Modified PIV5 vaccine vectors: methods of making and using

A modified PIV5 CVB backbone with specific mutations and deletions enhances viral growth and immunogenicity, addressing the need for potent vaccine vectors by inducing effective immune responses against SARS-CoV-2 and RSV.

JP2026504603APending Publication Date: 2026-02-05SIANBACK LLC
View PDF 3 Cites 0 Cited by

Patent Information

Application Number
JP2025568198
Authority / Receiving Office
JP · JP
Patent Type
Applications
Current Assignee / Owner
Priority Date
2023-02-06
Filing Date
2024-02-05
Publication Date
2026-02-05

AI Technical Summary

Technical Problem

There is a need for more potent and high-yield PIV5 vaccine vectors for effective immunization against respiratory viral infections, particularly for SARS-CoV-2 and RSV, with improved viral transcription and replication capabilities.

Method used

Development of a modified PIV5 CVB backbone with mutations at specific amino acid residues (S156N or S157F) and a deletion of the small hydrophobic (SH) gene, enhancing viral growth and immunogenicity, and expressing heterologous polypeptides such as SARS-CoV-2 and RSV antigens.

Benefits of technology

The modified PIV5 CVB backbone demonstrates improved growth in cell culture and enhanced immunogenicity in animal models, inducing robust immune responses against SARS-CoV-2 and RSV, including humoral and cellular immune responses.

✦ Generated by Eureka AI based on patent content.

Smart Images

  • Figure 2026504603000001_ABST
    Figure 2026504603000001_ABST
Patent Text Reader

Abstract

A CVB virus expression vector comprising a PIV5 W3A viral genome comprising a mutation at amino acid residue S157 or S156 of the P / V gene and a deletion of the small hydrophobic (SH) gene of the PIV5 W3A viral genome, wherein the amino acid substitution at amino acid residue S157 or S156 comprises a substitution of serine (S) with phenylalanine (F) or asparagine (N), and the SH gene has a deletion of the SH open reading frame or the entire SH gene transcription unit. The CVB virus expression vector expresses a heterologous polypeptide, including SARS-CoV-2 spike (S), and / or nucleocapsid (N) and / or membrane (M) proteins, RSV fusion protein (F), or other antigens.
Need to check novelty before this filing date? Find Prior Art

Description

[Technical Field]

[0001] REFERENCE TO RELATED APPLICATIONS This application claims the benefit of priority to U.S. Provisional Patent Application No. 63 / 483,377, filed February 6, 2023, which is incorporated herein by reference in its entirety.

[0002] The present invention relates generally to the field of vaccination, and more specifically to compositions and methods using modified PIV5 vaccine vectors, such as PIV5W3AΔSH or PIV5W3AΔSH, carrying the P / V gene mutation (CVB), to modulate immune responses in subjects carrying or susceptible to infectious agents such as RSV and SARS-CoV-2. [Background technology]

[0003] Parainfluenza virus type 5 (PIV5) belongs to the family Paramyxoviridae and the genus Rubulavirus (which includes mumps virus). Its genome is a 15,246-nt negative-stranded single-stranded RNA. The full-length genome structure of PIV5 is 3'-leader-NP-V / PMF-SH-HN-L-trailer-5', i.e., from the 3' end to the 5' end. The sequence encodes the nucleocapsid protein (NP), V protein / phosphorylation protein (P), matrix protein (M), fusion protein (F), small hydrophobic protein (SH), hemagglutinin-neuraminidase protein (HN), and polymerase protein (large protein, L). The V protein and SH protein are nonstructural proteins.

[0004] PIV5 is an excellent viral vector for vaccine development, and research into PIV5 recombinant vaccines is ongoing. In recent years, researchers have continuously explored the feasibility of using PIV5 as a vaccine vector. A common approach is to insert a protective antigen gene from a virus or bacteria into PIV5 and then express the inserted foreign gene through the replication and translation of the PIV5 vector. Given that PIV5 can infect the respiratory tract without causing disease, researchers often use this to focus on the control of certain respiratory viral infections. Therefore, in-depth research into the molecular biology and replication mechanism of the virus will be beneficial for a comprehensive and thorough understanding of PIV5, laying the foundation for research into PIV5 as a genetically engineered vaccine vector and for studying viral gene function. However, there remains a need for more potent and high-yield PIV5 vaccine vectors.

[0005] Thus, the disclosure provided herein provides for the generation of more potent, high-yield PIV5 CVB backbones containing the P / V gene S156N or S157F mutations, as well as novel SARS-CoV-2 CVB vector vaccines for intranasal immunization. The phosphoprotein (P) protein can be phosphorylated at serine residues at positions 36, 126, and 157, as well as at the threonine residue at position 286. Additionally, host cell Polo-like kinase 1 (PLK1) can phosphorylate the serine residue at position 308. Mutation of the serine residue at either position 157 or 308 to an alanine residue prevents phosphorylation at these residues, significantly enhancing the activity of vRdRP in minigenome assays and the replication of recombinant viruses bearing these mutations. Mutations at residues 156 and 157 are hypothesized to upregulate viral transcription and replication, improving vaccine virus yield. Alteration of the amino acid 155-159 TSSPI motif of the PIV5 P protein alters viral phenotype and growth characteristics in vitro and in vivo. Summary of the Invention

[0006] In accordance with the object(s) of the present invention, as embodied and broadly described herein, the present invention, in one aspect, relates to a modified PIV5 (referred to as CVB) viral expression vector comprising a PIV5 W3A viral genome having a mutation at amino acid residue S157 or S156 of the P / V gene and a deletion of the small hydrophobic (SH) gene of the PIV5 W3A viral genome. This modified CVB backbone has been shown to grow better in cell culture, such as serum-free Vero cells, and to be more immunogenic in animal models, such as cotton rats. The modified CVB backbone can be used as an effective vaccine platform.

[0007] In some embodiments, the mutation at amino acid residue S157 or S156 comprises a substitution of serine (S) with an amino acid residue selected from the group consisting of alanine (A), cysteine ​​(C), aspartic acid (D), glutamic acid (E), phenylalanine (F), glycine (G), histidine (H), isoleucine (I), lysine (K), leucine (L), methionine (M), asparagine (N), proline (P), glutamine (Q), arginine (R), selenocysteine ​​(U), valine (V), tryptophan (W), and tyrosine (Y). In one embodiment, the amino acid substitution at amino acid residue S157 comprises a substitution of serine (S) with phenylalanine (F), or S156 comprises a substitution of serine (S) with asparagine (N).

[0008] In a further embodiment, the SH gene has a deletion of the SH open reading frame or a deletion of the entire SH gene transcription unit.

[0009] In one embodiment, the CVB viral expression vector expresses a heterologous polypeptide comprising a viral antigen selected from the group consisting of SARS-CoV-2, RSV, or other viral or bacterial antigens. In another embodiment, the PIV5 genome comprises a heterologous nucleic acid sequence having at least 98% sequence identity to SEQ ID NO: 2, 3, 4, 5, 6, 7, 8, 9, 10, 11, 12, or 13, and the viral expression vector expresses a heterologous polypeptide comprising a coronavirus spike (S) and / or nucleocapsid (N) protein, an RSV-F protein, or a viral or bacterial antigen.

[0010] In one embodiment, the coronavirus S protein is a coronavirus S protein of severe acute respiratory syndrome coronavirus 2 (SARS-CoV-2), a SARS-CoV-2 variant of note or a variant of concern, and the coronavirus N protein is a coronavirus N protein of SARS-CoV-2, a SARS-CoV-2 variant of note or a variant of concern. In some embodiments, the coronavirus S protein is a coronavirus S protein of a SARS-CoV-2 Wuhan strain, a SARS-CoV-2 beta variant, a SARS-CoV-2 gamma variant, a SARS-CoV-2 delta variant, or a SARS-CoV-2 omicron variant, and the coronavirus N protein is a coronavirus N protein of a SARS-CoV-2 Wuhan strain, a SARS-CoV-2 beta variant, a SARS-CoV-2 gamma variant, a SARS-CoV-2 delta variant, or a SARS-CoV-2 omicron variant. In some embodiments, the SARS-CoV-2 Omicron variant is SARS-CoV-2 Omicron BA.1 or SARS-CoV-2 Omicron BA.5, BQ1 or XBB1, or any future emerging variant.

[0011] In one embodiment, the coronavirus S protein comprises the coronavirus S protein of SARS-CoV-2, and the cytoplasmic tail of the coronavirus S protein is replaced with the cytoplasmic tail of the fusion (F) protein of CVB.

[0012] In one embodiment, the PIV5 W3A viral genome contains an open reading frame deletion mutation in the SH gene of the SARS-CoV-2 Wuhan strain, and the S gene of the SARS-CoV-2 Wuhan strain is inserted between the PIV5 hemagglutinin (HN) gene and polymerase (L) gene of the CVB.

[0013] In some embodiments, the entire SH gene transcription unit of the PIV5 W3A viral genome is deleted, and the S gene of the SARS-CoV-2 Wuhan strain is placed between the HN and L genes of CVB.

[0014] In some embodiments, the N gene of the SARS-CoV-2 Wuhan strain is inserted to replace the SH gene of PIV5, and the S gene of the SARS-CoV-2 Wuhan strain is inserted between the HN and L genes of CVB.

[0015] In some embodiments, the N gene of the SARS-CoV-2 Wuhan strain is inserted to replace the SH gene of PIV5, and the S gene of the SARS-CoV-2 Omicron BA.1 variant is inserted between the HN and L genes of CVB.

[0016] In some embodiments, the S gene of the SARS-CoV-2 Omicron BA.5 variant is inserted between the HN and L genes of CVB.

[0017] In some embodiments, the S gene of the SARS-CoV-2 Omicron BA.5 variant is inserted between the HN and L genes, and the N gene of the SARS-CoV-2 Wuhan strain is inserted to replace the SH gene of CVB.

[0018] In some embodiments, the PIV5 F and HN genes are deleted, and the S gene of the SARS-CoV-2 Wuhan strain is located between the M and L genes of the CVB.

[0019] In some embodiments, the N gene of the SARS-CoV-2 Wuhan strain is inserted between the F and HN genes, and the S gene of the SARS-CoV-2 Wuhan strain is inserted between the HN and L genes of the CVB.

[0020] In some embodiments, the M gene from the SARS-CoV-2 Wuhan strain is inserted between F and HN, and the S gene of the SARS-CoV-2 Wuhan strain is inserted between HN and L of CVB.

[0021] In some embodiments, the M gene from the Wuhan strain of SARS-CoV-2 is inserted after the F of PIV5, the E gene from the Wuhan strain of SARS-CoV-2 is inserted between the M gene and HN of SARS-CoV-2, and the S gene of the Wuhan strain of SARS-CoV-2 is inserted between the HN and L of CVB.

[0022] In some embodiments, the M gene from the Wuhan strain of SARS-CoV-2 is inserted after the F of PIV5, the N gene from the Wuhan strain of SARS-CoV-2 is inserted between the M and E genes of SARS-CoV-2, the E gene from the Wuhan strain of SARS-CoV-2 is inserted between the N gene and HN of SARS-CoV-2, and the S gene from the Wuhan strain of SARS-CoV-2 is inserted between the HN and L of CVB.

[0023] In some embodiments, the F gene from respiratory syncytial virus (RSV) is inserted between the SH and HN genes of the CVB backbone.

[0024] In one embodiment, the viral particle comprises a viral expression vector.

[0025] In another aspect, the invention relates to a composition comprising a CVB virus expression vector having a nucleic acid sequence having at least 98% sequence identity to SEQ ID NO: 2, 3, 4, 5, 6, 7, 8, 9, 10, 11, 12, or 13, wherein the virus expression vector expresses a heterologous polypeptide comprising a coronavirus spike (S) and / or nucleocapsid (N) protein. In one embodiment, the heterologous coronavirus spike (S) and nucleocapsid (N) proteins are expressed in a cell by contacting the cell with the composition.

[0026] In yet another aspect, the present invention relates to a method of inducing an immune response in a subject having or at risk of having a SARS-COV-2, RSV, or other viral or bacterial infection, the method comprising administering to the subject a composition of matter, wherein the immune response comprises a humoral immune response and / or a cellular immune response.

[0027] Additional advantages of the present invention will be set forth in part in the following description, and in part will be apparent from the description, or may be learned by practice of the invention. The advantages of the present invention will be realized and attained by the elements and combinations particularly pointed out in the appended claims. It should be understood that both the foregoing general description and the following detailed description are exemplary and explanatory only and are not intended to limit the claimed invention. In one embodiment, a subject is vaccinated against COVID-19, RSV, or other viral or bacterial infection, the method comprising administering to the subject a composition, the composition being administered intranasally, intramuscularly, topically, or orally. The method further comprises administering a PIV5 booster vaccine composition comprising a viral expression vector or viral particle having a PIV5 genome comprising a heterologous nucleic acid sequence having at least 98% sequence identity to SEQ ID NO: 27, 28, 29, 30, 31, 32, or 33, wherein the subject has previously received a primary vaccination against SARS-COV-2, RSV, or other viral or bacterial infection.

[0028] The accompanying drawings, which are incorporated in and constitute a part of this specification, illustrate several embodiments of the invention and, together with the description, serve to explain the principles of the invention. [Brief explanation of the drawings]

[0029] [Figure 1] Schematic diagram of the W3AΔSH, CPI and CVB genome structures. [Figure 2] Figures AB show the RSV F-specific cellular immune response in AGMs immunized with W3AΔSH-RSV-F versus CPI-RSV-F. This shows the RSV F-specific cellular immune response in immunized African green monkeys (AGMs). PBMCs were isolated from immunized AGMs one day before vaccination and 14 and 28 days after immunization. PBMCs were stimulated with RSV F peptide pools, and the levels of different cytokines in CD4+ (Figure 2A) and CD8+ (Figure 2B) cells were quantified by ICS and expressed as a percentage of the total of all cytokines. [Figure 3] Pulmonary RSV virus titers following RSV challenge after immunization with the indicated control or antigens are shown. [Figure 4] 1 shows RSV titers after RSV challenge in nasal washes. [Figure 5] RSV neutralizing antibody responses are shown. [Figure 6] Shows anti-RSV F protein IgG antibody responses by ELISA. [Figure 7] 1 shows an exemplary outline of viral rescue. [Figure 8] Schematic diagram of PIV5 CVB-based SARS-CoV-2 vaccine construct showing the location of SARS-CoV-2 genes and the origin of their corresponding variants. [Figure 9A]Figure 9A shows the immune responses in animals induced by CVXGA16, CVXGA17, and CVXGA18. IgG antibodies against SARS-CoV-2 S protein (Figure 9A) or S-RBD (Figure 9B) in mice. Mice were immunized intranasally with 50 μL of PBS or 10 PFU of CVXGA1, CVXGA16, CVXGA17, and CVXGA18. Blood was collected on day 32. Anti-S WA1 or S WA1 RBD IgG antibodies were determined using ELISA. Figure 9C shows T cell responses to S or N peptides in mice. Mice were immunized as described above. Spleens were collected on day 32. S or N protein-specific IFNγ-secreting cells were determined using ELISPOT. Figure 9D shows IgG antibodies against the S protein in hamsters. Hamsters were immunized intramuscularly with 50 μL of PBS or 2 μg of COVID-19 mRNA vaccine. After the boost on day 21, hamsters from group 1 were boosted intranasally with 50 μL of PBS, and hamsters from group 2 received a second boost on day 42 with 2 μg of COVID-19 mRNA intramuscularly (group 2A) or 2 × 10 PFU of CVXGA1 (group 2B) or CVXGA18 (group 2C) intranasally. Blood was collected on day 63 post-immunization. Anti-S IgG antibodies were determined using ELISA. [Figure 9B]Figure 9A shows the immune responses in animals induced by CVXGA16, CVXGA17, and CVXGA18. IgG antibodies against SARS-CoV-2 S protein (Figure 9A) or S-RBD (Figure 9B) in mice. Mice were immunized intranasally with 50 μL of PBS or 10 PFU of CVXGA1, CVXGA16, CVXGA17, and CVXGA18. Blood was collected on day 32. Anti-S WA1 or S WA1 RBD IgG antibodies were determined using ELISA. Figure 9C shows T cell responses to S or N peptides in mice. Mice were immunized as described above. Spleens were collected on day 32. S or N protein-specific IFNγ-secreting cells were determined using ELISPOT. Figure 9D shows IgG antibodies against the S protein in hamsters. Hamsters were immunized intramuscularly with 50 μL of PBS or 2 μg of COVID-19 mRNA vaccine. After the boost on day 21, hamsters from group 1 were boosted intranasally with 50 μL of PBS, and hamsters from group 2 received a second boost on day 42 with 2 μg of COVID-19 mRNA intramuscularly (group 2A) or 2 × 10 PFU of CVXGA1 (group 2B) or CVXGA18 (group 2C) intranasally. Blood was collected on day 63 post-immunization. Anti-S IgG antibodies were determined using ELISA. [Figure 9C]Figure 9A shows the immune responses in animals induced by CVXGA16, CVXGA17, and CVXGA18. IgG antibodies against SARS-CoV-2 S protein (Figure 9A) or S-RBD (Figure 9B) in mice. Mice were immunized intranasally with 50 μL of PBS or 10 PFU of CVXGA1, CVXGA16, CVXGA17, and CVXGA18. Blood was collected on day 32. Anti-S WA1 or S WA1 RBD IgG antibodies were determined using ELISA. Figure 9C shows T cell responses to S or N peptides in mice. Mice were immunized as described above. Spleens were collected on day 32. S or N protein-specific IFNγ-secreting cells were determined using ELISPOT. Figure 9D shows IgG antibodies against the S protein in hamsters. Hamsters were immunized intramuscularly with 50 μL of PBS or 2 μg of COVID-19 mRNA vaccine. After the boost on day 21, hamsters from group 1 were boosted intranasally with 50 μL of PBS, and hamsters from group 2 received a second boost on day 42 with 2 μg of COVID-19 mRNA intramuscularly (group 2A) or 2 × 10 PFU of CVXGA1 (group 2B) or CVXGA18 (group 2C) intranasally. Blood was collected on day 63 post-immunization. Anti-S IgG antibodies were determined using ELISA. [Figure 9D]Figure 9A shows the immune responses in animals induced by CVXGA16, CVXGA17, and CVXGA18. IgG antibodies against SARS-CoV-2 S protein (Figure 9A) or S-RBD (Figure 9B) in mice. Mice were immunized intranasally with 50 μL of PBS or 10 PFU of CVXGA1, CVXGA16, CVXGA17, and CVXGA18. Blood was collected on day 32. Anti-S WA1 or S WA1 RBD IgG antibodies were determined using ELISA. Figure 9C shows T cell responses to S or N peptides in mice. Mice were immunized as described above. Spleens were collected on day 32. S or N protein-specific IFNγ-secreting cells were determined using ELISPOT. Figure 9D shows IgG antibodies against the S protein in hamsters. Hamsters were immunized intramuscularly with 50 μL of PBS or 2 μg of COVID-19 mRNA vaccine. After the boost on day 21, hamsters from group 1 were boosted intranasally with 50 μL of PBS, and hamsters from group 2 received a second boost on day 42 with 2 μg of COVID-19 mRNA intramuscularly (group 2A) or 2 × 10 PFU of CVXGA1 (group 2B) or CVXGA18 (group 2C) intranasally. Blood was collected on day 63 post-immunization. Anti-S IgG antibodies were determined using ELISA. [Figure 10] Growth curves of CVXGA29, CVXGA30, CVXGA31, and CVXGA32 expressing wt SARS-CoV-2 S compared to CVXGA17 expressing SARS-CoV-2 S with a PIV5 F tail are shown. [Figure 11] Figures 11A-11B show anti-SARS-CoV-2 S immunogenicity (Figure 11A) and anti-SARS-CoV-2 N immunogenicity (Figure 11B) for CVXGA1, CVXGA18, CVXGA29, CVXGA30, CVXGA31, or CVXGA32. [Figure 12]Figure 1 shows the determination of the percentage of RSV F protein expression in CVB-F infected cells. Vero-SF cells were infected with CVB-F pre-MVS virus at a dilution of -3 to -5. After 1 hour of incubation at 37°C, the medium was replaced and the cells were incubated at 37°C for 18 hours. Immunostaining was performed using mouse anti-CVB-HN and human anti-F (palivizumab) antibodies, followed by anti-mouse Alexa 488 and anti-human Cy3 secondary antibodies, respectively. Three representative images of wells infected with CVB-F pre-MVS show both green and red cells. 100% of CVB infected cells expressed both PIV5 and RSV F proteins. Images were taken at 10x magnification. [Figure 13A] Replication of CVB-F in serum-free Vero cells at 35°C vs. 37°C and 2 days vs. 4 days is shown. [Figure 13B] Replication of CVB-F in serum-free Vero cells at 35°C vs. 37°C and 2 days vs. 4 days is shown. [Figure 13C] Replication of CVB-F in serum-free Vero cells at 35°C vs. 37°C and 2 days vs. 4 days is shown. [Figure 13D] Replication of CVB-F in serum-free Vero cells at 35°C vs. 37°C and 2 days vs. 4 days is shown. [Figure 13E] Replication of CVB-F in serum-free Vero cells at 35°C vs. 37°C and 2 days vs. 4 days is shown. DETAILED DESCRIPTION OF THE INVENTION

[0030] The present invention can be understood more readily by reference to the following detailed description of preferred embodiments of the invention and the examples contained therein, as well as the drawings and their preceding and following descriptions.

[0031] I. Definition Various exemplary embodiments are described herein to facilitate an understanding of the principles and features of various embodiments of the present disclosure. While exemplary embodiments of the present disclosure are described in detail, it should be understood that other embodiments are contemplated. Accordingly, the present disclosure is not intended to be limited in scope to the details of the construction and arrangement of components set forth in the specification or examples. The present disclosure is capable of other embodiments and of being practiced or carried out in various ways.

[0032] When describing exemplary embodiments, specific terminology is used for the sake of clarity. As used herein and in the appended claims, the singular forms "a," "an," and "the" include plural referents unless the context clearly dictates otherwise. For example, reference to a component is intended to include compositions of multiple components. Reference to a composition containing "a" component is intended to include other components in addition to the specified component.

[0033] Ranges may be expressed herein as from "about" or "approximately" or "substantially" one particular value and / or to "about" or "approximately" another particular value. When such a range is expressed, other exemplary embodiments include from the one particular value and / or to the other particular value.

[0034] Similarly, as used herein, "substantially free" or "substantially pure" of something, and similar characterizations, can include both being "at least substantially free" or "at least substantially pure" of something, and being "completely free" or "completely pure" of something.

[0035] The terms "patient," "individual," "subject," and "animal" are used interchangeably herein and refer to mammals, including, but not limited to, humans and veterinary animals (e.g., cats, dogs, cows, horses, sheep, pigs, etc.), as well as experimental animal models. In particularly preferred embodiments, the subject is a human.

[0036] As used herein, the term "vaccinating" typically refers to the sequential administration of one or more antigens to a subject to generate and / or enhance an immune response to the antigen(s). Sequential administration includes a prime immunization followed by one or several boost immunizations.

[0037] In the context of the present invention, the term "pathogen" refers to any agent that can cause a pathological condition. Examples of "pathogens" include, but are not limited to, cells (e.g., bacterial cells, diseased mammalian cells, cancerous mammalian cells), fungi, parasites, viruses, prions, or toxins. Preferred pathogens are infectious pathogens. In certain embodiments, the infectious pathogen is a virus, such as a coronavirus.

[0038] As used herein, the term "antigen" refers to any molecule capable of eliciting a T-cell or B-cell immune response in a subject. A pathogen-specific antigen is typically an element obtained or derived from the pathogen, containing an epitope and capable of eliciting an immune response against the pathogen. Depending on the pathogenic agent, the antigen may be of various natures, such as a (poly)peptide, protein, nucleic acid, lipid, or cell. Attenuated live forms of pathogens (e.g., bacteria, viruses), or killed or inactivated forms thereof, or purified substances therefrom, such as proteins, peptides, lipids, etc., may also be used. The antigen may be naturally occurring or artificially produced. It may be exogenous or endogenous (e.g., tumor antigen) to the mammal being treated. The antigen may be produced by techniques known per se in the art, such as synthetic or recombinant techniques, or enzymatic methods.

[0039] In certain embodiments, the antigen is a protein, polypeptide, and / or peptide. The terms "polypeptide," "peptide," and "protein" are used interchangeably herein to refer to a polymer of amino acid residues. These terms also apply to amino acid polymers in which one or more amino acid residues may be modified or non-naturally occurring residues, for example, artificial chemical mimics of corresponding naturally occurring amino acids. It should be understood that the term "protein" also includes fragments or variants of different antigens, such as epitope-containing fragments, or proteins obtained from pathogens and subsequently modified enzymatically, chemically, mechanically, or thermally.

[0040] "Therapeutically effective amount" means the amount of a compound (e.g., a CVB-based composition described herein) that, when administered to a subject for treating a condition, disorder, or pathology, is sufficient to effect such treatment. A "therapeutically effective amount" may vary depending on the compound or bacterium administered, as well as the disease and its severity, and the age, weight, physical condition, and responsiveness of the mammal being treated.

[0041] The phrase "pharmaceutically acceptable" as used in connection with the compositions of the present disclosure refers to molecular entities and other components of such compositions that are physiologically tolerable and typically do not produce adverse reactions when administered to a mammal (e.g., a human). Preferably, as used herein, the term "pharmaceutically acceptable" means approved by a federal or state regulatory agency or listed in the United States Pharmacopoeia or other generally recognized pharmacopoeias for use in mammals, and more specifically, in humans.

[0042] The term "pharmaceutically acceptable composition," as used herein, refers to a composition comprising at least one compound disclosed herein formulated together with one or more pharmaceutically acceptable carriers.

[0043] The term "administration" refers to the introduction of a certain amount of a given substance into a patient by a particular suitable method. The compositions disclosed herein may be administered by any common route, such as, but not limited to, inhalation, intraperitoneal, intravenous, intramuscular, subcutaneous, intradermal, oral, topical, intranasal, pulmonary, or rectal administration, as long as the desired tissue can be reached. However, because peptides are digested when administered orally, the active ingredients of compositions for oral administration should be coated or formulated to protect them from degradation in the stomach.

[0044] The term "dose" refers to a single amount of a compound or agent administered thereto; and / or "regimen" refers to multiple predetermined doses, which may be of different or equal amounts, given at various time intervals, which may be of different or equal duration. In some embodiments, a regimen also includes the duration of the delivery period (e.g., drug administration period, or treatment period). Alternatively, a regimen is multiple predetermined, evaporated amounts given at predetermined time intervals.

[0045] The term "carrier" refers to a diluent, adjuvant, excipient, or vehicle with which a compound is administered. Such pharmaceutical carriers can be sterile liquids, such as water and oils, including those of petroleum, animal, vegetable, or synthetic origin, such as peanut oil, soybean oil, mineral oil, sesame oil, and the like. Water or aqueous solutions. Saline solutions and aqueous dextrose and glycerol solutions are preferably used as carriers, particularly for injectable solutions. Alternatively, the carrier can be a solid dosage form carrier, including, but not limited to, one or more of binders (for compressed pills), glidants, encapsulating agents, flavoring agents, and coloring agents. Suitable pharmaceutical carriers are described in "Remington's Pharmaceutical Sciences" by E.W. Martin.

[0046] The term "treating" a condition, disorder, or condition or "treatment" includes (1) preventing or delaying the onset of at least one clinical or subclinical symptom of the condition, disorder, or condition in a subject who may be afflicted with or predisposed to the condition, disorder, or condition but who has not yet experienced or exhibited clinical or subclinical symptoms of the condition, disorder, or condition, or (2) inhibiting the condition, disorder, or condition, i.e., arresting, reducing, or delaying the onset of the disease or its recurrence (in the case of maintenance therapy), or at least one clinical or subclinical symptom thereof, or (3) ameliorating the disease, i.e., causing regression of the condition, disorder, or condition, or at least one clinical or subclinical symptom thereof. The benefit accrued to the treated subject is either statistically significant or at least perceptible to the patient or physician.

[0047] "Comprising" or "containing" or "including" means that at least the specified compound, element, particle, or method step is present in a composition or article or method, but does not exclude the presence of other compounds, elements, particles, or method steps, even if such other compounds, materials, particles, or method steps have the same function as the one specified.

[0048] As used herein, the term "parainfluenza virus 5" (PIV5) includes, but is not limited to, strains KNU-11, CC-14, D277, 1168-1, and 08-1990. Non-limiting examples of PIV5 genomes are listed in GenBank Accession Nos. NC_006430.1, AF052755.1, KC852177.1, KP893891.1, KC237065.1, KC237064.1, and KC237063.1, which are incorporated herein by reference.

[0049] As used herein, the term "expression" refers to the process by which a polynucleic acid is transcribed into mRNA and translated into a peptide, polypeptide, or protein. If the polynucleic acid is derived from genomic DNA, expression may include splicing of the mRNA, if an appropriate eukaryotic host cell or organism is selected. In the context of the present invention, the term also encompasses the yield of F gene mRNA and F protein achieved after expression.

[0050] As used herein, the term "F protein" or "fusion protein" or "F protein polypeptide" or "fusion protein polypeptide" refers to a polypeptide or protein having all or part of the amino acid sequence of a RSV fusion protein polypeptide. Many RSV fusion proteins and attachment proteins have been described and are known to those skilled in the art. WO / 2008 / 114149 (incorporated herein by reference in its entirety) describes exemplary F and G protein variants (e.g., naturally occurring variants).

[0051] As used herein, the term "combination" of a CVB-based composition described herein with at least a second pharmaceutically active ingredient means at least two, although any desired combination of compounds can be delivered simultaneously or sequentially (e.g., within 24 hours). When used to treat various diseases, it is contemplated that the compositions and methods of the present disclosure can be utilized with other treatments / therapeutics suitable for the same or similar diseases. Such other treatments / therapeutics can be co-administered (simultaneously or sequentially in any order) to produce additive or synergistic effects. The therapeutically effective dosage suitable for each agent may be reduced due to additive or synergistic effects. Two or more embodiments of the present disclosure can also be co-administered to produce additive or synergistic effects.

[0052] The term "coronavirus" refers to a group of related RNA viruses that cause disease in mammals and birds. In humans, these viruses cause respiratory tract infections that can range from mild to fatal. Mild illnesses include some cases of the common cold (which is also caused by certain other viruses, primarily rhinoviruses), while more deadly varieties can cause SARS, MERS, and COVID-19. No vaccines or antiviral drugs currently exist to prevent or treat human coronavirus infections.

[0053] The term "SARS" or "severe acute respiratory syndrome" refers to the viral respiratory disease of zoonotic origin that surfaced in the early 2000s, caused by severe acute respiratory syndrome coronavirus (SARS-CoV or SARS-CoV-1), a strain of the first identified SARS coronavirus species, i.e., severe acute respiratory syndrome-associated coronavirus (SARS-CoV). This syndrome caused the SARS outbreak of 2002–2004. In 2019, a successor related viral strain, severe acute respiratory syndrome coronavirus 2 (SARS-CoV-2), was discovered. The term "Covid-19" or "coronavirus disease 2019" refers to severe acute respiratory syndrome (SARS), which is caused by the virus known as SARS-coronavirus 2 (SARS-CoV-2).

[0054] A reference to one or more method steps does not exclude the presence of additional or intervening method steps between the explicitly identified steps. Similarly, it should also be understood that a reference to one or more components in a composition does not exclude the presence of additional components other than those explicitly identified.

[0055] The materials described as constituting various elements of the present disclosure are intended to be exemplary and not limiting. Many suitable materials that may perform the same or similar functions as the materials described herein are intended to be encompassed within the scope of the present disclosure. Such other materials not described herein may include, but are not limited to, materials developed after the time of development of the present disclosure.

[0056] II. CPI-RSV-F, W3AΔSH, and CVB-RSV-F Compositions Respiratory syncytial virus (RSV) is a member of the Pneumoviridae genus. Human RSV (HRSV) is a major cause of severe lower respiratory tract disease in young children and is responsible for significant morbidity and mortality in humans. RSV is also recognized as an important factor in disease in immunocompromised adults and the elderly. Due to incomplete resistance to RSV in infected hosts after natural infection, RSV can cause multiple infections during childhood and adulthood.

[0057] The virus has a genome consisting of a single negative-stranded RNA, which is tightly associated with viral proteins to form a nucleocapsid. The viral envelope is composed of a lipid bilayer derived from the plasma membrane containing virally encoded structural proteins. A viral polymerase is packaged with the viral particle and transcribes the genomic RNA into mRNA. The RSV genome encodes three transmembrane structural proteins, F, G, and SH, two matrix proteins, M and M2, three nucleocapsid proteins, N, P, and L, and two nonstructural proteins, NS1 and NS2.

[0058] Fusion of HRSV with the cell membrane is thought to occur at the cell surface and is a necessary step for the translocation of viral ribonucleoproteins into the cytoplasm early in infection. This process is mediated by the fusion (F) protein, which also promotes fusion of the infected cell membrane with that of neighboring cells to form characteristic syncytia, which contribute to both the pronounced cytopathic effect and an additional mechanism for viral spread. Therefore, neutralization of fusion activity is important for host immunity. Indeed, monoclonal antibodies developed against the F protein have been shown to neutralize viral infectivity and inhibit membrane fusion (Calder et al., 2000, Virology 271:122-131).

[0059] The RSV F protein shares structural features and limited but significant amino acid sequence identity with the F glycoproteins of other paramyxoviruses. It is synthesized as a 574-amino acid inactive (F0) precursor that is cotranslationally glycosylated at asparagine in the endoplasmic reticulum, where it assembles into homo-oligomers. Before reaching the cell surface, the F0 precursor is cleaved by proteases N-terminally to F2 and C-terminally to F1. The F2 and F1 chains remain covalently linked by one or more disulfide bonds.

[0060] CPI-RSV-F is a parainfluenza virus (PIV5)-based RSV vaccine expressing the RSV F protein, and is provided herein as a prophylactic intranasal vaccine for preventing RSV infection and serious complications associated with RSV infection. CPI-RSV-F was designed to induce an immune response against the RSV F protein, a major antigenic protein highly conserved between RSV subgroups A and B. Anti-F antibodies inhibit viral entry into host cells, and RSV F is a proven vaccine target based on efficacy data from the commercially available product palivizumab (RSV F monoclonal antibody). W3AΔSH-RSV-F and CVB-RSV are modified RSV vaccines, and their backbone differences from CPI-RSV-F are summarized in Figure 1.

[0061] The present disclosure provides CPI-RSV-F, W3AΔSH-RSV-F and CVB-RSV compositions, systems and methods for their use in multiple applications, including functional genomics, drug discovery, target validation, protein production (e.g., therapeutic proteins, vaccines, monoclonal antibodies), gene therapy, and therapeutic treatments such as cancer therapy.

[0062] A. Pharmacological Summary of RSV Studies The present disclosure provides CPI-RSV-F, W3AΔSH-RSV-F and CVB-RSV compositions, systems and methods for their use in multiple applications, including functional genomics, drug discovery, target validation, protein production (e.g., therapeutic proteins, vaccines, monoclonal antibodies), gene therapy, and therapeutic treatments such as cancer therapy.

[0063] Previously published studies based on the W3A strain of PIV5 constructs engineered to express the RSV-F protein included immunogenicity and challenge studies in mice, cotton rats, and African green monkeys (1, 2, 3). As part of these studies, permissive PIV5 replication was confirmed in cotton rats and African green monkeys (1, 2). In addition, the following studies were conducted: 1) a vector construct based on CPI versus the W3A PIV5 strain; and 2) vaccine constructs expressing the RSV prefusion versus wt F protein inserted in place of the PIV5 SH gene (ΔSH), between the PIV5 SH and NH (SH-NH), or between the HN and L (HN-L). These studies led to the selection of CPI-RSV-F (CPI-RSV-F), which contains the full-length RSV F protein inserted between the SH and HN genes, for use in the first human studies.

[0064] Furthermore, the protective efficacy of the CPI-RSV-F vaccine has been evaluated in RSV challenge studies conducted in mice and cotton rats. Immunization with a single intranasal dose protected animals from RSV infection, based on significant reductions in RSV viral titers observed in lung and nasal washes of immunized animals compared with controls.

[0065] More recent preclinical proof-of-concept studies using the vaccine vector construct CPI-RSV-F included immunogenicity and challenge studies in mice and African green monkeys conducted by Blue Lake Biotechnology Inc. Additionally, preclinical data from an NIH-sponsored study of the CPI-RSV-F construct in a cotton rat challenge study are summarized herein. The CPI-RSV-F vaccine used in these more recent nonclinical studies used a previous vaccine vector construct (rescued from BHK cells) that was the same as the vector construct used in clinical lot material (rescued from 293 / Vero cells), and was also produced using serum-free Vero cells as a substrate and formulated in sucrose phosphate glutamate (SPG) buffer. These nonclinical studies included a control (PIV5 W3A strain with an SH gene deletion, W3AΔSH-RSV-F, engineered to express the RSV F protein) as an active comparator.

[0066] In summary, preclinical studies in various animal models demonstrated the ability of CPI-RSV-F, W3AΔSH-RSV-F, and CVB-RSV to induce RSV F-specific immune responses, as observed by F-specific antibody and cell-mediated immune responses after a single intranasal administration. All of these vaccine candidates were well tolerated in these animal models, with no signs of sensitization after vaccination. [Table 1]

[0067] i. Testing in mice, cotton rats, and monkeys with the related W3A PIV5 vector expressing the RSV F protein Testing of PIV5(W3A)-RSV-F and RSV-G proteins in Balb / c mice: In this test, Balb / c mice received a single intranasal dose of W3A-RSV-F (10 in 50 μl). 6PFU dose) followed by RSV challenge. The PIV5 W3A vaccine vector construct in this study consisted of a wild-type RSV F protein inserted into the HN and L intergenic region of PIV5. A single intranasal dose resulted in an IgG2a / IgG1 RSV response 21 days post-immunization similar to that observed after wild-type RSV A2 infection.

[0068] PIV5 (W3A)-expressing wild-type or pre-fusion RSV F protein challenge study in mice and cotton rats: This study evaluated improved PIV5 vector vaccines by altering the location of the F protein insert (inserted at the SH-HN junction of PIV5 or replacing SH with the RSV F protein gene). In addition, this study evaluated both the wild-type (wt) F protein and the pre-fusion conformation F protein (pF).

[0069] Mouse, 1 x 10 6 Patients were immunized intranasally at 100 PFU with a single dose of W3AΔSH-RSV-F (the RSV F protein gene inserted into the deleted SH region of PIV5) expressing wild-type F protein or a prefusion-stabilized RSV F mutant (W3AΔSH-RSV-pF) or the improved vectors W3AΔSH-RSV-F or W3A-RSV-pF SH-HN (the F protein gene inserted into the SH-HN junction). The test groups were as follows (Table 2): [Table 2]

[0070] After immunization, both humoral and cellular immune responses were observed. The highest neutralizing antibody responses were detected with vaccine constructs using the wt F protein. Furthermore, vaccine constructs containing wt F inserted with ΔSH before the HN junction appeared to be the most immunogenic. The level of cell-mediated immune responses (based on IFN-gamma using ELISPOT) was similar among the various vaccine constructs.

[0071] Twenty-eight days after immunization, mice were challenged with RSV A2 to determine protective efficacy. Challenge virus was recovered from only one of five mice in the W3AΔSH-RSV-F group on day 4 post-challenge, but not from any mice in the other vaccinated groups. Challenge virus was recovered from all mice in the PBS control group.

[0072] Similar studies were performed in cotton rats, which are more permissive to RSV infection. Rats were immunized with 10% WT or 10% IFN-γ vectors containing a low dose of either wild-type or a modified vector containing the perfusion-stabilized F protein (pF) (W3A-RSV-F(SH-HN), W3A-RSV-pF, or W3AΔSH-RSV-F). 3 10 pfu or W3AΔSH-RSV-pF 2 Immunized with PFU.

[0073] Immune responses, including neutralizing antibody responses to the RSV A / Tracey strain (97% identical to the RSV A / A2 strain), were observed in all groups. Similar to the mouse study, groups immunized with vaccine constructs containing the wt F protein had higher antibody levels compared to the pF group, with the highest value (titer of approximately 128) when ΔSH and F were inserted before the HN gene junction. Neutralizing antibody titers to RSV / B / 18537 were significantly lower than those to the RSV / A / Tracey strain, with significant antibody levels (titer of approximately 8) detected only in the W3A(SH-HN)-RSV-F and W3AΔSH-RSV-F groups. The 1.21 × 10 5 After RSV challenge on day 28 with PFU, reductions in RSV viral load in nasal washes (1.4–1.66 Log 10 Reduction) and reduction of RSV viral load in lung lavage fluid (2-3 Log 10 RSV challenge virus was recovered from all mice in the PBS control group (approximately 10 per nasal wash). 5 PFU, or 10 5 PFU / g lung lavage).

[0074] Overall, these initial studies in mouse and cotton rat models showed no evidence that the pre-fusion F protein was more immunogenic or protective than the wild-type F protein, and no difference in vector performance was observed between the ΔSH and SH-HN insertion vector constructs via the intranasal route.

[0075] Sigmovir Protocol No. XV-131 study report (Phan et al. 2017) challenge study in cotton rats using intranasal and subcutaneous routes: In a follow-up study (1, Phan et al. 2017), a higher dose of 10 5 and 10 6 The efficacy, immunogenicity, and safety of PFU W3A(SH-NH)-RSV-F and W3AΔSH-RSV-F were tested in a cotton rat challenge study, evaluating two different routes of administration: intranasal (in) and subcutaneous (sc). The study also included positive controls for disease enhancement (positive control groups consisting of animals immunized with FI-RSV followed by RSV challenge and animals pre-infected with RSV followed by RSV challenge). Animals in this study were challenged with RSV A2 on day 49, followed by necropsy and histology 5 days later (day 54). The test groups in this study were as follows (Table 3): [Table 3]

[0076] Immunogenicity: W3A(SH-HN)-RSV-F showed a 10% increase between the intranasal and subcutaneous groups. 5 ~10 6 Vaccination with W3AΔSH-RSV-F induced slightly higher neutralizing antibody titers in the intranasal group compared to the subcutaneous group, with 10 6 The dose resulted in slightly higher titers, although this was not statistically significant.

[0077] Efficacy: W3A(SH-HN)-RSV-F provided complete protection in the lower respiratory tract when administered either intranasally or subcutaneously. Animals also had significantly lower viral loads in the upper respiratory tract.

[0078] W3A(SH-HN)-RSV-F vaccination was significantly higher than control animals sham-immunized with PBS (mean titer 10 5 The reduction in titers observed in lung and nasal washes compared with the mean titer of 10 3 Subcutaneous administration provided complete protection of the lower respiratory tract, and intranasal administration provided near complete protection, based on PFU.

[0079] Safety: Lung sections from different groups were examined for lung inflammatory features: peribronchiolitis, perivasculitis, interstitial pneumonia, and alveolitis, and scored for severity. The greatest lesions were observed in the FI-RSV-immunized RSV-challenged group (positive control group). Lung changes were moderate in groups immunized with W3A-RSV-F (SH-HN) or W3AΔSH-RSV-F (intranasal or subcutaneous), lower than those observed in the RSV-immunized RSV-challenged positive control group, and similar to those observed in the PBS-sham-immunized RSV-challenged group.

[0080] Cytokine levels measured in lung tissue 5 days after challenge by quantitative real-time PCR (qPCR) did not indicate a potential for enhanced infection. IL-4 mRNA levels were significantly elevated only in the FI-RSV-vaccinated group, consistent with the histopathology results and enhanced disease phenotype. IFNγ mRNA levels were highest in the sham-immunized and FI-RSV-immunized groups. IFN mRNA levels were similarly low between the PIV5-based candidate and RSV-immunized groups. IL-2 mRNA levels were comparable in all groups, but the mean IL-2 levels in the FI-RSV-immunized group were significantly higher than those in the other groups.

[0081] RSV A2 (10 in 50 μl) 28 days after immunization 6After intranasal challenge of immunized mice with 1000 PFU (1000 PFU), lung sections obtained 4 days postchallenge showed no progression of lung lesions compared to RSV A2-immunized mice. Protective immunity, as assessed by viral load in lung tissue, was observed (n = 5 mice per group).

[0082] PIV5(W3A)-expressing RSV F or G protein challenge study in cotton rats and African green monkeys: This study evaluated the replication, immunogenicity, and protective efficacy of PIV5-vectored RSV F protein in cotton rats and African green monkeys. In this study, the F protein was inserted into the intergenic region of the PIV5 HN and L genes.

[0083] PIV5 replication permissiveness in cotton rats and African green monkeys: 1 x 10 5 PFU of PIV5 was inoculated intranasally in a volume of 10 μl or 100 μl. On day 4, the virus titer was measured in the nasal homogenate (up to 1 × 10 4 PFU) that had largely disappeared by day 6. With the higher inoculum volume (100 μl), vaccine virus was observed in the lungs of all animals on day 6, whereas this was observed in only one animal inoculated with the lower volume of 10 μl.

[0084] To assess PIV5 tolerance in African green monkeys, 60 animals were screened for anti-PIV5 antibodies and all were found to be negative. Animals (n = 3 per group) were immunized with 1 × 10 2 ~Max 1×10 8 Mice were infected intranasally with 1 x 10 PFU of PIV5 in a dose volume of 0.25 mL. Nasal washes and bronchoalveolar lavage were assessed for virus shedding on days 3, 5, 7, 10, and 14. Virus was administered at a dose of 1 x 10 2 Doses as low as 1.5 PFU were shedding from both the nose and lungs for up to 10 days with peak replication on day 5. This data demonstrates the permissiveness of African green monkeys to PIV5.

[0085] Immunogenicity in cotton rats and African green monkeys after a single dose of W3A-RSV-F: Cotton rats received 1 x 10 3 , 1×10 4 , 1×10 5 , and 1 × 10 6 Mice were immunized intranasally with PFU of W3A-RSV-F. IgG antibody responses were observed at all dose levels on day 28, with comparable responses across dose groups. Neutralizing antibodies were observed in all dose groups, with titers ranging from 64 to 256. Furthermore, IgA responses in lung homogenates were observed in all dose groups on day 21 postinoculation.

[0086] African green monkeys (PIV5 and RSV seronegative) were infected with 1 × 10 4 or 1×10 6 They received a single intranasal immunization with PFU W3A-RSV-F. Sera obtained 21 days after inoculation demonstrated high-titer F-specific antibody responses. In addition, neutralizing antibody responses were observed at low levels (1 × 10 6 52) in the PFU dose group were observed on day 21. Nasal swabs obtained on day 21 post-immunization showed significant levels of F protein IgA responses. Cellular responses, as assessed by gamma interferon, were observed at 1 x 10 6 The PFU dose group showed a low level of response.

[0087] Protection from RSV challenge in cotton rats (Study No. 131) and African green monkeys: 1 x 10 3 ~1×10 6 Cotton rats immunized intranasally with a single dose ranging from PFU W3A-RSV-F were challenged with the RSV A2 strain 28 days after immunization. Protection was assessed by measuring viral load in nasal and lung tissues. Reductions in viral load were 1 x 10 6 A dose-dependent pattern was observed except for the PFU group, which had a concentration of 1 × 10 3 Although the levels were higher compared to the PFU group, they were still reduced compared to the control group. 5 In the 10-dose group, no virus was detected in the lungs and titers were reduced (3 log10 (of the order of magnitude) were observed in the nose.

[0088] 1×10 4 or 1×10 6 African green monkeys immunized with PFU W3A-RSV-F were challenged 28 days after immunization with RSV A2. Nasal and BAL samples were assessed for RSV viral load 3 to 14 days post-challenge. Immunization with W3A-RSV-F did not shorten viral clearance, but peak viral RSV loads were reduced 10- to 100-fold in both dose groups, reaching 1 × 10 6 The highest reduction was observed in the PFU dose group.

[0089] Response to W3A-RSV-F in RSV-exposed African green monkeys: Prior exposure to RSV did not interfere with the ability to boost RSV neutralizing antibody titers (50-fold increase) in African green monkeys (seroconverted by intranasal infection with RSV A2).

[0090] Pulmonary pathology in W3A-RSV-F immunized cotton rats after RSV challenge: dose 1x10 on day 0 6 Lungs obtained 5 days after challenge from animals immunized with PFU PIV5-RSV-F and challenged with RSV A2 on day 49 were examined blindly by histopathology for alveolitis, interstitial pneumonia, perivasculitis, and peribronchitis and compared with lungs obtained from control animals inoculated with formalin-inactivated RSV. Scores for positive control animals inoculated with formalin-inactivated RSV, but not for W3A-RSV-F animals, were significantly higher than those for PBS control animals (ANOVA paired t-test).

[0091] B. Parainfluenza virus 5 (PIV5) Parainfluenza virus 5 (PIV5), a negative-strand RNA virus, is a member of the Rubulavirus genus in the Paramyxoviridae family, which includes many important human and animal pathogens, such as mumps virus, human parainfluenza virus types 2 and 4, Newcastle disease virus, Sendai virus, HPIV3, measles virus, canine distemper virus, rinderpest virus, and respiratory syncytial virus. PIV5 was formerly known as simian virus-5 (SV5). PIV5 infects many animals and humans, but no known symptoms or diseases in humans have been associated with PIV5. Unlike most paramyxoviruses, PIV5 infects normal cells with little or no cytopathic effect. As a negative-strand RNA virus, the PIV5 genome is highly stable. PIV5 does not have a DNA phase in its life cycle and replicates only in the cytoplasm; therefore, PIV5 cannot integrate into the host genome. Therefore, the use of PIV5 as a vector avoids the unintended consequences that may result from genetic modification of host cell DNA. PIV5 can grow to high titers in cells, including Vero cells, which are approved by WHO and FDA for vaccine production. Therefore, PIV5 shows many advantages as a vaccine vector.

[0092] The PIV5-based vaccine vectors of the present invention may be based on any of a variety of wild-type, mutant, or recombinant (rPIV5) strains. Wild-type strains include, but are not limited to, PIV5 strain W3A, WR (ATCC® No. VR-288™), canine parainfluenza virus strain 78-238 (ATCC No. VR-1573) (Evermann et al., 1980, J Am Vet Med Assoc; 177:1132-1134, and Evermann et al., 1981, Arch Virol; 68:165-172), canine parainfluenza virus strain D008 (ATCC No. VR-399) (Binn ​​et al., 1967, Proc Soc Exp Biol Med; 126:140-145), MIL, DEN, LN, MEL, seed-borne latent virus, CPI+, CPI-, H221, 78524, T1, and SER. See, e.g., Chatziandreou et al., 2004, J Gen Virol; 85(Pt 10):3007-16, Choppin, 1964, Virology: 23:224-233, and Baumgartner et al., 1987, Intervirology; 27:218-223. Additionally, PIV5 strains used in commercial kennel cough vaccines, such as, for example, BI, FD, Merck, and Merial vaccines, may be used.

[0093] C. PIV5 CPI strain vector backbone The PIV5 CPI strain vector backbone differs from the PIV5 W3A strain vector backbone in the following ways (Figure 1). The most notable difference is in the PIV5 F protein of the CPI strain, which consists of an additional 22 amino acid extension as part of the cytoplasmic tail. The F protein extension is thought to inhibit the membrane fusion properties of the virus (5, 6). CPI-based viruses are more soluble and produce more progeny virus in infected cells than W3A-based viruses, which lack the extended PIV5 F protein terminus and contain additional amino acids different from CPI (4). CVB backbones containing S156N or S157F in PIV5 W3A improve virus yields in cell culture and are more immunogenic in vivo than CPI backbones.

[0094] Previously, recombinant PIV5 viruses expressing foreign genes from numerous pathogens, including influenza, rabies, respiratory syncytial virus, tuberculosis, Burkholderia, and MERS-CoV and SARS-CoV-2, have been generated and tested as vaccine candidates (Li, Z., et al., J Virol, 87(1):354(2013); Chen, Z., et al., J Virol, 87(6):2986(2013); Wang, D., et al., J Virol, 91(11)(2017); Chen, Z., et al., Vaccine, 33(51):7217(2015); Lafontaine, E. R., et al., Vaccine X., 1:100002(2018); Li, K., et al., mBio, 11(2)(2020); An et al., Sci Adv, Jul 2;7, 2021). Because PIV5 vector vaccines actively replicate in the respiratory tract after intranasal immunization, they can generate mucosal immunity, including antigen-specific IgA antibodies and long-lived IgA plasma cells (Wang, D., et al., J Virol, 91(11)(2017). Xiao, P., et al., Front Immunol, 12:623996(2021)).

[0095] D.PIV5 CVB skeleton Provided herein is a modified PIV5 vector, CVB. The CVB backbone vector is immunogenic and can be used as an effective vaccine platform. The CVB backbone contains a mutation at amino acid residues S157 or S156 of the P / V gene, which removes the phosphorylation site, resulting in higher transcriptional activity and thereby improving viral titer in cell culture.

[0096] In some embodiments, the mutation at amino acid residue S157 or S156 comprises a substitution of serine (S) with an amino acid residue selected from the group consisting of alanine (A), cysteine ​​(C), aspartic acid (D), glutamic acid (E), phenylalanine (F), glycine (G), histidine (H), isoleucine (I), lysine (K), leucine (L), methionine (M), asparagine (N), proline (P), glutamine (Q), arginine (R), selenocysteine ​​(U), valine (V), tryptophan (W), and tyrosine (Y). In one embodiment, the amino acid substitution at amino acid residue S157 comprises a substitution of serine (S) with phenylalanine (F), or S156 comprises a substitution of serine (S) with asparagine (N).

[0097] i.CVB skeleton

[0098] III. CVB-Based RSV Compositions Provided herein is the CVB-RSV-F genome sequence.

[0099] A. CVB-RSV-F sequence The following CVB-RSV-F nucleic acid sequences are provided herein:

[0100] The inserted RSV-F sequence is in lower case and the CVB sequence is in upper case.

[0101] IV. CVB-based SARS-CoV-2 Composition The present disclosure provides CVB-based SARS-CoV-2 compositions, systems, and methods for their use in multiple applications, including functional genomics, drug discovery, target validation, protein production (e.g., therapeutic proteins, vaccines, monoclonal antibodies), gene therapy, and therapeutic treatments such as cancer therapy.

[0102] A. SARS-CoV-2 According to the present invention, modified parainfluenza virus type 5 (PIV5) virus constructs, CVB, expressing SARS-CoV-2 envelope spike (S) and nucleocapsid (N) proteins have been generated for use as vaccines against COVID-19. These constructs demonstrate efficacy as vaccines, with a single dose of intranasal immunization inducing protective immunity in ferrets and cats.

[0103] Coronavirus disease 2019 (COVID-19) is a newly emerged infectious disease currently spreading worldwide. It is caused by a novel coronavirus, severe acute respiratory syndrome coronavirus 2 (SARS-CoV-2) (Zhu et al., 2020, N Engl J Med;382:727-733). SARS-CoV-2 was first identified in Wuhan, China, in December 2019 and subsequently spread worldwide, causing the COVID-19 pandemic. As of September 8, 2021, the virus has infected over 221 million people worldwide and caused over 4,574,000 deaths, and there is a constant risk that it will continue to spread in the absence of herd immunity. Although vaccines and antibody therapies have been introduced worldwide, the emergence of multiple viral variants that are rapidly replacing the original virus identified in Wuhan allows for immune escape in vaccinated populations, highlighting the need for improved vaccine efficacy.

[0104] SARS-CoV-2 is a single-stranded RNA enveloped virus belonging to the Betacoronavirus family (Lu et al., 2020, Lancet; 395:565-74). RNA-based metagenomic next-generation sequencing has been applied to characterize its entire genome (GenBank sequence accession MN908947), which is 29,881 nucleotides (nt) long and encodes 9,860 amino acids (Chen et al., 2020, Emerg Microbes Infect; 9:313-9). Whole-genome sequenced genomes available in GenBank include isolates 2019-nCoV WHU01 (GenBank accession number MN988668) and SARS-CoV-2 NC_045512, both from Wuhan, China, as well as at least seven additional sequences (MN938384.1, MN975262.1, MN985325.1, MN988713.1, MN994467.1, MN994468.1, and MN997409.1), which are greater than 99.9% identical and are incorporated herein by reference.

[0105] i.SARS-CoV-2 mutant strain Since SARS-CoV-2 was first identified in 2019, multiple genetic variants of SARS-CoV-2 have emerged and circulated worldwide. Viral mutations and variants in the United States are constantly monitored through sequence-based surveillance, laboratory studies, and epidemiological investigations. The U.S. government's SARS-CoV-2 Interagency Group (SIG) has developed a variant classification scheme that defines three classes of SARS-CoV-2 variants: variants of note, variants of concern, and variants of potential high impact.

[0106] a. Notable mutants Notable SARS-CoV-2 variants are those that possess specific genetic markers associated with alterations to receptor binding, reduced neutralization by antibodies generated in response to previous infection or vaccination, reduced treatment efficacy, potential diagnostic impact, or prediction of increased transmissibility or disease severity.

[0107] Variants of interest may require one or more appropriate public health actions, including increased sequence surveillance, increased laboratory characterization, or epidemiological investigations to assess how easily the virus spreads to others, the severity of disease, the effectiveness of therapeutics, and whether currently approved or licensed vaccines provide protection. The growing list of variants of interest being monitored and characterized includes, but is not limited to, eta, iota, kappa, lambda, and mu.

[0108] b. Variants of Concern A SARS-CoV-2 variant of concern is one for which there is evidence of increased transmissibility, more severe disease (e.g., increased hospitalization or death), significantly reduced neutralization by antibodies generated during previous infection or vaccination, reduced efficacy of treatment or vaccine, or failure to be detected by diagnostics. Possible attributes of a variant of concern include evidence of an impact on diagnostics, treatment, or vaccines, widespread interference with diagnostic test targets, evidence of substantially reduced susceptibility to one or more types of therapy, evidence of significantly reduced neutralization by antibodies generated during previous infection or vaccination, evidence of reduced vaccine-induced protection against severe disease, evidence of increased transmissibility, and evidence of increased disease severity.

[0109] A variant of concern may require one or more appropriate public health actions, such as notification to WHO under the International Health Regulations, reporting to CDC, local or regional efforts to prevent spread, increased testing, or research to determine the efficacy of vaccines and treatments against the variant. Based on the characteristics of the variant, further considerations may include the development of new diagnostics or modifications to vaccines or treatments. The growing list of variants of concern that are being closely monitored and characterized includes, but is not limited to, alpha, beta, delta, gamma, and omicron.

[0110] c. Mutant strains that are expected to cause severe damage Potentially detrimental variants of SARS-CoV-2 have clear evidence that the efficacy of preventative measures or multiple countermeasures (MCMs) is significantly reduced compared to previously circulating variants. Possible attributes of potentially detrimental variants include a demonstrated lack of diagnostic test targets, evidence suggesting significantly reduced vaccine efficacy, a disproportionately high number of vaccine breakthrough cases or very low protection against vaccine-induced severe disease, significantly reduced susceptibility to multiple EUA or approved therapeutics, and more severe clinical disease and increased hospitalization.

[0111] Potentially destructive variants may require notification to WHO under the International Health Regulations, reporting to CDC, publication of strategies to prevent or contain transmission, and recommendations for treatment and vaccine updates. Currently, there are no SARS-CoV-2 variants that elevate the risk to a potentially destructive level.

[0112] B. PIV5 CVB Vector SARS-CoV-2 Constructs The PIV5 vaccine vectors of the present invention can be constructed using any of a variety of methods, including, but not limited to, the reverse genetics system described in detail by He et al. (Virology; 237(2):249-60, 1997). PIV5 encodes eight viral proteins. The nucleocapsid protein (NP), phosphoprotein (P), and large RNA polymerase (L) protein are important for transcription and replication of the viral RNA genome. The V protein plays an important role in viral pathogenesis and viral RNA synthesis. The fusion (F) protein, a glycoprotein, mediates both cell-cell and virus-cell fusion in a pH-independent manner and is essential for viral cell entry. The structure of the F protein has been determined, and amino acid residues important for efficient fusion have been identified. The hemagglutinin-neuraminidase (HN) glycoprotein is also involved in viral entry and release from host cells. The matrix (M) protein plays an important role in viral assembly and budding. The hydrophobic (SH) protein is a 44-residue hydrophobic integral membrane protein that is membrane-oriented and has its N-terminus in the cytoplasm. For an overview of the molecular biology of paramyxoviruses, see, e.g., Whelan et al., 2004, Curr Top Microbiol Immunol; 283:61-119, and Lamb & Parks, (2006). Paramyxoviridae: the viruses and their replication. In Fields Virology, 5th edn, pp. 1449-1496. Edited by D.M. Knipe & P.M. Howley. Philadelphia, PA: Lippincott Williams & Wilkins.

[0113] Because PIV5 actively replicates in the respiratory tract after intranasal immunization, PIV5-vectored vaccines can generate mucosal immunity, including antigen-specific IgA antibodies and long-lived IgA plasma cells (Wang, D., et al., J Virol, 91(11) (2017). Xiao, P., et al., Front Immunol, 12:623996 (2021)). Recently, a PIV5-vectored vaccine (CVXGA1) expressing the spike protein from SARS-CoV-2 Wuhan (WA1) was shown to be effective in mice and ferrets. A single intranasal dose of CVXGA1 induced WA1-neutralizing antibodies and protected K18-hACE2 mice from lethal infection with SARS-CoV-2 WA1. Furthermore, a single intranasal dose of CVXGA1 protected ferrets from infection with SARS-CoV-2 WA1 and blocked transmission to co-housed naive ferrets (An, D., et al., Sci Adv, 7(27)(2021)). These studies determined the efficacy of a single intranasal dose of CVXGA1 against SARS-CoV-2 WA1, but further studies are needed to establish its efficacy against SARS-CoV-2 mutant strains.

[0114] The PIV5 virus vaccine of the present invention may also have mutations, alterations, or deletions in one or more of these eight proteins of the PIV5 genome. For example, the PIV5 virus expression vector may contain one or more mutations, including but not limited to, any of those described herein. In some embodiments, a combination of two or more (2, 3, 4, 5, 6, 7, or more) mutations may be advantageous and may demonstrate enhanced activity.

[0115] In one embodiment, the PIV5 vector was further modified by introducing mutations in the PIV5 V / P gene and deleting the PIV5 SH gene to further improve vaccine efficacy. S157F and S308A in the PIV5 V / P gene have previously been shown to increase viral polymerase activity and improve viral titer or yield (Timani KA, Sun D, ​​Sun M, et al. J Virol., 82(18):9123-9133 (2008); Sun D, ​​Luthra P, Li Z, He B., PLoS Pathog., 5(7):e1000525 (2009)). A PIV5 W3A strain-based RSV vaccine with a single S157F mutation was shown to induce higher levels of neutralizing antibodies in cotton rats than a PIV5 CPI-vectored RSV vaccine (see Table 19). The PIV5 W3A strain, which lacks the SH gene and expresses the influenza virus H5 HA protein, induced higher levels of antibodies and provided better protection against influenza virus challenge (Li Z, Gabbard JD, Mooney A, et al., J Virol., 87(17):9604-9609(2013)). In one embodiment, a newly generated modified PIV5 viral vector backbone, designated CVB, is presented herein by introducing S157F into the V / P gene and deleting the SH gene from the PIV5 W3A viral genome. In another embodiment, a CVB-vectored SARS-CoV-2 vaccine for intranasal immunization was generated.

[0116] Mutations include, but are not limited to, mutations in the V / P gene, mutations in the shared N-terminus of the V and P proteins, mutations at residues 26, 32, 33, 50, 102, 156, and / or 157 of the shared N-terminus of the V and P proteins, mutations that lack the C-terminus of the V protein, mutations that lack the small hydrophobic (SH) protein, mutations in the fusion (F) protein, mutations in the phosphoprotein (P), mutations in the large RNA polymerase (L) protein, mutations incorporating residues from canine parainfluenza virus, and / or mutations that enhance syncytial formation.

[0117] Mutations may include, but are not limited to, rPIV5-V / P-CPI-, rPIV5-CPI-, rPIV5-CPI+, rPIV5VΔC, rPIV-Rev, rPIV5-RL, rPIV5-P-S156N, rPIV5-P-S157A, rPIV5-P-S308A, rPIV5-L-A1981D and rPIV5-F-S443P, rPIV5-MDA7, rPIV5ΔSH-CPI-, rPIV5ΔSH-Rev, and combinations thereof.

[0118] PIV5 can productively infect cells in many cell types with little or no cytopathic effect (CPE). In some cell types, PIV5 infection leads to the formation of syncytia, i.e., fusion bodies of many cells, resulting in cell death. Mutations may include one or more mutations that promote syncytium formation (see, e.g., Paterson et al., 2000, Virology; 270:17-30).

[0119] The PIV5 V protein plays an important role in preventing virus-induced apoptosis. Recombinant PIV5 lacking the conserved cysteine-rich C-terminus of the V protein (rPIV5VΔC) induces apoptosis in various cells, likely via the intrinsic apoptotic pathway initiated via endoplasmic reticulum (ER) stress (Sun et al., 2004, J Virol; 78:5068-5078). Mutant recombinant PIV5s with mutations in the N-terminus of the V / P gene product, such as rPIV5-CPI-, also induce apoptosis (Wansley and Parks, 2002, J Virol; 76:10109-10121). Mutations include, but are not limited to, rPIV5ΔSH, rPIV5-CPI-, rPIV5VΔC, and combinations thereof.

[0120] i. CVB-based vaccine vector encoding the SARS-CoV-2 spike (S) protein In the CVB-based vaccine vectors of the present invention, a heterologous nucleotide sequence encoding a coronavirus spike (S) protein, including but not limited to the S protein of SARS-CoV-2, is inserted into the CVB genome. Coronavirus entry into host cells is mediated by the transmembrane S glycoprotein (Tortorici and Veesler, 2019, Adv Virus Res; 105:93-116). Because the coronavirus S glycoprotein is surface-exposed and mediates entry into host cells, it is a primary target of neutralizing antibodies during infection and a focus of therapeutic and vaccine design. The SARS-CoV-2 spike S protein is composed of two subunits, S1 and S2. The S1 subunit contains a receptor-binding domain that recognizes and binds to the host receptor angiotensin-converting enzyme 2, and the S2 subunit mediates viral membrane fusion by forming a six-helix bundle via two heptad repeat domains (Huang et al., 2020, Acta Pharmacol Sinica; 0:1-9 (available on the World Wide Web at doi.org / 10.1038 / s41401-020-0485-4)).

[0121] The SARS-CoV-2 S protein is 1,273 amino acids (aa) long and consists of an N-terminal signal peptide (amino acids 1–13), an S1 subunit (residues 14–685), and an S2 subunit (residues 686–1,273). The last two regions are responsible for receptor binding and membrane fusion, respectively. The S1 subunit contains the N-terminal domain (residues 14–305) and the receptor-binding domain (RBD, residues 319–541). The S2 subunit contains the fusion peptide (FP) (residues 788–806), heptapeptide repeat 1 (HR1) (residues 912–984), HR2 (residues 1163–1213), the TM domain (residues 1213–1237), and the cytoplasmic domain (residues 1237–1273) (Xia et al., 2020, Cell Mol Immunol;17:765–7).

[0122] In some CVB-based vaccine vectors of the present invention, a heterologous nucleotide sequence encoding a coronavirus spike (S) protein, including but not limited to the S protein of SARS-CoV-2, is modified such that the cytoplasmic tail of the coronavirus S protein is replaced with the cytoplasmic tail of the fusion (F) protein of PIV5.

[0123] In some CVB-based vaccine vectors of the invention, the heterologous nucleotide sequence encoding a coronavirus S protein, including but not limited to the S protein of SARS-CoV-2, is modified such that the S protein comprises an amino acid substitution at amino acid residues W886 and / or F888. In some embodiments, the amino acid substitution at amino acid residue W886 comprises a substitution of tryptophan (W) with arginine (R), and / or the amino acid substitution at amino acid residue W888 comprises a substitution of phenylalanine (F) with arginine (R).

[0124] In some CVB-based vaccine vectors of the invention, the heterologous nucleotide sequence encoding a coronavirus spike (S) protein, including but not limited to the S protein of SARS-CoV-2, comprises both a replacement of the cytoplasmic tail of the coronavirus S protein with the cytoplasmic tail of the fusion (F) protein of PIV5, and a modification to include an amino acid substitution at amino acid residues W886 and / or F888. In some embodiments, the amino acid substitution at amino acid residue W886 includes a substitution of tryptophan (W) with arginine (R), and / or the amino acid substitution at amino acid residue W888 includes a substitution of phenylalanine (F) with arginine (R).

[0125] A heterologous nucleotide sequence encoding a coronavirus S protein, including but not limited to the S protein of SARS-CoV-2, can be inserted into any of a variety of locations within the CVB genome.

[0126] Disclosed herein are CVB vaccine vectors encoding SARS-CoV-2 variants of concern or of note. CVB-based vaccine vectors can include inserting SARS-CoV-2 spike (S) or nucleocapsid (N) genes from different variants into a CVB vector.

[0127] The CVB-based vaccine vector of the present invention comprises a CVB virus expression vector containing a mutation at amino acid residue S156 or S157 and a deletion of the small hydrophobic (SH) gene of the PIV5 W3A viral genome.

[0128] In some CVB-based vaccine vectors of the present invention, the mutation at amino acid residue S157 comprises a substitution of serine (S) with an amino acid residue selected from the group consisting of alanine (A), cysteine ​​(C), aspartic acid (D), glutamic acid (E), phenylalanine (F), glycine (G), histidine (H), isoleucine (I), lysine (K), leucine (L), methionine (M), asparagine (N), proline (P), glutamine (Q), arginine (R), selenocysteine ​​(U), valine (V), tryptophan (W), and tyrosine (Y).

[0129] In some CVB-based vaccine vectors of the present invention, the amino acid substitution at amino acid residue S157 comprises a serine (S) to phenylalanine (F) substitution, or S156N comprises a serine (S) to asparagine (N) substitution.

[0130] In some CVB-based vaccine vectors of the present invention, the SH gene has a deletion of the SH open reading frame or a deletion of the entire SH gene transcription unit.

[0131] In some CVB-based vaccine vectors of the present invention, the PIV5 genome has a heterologous nucleic acid sequence having at least 98% sequence identity to SEQ ID NO: 27, 28, 29, 30, 31, 32, or 33, and the viral expression vector expresses a heterologous polypeptide comprising coronavirus spike (S) and / or nucleocapsid (N) proteins.

[0132] In some CVB-based vaccine vectors of the present invention, the coronavirus S protein is the coronavirus S protein of severe acute respiratory syndrome coronavirus 2 (SARS-CoV-2), a variant of note or variant of concern of SARS-CoV-2, and the coronavirus N protein is the coronavirus N protein of SARS-CoV-2, a variant of note or variant of concern of SARS-CoV-2.

[0133] In another embodiment, the coronavirus S protein is a coronavirus S protein of a SARS-CoV-2 Wuhan strain, a SARS-CoV-2 beta variant, a SARS-CoV-2 gamma variant, a SARS-CoV-2 delta variant, or a SARS-CoV-2 omicron variant, and the coronavirus N protein is a coronavirus N protein of a SARS-CoV-2 Wuhan strain, a SARS-CoV-2 beta variant, a SARS-CoV-2 gamma variant, a SARS-CoV-2 delta variant, or a SARS-CoV-2 omicron variant.

[0134] In some CVB-based vaccine vectors of the invention, the coronavirus S protein comprises the coronavirus S protein of SARS-CoV-2, and the cytoplasmic tail of the coronavirus S protein is replaced with the cytoplasmic tail of the fusion (F) protein of the CVB.

[0135] In some CVB-based vaccine vectors of the present invention, the PIV5 W3A viral genome contains an open reading frame deletion mutation in the SH gene, and the S gene of the SARS-CoV-2 Wuhan strain is inserted between the PIV5 hemagglutinin (HN) gene and the polymerase (L) gene of PIV5.

[0136] In some CVB-based vaccine vectors of the present invention, the entire SH gene transcription unit of the PIV5 W3A viral genome is deleted, and the S gene of the SARS-CoV-2 Wuhan strain is placed between the HN and L genes of PIV5.

[0137] In some CVB-based vaccine vectors of the present invention, the N gene of the SARS-CoV-2 Wuhan strain is inserted to replace the SH gene of PIV5, and the S gene of the SARS-CoV-2 Wuhan strain is inserted between the HN and L genes of PIV5.

[0138] In some CVB-based vaccine vectors of the present invention, the S gene of the SARS-CoV-2 Omicron BA.1 variant is inserted to replace the S gene of the SARS-CoV-2 Wuhan strain, and the N gene of the SARS-CoV-2 Wuhan strain is inserted in place of the SH gene of PIV5.

[0139] In some CVB-based vaccine vectors of the present invention, the S gene of the SARS-CoV-2 Omicron BA.5 variant is inserted between the HN and L genes of PIV5 to replace the S gene of the Wuhan strain.

[0140] In some CVB-based vaccine vectors of the present invention, the S gene of the SARS-CoV-2 Omicron BA.5 variant is inserted to replace the S gene of the Wuhan strain, and the N gene of the SARS-CoV-2 Wuhan strain is inserted to replace the SH gene of PIV5.

[0141] In some CVB-based vaccine vectors of the present invention, the PIV5 F and HN genes are deleted, and the S gene of the SARS-CoV-2 Wuhan strain is located between the HN and L genes of PIV5.

[0142] Also included in the present invention are virions and infectious viral particles comprising a PIV5 genome that includes a heterologous nucleotide sequence encoding a coronavirus S protein, including but not limited to the S protein of SARS-CoV-2.

[0143] The present invention also includes compositions containing one or more of the PIV5 viral constructs or virions described herein. Such compositions may include a pharmaceutically acceptable carrier. As used herein, a pharmaceutically acceptable carrier refers to one or more compatible solid or liquid fillers, diluents, or encapsulating substances suitable for administration to humans or other vertebrates. Such carriers may be pyrogen-free. The present invention also includes methods of making and using the viral vectors and compositions described herein.

[0144] The compositions of the present disclosure can be formulated into various forms of pharmaceutical preparations adapted to the selected route of administration. Those skilled in the art will understand that the compositions may vary depending on the mode of administration and dosage unit.

[0145] The agent of the present invention can be administered by various means, including but not limited to intravenous, topical, oral, intranasal, subcutaneous, intraperitoneal, intramuscular, and intratumoral delivery.In some embodiments, the agent of the present invention can be formulated for controlled release or sustained release.One advantage of intranasal immunization is the possibility of inducing mucosal immune response.

[0146] C. CVB-S backbone vaccine virus sequence The CVB vector SARS-CoV-2 vaccine virus sequences from the constructs in Table 1 are listed below. The inserted N in the SARS-CoV-2 sequence is underlined lowercase, the M sequence is italic lowercase, the E sequence is bold lowercase, and the S is lowercase.

[0147] i.CVL104 The nucleic acid sequence of CVL104 is as follows: GATACGGGAGGGCTTACCATCTGGCCCCAGTGCTGCAATGATACCGCGAGACCCACGCTCACCGGCTCCAGATTTATCAGCAATAAACCAGCCAGCCGGAAGGGCCGAGCGCAGAAGTGGTCCTGCAACTTTATCCGCCTCCATCCAGTCTATTAATTGTTGCCGGGAAGCTAGAGTAAGTAGTTCGCCAGTTAATAGTTTGCGCAACGTTGTTGCCATTGCTACAGGCATCGTGGTGTCACGCTCGTCGTTTGGTATGGCTTCATTCAGCTCCGGTTCCCAACGATCAAGGCGAGTTACATGATCCCCCATGTTGTGCAAAAAAGCGGTTAGCTCCTTCGGTCCTCCGATCGTTGTCAGAAGTAAGTTGGCCGCAGTGTTATCACTCATGGTTATGGCAGCACTGCATAATTCTCTTACTGTCATGCCATCCGTAAGATGCTTTTCTGTGACTGGTGAGTACTCAACCAAGTCATTCTGAGAATAGTGTATGCGGCGACCGAGTTGCTCTTGCCCGGCGTCAATACGGGATAATACCGCGCCACATAGCAGAACTTTAAAAGTGCTCATCATTGGAAAACGTTCTTCGGGGCGAAAACTCTCAAGGATCTTACCGCTGTTGAGATCCAGTTCGATGTAACCCACTCGTGCACCCAACTGATCTTCAGCATCTTTTACTTTCACCAGCGTTTCTGGGTGAGCAAAAACAGGAAGGCAAAATGCCGCAAAAAAGGGAATAAGGGCGACACGGAAATGTTGAATACTCATACTCTTCCTTTTTCAATATTATTGAAGCATTTATCAGGGTTATTGTCTCATGAGCGGATACATATTTGAATGTATTTAGAAAAATAAACAAATAGGGGTTCCGCGCACATTTCCCCGAAAAGT (SEQ ID NO: 3).

[0148] ii. CVL87 The nucleic acid sequence of CVL87 is as follows: (SEQ ID NO: 4).

[0149] iii.CVL85 The nucleic acid sequence of CVL85 is as follows: CTCAATTGGCCAATGTAACCTACAATAGCACCATCAAGCTTGAATCATCCCAGATTCTTGTCTATTGATCCGTTGGATATATCCCAGAATCTAGCTGCGGTGAATAAGAGTCTAAGTGATGCACTACAACACTTAGCACAAAGTGACACATATCTTTCTGCAATCACATCAGCTACGACTACAAGTGTATTATCCATAATAGCAATCTGTCTTGGATCGTTAGGTTTAATATTAATAATCTTGCTCAGTGTAGTTGTGTGGAAGTTATTGACCATTGTCGTTGCTAATCGAAATAGAATGGAGAATTTTGTTTATCATAAATAAGCATTCCACCACTCACGATCTGATCTCAGTGAGAAAAATCAACCTGCAACTCTTGGAACAAGATAAGACAGTCATCCATTAGTAATTTTTAAGAAAAAAACGATAGGACCGAACCTAGTATTGAAAGAACCGTCTCGGTCAATCTAGGTAATCGAGCTGATACCGTCTCGGAAAGCTCAAATCGCGCGCCACC atgtcagataacggaccacagaaccagaggaacgcacccaggattactttcggaggaccaagcgatagcaccgggagcaaccagaatggagagcggagcggagcaagatccaagcagagacggccccagggcctgccaaacaataccgcatcctggttcaccgccctgacacagcacggcaaggaggacctgaagtttccaaggggacagggagtgcctatcaacaccaatagctcccctgacgatcagatcggctactataggagggcaacaaggagaatcaggggaggcgacggcaagatgaaggatctgagcccacgctggtacttctactatctgggaaccggacctgaggcaggcctgccatatggcgccaacaaggacggaatcatctgggtggcaaccgagggcgccctgaacacaccaaaggatcacatcggcacaagaaatcccgccaacaatgcagcaatcgtgctgcagctgccacagggaaccacactgcccaagggcttttacgcagagggctctcggggaggcagccaggcatctagcagatcctctagccggagcagaaactcctctaggaattccaccccaggaagctccaggggcacatcccctgcccgcatggcaggaaacggaggcgacgccgccctggccctgctgctgctggatcgcctgaatcagctggagtccaagatgtctggcaagggacagcagcagcagggacagaccgtgacaaagaagtccgccgccgaggcctctaagaagccaaggcagaagcgcaccgccacaaaggcctacaacgtgacccaggccttcggcaggcgcggaccagagcagacacagggcaattttggcgaccaggagctgatcaggcagggaaccgattataagcactggcctcagatcgcccagttcgccccatctgccagcgccttctttggcatgtctagaatcggcatggaggtgacccccagcggcacatggctgacc tacacaggcgccatcaagctggacgataaggaccctaacttcaaggatcaggtcatcctgctgaacaagcacatcgacgcctataagacctttccccctacagagcccaagaaggacaagaagaagaaggccgatgagacacaggccctgcctcagaggcagaagaagcagcagaccgtgacactgctgccagccgccgatctggacgatttctccaaacagctgcagcagagcatgtccagtgccgactccacccaggcttga

[0150] iv.CVL83 The nucleic acid sequence of CVL83 is as follows: CTCAATTGGCCAATGTAACCTACAATAGCACCATCAAGCTTGAATCATCCCAGATTCTTGTCTATTGATCCGTTGGATATATCCCAGAATCTAGCTGCGGTGAATAAGAGTCTAAGTGATGCACTACAACACTTAGCACAAAGTGACACATATCTTTCTGCAATCACATCAGCTACGACTACAAGTGTATTATCCATAATAGCAATCTGTCTTGGATCGTTAGGTTTAATATTAATAATCTTGCTCAGTGTAGTTGTGTGGAAGTTATTGACCATTGTCGTTGCTAATCGAAATAGAATGGAGAATTTTGTTTATCATAAATAAGCATTCCACCACTCACGATCTGATCTCAGTGAGAAAAATCAACCTGCAACTCTTGGAACAAGATAAGACAGTCATCCATTAGTAATTTTTAAGAAAAAAACGATAGGACCGAACCTAGTATTGAAAGAACCGTCTCGGTCAATCTAGGTAATCGAGCTGATACCGTCTCGGAAAGCTCAAATCGCGCGCCACC atgtcagataacggaccacagaaccagaggaacgcacccaggattactttcggaggaccaagcgatagcaccgggagcaaccagaatggagagcggagcggagcaagatccaagcagagacggccccagggcctgccaaacaataccgcatcctggttcaccgccctgacacagcacggcaaggaggacctgaagtttccaaggggacagggagtgcctatcaacaccaatagctcccctgacgatcagatcggctactataggagggcaacaaggagaatcaggggaggcgacggcaagatgaaggatctgagcccacgctggtacttctactatctgggaaccggacctgaggcaggcctgccatatggcgccaacaaggacggaatcatctgggtggcaaccgagggcgccctgaacacaccaaaggatcacatcggcacaagaaatcccgccaacaatgcagcaatcgtgctgcagctgccacagggaaccacactgcccaagggcttttacgcagagggctctcggggaggcagccaggcatctagcagatcctctagccggagcagaaactcctctaggaattccaccccaggaagctccaggggcacatcccctgcccgcatggcaggaaacggaggcgacgccgccctggccctgctgctgctggatcgcctgaatcagctggagtccaagatgtctggcaagggacagcagcagcagggacagaccgtgacaaagaagtccgccgccgaggcctctaagaagccaaggcagaagcgcaccgccacaaaggcctacaacgtgacccaggccttcggcaggcgcggaccagagcagacacagggcaattttggcgaccaggagctgatcaggcagggaaccgattataagcactggcctcagatcgcccagttcgccccatctgccagcgccttctttggcatgtctagaatcggcatggaggtgacccccagcggcacatggctgacc tacacaggcgccatcaagctggacgataaggaccctaacttcaaggatcaggtcatcctgctgaacaagcacatcgacgcctataagacctttccccctacagagcccaagaaggacaagaagaagaaggccgatgagacacaggccctgcctcagaggcagaagaagcagcagaccgtgacactgctgccagccgccgatctggacgatttctccaaacagctgcagcagagcatgtccagtgccgactccacccaggcttga

[0151] v.CVL109 The nucleic acid sequence of CVL109 is as follows: AATGTGTGAGTCTGCAGCTTGACAATCTCAGATTCACCATCACTCAATTGGCCAATGTAACCTACAATAGCACCATCAAGCTTGAATCATCCCAGATCTTGTCTATTGATCCGTTGGATATATCCCAGAATCTAGCTGCGGTGAATAAGAGTCTAAGTGATGCACTACAACACTTAGCACAAAGTGACACATATCTTTCTGCAATCACATCAGCTACGACTACAAGTGTATTATCCATAATAGCAATCTGTCTTGGATCGTTAGGTTTAATATTAATAA TCTTGCTCAGTGTAGTTGTGTGGAAGTTATTGACCATTGTCGTTGCTAATCGAAATAGAATGGAGAATTTTGTTTATCATAAATAAGCATTCCACCACTCACGATCTGATCTCAGTGAGAAAAATCAACCTGCAACTCTTGGAACAAGATAAGACAGTCATCCATTAGTAATTTTTAAGAAAAAAACGATAGGACCGAACCTAGTATTGAAAGAACCGTCTCGGTCAATCTAGGTAATCGAGCTGATACCGTCTCGGAAAGCTCAAATCGCGCGCCACC atgtcagataacggaccacagaaccagaggaacgcacccaggattactttcggaggaccaagcgatagcaccgggagcaaccagaatggagagcggagcggagcaagatccaagcagagacggccccagggcctgccaaacaataccgcatcctggttcaccgccctgacacagcacggcaaggaggacctgaagtttccaaggggacagggagtgcctatcaacaccaatagctcccctgacgatcagatcggctactataggagggcaacaaggagaatcaggggaggcgacggcaagatgaaggatctgagcccacgctggtacttctactatctgggaaccggacctgaggcaggcctgccatatggcgccaacaaggacggaatcatctgggtggcaaccgagggcgccctgaacacaccaaaggatcacatcggcacaagaaatcccgccaacaatgcagcaatcgtgctgcagctgccacagggaaccacactgcccaagggcttttacgcagagggctctcggggaggcagccaggcatctagcagatcctctagccggagcagaaactcctctaggaattccaccccaggaagctccaggggcacatcccctgcccgcatggcaggaaacggaggcgacgccgccctggccctgctgctgctggatcgcctgaatcagctggagtccaagatgtctggcaagggacagcagcagcagggacagaccgtgacaaagaagtccgccgccgaggcctctaagaagccaaggcagaagcgcaccgccacaaaggcctacaacgtgacccaggccttcggcaggcgcggaccagagcagacacagggcaattttggcgaccaggagctgatcaggcagggaaccgattataagcactggcctcagatcgcccagttcgccccatctgccagcgccttctttggcatgtct agaatcggcatggaggtgacccccagcggcacatggctgacctacacaggcgccatcaagctggacgataaggaccctaacttcaaggatcaggtcatcctgctgaacaagcacatcgacgcctataagacctttccccctacagagcccaagaaggacaagaagaagaaggccgatgagacacaggccctgcctcagaggcagaagaagcagcagaccgtgacactgctgccagccgccgatctggacgatttctccaaacagctgcagcagagcatgtccagtgccgactccacccaggcttga AAAACTCTCAAGGATCTTACCGCTGTTGAGATCCAGTTCGATGTAACCCACTCGTGCACCCAACTGATCTTCAGCATCTTTTACTTTCACCAGCGTTTCTGGGTGAGCAAAAACAGGAAGGCAAAATGCCGCAAAAAAGGGAATAAGGGCGA CACGGAAATGTTGAATACTCATACTCTTCCTTTTTCAATATTATTGAAGCATTTATCAGGGTTATTGTCTCATGAGCGGATACATATTTGAATGTATTTAGAAAAATAAACAAATAGGGGTTCCGCGCACATTTCCCGAAAGT (SEQ ID NO: 7).

[0152] vi.CVL110 The nucleic acid sequence of CVL110 is as follows: (SEQ ID NO:8).

[0153] vii.CVL112 The nucleic acid sequence of CVL112 is as follows:

[0154] viii.CVL119 The nucleic acid sequence of CVL119 is as follows: GGTCGATGTTGTGCAAGTGCATGCAACCTGCTGCTGTGATCCTACAGCCGAGTTCATCCCCTGTAACTGTCATTGACATGTACAAATGTGTGAGTCTGCAGCTTGACAATCTCAGATTCACCATCACTCAATTGGCCAATGTAACCTACAATAGCACCATCAAGCTTGAATCATCCCAGATTCTTGTCTATTGATCCGTTGGATATATCCCAGAATCTAGCTGCGGTGAATAAGAGTCTAAGTGATGCACTACAACACTTAGCACAAAGTGACACATATCTTTCTGCAATCACATCAGCTACGACTACAAGTGTATTATCCA TAATAGCAATCTGTCTTGGATCGTTAGGTTTAATATTAATAATCTTGCTCAGTGTAGTTGTGTGGAAGTTATTGACCATTGTCGTTGCTAATCGAAATAGAATGGAGAATTTTGTTTATCATAAATAAGCATTCCACCACTCACGATCTGATCTCAGTGAGAAAAATCAACCTGCAACTCTTGGAACAAGATAAGACAGTCATCCATTAGTAATTTTTAAGAAAAAAACGATAGGACCGAACCTAGTATTGAAAGAACCGTCTCGGTCAATCTAGGTAATCGAGCTGATACCGTCTCGGAAAGCTCAAATCGCGCGCCACC atgtcagataacggaccacagaaccagaggaacgcacccaggattactttcggaggaccaagcgatagcaccgggagcaaccagaatggagagcggagcggagcaagatccaagcagagacggccccagggcctgccaaacaataccgcatcctggttcaccgccctgacacagcacggcaaggaggacctgaagtttccaaggggacagggagtgcctatcaacaccaatagctcccctgacgatcagatcggctactataggagggcaacaaggagaatcaggggaggcgacggcaagatgaaggatctgagcccacgctggtacttctactatctgggaaccggacctgaggcaggcctgccatatggcgccaacaaggacggaatcatctgggtggcaaccgagggcgccctgaacacaccaaaggatcacatcggcacaagaaatcccgccaacaatgcagcaatcgtgctgcagctgccacagggaaccacactgcccaagggcttttacgcagagggctctcggggaggcagccaggcatctagcagatcctctagccggagcagaaactcctctaggaattccaccccaggaagctccaggggcacatcccctgcccgcatggcaggaaacggaggcgacgccgccctggccctgctgctgctggatcgcctgaatcagctggagtccaagatgtctggcaagggacagcagcagcagggacagaccgtgacaaagaagtccgccgccgaggcctctaagaagccaaggcagaagcgcaccgccacaaaggcctacaacgtgacccaggccttcggcagg cgcggaccagagcagacacagggcaattttggcgaccaggagctgatcaggcagggaaccgattataagcactggcctcagatcgcccagttcgccccatctgccagcgccttctttggcatgtctagaatcggcatggaggtgacccccagcggcacatggctgacctacacaggcgccatcaagctggacgataaggaccctaacttcaaggatcaggtcatcctgctgaacaagcacatcgacgcctataagacctttccccctacagagcccaagaaggacaagaagaagaaggccgatgagacacaggccctgcctcagaggcagaagaagcagcagaccgtgacactgctgccagccgccgatctggacgatttctccaaacagctgcagcagagcatgtccagtgccgactccacccaggcttga GTTGAGATCCAGTTCGATGTAACCCACTCGTGCACCCAACTGATCTTCAGCATCTTTACTTTCACCAGCGTTTCTGGGTGAGCAAAAACAGGAAGGCAAAATGCCGCAAAAAAGGGAATAAGGGCGACACGGAAATGTTG AATACTCATACTCTTCCTTTTTCAATATTATTGAAGCATTTATCAGGGTTATTGTCTCATGAGCGGATACATATTTGAATGTATTTAGAAAAATAAACAAATAGGGGTTCCGCGCACATTTCCCGAAAGT (SEQ ID NO: 10).

[0155] ix.CVL120 The nucleic acid sequence of CVL120 is as follows: CAGTTACCAATGCTTAATCAGTGAGGCACCTATCTCAGCGATCTGTCTATTTCGTTCATCCATAGTTGCCTGACTCCCCGTCGTGTAGATAACTACGATACGGGAGGGCTTACCATCTGGCCCCAGTGCTGCAATGATACCGCGAGACCCACGCTCACCGGCTCCAGATTTATCAGCAATAAACCAGCCAGCCGGAAGGGCCGAGCGCAGAAGTGGTCCTGCAACTTTATCCGCCTCCATCCAGTCTATTAATTGTTGCCGGGAAGCTAGAGTAAGTAGTTCGCCAGTTAATAGTTTGCGCAACGTTGTTGCCATTGCTACAGGCATCGTGGTGTCACGCTCGTCGTTTGGTATGGCTTCATTCAGCTCCGGTTCCCAACGATCAAGGCGAGTTACATGATCCCCCATGTTGTGCAAAAAAGCGGTTAGCTCCTTCGGTCCTCCGATCGTTGTCAGAAGTAAGTTGGCCGCAGTGTTATCACTCATGGTTATGGCAGCACTGCATAATTCTCTTACTGTCATGCCATCCGTAAGATGCTTTTCTGTGACTGGTGAGTACTCAACCAAGTCATTCTGAGAATAGTGTATGCGGCGACCGAGTTGCTCTTGCCCGGCGTCAATACGGGATAATACCGCGCCACATAGCAGAACTTTAAAAGTGCTCATCATTGGAAAACGTTCTTCGGGGCGAAAACTCTCAAGGATCTTACCGCTGTTGAGATCCAGTTCGATGTAACCCACTCGTGCACCCAACTGATCTTCAGCATCTTTTACTTTCACCAGCGTTTCTGGGTGAGCAAAAACAGGAAGGCAAAATGCCGCAAAAAAGGGAATAAGGGCGACACGGAAATGTTGAATACTCATACTCTTCCTTTTTCAATATTATTGAAGCATTTATCAGGGTTATTGTCTCATGAGCGGATACATATTTGAATGTATTTAGAAAAATAAACAAATAGGGGTTCCGCGCACATTTCCCCGAAAAGT (SEQ ID NO: 〖11〗).

[0156] x.CVL121 The nucleic acid sequence of CVL121 is as follows:

[0157] xi.CVL128 The nucleic acid sequence of CVL128 is as follows: GGTATGACACTGTACTAACCCTGAGGGTTTTAGAAAAAACGATTAACGATAAATAAGCCCGAACACTACACACTACCTGAGGCAGCCACC atgtcagataacggaccacagaaccagaggaacgcacccaggattactttcggaggaccaagcgatagcaccgggagcaaccagaatggagagcggagcggagcaagatccaagcagagacggccccagggcctgccaaacaataccgcatcctggttcaccgccctgacacagcacggcaaggaggacctgaagtttccaaggggacagggagtgcctatcaacaccaatagctcccctgacgatcagatcggctactataggagggcaacaaggagaatcaggggaggcgacggcaagatgaaggatctgagcccacgctggtacttctactatctgggaaccggacctgaggcaggcctgccatatggcgccaacaaggacggaatcatctgggtggcaaccgagggcgccctgaacacaccaaaggatcacatcggcacaagaaatcccgccaacaatgcagcaatcgtgctgcagctgccacagggaaccacactgcccaagggcttttacgcagagggctctcggggaggcagccaggcatctagcagatcctctagccggagcagaaactcctctaggaattccaccccaggaagctccaggggcacatcccctgcccgcatggcaggaaacggaggcgacgccgccctggccctgctgctgctggatcgcctgaatcagctggagtccaagatgtctggcaagggacagcagcagcagggacagaccgtgacaaagaagtccgccgccgaggcctctaagaagccaaggcagaagcgcaccgccacaaaggcctacaacgtgacccaggccttcggcaggcgcggaccagagcagacacagggcaattttggcgaccaggagctgatcaggcagggaaccgattataagcactggcctcagatcgcccagttcgccccatctgccagcgccttctttggcatgtctagaatcggcatggaggtgacccccagcggcacatggctgacctacacaggcgccatcaagctggacgataaggaccctaacttcaaggatcaggtcatcctgctgaacaagcacatcgacgcctataagacctttccccctacagagcccaagaaggacaagaagaagaaggccgatgagacacaggccctgcctcagaggcagaagaagcagcagaccgtgacactgctgccagccgccgatctggacgatttctccaaacagctgcagcagagcatgtccagtgccgactccacccaggcttga CGTACGGATCCCAATCTTAAATCGACACACCTAATTGACCAGTTAGATGGAACTACAGTGGATTCCATAAGGTTCCTG TGCACCCAACTGATCTTCAGCATCTTTTACTTTCACCAGCGTTTCTGGGTGAGCAAAAACAGGAAGGCAAAATGCCGCAAAAAAGGGAATAAGGGCGACACGGAAATGTTGAATACTCATACTCTTCCTTTTTCAATATTATTGAAGCATTTATCAGGGTTATTGTCTCATGAGCGGATACATATTTGAATGTATTTAGAAAAATAAACAAATAGGGGTTCCGCGCACATTTCCCCGAAAAGT (SEQ ID NO: 13).

[0158] V. Preparation Method The present invention also includes methods of making and using CVB virus expression vectors, including but not limited to any of those described herein.

[0159] For example, the present invention includes methods for expressing a coronavirus S protein, including but not limited to the S protein of SARS-CoV-2, in a cell by infecting the cell with a CVB virus expression vector, viral particle, or composition described herein.

[0160] The present invention includes methods of inducing an immune response in a subject against a coronavirus S protein, including but not limited to the S protein of SARS-CoV-2, by administering to the subject a viral expression vector, viral particle, or composition described herein. The immune response may include a humoral immune response and / or a cellular immune response. The immune response may enhance the innate and / or adaptive immune response.

[0161] The present invention includes methods for expressing a heterologous coronavirus S protein, including but not limited to the S protein of SARS-CoV-2, in a subject by administering to the subject a viral expression vector, viral particle, or composition described herein.

[0162] The present invention includes methods for expressing heterologous coronavirus S proteins in a subject, including but not limited to, the S proteins of SARS-CoV-2 alpha, gamma, delta, and omicron strains, by administering to the subject a viral expression vector, viral particle, or composition described herein.

[0163] VI. Treatment method The present disclosure may be used in gene therapy and / or therapeutic approaches for the treatment of diseases involving an increase or decrease in a nucleotide sequence of interest in a host cell. In these embodiments, the expressible heterologous nucleotide sequence may be derived from a mammalian genome. In some embodiments, it may be particularly useful to have an expressible heterologous nucleotide sequence derived from the human genome, where expression of wild-type RNA and / or protein can provide a therapeutic effect in a patient. For example, the expressible heterologous nucleotide sequence may encode CFTR, NeuroD1, Cas9, and guide RNA, or any other such sequence. In other embodiments, the heterologous nucleotide sequence encodes a secreted protein.

[0164] In other embodiments, the expressible heterologous nucleotide sequence responds to a positive selection stimulus. In other embodiments, the expressible heterologous nucleotide sequence also responds to a negative selection stimulus. In further embodiments, it may be useful for the polynucleotide sequence to further comprise a reporter gene. For example, the reporter gene may be luciferase or green fluorescent protein.

[0165] In some embodiments, the CVB expresses one or more nucleotide sequences (e.g., siRNAs) that modify the translation and / or transcription of a host cell nucleotide sequence of interest within the host cell. In some embodiments, the transcription and / or translation of the expressible heterologous nucleotide sequence is modified so that the nucleotide sequence is codon-degenerate with respect to endogenous genes in the cell. In addition, the expressible heterologous nucleotide sequence can be modified to co-express an inhibitory or silencing sequence that can inhibit or silence the host cell nucleotide sequence of interest within the host cell.

[0166] In certain embodiments of the present disclosure, CVB compositions can be utilized to prepare antigen preparations for use as vaccines. Any suitable antigen(s) can be prepared in accordance with the present disclosure, including antigens obtained from prions, viruses, mycobacteria, protozoa (e.g., Plasmodium falciparum (malaria)), trypanosomes, bacteria (e.g., Streptococcus, Neisseria, etc.), etc.

[0167] A host cell can be transfected with a single CVB particle containing one or more heterologous polynucleotide sequences, or with multiple CVB particles, each CVB particle containing the same or different heterologous polynucleotide sequence(s). For example, a multi-subunit antigen (comprising intracellular and cell surface multi-subunit components) can be prepared by expressing individual subunits in separate vectors but infecting all vectors into the same host cell, resulting in assembly within the host cell.

[0168] Vaccines often contain multiple antigenic components, e.g., from different proteins and / or from different epitopic regions of the same protein. For example, a vaccine against a viral disease can include one or more polypeptide sequences obtained from a virus that, when administered to a host, elicit an immunogenic or protective response against viral challenge.

[0169] As mentioned above, the present disclosure can also be used to prepare polypeptide multimers, for example, when an antigenic preparation composed of two or more polypeptides is produced. For example, a viral capsid can be composed of two or more polypeptide subunits. By transducing a vector carrying different viral envelope sequences into a host cell, the protein can self-assemble into a three-dimensional structure containing two or more protein subunits (for example, in their natural configuration) when expressed in the cell.

[0170] In further embodiments, the expressible heterologous nucleotide sequence is derived from another virus other than PIV5. For example, the heterologous nucleotide sequence can encode influenza HA (from any strain), RSV F, HIV Gag and / or Env, etc. Such embodiments may be useful in developing vaccines and / or vaccination methods. The examples provided herein are non-limiting, as one of skill in the art will understand that nucleotide sequences from a variety of pathogens (including bacteria, parasites, etc.) may be desirable for use in CVB vaccine compositions and / or vaccination methods.

[0171] Examples of viruses for which vaccines can be produced according to the present disclosure include, for example, coronaviruses, orthomyxoviruses, influenza virus A (including all strains in which their HA and NA proteins vary, such as (non-limiting examples) H1N1, H1N2, H2N2, H3N2, H5N1, H6N1, H7N7, H7N9, and H3N8), influenza B, influenza C, Thogotoviruses (including Dolly, Batken, and SiAR 126 viruses), and isaviruses (e.g., infectious salmon anemia virus). These include coronaviruses isolated or propagated from any species, including isolates from invertebrates, vertebrates, mammals, humans, non-human primates, monkeys, pigs, cattle, and other livestock, birds, poultry such as turkeys, chickens, quail, and ducks, wild fowl (including waterfowl and land birds), reptiles, etc. These include existing strains that have been altered, for example, through mutation, antigenic drift, antigenic shift, recombination, etc., particularly strains that have increased virulence and / or interspecies transmission (eg, human to human).

[0172] VII. Method of Administration A. Administration by vaccination The present invention includes methods of vaccinating a subject by administering to the subject a viral expression vector, viral particle, or composition described herein.

[0173] The present disclosure provides vaccines against all coronaviruses, including existing subtypes, their derivatives, and recombinant forms thereof, including subtypes and recombinant forms capable of human-to-human spread. Various isolates, particularly SARS-COV-2 isolates, have been characterized.

[0174] The present disclosure also provides methods for producing CVB compositions. Examples of host cells that can be used to produce CVB compositions include any mammalian or human cell line or primary cell. Non-limiting examples include 293, HT1080, Jurkat, and SupT1 cells. Other examples include CHO, 293, Hela, Vero, L929, BHK, NIH 3T3, MRC-5, BAE-1, HEP-G2, NSO, U937, Namalwa, HL60, WEHI 231, YAC 1, U 266B1, SH-SY5Y, CHO, e.g., CHO-K1 (CCL-61), and 293 (e.g., CRL-1573). Cells are cultured under conditions effective to allow transfection and expression. Such conditions include, for example, the specific environment required to achieve protein production. Such an environment may include, for example, appropriate buffers, oxidizing agents, reducing agents, pH, cofactors, temperature, ion concentrations, the appropriate time and / or stage of the cells where they are being used (e.g., a particular part of the cell cycle or a particular stage in which a particular gene is expressed), culture conditions (including cell culture medium, substrate, oxygen, carbon dioxide, glucose and other sugar substrates, serum, growth factors, etc.).

[0175] The present disclosure also provides various therapeutic methods involving delivering CVBs to host cells in vivo. In some embodiments, the CVBs are delivered to a subject to treat or prevent coronavirus. In other embodiments, the CVBs are delivered to a subject to treat or prevent SARS-CoV-2 alpha, delta, omicron strains, or variants thereof, or to induce an immune response to SARS-CoV-2 in the subject.

[0176] When used to treat various diseases, it is contemplated that the compositions and methods of the present disclosure can be combined with other therapeutic agents suitable for the same or similar diseases. Two or more embodiments of the present disclosure can also be co-administered to produce additive or synergistic effects. When co-administered with a second therapeutic agent, the embodiments of the present disclosure and the second therapeutic agent can be administered simultaneously or sequentially (in any order). The therapeutically effective dosage suitable for each agent may be reduced due to additive or synergistic effects.

[0177] As a non-limiting example, the present disclosure can be combined with other therapies that block inflammation (e.g., via inhibition, reduction, and / or blockage of IL1, INFα / β, IL6, TNF, L13, IL23, etc.). In some embodiments, the CVB compositions and methods disclosed herein are useful for improving the efficacy of vaccines directed against SARS-CoV-2 infection. The compositions and methods of the present disclosure can be administered to a subject simultaneously with or prior to (e.g., 1-30 days prior to) reagents (including, but not limited to, small molecules, antibodies, or cellular reagents) that act to elicit an immune response (e.g., to treat cancer or infectious diseases). The compositions and methods of the present disclosure can also be administered in combination with anti-tumor antibodies or antibodies directed against pathogenic antigens or allergens.

[0178] The pharmaceutical compositions of the present invention can be readily used for a variety of therapeutic or prophylactic purposes, such as treating SARS-CoV-2 infection or inducing an immune response to SARS-CoV-2 in a subject. In various embodiments, the vaccine compositions can be used to treat or prevent infections caused by pathogens from which the immunogenic polypeptides depicted in the PIV5-based vaccines are derived. Thus, the vaccine compositions of the present invention can be used to treat or prevent infections caused by various viruses in a variety of clinical settings. Illustratively, a SARS-CoV-2 CVB-based vaccine composition can be administered to a subject to induce an immune response to SARS-CoV-2, e.g., to induce the production of broadly neutralizing antibodies against the virus. For subjects at risk of developing SARS-CoV-2 infection, the vaccine compositions of the present invention can be administered to provide prophylactic protection against viral infection. Therapeutic and prophylactic uses of vaccines derived from the other immunogens described herein can be similarly implemented. Depending on the specific subject and condition, the pharmaceutical composition of the present invention can be administered to a subject by various modes of administration known to those skilled in the art, such as topical, oral, intranasal, intramuscular, subcutaneous, intravenous, intraarterial, intraarticular, intraperitoneal, or parenteral routes. In some aspects, administration is to a mucosal surface. The vaccine may be administered by mass administration techniques, such as by dispensing the vaccine in drinking water or spraying it into the animal's environment. When administered by injection, the immunogenic composition or vaccine may be administered parenterally. Parenteral administration includes, for example, intravenous, subcutaneous, intramuscular, or intraperitoneal injection.

[0179] Bi inhalation administration In one embodiment, the disclosed CVB vaccine compositions are formulated to allow intranasal administration. The intranasal composition may comprise an inhalable dry powder pharmaceutical formulation containing a therapeutic agent, where the therapeutic agent is present as a free base or as a mixture of a salt and a free base. The pharmaceutical formulations disclosed herein can be formulated to be suitable for respiratory tract administration, e.g., nasal, intranasal, sinusoidal, oral, and / or pulmonary administration. Typically, the formulations are prepared to have a particle size appropriate for the route or target of respiratory tract administration. Accordingly, the formulations disclosed herein can be prepared to have a defined particle size distribution.

[0180] For example, the particle size distribution of a salt form therapeutic agent for intranasal administration may be between about 5 μm and about 350 μm. More specifically, a salt form therapeutic agent may have a particle size distribution for intranasal administration between about 5 μm and about 250 μm, about 10 μm and about 200 μm, about 15 μm and about 150 μm, about 20 μm and about 100 μm, about 38 μm and about 100 μm, about 53 μm and about 100 μm, about 53 μm and about 150 μm, or about 20 μm and about 53 μm. A salt form therapeutic agent in a pharmaceutical composition of the present invention may have a particle size distribution range for intranasal administration of less than about 200 μm. In other embodiments, a salt form therapeutic agent in a pharmaceutical composition has a particle size distribution of less than about 150 μm, less than about 100 μm, less than about 53 μm, less than about 38 μm, less than about 20 μm, less than about 10 μm, or less than about 5 μm. The therapeutic agent in salt form in the pharmaceutical composition of the invention may have a particle size distribution range for intranasal administration of greater than about 5 μm, greater than about 10 μm, greater than about 15 μm, greater than about 20 μm, greater than about 38 μm, less than about 53 μm, less than about 70 μm, greater than about 100 μm, or greater than about 150 μm.

[0181] Additionally, the therapeutic agent salt form in the pharmaceutical composition of the invention can have a particle size distribution range for pulmonary administration of between about 1 μm and about 10 μm. In other embodiments for pulmonary administration, the particle size distribution range is between about 1 μm and about 5 μm, or between about 2 μm and about 5 μm. In other embodiments, the therapeutic agent salt form has an average particle size of at least 1 μm, at least 2 μm, at least 3 μm, at least 4 μm, at least 5 μm, at least 10 μm, at least 20 μm, at least 25 μm, at least 30 μm, at least 40 μm, at least 50 μm, at least 60 μm, at least 70 μm, at least 80 μm, at least 90 μm, or at least 100 μm.

[0182] In some embodiments, the cannabinoid compositions of the present disclosure comprise one or more cannabinoids or pharmaceutically acceptable derivatives or salts thereof, a propellant, an alcohol, and a glycol and / or glycol ether. The alcohol may be a monohydric or polyhydric alcohol, preferably a monohydric alcohol. Monohydric alcohols have a lower viscosity than glycols or glycol ethers. Thus, the composition can form droplets with a smaller diameter than compositions in which the monohydric alcohol is absent. The inventors have surprisingly found that a specific ratio of monohydric alcohol to glycol or glycol ether results in a composition with a desired combination of both long-term stability (e.g., the composition remains single-phase for at least one week at temperatures between 2 and 40°C) and small droplet size.

[0183] ii. Pulmonary Compositions One embodiment provides formulations and methods for treating SARS-CoV-2 in the pulmonary system by inhalation or pulmonary administration. The diffusion characteristics of a particular drug formulation through lung tissue are selected to obtain an effective concentration and effective residence time in the treated tissue. The dose may be increased or decreased, or administered more or less frequently, to achieve a selected blood level. In addition, the timing of administration and the amount of formulation are preferably controlled to optimize the therapeutic effect of the administered formulation on the treated tissue and / or to titrate to a specific blood level.

[0184] Diffusion through lung tissue can be further modified by various excipients that can be added to the formulation to delay or accelerate the absorption of the drug into lung tissue. For example, the drug may be combined with the administration of surfactants, such as phospholipids, dimyristoyl phosphatidylcholine, and dimyristoyl phosphatidylglycerol. The drug may also be used with a bronchodilator, which can relax the bronchial airways and allow the antineoplastic drug to more easily enter the lungs. Albuterol is an example of the latter, and many other substances are known in the art. Furthermore, the drug may be complexed with biocompatible polymers, micelle-forming structures, or cyclodextrins.

[0185] The particle size for the aerosolized drug used in this example was measured to be about 1.0-5.0 μm with a GSD of less than about 2.0 for deposition in the central and peripheral compartments of the lung. As noted elsewhere herein, the particle size is selected depending on the desired deposition site of the drug particles within the respiratory tract.

[0186] Aerosols useful in the present invention comprise an aqueous vehicle, such as water or saline, with or without ethanol, and may contain preservatives or antimicrobial agents, such as benzalkonium chloride, parabens, etc., and / or stabilizers, such as polyethylene glycol.

[0187] Powders useful in the present invention include formulations of the drug as is or in combination with an excipient or carrier, such as mannitol, lactose, or other sugars. The powders used herein are effectively suspended in a carrier gas for administration. Alternatively, the powder may be dispersed in a chamber containing a gas or gas mixture and then inhaled by the patient.

[0188] The agents of the present disclosure may be administered once or divided into several multiple doses administered at intervals. For example, the agents of the present disclosure may be administered repeatedly, for example, at least 2, 3, 4, 5, 6, 7, 8, or more times, or by continuous infusion. It is understood that the exact dosage and duration of treatment are a function of the disease being treated and may be determined empirically using known testing protocols or by extrapolation from in vivo or in vitro test data. It should be noted that concentration and dosage values ​​may also vary depending on the severity of the condition being alleviated. For any particular subject, specific dosage regimens should be adjusted over time according to the individual needs and the professional judgment of the person administering or supervising the administration of the composition, and it should be further understood that any concentration ranges set forth herein are merely exemplary and are not intended to limit the scope or practice of the claimed compositions and methods.

[0189] In some therapeutic embodiments, an "effective amount" of an agent is an amount that results in a reduction in at least one pathological parameter. Thus, for example, in some aspects of the present disclosure, an effective amount is an amount effective to achieve a reduction of at least about 10%, at least about 15%, at least about 20%, or at least about 25%, at least about 30%, at least about 35%, at least about 40%, at least about 45%, at least about 50%, at least about 55%, at least about 60%, at least about 65%, at least about 70%, at least about 75%, at least about 80%, at least about 85%, at least about 90%, or at least about 95% compared to the expected reduction in the parameter in an individual not treated with the agent.

[0190] In some aspects, any of the PIV5-based constructs and methods described in WO2013 / 112690 and WO2013 / 112720 (incorporated by reference herein in their entireties) can be used in the present invention.

[0191] As used herein, the term "subject" refers to living organisms, including, for example, mammals. Mammals include, but are not limited to, humans, non-human primates, and other non-human vertebrates. A subject may be an "individual," a "patient," or a "host." Non-human vertebrates include livestock animals (e.g., but not limited to, cows, horses, goats, and pigs), domestic pets or companion animals, such as, but not limited to, dogs or cats, and laboratory animals. Non-human subjects also include non-human primates and rodents, such as, but not limited to, rats or mice. Non-human subjects also include, but are not limited to, domestic birds, horses, cows, pigs, goats, dogs, cats, guinea pigs, hamsters, mink, and rabbits.

[0192] As used herein, "in vitro" is cell culture, and "in vivo" is within the body of a subject. As used herein, "isolated" refers to material that has been removed from its natural environment (e.g., its natural environment if it occurs in nature), produced using recombinant techniques, or synthesized chemically or enzymatically, and thus altered "by the hand of man" from its natural state.

[0193] B. Booster vaccine The present disclosure provides for administration of a booster CVB vaccine for use in such methods to induce an immune response in a human subject, the subject having previously received a primary vaccination against SARS-CoV-2.

[0194] A method of booster vaccination according to the present disclosure comprises administering a vaccine composition to a subject.

[0195] The immune response induced by the vaccine composition or method of the present disclosure is preferably a humoral response, particularly a response that includes the production of neutralizing antibodies against the COVID-19 virus, i.e., a neutralizing antibody response. [Example]

[0196] Example 1: Immunogenicity of CPI-RSV-F in African Green Monkeys (AGM) (Non-GLP Study) Objective: To compare the immunogenicity of CPI-RSV-F and W3AΔSH-RSV-F administered intranasally as a single dose in the African green monkey model.

[0197] method Four monkeys in each dose group were randomly assigned to receive 10 doses of either CPI-RSV-F or W3AΔSH-RSV-F. 6 PFU were immunized intranasally on day 0.

[0198] result As shown in Table 4, antibody responses to the RSV F protein and PIV5 vector on day 28 were determined by ELISA assay (plates coated with recombinant RSV F protein, source Sino Biologicals: 11049-V088 LC120C 2910, or PIV5 wild-type virus). In summary, all animals expressed antibodies to the F protein expressed by CPI or W3AΔSH, with comparable RSV F ELISA titers between the two groups. However, W3AΔSH-RSV-F induced higher PIV5 antibodies than CPI-RSV-F. [Table 4]

[0199] Cell-mediated responses: RSV F protein-specific cellular responses were evaluated by intracellular cytokine staining (ICS) assay. Blood was collected on days -1, 14, and 28 after immunization to quantify RSV F protein-specific CD4 and CD8 cellular responses. IFNγ, TNFα, MIP-1b, IL-13, and CD107a-positive cells were quantified (see FIG. 2). PBMCs collected one day before immunization did not respond to RSV F peptide stimulation as expected. After immunization, AGMs immunized with W3AΔSH-RSV-F and CPI-RSV-F generated RSV F protein-specific CD4 and CD8 cellular responses, as assessed on days 14 and 28. No F-specific cellular responses were detected in control animals (data not shown), and cellular responses from animals immunized with W3AΔSH-RSV-F and CPI-RSV-F increased from day 14 to day 28 after immunization (Figures 2A-2B). W3AΔSH-RSV-F induced a lower CD4 response than CPI-RSV-F on day 14, but the difference was not statistically significant. On day 28 after immunization, W3AΔSH-RSV-F induced a higher CD4 response than CPI-RSV-F, but this difference was not statistically significant. The CD8-specific response induced by W3AΔSH-RSV-F was higher than that of CPI-RSV-F, but the difference was not statistically significant on days 14 (P = 0.0883) or 28.

[0200] Both CPI-RSV-F and W3AΔSH-RSV-F induced an immune response to the RSV F protein. The antibody response to the RSV F protein induced by either CPI-RSV-F or W3AΔSH-RSV-F was 10 6 After a single intranasal dose of PFU, the CD4 and CD8 cellular responses induced by CPI-RSV-F were comparable, but were slightly lower than those induced by W3AΔSH-RSV-F, although the difference was not statistically significant.

[0201] Example 2: Safety and Immunogenicity of CPI-RSV-F in a Cotton Rat Challenge Study (Non-GLP) (NIH-Sponsored Study: Study XV-238) Objective: To evaluate the efficacy and safety of RSV F protein vaccine candidates based on the CPI or W3A strains of PIV5 (CPI-RSV-F and W3AΔSH-RSV-F, respectively) in the cotton rat Sigmodon hispidus model of RSV A / A2 challenge.

[0202] method Animals, first 10 4 , 10 5 , or 10 6 The mice were immunized intranasally with 100 μl of PIV5-based vaccine containing 10 PFU of virus, followed by 10 PFU of PIV5-based vaccine four weeks later. 5 The primary infection control group was mock immunized with PBS and then infected with RSV A / A2. The secondary infection control group was infected with RSV A / A2 and re-infected 7 weeks later. The vaccine-boosted disease control group was immunized twice with FI-RSV (formalin-inactivated RSV) by the im route, 4 weeks apart, and infected with RSV 3 weeks after the second immunization. See Table 5 for test groups. [Table 5]

[0203] Five days after RSV challenge, animals were sacrificed and samples were collected. RSV replication in the lungs and nose, lung histopathology, lung cytokine and RSV NS1 mRNA expression, and RSV serum neutralizing antibody (NA) and anti-F protein binding antibody titers were measured. To confirm PIV5 vaccine replication in the respiratory tract of cotton rats, 10 groups of three animals were injected with 100 mg / kg of RSV vaccine. 6 Mice were inoculated intranasally with PFU of CPI-RSV-F or a control and sacrificed 4 days later.

[0204] result Both candidate vaccine viruses replicated efficiently in the upper and lower respiratory tracts of cotton rats (groups K and L) (Table 6). The W3AΔSH-RSV-F vaccine virus replicated to higher levels in the upper respiratory tract compared to CPI-RSV-F, but replicated to lower levels in the lower respiratory tract compared to CPI-RSV-F. [Table 6]

[0205] Both the CPI-RSV-F and W3AΔSH-RSV-F vaccines were highly effective in protecting cotton rats from RSV challenge virus replication in the lungs, as indicated by very low levels of viral titers in lung tissue (Figure 3). All doses of both vaccines also induced statistically significant protection when assessing viral load in nasal washes, with a higher reduction observed for W3AΔSH-RSV-F compared to CPI-RSV-F immunization (Figure 4). W3AΔSH-RSV-F reduced viral load to nearly undetectable levels at all three vaccine doses tested. For CPI-RSV-F, 10 6 The 10 PFU dose induced the strongest protection in the upper respiratory tract, followed by the 10 5 PFU and 10 4 The dose was PFU.

[0206] Both the CPI-RSV-F and W3AΔSH-RSV-F vaccines induced strong neutralizing antibody (nAb) responses, with W3AΔSH-RSV-F eliciting the highest neutralizing antibody response at all three doses tested (10 6 CPI-RSV-F administered at a low dose (10 PFU) induced higher titers of nAb compared to CPI-RSV-F administered at a low dose (10 PFU). 4 and 10 5 CPI-RSV-F (100 PFU) induced weaker nAb responses (Fig. 5). Immunization with both CPI-RSV-F and W3AΔSH-RSV-F induced high levels of anti-RSV IgG antibodies, only slightly higher than W3AΔSH-RSV-F vaccination (Fig. 6).

[0207] Both vaccines are administered at an intermediate dose (10 5 With the exception of one animal immunized with W3AΔSH-RSV-F (1000 PFU), FI-RSV did not induce the lung histopathology or levels of IL-4 mRNA expression seen in FI-RSV-immunized animals (positive control animal for enhanced disease), but did exhibit elevated interstitial inflammation and alveolitis (consistent with elevated IL-4 levels in this animal). IFN-γ, IL-2, and IL-4 levels were low in both vaccine groups (data not shown). No deaths were observed in the PIV5 vector vaccine group. A single animal in the FI-RSV (positive control) group died on day 24.

[0208] Both PIV5 CPI and W3A-based RSV vaccine constructs were effective in eliciting neutralizing RSV antibody responses after a single vaccination and protecting the lungs after RSV challenge infection. Overall, the efficacy of the W3AΔSH-RSV-F vaccine appeared to be greater than that of CPI-RSV-F with respect to nasal protection and neutralizing antibody responses at all dose levels tested. 5 With the exception of one animal in the PFU W3AΔSH-RSV-F group, there was no sign of enhanced lung pathology when compared to the positive control group (RSV-F1 group).

[0209] Example 3: Manufacturing Process and Process Control Step 1: Vaccine vector rescue The recombinant vector viruses used to produce CPI-, W3AΔSH-, and CVB-based vaccines were rescued by transfecting the antigenomic cDNA plasmid, along with plasmids encoding the PIV5 NP, P, and L proteins and T7 RNA polymerase, into serum-free 293T suspension cells (obtained from GenHunter Corporation), allowing rescue of the recombinant viruses from the transfected cell cultures (Fig. 7).

[0210] Supported PIV5 plasmid clones encoding the nucleoprotein (N), phosphoprotein (P), or large polymerase protein (L) were previously described (1, 2). Each gene is under the T7 promoter in the pCAGGS vector. The following five plasmids were used to generate research virus seeds (RVS):

[0211] 1. CPI, W3AΔSH, CVB-based PIV5 antigenomic cDNA plasmid: This plasmid is a high-copy plasmid and contains an ampicillin resistance gene.

[0212] 2. pCAGGS-NP plasmid: This plasmid contains the PIV5 NP gene under the T7 promoter with an ampicillin resistance gene.

[0213] 3. pCAGGS-P plasmid: This plasmid contains the PIV5 P gene under the T7 promoter with the ampicillin resistance gene.

[0214] 4. pCAGGS-L plasmid: This plasmid contains the PIV5L gene under the control of the T7 promoter with the ampicillin resistance gene.

[0215] 5. pCAGGS-T7 plasmid (same as pBH437-T7): This plasmid encodes the T7 RNA polymerase gene under the SV40 promoter.

[0216] The medium used for virus rescue was CDM4HEK293 medium (Hyclone) containing 4 mM GlutaMAX (Gibco).

[0217] After 2 days of incubation, 293T cells were co-cultured with serum-free Vero MCB cells (P159) passaged from African green monkey kidney (WHO Vero10-87) CyanVac MCB DOM (19AUG2020-P148). After 4 days of incubation, 2 mL of supernatant containing the rescued virus was obtained, mixed with 10x SPG, and stored at -80°C.

[0218] Step 2: Plaque purification and expansion of virus rescue seeds An aliquot of the frozen stock containing the rescued virus was serially diluted and subjected to plaque assays on serum-free Vero cells in 6-well plates to obtain several isolated single plaques. Single plaques were pierced using a 1000 μL pipette tip and resuspended in VP-SFM medium containing 4 mM GlutaMAX. The resuspended plaques were then used to infect fresh serum-free Vero cells in 6-well plates. After 6 days, 2 mL of supernatant from the 6-well plate infected with a single plaque was mixed with 10% 10x SPG and stored at -80°C (to obtain 1x SPG). A portion of the supernatant (140 μL) was used for RNA extraction and RT-PCR to verify the viral genome sequence. RT-PCR was performed using the primers listed in Table 7. [Table 7]

[0219] Step 3: Production of pre-MVS on serum-free Vero cells An aliquot (plaque-purified virus) from step 2 was used to infect serum-free Vero cells in a T75 flask and incubated at 37°C for 5 days. The cell culture supernatant was centrifuged at 1,500 rpm for 10 minutes at 4°C to remove cell debris. The clarified supernatant (20 mL) was mixed with 10% 10x SPG containing 10% arginine (Sigma-Aldrich), quickly frozen in 1 mL aliquots, and stored at -80°C as pre-MVS stocks. The pre-MVS was sequenced from the NP gene through the L gene to confirm the viral genome sequence and the appropriate insertion of the RSV F protein or other antigen genes.

[0220] Before use in cGMP production of MVS, pre-MVS was tested at CRL for sterility (direct method), bacteriostatic and bacteriostatic properties, presence of mycoplasma, mycobacteria, porcine and bovine circoviruses, and apparent viruses.

[0221] Step 4: MVS manufacturing process The production of MVS was carried out in accordance with cGMP.

[0222] Preparation of Vaccine Bulk Material: Vero cells grown in T225 flasks in serum-free medium (VP-SFM) were infected with pre-MVS (using two vials) at an MOI of 0.001-0.002 for 7 days at 37°C. The cell culture fluid from the infected cells constituted the crude vaccine bulk material (3.0 liters). Samples of the MVS crude bulk virus fluid were taken for sterility (direct method), bacteriostatic and bacteriostatic properties, in vitro mycoplasma testing (cultivable and noncultivable agar), tissue culture safety testing, in vitro mycobacterial testing, latent virus, PBERT, and potency testing.

[0223] The vaccine bulk material was clarified by centrifugation at 1,500 rpm for 10 minutes at 2-8°C to yield 1.2 L, which was then filtered through a 0.45 μM PES filter unit (ThermoFisher) to yield 1.2 L. The clarified and filtered vaccine bulk material was immediately formulated with 10x SPG to stabilize the virus prior to filling. There was no retention of the vaccine bulk material prior to formulation and filling.

[0224] During the virus production process, control harvest fluids were prepared using uninfected Vero cells from the same production lot. Control fluids were stored at or below -60°C. Production control fluids were harvested and tested for bacteriostatic and bacteriostatic bulk product (direct method), sterility, detection and quantification of residual Vero DNA, and determination of endotoxin levels (LAL).

[0225] Vaccine Drug Manufacturing (Formulation and Filling) / MVS: Filtered virus was stabilized in a formulation containing 10% 10x SPG buffer and aliquoted into 2 mL cryotubes using a calibrated repeater pipette with a 1 mL volume to generate MVS stock / vaccine product. Aliquots of MVS / vaccine product were flash-frozen in a dry ice / methanol bath and stored at -60°C or below.

[0226] Characterization of MVS: Additionally, genetic identity was confirmed by sequencing viral genome cDNA from the NP gene through the L gene region to confirm identity.

[0227] Example 4: GLP Intranasal Safety Study of Candidate RSV Vaccines CPI-RSV-F and CVB-RSV-F in Cotton Rats The purpose of the single and repeated dose GLP tox study conducted in cotton rats was to determine the potential toxicity of single or repeated doses of CPI-RSV-F when administered intranasally to male and female cotton rats.

[0228] The study was conducted on 48 cotton rats (24 males and 24 females). 7PFU dose levels of PIV5-vectored RSV vaccine viruses (CPI-RSV-F and CVB-RSV-F) were evaluated after single dose (day 1) or multiple doses (days 1 and 15) instilled by the intranasal route.

[0229] Test article 1: CPI-RSV-F, 1 x 10 7.0 PFU / 100μL dose (50μl each nostril) (8.0log 10 PFU / mL, Lot No. CPI-RSV-F-210519PQ10MVS) was formulated in 1X SPG.

[0230] Test article 2: Active comparator CVB-RSV-F; 1 x 10 7.1 PFU / 100 μL dose (50 μL each nostril) (8.1 log10 PFU / mL, Lot No. 211007CHD) was formulated in 1× SPG.

[0231] Control: SPG 1 x 100 μL dose (50 μl each nostril)

[0232] On study day 1, animals were dosed by intranasal instillation using a calibrated pipette. A fresh pipette tip was used for each animal. Prior to administration of the test or control article, rats were anesthetized with an injection of 0.1 mL of a ketamine (25 mg / mL) / xylazine (10 mg / mL) mixture. Dosing groups are shown in Table 8. [Table 8]

[0233] evaluation: Experimental endpoints consisted of moribundity / mortality and cage-side clinical observations, physical examination observations, body weight and body weight change, body temperature, food intake, clinical pathology (clinical chemistry, hematology, and coagulation) parameters, serum immunogenicity analysis, brain weight, gross necropsy observations, and histopathological evaluation.

[0234] Pathology: Tissues required for microscopic evaluation were trimmed, routinely processed, paraffin-embedded, and stained with hematoxylin and eosin by Charles River Laboratories, Inc. (See Table 9.) Light microscopic evaluation was performed on protocol-specified tissues from all animals by a contributor to the study who is a board-certified veterinary pathologist. [Table 9]

[0235] For all test animals, the tissues / organs listed above were examined, sampled, and fixed in 10% neutral buffered formalin, except for bone marrow smears, which were fixed in methanol. Prior to sampling, the brain of each animal was weighed. Fasting body weight (measured on the day of necropsy) was used to calculate brain-to-body weight ratios.

[0236] Statistical analysis: Statistical procedures: Using the ToxData® system, descriptive statistics (means and standard deviations) were calculated and analyzed for statistical significance for the following quantitative data: body weight and body weight change, food intake, body temperature, clinical pathology (clinical chemistry, hematology, and coagulation) parameters, and absolute brain weight and brain-to-body weight ratio.

[0237] For all analyses, if the datasets were normally distributed and had equal variances, statistical comparisons were performed using one-way analysis of variance (ANOVA), with post-hoc comparisons using Dunnett's test (as appropriate). If datasets failed normality and / or equal variances, statistical comparisons were performed using non-parametric Kruskal-Wallis ANOVA, with post-hoc comparisons using Dunn's test (as appropriate). Accumulation data (e.g., clinical observations and physical examination observations) were evaluated using chi-square analysis and / or Fisher's exact test. A minimum significance level of p<0.05 was used for statistical comparisons in this study.

[0238] For all statistical comparisons, data from groups 2 and 3 were compared with group 1 (control) data from animals of the same sex, and data from groups 5 and 6 were compared with group 4 (control) data from animals of the same sex.

[0239] result Safety evaluation: 10 doses in male and female cotton rats 7 No unplanned treatment-related mortality or clinical signs of treatment-related toxicity were observed after single or double intranasal administration of CPI-RSV-F at the PFU dose level. Additionally, for both vaccine candidates (CPI-RSV-F and CVB-RSV-F), no treatment-related findings were observed in body weight, body weight change, temperature, food intake, absolute or relative brain weight, gross necropsy, or histopathology.

[0240] immunogenicity The CPI-RSV-F vaccine was shown to be immunogenic in this study. A summary of the immunogenicity data is shown in Table 10. [Table 10]

[0241] RSV neutralizing antibody titers were measured using RSV-rLuc report virus according to CVL protocol 038. RSV-F-specific ELSIA antibody titers were determined according to CVL protocol 049. PIV5 antibody levels were measured by ELISA assay using PIV5 virus particles according to CVL protocol 048. CVB-RSV-F is more immunogenic than CPI-RSV-F in eliciting RSV neutralizing antibodies.

[0242] A single intranasal dose of CPI-RSV-F administered to cotton rats on day 1 and repeated intranasal doses of CPI-RSV-F administered to cotton rats on days 1 and 15 did not result in early mortality by day 29.

[0243] There were no treatment-related clinical signs of toxicity or treatment-related findings in body weight, body weight change, temperature, food intake, absolute or relative brain weight, gross necropsy, or histopathology. These findings were not considered toxicologically significant due to the small magnitude of changes and the lack of correlating histopathological findings.

[0244] This study was validated by confirming antibody responses to PIV5, the vaccine vector, and the RSV F protein expressed by the CPI-RSV-F vaccine.

[0245] Repeated dose toxicity Repeat dose toxicity of the CPI-RSV-F vaccine was evaluated in groups 4 and 5 of the GLP toxicity study described above.

[0246] Repeated intranasal administration of CPI-RSV-F to cotton rats on days 1 and 15 resulted in no gross or microscopic findings or other treatment-related signs of toxicity on day 29.

[0247] Vaccine virus-induced antibody responses were detected in animals in groups 2, 3, 5, and 6 that received CPI-RSV-F or CVB-RSV-F, but not in groups 1 and 3 that received control only (1x SPG). Animals that received two doses of CPI-RSV-F demonstrated slightly higher RSV F and PIV5 antibody responses than those observed after a single dose.

[0248] Single or two doses of CPI-RSV-F and CVB-RSV-F at 7.0 log10 PFU were found to be immunogenic in cotton rats without toxicologically relevant adverse effects, including local reactogenicity in the nasal cavity.

[0249] Immunogenicity Summary Vaccine virus-induced antibody responses were detected in animals receiving one and two doses of either CPI-RSV-F or CVB-RSV-F, but not in control animals receiving the control article (1x SPG buffer). Animals receiving a second dose of CPI-RSV-F or CVB-RSV-F two weeks after the first dose had higher anti-PIV5 antibody levels compared to those receiving a single dose. A second dose of CPI-RSV-F did not significantly increase anti-RSV-F or RSV-neutralizing antibody titers. A second dose of CVB-RSV-F significantly increased RSV-neutralizing antibody titers, but not anti-RSV-F antibody titers. CVB-RSV-F is more immunogenic than CPI-RSV-F, generating higher anti-PIV5 and RSV-neutralizing antibody titers. Overall, the serological data showed that both CPI-RSV-F and CVB-RSV-F were immunogenic in cotton rats (see Table 1 for a summary of the serological data), validating this GLP toxicity study by demonstrating that CPI-RSV-F and CVB-RSV-F were active.

[0250] Example 5: Generation of CVB vector SARS-CoV-2 constructs material: The resulting CVB vectored SARS-CoV-2 vaccine candidate is described herein and in Figure 8.

[0251] The primers used in the cDNA cloning of CVB vaccine candidates are listed in Table 11. [Table 11] JPEG2026504603000013.jpg212159JPEG2026504603000014.jpg206159JPEG2026504603000015.jpg125159

[0252] In this study, SARS-CoV-2 candidate vaccines based on CVB vectors were evaluated (Table 12). [Table 12] JPEG2026504603000017.jpg44159

[0253] Vaccine virus sequences generated using the primers listed above.

[0254] The S gene of the SARS-CoV-2 Wuhan strain (CVL104) from CVXGA16, the S157F mutation in the P / V gene, and the SH open reading frame (ORF) from the deletion mutation were introduced into the W3A backbone by Gibson assembly. The recombinant plasmid contained the CVB backbone and the S gene of the SARS-CoV-2 Wuhan strain between the HN and L genes of PIV5. Recombinant viruses were obtained.

[0255] CVL87: The S gene, S157F mutation in the P / V gene, and the entire SH gene transcription unit deletion mutation of the SARS-CoV-2 Wuhan strain of CVXGA17 were introduced into the W3A backbone by Gibson assembly. The recombinant plasmid contained the CVB backbone and the S gene of the SARS-CoV-2 Wuhan strain between the HN and L genes of PIV5. Recombinant viruses were obtained.

[0256] CVL85: The N gene of the SARS-CoV-2 Wuhan strain from CVXGA18 was amplified and introduced into the CVL104 backbone by Gibson assembly. The recombinant plasmid contains the CVB backbone, the N gene of the SARS-CoV-2 Wuhan strain in place of the SH gene of PIV5, and the S gene of the SARS-CoV-2 Wuhan strain between the HN and L genes of PIV5. CVXGA18 contains both the N and S genes of the SARS-CoV-2 Wuhan strain within the CVB backbone. Recombinant viruses were obtained.

[0257] The S gene of the SARS-CoV-2 Omicron BA.1 variant of CVXGA19 was amplified and inserted into the CVL83 backbone to replace the S gene of the SARS-CoV-2 Wuhan strain by Gibson assembly. The recombinant plasmid contained the CVB backbone, the N gene of the SARS-CoV-2 Wuhan strain in place of the SH gene of PIV5, and the S gene of the SARS-CoV-2 Omicron BA.1 variant between the HN and L genes of PIV5. Recombinant viruses were obtained.

[0258] The S gene of the SARS-CoV-2 Omicron BA.5 variant of CVXGA22 was amplified and inserted into the CVL85 backbone to replace the S gene of the Wuhan strain by Gibson assembly. The recombinant plasmid contains the CVB backbone, the N gene of the SARS-CoV-2 Wuhan strain in place of the SH gene of PIV5, and the S gene of the SARS-CoV-2 Omicron BA.5 variant between the HN and L genes of PIV5. The recombinant plasmid was obtained, and virus rescue is currently underway.

[0259] The S gene of the SARS-CoV-2 Omicron BA.5 variant of CVXGA21 was amplified and inserted into the CVL87 backbone to replace the S gene of the Wuhan strain by Gibson assembly. The recombinant plasmid contains the S gene of the SARS-CoV-2 Omicron BA.5 variant between the CVB2 backbone and the HN and L genes of PIV5. The recombinant plasmid was obtained, and virus rescue is underway.

[0260] CVL112 of CVXGA24: The PIV5 F and HN genes were deleted from the CVL104 backbone by Gibson assembly. The recombinant plasmid contains a CVB backbone that does not contain the F and HN genes but contains the SARS-CoV-2 Wuhan strain S gene between the PIV5 HN and L genes. The recombinant plasmid was obtained, and virus rescue is underway. The recombinant virus contains only glycoproteins derived from the SARS-CoV-2 virus. This virus can serve as a vaccine strain and / or a virus for microneutralization assays to measure S-specific antibody responses.

[0261] CVL119: The wild-type S gene of the SARS-CoV-2 Wuhan strain from CVXGA29 was amplified and inserted into the CVL85 backbone by Gibson assembly. The recombinant plasmid contained the CVB backbone, the N gene of the SARS-CoV-2 Wuhan strain in place of the SH gene of PIV5, and the wild-type S gene of the SARS-CoV-2 Wuhan strain between the HN and L genes of PIV5. Recombinant viruses were obtained.

[0262] The CVL120:SARS-CoV-2 Wuhan strain M gene from CVXGA30 was amplified and inserted into the CVL119 backbone by Gibson assembly. The recombinant plasmid contained the CVB backbone, the SARS-CoV-2 Wuhan strain M gene in place of the PIV5 SH gene, and the SARS-CoV-2 Wuhan strain wild-type S gene between the PIV5 HN and L genes. Recombinant viruses were obtained.

[0263] CVL121: The E gene of the SARS-CoV-2 Wuhan strain from CVXGA31 was amplified and inserted into the CVL120 backbone by Gibson assembly. The recombinant plasmid contained the CVB backbone, the SARS-CoV-2 Wuhan M gene in place of the PIV5 SH gene, the SARS-CoV-2 Wuhan E gene between the SARS-CoV-2 M and PIV5 HN genes, and the SARS-CoV-2 Wuhan wild-type S gene between the PIV5 HN and L genes. Recombinant viruses were obtained.

[0264] The CVL128:SARS-CoV-2 Wuhan strain N gene from CVXGA32 was amplified and inserted into the CVL121 backbone by Gibson assembly. The recombinant plasmid contained the CVB backbone, the SARS-CoV-2 Wuhan strain M gene in place of the PIV5 SH gene, the SARS-CoV-2 Wuhan strain N gene between the SARS-CoV-2 M and E genes, the SARS-CoV-2 Wuhan strain E gene between the SARS-CoV-2 N and PIV5 HN genes, and the SARS-CoV-2 Wuhan strain wild-type S gene between the PIV5 HN and L genes. Recombinant viruses were obtained.

[0265] Example 6: Immunogenicity of CVB-based COVID-19 vaccines in mouse and hamster models The immunogenicity of CVXGA16, PIV5 CVB with a deletion of the SH open reading frame (ORF) encoding the S protein from the Wuhan strain, CVXGA17, PIV5 CVB with a deletion of the entire SH gene encoding the S protein from the Wuhan strain, and CVXGA18, PIV5 CVB with a deletion of the SH ORF encoding the N and S proteins from the Wuhan strain will be evaluated compared to CVXGA1 in a Balb / c mouse model (AE26) and a golden Syrian hamster model (AE25).

[0266] Materials and Methods On AE26, 25 female Balb / c mice were used in this study (N=5 per group). Mice were then placed in 50 μL of PBS or 10 5 Mice were immunized intranasally with plaque-forming units (PFU) of CVXGA1, CVXGA16, CVXGA17, and CVXGA18. Blood and spleens were collected 32 days post-immunization (dpi). Levels of anti-S or S RBD IgG antibodies and IFNγ-secreting cells were determined.

[0267] For AE25, 20 male golden Syrian hamsters were used in this study (N=5 for Group 1 and N=15 for Group 2 (COVID-19 mRNA)). Hamsters were immunized intramuscularly with 50 μL of PBS (Group 1) or 2 μg of COVID-19 mRNA vaccine (Group 2) per animal. At 21 days post-immunization (dpi), hamsters from Group 2 were boosted intramuscularly with 2 μg of COVID-19 mRNA. At 42 days post-immunization, hamsters from Group 1 were boosted intranasally with 50 μL of PBS and hamsters from Group 2 were boosted a second time intramuscularly with 2 μg of COVID-19 mRNA (Group 2A) or 2 × 10 6 The mice were then intranasally boosted with PFU of CVXGA1 (Group 2B) or CVXGA18 (Group 2C). Blood was collected 63 days after immunization, and anti-S IgG antibody levels were determined.

[0268] result From the AE26 study, CVXGA16, CVXGA17, and CVXGA18-vaccinated mice produced comparable IgG antibodies against the S protein or S-RBD domain compared to CVXGA1 (Figures 9A-9B). Animals from all vaccine groups induced similar levels of S protein-specific IFNγ-secreting cells, with the CVXGA1 group having slightly higher levels compared to the other groups. Animals from the CVXGA18-vaccinated group were the only animals to induce N protein-specific IFNγ-secreting cells (Figure 9C). From the AE25 study, CVXGA1- or CVXGA18-boosted hamsters had comparable IgG antibodies against the S protein compared to the 3× COVID-19 mRNA group (Figure 9D).

[0269] CVXGA16, CVXGA17, and CVXGA18 are immunogenic in Balb / c mice. CVXGA18 is also immunogenic in hamsters when administered as a booster to hamsters that had received a prime-boost immunization with a COVID-19 mRNA vaccine.

[0270] Example 7: CVB-based SARS-CoV-2 vaccine candidates Materials and Methods CVB-based SARS-CoV-2 viruses expressing multiple antigens, CVXGA29, CVXGA30, CVXGA31, and CVXGA32, were successfully rescued, as shown in Table 13. These rescued viruses were grown in T75 flasks of Vero cells at titers >7.2 Log10 PFU / mL. [Table 13]

[0271] Viral replication in Vero cells: Vero cells in 6-well plates were infected with CVXGA17, CVXGA29, CVXGA30, CVXGA31, and CVXGA32 at a multiplicity of infection (MOI) of 0.1. Cells were then washed with PBS and maintained in DMEM-2% FBS. Medium was collected 1–6 days postinfection (dpi). Virus titers were determined by plaque assay on Vero cells.

[0272] Mouse studies: To determine whether these viruses are immunogenic in vivo, 5-7 week old female Balb / c mice (Envigo) were used in immunogenicity studies. After isolation, five female mice were randomly grouped into seven test groups (Table 14). Each mouse was anesthetized by intraperitoneal injection of 250 μl or 300 μl of Avertin (2,2,2-tribromoethanol in tert-amyl alcohol) and given 100 μl (50 μl per nostril) of PBS, 1.7 × 10 5 Animals were inoculated intranasally with PFU of CVXGA1, CVXGA18, CVXGA29, CVXGA30, CVXGA31, or CVXGA32 and housed in HEPA-filtered isolators under ABSL2. Twenty-one days after immunization, animals were euthanized and blood was collected via cardiac thoracic bleeding for serum isolation. All experiments were performed in the University of Georgia animal facility according to protocols approved by the University of Georgia IACUC. [Table 14]

[0273] ELISA: To quantify anti-SARS-CoV-2-S or N antibody responses, mouse sera were analyzed by enzyme-linked immunosorbent assay (ELISA). Immulon 2HB 96-well microtiter plates were coated with 25 ng of purified SARS-CoV-2-S trimeric protein or N protein for 24 hours. Mouse serum samples were inactivated at 56°C, prediluted at 1:100, then serially diluted in two-fold dilutions, and incubated on the plates for 1 hour. After washing, the plates were incubated with horseradish peroxidase (HRP)-conjugated goat anti-mouse IgG secondary antibody at a 1:1250 dilution for 1 hour. The plates were developed with KPL SureBlue Reserve TMB Microwell Peroxidase Substrate, and OD450 (optical density at 450 nm) values ​​were read using a BioTek Epoch microplate spectrophotometer (BioTek, Winooski, VT). Antibody titers were calculated as the highest serum dilution at which the OD450 value was greater than 3 SD above the mean OD450 value of the negative controls.

[0274] result Growth curves: Compared to CVXGA17, which expresses SARS-CoV-2 S with a PIV5 F tail, CVXGA29, CVXGA30, CVXGA31, and CVXGA32, which express wt SARS-CoV-2 S, grew to similar titers (Figure 10).

[0275] Immunogenicity: Regarding anti-SARS-CoV-2 S immunogenicity (Figure 11A), CVXGA1, CVXGA18, CVXGA29, CVXGA30, CVXGA31, or CVXGA32 elicited similar levels of antibody titers, with no significant differences between vaccine groups.

[0276] Regarding anti-SARS-CoV-2 N immunogenicity (Figure 11B), CVXGA1, CVXGA30, and CVXGA31, which lack an N gene insertion, did not elicit N-specific antibodies, as expected. CVXGA18 and CVXGA29, which express N and S with a PIV5 F tail, and CVXGA32, which expresses N and wt S, elicited N-specific antibody titers. CVXGA18 induced significantly higher levels of antibodies than all other groups, and CVXGA29 induced significantly higher levels of antibodies than PBS, CVXGA1, and CVXGA31. CVXGA32 induced lower levels of anti-N antibodies, but with the exception of CVXGA18, there was no difference compared to the other groups. There was no significant difference between CVXGA29 and CVXGA32, which contain N and wt S.

[0277] From this study, we concluded that PIV5 is a good vector for expressing up to four antigens with a total length of approximately 6.4 kb. All recombinant viruses reached titers >7 Log in Vero cells. 10 The viruses grew to 100 PFU / mL. The anti-S immunogenicity from these viruses was similar. The anti-N immunogenicity from CVXGA29 and CVXGA32 was similar but lower than that of CVXGA18, which expresses N and S with the PIV5 F tail. It is possible that the PIV5 F-tailed S may enhance the immunogenicity of other genes.

[0278] Example 8: CVB-RSV-F Pre-MVS RSV F Expression Percent Figure 12 shows the determination of the percentage of F expression in CVB-RSV-F infected cells. Vero-SF cells were infected with CVB-RSV-F pre-MVSS virus at a dilution of -3 to -5. After 1 hour of incubation at 37°C, the medium was replaced and the cells were incubated at 37°C for 18 hours. Immunostaining was performed using mouse anti-CVB-HN and human anti-F (palivizumab) antibodies, followed by anti-mouse Alexa 488 and anti-human Cy3 secondary antibodies, respectively. These are representative images of wells infected with CVB-RSV-F pre-MVSS, showing both green and red cells. The table shows the percentage of RSV F protein expression in CVB infected cells. Images were taken at 10x magnification. All infected cells (100%) expressed RSV F protein.

[0279] Example 9: CVB-RSV-F pre-MVS growth kinetics Figures 13A-13E show replication of BLB-205 in serum-free Vero cells at 35°C vs. 37°C and on day 2 vs. 4. The data show that harvest can be performed at both 35°C and 37°C on day 6 or 7. Vero cells on days 2 and 4 produced similar amounts of virus.

[0280] The disclosures provided herein include the generation of more potent, high-yielding PIV5 CVB backbones containing the P / V gene S157F mutation or alternatively the S156N mutation, the PIV5 SH deletion as either an open reading frame or the entire S gene transcription unit in the PIV5 W3A strain. Multiple SARS-CoV-2 vaccine candidates in CVB backbones have been produced, demonstrating that antigen genes can be inserted between the SH and HN gene junctions and / or the HN-L gene junctions without significantly affecting viral antigen expression. Both the N and S genes (approximately 5 kb) have been successfully inserted into CVB backbones, resulting in approximately 10 8 A titer of PFU / ml has been reached.

[0281] The complete disclosures of all patents, patent applications, and publications cited herein, as well as electronically available materials (e.g., nucleotide sequence entries in GenBank and RefSeq, and amino acid sequence entries in, e.g., SwissProt, PIR, PRF, PDB, and translations from annotated coding regions in GenBank and RefSeq), are incorporated by reference. In the event of any inconsistency between the disclosure of this application and the disclosure(s) of any document incorporated herein by reference, the disclosure of this application shall control. The foregoing detailed description and examples are given for clarity of understanding only. No unnecessary limitations should be understood therefrom. The invention is not limited to the exact details shown and described, for variations obvious to those skilled in the art will be included within the scope of the invention as defined by the claims.

Claims

1. A composition comprising a modified PIV5 CVB viral expression vector having at least 98% sequence identity with SEQ ID NO: 1, wherein the CVB viral expression vector contains a mutation in the PIV5 viral genome at amino acid residue S157 or S156 of the P / V gene that results in removal of a phosphorylation site and higher transcriptional activity, thereby improving viral titer in cell culture, and wherein the CVB viral expression vector is highly immunogenic and can be used as an effective vaccine platform.

2. 2. The composition of claim 1, wherein the mutation at amino acid residue S157 or S156 comprises a substitution of serine (S) with an amino acid residue selected from the group consisting of alanine (A), cysteine ​​(C), aspartic acid (D), glutamic acid (E), phenylalanine (F), glycine (G), histidine (H), isoleucine (I), lysine (K), leucine (L), methionine (M), asparagine (N), proline (P), glutamine (Q), arginine (R), selenocysteine ​​(U), valine (V), tryptophan (W), and tyrosine (Y).

3. 2. The composition of claim 1, wherein the mutation at amino acid residue S157 or S156 comprises a substitution of serine (S) amino acid residue S157 with phenylalanine (F) or a substitution of serine (S) amino acid residue S156 with asparagine (N).

4. 2. The composition of claim 1, wherein the CVB viral expression vector expresses a heterologous polypeptide comprising a viral antigen selected from the group consisting of SARS-CoV-2, RSV, or a viral or bacterial antigen.

5. 2. The composition of claim 1, wherein the PIV5 genome comprises a heterologous nucleic acid sequence having at least 98% sequence identity to SEQ ID NO: 2, 3, 4, 5, 6, 7, 8, 9, 10, 11, 12, or 13, and the viral expression vector expresses a heterologous polypeptide comprising a coronavirus spike (S) and / or nucleocapsid (N) protein or an RSV-F protein.

6. 6. The composition of claim 5, wherein the coronavirus spike (S) and / or nucleocapsid (N) protein is the S or N protein of severe acute respiratory syndrome coronavirus 2 (SARS-CoV-2), SARS-CoV-2 Wuhan strain, or a variant of SARS-CoV-2, wherein the variant of SARS-CoV-2 is a SARS-CoV-2 beta variant, a SARS-CoV-2 gamma variant, a SARS-CoV-2 delta variant, a SARS-CoV-2 omicron variant, SARS-CoV-2 omicron BA.1, SARS-CoV-2 omicron BA.5, BQ1, or XBB1, or any future emerging variant.

7. 6. The composition of claim 5, wherein the coronavirus S gene comprises the coronavirus S gene of SARS-CoV-2, and the cytoplasmic tail of the coronavirus S gene is replaced with the cytoplasmic tail of the fusion (F) gene of the CVB or CPI vector.

8. 6. The composition of claim 5, wherein the PIV5 viral genome (CVB) having S157F or S156N in the P / V gene further comprises an open reading frame deletion mutation in the SH gene, wherein the N gene of the SARS-CoV-2 Wuhan strain is inserted to replace the SH gene of PIV5, and the S gene of the SARS-CoV-2 Wuhan strain or other mutant strain is inserted between the PIV5 hemagglutinin (HN) gene and the polymerase (L) gene of CVB.

9. The composition of claim 5, wherein the entire SH gene transcription unit of the PIV5 viral genome is deleted, and the S gene of the SARS-CoV-2 Wuhan strain or other mutant strains is placed between the HN gene and L gene of CVB.

10. 6. The composition of claim 5, wherein the S gene of a SARS-CoV-2 mutant strain is inserted to replace the S gene of a SARS-CoV-2 Wuhan strain, and the N gene of the SARS-CoV-2 Wuhan strain is inserted in place of the SH gene of the PIV5.

11. 6. The composition of claim 5, wherein the S gene of the SARS-CoV-2 Omicron BA.5 variant is inserted between the HN and L genes of the PIV5 to replace the S gene of the Wuhan strain.

12. 6. The composition of claim 5, wherein the S gene of the SARS-CoV-2 Omicron BA.5 variant is inserted to replace the S gene of the SARS-CoV-2 Wuhan strain, and the N gene of the SARS-CoV-2 Wuhan strain is inserted to replace the SH gene of the CVB.

13. 6. The composition of claim 5, wherein the PIV5 F and HN genes are deleted and the S gene of the SARS-CoV-2 Wuhan strain is located between the HN and L genes of the CVB.

14. 6. The composition of claim 5, wherein the N gene of the SARS-CoV-2 Wuhan strain is inserted between the F and HN genes, and the S gene of the SARS-CoV-2 Wuhan strain is inserted between the HN and L genes of the CVB.

15. 6. The composition of claim 5, wherein the M gene from the SARS-CoV-2 Wuhan strain is inserted between F and HN, and the S gene of the SARS-CoV-2 Wuhan strain is inserted between HN and L of the CVB.

16. 6. The composition of claim 5, wherein the M gene from the Wuhan strain of SARS-CoV-2 is inserted after the F of the PIV5, the E gene from the Wuhan strain of SARS-CoV-2 is inserted between the M gene and HN of SARS-CoV-2, and the S gene of the Wuhan strain of SARS-CoV-2 is inserted between the HN and L of the CVB.

17. 6. The composition of claim 5, wherein the M gene from the Wuhan strain of SARS-CoV-2 is inserted after the F of the PIV5, the N gene from the Wuhan strain of SARS-CoV-2 is inserted between the M gene and the E gene from SARS-CoV-2, the E gene from the Wuhan strain of SARS-CoV-2 is inserted between the N gene and HN of SARS-CoV-2, and the S gene of the Wuhan strain of SARS-CoV-2 is inserted between the HN and L of the CVB.

18. 6. The composition of claim 5, wherein the RSV-F protein is inserted in place of the PIV5 SH gene (ΔSH), or between the PIV5 SH and NH (SH-NH), or between the HN and L (HN-L).

19. 10. A method of inducing an immune response in a subject having or at risk of having a SARS-CoV-2, RSV, or other viral or bacterial infection, said method comprising administering to said subject the composition of claim 1 as a primary or booster vaccine, wherein said immune response comprises a humoral immune response and / or a cellular immune response.

20. 20. The method of claim 19, wherein the composition is administered intranasally, intramuscularly, topically, or orally.

Citation Information

Patent Citations

  • Recombinant mumps vaccine

    JP2014512804A

  • Parainfluenza virus type 5-based vaccine

    JP2015506689A

  • PIV5-based COVID-19 vaccine

    JP2023542922A