNS are not affected), or a combination thereof.

[0152] 158. The method of any one of embodiments 151 or 156-157, wherein the GD is type I GD (GD1), type 2 GD (GD2) or type 3 GD (GD3). 159. The method of embodiment 158, wherein GD1 is a non-neuronotoxic GD.

[0153] 160. The method of embodiment 158, wherein GD2 is neurotoxic GD. 161. The method of any one of embodiments 146 to 160, wherein the subject has a reduced GCase activity level compared to a reference level, as measured by an assay, such as the assay described in Example 7.

[0154] 162. The method of embodiment 161, wherein the reference level comprises the level of GCase activity in a subject who does not have a disease, neuromuscular disorder and / or neurodegenerative disorder associated with GBA1 expression. 163. The method of any one of embodiments 149-162, wherein treating includes preventing or preventing progression of disease in the subject.

[0155] 164. The method of any one of embodiments 149-162, wherein treating results in amelioration of at least one symptom of a disease, neurodegenerative disorder and / or neuromuscular disorder associated with GBA1 expression in the subject.

[0156] 165. The method of embodiment 164, wherein symptoms of diseases, neurodegenerative disorders and / or neuromuscular disorders associated with GBA1 expression include decreased GCase activity, accumulation of glucocerebroside and other glycolipids in immune cells (e.g., macrophages), increased synuclein aggregates (e.g., Lewy bodies), developmental delay, progressive encephalopathy, progressive dementia, ataxia, myoclonus, oculomotor dysfunction, bulbar palsy, generalized weakness, limb tremors, depression, visual hallucinations, cognitive decline, or a combination thereof.

[0157] 166. The method of any one of embodiments 146-165, wherein the subject is a human. 167. The method of any one of embodiments 146-166, wherein the subject is young, for example between 6 and 20 years old.

[0158] 168. The method of any one of embodiments 146-167, wherein the subject is an adult, for example over 20 years of age. 169. The method of any one of embodiments 146-168, wherein the subject has a mutation in the GBA1 gene, GBA1 mRNA and / or GBA1 protein.

[0159] 170. The method of any one of embodiments 146 to 169, wherein the AAV particles are administered to the subject via intravenous, intracerebral, intrathalamic (ITH) administration, via intramuscular, intrathecal, intracerebroventricular, intraparenchymal administration, for example via focused ultrasound (FUS) combined with intravenous administration of microbubbles (FUS-MB) or MRI-guided FUS combined with intravenous administration, or via intracisternal injection (ICM).

[0160] 171. The method of any one of embodiments 146 to 170, wherein the AAV particles are administered by dual ITH and ICM administration. 172. The method of any one of embodiments 146 to 170, wherein the AAV particles are administered by intravenous injection, optionally via intravenous injection, for example, via focused ultrasound (FUS) combined with intravenous administration of microbubbles (FUS-MB) or MRI-guided FUS combined with intravenous administration.

[0161] 173. A method according to any one of embodiments 146 to 172, wherein the AAV particles are administered to a cell, tissue or region of the CNS, such as a region of the brain or spinal cord, such as the parenchyma, cortex, substantia nigra, caudate-cerebellum, striatum, corpus callosum, cerebellum, brainstem-caudate-putamen, thalamus, superior colliculus, spinal cord, or a combination thereof.

[0162] 174. The method of any one of embodiments 146 to 173, wherein the AAV particles are administered to peripheral cells, tissues or regions, such as lung cells or tissues, cardiac cells or tissues, spleen cells or tissues, liver cells or tissues, or a combination thereof.

[0163] 175. The method of any one of embodiments 146 to 174, wherein the AAV particles are administered into cerebrospinal fluid, serum, or a combination thereof. 176. The method of any one of embodiments 146 to 175, wherein the AAV particles are administered to at least two tissues or regions of the CNS, for example, bilateral administration.

[0164] 177. The method of any one of embodiments 146-176, further comprising performing a blood test, performing an imaging test, taking a CNS biopsy sample, taking a tissue biopsy (e.g., a lung, liver, or spleen biopsy), taking a blood or serum sample, or taking a cerebrospinal fluid biopsy.

[0165] 178. The method of any one of embodiments 146 to 177, further comprising assessing, e.g., measuring, the expression level of GBA1 in the subject, e.g., in the cells, tissues, or body fluids of the subject, e.g., the expression level of the GBA1 gene, GBA1 mRNA, and / or GBA1 protein, optionally wherein the GBA1 protein level is measured by an assay described herein, e.g., ELISA, Western blot, or immunohistochemistry assay.

[0166] 179. The method of embodiment 178, wherein measuring the level of GBA1 expression is performed before, during or after treatment with AAV particles. 180. The method of embodiment 178 or 179, wherein the cell or tissue is a cell or tissue of the central nervous system (e.g., parenchyma) or a peripheral cell or tissue (e.g., liver, heart and / or spleen).

[0167] 181. A method according to any one of embodiments 146 to 180, wherein administration results in an increase in the level of GBA1 protein expression in the cells or tissues of the subject compared to a reference level, e.g., a subject not receiving the treatment, e.g., not receiving AAV particles.

[0168] 182. The method of any one of embodiments 146 to 181, further comprising assessing, e.g., measuring, the level of GCase activity in the subject, e.g., in the cells or tissues of the subject, optionally wherein the level of GCase activity is measured by an assay described herein, e.g., the assay described in Example 7.

[0169] 183. Administration is (i) the level of GCase activity in the subject's cells, tissues (e.g., cells or tissues of the CNS, such as the cortex, striatum, thalamus, cerebellum, and / or brainstem) and / or body fluids (e.g., CSF and / or serum), optionally increasing by at least 2, 3, 4, or 5 fold compared to a reference level, e.g., a subject not receiving the treatment, e.g., not receiving AAV particles; (ii) a level of viral genome (VG) per cell in a CNS tissue (e.g., cortex, striatum, thalamus, cerebellum, brainstem, and / or spinal cord) of the subject, optionally increased by more than 50 VG per cell compared to peripheral tissue, where the level of VG per cell is at most 4-10 times lower than in CNS tissue, as measured, for example, by an assay described herein; and / or (iii) the level of GBA1 mRNA expression in a cell or tissue (e.g., a cell or tissue of the CNS, e.g., the cortex, thalamus, and / or brainstem), optionally as measured, e.g., by an assay described herein, is increased by at least 100-1300 fold, e.g., 100-fold, 200-fold, 500-fold, 600-fold, 850-fold, 900-fold, 950-fold, 1000-fold, 1050-fold, 1100-fold, 1150-fold, 1200-fold, 1250-fold, or 1300-fold, compared to a reference level, e.g., a subject not receiving treatment (e.g., not administered AAV particles), or endogenous GBA1 mRNA level. 183. The method of any one of embodiments 146 to 182, resulting in an increase in at least one, two or all of:

[0170] 184. The method according to any one of embodiments 146 to 183, further comprising the administration of an additional therapeutic agent and / or therapy suitable for the treatment or prevention of diseases associated with GBA1 expression, neurodegenerative disorders and / or neuromuscular disorders.

[0171] 185. The method of embodiment 184, wherein the additional therapeutic agent comprises enzyme replacement therapy (ERT) (e.g., imiglucerase, velaglucerase alfa, or taliglucerase alfa), substrate reduction therapy (SRT) (e.g., eliglustat or miglustat), blood transfusion, levodopa, carbidopa, safinamide, dopamine agonists (e.g., pramipexole, rotigotine, or ropinirole), anticholinergics (e.g., benztropine or trihexyphenidyl), cholinesterase inhibitors (e.g., rivastigmine, donepezil, or galantamine), N-methyl-d-aspartate (NMDA) receptor antagonists (e.g., memantine), or combinations thereof.

[0172] 186. The isolated nucleic acid of any one of embodiments 1 to 6, the viral genome of any one of embodiments 7 to 121, the AAV particle of any one of embodiments 122 to 132, or the pharmaceutical composition of embodiment 145, for use in the manufacture of a medicament.

[0173] 187. An isolated nucleic acid according to any one of embodiments 1 to 6, a viral genome according to any one of embodiments 7 to 121, an AAV particle according to any one of embodiments 122 to 132 or a pharmaceutical composition according to embodiment 145 for use in the treatment of a disease associated with GBA1 expression, a neuromuscular disorder and / or a neurodegenerative disorder.

[0174] 188. Use of an effective amount of AAV particles comprising a genome according to any one of embodiments 7 to 121, an AAV particle comprising a genome comprising a nucleic acid according to any one of embodiments 1 to 6, an AAV particle according to any one of embodiments 122 to 132 or a pharmaceutical composition according to embodiment 146 in the manufacture of a medicament for the treatment of a disease associated with GBA1 expression, a neuromuscular disorder and / or a neurodegenerative disorder.

[0175] 189. An adeno-associated virus (AAV) viral genome comprising the nucleotide sequence of SEQ ID NO: 2006 or 2007. 190. An AAV particle comprising the AAV viral genome according to item 189 and a capsid selected from the group consisting of those listed in Table 1.

[0176] 191. The viral genome of embodiment 190, wherein the capsid comprises an AAV2 serotype, an AAV5 serotype, or an AAV9 serotype, or a variant thereof. 192. A pharmaceutical composition comprising AAV particles according to item 190 or 191.

[0177] 193. A method for treating a neurological or neuromuscular disorder, comprising administering to a subject the pharmaceutical composition according to item 192. 194. The method according to item 193, wherein the neurological or neuromuscular disorder is Parkinson's disease, Gaucher's disease or dementia with Lewy bodies or a related disorder.

[0178] 195. The method according to item 194, wherein the neurological or neuromuscular disorder is a disorder associated with a decrease in GCase protein levels. Details of various aspects or embodiments of the present disclosure are described below. Other features, objects, and advantages of the present disclosure will be apparent from this description and the claims. In the description, the singular also includes the plural unless the context clearly dictates otherwise. Unless otherwise defined, all scientific and technical terms used herein have the same meaning as commonly understood by those skilled in the art of the present disclosure. In the event of any conflict, the description in this specification shall prevail. [Brief explanation of the drawings]

[0179] [Figure 1-1] Figures 1A-1B illustrate LC-MS / MS results quantifying the levels of the GBA1 substrate glucosylsphingosine (GlcSph) in cell lysates from Gaucher disease patient-derived fibroblasts (GD1 patient GM04394, GD1 patient GM00852, and GD2 patient GM00877) and healthy control fibroblasts (CLT GM05758, CTL GM02937, and CTL GM08402). Data are shown as GlcSph normalized to actin (Figure 1A) or GlcSph normalized to the lysosomal protein Lamp1 (Figure 1B). Figure 1C illustrates the GBA1 protein levels detected by LC-MS / MS in lysates from Gaucher disease patient-derived fibroblasts (GD1 and GD2) compared with healthy control fibroblasts (HC). Data are presented as relative concentrations of GBA1 protein (ng) to total protein (mg). [Figure 1-2] Same as above. [Figure 2A]GCase activity (RFU / mL normalized per mg of protein) is depicted in GD-II GM00877 fibroblast pellets (FIG. 2A) or conditioned medium (FIG. 2B) 7 days after transduction at an MOI of 103.5 with AAV2 viral particles containing, from left to right, viral genome constructs on the X-axis: GBA_VG1 (SEQ ID NO: 1759), GBA_VG9 (SEQ ID NO: 1767), GBA_VG10 (SEQ ID NO: 1768), GBA_VG11 (SEQ ID NO: 1769), GBA_VG6 (SEQ ID NO: 1764), GBA_VG7 (SEQ ID NO: 1765), GBA_VG12 (SEQ ID NO: 1770), GBA_VG3 (SEQ ID NO: 1761), GBA_VG4 (SEQ ID NO: 1762), GBA_VG5 (SEQ ID NO: 1763), and GBA_VG13 (SEQ ID NO: 1771). The dotted line indicates baseline levels (vehicle treatment). [Figure 2B] Same as above. [Figure 3] Illustrated are levels (ng / mg Lamp1) of the GBA1 substrate glucosylsphingosine (GlcSph) in cell lysates collected from GD-II patient fibroblasts (GM00877) at day 7 post-transduction with either a no-AAV control or AAV2 vectors containing the viral genomes indicated on the X-axis (from left to right: GBA_VG1 (SEQ ID NO: 1759), GBA_VG9 (SEQ ID NO: 1767), GBA_VG6 (SEQ ID NO: 1764), GBA_VG7 (SEQ ID NO: 1765), GBA_VG3 (SEQ ID NO: 1761), GBA_VG4 (SEQ ID NO: 1762), and GBA_VG5 (SEQ ID NO: 1763)). [Figure 4A]GCase activity, measured as RFU per mL normalized per mg of protein, is depicted in GD-II patient fibroblasts (GD-II GM00877) at day 7 after transduction with AAV2 vectors containing the viral genomes indicated on the X-axis (from left to right: GBA_VG1 (SEQ ID NO: 1759), GBA_VG14 (SEQ ID NO: 1809), GBA_VG15 (SEQ ID NO: 1810), GBA_VG16 (SEQ ID NO: 1811), GBA_VG17 (SEQ ID NO: 1812), GBA_VG18 (SEQ ID NO: 1813), GBA_VG19 (SEQ ID NO: 1814), and GBA_VG20 (SEQ ID NO: 1815)) at an MOI of 102.5 (first bar), 103 (second bar), 103.5, and 104 (third bar). [Figure 4B] Illustrated are levels of the GBA1 substrate glucosylsphingosine (GlcSph, ng / mg Lamp1) in cell lysates from fibroblasts derived from GD-II patients 7 days after transduction with AAV2 vectors containing the viral genomes indicated on the X-axis (from left to right: GBA_VG1 (SEQ ID NO: 1759), GBA_VG14 (SEQ ID NO: 1809), GBA_VG15 (SEQ ID NO: 1810), GBA_VG16 (SEQ ID NO: 1811), GBA_VG17 (SEQ ID NO: 1812), GBA_VG18 (SEQ ID NO: 1813), GBA_VG19 (SEQ ID NO: 1814), and GBA_VG20 (SEQ ID NO: 1815)) at an MOI of 102.5 (first bar), 103 (second bar), 103.5, and 104 (third bar). [Figure 5] 1 illustrates the GC content and distribution of a first codon-optimized GBA1 protein-encoding nucleotide sequence of SEQ ID NO: 1773, a second codon-optimized GBA1 protein-encoding nucleotide sequence of SEQ ID NO: 1781, and a wild-type GBA1 protein-encoding nucleotide sequence of SEQ ID NO: 1777. [Figure 6A]Figure 6A compares the activity of GBA1 protein expressed by the AAV2-vectored viral genome constructs GBA_VG1 (SEQ ID NO: 1759), GBA_VG17 (SEQ ID NO: 1812), and GBA_VG21 (SEQ ID NO: 1816). Figure 6A depicts the GCase activity (RFU / mL) normalized per mg of protein in GD-II patient fibroblasts treated with AAV2 viral particles at an MOI of 104.5 containing the viral genome constructs indicated on the X-axis (GBA_VG1 (SEQ ID NO: 1759), GBA_VG17 (SEQ ID NO: 1812), and GBA_VG21 (SEQ ID NO: 1816)) compared to a no-AAV control. Figure 6B illustrates glucosylsphingosine (GlcSph) (ng / mL Lamp1) in cell lysates from GD-II patient fibroblasts treated with AAV2 viral particles containing the viral genome constructs shown on the X-axis (from left to right: GBA_VG1 (SEQ ID NO: 1759), GBA_VG17 (SEQ ID NO: 1812), and GBA_VG21 (SEQ ID NO: 1816)) at an MOI of 106 or a no-AAV treatment control. [Figure 6B] Same as above. [Figure 7] 1 illustrates GCase activity (RFU / mL) per mg of protein in rat embryonic dorsal root ganglion (DRG) neurons transduced with an AAV2 vector containing GBA_VG33 (sequence number 1828) or an AAV2 vector containing GBA_VG17 (sequence number 1812) at an MOI of 103.5 or 104.5 compared to a no-AAV control. [Figure 8] Figure 1 shows the biodistribution (VG / cell) compared to GCase activity (RFU / mL, fold over endogenous GCase activity, normalized per mg of protein) in the cortex, striatum, thalamus, brainstem, cerebellum and liver of wild-type mice one month after intravenous injection of 2e13vg / kg VOY101.GBA_VG17 (sequence number 1812). [Figure 9]Figure 1 illustrates the biodistribution (VG / cell) in the cortex, striatum and brainstem of wild-type mice 28 days after intravenous injection of VOY101.GBA_VG17 (sequence number 1812), VOY101.GBA_VG35 (sequence number 2006) or VOY101.GBA_VG36 (sequence number 2007). [Figure 10] Figure 1 depicts GCase activity in the cortex, striatum and brainstem of wild-type mice 28 days after intravenous injection of VOY101.GBA_VG17 (sequence number 1812), VOY101.GBA_VG35 (sequence number 2006) or VOY101.GBA_VG36 (sequence number 2007). [Figure 11] Figure 1 illustrates the biodistribution, mRNA expression and Gcase activity in the brainstem and DRG of wild-type mice 28 days after intravenous injection of VOY101.GBA_VG17 (sequence number 1812), VOY101.GBA_VG35 (sequence number 2006) or VOY101.GBA_VG36 (sequence number 2007). [Figure 12] Illustrates substrate quantification of glucosylceramide and glucosylsphingosine by LC-MS / MS in the brainstem, striatum and DRG of wild-type mice 28 days after intravenous injection of VOY101.GBA_VG17 (sequence number 1812), VOY101.GBA_VG35 (sequence number 2006) or VOY101.GBA_VG36 (sequence number 2007). [Figure 13] Figure 1 illustrates the biodistribution (VG / cell) in the cortex and GCase activity in the cortex, striatum and brainstem of wild-type mice 28 days after intravenous injection of VOY101.GBA_VG17 (SEQ ID NO: 1812) or VOY101.GBA_VG17-HA. [Figure 14A] Figure 1 depicts immunohistochemical analysis of HA expression in the cortex, striatum and brainstem of wild-type mice 28 days after intravenous injection of VOY101.GBA_VG17 (SEQ ID NO: 1812) or VOY101.GBA_VG17-HA. [Figure 14B]Figure 1 depicts immunohistochemical analysis of HA expression in the cerebellum, thalamus and hippocampus of wild-type mice 28 days after intravenous injection of VOY101.GBA_VG17 (SEQ ID NO: 1812) or VOY101.GBA_VG17-HA. DETAILED DESCRIPTION OF THE INVENTION

[0180] overview Described herein are, inter alia, compositions comprising isolated, e.g., recombinant viral particles, e.g., AAV particles, for delivery, e.g., vectored delivery, of proteins, e.g., GBA1 proteins, as well as methods for making and using the same. Adeno-associated viruses (AAVs) are small, non-enveloped, icosahedral-capsid viruses of the Parvoviridae family, characterized by a single-stranded DNA viral genome. Parvoviridae viruses consist of two subfamilies: the Parvovirinae, which infect vertebrates, and the Densovirinae, which infect invertebrates. The Parvoviridae family includes the Dependovirus genus, including AAVs, which are capable of replication in vertebrate hosts, including, but not limited to, humans, primates, bovine, canine, equine, and ovine species.

[0181] Parvoviruses and other members of the Parvoviridae family are reviewed in "Parvoviridae: The Viruses and Their Replication," by Kenneth I. Berns, Chapter 69 of Fields Virology (3rd ed., 1996), the contents of which are incorporated by reference in their entirety.

[0182] AAV has proven useful as a biological tool due to its relatively simple structure, ability to infect a wide range of cells (including quiescent and dividing cells) without integrating into the host genome and without replication, and its relatively benign immunogenicity profile. The viral genome can be engineered to contain the minimum components for assembly of a functional recombinant virus or viral particle loaded with a desired payload or engineered to target and express or deliver it to a specific tissue. The viral genome can be modified to contain the minimum components for assembly of a functional recombinant virus or viral particle loaded with a desired nucleic acid construct or payload, such as a transgene, a polynucleotide encoding a polypeptide, e.g., GBA1 protein, e.g., GCase, GCase and PSAP, GCase and SapA, or GCase and SapC, GCase and a cell-penetrating peptide (e.g., ApoEII peptide, TAT peptide, or ApoB peptide), or GCase and a lysosomal targeting sequence (LTS), which can be delivered to a target cell, tissue, or organism. In some embodiments, the genome encodes a wild-type GBA1 protein. In some embodiments, the genome comprises a wild-type GBA1 protein-encoding nucleotide sequence that is codon-optimized and CpG-reduced (e.g., CpG-depleted), for example, compared to a wild-type GBA1 coding sequence (e.g., comprising the nucleotide sequence of SEQ ID NO: 1776 or 1777). In some embodiments, the target cell is a CNS cell. In some embodiments, the target tissue is CNS tissue. The target CNS tissue can be brain tissue. In some embodiments, brain targets include the caudate nucleus, putamen, thalamus, superior colliculus, cortex, and corpus callosum.

[0183] Gene therapy offers an alternative approach to Parkinson's disease (PD) and related disorders that share a single gene etiology, such as Gaucher disease and dementia with Lewy bodies and related disorders. AAV is often used in gene therapy approaches as a result of several advantageous characteristics. Without wishing to be bound by theory, in some embodiments, administration and / or delivery of GBA1 proteins (e.g., GCase and related proteins) using expression vectors, e.g., adeno-associated viral vectors (AAV) or AAV particles, e.g., the AAV particles described herein, is believed to achieve sustained high concentrations, thereby allowing for longer-lasting efficacy, lower dose treatment, broader biodistribution, and / or more consistent GBA1 protein levels compared to non-AAV therapies.

[0184] As demonstrated in the Examples herein below, the compositions and methods described herein provide improved features compared to prior enzyme replacement approaches, including: (i) increased GCase activity in a subject's cells, tissues (e.g., cells or tissues of the CNS, e.g., the cortex, striatum, thalamus, cerebellum, and / or brainstem) and / or body fluids (e.g., CSF and / or serum); (ii) increased biodistribution throughout the CNS (e.g., the cortex, striatum, thalamus, cerebellum, brainstem, and / or spinal cord) and periphery (e.g., the liver); and / or (iii) increased payload expression, e.g., GBA1 mRNA expression, in multiple brain regions (e.g., the cortex, thalamus, and brainstem) and periphery (e.g., the liver). In some embodiments, an AAV viral genome comprising a codon-optimized, CpG-reduced (e.g., CpG-depleted) GBA1 protein-encoding nucleotide sequence (e.g., SEQ ID NO:2001 or SEQ ID NO:2002) results in high biodistribution in the CNS, increased GCase activity in the CNS, peripheral tissues, and / or body fluids, and successful transgene transcription and expression. The compositions and methods described herein may be used in the treatment of disorders associated with a deficiency of GBA1 protein and / or GCase activity, such as neuropathic (CNS-affecting) and non-neuronopathic (non-CNS-affecting) Gaucher disease (e.g., GD type 1, GD type 2, or GD type 3), PD associated with mutations in the GBA1 gene, and dementia with Lewy bodies (DLB). In some embodiments, the present disclosure provides an AAV viral genome comprising a codon-optimized, CpG-reduced (e.g., CpG-depleted) GBA1 protein-encoding nucleotide sequence (e.g., comprising the nucleotide sequence of SEQ ID NO: 2001 or SEQ ID NO: 2002) that has reduced immunogenicity compared to a codon-optimized sequence that includes one or more or all CpG motifs.

[0185] I. Composition Adeno-associated virus (AAV) vectors AAV has a genome approximately 5,000 nucleotides long, which contains two open reading frames encoding proteins involved in replication (Rep) and capsid structural proteins (Cap). The open reading frames are flanked by two inverted terminal repeat (ITR) sequences, which serve as origins of replication for the viral genome. The wild-type AAV viral genome contains two open reading frames, one for four nonstructural Rep proteins (Rep78, Rep68, Rep52, and Rep40 encoded by the Rep genes) and one for three capsid or structural proteins (VP1, VP2, and VP3 encoded by the capsid or Cap genes). The Rep proteins are important for replication and packaging, while the capsid proteins assemble to create the protein shell of AAV, i.e., the AAV capsid. Alternative splicing and alternating initiation codons and promoters result in the generation of four distinct Rep proteins from a single open reading frame, and three capsid proteins from a single open reading frame. This varies depending on the AAV serotype, but as a non-limiting example, in AAV9 / hu.14 (U.S. Pat. No. 7,906,111, the contents of which are incorporated herein by reference in their entirety), VP1 refers to amino acids 1-736, VP2 refers to amino acids 138-736, and VP3 refers to amino acids 203-736. As another non-limiting example, VP1 refers to amino acids 1-743 as numbered according to SEQ ID NO:1, VP2 refers to amino acids 138-743 as numbered according to SEQ ID NO:1, and VP3 refers to amino acids 203-743 as numbered according to SEQ ID NO:1. In other words, VP1 is the full-length capsid sequence, while VP2 and VP3 are shorter components of the whole. As a result, changes in the sequence of the VP3 region will also change VP1 and VP2, but the percent difference compared to the parent sequence will be greater for VP3 because it is the shortest sequence of the three. While described herein in terms of amino acid sequences, the nucleic acid sequences encoding these proteins may be described as well.Taken together, these three capsid proteins assemble to produce AAV capsid protein. Without wishing to be bound by theory, AAV capsid protein typically comprises VP1:VP2:VP3 in a molar ratio of 1:1:10. As used herein, "AAV serotype" is primarily defined by AAV capsid. In some cases, ITRs are also specifically described by AAV serotype (e.g., AAV2 / 9).

[0186] AAV vectors typically require a co-helper (e.g., adenovirus) to undergo productive infection in cells. In the absence of such helper functions, AAV virions inherently enter host cells but do not integrate into the cellular genome.

[0187] AAV vectors have been investigated for the delivery of gene therapy drugs due to several unique characteristics. Non-limiting examples of these characteristics include: (i) the ability to infect both dividing and non-dividing cells; (ii) a broad host range of infectivity, including human cells; (iii) wild-type AAV has not been associated with any disease and has not been shown to replicate in infected cells; (iv) the absence of a cell-mediated immune response to the vector; and (v) the lack of integration into host chromosomes, thereby reducing the likelihood of long-term genetic alterations. Furthermore, infection with AAV vectors has minimal impact on altering cellular gene expression patterns (Stilwell and Samulski et al., Biotechniques, 2003, 34:148, the contents of which are incorporated herein by reference in their entirety).

[0188] Typically, AAV vectors for GCase protein delivery can be replication-deficient recombinant viral vectors because they lack sequences encoding functional Rep and Cap proteins within the viral genome. In some cases, such defective AAV vectors can lack most or all coding sequences and essentially contain only one or two AAV ITR sequences and a payload sequence. In certain embodiments, the viral genome encodes the GCase protein. In some embodiments, the viral genome encodes the GCase protein and the SapA protein. In some embodiments, the viral genome encodes the GCase protein and the SapC protein. For example, the viral genome can encode human GCase, human GCase + SapA, or human GCase + SapC proteins.

[0189] In some embodiments, the viral genome may include one or more lysosomal targeting sequences (LTS). In some embodiments, the viral genome may comprise one or more cell penetrating peptide sequences (CPPs).

[0190] In some embodiments, the viral genome may include one or more lysosomal targeting sequences and one or more cell penetrating sequences. In some embodiments, the AAV particles of the present disclosure can be introduced into mammalian cells.

[0191] AAV vectors can be modified to enhance delivery efficiency, and such modified AAV vectors of the present disclosure can be packaged efficiently and used to successfully infect target cells at high frequencies and with minimal toxicity.

[0192] In other embodiments, the AAV particles of the present disclosure can be used to deliver GCase protein to specific tissues of the central nervous system (see, e.g., U.S. Patent No. 6,180,613, the contents of which are incorporated herein by reference in their entirety) or CNS.

[0193] As used herein, the term "AAV vector" or "AAV particle" includes a capsid and a viral genome that includes a payload. As used herein, "payload" or "payload region" refers to one or more polynucleotides or polynucleotide regions encoded by or within the viral genome, or the expression products of such polynucleotides or polynucleotide regions, such as transgenes, polynucleotides encoding polypeptides or multi-polypeptides, e.g., GCase protein.

[0194] It is understood that the compositions described herein may additionally have conservative or non-essential amino acid substitutions that have no substantial effect on their function. AAV serotype The AAV particles of the present disclosure can comprise or be derived from any natural or recombinant AAV serotype. According to the present disclosure, AAV particles include the following: VOY101, VOY201, AAVPHP.B (PHP.B), AAVPHP.A (PHP.A), AAVG2B-26, AAVG2B-13, AAVTH1.1-32, AAVTH1.1-35, AAVPHP.B2 (PHP.B2), AAVPHP.B3 (PHP.B3), AAVPHP.N / PHP.B-DGT, AAVPHP.B-EST, AAVPHP.B-GGT, AAVPHP.B -ATP, AAVPHP.B-ATT-T, AAVPHP.B-DGT-T, AAVPHP.B-GGT-T, AAVPHP.B-SGS, AAVPHP.B-AQP, AAVPHP.B-QQP, AAVPHP.B- SNP(3), AAVPHP.B-SNP, AAVPHP.B-QGT, AAVPHP.B-NQT, AAVPHP.B-EGS, AAVPHP.B-SGN, AAVPHP.B-EGT, AAVPHP.B-DST, A AVPHP.B-DST, AAVPHP.B-STP, AAVPHP.B-PQP, AAVPHP.B-SQP, AAVPHP.B-QLP, AAVPHP.B-TMP, AAVPHP.B-TTP, AAVPHP.S / G2A12, AAVG2A15 / G2A3(G2A3), AAVG2B4(G2B4), AAVG2B5(G2B5), PHP.S, AAV1, AAV2, AAV2G9, AAV3, AAV3a, AAV3b, AAV3 -3, AAV4, AAV4-4, AAV5, AAV6, AAV6.1, AAV6.2, AAV6.1.2, AAV7, AAV7.2, AAV8, AAV9, AAV9.11, AAV9.13, AAV9.16, AAV9 .24, AAV9.45, AAV9.47, AAV9.61, AAV9.68, AAV9.84, AAV9.9, AAV10, AAV11, AAV12, AAV16.3, AAV24.1, AAV27.3, AAV42.12、AAV42-1b、AAV42-2、AAV42-3a、AAV42-3b、AAV42-4、AAV42-5a、AAV42-5b、AAV42-6b、AAV42-8、AAV42-10、AAV42-11、AAV42-12、AAV42-13、AAV42-1 5、AAV42-aa、AAV43-1、AAV43-12、AAV43-20、AAV43-21、AAV43-23、AAV43-25、AAV43-5、AAV44.1、AAV44.2、AAV44.5、AAV223.1、AAV223.2、AAV223.4、AA V223.5、AAV223.6、AAV223.7、AAV1-7 / rh.48、AAV1-8 / rh.49、AAV2-15 / rh.62、AAV2-3 / rh.61、AAV2-4 / rh.50、AAV2-5 / rh.51、AAV3.1 / rh.6、AAV3.1 / rh.61 .9、AAV3-9 / rh.52、AAV3-11 / rh.53、AAV4-8 / r11.64、AAV4-9 / rh.54、AAV4-19 / rh.55、AAV5-3 / rh.57、AAV5-22 / rh.58、AAV7.3 / hu.7、AAV16.8 / hu.10 AV16.12 / hu.11、AAV29.3 / bb.1、AAV29.5 / bb.2、AAV106.1 / hu.37、AAV114.3 / hu.40、AAV127.2 / hu.41、AAV127.5 / hu.42、AAV128.3 / hu.44、AAV130.4 / hu.48、AAV145.1 / hu.53、AAV145.5 / hu.54、AAV145.6 / hu.55、AAV161.10 / hu.60、AAV161.6 / hu.61、AAV33.12 / hu.17、AAV33.4 / hu.15、AAV33.8 / hu.16、A AV52 / hu.19、AAV52.1 / hu.20、AAV58.2 / hu.25、AAVA3.3、AAVA3.4、AAVA3.5、AAVA3.7、AAVC1、AAVC2、AAVC5、AAV-DJ、AAV-DJ8、AAV3、AAV5、AAV2 rh.72、AAVhu.8、AAVrh.68、AAVrh.70、AAVpi.1、AAVpi.3、AAVpi.2、AAVrh.60、AAVrh.44、AAVrh.65、AAVrh.55、AAVrh.47、AAVrh.69、AAVrh.45、AAVrh.59、AAVhu.12、AAVH6、AAVLK03、AAVH-1 / hu.1、AAVH-5 / hu.3、AAVLG-10 / rh.40、AAVLG-4 / rh.38、AAVLG-9 / hu.39、AAV N721-8 / rh.43、AAVCh.5、AAVCh.5R1、AAVcy.2、AAVcy.3、AAVcy.4、AAVcy.5、AAVCy.5R1、AAVCy.5R2、AAVCy.5R3、AAVC y.5R4、AAVcy.6、AAVhu.1、AAVhu.2、AAVhu.3、AAVhu.4、AAVhu.5、AAVhu.6、AAVhu.7、AAVhu.9、AAVhu.10、AAVhu.11、 AAVhu.13、AAVhu.15、AAVhu.16、AAVhu.17、AAVhu.18、AAVhu.20、AAVhu.21、AAVhu.22、AAVhu.23.2、AAVhu.24、AAVhu .25、AAVhu.27、AAVhu.28、AAVhu.29、AAVhu.29R、AAVhu.31、AAVhu.32、AAVhu.34、AAVhu.35、AAVhu.37、AAVhu.39、A AVhu.40、AAVhu.41、AAVhu.42、AAVhu.43、AAVhu.44、AAVhu.44R1、AAVhu.44R2、AAVhu.44R3、AAVhu.45、AAVhu.46、AA Vhu.47、AAVhu.48、AAVhu.48R1、AAVhu.48R2、AAVhu.48R3、AAVhu.49、AAVhu.51、AAVhu.52、AAVhu.54、AAVhu.55、AA Vhu.56、AAVhu.57、AAVhu.58、AAVhu.60、AAVhu.61、AAVhu.63、AAVhu.64、AAVhu.66、AAVhu.67、AAVhu.14 / 9、AAVhu.t 19、AAVrh.2、AAVrh.2R、AAVrh.8、AAVrh.8R、AAVrh.10、AAVrh.12、AAVrh.13、AAVrh.13R、AAVrh.14、AAVrh.17、AAVrh.18、AAVrh.19、AA Vrh.20、AAVrh.21、AAVrh.22、AAVrh.23、AAVrh.24、AAVrh.25、AAVrh.31、AAVrh.32、AAVrh.33、AAVrh.34、AAVrh.35、AAVrh.36、AAVrh.37、AAVrh.37R2、AAVrh.38、AAVrh.39、AAVrh.40、AAVrh.46、AAVrh.48、AAVrh.48.1、AAVrh.48.1.2、AAVrh.48.2、AAVrh.49、AAVrh.51、AAVrh.52、AAVrh. rh.53、AAVrh.54、AAVrh.56、AAVrh.57、AAVrh.58、AAVrh.61、AAVrh.64、AAVrh.64R1、AAVrh.64R2、AAVrh.67、AAVrh.73、AAVrh.74、AAVrh.8R、AAVrh.8R. A586R mutation、AAVrh8R R533A mutation、AAAV、BAAV、ヤギAAV、ウシAAV、AAVhE1.1、AAVhEr1.5、AAVhER1.14、AAVhEr1.8、AAVhEr1.16、AAVhEr1.18、AAVhEr1.35、AAVhEr1.7、AAVhEr1.36、AAV hEr2.29、AAVhEr2.4、AAVhEr2.16、AAVhEr2.30、AAVhEr2.31、AAVhEr2.36、AAVhER1.23、AAVhEr3.1、AAV2.5T、AAV-PAEC、AAV-LK01、AAV-LK02、AAV-LK03 -LK04、AAV-LK05、AAV-LK06、AAV-LK07、AAV-LK08、AAV-LK09、AAV-LK10、AAV-LK11、AAV-LK12、AAV-LK13、AAV-LK14、AAV-LK15、AAV-LK16、AAV-LK17、AAV-LK1 8、AAV-LK19、AAV-PAEC2、AAV-PAEC4、AAV-PAEC6、AAV-PAEC7、AAV-PAEC8、AAV-PAEC11、AAV-PAEC12、AAV-2-premiRNA-101、AAV-8h、AAV-8b、AAV-h、AAV-b、AAV SM 10-2、AAVシャッフル100-1、AAVシャッフル100-3、AAVシャッフル100-7、AAVシャッフル10-6、AAVシャッフル10-8、AAV SM 10-1、AAV SM 10-8、AAV SM 100-3 100-10、BNP61 AAV、BNP62 AAV、BNP63 AAV、AAVrh.50、AAVrh.43、AAVrh.62, AAVrh.48, AAVhu.19, AAVhu.11, AAVhu.53, AAV4-8 / rh.64, AAVLG-9 / hu.39, AAV54.5 / hu.23, AAV54.2 / hu.22, AAV54.7 / hu.24, AAV54.1 / hu.21, AAV54.4R / hu.27, AAV46.2 / hu.28, AAV46.6 / hu.29, AAV128.1 / hu.43, True AAV (ttAAV), UPENN AAV 10, Japanese AAV serotype 10, AAV CBr-7.1, AAV CBr-7.10, AAV CBr-7.2, AAV CBr-7.3, AAV CBr-7.4, AAV CBr-7.5, AAV CBr-7.7, AAV CBr-7.8, AAV CBr-B7.3, AAV CBr-B7.4, AAV CBr-E1, AAV CBr-E2, AAV CBr-E3, AAV CBr-E4, AAV CBr-E5, AAV CBr-e5, AAV CBr-E6, AAV CBr-E7, AAV CBr-E8, AAV CHt-1, AAV CHt-2, AAV CHt-3, AAV CHt-6.1, AAV CHt-6.10, AAV CHt-6.5, AAV CHt-6.6, AAV CHt-6.7, AAV CHt-6.8、AAV CHt-P1、AAV CHt-P2、AAV CHt-P5、AAV CHt-P6、AAV CHt-P8、AAV CHt-P9、AAV CKd-1、AAV CKd-10、AAV CKd-2、AAV CKd-3、AAV CKd-4、AAV CKd-6、AAV CKd-7、AAV CKd-8、AAV CKd-B1、AAV CKd-B2、AAV CKd-B3、AAV CKd-B4、AAV CKd-B5、AAV CKd-B6、AAV CKd-B7、AAV CKd-B8、AAV CKd-H1、AAV CKd-H2、AAV CKd-H3、AAV CKd-H4、AAV CKd-H5、AAV CKd-H6、AAV CKd-N3、AAV CKd-N4、AAV CKd-N9、AAV CLg-F1、AAV CLg-F2、AAV CLg-F3、AAV CLg-F4、AAV CLg-F5、AAV CLg-F6、AAV CLg-F7、AAV CLg-F8、AAV CLv-1、AAV CLv1-1、AAV CLv1-10、AAV CLv1-2、AAV CLv-12、AAV CLv1-3、AAV CLv-13、AAV CLv1-4、AAV Clv1-7、AAV Clv1-8、AAV Clv1-9、AAV CLv-2、AAV CLv-3、AAV CLv-4、AAV CLv-6、AAV CLv-8、AAV CLv-D1、AAV CLv-D2、AAV CLv-D3、AAV CLv-D4、AAV CLv-D5、AAV CLv-D6、AAV CLv-D7、AAV CLv-D8、AAV CLv-E1、AAV CLv-K1、AAV CLv-K3、AAV CLv-K6、AAV CLv-L4、AAV CLv-L5、AAV C. Lv-L6, AAV CLv-M1, AAV CLv-M11, AAV CLv-M2, AAV CLv-M5, AAV CLv-M6, AAV CLv-M7, AAV CLv-M8, AAV CLv-M9, AAV CLv-R1, AAV CLv-R2, AAV CLv-R3, AAV CLv-R4, AAV CLv-R5, AAV CLv-R6, AAV CLv-R7, AAV CLv-R8, AAV CLv-R9, AAV CSp-1, AAV CSp-10, AAV CSp-11, AAV CSp-2, AAV CSp-3, AAV CSp-4, AAV CSp-6, AAV CSp-7, AAV CSp-8, AAV CSp-8.10, AAV CSp-8.2, AAV CSp-8.4, AAV CSp-8.5, AAV CSp-8.6, AAV CSp-8.7, AAV CSp-8.8, AAV CSp-8.9, AAV CSp-9, AAV.hu.48R3, AAV.VR-355, AAV3B, AAV4, AAV5, AAVF1 / HSC1, AAVF11 / HSC11, AAVF12 / HSC12, AAVF13 / HSC13, AAVF14 / HSC14, AAVF15 / HSC15, AAVF16 / HSC16, AAVF17 / HSC17, AAVF2 / HSC2, AAVF3 / HSC3, AAVF4 / HSC4, AAVF5 / HSC5, AAVF6 / HSC6, AAVF7 / HSC7, AAVF8 / HSC8 and / or AAVF9 / HSC9 and variants thereof, or may comprise a peptide.

[0195] In some embodiments, the AAV serotypes include sequences as set forth in U.S. Patent Application Publication No. 20030138772, the contents of which are incorporated herein by reference in their entirety, including but not limited to, AAV1 (SEQ ID NOs: 6 and 64 of U.S. Patent Application Publication No. 20030138772), AAV2 (SEQ ID NOs: 7 and 70 of U.S. Patent Application Publication No. 20030138772), AAV3 (SEQ ID NOs: 8 and 71 of U.S. Patent Application Publication No. 20030138772), AAV4 (SEQ ID NOs: 9 and 10 of U.S. Patent Application Publication No. 20030138772), AAV5 (SEQ ID NOs: 11 and 12 of U.S. Patent Application Publication No. 20030138772), AAV6 (SEQ ID NOs: 13 and 14 of U.S. Patent Application Publication No. 20030138772), AAV7 (SEQ ID NOs: 14 and 15 of U.S. Patent Application Publication No. 20030138772), AAV8 (SEQ ID NOs: 15 and 16 of U.S. Patent Application Publication No. 20030138772), AAV9 (SEQ ID NOs: 16 and 17 of U.S. Patent Application Publication No. 20030138772), AAV10 (SEQ ID NOs: 17 and 18 of U.S. Patent Application Publication No. 20030138772), AAV11 (SEQ ID NOs: 18 and 19 of U.S. Patent Application Publication No. 20030138772), AAV12 (SEQ ID NOs: 1 No. 63), AAV5 (SEQ ID NO: 114 in U.S. Patent Application Publication No. 20030138772), AAV6 (SEQ ID NO: 65 in U.S. Patent Application Publication No. 20030138772), AAV7 (SEQ ID NOs: 1 to 3 in U.S. Patent Application Publication No. 20030138772), AAV8 (SEQ ID NOs: 4 and 95 in U.S. Patent Application Publication No. 20030138772), AAV9 (SEQ ID NOs: 5 and 100 in U.S. Patent Application Publication No. 20030138772), AAV10 (SEQ ID NO: 117 in U.S. Patent Application Publication No. 20030138772), AAV1 AAV16.1 (US Patent Application Publication No. 20030138772, SEQ ID NO: 118), AAV12 (US Patent Application Publication No. 20030138772, SEQ ID NO: 119), AAVrh10 (amino acids 1 to 738 of SEQ ID NO: 81 in US Patent Application Publication No. 20030138772), AAV16.3 (US Patent Application Publication No. 20030138772, SEQ ID NO: 10), AAV29.3 / bb.1 (US Patent Application Publication No. 20030138772, SEQ ID NO: 11), AAV29.4 (US Patent Application Publication No. 20030138772, SEQ ID NO: No. 12), AAV29.5 / bb.2 (U.S. Patent Application Publication No. 20030138772, SEQ ID NO: 13), AAV1.3 (U.S. Patent Application Publication No. 20030138772, SEQ ID NO: 14), AAV13.3 (U.S. Patent Application Publication No. 20030138772, SEQ ID NO: 15), AAV24.1 (U.S. Patent Application Publication No. 20030138772, SEQ ID NO: 16), AAV27.3 (U.S. Patent Application Publication No. 20030138772, SEQ ID NO: 17), AAV7.2 (U.S. Patent Application Publication No. 20030138772, SEQ ID NO: 18),AAVC1 (US Patent Application Publication No. 20030138772, SEQ ID NO: 19), AAVC3 (US Patent Application Publication No. 20030138772, SEQ ID NO: 20), AAVC5 (US Patent Application Publication No. 20030138772, SEQ ID NO: 21), AAVF1 (US Patent Application Publication No. 20030138772, SEQ ID NO: 22), AAVF3 (US Patent Application Publication No. 20030138772, SEQ ID NO: 23), AAVF5 (US Patent Application Publication No. 20030138772, SEQ ID NO: 24), AAVH6 (US Patent Application Publication No. 20030138772, SEQ ID NO: 25), AAVF7 (US Patent Application Publication No. 20030138772, SEQ ID NO: 26), AAVF8 (US Patent Application Publication No. 20030138772, SEQ ID NO: 27), AAVF9 (US Patent Application Publication No. 20030138772, SEQ ID NO: 28), AAVF10 (US Patent Application Publication No. 20030138772, SEQ ID NO: 29), AAVF11 (US Patent Application Publication No. 20030138772, SEQ ID NO: 30), AAVF12 (US Patent Application Publication No. 20030138772, SEQ ID NO: 31), AAVF13 (US Patent Application Publication No. 20030138772, SEQ ID NO: 32), AAVF14 (US Patent Application Publication No. 20030138772, SEQ ID NO: 33), AAVF15 (US Patent Application Publication No No. 38772, SEQ ID NO: 25), AAVH2 (U.S. Patent Application Publication No. 20030138772, SEQ ID NO: 26), AAV42-8 (U.S. Patent Application Publication No. 20030138772, SEQ ID NO: 27), AAV42-15 (U.S. Patent Application Publication No. 20030138772, SEQ ID NO: 28), AAV42-5b (U.S. Patent Application Publication No. 20030138772, SEQ ID NO: 29), AAV42-1b (U.S. Patent Application Publication No. 20030138772, SEQ ID NO: 30), AAV42-13 (U.S. Patent Application Publication No. 20030138772, SEQ ID NO: 31), AAV42-14 (U.S. Patent Application Publication No. 20030138772, SEQ ID NO: 32), AAV42-15 (U.S. Patent Application Publication No. 20030138772, SEQ ID NO: 33), AAV42-5b (U.S. Patent Application Publication No. 20030138772, SEQ ID NO: 34), AAV42-1b (U.S. Patent Application Publication No. 20030138772, SEQ ID NO: 35), AAV42-13 (U.S. Patent Application Publication No. 20030138772, SEQ ID NO: 36), AAV42-15 (U.S. Patent Application Publication No. 20030138772, SEQ ID NO: 37), AAV42-5b (U.S. Patent Application Publication No. 20030138772 SEQ ID NO: 31), AAV42-3a (US Patent Application Publication No. 20030138772, SEQ ID NO: 32), AAV42-4 (US Patent Application Publication No. 20030138772, SEQ ID NO: 33), AAV42-5a (US Patent Application Publication No. 20030138772, SEQ ID NO: 34), AAV42-10 (US Patent Application Publication No. 20030138772, SEQ ID NO: 35), AAV42-3b (US Patent Application Publication No. 20030138772, SEQ ID NO: 36), AAV42-11 (US Patent Application Publication No. 20030138772, SEQ ID NO: 37), AAV42-3b (US Patent Application Publication No. 20030138772, SEQ ID NO: 38), AAV42-11 (US Patent Application Publication No. 20030138772, SEQ ID NO: 39), AAV42-3c (US Patent Application Publication No. 20030138772, SEQ ID NO: 40), AAV42-3d (US Patent Application Publication No. 20030138772, SEQ ID NO: 41), AAV42-3e (US Patent Application Publication No. 20030138772, SEQ ID NO: 42), AAV42-3f (US Patent Application Publication No. 20030138772, SEQ ID NO: 43), AAV42-3g (US Patent Application Publication No. 20030138772, SEQ ID NO: 44), AAV42-3h (US Patent Application Publication No. 20030138772, SEQ ID NO: 45 No. 37), AAV42-6b (US Patent Application Publication No. 20030138772, SEQ ID NO: 38), AAV43-1 (US Patent Application Publication No. 20030138772, SEQ ID NO: 39), AAV43-5 (US Patent Application Publication No. 20030138772, SEQ ID NO: 40), AAV43-12 (US Patent Application Publication No. 20030138772, SEQ ID NO: 41), AAV43-20 (US Patent Application Publication No. 20030138772, SEQ ID NO: 42), AAV43-21 (US Patent Application Publication No. 20030138772, SEQ ID NO: 43),AAV43-23 (US Patent Application Publication No. 20030138772, SEQ ID NO: 44), AAV43-25 (US Patent Application Publication No. 20030138772, SEQ ID NO: 45), AAV44.1 (US Patent Application Publication No. 20030138772, SEQ ID NO: 46), AAV44.5 (US Patent Application Publication No. 20030138772, SEQ ID NO: 47), AAV223.1 (US Patent Application Publication No. AAV223.2 (US Patent Application Publication No. 20030138772, SEQ ID NO: 48), AAV223.2 (US Patent Application Publication No. 20030138772, SEQ ID NO: 49), AAV223.4 (US Patent Application Publication No. 20030138772, SEQ ID NO: 50), AAV223.5 (US Patent Application Publication No. 20030138772, SEQ ID NO: 51), AAV223.6 (US Patent Application Publication No. 20030138772, SEQ ID NO: 52), AAV223.7 (US Patent Application Publication No. 20030138772, SEQ ID NO: 53), AAV223.8 (US Patent Application Publication No. 20030138772, SEQ ID NO: 54), AAV223.9 (US Patent Application Publication No. 20030138772, SEQ ID NO: 55), AAV223.10 (US Patent Application Publication No. 20030138772, SEQ ID NO: 56), AAV223.11 (US Patent Application Publication No. 20030138772, SEQ ID NO: 57), AAV223.12 (US Patent Application Publication No. 20030138772, SEQ ID NO: 58), AAV223.13 (US Patent Application Publication No. 20030138772, SEQ ID NO: 59), AAV223.14 (US Patent Application Publication No. 20030138772, SEQ ID NO: 60), AAV223.15 (US Patent Application Publication No. 20030138772, SEQ ID NO: 61), A SEQ ID NO: 52), AAV223.7 (US Patent Application Publication No. 20030138772, SEQ ID NO: 53), AAVA3.4 (US Patent Application Publication No. 20030138772, SEQ ID NO: 54), AAVA3.5 (US Patent Application Publication No. 20030138772, SEQ ID NO: 55), AAVA3.7 (US Patent Application Publication No. 20030138772, SEQ ID NO: 56), AAVA3.3 (US Patent Application Publication No. 20030138772, SEQ ID NO: 57), AAV42.12 (US Patent Application Publication No. 20030138772, SEQ ID NO: 58), AAV44.2 (US Patent Application Publication No. 20030138772, SEQ ID NO: 59), AAV42-2 (US Patent Application Publication No. 20030138772, SEQ ID NO: 9), or a variant thereof, etc.

[0196] In some embodiments, the AAV serotypes include sequences as described in U.S. Patent Application Publication No. 20150159173, the contents of which are incorporated herein by reference in their entirety, including but not limited to, AAV2 (SEQ ID NOs: 7 and 23 of U.S. Patent Application Publication No. 20150159173), rh20 (SEQ ID NO: 1 of U.S. Patent Application Publication No. 20150159173), rh32 / 33 (SEQ ID NO: 1 of U.S. Patent Application Publication No. 20150159173), rh40 (SEQ ID NO: 1 of U.S. Patent Application Publication No. 20150159173), rh50 (SEQ ID NO: 1 of U.S. Patent Application Publication No. 20150159173), rh60 (SEQ ID NO: 1 of U.S. Patent Application Publication No. 20150159173), rh70 (SEQ ID NO: 1 of U.S. Patent Application Publication No. 20150159173), rh80 (SEQ ID NO: 1 of U.S. Patent Application Publication No. 20150159173), rh90 (SEQ ID NO: 1 of U.S. Patent Application Publication No. 20150159173), rh10 (SEQ ID NO: 1 of U.S. Patent Application Publication No. 20150159173), rh11 (SEQ ID NO: 1 of U.S. Patent Application Publication No. 20150159173), rh20 (SEQ ID NO: 1 of U.S. Patent Application Publication No. 20150159173), rh32 / 33 (SEQ ID NO: 1 of U.S. Patent Application Publication No. No. 159173), rh39 (SEQ ID NOs: 3, 20, and 36 in U.S. Patent Application Publication No. 20150159173), rh46 (SEQ ID NOs: 4 and 22 in U.S. Patent Application Publication No. 20150159173), rh73 (SEQ ID NO: 5 in U.S. Patent Application Publication No. 20150159173), rh74 (SEQ ID NO: 6 in U.S. Patent Application Publication No. 20150159173), AAV6.1 (U.S. Patent Application Publication No. 20150159173), No. 20150159173), rh.8 (SEQ ID NO: 29 in U.S. Patent Application Publication No. 20150159173), rh.48.1 (SEQ ID NO: 44 in U.S. Patent Application Publication No. 20150159173), hu.44 (SEQ ID NO: 45 in U.S. Patent Application Publication No. 20150159173), hu.29 (SEQ ID NO: 42 in U.S. Patent Application Publication No. 20150159173), hu.48 (U.S. U.S. Patent Application Publication No. 20150159173, SEQ ID NO: 38), rh54 (U.S. Patent Application Publication No. 20150159173, SEQ ID NO: 49), AAV2 (U.S. Patent Application Publication No. 20150159173, SEQ ID NO: 7), cy.5 (U.S. Patent Application Publication No. 20150159173, SEQ ID NO: 8 and 24), rh.10 (U.S. Patent Application Publication No. 20150159173, SEQ ID NO: 9 and 25), rh.13 (SEQ ID NOs: 10 and 26 in U.S. Patent Application Publication No. 20150159173), AAV1 (SEQ ID NOs: 11 and 27 in U.S. Patent Application Publication No. 20150159173), AAV3 (SEQ ID NOs: 12 and 28 in U.S. Patent Application Publication No. 20150159173), AAV6 (SEQ ID NOs: 13 and 29 in U.S. Patent Application Publication No. 20150159173), AAV7 (SEQ ID NOs: 14 and 30 in U.S. Patent Application Publication No. 20150159173), AAV8 (SEQ ID NOs: 15 and 26 in U.S. Patent Application Publication No. 20150159173), AAV9 (SEQ ID NOs: 16 and 27 in U.S. Patent Application Publication No. 20150159173), AAV10 (SEQ ID NOs: 17 and 28 in U.S. Patent Application Publication No. 20150159173), AAV11 (SEQ ID NOs: 18 and 29 in U.S. Patent Application Publication No. 20150159173), AAV12 (SEQ ID NOs: 19 and 30 in U.S. Patent Application Publication No. 20150159173), AAV13 (SEQ ID NOs: 20 and 26 in U.S. Patent Application Publication No. 20150159173), AAV14 (SEQ ID NOs: 20 and 27 in U.S. Patent Application Publication No. 20150159173), AAV15 (SEQ ID NOs: 20 and 28 in U.S. Patent Application Publication 15 and 31), hu.13 (SEQ ID NOs: 16 and 32 of U.S. Patent Application Publication No. 20150159173), hu.26 (SEQ ID NOs: 17 and 33 of U.S. Patent Application Publication No. 20150159173), hu.37 (SEQ ID NOs: 18 and 34 of U.S. Patent Application Publication No. 20150159173), hu.53 (SEQ ID NOs: 19 and 35 of U.S. Patent Application Publication No. 20150159173), rh.43 (SEQ ID NOs: 21 and 37 of U.S. Patent Application Publication No. 20150159173), rh2 (U.S. Patent Application Publication No. 20150159173), and rh3 (U.S. Patent Application Publication No. 20150159173). No. 20150159173), rh.37 (SEQ ID NO: 39 in U.S. Patent Application Publication No. 20150159173), rh.37 (SEQ ID NO: 40 in U.S. Patent Application Publication No. 20150159173), rh.64 (SEQ ID NO: 43 in U.S. Patent Application Publication No. 20150159173), rh.48 (SEQ ID NO: 44 in U.S. Patent Application Publication No. 20150159173), ch.5 (SEQ ID NO: 46 in U.S. Patent Application Publication No. 20150159173), rh.67 (SEQ ID NO: 47 in U.S. Patent Application Publication No. 20150159173), rh.58 (U.S. Patent Application Publication No. and SEQ ID NO: 48 of the specification of US Patent Application Publication No. 20150159173, or variants thereof, including but not limited to Cy5R1, Cy5R2, Cy5R3, Cy5R4, rh.13R, rh.37R2, rh.2R, rh.8R, rh.48.1, rh.48.2, rh.48.1.2, hu.44R1, hu.44R2, hu.44R3, hu.29R, ch.5R1, rh64R1, rh64R2, AAV6.2, AAV6.1, AAV6.12, hu.48R1, hu.48R2, and hu.48R3.

[0197] In some embodiments, the AAV serotype may be or have a sequence as described in U.S. Pat. No. 7,198,951 (the contents of which are incorporated herein by reference in their entirety), including, but not limited to, AAV9 (SEQ ID NOs: 1-3 of U.S. Pat. No. 7,198,951), AAV2 (SEQ ID NO: 4 of U.S. Pat. No. 7,198,951), AAV1 (SEQ ID NO: 5 of U.S. Pat. No. 7,198,951), AAV3 (SEQ ID NO: 6 of U.S. Pat. No. 7,198,951), and AAV8 (SEQ ID NO: 7 of U.S. Pat. No. 7,198,951).

[0198] In some embodiments, the AAV serotype can be or have mutations in the AAV9 sequence as described by N. Pulicherla et al. (Molecular Therapy, Vol. 19, No. 6, pp. 1070-1078, 2011, which is incorporated by reference in its entirety), including, but not limited to, AAV9.9, AAV9.11, AAV9.13, AAV9.16, AAV9.24, AAV9.45, AAV9.47, AAV9.61, AAV9.68, AAV9.84, etc.

[0199] In some embodiments, the AAV serotype may be or may have a sequence as described in U.S. Pat. No. 6,156,303 (the contents of which are incorporated herein by reference in their entirety), such as, but not limited to, AAV3B (SEQ ID NOs: 1 and 10 of U.S. Pat. No. 6,156,303), AAV6 (SEQ ID NOs: 2, 7, and 11 of U.S. Pat. No. 6,156,303), AAV2 (SEQ ID NOs: 3 and 8 of U.S. Pat. No. 6,156,303), AAV3A (SEQ ID NOs: 4 and 9 of U.S. Pat. No. 6,156,303), or derivatives thereof.

[0200] In some embodiments, the AAV serotype may be or have a sequence as described in U.S. Patent Application Publication No. 20140359799 (the contents of which are incorporated herein by reference in their entirety), such as, but not limited to, AAV8 (SEQ ID NO: 1 of U.S. Patent Application Publication No. 20140359799), AAVDJ (SEQ ID NOs: 2 and 3 of U.S. Patent Application Publication No. 20140359799), or variants thereof.

[0201] In some embodiments, the serotype can be AAVDJ or a variant thereof, such as AAVDJ8 (or AAV-DJ8), as described by Grimm et al., Journal of Virology, Vol. 82, No. 12, pp. 5887-5911, 2008 (incorporated herein by reference in its entirety). The amino acid sequence of AAVDJ8 can include two or more mutations to remove the heparin-binding domain (HBD). As a non-limiting example, the AAV-DJ sequence set forth as SEQ ID NO:1 in U.S. Pat. No. 7,588,772 (the contents of which are incorporated herein by reference in their entirety) can contain two mutations: (1) R587Q (arginine (R; Arg) at amino acid position 587 is changed to glutamine (Q; Gln)) and (2) R590T (arginine (R; Arg) at amino acid position 590 is changed to threonine (T; Thr)). Another non-limiting example may include three mutations: (1) K406R (lysine (K; Lys) at amino acid position 406 is changed to arginine (R; Arg)), (2) R587Q (arginine (R; Arg) at amino acid position 587 is changed to glutamine (Q; Gln)), and (3) R590T (arginine (R; Arg) at amino acid position 590 is changed to threonine (T; Thr)).

[0202] In some embodiments, the AAV serotype may be or have the sequence of AAV4 as described in WO1998011244 (the contents of which are incorporated by reference in their entirety), such as, but not limited to, AAV4 (SEQ ID NOs: 1-20 of WO1998011244).

[0203] In some embodiments, the AAV serotype may be or may have a mutation in the AAV2 sequence such that AAV2G9 is generated as described in WO2014144229 (and incorporated herein by reference in its entirety).

[0204] In some embodiments, the AAV serotypes include sequences as described in WO2005033321 (the contents of which are incorporated herein by reference in their entirety), including but not limited to, AAV3-3 (SEQ ID NO: 217 in WO2005033321), AAV1 (SEQ ID NOs: 219 and 202 in WO2005033321), AAV106.1 / hu.37 (SEQ ID NO: 10 in WO2005033321), AAV114.3 / hu.40 (SEQ ID NO: 11 in WO2005033321), AAV114.3 / hu.40 (SEQ ID NO: 12 in WO2005033321), AAV115.3 / hu.40 (SEQ ID NO: 13 in WO2005033321), AAV116.1 / hu.37 (SEQ ID NO: 14 in WO2005033321), AAV117.1 / hu.40 (SEQ ID NO: 15 in WO2005033321), AAV118.1 / hu.40 (SEQ ID NO: 16 in WO2005033321), AAV119.1 / hu.40 (SEQ ID NO: 17 in WO2005033321), AAV119.1 / hu.40 (SEQ ID NO: 18 in WO2005033321), AAV119.1 / hu.40 (SEQ ID NO: 19 ... AAV127.2 / hu.41 (SEQ ID NOs: 6 and 8 in WO 2005033321), AAV128.3 / hu.44 (SEQ ID NO: 81 in WO 2005033321), AAV130.4 / hu.48 (SEQ ID NO: 78 in WO 2005033321), AAV145.1 / hu.53 (SEQ ID NOs: 176 and 177 in WO 2005033321), AAV145.6 / hu.56 (SEQ ID NO: 1 ... Nos. 168 and 192), AAV16.12 / hu.11 (SEQ ID NOs. 153 and 57 in WO 2005033321), AAV16.8 / hu.10 (SEQ ID NOs. 156 and 56 in WO 2005033321), AAV161.10 / hu.60 (SEQ ID NO: 170 in WO 2005033321), AAV161.6 / hu.61 (SEQ ID NO: 174 in WO 2005033321), AAV1-7 / rh.48 (SEQ ID NO: 176 in WO 2005033321), AAV1-7 / rh.48 (SEQ ID NO: 178 in WO 2005033321), AAV1-7 / rh.48 (SEQ ID NO: 179 in WO 2005033321), AAV1-7 / rh.48 (SEQ ID NO: 180 in WO 2005033321), AAV1-7 / rh.48 (SEQ ID NO: 181 in WO 2005033321), AAV1-7 / rh.48 (SEQ ID NO: 182 in WO 2005033321), AAV1-7 / rh.48 (SEQ ID NO: 183 in WO 2005033321), AAV1-7 / rh.48 (SEQ ID NO: 184 in WO 2005033321), AAV1-7 / rh.48 (SEQ ID NO: 185 in WO 2005033321), AAV1-7 / rh.48 (SEQ ID NO: 186 in WO 2 32), AAV1-8 / rh.49 (SEQ ID NOs: 103 and 25 in WO 2005033321), AAV2 (SEQ ID NOs: 211 and 221 in WO 2005033321), AAV2-15 / rh.62 (SEQ ID NOs: 33 and 114 in WO 2005033321), AAV2-3 / rh.61 (SEQ ID NO: 21 in WO 2005033321), AAV2-4 / rh.50 (SEQ ID NOs: 23 and 108 in WO 2005033321), AAV2-5 / rh.AAV3.1 / hu.51 (SEQ ID NOs: 104 and 22 in WO 2005033321), AAV3.1 / hu.6 (SEQ ID NOs: 5 and 84 in WO 2005033321), AAV3.1 / hu.9 (SEQ ID NOs: 155 and 58 in WO 2005033321), AAV3-11 / rh.53 (SEQ ID NOs: 186 and 176 in WO 2005033321), AAV3-3 (SEQ ID NO: 200 in WO 2005033321), AAV3.12 / hu.1 7 (SEQ ID NO: 4 in WO 2005033321), AAV33.4 / hu.15 (SEQ ID NO: 50 in WO 2005033321), AAV33.8 / hu.16 (SEQ ID NO: 51 in WO 2005033321), AAV3-9 / rh.52 (SEQ ID NOs: 96 and 18 in WO 2005033321), AAV4-19 / rh.55 (SEQ ID NO: 117 in WO 2005033321), AAV4-4 (SEQ ID NO: 117 in WO 2005033321), AAV4-5 / rh.52 (SEQ ID NO: 117 in WO 2005033321), AAV4-6 / rh.52 (SEQ ID NO: 117 in WO 2005033321), AAV4-7 / rh.52 (SEQ ID NO: 117 in WO 2005033321), AAV4-8 / rh.52 (SEQ ID NO: 117 in WO 2005033321), AAV4-9 / rh.52 (SEQ ID NO: 117 in WO 2005033321), AAV4-19 / rh.52 (SEQ ID NO: 117 in WO 2005033321), AAV4-4 ... 21), AAV4-9 / rh.54 (SEQ ID NO: 116 in WO 2005033321), AAV5 (SEQ ID NO: 199 and 216 in WO 2005033321), AAV52.1 / hu.20 (SEQ ID NO: 63 in WO 2005033321), AAV52 / hu.19 (SEQ ID NO: 133 in WO 2005033321), AAV5-22 / rh.58 (W ... SEQ ID NO: 27 in WO 2005033321), AAV5-3 / rh.57 (SEQ ID NO: 105 in WO 2005033321), AAV5-3 / rh.57 (SEQ ID NO: 26 in WO 2005033321), AAV58.2 / hu.25 (SEQ ID NO: 49 in WO 2005033321), AAV6 (SEQ ID NOs: 203 and 220 in WO 2005033321), AAV7 (SEQ ID NOs: 222 and 213 in WO 2005033321), AAV7.3 / hu.7 (SEQ ID NO: 55 in WO 2005033321), AAV8 (SEQ ID NOs: 223 and 214 in WO 2005033321), AAVH-1 / hu.1 (SEQ ID NO: 46 in WO 2005033321), AAVH-5 / hu.3 (SEQ ID NO: 44 in WO 2005033321), AAVhu.1 (SEQ ID NO: 144 in WO 2005033321), AAVhu.10 (SEQ ID NO: 156 in WO 2005033321), AAVhu. AAVhu.11 (SEQ ID NO: 153 in WO 2005033321), AAVhu.12 (SEQ ID NO: 59 in WO 2005033321), AAVhu.13 (SEQ ID NO: 129 in WO 2005033321), AAVhu.14 / AAV9 (SEQ ID NOs: 123 and 3 in WO 2005033321), AAVhu.15 (SEQ ID NO: 147 in WO 2005033321), AAVhu.16 (SEQ ID NO: 148 in WO 2005033321), AA Vhu.17 (SEQ ID NO: 83 in WO 2005033321), AAVhu.18 (SEQ ID NO: 149 in WO 2005033321), AAVhu.19 (SEQ ID NO: 133 in WO 2005033321), AAVhu.2 (SEQ ID NO: 143 in WO 2005033321), AAVhu.20 (SEQ ID NO: 134 in WO 2005033321), AAVhu.21 (SEQ ID NO: 135 in WO 2005033321), AAVhu. 22 (SEQ ID NO: 138 in WO 2005033321), AAVhu.23.2 (SEQ ID NO: 137 in WO 2005033321), AAVhu.24 (SEQ ID NO: 136 in WO 2005033321), AAVhu.25 (SEQ ID NO: 146 in WO 2005033321), AAVhu.27 (SEQ ID NO: 140 in WO 2005033321), AAVhu.29 (SEQ ID NO: 132 in WO 2005033321), AAVhu.3 (SEQ ID NO: 145 in WO 2005033321), AAVhu.31 (SEQ ID NO: 121 in WO 2005033321), AAVhu.32 (SEQ ID NO: 122 in WO 2005033321), AAVhu.34 (SEQ ID NO: 125 in WO 2005033321), AAVhu.35 (SEQ ID NO: 164 in WO 2005033321), AAVhu.37 (SEQ ID NO: 88 in WO 2005033321), AAVhu. AAVhu.39 (SEQ ID NO: 102 in WO 2005033321), AAVhu.4 (SEQ ID NO: 141 in WO 2005033321), AAVhu.40 (SEQ ID NO: 87 in WO 2005033321), AAVhu.41 (SEQ ID NO: 91 in WO 2005033321), AAVhu.42 (SEQ ID NO: 85 in WO 2005033321), AAVhu.43 (SEQ ID NO: 160 in WO 2005033321), AAVhu.44 ( AAVhu.45 (SEQ ID NO: 144 in WO 2005033321), AAVhu.46 (SEQ ID NO: 159 in WO 2005033321), AAVhu.47 (SEQ ID NO: 128 in WO 2005033321), AAVhu.48 (SEQ ID NO: 157 in WO 2005033321), AAVhu.49 (SEQ ID NO: 189 in WO 2005033321), AAVhu.5 1 (SEQ ID NO: 190 in WO 2005033321), AAVhu.52 (SEQ ID NO: 191 in WO 2005033321), AAVhu.53 (SEQ ID NO: 186 in WO 2005033321), AAVhu.54 (SEQ ID NO: 188 in WO 2005033321), AAVhu.55 (SEQ ID NO: 187 in WO 2005033321), AAVhu.56 (SEQ ID NO: 192 in WO 2005033321), AAVhu.AAVhu.57 (SEQ ID NO: 193 in WO 2005033321), AAVhu.58 (SEQ ID NO: 194 in WO 2005033321), AAVhu.6 (SEQ ID NO: 84 in WO 2005033321), AAVhu.60 (SEQ ID NO: 184 in WO 2005033321), AAVhu.61 (SEQ ID NO: 185 in WO 2005033321), AAVhu.63 (SEQ ID NO: 195 in WO 2005033321), AAVhu.64 ( AAVhu.66 (SEQ ID NO: 197 in WO 2005033321), AAVhu.67 (SEQ ID NO: 198 in WO 2005033321), AAVhu.7 (SEQ ID NO: 150 in WO 2005033321), AAVhu.8 (SEQ ID NO: 12 in WO 2005033321), AAVhu.9 (SEQ ID NO: 155 in WO 2005033321), AAVLG-10 / rh.40 ( AAVN721-8 / rh.43 (SEQ ID NO: 163 in WO 2005033321), AAVN721-8 / rh.43 (SEQ ID NO: 43 in WO 2005033321), AAVpi.1 (SEQ ID NO: 14 in WO 2005033321), AAVLG-4 / rh.38 (SEQ ID NO: 86 in WO 2005033321), AAVLG-4 / rh.38 (SEQ ID NO: 7 in WO 2005033321), AAVN721-8 / rh.43 (SEQ ID NO: 163 in WO 2005033321), AAVN721-8 / rh.43 (SEQ ID NO: 43 in WO 2005033321), AAVpi.1 (SEQ ID NO: 16 ... No. 28), AAVpi.2 (SEQ ID NO: 30 in WO 2005033321), AAVpi.3 (SEQ ID NO: 29 in WO 2005033321), AAVrh.38 (SEQ ID NO: 86 in WO 2005033321), AAVrh.40 (SEQ ID NO: 92 in WO 2005033321), AAVrh.43 (SEQ ID NO: 163 in WO 2005033321), AAVrh.44 (SEQ ID NO: 34 in WO 2005033321), AAVrh.AAVrh.45 (WO 2005033321, SEQ ID NO: 41), AAVrh.47 (WO 2005033321, SEQ ID NO: 38), AAVrh.48 (WO 2005033321, SEQ ID NO: 115), AAVrh.49 (WO 2005033321, SEQ ID NO: 103), AAVrh.50 (WO 2005033321, SEQ ID NO: 108), and AAVrh.51 (WO 2005033321, SEQ ID NO: 109). AAVrh.52 (SEQ ID NO: 96 in WO 2005033321), AAVrh.53 (SEQ ID NO: 97 in WO 2005033321), AAVrh.55 (SEQ ID NO: 37 in WO 2005033321), AAVrh.56 (SEQ ID NO: 152 in WO 2005033321), AAVrh.57 (SEQ ID NO: 161 in WO 2005033321), AAVrh.58 (SEQ ID NO: 162 in WO 2005033321), AAVrh.59 (SEQ ID NO: 163 in WO 2005033321), AAVrh.50 (SEQ ID NO: 164 in WO 2005033321), AAVrh.51 (SEQ ID NO: 164 in WO 2005033321), AAVrh.52 (SEQ ID NO: 96 in WO 2005033321), AAVrh.53 (SEQ ID NO: 97 in WO 2005033321), AAVrh.55 (SEQ ID NO: 37 in WO 2005033321), AAVrh.56 (SEQ ID NO: 152 in WO 2005033321), AAVrh.57 (SEQ ID NO: 164 in WO 2005033321), AAVrh.58 (SEQ ID NO: 164 in WO 2005033321), AAVrh.59 (SEQ ID NO: 164 in WO 2005033321), AAVrh.50 (SEQ ID NO: 164 in WO 2 AAVrh.58 (SEQ ID NO: 106 in WO 2005033321), AAVrh.59 (SEQ ID NO: 42 in WO 2005033321), AAVrh.60 (SEQ ID NO: 31 in WO 2005033321), AAVrh.61 (SEQ ID NO: 107 in WO 2005033321), AAVrh.62 (SEQ ID NO: 109 in WO 2005033321), AAVrh.63 (SEQ ID NO: 106 in WO 2005033321), AAVrh.64 (SEQ ID NO: 109 in WO 2005033321), AAVrh.65 (SEQ ID NO: 109 in WO 2005033321), AAVrh.66 (SEQ ID NO: 109 in WO 2005033321), AAVrh.67 (SEQ ID NO: 109 in WO 2005033321), AAVrh.68 (SEQ ID NO: 109 in WO 2005033321), AAVrh.69 (SEQ ID NO: 109 in WO 2005033321), AAVrh.70 (SEQ ID NO: 109 in WO 2005033321), AAVrh.71 (SEQ ID NO: 109 in WO 2005033321), AAVrh.72 (SEQ ID NO: 109 in WO 2005033321), AAVrh.73 (SEQ ID NO: 109 in WO 2005033321), AAVrh.74 (SEQ ID NO: 109 in AAVrh.64 (SEQ ID NO: 114 in WO 2005033321), AAVrh.64 (SEQ ID NO: 99 in WO 2005033321), AAVrh.65 (SEQ ID NO: 35 in WO 2005033321), AAVrh.68 (SEQ ID NO: 16 in WO 2005033321), AAVrh.69 (SEQ ID NO: 39 in WO 2005033321), AAVrh.70 (SEQ ID NO: 10 in WO 2005033321), AAVrh.71 (SEQ ID NO: 11 in WO 2005033321), AAVrh.72 (SEQ ID NO: 11 in WO 2005033321), AAVrh.73 (SEQ ID NO: 11 in WO 2005033321), AAVrh.74 (SEQ ID NO: 11 in WO 2005033321), AAVrh.75 (SEQ ID NO: 11 in WO 2005033321), AAVrh.76 (SEQ ID NO: 11 in WO 2005033321), AAVrh.77 (SEQ ID NO: 11 in WO 2005033321), AAVrh.78 (SEQ ID NO: 11 in WO 2005033321), AAVrh.79 (SEQ ID NO: 39 in WO 2005033321), AAVrh.70 (SEQ ID NO: 11 in WO 2005033321), AAVrh.79 (SEQ ID NO: 39 in WO 2005033321), 321 SEQ ID NO:20), AAVrh.72 (WO2005033321 SEQ ID NO:9), or variants thereof including but not limited to AAVcy.2, AAVcy.3, AAVcy.4, AAVcy.5, AAVcy.6, AAVrh.12, AAVrh.17, AAVrh.18, AAVrh.19, AAVrh.21, AAVrh.22, AAVrh.23, AAVrh.24, AAVrh.25, AAVrh.25 / 42 15, AAVrh.31, AAVrh.32, AAVrh.33, AAVrh.34, AAVrh.35, AAVrh.36, AAVrh.37, AAVrh14, and the like.Non-limiting examples of variants include SEQ ID NOs: 13, 15, 17, 19, 24, 36, 40, 45, 47, 48, 51-54, 60-62, 64-77, 79, 80, 82, 89, 90, 93-95, 98, 100, 101, 109-113, 118-120, 124, 126, 131, 139, 142, 151, 154, 158, 161, 162, 165-183, 202, 204-212, 215, 219, 224-236 of WO2005033321, the contents of which are incorporated herein by reference in their entirety.

[0205] In some embodiments, the AAV serotype may be or have a sequence as described in WO2015168666 (the contents of which are incorporated by reference in their entirety), such as, but not limited to, AAVrh8R (SEQ ID NO: 9 in WO2015168666), AAVrh8R A586R mutant (SEQ ID NO: 10 in WO2015168666), AAVrh8R R533A mutant (SEQ ID NO: 11 in WO2015168666), or variants thereof.

[0206] In some embodiments, the AAV serotypes include sequences as described in U.S. Pat. No. 9,233,131 (the contents of which are incorporated herein by reference in their entirety), including but not limited to, AAVhE1.1 (SEQ ID NO: 44 in U.S. Pat. No. 9,233,131), AAVhEr1.5 (SEQ ID NO: 45 in U.S. Pat. No. 9,233,131), AAVhER1.14 (SEQ ID NO: 46 in U.S. Pat. No. 9,233,131), AAVhEr1.5 (SEQ ID NO: 47 in U.S. Pat. No. 9,233,131), AAVhER1.14 (SEQ ID NO: 48 in U.S. Pat. No. 9,233,131), AAVhER1.15 (SEQ ID NO: 49 in U.S. Pat. No. 9,233,131), AAVhER1.16 (SEQ ID NO: 50 in U.S. Pat. No. 9,233,131), AAVhER1.17 (SEQ ID NO: 51 in U.S. Pat. No. 9,233,131), AAVhER1.18 (SEQ ID NO: 52 in U.S. Pat. No. 9,233,131), AAVhER1.19 (SEQ ID NO: 53 in U.S. Pat. No. 9,233,131), AAVhER1.20 (SEQ ID NO: 54 in U.S. Pat. No. 9,233,131), AAVhER1.21 (SEQ ID NO: 55 in U.S. Pat. No. 9,233,131), AAVhER1.22 (SEQ ID ), AAVhEr1.8 (SEQ ID NO: 47 in U.S. Pat. No. 9,233,131), AAVhEr1.16 (SEQ ID NO: 48 in U.S. Pat. No. 9,233,131), AAVhEr1.18 (SEQ ID NO: 49 in U.S. Pat. No. 9,233,131), AAVhEr1.35 (SEQ ID NO: 50 in U.S. Pat. No. 9,233,131), AAVhEr1.7 (SEQ ID NO: 51 in U.S. Pat. No. 9,233,131), AAVhEr1. .36 (SEQ ID NO: 52 in U.S. Pat. No. 9,233,131), AAVhEr2.29 (SEQ ID NO: 53 in U.S. Pat. No. 9,233,131), AAVhEr2.4 (SEQ ID NO: 54 in U.S. Pat. No. 9,233,131), AAVhEr2.16 (SEQ ID NO: 55 in U.S. Pat. No. 9,233,131), AAVhEr2.30 (SEQ ID NO: 56 in U.S. Pat. No. 9,233,131), AAVhEr2.31 (U.S. Pat. No. No. 9,233,131), AAVhEr2.36 (SEQ ID NO: 58 in U.S. Pat. No. 9,233,131), AAVhER1.23 (SEQ ID NO: 53 in U.S. Pat. No. 9,233,131), AAVhEr3.1 (SEQ ID NO: 59 in U.S. Pat. No. 9,233,131), AAV2.5T (SEQ ID NO: 42 in U.S. Pat. No. 9,233,131), or a variant thereof.

[0207] In some embodiments, the AAV serotypes include sequences as described in U.S. Patent Application Publication No. 20150376607, the contents of which are incorporated herein by reference in their entirety, including but not limited to, AAV-PAEC (SEQ ID NO: 1 in U.S. Patent Application Publication No. 20150376607), AAV-LK01 (SEQ ID NO: 2 in U.S. Patent Application Publication No. 20150376607), AAV-LK02 (SEQ ID NO: 3 in U.S. Patent Application Publication No. 20150376607), AAV-LK03 (SEQ ID NO: 4 in U.S. Patent Application Publication No. 20150376607), AAV-LK04 (SEQ ID NO: 5 in U.S. Patent Application Publication No. 20150376607), AAV-LK05 (SEQ ID NO: 6 in U.S. Patent Application Publication No. 20150376607), AAV-LK06 (SEQ ID NO: 7 in U.S. Patent Application Publication No. 20150376607), AAV-LK07 (SEQ ID NO: 8 in U.S. Patent Application Publication No. 20150376607), AAV-LK08 (SEQ ID NO: 9 in U.S. Patent Application Publication No. 20150376607), AAV-LK09 (SEQ ID NO: 10 in U.S. Patent Application Publication No. 20150376607), AAV-LK10 (SEQ ID NO: 11 in U.S. Patent Application Publication No. 20150376607), AAV-LK11 (SEQ ID NO: 12 in U.S. Patent Application Publication No. 2015037 No. 20150376607), AAV-LK04 (SEQ ID NO: 5 of U.S. Patent Application Publication No. 20150376607), AAV-LK05 (SEQ ID NO: 6 of U.S. Patent Application Publication No. 20150376607), AAV-LK06 (SEQ ID NO: 7 of U.S. Patent Application Publication No. 20150376607), AAV-LK07 (SEQ ID NO: 8 of U.S. Patent Application Publication No. 20150376607), AAV-LK08 (SEQ ID NO: 9 of U.S. Patent Application Publication No. 20150376607), AAV-LK09 (U.S. Patent Application Publication No. 20150376607), AAV-LK10 (SEQ ID NO: 10 of U.S. Patent Application Publication No. 20150376607), AAV-LK11 (SEQ ID NO: 11 of U.S. Patent Application Publication No. 20150376607), AAV-LK12 (SEQ ID NO: 12 of U.S. Patent Application Publication No. 20150376607), AAV-LK13 (SEQ ID NO: 13 of U.S. Patent Application Publication No. 20150376607), AAV-LK14 (SEQ ID NO: 14 of U.S. Patent Application Publication No. 20150376607), AAV-LK15 (SEQ ID NO: 15 of U.S. Patent Application Publication No. 20150376607), AAV-LK16 (SEQ ID NO: 16 of U.S. Patent Application Publication No. 20150376607), AAV- AAV-LK10 (SEQ ID NO: 11 in U.S. Patent Application Publication No. 20150376607), AAV-LK11 (SEQ ID NO: 12 in U.S. Patent Application Publication No. 20150376607), AAV-LK12 (SEQ ID NO: 13 in U.S. Patent Application Publication No. 20150376607), AAV-LK13 (SEQ ID NO: 14 in U.S. Patent Application Publication No. 20150376607), AAV-LK14 (SEQ ID NO: 15 in U.S. Patent Application Publication No. 20150376607), AAV-LK15 (U.S. Patent Application Publication No. 20150376607), AAV-LK16 (SEQ ID NO: 17 in U.S. Patent Application Publication No. 20150376607), AAV-LK17 (SEQ ID NO: 18 in U.S. Patent Application Publication No. 20150376607), AAV-LK18 (SEQ ID NO: 19 in U.S. Patent Application Publication No. 20150376607), AAV-LK19 (SEQ ID NO: 20 in U.S. Patent Application Publication No. 20150376607), AAV-LK20 (SEQ ID NO: 21 in U.S. Patent Application Publication No. 20150376607), AAV-LK21 (SEQ ID NO: 22 in U.S. Patent Application Publication No. 20150376607), AAV-LK22 (SEQ ID NO: 23 in U.S. Patent Application Publication No. 20150376607), AAV-LK23 (SEQ ID NO: US Patent Application Publication No. 20150376607, SEQ ID NO: 16), AAV-LK16 (US Patent Application Publication No. 20150376607, SEQ ID NO: 17), AAV-LK17 (US Patent Application Publication No. 20150376607, SEQ ID NO: 18), AAV-LK18 (US Patent Application Publication No. 20150376607, SEQ ID NO: 19), AAV-LK19 (US Patent Application Publication No. 20150376607, SEQ ID NO: 20), AAV-PAEC2 (US Patent Application Publication No. 20150376607, SEQ ID NO: 21),It may be or may have AAV-PAEC4 (SEQ ID NO: 22 in U.S. Patent Application Publication No. 20150376607), AAV-PAEC6 (SEQ ID NO: 23 in U.S. Patent Application Publication No. 20150376607), AAV-PAEC7 (SEQ ID NO: 24 in U.S. Patent Application Publication No. 20150376607), AAV-PAEC8 (SEQ ID NO: 25 in U.S. Patent Application Publication No. 20150376607), AAV-PAEC11 (SEQ ID NO: 26 in U.S. Patent Application Publication No. 20150376607), AAV-PAEC12 (SEQ ID NO: 27 in U.S. Patent Application Publication No. 20150376607), or a variant thereof.

[0208] In some embodiments, the AAV serotype may be or have a sequence as described in U.S. Pat. No. 9,163,261 (the contents of which are incorporated herein by reference in their entirety), such as, but not limited to, AAV-2-pre-miRNA-101 (SEQ ID NO: 1 U.S. Pat. No. 9,163,261) or variants thereof.

[0209] In some embodiments, the AAV serotype may be or have a sequence as described in U.S. Patent Application Publication No. 20150376240 (the contents of which are incorporated by reference in their entirety), such as, but not limited to, AAV-8h (SEQ ID NO: 6 of U.S. Patent Application Publication No. 20150376240), AAV-8b (SEQ ID NO: 5 of U.S. Patent Application Publication No. 20150376240), AAV-h (SEQ ID NO: 2 of U.S. Patent Application Publication No. 20150376240), AAV-b (SEQ ID NO: 1 of U.S. Patent Application Publication No. 20150376240), or variants thereof.

[0210] In some embodiments, the AAV serotypes include sequences as described in U.S. Patent Application Publication No. 20160017295 (the contents of which are incorporated by reference in their entirety), including, but not limited to, AAV SM 10-2 (SEQ ID NO: 22 of U.S. Patent Application Publication No. 20160017295), AAV Shuffle 100-1 (SEQ ID NO: 23 of U.S. Patent Application Publication No. 20160017295), AAV Shuffle 100-3 (SEQ ID NO: 24 of U.S. Patent Application Publication No. 20160017295), AAV Shuffle 100-7 (SEQ ID NO: 25 of U.S. Patent Application Publication No. 20160017295), AAV Shuffle 100-8 (SEQ ID NO: 26 of U.S. Patent Application Publication No. 20160017295), AAV Shuffle 100-9 (SEQ ID NO: 27 of U.S. Patent Application Publication No. 20160017295), AAV Shuffle 100-10 (SEQ ID NO: 28 of U.S. Patent Application Publication No. 20160017295), AAV Shuffle 100-2 (SEQ ID NO: 29 of U.S. Patent Application Publication No. 20160017295), AAV Shuffle 100-3 (SEQ ID NO: 30 of U.S. Patent Application Publication No. 20160017295), AAV Shuffle 100-7 (SEQ ID NO: 31 of U.S. Patent Application Publication No. 20160017295), AAV Shuffle 100-8 (SEQ ID NO: 32 of U.S. Patent Application Publication No. 20 shuffle10-2 (SEQ ID NO: 34 in U.S. Patent Application Publication No. 20160017295), AAV shuffle10-6 (SEQ ID NO: 35 in U.S. Patent Application Publication No. 20160017295), AAV shuffle10-8 (SEQ ID NO: 36 in U.S. Patent Application Publication No. 20160017295), AAV shuffle100-2 (SEQ ID NO: 37 in U.S. Patent Application Publication No. 20160017295), AAV It may be or may have SM 10-1 (SEQ ID NO: 38 in US Patent Application Publication No. 20160017295), AAV SM 10-8 (SEQ ID NO: 39 in US Patent Application Publication No. 20160017295), AAV SM 100-3 (SEQ ID NO: 40 in US Patent Application Publication No. 20160017295), AAV SM 100-10 (SEQ ID NO: 41 in US Patent Application Publication No. 20160017295), or a variant thereof.

[0211] In some embodiments, the AAV serotype may be or have a sequence as described in U.S. Patent Application Publication No. 20150238550, the contents of which are incorporated herein by reference in their entirety, such as, but not limited to, BNP61 AAV (SEQ ID NO: 1 in U.S. Patent Application Publication No. 20150238550), BNP62 AAV (SEQ ID NO: 3 in U.S. Patent Application Publication No. 20150238550), BNP63 AAV (SEQ ID NO: 4 in U.S. Patent Application Publication No. 20150238550), or variants thereof.

[0212] In some embodiments, the AAV serotypes include sequences as described in U.S. Patent Application Publication No. 20150315612 (the contents of which are incorporated by reference in their entirety), including but not limited to, AAVrh.50 (SEQ ID NO: 108 in U.S. Patent Application Publication No. 20150315612), AAVrh.43 (SEQ ID NO: 163 in U.S. Patent Application Publication No. 20150315612), AAVrh.62 (SEQ ID NO: 114 in U.S. Patent Application Publication No. 20150315612), AAVrh.70 (SEQ ID NO: 115 in U.S. Patent Application Publication No. 20150315612), AAVrh.80 (SEQ ID NO: 116 in U.S. Patent Application Publication No. 20150315612), AAVrh.90 (SEQ ID NO: 117 in U.S. Patent Application Publication No. 20150315612), AAVrh.100 (SEQ ID NO: 118 in U.S. Patent Application Publication No. 20150315612), AAVrh.110 (SEQ ID NO: 119 in U.S. Patent Application Publication No. 20150315612), AAVrh.120 (SEQ ID NO: 123 in U.S. Patent Application Publication No. 20150315612), AAVrh.130 (SEQ ID NO: 124 in U.S. Patent Application Publication No. 20150315612), AAVrh.140 (SEQ ID NO: 125 in U.S. Patent Application Publication No. 20150315612), AAVrh.150 (SEQ ID NO: 126 in U Vrh.48 (SEQ ID NO: 115 in U.S. Patent Application Publication No. 20150315612), AAVhu.19 (SEQ ID NO: 133 in U.S. Patent Application Publication No. 20150315612), AAVhu.11 (SEQ ID NO: 153 in U.S. Patent Application Publication No. 20150315612), AAVhu.53 (SEQ ID NO: 186 in U.S. Patent Application Publication No. 20150315612), AAV4-8 / rh.64 (SEQ ID NO: 15 in U.S. Patent Application Publication No. 20150315612), AAVLG- AAV54.9 / hu.39 (SEQ ID NO: 24 in U.S. Patent Application Publication No. 20150315612), AAV54.5 / hu.23 (SEQ ID NO: 60 in U.S. Patent Application Publication No. 20150315612), AAV54.2 / hu.22 (SEQ ID NO: 67 in U.S. Patent Application Publication No. 20150315612), AAV54.7 / hu.24 (SEQ ID NO: 66 in U.S. Patent Application Publication No. 20150315612), AAV54.1 / hu.21 (SEQ ID NO: 1 in U.S. Patent Application Publication No. 20150315612), AAV54.1 / hu.22 (SEQ ID NO: 1 in U.S. Patent Application Publication No. 20150315612), AAV54.1 / hu.21 ... AAV46.6 / hu.29 (SEQ ID NO: 69 in U.S. Patent Application Publication No. 20150315612), AAV128.1 / hu.43 (SEQ ID NO: 80 in U.S. Patent Application Publication No. 20150315612), or a variant thereof.

[0213] In some embodiments, the AAV serotype may be or have a sequence as described in WO2015121501 (the contents of which are incorporated by reference in their entirety), such as, but not limited to, authentic AAV (ttAAV) (SEQ ID NO: 2 in WO2015121501), "UPenn AAV10" (SEQ ID NO: 8 in WO2015121501), "Japan AAV10" (SEQ ID NO: 9 in WO2015121501), or variants thereof.

[0214] According to the present disclosure, the selection or use of AAV capsid serotypes can be from various species. In some embodiments, the AAV can be avian AAV (AAAV). The AAAV serotypes can be or have sequences as described in U.S. Patent No. 9,238,800 (the contents of which are incorporated herein by reference in their entirety), such as, but not limited to, AAAV (SEQ ID NOS: 1, 2, 4, 6, 8, 10, 12, and 14 of U.S. Patent No. 9,238,800), or variants thereof.

[0215] In some embodiments, the AAV may be bovine AAV (BAAV). The BAAV serotype may be or have a sequence as described in U.S. Pat. No. 9,193,769 (the contents of which are incorporated herein by reference in their entirety), such as, but not limited to, BAAV (SEQ ID NOS: 1 and 6 of U.S. Pat. No. 9,193,769) or a variant thereof. The BAAV serotype may be or have a sequence as described in U.S. Pat. No. 7,427,396 (the contents of which are incorporated herein by reference in their entirety), such as, but not limited to, BAAV (SEQ ID NOS: 5 and 6 of U.S. Pat. No. 7,427,396) or a variant thereof.

[0216] In some embodiments, the AAV can be a caprine AAV. The caprine AAV serotype can be or have a sequence as described in U.S. Patent No. 7,427,396 (the contents of which are incorporated herein by reference in their entirety), such as, but not limited to, caprine AAV (SEQ ID NO: 3 of U.S. Patent No. 7,427,396) or variants thereof.

[0217] In other embodiments, the AAV may be engineered as a hybrid AAV from two or more parent serotypes. In some embodiments, the AAV may be AAV2G9, which contains sequences from AAV2 and AAV9. The AAV2G9 AAV serotype may be or have sequences as described in U.S. Patent Application Publication No. 20160017005, the contents of which are incorporated herein by reference in their entirety.

[0218] In some embodiments, the AAV can be a serotype generated by an AAV9 capsid library with mutations at amino acids 390-627 (VP1 numbering) as described by Pulicherla et al. (Molecular Therapy, Vol. 19, No. 6, pp. 1070-1078, 2011, the contents of which are incorporated herein by reference in their entirety). Serotypes and corresponding nucleotide and amino acid substitutions include, but are not limited to, AAV9.1 (G1594C; D532H), AAV6.2 (T1418A and T1436X; V473D and I479K), AAV6.3 (T1418A and T1436X; V473D and I479K), AAV9.4 (T1418A and T1436X; V473D and I479K), AAV9.5 (T1418A and T1436X; V473D and I479K), AAV9.6 (T1418A and T1436X; V473D and I479K), AAV9.7 (T1418A and T1436X; V473D and I479K), AAV9.8 (T1418A and T1436X; V473D and I479K), AAV9.9 (T1418A and T1436X; V473D and I479K), AAV9.1 ... AV9.3 (T1238A; F413Y), AAV9.4 (T1250C and A1617T; F417S), AAV9.5 (A1235G, A1314T, A1642G, C1760T; Q412R, T548A, A587V), AAV9.6 (T1231A; F411I), AAV9.9 (G1203A, G1785T; W595C), AAV9.10 (A1500G, T1676C; M559T), AAV9.11 (A1425T, A1702C, A1769T; T568P, Q590L), AAV9.13 (A1369C, A1720T; N457H, T574S), AAV9.14 (T1340A, T1362C, T1560C, G1713A; L447H), AAV9.16 (A1775T; Q592L), AAV9.24 (T1507C, T1521G; W503R), AAV9.26 (A1337G, A1769C; Y446C, Q590P), AAV9.33 (A1667C; D556A), AAV9.34 (A1534G, C1794T; N512D), AAV9.35 (A1289T, T1450A, C1494T, A1515T, C1794A, G1816A; Q430L, Y484N, N98K, V606I), AAV9.40 (A1694T, E565V), AAV9.41 (A1348T, T1362C; T450S), AAV9.44 (A168 4C, A1701T, A1737G; N562H, K567N), AAV9.45 (A1492T, C1804T; N498Y, L602F), AAV9.46 (G1441C, T1525C, T1549G; G481R, W509R, L517V), 9.47 (G1241A, G1358A, A1669G, C1745T; S414N, G453D, K557E, T582I), AAV9.48 (C1445T, A1736T; P482L, Q579L) , AAV9.50(A1638T, C1683T, T1805A; Q546H, L602H), AAV9.53(G1301A, A1405C, C1664T, G1811T; R134Q, S469R , A555V, G604V), AAV9.54 (C1531A, T1609A; L511I, L537M), AAV9.55 (T1605A; F535L), AAV9.58 (C1475T, C157 9A;T492I, H527N), AAV.59(T1336C;Y446H), AAV9.61(A1493T;N498I), AAV9.64(C1531A, A1617T;L511I), AAV 9.65 (C1335T, T1530C, C1568A; A523D), AAV9.68 (C1510A; P504T), AAV9.80 (G1441A; G481R), AAV9.83 (C1402 A, A1500T; P468T, E500D), AAV9.87 (T1464C, T1468C; S490P), AAV9.90 (A1196T; Y399F), AAV9.91 (T1316G, A15 The vectors may be AAV9.93 (A1273G, A1421G, A1638C, C1712T, G1732A, A1744T, A1832T; S425G, Q474R, Q546H, P571L, G578R, T582S, D611V), AAV9.94 (A1675T; M559L), and AAV9.95 (T1605A; F535L).

[0219] In some embodiments, the AAV serotypes include sequences as described in WO2016049230 (the contents of which are incorporated by reference in their entirety), including but not limited to, AAVF1 / HSC1 (SEQ ID NOs: 2 and 20 in WO2016049230), AAVF2 / HSC2 (SEQ ID NOs: 3 and 21 in WO2016049230), AAVF3 / HSC3 (SEQ ID NOs: 4 and 5 in WO2016049230), AAVF4 / HSC5 (SEQ ID NOs: 6 and 7 in WO2016049230), AAVF5 / HSC6 (SEQ ID NOs: 8 and 9 in WO2016049230), AAVF6 / HSC7 (SEQ ID NOs: 10 and 11 in WO2016049230), AAVF7 / HSC8 (SEQ ID NOs: 12 and 13 in WO2016049230), AAVF8 / HSC9 (SEQ ID NOs: 14 and 15 in WO2016049230), AAVF9 / HSC10 (SEQ ID NOs: 16 and 17 in WO2016049230), AAVF9 / HSC11 (SEQ ID NOs: 17 and 18 in WO2016049230), AAVF9 / HSC12 (SEQ ID NOs: 18 and 20 in WO2016049230), AAVF9 / HSC13 (SEQ ID NOs: 19 and 20 in WO2016049230), AAVF9 / HSC14 (SEQ ID NOs: 20 and 21 in WO20160492 Nos. 5 and 22), AAVF4 / HSC4 (SEQ ID NOs. 6 and 23 in WO 2016049230), AAVF5 / HSC5 (SEQ ID NOs. 11 and 25 in WO 2016049230), AAVF6 / HSC6 (SEQ ID NOs. 7 and 24 in WO 2016049230), AAVF7 / HSC7 (SEQ ID NOs. 8 and 27 in WO 2016049230), AAVF8 / HSC8 (SEQ ID NOs. 8 and 27 in WO 2016049230), AAVF9 / HSC10 (SEQ ID NOs. 8 and 28 in WO 2016049230), AAVF11 / HSC12 (SEQ ID NOs. 8 and 29 in WO 2016049230), AAVF12 / HSC14 (SEQ ID NOs. 8 and 29 in WO 2016049230), AAVF13 / HSC15 (SEQ ID NOs. 8 and 29 in WO 2016049230), AAVF14 / HSC16 (SEQ ID NOs. 8 and 29 in WO 2016049230), AAVF15 / HSC17 (SEQ ID NOs. 8 and 29 in WO 2016049230), AAVF16 / HSC18 (SEQ ID NOs. 8 and 29 in WO 2016049230), AAVF17 / HSC19 (SEQ ID NOs. 8 and 29 in WO 2016049230), AAVF18 / HSC19 (SEQ ID NOs. AAVF9 / HSC9 (SEQ ID NOs: 10 and 29 in WO 2016049230), AAVF11 / HSC11 (SEQ ID NOs: 4 and 26 in WO 2016049230), AAVF12 / HSC12 (SEQ ID NOs: 12 and 30 in WO 2016049230), AAVF13 / HSC13 (SEQ ID NOs: 14 and 31 in WO 2016049230), AAVF14 / HSC15 (SEQ ID NOs: 15 and 32 in WO 2016049230), AAVF15 / HSC16 (SEQ ID NOs: 16 and 33 in WO 2016049230), AAVF16 / HSC17 (SEQ ID NOs: 17 and 34 in WO 2016049230), AAVF17 / HSC18 (SEQ ID NOs: 18 and 35 in WO 2016049230), AAVF18 / HSC19 (SEQ ID NOs: 19 and 20 in WO 2016049230), AAVF19 / HSC20 (SEQ ID NOs: 21 and 22 in WO 2016049230), AAVF19 / HSC21 (SEQ ID NOs: 23 and 24 in WO 2016049230), AAVF19 / HSC22 (SEQ ID NOs: 25 and 26 in WO 2016049230), AAVF19 / HSC23 (SEQ ID NOs: 26 and 28 in WO 2016049230), AAVF19 / HS C14 (SEQ ID NOs: 15 and 32 in WO 2016049230), AAVF15 / HSC15 (SEQ ID NOs: 16 and 33 in WO 2016049230), AAVF16 / HSC16 (SEQ ID NOs: 17 and 34 in WO 2016049230), AAVF17 / HSC17 (SEQ ID NOs: 13 and 35 in WO 2016049230), or a mutant or derivative thereof.

[0220] In some embodiments, the AAV serotypes include sequences as described in U.S. Pat. No. 8,734,809 (the contents of which are incorporated herein by reference in their entirety), including but not limited to, AAV CBr-El (SEQ ID NOs: 13 and 87 in U.S. Pat. No. 8,734,809), AAV CBr-E2 (SEQ ID NOs: 14 and 88 in U.S. Pat. No. 8,734,809), AAV CBr-E3 (SEQ ID NOs: 15 and 89 in U.S. Pat. No. 8,734,809), AAV CBr-E4 (SEQ ID NOs: 16 and 90 in U.S. Pat. No. 8,734,809), AAV CBr-E5 (SEQ ID NOs: 17 and 91 in U.S. Pat. No. 8,734,809), AAV CBr-e5 (SEQ ID NOs: 18 and 92 in U.S. Pat. No. 8,734,809), AAV CBr-E6 (SEQ ID NOs: 19 and 93 in U.S. Pat. No. 8,734,809), AAV CBr-E7 (SEQ ID NOs: 19 and 94 in U.S. Pat. No. 8,734,809), AAV CBr-E8 (SEQ ID NOs: 20 and 21 in U.S. Pat. No. 8,734,809), AAV CBr-E9 (SEQ ID NOs: 21 and 22 in U.S. Pat. No. 8,734,809), AAV CBr-E10 (SEQ ID NOs: 22 and 23 in U.S. Pat. No. 8,734,809), AAV CBr CBr-E7 (SEQ ID NOs: 20 and 94 in U.S. Patent No. 8,734,809), AAV CBr-E8 (SEQ ID NOs: 21 and 95 in U.S. Patent No. 8,734,809), AAV CLv-D1 (SEQ ID NOs: 22 and 96 in U.S. Patent No. 8,734,809), AAV CLv-D2 (SEQ ID NOs: 23 and 97 in U.S. Patent No. 8,734,809), AAV CLv-D3 (SEQ ID NOs: 24 and 98 in U.S. Patent No. 8,734,809), AAV CLv-D4 (SEQ ID NOs: 25 and 99 in U.S. Patent No. 8,734,809), AAV CLv-D5 (SEQ ID NOs: 26 and 100 in U.S. Patent No. 8,734,809), AAV CLv-D6 (SEQ ID NOs: 27 and 101 in U.S. Patent No. 8,734,809), AAV CLv-D7 (SEQ ID NOs: 28 and 102 in U.S. Patent No. 8,734,809), AAV CLv-D8 (SEQ ID NOs: 29 and 103 in U.S. Patent No. 8,734,809), AAV CLv-E1 (SEQ ID NOs: 13 and 87 in U.S. Patent No. 8,734,809), AAV CLv-R1 (SEQ ID NOs: 30 and 104 in U.S. Patent No. 8,734,809), AAV CLv-R2 (SEQ ID NOs: 31 and 105 in U.S. Patent No. 8,734,809), AAV CLv-R3 (SEQ ID NOs: 32 and 106 in U.S. Patent No. 8,734,809), AAV CLv-R4 (SEQ ID NOs: 33 and 107 in U.S. Patent No. 8,734,809), AAVCLv-R5 (SEQ ID NOs: 34 and 108 in U.S. Patent No. 8,734,809), AAV CLv-R6 (SEQ ID NOs: 35 and 109 in U.S. Patent No. 8,734,809), AAV CLv-R7 (SEQ ID NOs: 36 and 110 in U.S. Patent No. 8,734,809), AAV CLv-R8 (SEQ ID NOs: X and X in U.S. Patent No. 8,734,809), AAV CLv-R9 (SEQ ID NOs: X and X in U.S. Patent No. 8,734,809), AAV CLg-F1 (SEQ ID NOs: 39 and 113 in U.S. Patent No. 8,734,809), AAV CLg-F2 (SEQ ID NOs: 40 and 114 in U.S. Patent No. 8,734,809), AAV CLg-F3 (SEQ ID NOs: 41 and 115 in U.S. Patent No. 8,734,809), AAV CLg-F4 (SEQ ID NOs: 42 and 116 in U.S. Patent No. 8,734,809), AAV CLg-F5 (SEQ ID NOs: 43 and 117 in U.S. Patent No. 8,734,809), AAV CLg-F6 (SEQ ID NOs: 43 and 117 in U.S. Patent No. 8,734,809), AAV CLg-F7 (SEQ ID NOs: 44 and 118 in U.S. Patent No. 8,734,809), AAV CLg-F8 (SEQ ID NOs: 43 and 117 in U.S. Patent No. 8,734,809), AAV CSp-1 (SEQ ID NOs: 45 and 119 in U.S. Patent No. 8,734,809), AAV CSp-10 (SEQ ID NOs: 46 and 120 in U.S. Patent No. 8,734,809), AAV CSp-11 (SEQ ID NOs: 47 and 121 in U.S. Patent No. 8,734,809), AAV CSp-2 (SEQ ID NOs: 48 and 122 in U.S. Patent No. 8,734,809), AAV CSp-3 (SEQ ID NOs: 49 and 123 in U.S. Patent No. 8,734,809), AAV CSp-4 (SEQ ID NOs: 50 and 124 in U.S. Patent No. 8,734,809), AAV CSp-6 (SEQ ID NOs: 51 and 125 in U.S. Patent No. 8,734,809), AAV CSp-7 (SEQ ID NOs: 52 and 126 in U.S. Patent No. 8,734,809), AAV CSp-8 (SEQ ID NOs: 53 and 127 in U.S. Patent No. 8,734,809), AAV CSp-9 (SEQ ID NOs: 54 and 128 in U.S. Patent No. 8,734,809), AAV CHt-2 (SEQ ID NOs: 55 and 129 in U.S. Patent No. 8,734,809), AAVCHt-3 (SEQ ID NOs: 56 and 130 in U.S. Patent No. 8,734,809), AAV CKd-1 (SEQ ID NOs: 57 and 131 in U.S. Patent No. 8,734,809), AAV CKd-10 (SEQ ID NOs: 58 and 132 in U.S. Patent No. 8,734,809), AAV CKd-2 (SEQ ID NOs: 59 and 133 in U.S. Patent No. 8,734,809), AAV CKd-3 (SEQ ID NOs: 60 and 134 in U.S. Patent No. 8,734,809), AAV CKd-4 (SEQ ID NOs: 61 and 135 in U.S. Patent No. 8,734,809), AAV CKd-6 (SEQ ID NOs: 62 and 136 in U.S. Patent No. 8,734,809), AAV CKd-7 (SEQ ID NOs: 63 and 137 in U.S. Patent No. 8,734,809), AAV CKd-8 (SEQ ID NOs: 64 and 138 in U.S. Patent No. 8,734,809), AAV CLv-1 (SEQ ID NOs: 35 and 139 in U.S. Patent No. 8,734,809), AAV CLv-12 (SEQ ID NOs: 66 and 140 in U.S. Patent No. 8,734,809), AAV CLv-13 (SEQ ID NOs: 67 and 141 in U.S. Patent No. 8,734,809), AAV CLv-2 (SEQ ID NOs: 68 and 142 in U.S. Patent No. 8,734,809), AAV CLv-3 (SEQ ID NOs: 69 and 143 in U.S. Patent No. 8,734,809), AAV CLv-4 (SEQ ID NOs: 70 and 144 in U.S. Patent No. 8,734,809), AAV CLv-6 (SEQ ID NOs: 71 and 145 in U.S. Patent No. 8,734,809), AAV CLv-8 (SEQ ID NOs: 72 and 146 in U.S. Patent No. 8,734,809), AAV CKd-B1 (SEQ ID NOs: 73 and 147 in U.S. Patent No. 8,734,809), AAV CKd-B2 (SEQ ID NOs: 74 and 148 in U.S. Patent No. 8,734,809), AAV CKd-B3 (SEQ ID NOs: 75 and 149 in U.S. Patent No. 8,734,809), AAV CKd-B4 (SEQ ID NOs: 76 and 150 in U.S. Patent No. 8,734,809), AAV CKd-B5 (SEQ ID NOs: 77 and 151 in U.S. Patent No. 8,734,809), AAV CKd-B6 (SEQ ID NOs: 78 and 152 in U.S. Patent No. 8,734,809), AAV CKd-B7 (SEQ ID NOs: 79 and 153 in U.S. Patent No. 8,734,809), AAVCKd-B8 (SEQ ID NOs: 80 and 154 in U.S. Patent No. 8,734,809), AAV CKd-H1 (SEQ ID NOs: 81 and 155 in U.S. Patent No. 8,734,809), AAV CKd-H2 (SEQ ID NOs: 82 and 156 in U.S. Patent No. 8,734,809), AAV CKd-H3 (SEQ ID NOs: 83 and 157 in U.S. Patent No. 8,734,809), AAV CKd-H4 (SEQ ID NOs: 84 and 158 in U.S. Patent No. 8,734,809), AAV CKd-H5 (SEQ ID NOs: 85 and 159 in U.S. Patent No. 8,734,809), AAV CKd-H6 (SEQ ID NOs: 77 and 151 in U.S. Patent No. 8,734,809), AAV CHt-1 (SEQ ID NOs: 86 and 160 in U.S. Patent No. 8,734,809), AAV CLv1-1 (SEQ ID NO: 171 in U.S. Patent No. 8,734,809), AAV CLv1-2 (SEQ ID NO: 172 in U.S. Patent No. 8,734,809), AAV CLv1-3 (SEQ ID NO: 173 in U.S. Patent No. 8,734,809), AAV CLv1-4 (SEQ ID NO: 174 in U.S. Patent No. 8,734,809), AAV Clv1-7 (SEQ ID NO: 175 in U.S. Patent No. 8,734,809), AAV Clv1-8 (SEQ ID NO: 176 in U.S. Patent No. 8,734,809), AAV Clv1-9 (SEQ ID NO: 177 in U.S. Patent No. 8,734,809), AAV The vector may be or may have Clv1-10 (SEQ ID NO: 178 of U.S. Patent No. 8,734,809), AAV.VR-355 (SEQ ID NO: 181 of U.S. Patent No. 8,734,809), AAV.hu.48R3 (SEQ ID NO: 183 of U.S. Patent No. 8,734,809), or a variant or derivative thereof.

[0221] In some embodiments, the AAV serotypes include sequences as set forth in WO2016065001 (the contents of which are incorporated by reference in their entirety), including, but not limited to, AAV CHt-P2 (SEQ ID NOs: 1 and 51 in WO2016065001), AAV CHt-P5 (SEQ ID NOs: 2 and 52 in WO2016065001), AAV CHt-P9 (SEQ ID NOs: 3 and 53 in WO2016065001), AAV CBr-7.1 (SEQ ID NOs: 4 and 54 in WO2016065001), AAV CBr-7.2 (SEQ ID NOs: 5 and 55 in WO2016065001), AAV CBr-7.3 (SEQ ID NOs: 6 and 56 in WO2016065001), AAV CBr-7.4 (SEQ ID NOs: 7 and 57 in WO 2016065001), AAV CBr-7.5 (SEQ ID NOs: 8 and 58 in WO 2016065001), AAV CBr-7.7 (SEQ ID NOs: 9 and 59 in WO 2016065001), AAV CBr-7.8 (SEQ ID NOs: 10 and 60 in WO 2016065001), and AAV CBr-7.10 (SEQ ID NOs: 11 and 61 in WO 2016065001), AAV CKd-N3 (SEQ ID NOs: 12 and 62 in WO 2016065001), AAV CKd-N4 (SEQ ID NOs: 13 and 63 in WO 2016065001), AAV CKd-N9 (SEQ ID NOs: 14 and 64 in WO 2016065001), AAV CLv-L4 (SEQ ID NOs: 15 and 65 in WO 2016065001), AAV CLv-L5 (SEQ ID NOs: 16 and 66 in WO 2016065001), AAV CLv-L6 (SEQ ID NOs: 17 and 67 in WO 2016065001), AAV CLv-K1 (SEQ ID NOs: 18 and 68 in WO 2016065001), AAV CLv-K3 (SEQ ID NOs: 19 and 69 in WO 2016065001), AAV CLv-K6 (SEQ ID NOs: 20 and 70 in WO 2016065001), AAV CLv-M1 (SEQ ID NOs: 21 and 71 in WO 2016065001), AAV CLv-M11 (SEQ ID NOs: 22 and 72 in WO 2016065001), AAV CLv-M2 (SEQ ID NOs: 23 and 73 in WO 2016065001), AAV CLv-M5 (SEQ ID NOs: 24 and 74 in WO 2016065001), AAV CLv-M6 (SEQ ID NOs: 25 and 75 in WO 2016065001), AAV CLv-M7 (SEQ ID NOs: 26 and 76 in WO 2016065001), AAV CLv-M8 (SEQ ID NOs: 27 and 77 in WO 2016065001), AAV CLv-M9 (SEQ ID NOs: 28 and 78 in WO 2016065001), AAV CHt-P1 (SEQ ID NOs: 29 and 79 in WO 2016065001), AAV CHt-P6 (SEQ ID NOs: 30 and 80 in WO 2016065001), AAV CHt-P8 (SEQ ID NOs: 31 and 81 in WO 2016065001), and AAV CHt-6.1 (SEQ ID NOs: 32 and 82 in the pamphlet of International Publication No. 2016065001), AAV CHt-6.10 (SEQ ID NOs: 33 and 83 in the pamphlet of International Publication No. 2016065001), AAV CHt-6.5 (SEQ ID NOs: 34 and 84 in the pamphlet of International Publication No. 2016065001), AAV CHt-6.6 (SEQ ID NOs: 35 and 85 in the pamphlet of International Publication No. 2016065001), AAV CHt-6.7 (SEQ ID NOs: 36 and 86 in the pamphlet of International Publication No. 2016065001), AAV CHt-6.8 (SEQ ID NOs: 37 and 87 in the pamphlet of International Publication No. 2016065001), AAV CSp-8.10 (SEQ ID NOs: 38 and 88 in the pamphlet of International Publication No. 2016065001), AAV CSp-8.2 (SEQ ID NOs: 39 and 89 in WO 2016065001), AAV CSp-8.4 (SEQ ID NOs: 40 and 90 in WO 2016065001), AAV CSp-8.5 (SEQ ID NOs: 41 and 91 in WO 2016065001), AAV CSp-8.6 (SEQ ID NOs: 42 and 92 in WO 2016065001), AAV CSp-8.7 (SEQ ID NOs: 43 and 93 in WO 2016065001), AAV CSp-8.8 (SEQ ID NOs: 44 and 94 in WO 2016065001), AAV CSp-8.9 (SEQ ID NOs: 45 and 95 in WO 2016065001), AAV The vector may be or may have CBr-B7.3 (SEQ ID NOs: 46 and 96 in WO 2016065001), AAV CBr-B7.4 (SEQ ID NOs: 47 and 97 in WO 2016065001), AAV3B (SEQ ID NOs: 48 and 98 in WO 2016065001), AAV4 (SEQ ID NOs: 49 and 99 in WO 2016065001), AAV5 (SEQ ID NOs: 50 and 100 in WO 2016065001), or a mutant or derivative thereof.

[0222] In some embodiments, the AAV particles may have or be a serotype selected from any of those found in Table 1. In some embodiments, the AAV capsid may comprise any of the sequences in Table 1, fragments or variants thereof.

[0223] In some embodiments, the AAV capsid may be encoded by a sequence, fragment, or variant as set forth in Table 1. In any of the DNA and RNA sequences referenced and / or described herein, the single letter symbols have the following explanations: adenine is A, cytosine is C, guanine is G, thymine is T, uracil is U, weak bases such as adenine or thymine are W, strong nucleotides such as cytosine and guanine are S, amino nucleotides such as adenine and cytosine are M, keto nucleotides such as guanine and thymine are K, and the purines adenine and guanine are C, G, T, U, U, and S. Adenine is R, the pyrimidines cytosine and thymine are Y, any base that is not A (e.g., cytosine, guanine, and thymine) is B, any base that is not C (e.g., adenine, guanine, and thymine) is D, any base that is not G (e.g., adenine, cytosine, and thymine) is H, any base that is not T (e.g., adenine, cytosine, and guanine) is V, any nucleotide (not a gap) is N, and Z is for zero.

[0224] In any of the amino acid sequences referenced and / or described herein, the single letter codes have the following explanations: glycine is G (Gly), alanine is A (Ala), leucine is L (Leu), methionine is M (Met), phenylalanine is F (Phe), tryptophan is W (Trp), lysine is K (Lys), glutamine is Q (Gln), glutamic acid is E (Glu), serine is S (Ser), proline is P (Pro), valine is V (Val), and isoleucine is I (Ile). ), cysteine ​​is C (Cys), tyrosine is Y (Tyr), histidine is H (His), arginine is R (Arg), asparagine is N (Asn), aspartic acid is D (Asp), threonine is T (Thr), aspartic acid or asparagine is B (Asx), leucine or isoleucine is J (Xle), pyrrolysine is O (Pyl), selenocysteine ​​is U (Sec), any amino acid is X (Xaa), and glutamine or glutamic acid is Z (Glx).

[0225] [Table 1]

[0226] In some embodiments, the AAV serotype is selected from the group consisting of sequences as set forth in WO2015038958 (the contents of which are incorporated by reference in their entirety), including but not limited to, AAV9 (SEQ ID NOs: 11 and 2 in WO2015038958 or SEQ ID NOs: 137 and 138, respectively, herein), PHP.B (SEQ ID NOs: 8 and 9 in WO2015038958, SEQ ID NOs: 5 and 6, respectively, herein), G2B-13 (SEQ ID NO: 12 in WO2015038958, SEQ ID NOs: 137 and 138, respectively, herein), G2B-14 (SEQ ID NO: 14 in WO2015038958, SEQ ID NOs: 148 and 149, respectively, herein), G2B-15 (SEQ ID NO: 15 in WO2015038958, SEQ ID NOs: 159 and 160, respectively, herein), G2B-16 (SEQ ID NO: 16 in WO2015038958, SEQ ID NOs: 161 and 162, respectively, herein), G2B-17 (SEQ ID NO: 17 in WO2015038958, SEQ ID NOs: 173 and 174, respectively, herein), G2B-18 (SEQ ID NO: 18 in WO2015038958, SEQ ID NOs: 185 and 186, respectively, herein), G2B-19 (SEQ ID NO: 19 in WO2015038958, SEQ ID NOs: 196 and 197, respectively, herein), G2B-20 (SEQ ID NO: 20 in W No. 7), G2B-26 (SEQ ID NO: 13 in WO2015038958, herein SEQ ID NO: 5), TH1.1-32 (SEQ ID NO: 14 in WO2015038958, herein SEQ ID NO: 8), TH1.1-35 (SEQ ID NO: 15 in WO2015038958, herein SEQ ID NO: 9), AAV5 (SEQ ID NOs: 199 and 216 in US Patent Application Publication No. 20150315612, herein SEQ ID NOs: 105 and 104, respectively), or variants thereof.

[0227] In some embodiments, the AAV particles described herein comprise an AAV capsid protein comprising an amino acid sequence provided in WO 2021 / 230987, e.g., Table 4 or Table 6 of WO 2021 / 230987 (the contents of which are hereby incorporated by reference in their entirety).

[0228] In some embodiments, the AAV serotype of the AAV particles, such as the AAV particles for vectored delivery of the GBA1 protein described herein, is AAV9 or AAV5, or an AAV5 mutant or an AAV9 mutant. In some embodiments, the AAV particles comprise an AAV5 capsid mutant. In some embodiments, the AAV particles comprise an AAV9 capsid mutant.

[0229] In some embodiments, an AAV particle, such as a recombinant AAV particle described herein, comprises an AAV9 capsid protein. In some embodiments, the AAV9 capsid protein comprises the amino acid sequence of SEQ ID NO: 138. In some embodiments, the nucleic acid sequence encoding the AAV9 capsid protein comprises the nucleotide sequence of SEQ ID NO: 137. In some embodiments, the AAV9 capsid protein comprises an amino acid sequence that is at least 70% identical to SEQ ID NO: 138, such as at least 70% identical thereto, such as at least 70%, at least 75%, at least 80%, at least 85%, at least 90%, at least 91%, at least 92%, at least 93%, at least 94%, at least 95%, at least 96%, at least 97%, at least 98%, at least 99%, or 100% identical thereto. In some embodiments, the nucleic acid sequence encoding the AAV9 capsid protein comprises a nucleotide sequence that is at least 70% identical to SEQ ID NO: 137, such as at least 70%, at least 75%, at least 80%, at least 85%, at least 90%, at least 91%, at least 92%, at least 93%, at least 94%, at least 95%, at least 96%, at least 97%, at least 98%, at least 99%, or 100% identical thereto.

[0230] In some embodiments, an AAV particle, such as a recombinant AAV particle described herein, comprises an AAV5 capsid protein. In some embodiments, the AAV5 capsid protein comprises the amino acid sequence of SEQ ID NO: 104. In some embodiments, the nucleic acid sequence encoding the AAV5 capsid protein is encoded by the nucleotide sequence of SEQ ID NO: 105. In some embodiments, the AAV5 capsid protein comprises an amino acid sequence that is at least 70% identical to SEQ ID NO: 104, such as at least 70% identical thereto, such as at least 70%, at least 75%, at least 80%, at least 85%, at least 90%, at least 91%, at least 92%, at least 93%, at least 94%, at least 95%, at least 96%, at least 97%, at least 98%, at least 99%, or 100% identical thereto. In some embodiments, the nucleic acid sequence encoding the AAV5 capsid protein is encoded by a nucleotide sequence that is at least 70% identical to SEQ ID NO: 105, such as at least 70%, at least 75%, at least 80%, at least 85%, at least 90%, at least 91%, at least 92%, at least 93%, at least 94%, at least 95%, at least 96%, at least 97%, at least 98%, at least 99%, or 100% identical to SEQ ID NO: 105.

[0231] In some embodiments, AAV particles, such as the AAV capsids of AAV particles for vectored delivery of the GBA1 protein described herein, are capable of crossing the blood-brain barrier following intravenous administration. Non-limiting examples of such AAV capsids include AAV9, AAV9 K449R, AAV5, VOY101, VOY201, or AAV capsids containing peptide inserts, including, but not limited to, AAVPHP.N (PHP.N), AAVPHP.B (PHP.B), PHP.S, G2A3, G2B4, G2B5, G2A12, G2A15, PHP.B2, PHP.B3, AAV2.BR1, or AAVPHP.A (PHP.A).

[0232] In some embodiments, the AAV capsid is an AAV9 containing an insert comprising the amino acid sequence PLNGAVHLY (SEQ ID NO: 3648), which occurs immediately after position 586 when compared to a reference sequence numbered according to the amino acid sequence of SEQ ID NO: 138. In some embodiments, the AAV capsid comprises the amino acid sequence of 3636. In some embodiments, SEQ ID NO: 3636 is the amino acid sequence:

[0233] [ka]

[0234] Includes: In some embodiments, the AAV serotype is selected for use due to its tropism for cells of the central nervous system. In some embodiments, the cells of the central nervous system are neurons. In other embodiments, the cells of the central nervous system are astrocytes.

[0235] In some embodiments, an AAV serotype is selected for use because of its tropism for cells of one or more muscles. In some embodiments, the translation start codon of the AAV VP1 capsid protein can be CTG, TTG, or GTG, as described in U.S. Patent No. 8,163,543, the contents of which are incorporated by reference in their entirety. In some embodiments, the nucleotide sequence encoding the capsid protein, e.g., the VP1 capsid protein, includes 3 to 20 mutations (e.g., substitutions), e.g., 3 to 15 mutations, 3 to 10 mutations, 3 to 5 mutations, 5 to 20 mutations, 5 to 15 mutations, 5 to 10 mutations, 10 to 20 mutations, 10 to 15 mutations, 15 to 20 mutations, 3 mutations, 5 mutations, 10 mutations, 12 mutations, 15 mutations, 18 mutations, or 20 mutations, relative to the nucleotide sequence of SEQ ID NO: 137.

[0236] This disclosure refers to structural capsid proteins (including VP1, VP2, and VP3) encoded by capsid (Cap) genes. These capsid proteins form the outer protein shell (i.e., capsid) of viral vectors, such as AAV. VP capsid proteins synthesized from Cap polynucleotides generally contain a methionine (Met1) as the first amino acid in the peptide sequence, relative to the initiation codon (AUG or ATG) in the corresponding Cap nucleotide sequence. However, the first methionine (Met1) residue, or generally any first amino acid (AA1), is typically cleaved by a protein processing enzyme, such as Met-aminopeptidase, after or during polypeptide synthesis. This "Met / AA clipping" process is often correlated with the corresponding acetylation of a second amino acid (e.g., alanine, valine, serine, threonine, etc.) in the polypeptide sequence. Met clipping occurs most frequently in VP1 and VP3 capsid proteins, but can also occur in VP2 capsid proteins.

[0237] If Met / AA clipping is incomplete, a mixture of one or more (one, two, or three) VP capsid proteins comprising the viral capsid may be produced, some of which may contain the Met1 / AA1 amino acid (Met+ / AA+) and some of which may lack the Met1 / AA1 amino acid (Met- / AA-) as a result of Met / AA clipping. For further discussion of Met / AA clipping in capsid proteins, see Jin et al., "Direct Liquid Chromatography / Mass Spectrometry Analysis for Complete Characterization of Recombinant Adeno-Associated Virus Capsid Proteins," Hum Gene Ther Methods, October 2017, Vol. 28, No. 5, pp. 255-267; Hwang et al., "N-Terminal Acetylation of Cellular Proteins Creates Specific Degradation Signals," Science, February 19, 2010, Vol. 327, No. 5968, pp. 973-977, the contents of each of which are incorporated herein by reference in their entireties.

[0238] According to the present disclosure, reference to a capsid protein is not limited to either clipped (Met- / AA-) or unclipped (Met+ / AA+) capsid proteins, and may refer, as the context requires, to individual capsid proteins, viral capsids comprised of mixtures of capsid proteins, and / or polynucleotide sequences (or fragments thereof) that encode, describe, produce, or result in the capsid proteins of the present disclosure. Direct reference to a "capsid protein" or "capsid polypeptide" (such as VP1, VP2, or VP2) may include VP capsid proteins that include the Met1 / AA1 amino acids (Met+ / AA+) as well as the corresponding VP capsid protein that lacks the Met1 / AA1 amino acids as a result of Met / AA clipping (Met- / AA-).

[0239] Further, according to the present disclosure, reference to specific "SEQ ID NOs" (whether protein or nucleic acid) each containing or encoding one or more capsid proteins (Met+ / AA+) containing Met1 / AA1 amino acids should be understood to teach VP capsid proteins lacking the Met1 / AA1 amino acids, as it is readily apparent from a look at the sequences that any sequence simply lacks the first-listed amino acid (whether Met1 / AA1 or not).

[0240] As a non-limiting example, a reference to a (Met+)VP1 polypeptide sequence that is 736 amino acids in length and that includes the "Met1" amino acid encoded by an AUG / ATG start codon can be understood to also teach a (Met-)VP1 polypeptide sequence that is 735 amino acids in length and that does not include the "Met1" amino acid of the 736 amino acid Met+ sequence. As a second non-limiting example, a reference to a (AA1+)VP1 polypeptide sequence that is 736 amino acids in length and that includes the "AA1" amino acid encoded by any NNN initiator codon can be understood to also teach a (AA1-)VP1 polypeptide sequence that is 735 amino acids in length and that does not include the "AA1" amino acid of the 736 amino acid AA1+ sequence.

[0241] Reference to a viral capsid formed from VP capsid proteins (such as a reference to a specific AAV capsid serotype) can encompass VP capsid proteins that include the Met1 / AA1 amino acids (Met+ / AA1+), the corresponding VP capsid proteins that lack the Met1 / AA1 amino acids as a result of Met / AA1 clipping (Met- / AA1-), and combinations thereof (Met+ / AA1+ and Met- / AA1-).

[0242] As non-limiting examples, AAV capsid serotypes can include VP1(Met+ / AA1+), VP1(Met- / AA1-), or a combination of VP1(Met+ / AA1+) and VP1(Met- / AA1-). AAV capsid serotypes can also include VP3(Met+ / AA1+), VP3(Met- / AA1-), or a combination of VP3(Met+ / AA1+) and VP3(Met- / AA1-), and similar optional combinations of VP2(Met+ / AA1) and VP2(Met- / AA1-).

[0243] AAV viral genome In some aspects, the AAV particles of the present disclosure serve as expression vectors comprising a viral genome encoding a GCase protein. The viral genome may encode the GCase protein and enhancers such as prosaposin (PSAP) or saposin (Sap) polypeptides or functional variants thereof (e.g., SapA protein or SapC protein), cell-penetrating peptides (e.g., ApoEII peptide, TAT peptide, or ApoB peptide), lysosomal targeting sequences (LTS), or combinations thereof. In some embodiments, the expression vector is not limited to AAV, but may be an adenovirus, retrovirus, lentivirus, plasmid, vector, or any variant thereof.

[0244] In some embodiments, the AAV particle, e.g., an AAV particle for vectored delivery of a GBA1 protein described herein, comprises a viral genome, e.g., an AAV viral genome (e.g., a vector genome or an AAV vector genome). In some embodiments, the viral genome, e.g., the AAV viral genome, further comprises an inverted terminal repeat (ITR) region, an enhancer, a promoter, an intron region, a Kozak sequence, an exon region, a nucleic acid encoding a transgene encoding a payload (e.g., a GBA1 protein described herein) with or without an enhancing element, a nucleotide sequence encoding at least one miR binding site (e.g., at least one miR183 binding site), a polyA signal region, or a combination thereof.

[0245] Viral genome components: inverted terminal repeats (ITRs) In some embodiments, the viral genome may comprise at least one inverted terminal repeat (ITR) region. The AAV particles of the present disclosure comprise a viral genome having at least one ITR region and a payload region. In some embodiments, the viral genome has two ITRs. These two ITRs flank the payload region at the 5' and 3' ends. In some embodiments, the ITRs function as origins of replication containing recognition sites for replication. In some embodiments, the ITRs comprise sequence regions that may be complementary and symmetrically arranged. In some embodiments, the ITRs incorporated into the viral genomes described herein may comprise naturally occurring polynucleotide sequences or recombinantly derived polynucleotide sequences.

[0246] The ITRs may be from the same serotype as the capsid or derivatives thereof, selected from any of the serotypes listed in Table 1. The ITRs may be of a different serotype from the capsid. In some embodiments, the AAV particle has two or more ITRs. In a non-limiting example, the AAV particle has a viral genome comprising two ITRs. In some embodiments, the ITRs are of the same serotype as each other. In other embodiments, the ITRs are of different serotypes. Non-limiting examples include those in which none, one, or both ITRs are of the same serotype as the capsid. In some embodiments, both ITRs in the viral genome of the AAV particle are AAV2 ITRs.

[0247] Independently, each ITR can be about 100 to about 150 nucleotides in length. In some embodiments, the ITRs are 100 to 180 nucleotides in length, e.g., about 100 to 115, about 100 to 120, about 100 to 130, about 100 to 140, about 100 to 150, about 100 to 160, about 100 to 170, about 100 to 180, about 110 to 120, about 110 to 130, about 110 to 140, about 110 to 150, about 110 to 160, about 110 to 170, about 110 to 180, about 120 to 130, about 120 to 140, about 110 to 150, about 110 to 160, about 110 to 170, about 110 to 180, about 120 to 140, about 120 to 150, about 120 to 160, about 120 to 170, about 120 to 180, about 130 to 140, about 130 to 15 ... The ITRs may comprise about 0, about 120-150, about 120-160, about 120-170, about 120-180, about 130-140, about 130-150, about 130-160, about 130-170, about 130-180, about 140-150, about 140-160, about 140-170, about 140-180, about 150-160, about 150-170, about 150-180, about 160-170, about 160-180, or about 170-180 nucleotides in length. In some embodiments, the ITRs comprise about 120-140 nucleotides in length, e.g., about 130 nucleotides in length. In some embodiments, the ITRs are 140-142 nucleotides in length, e.g., 141 nucleotides in length. In some embodiments, the ITRs comprise between 1205 and 135 nucleotides in length, for example, 130 nucleotides in length. Non-limiting examples of ITR lengths are 102, 130, 140, 141, 142, 145 nucleotides in length and those with at least 95% identity thereto.

[0248] In some embodiments, each ITR is 141 nucleotides in length. In some embodiments, each ITR is 130 nucleotides in length. In some embodiments, the AAV particle comprises two ITRs, one ITR is 141 nucleotides in length and the other ITR is 130 nucleotides in length.

[0249] In some embodiments, the ITRs comprise the nucleotide sequence of any one of SEQ ID NOs: 1829, 1830, or 1862, or a nucleotide sequence substantially identical to any of the foregoing sequences (e.g., at least 70%, at least 75%, at least 80%, at least 85%, at least 90%, at least 91%, at least 92%, at least 93%, at least 94%, at least 95%, at least 96%, at least 97%, at least 98%, at least 99% identical, or 100% identical thereto). In some embodiments, the ITRs comprise the nucleotide sequence of any one of SEQ ID NOs: 1860, 1861, 1863, or 1864, or a nucleotide sequence having one, two, or three, but not more than four, modifications, e.g., substitutions, relative to SEQ ID NOs: 1860, 1861, 1863, or 1864.

[0250] Viral genome components: promoters and expression enhancers In some embodiments, the payload region of the viral genome comprises at least one element that enhances transgene target specificity and expression. See, e.g., Powell et al., "Viral Expression Cassette Elements to Enhance Transgene Target Specificity and Expression in Gene Therapy," 2015, the contents of which are incorporated herein by reference in their entirety. Non-limiting examples of elements that enhance transgene target specificity and expression include promoters, endogenous miRNAs, post-transcriptional regulatory elements (PREs), polyadenylation (polyA) signal sequences, upstream enhancers (USEs), CMV enhancers, and introns.

[0251] In some embodiments, expression of the polypeptide in the target cell can be driven by a specific promoter, including, but not limited to, a species-specific, inducible, tissue-specific, or cell cycle-specific promoter (Parr et al., Nat. Med. 3:1145-9, 1997; the contents of which are incorporated herein by reference in their entirety).

[0252] In some embodiments, the viral genome directs expression of the GBA1 protein in a target tissue (e.g., the CNS). In some embodiments, a promoter is considered efficient when it drives expression of one or more polypeptides encoded in the payload region of the viral genome of the AAV particle.

[0253] In some embodiments, the promoter is one that is considered efficient when it drives expression in the cell or tissue to which it is targeted (eg, the CNS). In some embodiments, the promoter drives expression of GCase, GCase and SapA, or GCase and SapC proteins in the targeted tissue over a period of time, such as 1 hour, 2 hours, 3 hours, 4 hours, 5 hours, 6 hours, 7 hours, 8 hours, 9 hours, 10 hours, 11 hours, 12 hours, 13 hours, 14 hours, 15 hours, 16 hours, 17 hours, 18 hours, 19 hours, 20 hours, 21 hours, 22 hours, 23 hours, 1 day, 2 days, 3 days, 4 days, 5 days, 6 days, 1 week, 8 days, 9 days, 10 days, 11 days, 12 days, 13 days, 2 weeks, 15 days, 16 days, 17 days, 18 days, 19 days, The period may be 20 days, 3 weeks, 22 days, 23 days, 24 days, 25 days, 26 days, 27 days, 28 days, 29 days, 30 days, 31 days, 1 month, 2 months, 3 months, 4 months, 5 months, 6 months, 7 months, 8 months, 9 months, 10 months, 11 months, 1 year, 13 months, 14 months, 15 months, 16 months, 17 months, 18 months, 19 months, 20 months, 21 months, 22 months, 23 months, 2 years, 3 years, 4 years, 5 years, 6 years, 7 years, 8 years, 9 years, 10 years or more than 10 years. Expression may occur over 1 to 5 hours, 1 to 12 hours, 1 to 2 days, 1 to 5 days, 1 to 2 weeks, 1 to 3 weeks, 1 to 4 weeks, 1 to 2 months, 1 to 4 months, 1 to 6 months, 2 to 6 months, 3 to 6 months, 3 to 9 months, 4 to 8 months, 6 to 12 months, 1 to 2 years, 1 to 5 years, 2 to 5 years, 3 to 6 years, 3 to 8 years, 4 to 8 years, or 5 to 10 years.

[0254] In some embodiments, the promoter is capable of directing expression of a polypeptide (e.g., a GCase polypeptide, a GCase polypeptide and a prosaposin (PSAP) polypeptide, a GCase polypeptide and a SapA polypeptide, a GCase polypeptide and a SapC polypeptide, a GCase polypeptide and a cell penetrating peptide (e.g., an ApoEII peptide, a TAT peptide, and / or an ApoB peptide), or a GCase polypeptide and a lysosomal targeting peptide) for at least 1 month, 2 months, 3 months, 4 months, 5 months, 6 months, or 7 months. , 7 months, 8 months, 9 months, 10 months, 11 months, 1 year, 2 years, 3 years, 4 years, 5 years, 6 years, 7 years, 8 years, 9 years, 10 years, 11 years, 12 years, 13 years, 14 years, 15 years, 16 years, 17 years, 18 years, 19 years, 20 years, 21 years, 22 years, 23 years, 24 years, 25 years, 26 years, 27 years, 28 years, 29 years, 30 years, 31 years, 32 years, 33 years, 34 years, 35 years, 36 years, 37 years, 38 years, 39 years, 40 years, 41 years, 42 years, 43 years, 44 years, 45 years, 46 years, 47 years, 48 ​​years, 49 years, 50 years, 55 years, 60 years, 65 years or more.

[0255] The promoter may be naturally occurring or non-naturally occurring. Non-limiting examples of promoters include viral promoters, plant promoters, and mammalian promoters. In some embodiments, the promoter may be a human promoter. In some embodiments, the promoter may be truncated.

[0256] In some embodiments, the viral genome includes one or more promoters, e.g., a ubiquitous promoter, that direct expression in multiple cells and / or tissues. In some embodiments, promoters that drive or enhance expression in most mammalian tissues include, but are not limited to, human elongation factor 1 α-subunit (EF1α), cytomegalovirus (CMV) immediate-early enhancer and / or promoter, chicken β-actin (CBA) and its derivative CAG, β-glucuronidase (GUSB), and ubiquitin C (UBC). Expression can be restricted to certain cell types using tissue-specific expression elements, such as, but not limited to, a CNS-specific promoter, a B-cell promoter, a monocyte promoter, a leukocyte promoter, a macrophage promoter, a pancreatic acinar cell promoter, an endothelial cell promoter, a lung tissue promoter, an astrocyte promoter, or various specific nervous system cell-type or tissue-type promoters that can be used to restrict expression to, for example, neurons, astrocytes, or oligodendrocytes.

[0257] In some embodiments, the viral genome includes a nervous system-specific promoter, such as a promoter that drives expression of the payload in neurons, astrocytes, and / or oligodendrocytes. Non-limiting examples of tissue-specific expression elements for neurons include neuron-specific enolase (NSE), platelet-derived growth factor (PDGF), platelet-derived growth factor B chain (PDGF-β), synapsin (Syn), synapsin 1 (Syn1), methyl-CpG-binding protein 2 (MeCP2), Ca2+ / calmodulin-dependent protein kinase II (CaMKII), metabotropic glutamate receptor 2 (mGluR2), neurofilament light chain (NFL) or heavy chain (NFH), β-globin minigene nβ2, preproenkephalin (PPE), enkephalin (Enk), and excitatory amino acid transporter 2 (EAAT2) promoters. Non-limiting examples of tissue-specific expression elements for astrocytes include glial fibrillary acidic protein (GFAP) and EAAT2 promoters. Non-limiting examples of tissue-specific expression elements for oligodendrocytes include the myelin basic protein (MBP) promoter. The prion promoter represents a further tissue-specific promoter useful for driving protein expression in CNS tissues (see Loftus, Stacie K. et al., Human Molecular Genetics, Vol. 11, No. 24, 2002, pp. 3107-3114, the disclosure of which is incorporated by reference in its entirety).

[0258] In some embodiments, the promoter may be less than 1 kb. , 530, 540, 550, 560, 570, 580, 590, 600, 610, 620, 630, 640, 650, 660, 670, 680, 690, 700, 710, 720, 730, 740, 750, 760, 770, 780, 790, 800 nucleotides or more in length. The promoter may have a length of 200 to 300, 200 to 400, 200 to 500, 200 to 600, 200 to 700, 200 to 800, 300 to 400, 300 to 500, 300 to 600, 300 to 700, 300 to 800, 400 to 500, 400 to 600, 400 to 700, 400 to 800, 500 to 600, 500 to 700, 500 to 800, 600 to 700, 600 to 800 or 700 to 800 nucleotides.

[0259] In some embodiments, the promoter can be a combination of two or more components that are the same or different starting or parent promoters, such as, but not limited to, CMV and CBA. 700, 710, 720, 730, 740, 750, 760, 770, 780, 790, 800 nucleotides or more in length. Each component can have a length of 200-300, 200-400, 200-500, 200-600, 200-700, 200-800, 300-400, 300-500, 300-600, 300-700, 300-800, 400-500, 400-600, 400-700, 400-800, 500-600, 500-700, 500-800, 600-700, 600-800, or 700-800 nucleotides. In some embodiments, the promoter is a combination of a 382 nucleotide CMV enhancer sequence and a 260 nucleotide CBA promoter sequence. In some embodiments, the promoter is a combination of a 380 nucleotide CMV enhancer sequence (e.g., comprising the nucleotide sequence of SEQ ID NO: 1831) and a 260 nucleotide CBA promoter sequence (e.g., comprising the nucleotide sequence of SEQ ID NO: 1834).

[0260] In some embodiments, the viral genome comprises a ubiquitous promoter. Non-limiting examples of ubiquitous promoters include CMV, CBA (including derivatives CAG, CB6, CBh, etc.), EF-1α, PGK, UBC, GUSB (hGBp), and UCOE (promoter of HNRPA2B1-CBX3). In some embodiments, the viral genome comprises an EF-1α promoter or an EF-1α promoter variant.

[0261] In some embodiments, the promoter is a ubiquitous promoter as described in Yu et al. (Molecular Pain, 2011, Vol. 7, No. 63), Soderblom et al. (E. Neuro, 2015), Gill et al. (Gene Therapy, 2001, Vol. 8, pp. 1539-1546), and Husain et al. (Gene Therapy, 2009), each of which is incorporated by reference in its entirety.

[0262] In some embodiments, the promoter is not cell-specific. In some embodiments, the promoter is a ubiquitin c (UBC) promoter. The UBC promoter can have a size of 300-350 nucleotides. As a non-limiting example, the UBC promoter is 332 nucleotides. In some embodiments, the promoter is a β-glucuronidase (GUSB) promoter. The GUSB promoter can have a size of 350-400 nucleotides. As a non-limiting example, the GUSB promoter is 378 nucleotides. In some embodiments, the promoter is a neurofilament light chain (NFL) promoter. The NFL promoter can have a size of 600-700 nucleotides. As a non-limiting example, the NFL promoter is 650 nucleotides. In some embodiments, the promoter is a neurofilament heavy chain (NFH) promoter. The NFH promoter can have a size of 900-950 nucleotides. As a non-limiting example, the NFH promoter is 920 nucleotides. In some embodiments, the promoter is a scn8a promoter. The scn8a promoter may have a size of 450-500 nucleotides. As a non-limiting example, the scn8a promoter is 470 nucleotides.

[0263] In some embodiments, the promoter is a phosphoglycerate kinase 1 (PGK) promoter. In some embodiments, the promoter is a chicken beta-actin (CBA) promoter or a functional variant thereof.

[0264] In some embodiments, the promoter is a CB6 promoter or a functional variant thereof. In some embodiments, the promoter is a CB promoter or a functional variant thereof. In some embodiments, the promoter is a minimal CB promoter or a functional variant thereof.

[0265] In some embodiments, the promoter is a CBA promoter or a functional variant thereof. In some embodiments, the promoter is a minimal CBA promoter or a functional variant thereof.

[0266] In some embodiments, the promoter is a cytomegalovirus (CMV) promoter or a functional variant thereof. In some embodiments, the promoter is a CAG promoter or a functional variant thereof.

[0267] In some embodiments, the promoter is the EF1α promoter or a functional variant thereof. In some embodiments, the promoter is a GFAP promoter driving expression of a GCase polypeptide or a GCase polypeptide and an enhancer element (e.g., GCase and SapA or GCase and SapC protein expression) in astrocytes (e.g., as described in Zhang, Min et al., Journal of Neuroscience Research, Vol. 86, No. 13, 2008, pp. 2848-2856, the disclosure of which is incorporated by reference in its entirety).

[0268] In some embodiments, the promoter is a synapsin promoter or a functional variant thereof. In some embodiments, the promoter is an RNA pol III promoter. As a non-limiting example, the RNA pol III promoter is U6. As a non-limiting example, the RNA pol III promoter is H1.

[0269] In some embodiments, the viral genome comprises two promoters. As a non-limiting example, the promoters are the EF1α promoter and the CMV promoter. In some embodiments, the viral genome comprises an enhancer element, a promoter, and / or a 5'UTR intron. The enhancer element, also referred to herein as an "enhancer," can be, but is not limited to, a CMV enhancer, the promoter can be, but is not limited to, a CMV, CBA, UBC, GUSB, NSE, synapsin, MeCP2, and GFAP promoter, and the 5'UTR / intron can be, but is not limited to, an SV40 and CBA-MVM promoter. As non-limiting examples, the enhancers, promoters and / or introns used in combination can be: (1) CMV enhancer, CMV promoter, SV40 5'UTR intron, (2) CMV enhancer, CBA promoter, SV40 5'UTR intron, (3) CMV enhancer, CBA promoter, CBA-MVM 5'UTR intron, (4) UBC promoter, (5) GUSB promoter, (6) NSE promoter, (7) synapsin promoter, (8) MeCP2 promoter, and (9) GFAP promoter.

[0270] In some embodiments, the viral genome comprises an enhancer. In some embodiments, the enhancer comprises a CMVie enhancer. In some embodiments, the viral genome comprises a CMVie enhancer and a CB promoter. In some embodiments, the viral genome comprises a CMVie enhancer and a CMV promoter (e.g., a CMV promoter region). In some embodiments, the viral genome comprises a CMVie enhancer, a CBA promoter or a functional variant thereof, and an intron (e.g., a CAG promoter).

[0271] In some embodiments, the viral genome comprises an engineered promoter, hi other embodiments, the viral genome comprises a promoter from a naturally expressed protein.

[0272] In some embodiments, a CBA promoter is used in the viral genome of an AAV particle described herein, for example, a viral genome encoding a GCase protein or a GCase protein and an enhancing element (e.g., a GCase and SapA protein, a GCase and SapC protein, or a GCase protein and a cell-penetrating peptide, or a variant thereof). In some embodiments, the CBA promoter is engineered for optimal expression of a GCase polypeptide or a GCase polypeptide and an enhancing element described herein (e.g., a prosaposin or saposin protein or variant thereof, a cell-penetrating peptide or variant thereof, or a lysosomal targeting signal).

[0273] Viral genome components: introns In some embodiments, the vector genome comprises at least one intron or a fragment or derivative thereof. In some embodiments, the at least one intron may enhance expression of a GCase protein and / or an enhancing element described herein (e.g., a prosaposin protein or SapC protein or variant thereof, a cell-penetrating peptide (e.g., an ApoEII peptide, a TAT peptide, or an ApoB peptide) or variant thereof, and / or a lysosomal targeting signal) (see, e.g., Powell et al., “Viral Expression Cassette Elements to Enhance Transgene Target Specificity and Expression in Gene Therapy,” 2015, the contents of which are incorporated herein by reference in their entirety). Non-limiting examples of introns include MVM (67-97 bps), F.IX truncated intron 1 (300 bps), β-globin SD / immunoglobulin heavy chain splice acceptor (250 bps), adenovirus splice donor / immunoglobulin splice acceptor (500 bps), SV40 late splice donor / splice acceptor (19S / 16S) (180 bps), and hybrid adenovirus splice donor / IgG splice acceptor (230 bps).

[0274] In some embodiments, the intron may be 100 to 500 nucleotides in length. The intron may have a length of 80, 90, 100, 110, 120, 130, 140, 150, 160, 170, 171, 172, 173, 174, 175, 176, 177, 178, 179, 180, 190, 200, 210, 220, 230, 240, 250, 260, 270, 280, 290, 300, 310, 320, 330, 340, 350, 360, 370, 380, 390, 400, 410, 420, 430, 440, 450, 460, 470, 480, 490, or 500 nucleotides. The intron may have a length of 80 to 100, 80 to 120, 80 to 140, 80 to 160, 80 to 180, 80 to 200, 80 to 250, 80 to 300, 80 to 350, 80 to 400, 80 to 450, 80 to 500, 200 to 300, 200 to 400, 200 to 500, 300 to 400, 300 to 500, or 400 to 500 nucleotides.

[0275] In some embodiments, the intron may be 100 to 600 nucleotides in length, hi some embodiments, the intron is 566 nucleotides in length. In some embodiments, the AAV vector may include an SV40 intron or a fragment or variant thereof. In some embodiments, the promoter may be a CMV promoter. In some embodiments, the promoter may be a CBA promoter. In some embodiments, the promoter may be an H1 promoter.

[0276] In some embodiments, the AAV vector may comprise a β-globin intron or a fragment or variant thereof. In some embodiments, the intron comprises one or more human β-globin sequences (e.g., including fragments / variants thereof). In some embodiments, the promoter may be a CB promoter. In some embodiments, the promoter comprises a CMV promoter. In some embodiments, the promoter comprises a minimal CBA promoter.

[0277] In some embodiments, one or more encoded proteins may be located downstream of an intron in an expression vector, such as, but not limited to, an SV40 intron or a beta-globin intron, or others known in the art. Additionally, the encoded GBA1 protein may also be located upstream of a polyadenylation sequence in an expression vector. In some embodiments, the encoded protein may be located within 1, 2, 3, 4, 5, 6, 7, 8, 9, 10, 11, 12, 13, 14, 15, 16, 17, 18, 19, 20, 21, 22, 23, 24, 25, 26, 27, 28, 29, 30, or more than 30 nucleotides downstream of an intron-containing promoter (e.g., 3' to the intron-containing promoter) and / or upstream of a polyadenylation sequence (e.g., 5' to the polyadenylation sequence) in an expression vector. In some embodiments, the encoded GBA1 protein may be located within 1 to 5, 1 to 10, 1 to 15, 1 to 20, 1 to 25, 1 to 30, 5 to 10, 5 to 15, 5 to 20, 5 to 25, 5 to 30, 10 to 15, 10 to 20, 10 to 25, 10 to 30, 15 to 20, 15 to 25, 15 to 30, 20 to 25, 20 to 30, or 25 to 30 nucleotides downstream from the intron (e.g., 3' to the intron) and / or upstream of the polyadenylation sequence (e.g., 5' to the polyadenylation sequence) in the expression vector. In some embodiments, the encoded protein may be located within or more than the first 1%, 2%, 3%, 4%, 5%, 6%, 7%, 8%, 9%, 10%, 15%, 20%, 25%, or 25% of the nucleotides in the expression vector that are downstream from the intron (e.g., 3' to the intron) and / or upstream of the polyadenylation sequence (e.g., 5' to the polyadenylation sequence). In some embodiments, the encoded protein may be located within the first 1-5%, 1-10%, 1-15%, 1-20%, 1-25%, 5-10%, 5-15%, 5-20%, 5-25%, 10-15%, 10-20%, 10-25%, 15-20%, 15-25%, or 20-25% of the sequence in the expression vector that is downstream from the intron (e.g., 3' to the intron) and / or upstream of the polyadenylation sequence (e.g., 5' to the polyadenylation sequence).

[0278] In certain embodiments, the intron sequence is not an enhancer sequence. In some embodiments, the intron sequence is not a subcomponent of the promoter sequence. In some embodiments, the intron sequence is a subcomponent of the promoter sequence.

[0279] Viral genome components: untranslated regions (UTRs) In some embodiments, the wild-type untranslated region (UTR) of a gene is transcribed but not translated. Generally, the 5' UTR begins at the transcription start site and ends at the start codon, and the 3' UTR begins immediately after the stop codon and continues to the transcription termination signal.

[0280] Features typically found in genes that are abundantly expressed in specific target organs can be engineered into UTRs to enhance stability and protein production. As a non-limiting example, the use of 5' UTRs from mRNAs normally expressed in the liver (e.g., albumin, serum amyloid A, apolipoproteins A / B / E, transferrin, alpha-fetoprotein, erythropoietin, or factor VIII) in the viral genome of AAV particles of the present disclosure can enhance expression in hepatic cell lines or the liver.

[0281] In some embodiments, a viral genome encoding a transgene described herein (e.g., a transgene encoding a GBA1 protein) contains a Kozak sequence. Without wishing to be bound by theory, wild-type 5' untranslated regions (UTRs) contain features that play a role in translation initiation. The Kozak sequence, known to be involved in the ribosomal translation initiation process of many genes, is typically contained in the 5' UTR. The Kozak sequence has the consensus CCR(A / G)CCAUGG (where R is a purine (adenine or guanine) three bases upstream from the start codon (ATG) followed by another "G").

[0282] In some embodiments, the 5'UTR in the viral genome comprises a Kozak sequence. In some embodiments, the 5'UTR in the viral genome does not comprise a Kozak sequence. Without wishing to be bound by theory, wild-type 3'UTRs are known to contain a stretch of adenosines with embedded uridines. This AU-rich signature is particularly common in genes with high turnover rates. AU-rich elements (AREs) can be divided into three classes based on their sequence characteristics and functional properties (Chen et al., 1995, the contents of which are incorporated herein by reference in their entirety): Class I AREs, such as, but not limited to, c-Myc and MyoD, contain several copies of the AUUUA motif dispersed within the U-rich region. Class II AREs, such as, but not limited to, GM-CSF and TNF-α, have two or more overlapping UUAUUUA(U / A)(U / A) nonamers. Class III AREs, such as, but not limited to, c-Jun and myogenin, are less well defined. These U-rich regions do not contain the AUUUA motif. While most proteins that bind to AREs are known to destabilize messengers, members of the ELAV family, most notably HuR, have been demonstrated to increase mRNA stability. HuR binds to all three classes of AREs. Engineering a HuR-specific binding site into the 3'UTR of a nucleic acid molecule leads to HuR binding and thus to message stabilization in vivo.

[0283] The introduction, removal, or modification of 3'UTR AU-rich elements (AREs) can be used to regulate polynucleotide stability. When engineering a particular polynucleotide, such as the payload region of a viral genome, the introduction of one or more copies of AREs can reduce the stability of the polynucleotide, thereby reducing translation and the resulting protein production. Similarly, identifying and removing or mutating AREs can increase intracellular stability, thereby increasing the translation and production of the resulting protein.

[0284] In some embodiments, the 3'UTR of the viral genome may contain an oligo(dT) sequence for templated addition of a polyA tail. Any UTR from any gene known in the art can be incorporated into the viral genome of an AAV particle. These UTRs or portions thereof can be oriented in the same direction as in the gene from which they were selected, or their orientation or position can be modified. In some embodiments, the UTRs used in the viral genome of an AAV particle can be reversed, shortened, lengthened, or created with one or more other 5' or 3' UTRs known in the art. As used herein, the term "modified," when referring to a UTR, means that the UTR has been altered in some way compared to a reference sequence. For example, the 3' or 5' UTR can be modified relative to the wild-type or native UTR by changing its orientation or position as taught above, or by the inclusion of additional nucleotides, deletion of nucleotides, nucleotide exchanges, or rearrangements.

[0285] In some embodiments, the viral genome of the AAV particle comprises at least one artificial UTR that is not a mutant of a wild-type UTR. In some embodiments, the viral genome of the AAV particle comprises UTRs selected from a family of transcripts whose proteins share a common function, structure, feature, or characteristic.

[0286] Viral genome components: miR binding sites Tissue- or cell-specific expression of the AAV viral particles of the present invention can be enhanced by introducing tissue- or cell-specific regulatory sequences, such as promoters, enhancers, microRNA binding sites, e.g., detargeting sites. Without wishing to be bound by theory, it is believed that the encoded miR binding site can regulate, e.g., prevent, suppress, or otherwise inhibit, the expression of a gene of interest on the viral genome of the present invention based on the expression of a corresponding endogenous microRNA (miRNA) or a corresponding regulated exogenous miRNA in a tissue or cell, e.g., a non-target cell or tissue. In some embodiments, the miR binding site regulates, e.g., reduces, the expression of a payload encoded by the viral genome of an AAV particle described herein in a cell or tissue in which the corresponding mRNA is expressed. In some embodiments, the miR binding site regulates, e.g., reduces, the expression of the encoded GBA1 protein in cells or tissues of the DRG, liver, hematopoietic lineage, or a combination thereof.

[0287] In some embodiments, the viral genome of an AAV particle described herein comprises a nucleotide sequence encoding a microRNA binding site, e.g., a detargeting site. In some embodiments, the viral genome of an AAV particle described herein comprises a nucleotide sequence encoding a miR binding site, a microRNA binding site sequence (miR BS) or its reverse complement.

[0288] In some embodiments, the miR binding site sequence or a nucleotide sequence encoding the miR binding site is located in the 3'-UTR region of the viral genome (e.g., 3' to the nucleic acid sequence encoding the payload), e.g., before the polyA sequence, in the 5'-UTR region of the viral genome (e.g., 5' to the nucleic acid sequence encoding the payload), or both.

[0289] In some embodiments, the encoded miR binding site series contains at least 1 to 5 copies of a miR binding site (miR BS), e.g., 1 to 3, 2 to 4, or 3 to 5 copies, or at least 1, at least 2, at least 3, at least 4, at least 5, or more copies. In some embodiments, the encoded miR binding site series contains 4 copies of a miR binding site. In some embodiments, all copies are identical, e.g., contain the same miR binding site. In some embodiments, the miR binding sites within the encoded miR binding site series are contiguous and not separated by spacers. In some embodiments, the miR binding sites within the encoded miR binding site series are separated by spacers, e.g., non-coding sequences. In some embodiments, the spacer is about 1 to about 6 nucleotides or about 5 to about 10 nucleotides, e.g., about 7 to 8 nucleotides, in length. In some embodiments, the spacer is about 8 nucleotides in length. In some embodiments, the spacer sequence comprises one or more of (i) GGAT, (ii) CACGTG, (iii) GCATGC, or repeats of one or more of (i)-(iii). In some embodiments, the spacer comprises the nucleotide sequence of SEQ ID NO: 1848 or a nucleotide sequence having one, two, or more, but not more than four modifications of SEQ ID NO: 1848.

[0290] In some embodiments, the encoded miR binding site series contains at least 1 to 5 copies of a miR binding site (miR BS), e.g., 1 to 3, 2 to 4, or 3 to 5 copies, or at least 1, at least 2, at least 3, at least 4, at least 5, or more copies. In some embodiments, at least 1 copy, at least 2 copies, at least 3 copies, at least 4 copies, at least 5 copies, or all are different, e.g., contain different miR binding sites. In some embodiments, the miR binding sites within the encoded miR binding site series are contiguous and not separated by a spacer. In some embodiments, the miR binding sites within the encoded miR binding site series are separated by a spacer, e.g., a non-coding sequence. In some embodiments, the spacer is about 1 to about 6 nucleotides, or about 5 to about 10 nucleotides, e.g., about 7 to 8 nucleotides, or about 8 nucleotides in length. In some embodiments, the spacer sequence comprises one or more of (i) GGAT, (ii) CACGTG, or (iii) GCATGC, or repeats of one or more of (i)-(iii). In some embodiments, the spacer comprises a nucleotide sequence of GATAGTTA (SEQ ID NO: 1848) or a nucleotide sequence having one, two, or more, but not more than four, modifications of GATAGTTA (SEQ ID NO: 1848).

[0291] In some embodiments, the encoded miR binding site is substantially identical (e.g., at least 70%, 75%, 80%, 85%, 90%, 95%, 99%, or 100% identical) to a miR in the host cell. In some embodiments, the encoded miR binding site contains at least 1, 2, 3, 4, or 5 mismatches, or no more than 6, 7, 8, 9, or 10 mismatches, with a miR in the host cell. In some embodiments, the mismatched nucleotides are contiguous. In some embodiments, the mismatched nucleotides are discontinuous. In some embodiments, the mismatched nucleotides appear outside the seed region binding sequence of the miR binding site, such as at one or both ends of the miR binding site. In some embodiments, the encoded miR binding site is 100% identical to a miR in the host cell.

[0292] In some embodiments, the nucleotide sequence encoding the miR binding site is substantially complementary (e.g., at least 70%, at least 75%, at least 80%, at least 85%, at least 90%, at least 95%, at least 99%, or 100% complementary) to an miR in a host cell. In some embodiments, the sequence complementary to the nucleotide sequence encoding the miR binding site contains at least one, at least two, at least three, at least four, or at least five mismatches, or no more than six, seven, eight, nine, or ten mismatches, compared to the corresponding miR in a host cell. In some embodiments, the mismatched nucleotides are contiguous. In some embodiments, the mismatched nucleotides are discontinuous. In some embodiments, the mismatched nucleotides appear outside the seed region-binding sequence of the miR binding site, such as at one or both ends of the miR binding site. In some embodiments, the encoded miR binding site is 100% complementary to an miR in a host cell.

[0293] In some embodiments, the encoded miR binding site or encoded miR binding site sequence is about 10 to about 125 nucleotides in length, e.g., about 10 to about 50 nucleotides, about 10 to about 100 nucleotides, about 50 to about 100 nucleotides, about 50 to about 125 nucleotides, or about 100 to about 125 nucleotides in length. In some embodiments, the encoded miR binding site or encoded miR binding site sequence is about 7 to about 28 nucleotides in length, e.g., about 8 to 28 nucleotides, about 7 to 28 nucleotides, about 8 to 18 nucleotides, about 12 to 28 nucleotides, about 20 to 26 nucleotides, about 22 nucleotides, about 24 nucleotides, or about 26 nucleotides in length, and optionally includes at least one contiguous region (e.g., 7 or 8 nucleotides) complementary (e.g., fully complementary or partially complementary) to the seed sequence of a miRNA (e.g., miR122, miR142, miR183).

[0294] In some embodiments, the encoded miR binding site or sequence of encoded miR binding sites is 22 nucleotides in length. In some embodiments, the encoded miR binding site is complementary (e.g., fully complementary or partially complementary) to a miR expressed in the liver or hepatocytes, such as miR122. In some embodiments, the encoded miR binding site or encoded miR binding site series comprises a miR122 binding site sequence. In some embodiments, the encoded miR122 binding site comprises the nucleotide sequence ACAAACACCATTGTCACACTCCA (SEQ ID NO: 1865) or a nucleotide sequence having at least 50%, at least 55%, at least 60%, at least 65%, at least 70%, at least 75%, at least 80%, at least 85%, at least 90%, at least 95%, at least 99%, or 100% sequence identity to SEQ ID NO: 1865, or having one or more, two or more, three or more, four or more, five or more, six or more, or seven or more modifications, but not more than 10 modifications, e.g., modifications that may create a mismatch between the encoded miR binding site and the corresponding miRNA. In some embodiments, the viral genome comprises at least 3, 4, or 5 copies of an encoded miR122 binding site, e.g., an encoded miR122 binding site sequence, and optionally the encoded miR122 binding site sequence comprises a nucleotide sequence of ACAAACACCATTGTCACACTCCACACAAACACCATTGTCACACTCCACACAAACACCATTGTCACACTCCA (SEQ ID NO: 1866), or a nucleotide sequence having at least 50%, at least 55%, at least 60%, at least 65%, at least 70%, at least 75%, at least 80%, at least 85%, at least 90%, at least 95%, at least 99%, or 100% sequence identity to SEQ ID NO: 1866, or one, two, three, four, five, six, seven, or more modifications, but not more than ten modifications, e.g., modifications that may cause mismatches between the encoded miR binding site and the corresponding miRNA. In some embodiments, at least two of the encoded miR122 binding sites are directly linked, e.g., without a spacer.In other embodiments, at least two of the encoded miR122-binding sites are separated by a spacer, e.g., 1, 2, 3, 4, 5, 6, 7, 8, 9, or 10 nucleotides in length, located between two or more consecutive encoded miR122-binding site sequences. In embodiments, the spacer is about 1-6 nucleotides or about 5-10 nucleotides, e.g., about 7-8 nucleotides or about 8 nucleotides in length. In some embodiments, the spacer sequence comprises one or more of (i) GGAT, (ii) CACGTG, or (iii) GCATGC, or one or more repeats of (i)-(iii). In some embodiments, the spacer comprises the nucleotide sequence of SEQ ID NO: 1848 or a nucleotide sequence having one, two, or more modifications, but not more than four modifications, of SEQ ID NO: 1848.

[0295] In some embodiments, the encoded miR binding site is complementary (e.g., fully complementary or partially complementary) to a miR expressed in the hematopoietic lineage, including immune cells (e.g., antigen-presenting cells or APCs, including dendritic cells (DCs), macrophages, and B lymphocytes). In some embodiments, the encoded miR binding site is complementary (e.g., fully complementary or partially complementary) to a miR expressed in the hematopoietic lineage, and comprises, for example, a nucleotide sequence disclosed in U.S. Patent Application Publication No. 2018 / 0066279, the contents of which are incorporated herein by reference in their entirety.

[0296] In some embodiments, the encoded miR binding site or encoded miR binding site sequence comprises a miR-142-3p binding site sequence. In some embodiments, the encoded miR-142-3p binding site comprises a nucleotide sequence having at least 50%, at least 55%, at least 60%, at least 65%, at least 70%, at least 75%, at least 80%, at least 85%, at least 90%, at least 95%, at least 99%, or 100% sequence identity to the nucleotide sequence of TCCATAAAGTAGGAAACACTACA (SEQ ID NO: 1869), SEQ ID NO: 1842, or one or more, two or more, three or more, four or more, five or more, six or more, or seven or more modifications, but not more than 10 modifications, e.g., modifications that may create a mismatch between the encoded miR binding site and the corresponding miRNA. In some embodiments, the viral genome comprises at least three, at least four, or at least five copies of the encoded miR-142-3p binding site, e.g., a series of encoded miR-142-3p binding sites. In some embodiments, the at least three, at least four, or at least five (e.g., four) copies of the encoded miR-142-3p binding site are contiguous (e.g., not separated by a spacer) or separated by a spacer. In some embodiments, the spacer is about 1 to 6 nucleotides or about 5 to about 10 nucleotides, e.g., about 7 to 8 nucleotides or about 8 nucleotides in length. In some embodiments, the spacer sequence comprises one or more of (i) GGAT, (ii) CACGTG, or (iii) GCATGC, or one or more repeats of (i)-(iii). In some embodiments, the spacer comprises the nucleotide sequence of SEQ ID NO: 1848 or a nucleotide sequence having one, two, or more modifications, but not more than four modifications, of SEQ ID NO: 1848.

[0297] In some embodiments, the encoded miR binding site is complementary (e.g., fully complementary or partially complementary) to a miR expressed in DRG (dorsal root ganglion) neurons, such as miR183, miR182, and / or miR96 binding site. In some embodiments, the encoded miR binding site is complementary (e.g., fully complementary or partially complementary) to a miR expressed in DRG neurons. In some embodiments, the encoded miR binding site comprises a nucleotide sequence disclosed, for example, in WO 2020 / 132455, the contents of which are incorporated herein by reference in their entirety.

[0298] In some embodiments, the encoded miR binding site or encoded series of miR binding sites comprises a miR183 binding site sequence.

[0299] [ka]

[0300] (SEQ ID NO: 1847) or a nucleotide sequence having at least 50%, at least 55%, at least 60%, at least 65%, at least 70%, at least 75%, at least 80%, at least 85%, at least 90%, at least 95%, at least 99%, or 100% sequence identity to SEQ ID NO: 1847, or having one or more, two or more, three or more, four or more, five or more, six or more, or seven or more modifications, but not more than 10 modifications, e.g., modifications that may result in a mismatch between the encoded miR-183 binding site and the corresponding miRNA. In some embodiments, the sequence complementary (e.g., fully complementary or partially complementary) to the seed sequence corresponds to the double-underlined portion of the encoded miR-183 binding site sequence. In some embodiments, the viral genome comprises the encoded miR183 binding site, e.g., at least 3, at least 4, or at least 5 copies (e.g., 4 copies) of the encoded miR183 binding site. In some embodiments, the viral genome comprises at least four copies of the encoded miR183 binding site. In some embodiments, the viral genome comprises an encoded miR183 binding site comprising four copies of the miR183 binding site. In some embodiments, the at least three, at least four, or at least five (e.g., four) copies of the encoded miR183 binding site are contiguous (e.g., not separated by a spacer) or separated by a spacer. In some embodiments, the spacer is about 1 to about 6 nucleotides or about 5 to about 10 nucleotides, e.g., about 7 to 8 nucleotides or about 8 nucleotides in length. In some embodiments, the spacer comprises the nucleotide sequence of SEQ ID NO: 1848 or a nucleotide sequence having one or more, two or more, or three or more, but not more than four modifications of SEQ ID NO: 1848.In some embodiments, the encoded miR183 binding site sequence comprises the nucleotide sequence of SEQ ID NO:1849 or a nucleotide sequence having at least 50%, at least 55%, at least 60%, at least 65%, at least 70%, at least 75%, at least 80%, at least 85%, at least 90%, at least 95%, at least 99%, or 100% sequence identity to SEQ ID NO:1849, or having one or more, two or more, three or more, four or more, five or more, six or more, or seven or more, but not more than 10 modifications.

[0301] In some embodiments, the encoded miR binding site or encoded miR binding site sequence comprises a miR182 binding site sequence. In some embodiments, the encoded miR182 binding site comprises a nucleotide sequence of AGTGTGAGTTCTACCATTGCCAAA (SEQ ID NO: 1867), a nucleotide sequence having at least 50%, at least 55%, at least 60%, at least 65%, at least 70%, at least 75%, at least 80%, at least 85%, at least 90%, at least 95%, at least 99%, or 100% sequence identity to SEQ ID NO: 1867, or one or more, two or more, three or more, four or more, five or more, six or more, or seven or more modifications, but not more than 10 modifications, e.g., modifications that may result in mismatches between the encoded miR binding site and the corresponding miRNA. In some embodiments, the viral genome comprises at least 3, at least 4, or at least 5 copies of the encoded miR182 binding site, e.g., the encoded miR182 binding site sequence. In some embodiments, at least three, at least four, or at least five (e.g., four) copies of the encoded miR182 binding site are contiguous (e.g., not separated by a spacer) or separated by a spacer. In some embodiments, the spacer is about 1 to about 6 nucleotides or about 5 to about 10 nucleotides, e.g., about 7 to 8 nucleotides or about 8 nucleotides in length. In some embodiments, the spacer comprises the nucleotide sequence of SEQ ID NO: 1848 or a nucleotide sequence having one or more, two or more, or three or more, but not more than four modifications of SEQ ID NO: 1848.

[0302] In some embodiments, the encoded miR binding site or encoded miR binding site sequence comprises a miR96 binding site sequence. In some embodiments, the encoded miR96 binding site comprises a nucleotide sequence of AGCAAAAATGTGCTAGTGCCAAA (SEQ ID NO: 1868), a sequence having at least 50%, at least 55%, at least 60%, at least 65%, at least 70%, at least 75%, at least 80%, at least 85%, at least 90%, at least 95%, at least 99%, or 100% sequence identity to SEQ ID NO: 1868, or one or more, two or more, three or more, four or more, five or more, six or more, or seven or more modifications, but not more than 10 modifications, e.g., modifications that may result in mismatches between the encoded miR binding site and the corresponding miRNA. In some embodiments, the viral genome comprises at least 3, at least 4, or at least 5 copies of the encoded miR96 binding site, e.g., the encoded miR96 binding site sequence. In some embodiments, at least three, at least four, or at least five (e.g., four) copies of the encoded miR96 binding site are contiguous (e.g., not separated by a spacer) or separated by a spacer. In some embodiments, the spacer is about 1 to about 6 nucleotides or about 5 to about 10 nucleotides, e.g., about 7 to 8 nucleotides or about 8 nucleotides in length. In some embodiments, the spacer comprises the nucleotide sequence of SEQ ID NO: 1848 or a nucleotide sequence having one or more, two or more, or three or more, but not more than four modifications of SEQ ID NO: 1848.

[0303] In some embodiments, the encoded miR binding site series includes miR122-binding sites, miR142-binding sites, miR183-binding sites, miR182-binding sites, miR96-binding sites, or combinations thereof. In some embodiments, the encoded miR binding site series includes at least 3, at least 4, or at least 5 copies of miR122-binding sites, miR142-binding sites, miR183-binding sites, miR182-binding sites, miR96-binding sites, or combinations thereof. In some embodiments, at least two of the encoded miR binding sites are directly linked, e.g., without a spacer. In other embodiments, at least two of the encoded miR binding sites are separated by a spacer, e.g., 1, 2, 3, 4, 5, 6, 7, 8, 9, or 10 nucleotides in length, positioned between two or more consecutive encoded miR binding site sequences. In embodiments, the spacer is at least about 5 to about 10 nucleotides in length, e.g., about 7 to 8 nucleotides or about 8 nucleotides in length. In some embodiments, the spacer sequence comprises one or more of (i) GGAT, (ii) CACGTG, (iii) GCATGC, or repeats of one or more of (i)-(iii). In some embodiments, the spacer comprises the nucleotide sequence of SEQ ID NO: 1848 or a nucleotide sequence having one, two, or more, but not more than four modifications of SEQ ID NO: 1848.

[0304] In some embodiments, the encoded miR binding site series includes at least 3-5 copies (e.g., 4 copies) of a combination of at least 2, 3, 4, 5, or all of the following: miR122 binding site, miR142 binding site, miR183 binding site, miR182 binding site, and miR96 binding site, where each miR binding site in the series is contiguous (e.g., not separated by a spacer) or separated by a spacer. In some embodiments, the spacer is about 1 to about 6 nucleotides or about 5 to about 10 nucleotides, e.g., about 7-8 nucleotides or about 8 nucleotides in length. In some embodiments, the spacer sequence includes one or more of (i) GGAT, (ii) CACGTG, and (iii) GCATGC, or one or more repeats of (i)-(iii). In some embodiments, the spacer includes the nucleotide sequence of SEQ ID NO: 1848 or a nucleotide sequence having one, two, or more modifications, but not more than four modifications, of SEQ ID NO: 1848.

[0305] Viral genome components: Polyadenylation sequences In some embodiments, the viral genome of the AAV particle of the present disclosure comprises at least one polyadenylation (polyA) sequence. The viral genome of the AAV particle may comprise a polyadenylation sequence between the 3' end of the payload coding sequence and the 5' end of the 3'UTR. In some embodiments, the polyA signal region is located 3' to the nucleic acid encoding the payload, for example, the transgene encoding the GBA1 protein described herein.

[0306] In some embodiments, the poly(A) signal region comprises a length of about 100 to 600 nucleotides, e.g., about 100 to 500 nucleotides, about 100 to 400 nucleotides, about 100 to 300 nucleotides, about 100 to 200 nucleotides, about 200 to 600 nucleotides, about 200 to 500 nucleotides, about 200 to 400 nucleotides, about 200 to 300 nucleotides, about 300 to 600 nucleotides, about 300 to 500 nucleotides, about 300 to 400 nucleotides, about 400 to 600 nucleotides, about 400 to 500 nucleotides, or about 500 to 600 nucleotides. In some embodiments, the poly(A) signal region comprises a length of about 100 to about 150 nucleotides, e.g., about 127 nucleotides. In some embodiments, the poly(A) signal region comprises a length of about 450 to about 500 nucleotides, e.g., about 477 nucleotides. In some embodiments, the polyA signal region comprises a length of about 520 to about 560 nucleotides, for example, about 552 nucleotides, hi some embodiments, the polyA signal region comprises a length of about 127 nucleotides.

[0307] In some embodiments, the viral genome comprises a human growth hormone (hGH) polyA sequence. In some embodiments, the viral genome comprises an hGH polyA as described above and a payload region encoding a GCase protein or a GCase and an enhancer element (e.g., a prosaposin, SapA, or SapC protein or variant thereof, a cell-penetrating peptide (e.g., an ApoEII peptide, a TAT peptide, or an ApoB peptide), or a lysosomal targeting peptide), e.g., a sequence as provided in Tables 3 and 4, or a fragment or variant thereof.

[0308] Viral genome components: filler sequences In some embodiments, the viral genome comprises one or more filler sequences. The filler sequences can be wild-type sequences or engineered sequences. The filler sequences can be variants of wild-type sequences. In some embodiments, the filler sequences are derivatives of human albumin.

[0309] In some embodiments, the viral genome comprises one or more filler sequences so that the length of the viral genome reaches an optimal size for packaging. In some embodiments, the viral genome comprises at least one filler sequence so that the length of the viral genome reaches about 2.3 kb. In some embodiments, the viral genome comprises at least one filler sequence so that the length of the viral genome reaches about 4.6 kb.

[0310] In some embodiments, the viral genome is a single-stranded (ss) viral genome and is between about 0.1 kb and 3.8 kb, including but not limited to, 0.1 kb, 0.2 kb, 0.3 kb, 0.4 kb, 0.5 kb, 0.6 kb, 0.7 kb, 0.8 kb, 0.9 kb, 1 kb, 1.1 kb, 1.2 kb, 1.3 kb, 1.4 kb, 1.5 kb, 1.6 kb, 1.7 kb , 1.8 kb, 1.9 kb, 2 kb, 2.1 kb, 2.2 kb, 2.3 kb, 2.4 kb, 2.5 kb, 2.6 kb, 2.7 kb, 2.8 kb, 2.9 kb, 3 kb, 3.1 kb, 3.2 kb, 3.3 kb, 3.4 kb, 3.5 kb, 3.6 kb, 3.7 kb, or 3.8 kb, independently or in combination. In some embodiments, the full length filler sequence in the vector genome is 3.1 kb. In some embodiments, the full length filler sequence in the vector genome is 2.7 kb. In some embodiments, the full length filler sequence in the vector genome is 0.8 kb. In some embodiments, the full length filler sequence in the vector genome is 0.4 kb. In some embodiments, the length of each filler sequence in the vector genome is 0.8 kb. In some embodiments, each filler sequence in the vector genome is 0.4 kb in length.

[0311] In some embodiments, the viral genome is a self-complementary (sc) viral genome and comprises one or more filler sequences, independently or in combination, having a length of about 0.1 kb to 1.5 kb, including but not limited to, 0.1 kb, 0.2 kb, 0.3 kb, 0.4 kb, 0.5 kb, 0.6 kb, 0.7 kb, 0.8 kb, 0.9 kb, 1 kb, 1.1 kb, 1.2 kb, 1.3 kb, 1.4 kb, or 1.5 kb. In some embodiments, the full-length filler sequence in the vector genome is 0.8 kb. In some embodiments, the full-length filler sequence in the vector genome is 0.4 kb. In some embodiments, the length of each filler sequence in the vector genome is 0.8 kb. In some embodiments, the length of each filler sequence in the vector genome is 0.4 kb.

[0312] In some embodiments, the viral genome comprises any portion of the filler sequence. The viral genome may comprise 1%, 2%, 3%, 4%, 5%, 6%, 7%, 8%, 9%, 10%, 15%, 20%, 25%, 30%, 35%, 40%, 45%, 50%, 55%, 60%, 65%, 70%, 75%, 80%, 85%, 90%, 95%, or 99% of the filler sequence.

[0313] In some embodiments, the viral genome is a single-stranded (ss) viral genome and includes one or more filler sequences to achieve a viral genome length of approximately 4.6 kb. In some embodiments, the viral genome includes at least one filler sequence, the filler sequence being located 3' to the 5' ITR sequence. In some embodiments, the viral genome includes at least one filler sequence, the filler sequence being located 5' to the promoter sequence. In some embodiments, the viral genome includes at least one filler sequence, the filler sequence being located 3' to the polyadenylation signal sequence. In some embodiments, the viral genome includes at least one filler sequence, the filler sequence being located 5' to the 3' ITR sequence. In some embodiments, the viral genome includes at least one filler sequence, the filler sequence being located between two intron sequences. In some embodiments, the viral genome includes at least one filler sequence, the filler sequence being located within an intron sequence. In some embodiments, the viral genome comprises two filler sequences, a first filler sequence located 3' to the 5' ITR sequence and a second filler sequence located 3' to the polyadenylation signal sequence. In some embodiments, the viral genome comprises two filler sequences, a first filler sequence located 5' to the promoter sequence and a second filler sequence located 3' to the polyadenylation signal sequence. In some embodiments, the viral genome comprises two filler sequences, a first filler sequence located 3' to the 5' ITR sequence and a second filler sequence located 5' to the 5' ITR sequence.

[0314] In some embodiments, the viral genome is a self-complementary (sc) viral genome and includes one or more filler sequences to achieve a viral genome length of approximately 2.3 kb. In some embodiments, the viral genome includes at least one filler sequence, the filler sequence being located 3' to the 5' ITR sequence. In some embodiments, the viral genome includes at least one filler sequence, the filler sequence being located 5' to the promoter sequence. In some embodiments, the viral genome includes at least one filler sequence, the filler sequence being located 3' to the polyadenylation signal sequence. In some embodiments, the viral genome includes at least one filler sequence, the filler sequence being located 5' to the 3' ITR sequence. In some embodiments, the viral genome includes at least one filler sequence, the filler sequence being located between two intron sequences. As a non-limiting example, the viral genome includes at least one filler sequence, the filler sequence being located within an intron sequence. In some embodiments, the viral genome comprises two filler sequences, a first filler sequence located 3' to the 5' ITR sequence and a second filler sequence located 3' to the polyadenylation signal sequence. In some embodiments, the viral genome comprises two filler sequences, a first filler sequence located 5' to the promoter sequence and a second filler sequence located 3' to the polyadenylation signal sequence. In some embodiments, the viral genome comprises two filler sequences, a first filler sequence located 3' to the 5' ITR sequence and a second filler sequence located 5' to the 5' ITR sequence.

[0315] In some embodiments, the viral genome may comprise one or more filler sequences between one or more regions of the viral genome. In some embodiments, the filler region may be located before a region such as, but not limited to, a payload region, an inverted terminal repeat (ITR), a promoter region, an intron region, an enhancer region, a polyadenylation signal sequence region, and / or an exon region. In some embodiments, the filler region may be located after a region such as, but not limited to, a payload region, an inverted terminal repeat (ITR), a promoter region, an intron region, an enhancer region, a polyadenylation signal sequence region, and / or an exon region. In some embodiments, the filler region may be located before and after a region such as, but not limited to, a payload region, an inverted terminal repeat (ITR), a promoter region, an intron region, an enhancer region, a polyadenylation signal sequence region, and / or an exon region.

[0316] In some embodiments, the viral genome may include one or more filler sequences bisecting at least one region of the viral genome. The bisected region of the viral genome may include 1%, 2%, 3%, 4%, 5%, 6%, 7%, 8%, 9%, 10%, 15%, 20%, 25%, 30%, 35%, 40%, 45%, 50%, 55%, 60%, 65%, 70%, 75%, 80%, 85%, 90%, 95%, or 99% of the region 5' to the filler sequence region. In some embodiments, the filler sequence may bisect at least one region such that 10% of the region is located 5' to the filler sequence and 90% of the region is located 3' to the filler sequence. In some embodiments, the filler sequence may bisect at least one region such that 20% of the region is located 5' to the filler sequence and 80% of the region is located 3' to the filler sequence. In some embodiments, the filler sequence may bisect at least one region such that 30% of the region is located 5' from the filler sequence and 70% of the region is located 3' from the filler sequence. In some embodiments, the filler sequence may bisect at least one region such that 40% of the region is located 5' from the filler sequence and 60% of the region is located 3' from the filler sequence. In some embodiments, the filler sequence may bisect at least one region such that 50% of the region is located 5' from the filler sequence and 50% of the region is located 3' from the filler sequence. In some embodiments, the filler sequence may bisect at least one region such that 60% of the region is located 5' from the filler sequence and 40% of the region is located 3' from the filler sequence. In some embodiments, the filler sequence may bisect at least one region such that 70% of the region is located 5' from the filler sequence and 30% of the region is located 3' from the filler sequence. In some embodiments, the filler sequence may bisect at least one region such that 80% of the region is located 5' of the filler sequence and 20% of the region is located 3' of the filler sequence. In some embodiments, the filler sequence may bisect at least one region such that 90% of the region is located 5' of the filler sequence and 10% of the region is located 3' of the filler sequence.

[0317] In some embodiments, the viral genome comprises a filler sequence after the 5' ITR. In some embodiments, the viral genome comprises a filler sequence after the promoter region. In some embodiments, the viral genome comprises a filler sequence after the payload region. In some embodiments, the viral genome comprises a filler sequence after the intron region. In some embodiments, the viral genome comprises a filler sequence after the enhancer region. In some embodiments, the viral genome comprises a filler sequence after the polyadenylation signal sequence region. In some embodiments, the viral genome comprises a filler sequence after the exon region.

[0318] In some embodiments, the viral genome comprises a filler sequence before the promoter region. In some embodiments, the viral genome comprises a filler sequence before the payload region. In some embodiments, the viral genome comprises a filler sequence before the intron region. In some embodiments, the viral genome comprises a filler sequence before the enhancer region. In some embodiments, the viral genome comprises a filler sequence before the polyadenylation signal sequence region. In some embodiments, the viral genome comprises a filler sequence before the exon region.

[0319] In some embodiments, the viral genome comprises a filler sequence before the 3' ITR. In some embodiments, the filler sequence may be located between two regions, such as, but not limited to, between the 5' ITR and a promoter region. In some embodiments, the filler sequence may be located between two regions, such as, but not limited to, between the 5' ITR and a payload region. In some embodiments, the filler sequence may be located between two regions, such as, but not limited to, between the 5' ITR and an intron region. In some embodiments, the filler sequence may be located between two regions, such as, but not limited to, between the 5' ITR and an enhancer region. In some embodiments, the filler sequence may be located between two regions, such as, but not limited to, between the 5' ITR and a polyadenylation signal sequence region.

[0320] In some embodiments, the filler sequence may be located between two regions, such as, but not limited to, between the 5' ITR and an exon region. In some embodiments, the filler sequence may be located between two regions, such as, but not limited to, between a promoter region and a payload region. In some embodiments, the filler sequence may be located between two regions, such as, but not limited to, between a promoter region and an intron region. In some embodiments, the filler sequence may be located between two regions, such as, but not limited to, between a promoter region and an enhancer region. In some embodiments, the filler sequence may be located between two regions, such as, but not limited to, between a promoter region and a polyadenylation signal sequence region. In some embodiments, the filler sequence may be located between two regions, such as, but not limited to, between a promoter region and an exon region. In some embodiments, the filler sequence may be located between two regions, such as, but not limited to, between a promoter region and a 3' ITR.

[0321] In some embodiments, the filler sequence may be located between two regions, such as, but not limited to, between the payload region and the intron region. In some embodiments, the filler sequence may be located between two regions, such as, but not limited to, between the payload region and the enhancer region. In some embodiments, the filler sequence may be located between two regions, such as, but not limited to, between the payload region and the polyadenylation signal sequence region. In some embodiments, the filler sequence may be located between two regions, such as, but not limited to, between the payload region and the exon region.

[0322] In some embodiments, the filler sequence may be located between two regions, such as, but not limited to, between the payload region and the 3' ITR. Viral genome components: payload In some embodiments, the present disclosure provides an AAV particle comprising a viral genome encoding a GBA1 protein, e.g., a GCase protein, encoded by the nucleotide sequence of SEQ ID NO: 2001 or SEQ ID NO: 2002. In some embodiments, the viral genome comprises a promoter operably linked to a nucleotide sequence encoding the GBA1 protein, e.g., SEQ ID NO: 2001 or SEQ ID NO: 2002. In some embodiments, the viral genome comprises the nucleotide sequence of SEQ ID NO: 2002.

[0323] In some embodiments, the disclosure herein provides constructs that allow for improved expression of GCase proteins delivered by gene therapy vectors. In some embodiments, the present disclosure provides constructs that allow for improved biodistribution of GCase proteins delivered by gene therapy vectors.

[0324] In some embodiments, the present disclosure provides constructs that allow for improved intracellular biodistribution or trafficking of GCase proteins delivered by gene therapy vectors. In some embodiments, the present disclosure provides constructs that allow for improved transport of GCase protein delivered by a gene therapy vector to the lysosomal membrane.

[0325] In some embodiments, the present disclosure relates to compositions containing or comprising a nucleic acid sequence encoding a GBA1 protein, or a functional fragment or variant thereof, and methods of administering the compositions in vitro or in vivo in subjects, e.g., human subjects and / or animal models, of a disease, e.g., a disease in which expression of GBA is implicated.

[0326] AAV particles of the present disclosure can include a nucleic acid sequence encoding at least one "payload." As used herein, "payload" or "payload region" refers to one or more polynucleotides or polynucleotide regions encoded by or within the viral genome, or expression products of such polynucleotides or polynucleotide regions, such as transgenes, polypeptides, or multipolypeptides, e.g., polynucleotides encoding GBA1 protein or functional fragments or variants thereof. The payload can include any nucleic acid known in the art to be useful for expressing GBA1 protein (by supplementation of the protein product using a regulatory nucleic acid or by gene replacement) in target cells transduced or contacted with an AAV particle carrying the payload.

[0327] In some embodiments, the present disclosure provides a nucleotide sequence encoding a GBA1 protein for use in an AAV genome, the nucleotide sequence comprising a codon-optimized, CpG-reduced (e.g., CpG-depleted) GBA1 coding sequence. In some embodiments, the CpG-reduced (e.g., CpG-depleted) GBA1 coding sequence provides improved in vivo toxicity, e.g., reduced immunogenicity in a human or animal subject. In some embodiments, the nucleotide sequence further comprises one or more, e.g., all of, a 5' ITR sequence, a CMVie sequence, a CB promoter sequence, an intron sequence, a signal sequence, a polyA sequence, and a 3' ITR sequence. In some embodiments, the GBA1 protein encoded by the nucleotide sequence has an amino acid sequence that is 100% identical to a wild-type GBA1 protein. In some embodiments, the wild-type GBA1 coding sequence is as provided by NCBI Reference Sequence NCBI Reference Sequence NP_000148.2 (SEQ ID NO: 14 of WO2019070893, which is incorporated herein by reference).

[0328] In some embodiments, the AAV genome encodes a payload construct that comprises a combination of coding and non-coding nucleic acid sequences. In some embodiments, the viral genome encodes two or more payloads. As a non-limiting example, a viral genome encoding two or more payloads can be replicated and packaged into a viral particle. A target cell transduced with a viral particle containing two or more payloads can express each of the payloads in a single cell.

[0329] In some embodiments, the viral genome may encode a coding or non-coding RNA. In certain embodiments, the adeno-associated viral vector particle further comprises at least one cis element selected from the group consisting of a Kozak sequence, a backbone sequence, and an intron sequence.

[0330] In some embodiments, the payload is a polypeptide, including a secreted protein, an intracellular protein, an extracellular protein, and / or a membrane protein. In some embodiments, the encoded protein is structural or functional. In some embodiments, the protein encoded by the viral genome includes, but is not limited to, a mammalian protein. In certain embodiments, the AAV particle comprises a viral genome encoding a GBA1 protein or a functional fragment or variant thereof. The AAV particles described herein may be useful in the field of human disease, veterinary applications, and various in vivo and in vitro settings.

[0331] In some embodiments, the payload comprises a polypeptide that serves as a marker protein to assess cell transformation and expression, a fusion with a desired biological activity, a gene product that complements a genetic defect, an RNA molecule, a transcription factor and / or another gene product involved in gene regulation and / or expression.

[0332] In some embodiments, the payload includes a gene therapy product, including but not limited to a polypeptide, RNA molecule, or other gene product that provides a desired therapeutic effect when expressed in a target cell. In some embodiments, the gene therapy product may include a non-functional gene or a substitute for an absent, under-expressed, or mutated gene. In some embodiments, the gene therapy product may include a non-functional protein or polypeptide or a substitute for an absent, under-expressed, misfolded, overly degraded, or mutated protein or polypeptide. For example, the gene therapy product may include a polynucleotide encoding a GBA1 protein for treating GCase deficiency or a GBA1-related disorder. In some embodiments, the gene therapy product includes a nucleotide sequence encoding a polyGBA1 protein.

[0333] In some embodiments, the payload encodes a messenger RNA (mRNA). As used herein, the term "messenger RNA" (mRNA) refers to any polynucleotide that encodes a polypeptide of interest and that, when translated, is capable of producing the encoded polypeptide of interest in vitro, in vivo, in situ, or ex vivo. Certain embodiments provide mRNA or variants thereof as encoding GCase.

[0334] In some embodiments, the protein or polypeptide or functional variant thereof encoded by the payload construct encoding GCase is about 50 to about 4500 amino acid residues in length (hereinafter, in this context, "X amino acids in length" refers to X amino acid residues). In some embodiments, the encoded protein or polypeptide is 50 to 2000 amino acids in length. In some embodiments, the encoded protein or polypeptide is 50 to 1000 amino acids in length. In some embodiments, the encoded protein or polypeptide is 50 to 1500 amino acids in length. In some embodiments, the encoded protein or polypeptide is 50 to 1000 amino acids in length. In some embodiments, the encoded protein or polypeptide is 50 to 800 amino acids in length. In some embodiments, the encoded protein or polypeptide is 50 to 600 amino acids in length. In some embodiments, the encoded protein or polypeptide is 50 to 400 amino acids in length. In some embodiments, the encoded protein or polypeptide is 50 to 200 amino acids in length. In some embodiments, the encoded protein or polypeptide is 50 to 100 amino acids in length. In some embodiments, the encoded protein or polypeptide is 497 amino acids in length.

[0335] A payload construct encoding a payload may include or encode a selectable marker. A selectable marker may include a gene sequence, or a protein or polypeptide encoded by a gene sequence, expressed in a host cell that allows for identification, selection, and / or purification of the host cell from a population of cells that may or may not express the selectable marker. In some embodiments, a selectable marker provides resistance to survive a selection process that would otherwise kill the host cell, such as treatment with an antibiotic. In some embodiments, an antibiotic selectable marker may include one or more antibiotic resistance factors, including, but not limited to, neomycin resistance (e.g., neo), hygromycin resistance, kanamycin resistance, and / or puromycin resistance.

[0336] In some embodiments, the payload construct encoding the payload may include a selectable marker including, but not limited to, β-lactamase, luciferase, β-galactosidase, or any other reporter gene as that term is understood in the art, including cell surface markers such as CD4 or truncated nerve growth factor (NGFR) (for GFP, see WO 96 / 23810; Heim et al., Current Biology). Biology, Vol. 2, pp. 178-182, 1996; Heim et al., Proc. Natl. Acad. Sci. USA, 1995; or Heim et al., Science, Vol. 373, pp. 663-664, 1995; for β-lactamases, see WO 96 / 30540, the contents of each of which are incorporated herein by reference in their entireties.

[0337] In some embodiments, the payload construct encoding the selectable marker may comprise a fluorescent protein. Fluorescent proteins as described herein may include any fluorescent marker, including but not limited to green, yellow, and / or red fluorescent proteins (GFP, YFP, and / or RFP). In some embodiments, the payload construct encoding the selectable marker may comprise a human influenza hemagglutinin (HA) tag.

[0338] In certain embodiments, the nucleic acid for expressing the payload in the target cell is incorporated into the viral genome and is located between two ITR sequences. In some embodiments, the payload construct further comprises a nucleic acid sequence encoding a peptide that binds with high affinity to the cation-independent mannose 6-phosphate (M6P) receptor (CI-MPR), as described in International Publication No. WO 2019213180 A1 (the disclosure of which is incorporated herein by reference in its entirety). The peptide that binds to the CI-MPR can be, for example, an IGF2 peptide or a variant thereof. Binding to the CI-MPR can facilitate cellular uptake or delivery and intracellular or subcellular targeting of the therapeutic protein provided by the gene therapy vector.

[0339] Payload component: signal sequence In some embodiments, the nucleic acid sequence comprising the transgene encoding the payload, eg, the GBA1 protein, comprises a nucleic acid sequence encoding a signal sequence (eg, a signal sequence region herein).

[0340] In some embodiments, the nucleotide sequence encoding the signal sequence is located 5' to the nucleotide sequence encoding the GBA1 protein. In some embodiments, the encoded GBA1 protein comprises a signal sequence at its N-terminus, which signal sequence is optionally cleaved during cellular processing and / or localization of the GBA1 protein and / or the enhancing element.

[0341] In some embodiments, the signal sequence comprises SEQ ID NO: 2005, or a sequence at least 85% identical thereto (e.g., at least 85%, at least 90%, at least 91%, at least 92%, at least 93%, at least 94%, at least 95%, at least 96%, at least 97%, at least 98%, or at least 99% identical). In some embodiments, the signal sequence comprises the amino acid sequence of SEQ ID NO: 1853, or an amino acid sequence at least at least 90% identical thereto (e.g., at least 90%, at least 91%, at least 92%, at least 93%, at least 94%, at least 95%, at least 96%, at least 97%, at least 98%, or at least 99% identical).

[0342] Exemplary GCase (GBA1) Protein Payloads In some embodiments, the payload, eg, the payload of a viral genome described herein, is a wild-type GBA1 protein, eg, a wild-type GBA1 protein.

[0343] Tables 2A and 2B provide exemplary polynucleotide sequences encoding GBA1 proteins and polypeptide sequences of exemplary GBA1 proteins that can be used in the viral genomes disclosed herein and that can constitute the GBA1 protein payload. In some embodiments, a GBA1 protein suitable for delivery in an AAV disclosed herein is encoded by the nucleotide sequence of SEQ ID NO:2001 or SEQ ID NO:2002.

[0344] [Table 2]

[0345] [Table 3-1]

[0346] [Table 3-2]

[0347] [Table 3-3]

[0348] [Table 3-4]

[0349] [Table 3-5]

[0350] [Table 3-6]

[0351] [Table 3-7]

[0352] In some embodiments, the nucleotide sequence encoding the GBA1 protein described herein contains a reduced number of CpG motifs (e.g., lacks all CpG motifs) compared to, for example, the nucleotide sequence of SEQ ID NO: 1776 or 1777.

[0353] In some embodiments, the encoded GBA1 protein comprises the amino acid sequence of SEQ ID NO:1774 or SEQ ID NO:1775. In some embodiments, the nucleotide sequence encoding the GBA1 protein or a functional variant thereof comprises the nucleotide sequence of SEQ ID NO: 2002. In some embodiments, the nucleotide sequence encoding the GBA1 protein comprises the sequence of SEQ ID NO: 2001, and the encoded GBA1 protein comprises a signal sequence, wherein the signal sequence is encoded by the nucleotide sequence of SEQ ID NO: 2005.

[0354] In some embodiments, the codon-optimized nucleotide sequence encoding the GBA1 protein described herein (e.g., SEQ ID NO:2001 or SEQ ID NO:2002) contains a donor splice site, e.g.,

[0355] [ka]

[0356] or nucleotide 49 of the 117 nucleotides numbered according to the nucleotide sequence of SEQ ID NO: 1776,

[0357] [ka]

[0358] nucleotide sequence of SEQ ID NO: 1776, e.g., nucleotide 49 of the 117 nucleotides numbered according to SEQ ID NO: 1776.

[0359] [ka]

[0360] In some embodiments, the codon-optimized nucleotide sequence encoding the GBA1 protein described herein (e.g., SEQ ID NO:2001 or SEQ ID NO:2002) has more than 121, 122, 123, 124, 125, 126, 127, 128, 129, 130, 131, 132, 133, 134, 135, 136, 137, 138, 139, 140, or more unique modifications, e.g., mutations, compared to the nucleotide sequence of SEQ ID NO:1776. In some embodiments, the codon-optimized nucleotide sequence of the GBA1 protein described herein (e.g., SEQ ID NO:2001 or SEQ ID NO:2002) comprises a unique GC content profile. Without wishing to be bound by theory, in some embodiments, it is believed that modifying the GC content of the nucleotide sequence of the GBA1 protein described herein enhances expression of the codon-optimized nucleotide sequence in cells (e.g., human cells or neuronal cells). In some embodiments, the codon-optimized nucleotide sequence of the GBA1 protein described herein (e.g., SEQ ID NO:2001 or SEQ ID NO:2002) has a reduced GC content compared to the wild-type GBA1 nucleotide sequence. In some embodiments, the codon-optimized nucleotide sequence of the GBA1 protein described herein (e.g., SEQ ID NO:2001 or SEQ ID NO:2002) contains a reduced number of CpG motifs (e.g., lacks all CpG motifs) compared to the wild-type GBA1 coding sequence (e.g., comprising the nucleotide sequence of SEQ ID NO:1776 or 1777). In some embodiments, the codon-optimized nucleotide sequence of the GBA1 protein described herein (e.g., SEQ ID NO:2001 or SEQ ID NO:2002) does not have any CpG motifs. Without wishing to be bound by theory, in some embodiments, a sequence depleted of CpG nucleotides may have reduced in vivo toxicity, e.g., immunogenicity.

[0361] In some embodiments, the viral genome comprises a payload region encoding a GCase protein, which may be from any species, including but not limited to, human, non-human primate, or rodent.

[0362] In some embodiments, the viral genome includes a payload region encoding a human (Homo sapiens) GCase protein, and in some embodiments, the methods disclosed herein can be used to generate the GCase protein.

[0363] Payload component: Enhancement element In some embodiments, the viral genome described herein that encodes the GBA1 protein comprises an enhancing element or a functional variant thereof. In some embodiments, the encoded enhancement comprises a prosaposin (PSAP) protein, a saposin C (SapC) protein or a functional variant thereof, a cell-penetrating peptide (e.g., an ApoEII peptide, a TAT peptide, and / or an ApoB peptide) or a functional variant thereof, or a lysosomal targeting signal or a functional variant thereof.

[0364] In some embodiments, the viral genome comprises a payload region that further encodes a prosaposin (PSAP) protein or a saposin C (SapC) protein or a functional variant thereof, e.g., as described herein, e.g., in Table 3A or Table 3B.

[0365] [Table 4]

[0366] [Table 5-1]

[0367] [Table 5-2]

[0368] [Table 5-3]

[0369] [Table 5-4]

[0370] Exemplary GBA1 AAV viral genome sequence regions and inter-ITR sequences In some embodiments, a viral genome, e.g., an AAV viral genome or vector genome, described herein comprises a promoter operably linked to a transgene encoding a GBA1 protein. In some embodiments, the viral genome further comprises an inverted terminal repeat region, an enhancer, an intron, an miR binding site, a polyA tract, or a combination thereof. Exemplary sequence regions within the inter-ITR sequences for viral genomes according to this description are provided in Table 4.

[0371] [Table 6]

[0372] In some embodiments, the viral genome comprises a nucleotide sequence that is at least 70%, at least 75%, at least 80%, at least 85%, at least 90%, at least 95%, or at least 99% sequence identity to an inverted terminal repeat region (ITR) provided in Table 4 or any of the ITR sequences in Table 5.

[0373] The present disclosure also provides, in some embodiments, a GBA1 protein encoded by SEQ ID NO:2001 or a nucleotide sequence having at least at least 93%, at least 94%, at least 95%, at least 97%, at least 98%, or at least 99% sequence identity thereto, or SEQ ID NO:2002 or a nucleotide sequence having at least at least 94%, at least 95%, at least 96%, at least 97%, at least 98%, or at least 99% sequence identity thereto. In some embodiments, the viral genome comprises a promoter comprising the nucleotide sequence SEQ ID NO:1834 or a nucleotide sequence having at least at least 70%, at least 75%, at least 80%, at least 85%, at least 90%, at least 95%, or at least 99% sequence identity thereto.

[0374] In some embodiments, the viral genome of the AAV particles described herein comprises the nucleotide sequence of SEQ ID NO: 2006 and SEQ ID NO: 2007, or a sequence that is at least 97%, at least 98%, or at least 99% identical thereto, e.g., the nucleotide sequence from the 5' ITR to the 3' ITR.

[0375] In some embodiments, the present disclosure also provides a GBA1 protein (e.g., a GBA1 protein) encoded by SEQ ID NO: 2001 or a sequence at least 93% identical thereto, or SEQ ID NO: 2002 or a sequence at least 94% identical thereto.

[0376] In some embodiments, the viral genome encoding the GBA1 protein is a wtGBA1 viral genome, which comprises a codon-optimized nucleotide sequence encoding a wild-type GBA1 protein, which nucleotide sequence comprises a reduced number of CpG nucleotides (e.g., lacks all CpG motifs) compared to a wild-type GBA1 coding sequence (e.g., comprises the nucleotide sequence of SEQ ID NO: 1776 or 1777). In some embodiments, the viral genome encoding the GBA1 protein is a wtGBA1 viral genome, which comprises a codon-optimized nucleotide sequence encoding a wild-type GBA1 protein, which nucleotide sequence does not comprise any CpG nucleotides.

[0377] [Table 7-1]

[0378] [Table 7-2]

[0379] [Table 7-3]

[0380] [Table 7-4]

[0381] [Table 7-5]

[0382] [Table 7-6]

[0383] [Table 8-1]

[0384] [Table 8-2]

[0385] [Table 8-3]

[0386] [Table 8-4]

[0387] [Table 8-5]

[0388] [Table 8-6]

[0389] [Table 8-7]

[0390] [Table 8-8]

[0391] [Table 8-9]

[0392] In some embodiments, the viral genome of an AAV particle described herein comprises a nucleotide sequence that includes one or more, e.g., all, of the components provided in Table 9 or Table 10, or a sequence that has at least 70%, at least 75%, at least 80%, at least 85%, at least 90%, at least 95%, or at least 99% sequence identity thereto.

[0393] In some embodiments, the viral genome of an AAV particle described herein comprises a GBA1 variant nucleotide sequence comprising SEQ ID NO:2002, e.g., as shown in Table 9, or a sequence with at least 95% identity thereto. In some embodiments, the AAV particle comprises improved GC content and reduced immunogenicity compared to an AAV particle comprising a GBA1 variant nucleotide sequence comprising SEQ ID NO:1773, e.g., as shown in Table 7. In some embodiments, the viral genome of an AAV particle described herein comprises a signal sequence and a GBA1 variant nucleotide sequence comprising SEQ ID NOs:2005 and 2002, e.g., as shown in Table 9, or a sequence with at least 95% identity thereto. In some embodiments, the AAV particle comprises improved GC content and reduced immunogenicity compared to an AAV particle comprising a signal sequence and a GBA1 variant nucleotide sequence comprising SEQ ID NOs:1850 and 1773, e.g., as shown in Table 7. In some embodiments, the viral genome of an AAV particle described herein comprises a nucleotide sequence comprising SEQ ID NO:2006, or a sequence having at least 95% identity thereto, e.g., as shown in Table 9. In some embodiments, the AAV particle comprises improved GC content and reduced immunogenicity compared to an AAV particle comprising a nucleotide sequence comprising SEQ ID NO:1812, e.g., as shown in Table 7.

[0394] In some embodiments, the viral genome of an AAV particle described herein comprises a GBA1 variant nucleotide sequence comprising SEQ ID NO: 2002, e.g., as shown in Table 10, or a sequence with at least 95% identity thereto. In some embodiments, the AAV particle comprises improved GC content and reduced immunogenicity compared to an AAV particle comprising a GBA1 variant nucleotide sequence comprising SEQ ID NO: 1773, e.g., as shown in Table 8. In some embodiments, the viral genome of an AAV particle described herein comprises a signal sequence and a GBA1 variant nucleotide sequence comprising SEQ ID NOs: 2005 and 2002, e.g., as shown in Table 10, or a sequence with at least 95% identity thereto. In some embodiments, the AAV particle comprises improved GC content and reduced immunogenicity compared to an AAV particle comprising a signal sequence and a GBA1 variant nucleotide sequence comprising SEQ ID NOs: 1850 and 1773, e.g., as shown in Table 8. In some embodiments, the viral genome of an AAV particle described herein comprises a nucleotide sequence comprising SEQ ID NO:2007, or a sequence having at least 95% identity thereto, e.g., as shown in Table 10. In some embodiments, the AAV particle comprises improved GC content and reduced immunogenicity compared to an AAV particle comprising a nucleotide sequence comprising SEQ ID NO:1828, e.g., as shown in Table 8.

[0395] [Table 9]

[0396] [Table 10]

[0397] [Table 11]

[0398] In some embodiments, the AAV particles comprise a nucleotide sequence encoding a wild-type GBA1 protein, wherein the nucleotide sequence comprises the sequence of SEQ ID NO: 2002 or a sequence that is at least 93% identical thereto.

[0399] In some embodiments, the AAV particle comprising the nucleotide sequence of SEQ ID NO: 2002 further comprises an ITR sequence that is 130 nucleotides in length, and optionally the ITR sequence comprises the nucleotide sequence of SEQ ID NO: 1829 or SEQ ID NO: 1830 or a sequence that is at least 70% (e.g., at least 70%, at least 80%, at least 90%, at least 91%, at least 92%, at least 93%, at least 94%, at least 95%, at least 96%, at least 97%, at least 98%, or at least 99%) identical thereto. In some embodiments, the AAV particles comprise a 5' ITR comprising the nucleotide sequence of SEQ ID NO: 1829 or a sequence that is at least 70% (e.g., at least 70%, at least 80%, at least 90%, at least 91%, at least 92%, at least 93%, at least 94%, at least 95%, at least 96%, at least 97%, at least 98%, or at least 99%) identical thereto, and / or a 3' ITR comprising the nucleotide sequence of SEQ ID NO: 1830 or a sequence that is at least 70% (e.g., at least 70%, at least 80%, at least 90%, at least 91%, at least 92%, at least 93%, at least 94%, at least 95%, at least 96%, at least 97%, at least 98%, or at least 99%) identical thereto.

[0400] In some embodiments, the AAV particle comprising the nucleotide sequence of SEQ ID NO: 2002 further comprises a CB promoter operably linked to the CMVie sequence and / or the nucleotide sequence encoding the GBA1 protein, and optionally, the CMVie sequence comprises the nucleotide sequence of SEQ ID NO: 1831 or a sequence at least 70% (e.g., at least 70%, at least 80%, at least 90%, at least 91%, at least 92%, at least 93%, at least 94%, at least 95%, at least 96%, at least 97%, at least 98%, or at least 99%) identical thereto, and the CB promoter comprises the nucleotide sequence of SEQ ID NO: 1834 or a sequence at least 70% (e.g., at least 70%, at least 80%, at least 90%, at least 91%, at least 92%, at least 93%, at least 94%, at least 95%, at least 96%, at least 97%, at least 98%, or at least 99%) identical thereto.

[0401] In some embodiments, the AAV particle comprising the nucleotide sequence of SEQ ID NO: 2002 further comprises a sequence encoding a signal peptide, wherein the sequence encoding the signal peptide comprises the nucleotide sequence of SEQ ID NO: 2005 or a sequence that is at least 70% (e.g., at least 70%, at least 80%, at least 90%, at least 91%, at least 92%, at least 93%, at least 94%, at least 95%, at least 96%, at least 97%, at least 98%, or at least 99%) identical thereto, and the sequence encoding the signal peptide is 5' to the sequence encoding the GBA1 protein.

[0402] In some embodiments, an AAV particle comprising the nucleotide sequence of SEQ ID NO: 2002 further comprises an intron region comprising the nucleotide sequence of SEQ ID NO: 1842 or a sequence at least 70% (e.g., at least 70%, at least 80%, at least 90%, at least 91%, at least 92%, at least 93%, at least 94%, at least 95%, at least 96%, at least 97%, at least 98%, or at least 99%) identical thereto.

[0403] In some embodiments, the AAV particle comprising the nucleotide sequence of SEQ ID NO: 2002 further comprises a polyA sequence comprising the nucleotide sequence of SEQ ID NO: 1846 or a sequence at least 70% (e.g., at least 70%, at least 80%, at least 90%, at least 91%, at least 92%, at least 93%, at least 94%, at least 95%, at least 96%, at least 97%, at least 98%, or at least 99%) identical thereto.

[0404] In some embodiments, the AAV particle comprising the nucleotide sequence of SEQ ID NO:2002 comprises, from 5' to 3', ITRs that include the nucleotide sequence of SEQ ID NO:1829 or a sequence that is at least 70% (e.g., at least 70%, at least 80%, at least 90%, at least 91%, at least 92%, at least 93%, at least 94%, at least 95%, at least 96%, at least 97%, at least 98%, or at least 99%) identical thereto, the nucleotide sequence of SEQ ID NO:1831 or a sequence that is at least 70% (e.g., at least 70%, at least 80%, at least 90%, at least 91%, at least 92%, at least 93%, at least 94%, at least 95%, at least 96%, at least 97%, at least 98%, or at least 99%) identical thereto, , at least 80%, at least 90%, at least 91%, at least 92%, at least 93%, at least 94%, at least 95%, at least 96%, at least 97%, at least 98%, or at least 99% identical thereto, the nucleotide sequence of SEQ ID NO: 1834 or a sequence at least 70% (e.g., at least 70%, at least 80%, at least 90%, at least 91%, at least 92%, at least 93%, at least 94%, at least 95%, at least 96%, at least 97%, at least 98%, or at least 99%) identical thereto. a CB promoter comprising a sequence that is at least 98% or at least 99% identical thereto; an intron comprising the nucleotide sequence of SEQ ID NO: 1842 or a sequence that is at least 70% (e.g., at least 70%, at least 80%, at least 90%, at least 91%, at least 92%, at least 93%, at least 94%, at least 95%, at least 96%, at least 97%, at least 98%, or at least 99%) identical thereto; a nucleotide sequence of SEQ ID NO: 2005 or a sequence that is at least 70% (e.g., at least 70%, at least 80%, at least 90%, at least 91%, at least 92%, at least 93%, at least 94%, at least 95%, at least 96%, at least 97%, at least 98%, or at least 99%) identical thereto; 1846 and / or a signal sequence comprising a sequence that is at least 70% (e.g., at least 70%, at least 80%, at least 90%, at least 91%, at least 92%, at least 93%, at least 94%, at least 95%, at least 96%, at least 97%, at least 98%, or at least 99%) identical thereto, a polyA sequence comprising the nucleotide sequence of SEQ ID NO: 1846 and / or the nucleotide sequence of SEQ ID NO: 1830 or at least 70% (e.g., at least 70%, at least 80%, at least 90%, at least 91%, at least 92%, at least 93%, at least 94%, at least 95%,It further includes one or more, for example all, of the ITRs comprising a sequence that is at least 96%, at least 97%, at least 98%, or at least 99% identical to the ITR.

[0405] In some embodiments, the AAV particles comprise a viral genome comprising a sequence encoding a GBA1 protein, the sequence comprising SEQ ID NO:2002 or a sequence at least 93% identical thereto (e.g., at least 95%, at least 96%, at least 97%, at least 98%, or at least 99% identical thereto). In some embodiments, the AAV particles comprise a viral genome comprising the nucleotide sequence of SEQ ID NO:2006 (GBA_VG35) or a nucleotide sequence at least 97% identical thereto (e.g., at least 97%, at least 98%, or at least 99%) identical thereto.In some embodiments, the viral genome comprising the nucleotide sequence of SEQ ID NO:2006 comprises, in 5' to 3' order, a 5' ITR sequence region comprising the nucleotide sequence of SEQ ID NO:1829 or a nucleotide sequence at least 95% (e.g., at least 95%, at least 96%, at least 97%, at least 98%, or at least 99%) identical thereto; a CMVie enhancer comprising the nucleotide sequence of SEQ ID NO:1831 or a nucleotide sequence at least 95% identical thereto; a CB promoter comprising the nucleotide sequence of SEQ ID NO:1834 or a nucleotide sequence at least 95% (e.g., at least 95%, at least 96%, at least 97%, at least 98%, or at least 99%) identical thereto; an intron comprising the nucleotide sequence of SEQ ID NO:1842 or a nucleotide sequence at least 95% (e.g., at least 95%, at least 96%, at least 97%, at least 98%, or at least 99%) identical thereto; a nucleotide sequence encoding a GBA1 protein comprising the nucleotide sequence of SEQ ID NO:2002 or a nucleotide sequence at least 94% (e.g., at least 94%, at least 95%, at least 96%, at least 97%, at least 98%, or at least 99%) identical to the nucleotide sequence of SEQ ID NO:2002; a polyadenylation sequence comprising the nucleotide sequence of SEQ ID NO:1846 or a nucleotide sequence at least 95% (e.g., at least 95%, at least 96%, at least 97%, at least 98%, or at least 99%) identical thereto; and a 3' ITR sequence region comprising the nucleotide sequence of SEQ ID NO:1830 or a nucleotide sequence at least 95% (e.g., at least 95%, at least 96%, at least 97%, at least 98%, or at least 99%) identical thereto.

[0406] In some embodiments, the AAV viral genome does not contain a miR-183 binding site. In some embodiments, the nucleotide sequence encoding the GBA1 protein comprises a sequence that is at least 94% identical to SEQ ID NO:2002. In some embodiments, the nucleotide sequence encoding the GBA protein comprises a sequence that is at least 95% identical to SEQ ID NO:2002. In some embodiments, the nucleotide sequence encoding the GBA1 protein comprises a sequence that is at least 96% identical to SEQ ID NO:2002. In some embodiments, the nucleotide sequence encoding the GBA1 protein comprises a sequence that is at least 97% identical to SEQ ID NO:2002. In some embodiments, the nucleotide sequence encoding the GBA1 protein comprises a sequence that is at least 98% identical to SEQ ID NO:2002. In some embodiments, the nucleotide sequence encoding the GBA1 protein comprises a sequence that is at least 99% identical to SEQ ID NO:2002. In some embodiments, the nucleotide sequence encoding the GBA1 protein comprises SEQ ID NO:2002.

[0407] In some embodiments, a viral genome comprising the nucleotide sequence of SEQ ID NO: 2006 or a nucleotide sequence at least 97% (e.g., at least 97%, at least 98%, or at least 99%) identical thereto encodes a GBA1 protein comprising the amino acid sequence of SEQ ID NO: 1775.

[0408] [Table 12]

[0409] In some embodiments, the AAV particle comprises a nucleotide sequence encoding a wild-type GBA1 protein, wherein the nucleotide sequence comprises the sequence of SEQ ID NO: 2002 or a sequence that is at least 93% (e.g., at least 93%, at least 94%, at least 95%, at least 96%, at least 97%, at least 98% or at least 99%) identical thereto.

[0410] In some embodiments, AAV particles comprising the sequence of SEQ ID NO:2002 further comprise at least one miR183 binding site. In some embodiments, AAV particles comprising the sequence of SEQ ID NO:2002 further comprise four miR183 binding sites, each miR183 binding site comprising the sequence of SEQ ID NO:1847 or a sequence at least 70% (e.g., at least 70%, at least 80%, at least 90%, at least 91%, at least 92%, at least 93%, at least 94%, at least 95%, at least 96%, at least 97%, at least 98%, or at least 99%) identical thereto.

[0411] In some embodiments, the AAV particle comprising the sequence of SEQ ID NO: 2002 further comprises at least one spacer sequence between the two miR binding sites, and each spacer sequence comprises the sequence of SEQ ID NO: 1848 or a sequence at least 75% identical thereto (e.g., at least 75%, at least 80%, at least 90%, at least 91%, at least 92%, at least 93%, at least 94%, at least 95%, at least 96%, at least 97%, at least 98%, or at least 99% identical thereto).

[0412] In some embodiments, the AAV particle comprising the sequence of SEQ ID NO: 2002 further comprises an miR binding site sequence comprising SEQ ID NO: 1849 or a sequence at least 70% (e.g., at least 70%, at least 80%, at least 90%, at least 91%, at least 92%, at least 93%, at least 94%, at least 95%, at least 96%, at least 97%, at least 98%, or at least 99%) identical thereto.

[0413] In some embodiments, the AAV particle comprising the nucleotide sequence of SEQ ID NO:2002 comprises, from 5' to 3', ITRs that include the nucleotide sequence of SEQ ID NO:1829 or a sequence at least 70% (e.g., at least 70%, at least 80%, at least 90%, at least 91%, at least 92%, at least 93%, at least 94%, at least 95%, at least 96%, at least 97%, at least 98%, or at least 99%) identical thereto, the nucleotide sequence of SEQ ID NO:1831 or a sequence at least 70% (e.g., at least CMVie sequences, including sequences that are 70%, at least 80%, at least 90%, at least 91%, at least 92%, at least 93%, at least 94%, at least 95%, at least 96%, at least 97%, at least 98%, or at least 99% identical thereto, the nucleotide sequence of SEQ ID NO: 1834 or at least 70% (e.g., at least 70%, at least 80%, at least 90%, at least 91%, at least 92%, at least 93%, at least 94%, at least 95%, at least 96%, at least 97%, at least 98%, or at least 99%) identical thereto. a CB promoter comprising a sequence which is at least 7%, at least 98%, or at least 99%) identical thereto; an intron comprising the nucleotide sequence of SEQ ID NO: 1842 or a sequence which is at least 70% (e.g., at least 70%, at least 80%, at least 90%, at least 91%, at least 92%, at least 93%, at least 94%, at least 95%, at least 96%, at least 97%, at least 98%, or at least 99%) identical thereto; a nucleotide sequence of SEQ ID NO: 2005 or a sequence which is at least 70% (e.g., at least 70%, at least 80%, at least 90%, at least 91%, at least 92%, at least 93%, at least 94%, at least 95%, at least 96%, at least 97%, at least 98%, or at least 99%) identical thereto; %, at least 80%, at least 90%, at least 91%, at least 92%, at least 93%, at least 94%, at least 95%, at least 96%, at least 97%, at least 98%, or at least 99% identical thereto, the nucleotide sequence of SEQ ID NO: 1849 or a sequence at least 70% (e.g., at least 70%, at least 80%, at least 90%, at least 91%, at least 92%, at least 93%, at least 94%, at least 95%, at least 96%, at least 97%,and / or one or more, e.g., all, of an miR183 binding site sequence comprising a sequence at least 98% or at least 99% identical thereto, a polyA sequence comprising the nucleotide sequence of SEQ ID NO: 1846, and / or an ITR comprising the nucleotide sequence of SEQ ID NO: 1830 or a sequence at least 70% (e.g., at least 70%, at least 80%, at least 90%, at least 91%, at least 92%, at least 93%, at least 94%, at least 95%, at least 96%, at least 97%, at least 98%, or at least 99%) identical thereto.

[0414] In some embodiments, the AAV particles comprise a viral genome comprising a sequence encoding a GBA1 protein, the sequence comprising SEQ ID NO:2002 or a sequence at least 93% identical thereto (e.g., at least 93%, at least 94%, at least 95%, at least 96%, at least 97%, at least 98%, or at least 99% identical thereto). In some embodiments, the AAV particles comprise a viral genome comprising the nucleotide sequence of SEQ ID NO:2007 (GBA_VG36) or a nucleotide sequence at least 97% identical thereto (e.g., at least 97%, at least 98%, or at least 99% identical thereto). In some embodiments, the viral genome comprising the nucleotide sequence of SEQ ID NO:2007 comprises, in 5' to 3' order: a 5' ITR sequence region comprising the nucleotide sequence of SEQ ID NO:1829 or a nucleotide sequence at least 95% identical thereto (e.g., at least 95%, at least 96%, at least 97%, at least 98%, or at least 99% identical thereto); a CMVie enhancer comprising the nucleotide sequence of SEQ ID NO:1831 or a nucleotide sequence at least 95% identical thereto (e.g., at least 95%, at least 96%, at least 97%, at least 98%, or at least 99% identical thereto); a nucleotide sequence of SEQ ID NO:1834 or a nucleotide sequence at least 95% identical thereto (e.g., at least 95%, at least 96%, at least 97%, at least 98%, or at least 99% identical thereto); a CB promoter comprising a nucleotide sequence of SEQ ID NO: 1842 or a nucleotide sequence at least 95% identical thereto (e.g., at least 95%, at least 96%, at least 97%, at least 98%, or at least 99% identical thereto); an intron comprising the nucleotide sequence of SEQ ID NO: 1842 or a nucleotide sequence at least 95% identical thereto (e.g., at least 95%, at least 96%, at least 97%, at least 98%, or at least 99% identical thereto); a nucleotide sequence encoding a signal sequence comprising the nucleotide sequence of SEQ ID NO: 2005 or a nucleotide sequence at least 95% identical thereto (e.g., at least 95%, at least 96%, at least 97%, at least 98%, or at least 99% identical thereto); a nucleotide sequence encoding a signal sequence comprising the nucleotide sequence of SEQ ID NO: 2002 or a nucleotide sequence at least 93% (e.g., at least 93%, at least 97%, at least 98%, or at least 99% identical thereto);a nucleotide sequence encoding a GBA1 protein comprising a nucleotide sequence identical thereto (e.g., at least 93%, at least 94%, at least 95%, at least 96%, at least 97%, at least 98%, or at least 99%) to the sequence of SEQ ID NO: 1849 or a sequence at least 95% identical thereto (e.g., at least 95%, at least 96%, at least 97%, at least 98%, or at least 99% identical thereto); a miR183 binding site sequence comprising a nucleotide sequence of SEQ ID NO: 1846 or a nucleotide sequence at least 95% identical thereto (e.g., at least 95%, at least 96%, at least 97%, at least 98%, or at least 99% identical thereto); and a 3' ITR sequence region comprising a nucleotide sequence of SEQ ID NO: 1830 or a nucleotide sequence at least 95% identical thereto (e.g., at least 95%, at least 96%, at least 97%, at least 98%, or at least 99% identical thereto).

[0415] In some embodiments, a viral genome comprising the nucleotide sequence of SEQ ID NO: 2007 or a nucleotide sequence at least 97% identical thereto (e.g., at least 97%, at least 98%, or at least 99% identical thereto) encodes a GBA1 protein comprising the amino acid sequence of SEQ ID NO: 1775.

[0416] In some embodiments, the AAV viral genome further comprises a nucleic acid encoding a capsid protein, e.g., a structural protein. In some embodiments, the capsid protein comprises a VP1 polypeptide, a VP2 polypeptide, and / or a VP3 polypeptide. In some embodiments, the VP1 polypeptide, the VP2 polypeptide, and / or the VP3 polypeptide are encoded by at least one Cap gene. In some embodiments, the AAV viral genome further comprises a nucleic acid encoding a Rep protein, e.g., a nonstructural protein. In some embodiments, the Rep protein comprises a Rep78 protein, a Rep68 protein, a Rep52 protein, and / or a Rep40 protein. In some embodiments, the Rep78 protein, a Rep68 protein, a Rep52 protein, and / or a Rep40 protein are encoded by at least one Rep gene.

[0417] In some embodiments, the AAV particle comprises a viral genome comprising the nucleotide sequence of SEQ ID NO:2006 or SEQ ID NO:2007, or a sequence having at least 97%, at least 98%, or at least 99% sequence identity to SEQ ID NO:2006 or SEQ ID NO:2007. In some embodiments, the viral genome is packaged in a capsid protein having a serotype selected from Table 1, or a functional variant thereof. In some embodiments, the capsid protein comprises VOY101, VOY201, AAVPHP.N (PHP.N), AAVPHP.B (PHP.B), AAVPHP.A (PHP.A), PHP.B2, PHP.B3, G2B4, G2B5, AAV5, AAV9, AAVrhlO, or a functional variant thereof. In some embodiments, the capsid protein comprises a VOY101 capsid protein or a functional variant thereof. In some embodiments, the capsid protein comprises an AAV9 capsid protein or a functional variant thereof. In some embodiments, the capsid protein comprises an AAV5 capsid protein or a functional variant thereof.

[0418] In some embodiments, an AAV particle comprising a viral genome comprising the nucleotide sequence of SEQ ID NO:2006 or SEQ ID NO:2007, or a sequence having at least 97%, at least 98%, or at least 99% sequence identity thereto, comprises a capsid protein comprising the amino acid sequence of SEQ ID NO:138, or a sequence with at least 90%, at least 91%, at least 92%, at least 93%, at least 94%, at least 95%, at least 96%, at least 97%, at least 98%, or at least 99% sequence identity thereto. In some embodiments, the capsid protein comprises an amino acid sequence having one, two, or three or more modifications, but not more than 30, 20, or 10 modifications, of the amino acid sequence of SEQ ID NO:138. In some embodiments, the capsid protein is encoded by the nucleotide sequence of SEQ ID NO: 137, or a nucleotide sequence having at least 70%, at least 75%, at least 80%, at least 85%, at least 90%, at least 91%, at least 92%, at least 93%, at least 94%, at least 95%, at least 96%, at least 97%, at least 98%, or at least 99% identity thereto. In some embodiments, the capsid protein comprises an amino acid substitution at position K449, e.g., a K449R substitution, when numbered according to SEQ ID NO: 138. In some embodiments, the capsid protein comprises an insertion comprising the amino acid sequence of TLAVPFK (SEQ ID NO: 1262), which insertion is located immediately after position 588 relative to the reference sequence numbered according to SEQ ID NO: 138. In some embodiments, the capsid protein comprises an amino acid other than "A" at position 587 and / or an amino acid other than "Q" at position 588, when numbered according to SEQ ID NO: 138. In some embodiments, the capsid protein comprises an A587D and / or Q588G amino acid substitution, numbered according to SEQ ID NO: 138. In some embodiments, the capsid protein comprises an insertion comprising the amino acid sequence PLNGAVHLY (SEQ ID NO: 3648), which amino acid sequence of PLNGAVHLY (SEQ ID NO: 3648) occurs immediately after position 586 relative to a reference sequence numbered according to the amino acid sequence of SEQ ID NO: 138. In some embodiments, the AAV capsid comprises the amino acid sequence of SEQ ID NO: 3636.

[0419] In some embodiments, an AAV particle comprising a viral genome comprising SEQ ID NO:2006 or SEQ ID NO:2007, or a sequence having at least 97%, at least 98%, or at least 99% identity thereto, comprises a capsid protein comprising the amino acid sequence of SEQ ID NO:1, or a sequence substantially identical thereto (e.g., having at least 70%, at least 75%, at least 80%, at least 85%, at least 90%, at least 91%, at least 92%, at least 93%, at least 94%, at least 95%, at least 96%, at least 97%, at least 98%, or at least 99% sequence identity). In some embodiments, the capsid protein comprises an amino acid sequence having one, two, or three or more modifications, but no more than 30, no more than 20, or no more than 10 modifications, of the amino acid sequence of SEQ ID NO:1. In some embodiments, the capsid protein is encoded by the nucleotide sequence of SEQ ID NO:2 or a sequence substantially identical thereto (e.g., having at least 70%, at least 75%, at least 80%, at least 85%, at least 90%, at least 91%, at least 92%, at least 93%, at least 94%, at least 95%, at least 96%, at least 97%, at least 98%, or at least 99% sequence identity).

[0420] The present disclosure provides, in some embodiments, vectors, cells and / or AAV particles comprising the above-identified viral genomes. Self-complementary and single-stranded vectors In some embodiments, the AAV vectors used in this disclosure are single-stranded vectors (ssAAV).

[0421] In some embodiments, AAV vectors can be self-complementary AAV vectors (scAAV).See, for example, U.S. Patent No. 7,465,583.scAAV vectors have both DNA strands, which anneal together to form double-stranded DNA.scAAV skips the synthesis of the second strand, allowing for rapid expression in cells.

[0422] In some embodiments, the AAV vector used in this disclosure is a scAAV. The art discloses methods for producing and / or modifying AAV vectors, including pseudotyped AAV vectors (WO 200028004, WO 200123001, WO 2004112727, WO 2005005610, and WO 2005072364, the contents of each of which are incorporated herein by reference in their entirety).

[0423] Viral genome size In some embodiments, the viral genome of the AAV particles of the present disclosure can be single-stranded or double-stranded. The size of the vector genome can be small, medium, large, or maximum size.

[0424] In some embodiments, a vector genome comprising a nucleic acid sequence encoding a GCase protein described herein can be a small, single-stranded vector genome. The small, single-stranded vector genome can be about 2.7 kb to about 3.5 kb in size, such as about 2.7, about 2.8, about 2.9, about 3.0, about 3.1, about 3.2, about 3.3, about 3.4, or about 3.5 kb in size. In some embodiments, the small, single-stranded vector genome can be 3.2 kb in size.

[0425] In some embodiments, a vector genome comprising a nucleic acid sequence encoding a GCase protein described herein can be a small, double-stranded vector genome. The small, double-stranded vector genome can be about 1.3 to about 1.7 kb in size, such as about 1.3, about 1.4, about 1.5, a...

Claims

1. An isolated nucleic acid encoding a β-glucocerebrosidase 1 (GBA1) protein and comprising a nucleotide sequence that is at least 93% identical (e.g., at least 93%, at least 94%, at least 95%, at least 96%, at least 97%, at least 98%, at least 99% or 100% identical) to the nucleotide sequence of SEQ ID NO:2002.

2. The isolated nucleic acid of claim 1, wherein the nucleotide sequence encoding the GBA1 protein comprises a nucleotide sequence that is at least 95% identical (e.g., at least 95%, at least 96%, at least 97%, at least 98%, at least 99% or 100% identical) to SEQ ID NO: 2002.

3. 3. The isolated nucleic acid of claim 1 or 2, wherein the nucleotide sequence encoding the GBA1 protein comprises SEQ ID NO: 2002.

4. 4. The isolated nucleic acid of any one of claims 1 to 3, further comprising a signal sequence comprising a nucleotide sequence at least 90% identical (e.g., at least 90%, at least 91%, at least 92%, at least 93%, at least 94%, at least 95%, at least 96%, at least 97%, at least 98%, at least 99% or 100% identical) to SEQ ID NO:2005.

5. 5. The isolated nucleic acid of claim 4, wherein the signal sequence comprises the nucleotide sequence of SEQ ID NO: 2005.

6. An isolated nucleic acid encoding a β-glucocerebrosidase 1 (GBA1) protein and comprising a nucleotide sequence that is at least 94% identical (e.g., at least 94%, at least 95%, at least 96%, at least 97%, at least 98%, at least 99% or 100% identical) to the nucleotide sequence of SEQ ID NO:2001.

7. 7. The isolated nucleic acid of claim 6, wherein the nucleotide sequence encoding the GBA1 protein comprises the nucleotide sequence of SEQ ID NO: 2001.

8. A recombinant viral genome comprising a nucleotide sequence encoding a β-glucocerebrosidase 1 (GBA1) protein, further comprising an miRNA (miR) binding site that regulates expression of the encoded GBA1 protein in cells or tissues of the DRG, liver, hematopoietic lineage, or a combination thereof, and wherein the GBA1-encoding nucleotide sequence is at least 93% identical (e.g., at least 93%, at least 94%, at least 95%, at least 96%, at least 97%, at least 98%, at least 99%, or 100% identical) to the nucleotide sequence of SEQ ID NO:2002.

9. The recombinant viral genome of claim 8, wherein the nucleotide sequence encoding the GBA1 protein comprises a nucleotide sequence that is at least 95% identical (e.g., at least 95%, at least 96%, at least 97%, at least 98%, at least 99% or 100% identical) to the nucleotide sequence of SEQ ID NO: 2002.

10. 10. The recombinant viral genome of claim 8 or 9, wherein the nucleotide sequence encoding the GBA1 protein comprises or consists of the nucleotide sequence of SEQ ID NO: 2002.

11. 11. The recombinant viral genome of any one of claims 8 to 10, further comprising a promoter operably linked to the nucleic acid comprising the nucleotide sequence encoding the GBA protein, wherein optionally the promoter comprises a nucleotide sequence at least 90% identical (e.g., at least 90%, at least 91%, at least 92%, at least 93%, at least 94%, at least 95%, at least 96%, at least 97%, at least 98%, at least 99% or 100% identical) to the nucleotide sequence of SEQ ID NO: 1834, and further optionally the promoter comprises or consists of the nucleotide sequence of SEQ ID NO: 1834.

12. The recombinant viral genome of any one of claims 8 to 11, further comprising an enhancer.

13. 13. The recombinant viral genome of claim 12, wherein the enhancer comprises a CMVie enhancer, optionally comprising a nucleotide sequence at least 90% identical (e.g., at least 90%, at least 91%, at least 92%, at least 93%, at least 94%, at least 95%, at least 96%, at least 97%, at least 98%, at least 99%, or 100% identical) to the nucleotide sequence of SEQ ID NO: 1831, and further optionally, the CMVie enhancer comprises or consists of the nucleotide sequence of SEQ ID NO: 1831.

14. 14. The recombinant viral genome of any one of claims 8 to 13, further comprising an intron sequence, optionally comprising a nucleotide sequence that is at least 90% identical (e.g., at least 90%, at least 91%, at least 92%, at least 93%, at least 94%, at least 95%, at least 96%, at least 97%, at least 98%, at least 99% or 100% identical) to the nucleotide sequence of SEQ ID NO: 1842, and further optionally comprising or consisting of the nucleotide sequence of SEQ ID NO: 1842.

15. 15. The recombinant viral genome of any one of claims 8 to 14, further comprising a polyadenylation (polyA) sequence, optionally comprising a nucleotide sequence that is at least 90% identical (e.g., at least 90%, at least 91%, at least 92%, at least 93%, at least 94%, at least 95%, at least 96%, at least 97%, at least 98%, at least 99% or 100% identical) to the nucleotide sequence of SEQ ID NO: 1846, and further optionally comprising or consisting of the nucleotide sequence of SEQ ID NO: 1846.

16. 16. The recombinant viral genome of any one of claims 8 to 15, further comprising ITR sequences, optionally comprising a nucleotide sequence that is at least 90% identical (e.g., at least 90%, at least 91%, at least 92%, at least 93%, at least 94%, at least 95%, at least 96%, at least 97%, at least 98%, at least 99% or 100% identical) to the nucleotide sequence of SEQ ID NO: 1829 or SEQ ID NO: 1830, and further optionally, the ITR sequences comprise or consist of the nucleotide sequence of SEQ ID NO: 1829 or SEQ ID NO: 1830.

17. 17. The recombinant viral genome of claim 16, comprising a 5' ITR sequence and a 3' ITR sequence, wherein the 5' ITR sequence comprises or consists of the nucleotide sequence of SEQ ID NO: 1829, and the 3' ITR comprises or consists of the nucleotide sequence of SEQ ID NO: 1830.

18. 18. The recombinant viral genome of any one of claims 8 to 17, further comprising one or more miR183 binding sites, optionally comprising four miR183 binding sites, and further optionally each of said four miR183 binding sites comprising or consisting of the nucleotide sequence of SEQ ID NO: 1847 or a nucleotide sequence having up to three modifications compared to SEQ ID NO: 1847.

19. 18. The recombinant viral genome of any one of claims 8 to 17, further comprising a series of miR183 binding sites comprising a nucleotide sequence that is at least 95% identical (e.g., at least 95%, at least 96%, at least 97%, at least 98%, at least 99% or 100% identical) to the nucleotide sequence of SEQ ID NO: 1849, and optionally the miR183 binding site series comprises or consists of the nucleotide sequence of SEQ ID NO: 1849.

20. The recombinant viral genome of any one of claims 8 to 17, which does not contain a miR183 binding site.

21. In order from 5' to 3', (i) a 5′ adeno-associated (AAV) ITR comprising or consisting of the nucleotide sequence of SEQ ID NO: 1829 or a nucleotide sequence at least 95% identical thereto (e.g., at least 95%, at least 96%, at least 97%, at least 98%, or at least 99% identical); (ii) a CMVie enhancer comprising or consisting of the nucleotide sequence SEQ ID NO: 1831 or a nucleotide sequence at least 95% identical thereto (e.g., at least 95%, at least 96%, at least 97%, at least 98%, or at least 99% identical); (iii) a CB promoter comprising or consisting of the nucleotide sequence of SEQ ID NO: 1834 or a nucleotide sequence at least 95% identical thereto (e.g., at least 95%, at least 96%, at least 97%, at least 98%, or at least 99% identical); (iv) an intron comprising or consisting of the nucleotide sequence of SEQ ID NO: 1842, or a nucleotide sequence at least 95% identical thereto (e.g., at least 95%, at least 96%, at least 97%, at least 98%, or at least 99% identical); (v) a nucleotide sequence encoding a signal sequence, the nucleotide sequence comprising or consisting of the nucleotide sequence of SEQ ID NO: 2005 or a nucleotide sequence at least 95% identical thereto (e.g., at least 95%, at least 96%, at least 97%, at least 98%, or at least 99% identical); (vi) a nucleotide sequence encoding a GBA1 protein, comprising or consisting of the nucleotide sequence of SEQ ID NO: 2002 or a nucleotide sequence at least 93% identical thereto (e.g., at least 93%, at least 94%, at least 95%, at least 96%, at least 97%, at least 98%, or at least 99% identical); (vii) a polyA signal region comprising or consisting of the nucleotide sequence of SEQ ID NO: 1846, or a nucleotide sequence at least 95% identical thereto (e.g., at least 95%, at least 96%, at least 97%, at least 98%, or at least 99% identical thereto); and (viii) a 3′ AAV ITR comprising or consisting of the nucleotide sequence of SEQ ID NO: 1830, or a nucleotide sequence at least 95% identical thereto (e.g., at least 95%, at least 96%, at least 97%, at least 98%, or at least 99% identical). A recombinant viral genome comprising:

22. (i) the 5′ AAV ITR comprises or consists of the nucleotide sequence of SEQ ID NO: 1829; (ii) the CMVie enhancer comprises or consists of the nucleotide sequence of SEQ ID NO: 1831; (iii) the CB promoter or a functional variant thereof comprises or consists of the nucleotide sequence of SEQ ID NO: 1834; (iv) the intron comprises or consists of the nucleotide sequence of SEQ ID NO: 1842; (v) the nucleotide sequence encoding the signal sequence comprises or consists of the nucleotide sequence of SEQ ID NO: 2005; (vi) the nucleotide sequence encoding the GBA1 protein comprises or consists of the nucleotide sequence of SEQ ID NO: 2002; (vii) the poly A signal region comprises or consists of the nucleotide sequence of SEQ ID NO: 1846; and (viii) the 3′ AAV ITR comprises or consists of the nucleotide sequence of SEQ ID NO: 1830.

23. 23. The recombinant viral genome of claim 22, comprising the nucleotide sequence of SEQ ID NO: 2006 or a nucleotide sequence at least 97% identical thereto (e.g., at least 97%, at least 98%, or at least 99% identical).

24. 24. The recombinant viral genome of claim 22 or 23, comprising the nucleotide sequence of SEQ ID NO: 2006.

25. A recombinant viral genome according to any one of claims 22 to 24, consisting of the nucleotide sequence of SEQ ID NO: 2006.

26. In order from 5' to 3', (i) a 5′ adeno-associated (AAV) ITR comprising or consisting of the nucleotide sequence of SEQ ID NO: 1829 or a nucleotide sequence at least 95% identical thereto (e.g., at least 95%, at least 96%, at least 97%, at least 98%, or at least 99% identical); (ii) a CMVie enhancer comprising or consisting of the nucleotide sequence of SEQ ID NO: 1831 or a nucleotide sequence at least 95% identical thereto (e.g., at least 95%, at least 96%, at least 97%, at least 98%, or at least 99% identical); (iii) a CB promoter comprising or consisting of the nucleotide sequence of SEQ ID NO: 1834 or a nucleotide sequence at least 95% identical thereto (e.g., at least 95%, at least 96%, at least 97%, at least 98%, or at least 99% identical); (iv) an intron comprising or consisting of the nucleotide sequence of SEQ ID NO: 1842, or a nucleotide sequence at least 95% identical thereto (e.g., at least 95%, at least 96%, at least 97%, at least 98%, or at least 99% identical); (v) a nucleotide sequence encoding a signal sequence, optionally comprising or consisting of the nucleotide sequence of SEQ ID NO: 2005 or a nucleotide sequence at least 95% identical thereto (e.g., at least 95%, at least 96%, at least 97%, at least 98%, or at least 99% identical); (vi) a nucleotide sequence encoding a GBA1 protein, comprising or consisting of the nucleotide sequence of SEQ ID NO: 2002 or a nucleotide sequence that is at least 93% identical (e.g., at least 93%, at least 94%, at least 95%, at least 96%, at least 97%, at least 98%, or at least 99% identical) to the nucleotide sequence of SEQ ID NO: 2002; (vii) a miR183 binding site series comprising or consisting of the nucleotide sequence of SEQ ID NO: 1849 or a nucleotide sequence at least 90% identical thereto (e.g., at least 90%, at least 91%, at least 92%, at least 93%, at least 94%, at least 95%, at least 96%, at least 97%, at least 98%, or at least 99% identical); (viii) a polyA signal region comprising or consisting of the nucleotide sequence of SEQ ID NO: 1846, or a nucleotide sequence at least 95% identical thereto (e.g., at least 93%, at least 94%, at least 95%, at least 96%, at least 97%, at least 98%, or at least 99% identical thereto); and (ix) a 3′ AAV ITR comprising or consisting of the nucleotide sequence of SEQ ID NO: 1830, or a nucleotide sequence at least 95% identical thereto (e.g., at least 95%, at least 96%, at least 97%, at least 98%, or at least 99% identical). A recombinant viral genome comprising:

27. (i) the 5′ AAV ITR comprises or consists of the nucleotide sequence of SEQ ID NO: 1829; (ii) the CMVie enhancer comprises or consists of the nucleotide sequence of SEQ ID NO: 1831; (iii) the CB promoter or a functional variant thereof comprises or consists of the nucleotide sequence of SEQ ID NO: 1834; (iv) the intron comprises or consists of the nucleotide sequence of SEQ ID NO: 1842; (v) the nucleotide sequence encoding the signal sequence comprises the nucleotide sequence of SEQ ID NO: 2005; (vi) the nucleotide sequence encoding the GBA1 protein comprises or consists of the nucleotide sequence of SEQ ID NO: 2002; (vii) the miR183 binding site sequence comprises or consists of the nucleotide sequence of SEQ ID NO: 1849; (viii) the poly A signal region comprises or consists of the nucleotide sequence of SEQ ID NO: 1846; and (ix) the 3′ AAV ITR comprises or consists of the nucleotide sequence of SEQ ID NO: 1830.

28. 28. The recombinant viral genome of claim 27, comprising the nucleotide sequence of SEQ ID NO: 2007 or a nucleotide sequence at least 97% identical thereto (e.g., at least 97%, at least 98%, or at least 99% identical).

29. 29. The recombinant viral genome of claim 27 or 28, comprising the nucleotide sequence of SEQ ID NO: 2007.

30. 29. The recombinant viral genome of claim 27 or 28, consisting of the nucleotide sequence of SEQ ID NO: 2007.

31. 31. The recombinant viral genome of any one of claims 8 to 30, further comprising a nucleic acid encoding a capsid protein, wherein the capsid protein comprises a VP1 polypeptide, a VP2 polypeptide and / or a VP3 polypeptide.

32. 32. The recombinant viral genome of claim 31 , wherein the VP1 polypeptide, the VP2 polypeptide and / or the VP3 polypeptide are encoded by at least one Cap gene.

33. 33. The recombinant viral genome of any one of claims 8 to 32, further comprising a nucleic acid encoding a Rep protein, said Rep protein comprising a Rep78 protein, a Rep68 protein, a Rep52 protein and / or a Rep40 protein.

34. 34. The recombinant viral genome of claim 33, wherein the Rep78 protein, the Rep68 protein, the Rep52 protein and / or the Rep40 protein are encoded by at least one Rep gene.

35. (i) a capsid protein; and (ii) a recombinant virus genome according to any one of claims 8 to 30; An AAV particle comprising:

36. 36. The AAV particle of claim 35, wherein the capsid protein comprises a VOY101, VOY201, AAVPHP.N (PHP.N), AAVPHP.B (PHP.B), AAVPHP.A (PHP.A), PHP.B2, PHP.B3, G2B4, G2B5, AAV5, AAV9, AAVrhlO capsid protein, or a functional variant thereof.

37. 37. The AAV particle of claim 35 or 36, wherein the capsid protein comprises a mutant of an AAV5 capsid protein.

38. 37. The AAV particle of claim 35 or 36, wherein the capsid protein comprises a mutant of an AAV9 capsid protein.

39. 35. A vector comprising the isolated nucleic acid of any one of claims 1 to 7 or the recombinant viral genome of any one of embodiments 8 to 34.

40. 40. A cell comprising an isolated nucleic acid according to any one of claims 1 to 7, a recombinant viral genome according to any one of claims 8 to 34, a viral particle according to any one of claims 35 to 38 or a vector according to claim 39, wherein the cell is optionally a mammalian cell (e.g. a HEK293 cell), an insect cell (e.g. an Sf9 cell) or a bacterial cell.

41. 35. A nucleic acid comprising the recombinant viral genome of any one of embodiments 8 to 34 and a scaffold region suitable for replication of said viral genome in a cell, e.g., a bacterial cell (e.g., said scaffold region comprises one or both of a bacterial origin of replication and a selectable marker).

42. 1. A method for producing recombinant AAV particles, comprising: (i) providing a host cell containing a recombinant viral genome according to any one of claims 8 to 34; (ii) incubating the host cells under conditions suitable for packaging the viral genome into capsid proteins; thereby producing said isolated AAV particles, Optionally, the capsid protein is a VOY101 capsid protein.

43. 43. The method of claim 42, further comprising, prior to step (i), introducing into the host cell a first nucleic acid molecule comprising the viral genome.

44. 44. The method of claim 43, wherein the host cell comprises a second nucleic acid molecule encoding a capsid protein, and optionally, the capsid protein is a VOY101 capsid protein.

45. 44. The method of claim 43, further comprising introducing a second nucleic acid into the cell.

46. 46. ​​The method of claim 44 or 45, wherein the second nucleic acid molecule is introduced into the host cell before, simultaneously with, or after the first nucleic acid molecule.

47. 47. The method of any one of claims 42 to 46, wherein the host cell comprises a mammalian cell (e.g., a HEK293 cell), an insect cell (e.g., an Sf9 cell), or a bacterial cell.

48. A pharmaceutical composition comprising the AAV particles of any one of claims 35 to 38 and a pharmaceutically acceptable excipient.

49. A method for delivering a nucleic acid sequence encoding a GBA1 protein to a subject, comprising administering an effective amount of a pharmaceutical composition described in claim 48, an AAV particle described in any one of claims 35 to 38, an isolated nucleic acid described in any one of claims 1 to 7, or a recombinant viral genome described in any one of claims 8 to 34, thereby delivering the nucleic acid encoding a GBA1 protein to the subject.

50. The method of claim 49, wherein the subject has, has been diagnosed with, or is at risk of having a disease associated with expression of GBA1, such as abnormal or reduced GBA1 expression, such as expression of the GBA1 gene, GBA1 mRNA and / or GBA1 protein.

51. 51. The method of claim 49 or 50, wherein the subject has, has been diagnosed with, or is at risk of having a neurodegenerative or neuromuscular disorder.

52. A method for treating a subject having or diagnosed as having a disease associated with GBA1 expression, comprising administering an effective amount of a pharmaceutical composition described in claim 48, an AAV particle described in any one of claims 35 to 38, an isolated nucleic acid described in any one of claims 1 to 7, or a recombinant viral genome described in any one of claims 8 to 34, thereby treating the disease associated with GBA1 expression in the subject.

53. 10. A method of treating a subject having or diagnosed as having a neurodegenerative or neuromuscular disorder, comprising administering an effective amount of the pharmaceutical composition of claim 48, the AAV particle of any one of claims 35 to 38, the isolated nucleic acid of any one of claims 1 to 7 or the recombinant viral genome of any one of claims 8 to 34, thereby treating said neurodegenerative or neuromuscular disorder in said subject.

54. 54. The method of any one of claims 49 to 53, wherein the disease associated with GBA1 expression or the neurodegenerative or neuromuscular disorder is Parkinson's disease (PD).

55. 54. The method of any one of claims 49 to 53, wherein the disease associated with GBA1 expression or the neurodegenerative or neuromuscular disorder is Gaucher disease (GD).

56. 56. The method of claim 55, wherein the GD is type 1 GD (GD1) or type 3 GD (GD3).

57. 54. The method of any one of claims 49 to 53, wherein the disease associated with GBA1 expression or the neurodegenerative or neuromuscular disorder is dementia with Lewy bodies (DLB).

58. 10. A method of treating a subject having or diagnosed as having Parkinson's disease (PD), comprising administering an effective amount of the pharmaceutical composition of claim 48, the AAV particle of any one of claims 35-38, the isolated nucleic acid of any one of claims 1-7, or the recombinant viral genome of any one of claims 8-34, thereby treating PD in the subject.

59. 10. A method of treating a subject having or diagnosed as having Gaucher disease (GD), comprising administering an effective amount of the pharmaceutical composition of claim 48, the AAV particle of any one of claims 35-38, the isolated nucleic acid of any one of claims 1-7, or the recombinant viral genome of any one of claims 8-34, thereby treating GD in the subject.

60. 60. The method of claim 59, wherein the GD is GD1 or GD3.

61. 10. A method of treating a subject having or diagnosed as having dementia with Lewy bodies (DLB), comprising administering an effective amount of the pharmaceutical composition of claim 48, the AAV particle of any one of claims 35-38, the isolated nucleic acid of any one of claims 1-7, or the recombinant viral genome of any one of claims 8-34, thereby treating DLB in the subject.

62. 62. The method of any one of claims 49-61, wherein the subject has a level of GCase activity that is decreased compared to a reference level, and optionally the level of GCase activity is measured by a 4-MUG assay or a SensoLyte Blue glucocerebrosidase assay.

63. 63. The method of claim 62, wherein the reference level comprises the level of GCase activity in a healthy subject who does not have a disease, neuromuscular disorder and / or neurodegenerative disorder associated with GBA1 expression.

64. 64. The method of any one of claims 49 to 63, wherein treating comprises preventing progression of the disease in the subject.

65. 65. The method of any one of claims 49 to 64, wherein treating results in amelioration of at least one symptom of the disease associated with GBA1 expression, the neurodegenerative disorder and / or the neuromuscular disorder in the subject.

66. The method of claim 65, wherein the symptoms of the disease, neurodegenerative disorder and / or neuromuscular disorder associated with GBA1 expression include decreased GCase activity, accumulation of glucocerebroside and other glycolipids, for example in immune cells (e.g., macrophages), an increase in synuclein aggregates (e.g., Lewy bodies), developmental delay, progressive encephalopathy, progressive dementia, ataxia, myoclonus, oculomotor dysfunction, bulbar palsy, generalized weakness, limb tremors, depression, visual hallucinations, cognitive decline, or a combination thereof.

67. 67. The method of any one of claims 49 to 66, wherein the subject is a human subject.

68. 68. The method of any one of claims 49 to 67, wherein the subject has one or more mutations in the GBA1 gene, GBA1 mRNA and / or GBA1 protein.

69. 69. The method of any one of claims 49 to 68, wherein the pharmaceutical composition, the AAV particle, the isolated nucleic acid, or the recombinant viral genome is administered to the subject via intravenous, intracerebral, intrathalamic (ITH) administration, via intramuscular, intrathecal, intracerebroventricular, intraparenchymal administration, such as via focused ultrasound (FUS) combined with intravenous administration of microbubbles (FUS-MB) or MRI-guided FUS combined with intravenous administration, or via intracisternal injection (ICM).

70. 70. The method of any one of claims 49 to 69, wherein the pharmaceutical composition, the AAV particle, the isolated nucleic acid, or the recombinant viral genome is administered intravenously to the subject.

71. 71. The method of any one of claims 49 to 70, wherein the pharmaceutical composition, the AAV particle, the isolated nucleic acid, or the recombinant viral genome is delivered to a cell, tissue, or region of the CNS, such as a region of the brain or spinal cord, such as the parenchyma, cortex, substantia nigra, caudate-cerebellum, striatum, corpus callosum, cerebellum, brainstem-caudate-putamen, thalamus, superior colliculus, spinal cord, or a combination thereof.

72. A method according to any one of claims 49 to 71, further comprising assessing, e.g. measuring, the level of GBA1 expression, e.g. GBA1 gene, GBA1 mRNA and / or GBA1 protein expression, in the subject, e.g. in the cells, tissues or body fluids of the subject, optionally wherein the level of GBA1 protein is measured by an assay described herein, e.g. ELISA, Western blot or immunohistochemistry assay.

73. 73. The method of claim 72, wherein measuring the level of GBA1 expression is performed before, during, or after treatment with the AAV particles.

74. 74. The method of claim 72 or 73, wherein the cell or tissue is a cell or tissue (e.g., parenchyma) of the central nervous system.

75. A method according to any one of claims 49 to 74, wherein the administration results in an increase in the level of GBA1 protein expression in cells or tissues of the subject compared to a reference level, e.g., a subject not receiving treatment, e.g., not receiving the AAV particles.

76. 76. The method of any one of claims 49 to 75, further comprising assessing, e.g. measuring, the level of GCase activity in the subject, e.g. in cells or tissues of the subject, optionally wherein the level of GCase activity is measured by a 4-MUG assay or a SensoLyte Blue glucocerebrosidase assay.

77. The administration (i) the level of GCase activity in the subject's cells, tissues (e.g., cells or tissues of the CNS, e.g., the cortex, striatum, thalamus, cerebellum, and / or brainstem) and / or body fluids (e.g., CSF and / or serum), optionally increased by at least 2, 3, 4, or 5 fold compared to a reference level, e.g., a subject not receiving the treatment, e.g., not administered the AAV particles; (ii) a level of viral genomes (VG) per cell in a CNS tissue (e.g., cortex, striatum, thalamus, cerebellum, brainstem, and / or spinal cord) of said subject, which optionally is increased by more than 50 VG per cell compared to peripheral tissue, in which the level of VG per cell is at most 4-10 times lower than in said CNS tissue, as measured, for example, by an assay described herein; and / or (iii) the level of GBA1 mRNA expression in a cell or tissue (e.g., a cell or tissue of the CNS, e.g., the cortex, thalamus, and / or brainstem), which optionally is increased by at least 100-1300 fold compared to a reference level from a subject not receiving said treatment.

77. The method of any one of claims 49 to 76, resulting in an increase in at least one, two or all of:

78. 78. The method of any one of claims 49 to 77, further comprising the administration of an additional therapeutic agent and / or therapy suitable for the treatment or prevention of the disease associated with GBA1 expression, the neurodegenerative disorder and / or the neuromuscular disorder, optionally wherein the additional therapeutic agent and / or therapy comprises enzyme replacement therapy (ERT) (e.g., imiglucerase, velaglucerase alfa or taliglucerase alfa), substrate reduction therapy (SRT) (e.g., eliglustat or miglustat), blood transfusion, levodopa, carbidopa, safinamide, dopamine agonists (e.g., pramipexole, rotigotine or ropinirole), anticholinergics (e.g., benztropine or trihexyphenidyl), cholinesterase inhibitors (e.g., rivastigmine, donepezil or galantamine), N-methyl-d-aspartate (NMDA) receptor antagonists (e.g., memantine), or combinations thereof.

79. 49. The pharmaceutical composition of claim 48, the AAV particle of any one of claims 35 to 38, the isolated nucleic acid of any one of claims 1 to 7 or the recombinant viral genome of any one of claims 8 to 34 for use in the manufacture of a medicament.

80. A pharmaceutical composition according to claim 48, an AAV particle according to any one of claims 35 to 38, an isolated nucleic acid according to any one of claims 1 to 7 or a recombinant viral genome according to any one of claims 8 to 34 for use in the treatment of a disease, neuromuscular disorder and / or neurodegenerative disorder associated with GBA1 expression, wherein the disease, neuromuscular disorder and / or neurodegenerative disorder associated with GBA1 expression is PD.

81. 10. Use of an effective amount of the pharmaceutical composition of claim 48, the AAV particle of any one of claims 35 to 38, the isolated nucleic acid of any one of claims 1 to 7 or the recombinant viral genome of any one of claims 8 to 34 for use in the manufacture of a medicament for the treatment of a disease, neuromuscular disorder and / or neurodegenerative disorder associated with GBA1 expression, wherein the disease, neuromuscular disorder and / or neurodegenerative disorder associated with GBA1 expression is PD.

82. A pharmaceutical composition according to claim 48, an AAV particle according to any one of claims 35 to 38, an isolated nucleic acid according to any one of claims 1 to 7 or a recombinant viral genome according to any one of claims 8 to 34 for use in the treatment of a disease, neuromuscular disorder and / or neurodegenerative disorder associated with GBA1 expression, wherein the disease, neuromuscular disorder and / or neurodegenerative disorder associated with GBA1 expression is GD.

83. 83. The pharmaceutical composition, AAV particle, isolated nucleic acid or recombinant viral genome for use according to claim 82, wherein the GD is GD1.

84. 83. The pharmaceutical composition, AAV particle, isolated nucleic acid or recombinant viral genome for use according to claim 82, wherein the GD is GD3.

85. 10. Use of an effective amount of the pharmaceutical composition of claim 48, the AAV particle of any one of claims 35 to 38, the isolated nucleic acid of any one of claims 1 to 7 or the recombinant viral genome of any one of claims 8 to 34 for use in the manufacture of a medicament for the treatment of a disease, neuromuscular disorder and / or neurodegenerative disorder associated with GBA1 expression, wherein the disease, neuromuscular disorder and / or neurodegenerative disorder associated with GBA1 expression is GD.

86. 86. The use of claim 85, wherein the GD is GD1.

87. 86. The use of claim 85, wherein the GD is GD3.