OCA2 modulator, its composition and use
By using a regulator that modulates the level of the OCA2 protein, eye color can be safely and effectively altered, solving the side effects of traditional methods and achieving a natural and aesthetically pleasing eye color adjustment effect.
Patent Information
- Application Number
- JP2025556866
- Authority / Receiving Office
- JP · JP
- Patent Type
- Applications
- Current Assignee / Owner
- Priority Date
- 2023-03-28
- Filing Date
- 2024-03-28
- Publication Date
- 2026-04-23
AI Technical Summary
Existing methods for changing eye color are unsafe, ineffective, and have serious side effects, and cannot effectively solve the problem of blue eyes caused by genetic factors or darkening of eye color caused by drugs.
By using OCA2 protein modulators, such as nucleic acid molecules, PROTAC, Aptamer, and immunomodulators, the OCA2 protein level can be regulated, directly or indirectly acting on the OCA2 gene and protein to achieve safe and effective regulation of eye color.
It achieves a natural and aesthetically pleasing change in eye color, avoids the side effects of traditional methods, and adapts to changes in eye color caused by genetic factors and medication.
Smart Images

Figure 2026513271000004 
Figure 2026513271000005 
Figure 2026513271000006
Abstract
Description
Technical Field
[0001] The present disclosure relates to cosmetic uses. More specifically, the present invention relates to the regulation of oculocutaneous albinism type 2 (OCA2) protein in a subject, for example, for modifying the eye color of the subject.
[0002] References References considered relevant as background to the subject matter of the present disclosure are listed below. -[1] Eiberg H, et al. (2008) Hum Genet. 2008 Mar;123(2):177-87. -[作為背景技術の文献2] Suarez P, et al (2021). Sci Rep. 11(1):22530. -[3] Park, S., Morya, V.K., Nguyen, D.H. et al. (2015) Mol Cell Biochem 403, 61-71. -[4] International Publication No. 2021 / 146668 -[5] U.S. Patent No. 9,744,237
[0003] The recognition of the above references in this specification should not be construed as inferring that they are relevant in any way to the patentability of the subject matter of the present disclosure.
Background Art
[0004] Many people wish to change or enhance the color of their eyes, skin, or hair for cosmetic reasons. For example, there is a large market for products that change eye color. However, conventional methods such as contact lenses, implants, and laser surgery are not effective. In addition, traditional methods for coloring skin and hair have the problem of requiring multiple applications of potentially toxic products.
[0005] Furthermore, among people taking glaucoma medication, the problem of the medication darkening the eyes and resulting in an unsightly appearance is becoming increasingly common. As the population ages and the prevalence of glaucoma increases, more people are experiencing this problem. In addition, asymmetry caused by congenital or acquired heterochromia iridum (e.g., due to Horner's or Fuchs' iridocyclitis) can be corrected by treating the opposite eye or the darker eye.
[0006] Eye color is determined by several intrinsic factors, including the amount of melanin in the iris, the type (eumelanin / pheomelanin) and ratio of melanosomes, the number of melanosomes and their maturation level, the distance between melanosomes and nuclei, and the number of fibroblasts and collagen in the iris. Color is also given by the cornea, as its removal reveals differences in color vividness.
[0007] Melanocytes are cells found in various tissues throughout the body, and their primary role is to regulate the amount of pigmentation in those tissues through melanin synthesis. They are mainly found in the eyes (e.g., the iris), hair, and skin.
[0008] Melanin is a brown pigment, and its abundance is what gives the iris its color in brown eyes. However, the blue color of blue eyes is not due to pigment, but rather to an optical phenomenon similar to that which produces a blue sky. Light of the entire spectrum of wavelengths enters the eye. Longer waves (yellow and red) continue relatively unobstructed until they are absorbed on the back of the iris, while shorter waves are a random phenomenon that occurs more frequently with shorter waves, with blue light being scattered more often (Rayleigh scattering) in the absence of melanin.
[0009] Melanin is produced in specialized organelles called melanosomes. Maintaining the correct internal pH is essential for melanosomes to mature and produce a high degree of pigment. As a result of the absence of the protein OCA2, melanosomes are non-functional and unable to mature, and pigment production in tissues is significantly reduced. A considerable majority of individuals with blue eyes have reduced levels of the OCA2 protein, resulting in immature melanosomes in the iris stratum and consequently reduced pigmentation.
[0010] Melanosome maturation occurs in the cytoplasm and is generally divided into four distinct stages, with stage 4 being considered mature. Several proteins are required for melanosome maturation. In brown eyes, melanosome organelles are mainly present in stage 4 of maturation, while in blue eyes, the majority of melanosomes are in stages I-II, some in stage III, and virtually no melanosomes in stage IV.
[0011] The eye color of most people with light eyes is due to an ancestral mutation in the HERC2 gene on chromosome 15 [1]. While many mutations and genetic changes contribute to a wide range of colors in human skin, hair, and eyes, reduced expression of the OCA2 gene is the main cause of light eyes. Mutations in two genes, OCA2 itself and HERC2, which also acts as the OCA2 transcription promoter, account for approximately 90% of an individual's eye color phenotype (light / brown) [2]. Inhibition of the pink-eyed dilution protein (P protein produced by the OCA2 gene) has been previously shown to alter the morphology, type, and number of melanosomes and may play a role in regulating melanin synthesis in mouse skin cancer cells [3].
[0012] International Publication No. 2021146668[4] discloses a method for altering the iris color of a subject by genetically manipulating the iris to induce the death of melanocytes in the iris crust.
[0013] U.S. Patent No. 9,744,237[5] discloses a method and system for brightening the color of the iris by administering a tyrosinase inhibitor.
[0014] There is a need for safe and effective methods to alter eye color, as well as solutions to reverse eye discoloration caused by glaucoma medications. In addition, there is a need for rapidly penetrating topical ophthalmic agents that can overcome barriers currently inhibiting the penetration of active ingredients in the eye, such as precorneal factors and corneal factors, or alternatively, reach the target tissue, the iris, via the scleral-conjunctival route or any other route found between the scleral-conjunctival route and any administration form (subconjunctival, intravitreal, anterior chamber, subretinal, systemic, or other). Furthermore, there is a need for delivery systems for cosmetic or therapeutic agents that can target the pigment tissue of the iris and effectively alter color or deliver treatment without adverse effects on the patient. [Overview of the Initiative]
[0015] In a first aspect, the Disclosure provides a method for modifying the eye color of a subject, the method comprising administering to the subject an effective amount of at least one oculocutaneous albinism 2 (OCA2) protein modulator, or any vehicle, matrix, nanoparticles or microparticles thereof, or any composition containing thereof.
[0016] In another aspect, the Disclosure provides at least one oculocutaneous albinism 2 (OCA2) protein modulator, or any vehicle, matrix, nanoparticles or microparticles thereof, or any composition comprising them, for use in a method of correcting the eye color of a subject, the method comprising administering an effective amount of the at least one OCA2 protein modulator to the subject.
[0017] In a further embodiment, the disclosure provides a composition for modifying the eye color of a subject, comprising at least one oculocutaneous albinism 2 (OCA2) protein modulator.
[0018] In a further embodiment, the disclosure provides a pharmaceutical composition comprising at least one oculocutaneous albinism 2 (OCA2) protein modulator and at least one pharmaceutically acceptable carrier, diluent, and / or excipient.
[0019] In yet another aspect, the disclosure provides nucleic acid molecules for modifying the eye color of a subject, comprising at least one oculocutaneous albinism 2 (OCA2) protein modulator.
[0020] In a further embodiment, the Disclosure provides a method for treating a disease / disorder in a subject that requires treatment, the method comprising administering to the subject an effective amount of at least one oculocutaneous albinism 2 (OCA2) protein modulator, or any vehicle, matrix, nanoparticles or microparticles thereof, or any composition containing thereof.
[0021] In further embodiments, the Disclosure provides at least one oculocutaneous albinism 2 (OCA2) protein modulator, or any vehicle, matrix, nanoparticles or microparticles thereof, or any composition comprising them, for use in a manner in which a disease / disorder needs to be treated, the manner comprising administering an effective amount of the at least one OCA2 protein modulator to the subject.
[0022] Embodiments are described herein, only as non-limiting examples, with reference to the accompanying drawings, in order to better understand the subject matter disclosed herein and to illustrate how it may actually be carried out. [Brief explanation of the drawing]
[0023] [Figure 1] Melanin evaluation. Rational calibration for melanin evaluation (OD at 360 nm) directly measured in B16-F10 cells at different concentrations 5 days after seeding. [Figure 2]OCA2 expression. OCA2 expression in B16-F10 cells after transfection with 20 nM or 50 nM of OCA2 siRNA #1, #2, or #3 (shown in SEQ ID NOs: 70-75). Abbreviations: "negative" is the negative control, "lipofectamine only", and "non" (non-transfected). [Figure 3] Melanin absorbance. Melanin absorbance at OD 360 nm after transfection of B16-F10 cells with different concentrations of OCA2 siRNA #1, #2, or #3 (shown in SEQ ID NOs: 70-75). [Figure 4] Iris survival assay. Survival assay of mouse iris explants cultured in three types of media, A, B, and C. Iris 4 and Iris 12 were non-viable from the first day and remained non-viable throughout the test. The remaining samples retained their viability and only minor changes were observed. [Figure 5A] Visualization of ex vivo iris transfection. Photographs of iris samples transfected with fluorophore-conjugated control siRNA (green) and iris samples counterstained with Hoechst (green), showing the co-localization of siRNA within the cell structure. The red square indicates a specific region around the 6 o'clock position of the iris. The complete morphology of the iris is shown in FIG. 5A. [Figure 5B] Magnification of the red square shown in FIG. 5A for visualization of ex vivo iris transfection. [Figure 6] SOX10 expression in iris samples after transfection with SOX10 siRNA or scrambled siRNA. Each group contains a pool of two iris samples. [Figure 7A] Effect of exposure to light source. Comparative analysis of hair samples after a three-week interval. Control group without light exposure. [Figure 7B] Effect of exposure to light source. Experimental group exposed to light. This figure shows the difference in pigmentation between light brown hair from a female donor and darker hair from a male donor after being placed under separate conditions for three weeks. [Figure 8A]Macroscopic images of ex vivo biological iris samples before and after treatment with depigmentation-OCA2-siRNA. Image of the iris sample before treatment. [Figure 8B] Macroscopic images of ex vivo biological iris samples before and after treatment with depigmentation-OCA2-siRNA. Post-treatment images of iris samples from the OCA2-siRNA group. [Figure 8C] Macroscopic images of ex vivo biological iris samples before and after treatment with depigmentation-OCA2-siRNA. Pre-treatment images of iris samples from the control group and baseline. [Figure 8D] Macroscopic images of ex vivo biological iris samples before and after treatment with depigmentation-OCA2-siRNA. Post-treatment images of iris samples from the control group. [Figure 9] Iris saturation. This graph shows the average iris saturation values comparing the treated group and the control group. The background difference was corrected for all images by subtracting the background saturation value from the iris saturation value. [Figure 10A] Comparative microscopic analysis of iris tissue after treatment. Photographs of microscopic analysis of iris tissue after treatment with OCA2-siRNA and photobleaching. [Figure 10B] Comparative microscopic analysis of iris tissue after treatment. Photographs of microscopic analysis of iris tissue after treatment with scrambled siRNA and after photobleaching. [Figure 10C] Comparative microscopic analysis of iris tissue after treatment. Photographs of microscopic analysis of iris tissue without any treatment or photobleaching. [Modes for carrying out the invention]
[0024] The solutions currently proposed to correct eye color are unsatisfactory and include severe side effects, unnatural and unease-inducing results, and inconvenience of use.
[0025] This disclosure aims to address an unmet need for altering eye color in a safe and effective manner and relates to the modulation of OCA2 protein levels in an eye subject. A natural and aesthetic appearance and a perceptible change in eye color are achieved by the proposed compositions and methods disclosed herein.
[0026] In a first aspect, the Disclosure provides a method for modifying the eye color of a subject. The method modulates the eye color of a subject and comprises administering to the subject an effective amount of at least one oculocutaneous albinism 2 (OCA2) protein modulator, or any vehicle, matrix, nanoparticles or microparticles thereof, or any composition containing thereof.
[0027] As used herein, the oculocutaneous albinism 2 (OCA2) gene relates to a gene encoding the OCA2 protein, also known as the P-protein. In some embodiments, OCA2 is human OCA2. In some further embodiments, the human OCA2 gene is located on chromosome 15 (position 15q12-q13.1). In some embodiments, the human OCA2 mRNA comprises a nucleic acid sequence indicated by accession number NM_000275.3. In some embodiments, the human OCA2 mRNA comprises a nucleic acid sequence indicated by sequence number 65. Further, in some embodiments, the human OCA2 mRNA encodes the OCA2 protein having accession number NP_000266.2. In some embodiments, the human OCA2 protein may comprise an amino acid sequence indicated by sequence number 66.
[0028] As used herein, OCA2 protein modifiers relate to any agent that can modify (increase or decrease) the level of active OCA2 protein, either directly, i.e., by acting on the OCA2 protein itself, or by acting on the OCA2 gene and its transcription. In some further embodiments, the modifier may act indirectly on any target molecule or any sequence that controls and / or affects the expression and / or activity and / or stability and / or tissue distribution and / or cellular localization of OCA2. In some embodiments, the modifier may be modified to increase its efficacy and reduce its potential adverse effects. In some embodiments, the modifier may include auxiliary materials such as nanoparticle envelopes having a defined role in assisting the delivery of the drug across any anatomical or physiological barrier, improving its stability in tissue, introducing the drug into cells, and increasing the rate of endosomal escape events. The materials may include, but are not limited to, lipids, polymers, and the like. In some embodiments, the modifier may be conjugated with a ligand or molecule capable of immobilizing the envelope to target cells. In some embodiments, the modifier does not activate the immune system and does not increase cytokine levels, such as TNF-alpha or IFN-alpha levels, as measured by assays such as in vitro.
[0029] In some embodiments, the OCA2 protein regulator may be at least one of nucleic acid molecules, aptamers, peptides, peptide mimes, immunologic agents, small molecules, proteolysis-targeting chimeras (PROTACs), glycans, and any combination thereof.
[0030] In some embodiments, the eye color is modified to be blue, green, gray, sky blue, yellow, brown, amber, light brown, black, purple, red, or any color in the visible spectrum.
[0031] In some embodiments, the OCA2 protein modifier may be a nucleic acid molecule. As used herein, the terms “nucleic acid,” “nucleic acid sequence,” “oligonucleotide,” or “polynucleotide,” and “nucleic acid molecule” refer to polymers of nucleotides, including, but not limited to, deoxyribonucleic acid (DNA), ribonucleic acid (RNA), DNA / RNA hybrids containing regularly and / or irregularly alternating deoxyribosyl and ribosyl polynucleotide chains (i.e., alternating nucleotide units having --OH, then --H, then --OH, then --H, etc., at the 2' position of the sugar moiety), xeno nucleic acid (XNA) (e.g., PNA), and modifications of these types of polynucleotides, which include the attachment of various entities or parts to nucleotide units at any position. The term should also be understood to include, as equivalents, analogues of either RNA or DNA prepared from nucleotide analogues, and, as applicable to the embodiments described, single-stranded (sense or antisense, etc.) and double-stranded polynucleotides. The preparation of nucleic acids is well known in the art.
[0032] In some embodiments, the OCA2 protein modulator may be a PROTAC. As used herein, "PROTAC" is typically designed with three parts: (1) a ligand / molecule that binds to and / or modulates a ubiquitin ligase; (2) a binding site that targets and recruits the protein of interest for proteolysis, e.g., OCA2; and (3) a linker that connects the two molecules together. Thus, a PROTAC functions by binding the ligand / molecule to a ubiquitin ligase, thereby recruiting the target of the protein of interest to the ligase for ubiquitination and ultimately proteolysis and degradation.
[0033] However, other names are found in the literature, such as specific and non-genetic IAP-dependent protein eraser (SNIPER), degradation agent, degronimid, proteolysis targeting peptide (PROTAP), and protein degradation probe (PDP). PROTAC hijacks the catalytic activity of ubiquitin E3 ligases and mediates the proteasome-dependent degradation of selected protein of interest (POI) by spatially bringing the ligase and POI into close proximity and initiating the polyubiquitination process.
[0034] In some embodiments, the OCA2 protein modulator may be an aptamer. As used herein, an aptamer is a short, single-stranded DNA or RNA molecule, typically in the range of about 20 to 100 nucleotides in length, that can specifically bind to a target molecule, such as the OCA2 protein, with high affinity and specificity. Aptamers are often referred to as "chemoantibodies" because they can recognize and bind to specific targets, such as proteins, small molecules, or even entire cells, with binding affinities comparable to, or sometimes even exceeding, those of antibodies. Aptamers with high affinity and specificity to the target protein, such as OCA2, are selected using SELEX (Systematic Evolution of Ligands by Exponential Enrichment) or a similar process. During SELEX, a large pool of randomly sequenced nucleic acids (DNA or RNA) is exposed to the target protein, and sequences that strongly bind to the protein are retained, while non-binding sequences are washed away.
[0035] In some embodiments, the OCA2 protein regulator may be a peptide. In some further embodiments, the OCA2 protein regulator may be a peptide mimetic. As used herein, a peptide mimetic is a synthetic compound that mimics the structure and / or function of a peptide (a short chain of amino acids) and is designed to interact with a biomolecule, such as the OCA2 protein.
[0036] In some embodiments, the OCA2 protein modulator may be an immunological agent. As used herein, an immunological agent typically refers to a molecule designed to interact directly or indirectly with the protein of interest, i.e., the OCA2 protein derived from the immune system. These agents may include, but are not limited to, antibodies, antibody derivatives, nanobodies, and the like.
[0037] In some embodiments, the OCA2 protein modulator may be a small molecule. As used herein, a small molecule refers to a compound with a relatively low molecular weight that is designed to specifically interact with a particular protein target, namely the OCA2 protein. These small molecules are often referred to as "ligands" when they bind to the protein.
[0038] In some embodiments, the at least one OCA2 modulator is at least one gene editing agent adapted to modulate the expression and / or activity and / or stability of OCA2.
[0039] As used herein, gene editing agents can regulate the expression and / or activity of OCA2 by various mechanisms. For example, gene editing agents may regulate OCA2 expression and / or activity by modifying chromosomal DNA, which can result in the knockdown of cells, organisms, etc. In addition, gene editing agents may regulate the expression and / or activity of OCA2 by transient / temporary modification (transient knockdown).
[0040] The gene editing agents according to the compositions and methods of the present invention may, in some embodiments, be naturally occurring compounds (such as enzymes, short DNA or RNA oligonucleotides), synthetic compounds, or artificial compounds. In some embodiments, at least one gene editing agent may be an oligonucleotide. Such oligonucleotides can bind to an active gene or any transcript thereof and, for example, in the case of gene binding by an anti-sense oligonucleotide (ASO), can cause a reduction in expression by, for example, blocking transcription, degrading the mRNA transcript by small interfering RNA (siRNA) or RNase-H-dependent antisense, or by blocking any of the nuclease cleavage sites used for mRNA translation, premRNA splicing sites, or maturation of other functional RNAs including miRNA (e.g., by morpholino oligonucleotides or other RNase-H-independent antisense oligonucleotides).
[0041] In some embodiments, the OCA2 regulator may be any one of the following: a gene editing agent, such as a clustered regularly interspersed short palindromic repeat (CRISPR) / Cas system, a transcription activator-like effector nuclease (TALEN), or a zinc-finger nuclease (ZFN).
[0042] In some embodiments, the OCA2 modifier may be a short palindromic repeat (CRISPR) / Cas system that forms clusters and has regular spacing. As used herein, the short palindromic repeat (CRISPR) system that forms clusters and has regular spacing is a bacterial immune system modified for genomic manipulation.
[0043] The CRISPR-Cas system can be divided into two classes. Class I systems use a complex of multiple Cas proteins to degrade foreign nucleic acids. Class II systems use a single large Cas protein for the same purpose. More specifically, Class I can be subdivided into types I, III, and IV, and Class II can be subdivided into types II, V, and VI.
[0044] The CRISPR-Cas system has evolved in prokaryotes to protect against phage attacks and unwanted plasmid replication by targeting foreign DNA or RNA. The CRISPR-Cas system targets DNA molecules based on short homologous DNA sequences called spacers that are present between repeats. These spacers guide CRISPR-associated (Cas) proteins to matching (and / or complementary) sequences in target DNA (e.g., foreign DNA) called protospacers, which are later cleaved. Spacers can be reasonably designed to target any target DNA sequence, for example, within the OCA2 gene sequence. For this reason, in some more specific embodiments, the at least one cas gene used in the methods and compositions of the present invention may be at least one cas gene of a type II CRISPR system. The CRISPR type II system used herein requires the inclusion of two essential components: a "guide" RNA (gRNA) and a CRISPR-associated endonuclease (Cas9). gRNA is a short synthetic RNA composed of a “scaffold” sequence (also called tracrRNA) necessary for Cas9 binding and a “spacer” or “targeting” sequence approximately 20 nucleotides long that defines the genomic target to be modified. As used herein, guide RNA (gRNA) refers to a synthetic fusion of endogenous tracrRNA and a targeting sequence (also called crRNA) that provides both scaffolding / binding ability and target specificity for the Cas9 nuclease.
[0045] In some embodiments, the OCA2 modifier may be a TALEN. As used herein, TALENs are restriction enzymes that can be manipulated to cleave specific sequences of DNA. They are made by fusing a TAL effector DNA-binding domain to the DNA-cleaving domain of a nuclease. More specifically, TALENs are artificial endonucleases designed by fusing a DNA-binding domain (a complex of nearly identical repeats, each consisting of approximately 34 amino acids) derived from a TAL (transcription activator-like effector, TALE) protein to the cleaving domain of a FokI endonuclease. Each TALE repeat independently recognizes its corresponding nucleotide (nt) base having two variable residues [called repeat variable di-residues, RVDs] such that the repeat linearly represents the nucleotide sequence of the binding site.
[0046] In some embodiments, the OCA2 modifier may be a ZFN agent. A ZFN is an artificial restriction enzyme produced by fusing a zinc finger DNA-binding domain to a DNA-cleaving domain. The zinc finger domain can be manipulated to target specific desired DNA sequences, thereby enabling the zinc finger nuclease to target unique sequences within complex genomes. More specifically, a ZFN is an artificial endonuclease produced by combining a small zinc finger (zinc finger, ZF; approximately 30 amino acids) DNA-binding / recognition domain (Cys2His2) with an IIS-type nonspecific DNA-cleaving domain from a FokI restriction enzyme. However, the cleavage activity of FokI endonucleases requires dimerization. Since the ZF module recognizes 3bp sequences, multiple fingers are required in each ZFN monomer to recognize and bind to longer DNA target sequences.
[0047] In some embodiments, the at least one OCA2 regulator comprises at least one nucleic acid molecule.
[0048] In some embodiments, the nucleic acid molecule is sequence numbers 1, 2, 3, 4, 5, 6, 7, 8, 9, 10, 11, 12, 13, 14, 15, 16, 17, 18, 19, 20, 21, 22, 23, 24, 25, 26, 27, 28, 29, 30, 31, 32, 33, 34, 35, 36, 37, 38, 39, 40, 41, 42, 43, 44, 45, 46, 47, 48, 49, 50, 51, 52, 53, 54, 55, 56, 57, 58, 59, 60, 61, 62, 63, 64, 67, 68, 69, 70, 71, 72, 73, 74, 75, 76, 77, 78, 79, 80, 81, 82, 83, 84, 85, 86, 87, 88, 89, 90, 91, 92, 93, 94, 95, 96, 97, 98, 99, 100, 101, 102, 103, 104, 105, 106, 107, 108, 109, 110, 111, 112, 113, 114, 1 15, 116, 117, 118, 119, 120, 121, 122, 123, 124, 125, 126, 127, 128, 129, 130, 131, 132, 133, 134, 135, 136, 137, 138, 139, 140, 141, 142, 143, 144, 145, 146, 147, 148, 149, 150, 151, 152, 153, 154, 155, 156, 157, 158, 159, 160, 1 It comprises at least one nucleic acid sequence represented by 61, 162, 163, 164, 165, 166, 167, 168, 169, 170, 171, 172, 173, 174, 175, 176, 177, 178, 179, 180, 181, 182, 183, 184, 185, 186, 187, 188, 189, 190, 191, 192, 193, 194, 195, 196, 197, 198, 199, or 200.
[0049] In some specific embodiments, the nucleic acid molecule includes at least one of the following: single-stranded RNA (ssRNA), single-stranded DNA (ssDNA), double-stranded DNA (dsDNA), double-stranded RNA (dsRNA), a nucleic acid molecule having at least one modified nucleotide, and any combination thereof.
[0050] In some more specific embodiments, the nucleic acid molecule includes at least one of the following: small interfering RNA (siRNA), antisense oligonucleotide (ASO), guide RNA, short hairpin RNA (shRNA), microRNA (miRNA), peptide-nucleic acid (PNA), and locked nucleic acid (LNA).
[0051] In some embodiments, the OCA2 regulators of the present invention act via RNA silencing. As used herein, the term “RNA silencing” refers to a group of RNA-mediated regulatory mechanisms that result in inhibition or “silencing” of the expression of a corresponding protein-coding gene or RNA sequence, such as RNA interference (RNAi), transcriptional gene silencing (TGS), post-transcriptional gene silencing (PTGS), querying, co-repression, and translational repression. In certain embodiments, RNA silencing agents can prevent the complete processing of mRNA molecules (e.g., complete translation and / or expression) via post-transcriptional silencing mechanisms. RNA silencing agents include non-coding RNA molecules, such as RNA double helix containing a paired strand, and precursor RNA capable of generating such small non-coding RNAs. Examples of RNA silencing agents include, but are not limited to, dsRNAs, such as siRNA, miRNA, shRNA, piwi-interacting RNA (piRNA), long non-coding RNA (lncRNA), antisense oligonucleotides (ASOs), ribozymes, DNA-directed RNA (ddRNA), small activating RNA (saRNA), CRISPR RNA (crRNA), and Dicer-substrate siRNA (dsiRNA). In some embodiments, the RNA silencing agent can induce RNA interference. In other embodiments, the RNA silencing agent can mediate translational repression. More specifically, nucleic acid agents according to the present invention may encode an "antisense RNA," which is a single-stranded RNA (ssRNA) molecule complementary to the mRNA strand of a particular target gene product. The antisense RNA may inhibit the translation of the complementary mRNA by base-pairing with it and physically interfering with the translation mechanism."Complementary" refers to the ability of polynucleotides to form base pairs with one another. Base pairs are typically formed by hydrogen bonds between nucleotide units in antiparallel polynucleotide chains. Complementary polynucleotide chains can form base pairs in a Watson-Crick manner (e.g., A to T, A to U, C to G) or in any other manner that allows for the formation of double helix chains.
[0052] In some specific embodiments, the nucleic acid modifiers of this disclosure may encode RNA, particularly dsRNA molecules involved in RNA interference. RNA interference (RNAi), as described above, is a common conserved eukaryotic pathway that downregulates gene expression in a sequence-specific manner. It is a sequence-specific post-transcriptional gene silencing process in animals and plants, initiated by an siRNA homologous in its double-stranded region to the sequence of the gene to be silenced. Gene silencing is induced and maintained by the presence of a partially or completely double-stranded RNA (dsRNA). The silenced gene may be endogenous or exogenous to the organism and may be integrated into a chromosome or present in a transfection vector that is not integrated into the genome. Expression of the target OCA2 gene is completely or partially inhibited.
[0053] More specifically, the dsRNA regulators included in this disclosure may be selected from the group consisting of small interfering RNAs (siRNAs), microRNAs (miRNAs), short hairpin RNAs (shRNAs), and PIWI-interacting RNAs (piRNAs).
[0054] In some further specific embodiments, the OCA2 modulator may be a nucleic acid molecule comprising at least one siRNA molecule. In some embodiments, the siRNA molecule targets at least one sequence that encodes OCA2 or directly or indirectly controls the level and / or activity and / or stability of OCA2.
[0055] Specifically, as used herein, an siRNA molecule relates to a molecule comprising two strands: an antisense strand, which acts as a "guide" for mRNA, and a sense strand, which does not actively participate in gene silencing. The time that siRNA molecules remain in tissue is determined by their degradation by nuclease enzymes. In some embodiments, siRNA may be synthesized using a modified sugar-phosphate backbone that inhibits the activity of these enzymes, thereby allowing the siRNA molecule to remain in tissue for a longer period. In some specific embodiments, siRNA includes a blunt end.
[0056] In some specific embodiments, the siRNA molecule may target at least one region in the OCA2 transcript or mRNA. In some specific embodiments, the siRNA molecule may target at least one region in the human OCA2 transcript or mRNA. In some embodiments, the human OCA2 transcript or mRNA may include the nucleic acid molecule indicated by no. 65. In some embodiments, the siRNA molecule may target nucleotide regions located at 375-420, 1270-1370, 1500-1600, 1900-2400, or 2610-3143 in the OCA2 mRNA transcript. Other preferred regions that the siRNA of this disclosure may target are described in Example 5 below.
[0057] In some embodiments, the siRNA molecule is represented by SEQ ID NOs: 1, 2, 3, 4, 5, 6, 7, 8, 9, 10, 11, 12, 13, 14, 15, 16, 17, 18, 19, 20, 21, 22, 23, 24, 25, 26, 27, 28, 29, 30, 31, 32, 33, 34, 35, 36, 37, 38, 39, 40, 41, 42, 43, 44, 45, 46, 47, 48, 49, 50, 51, 52, 53, 54, 55, 56, 5 7, 58, 59, 60, 61, 62, 63, 64, 67, 68, 69, 70, 71, 72, 73, 74, 75, 76, 77, 78, 79, 80, 81, 82, 83, 84, 85, 86, 87, 88, 89, 90, 91, 92, 93, 94, 95, 96, 97, 98, 99, 100, 101, 102, 103, 104, 105, 106, 107, 108, 109, 110, 111, 112, 113, 114, 115 ,116,117,118,119,120,121,122,123,124,125,126,127,128,129,130,131,132,133,134,135,136,137,138,139,140,141,142,143,144,145,146,147,148,149,150,151,152,153,154,155,156,157,158,159,160,161, It may include at least one nucleic acid sequence represented by 162, 163, 164, 165, 166, 167, 168, 169, 170, 171, 172, 173, 174, 175, 176, 177, 178, 179, 180, 181, 182, 183, 184, 185, 186, 187, 188, 189, 190, 191, 192, 193, 194, 195, 196, 197, 198, 199, or 200.
[0058] In some alternative embodiments, the nucleic acid molecule comprises at least one ASO. In some further embodiments, as used herein, the antisense oligonucleotide (ASO) is a single-stranded synthetic RNA (or DNA) sequence, which may be highly modified, and is designed to selectively bind to the RNA encoding the gene of interest via complementary base pairing. Binding of the ASO to its target can evoke a range of consequences, ranging from alteration of mRNA processing to degradation of the target transcript. A synthesized ASO can bind to a complementary sequence in premRNA, modifying the recruitment of splicing factors to the molecule to modulate the splicing event; bind to mature mRNA, preventing its attachment to ribosomes and blocking protein translation; or recruit RNase H to a target transcript that will subsequently be degraded.
[0059] In some specific embodiments, nucleic acid modifiers (e.g., ASOs or siRNAs) can be synthesized by standard methods known in the art, as further discussed below, for example, by using an automated DNA / RNA synthesizer (e.g., one commercially available from Biosearch, Applied Biosystems, Inc.). The dsRNA compounds of the present invention can be prepared using a two-step procedure. First, the individual strands of the dsRNA compound are prepared separately. Then, the component strands are annealed. The individual strands of the dsRNA compound can be prepared using liquid-phase organic synthesis, solid-phase organic synthesis, or both. Organic synthesis offers the advantage that oligonucleotide chains containing non-natural or modified nucleotides can be easily prepared.
[0060] In some further embodiments, the single-chain oligonucleotides of the present invention can be prepared using liquid-phase organic synthesis, solid-phase organic synthesis, or both.
[0061] The embodiments described above may include nucleic acid molecular agents such as siRNA, ASO, or other types of RNA interference having at least one chain of at least 17 nucleotides in length, due to the nature of the oligonucleotide sequences provided herein. Shorter double helixes, excluding just a few nucleotides at one or both ends, may be expected to be equally effective compared to the nucleic acid molecular agents. In other words, nucleic acid molecular agents comprising sequences of at least 15, 16, 17, 18, 19, 20, or more consecutive nucleotides, derived from the sequences described herein but with an inhibitory effect of 30% or less on OCA2 gene expression compared to nucleic acid molecular agents comprising the complete sequence, are intended to be within the scope of the present invention. In some specific embodiments, the nucleic acid molecular agent may comprise 19 nucleotides.
[0062] In the present invention, the nucleic acid molecular agent may contain one or more mismatches with respect to the target sequence. One embodiment describes a nucleic acid molecular factor containing three or fewer mismatches. When the antisense strand of an RNA therapeutic agent contains a mismatch with respect to the target sequence, it is preferable that the mismatch is not located in the center of the complementarity region. Instead, the mismatch should be located within the last five nucleotides, either at the 5' or 3' end of the complementarity region. Whether an RNA therapeutic agent containing a mismatch with respect to the target sequence is effective in inhibiting the expression of the OCA2 gene can be determined using the methods described herein or methods known in the art. If a particular complementarity region in the OCA2 gene is known to undergo polymorphic sequence variation within a population, it is appropriate to consider the effectiveness of an RNA therapeutic agent with a mismatch in inhibiting OCA2 expression.
[0063] Although some of the sequences listed in Table 2 are unmodified and / or unconjugated sequences, the RNA of the RNA therapeutic agent of the present invention, for example, dsRNA, may contain any one of these sequences listed in Table 2, which is either unmodified and unconjugated, or modified and / or conjugated in a manner different from that described in Table 2.
[0064] In one embodiment, the present invention uses an unmodified nucleic acid molecular agent that does not contain chemical modifications or conjugations known to those skilled in the art or described herein. Another embodiment of the present invention involves chemical modification of the nucleic acid molecular agent to improve stability or other beneficial properties (such as resistance to nucleases, increased uptake by endocytosis, increased tissue retention, increased endosome escape rate, increased storage of nucleic acid molecules near melanin, increased silencing efficiency, a more favorable pharmacokinetic profile, better distribution to the anterior chamber and / or iris, or RISC uptake of the guide strand). In certain embodiments of the present invention, substantially all of the nucleotides of the nucleic acid molecular agent are modified. For example, substantially all of the nucleotides in the sense strand are modified nucleotides, and / or substantially all of the nucleotides in the antisense strand are modified nucleotides, and / or substantially all of the nucleotides in both the sense and antisense strands are modified nucleotides.
[0065] In another embodiment of the present invention, all nucleotides of the nucleic acid molecular drug are modified. In this case, all nucleotides of the sense strand are modified nucleotides, and / or all nucleotides of the antisense strand are modified nucleotides, and / or all nucleotides of both the sense strand and the antisense strand are modified nucleotides.
[0066] The nucleic acid molecular agents of the present invention can be synthesized and / or modified according to known methods. These include, for example, terminal modifications such as 5'-end modifications (phosphorylation, conjugation, reverse bonding) or 3'-end modifications (conjugation, DNA nucleotide, reverse bonding, etc.). Base modifications, such as stabilizing bases, destabilizing bases, substitutions with bases that base-pair with an expanded repertoire of partners, or base removal (debastic nucleotides). In addition, modifications at the 2' or 4' position (e.g., 2'-O-methyl (2'-OMe), 2'-fluoro (2'-F), locked nucleic acid (LNA), 5-methylcytidine (5mC), unlocked nucleic acid (UNA), 2'-O-(2-methoxyethyl) (2'-MOE)), sugar modifications such as sugar substitution, and modifications to the backbone, such as modification or substitution of phosphodiester bonds, are available.
[0067] Examples of nucleic acid molecular compounds useful in the embodiments described herein include, but are not limited to, nucleic acid molecules containing a modified skeleton or nucleic acid molecules lacking natural internucleoside bonds. Some nucleic acid molecules having a modified skeleton lack a phosphorus atom. As mentioned in the art, a modified nucleic acid molecule without a phosphorus atom in its internucleoside skeleton may also be considered an oligonucleoside for the purposes of this specification. In some embodiments, the modified nucleic acid molecule may contain a phosphorus atom in its internucleoside skeleton.
[0068] The backbone of modified nucleic acid molecules includes, for example, phosphorothioates, chiral phosphorothioates, phosphorodithioates, phosphotryesters, aminoalkyl phosphotryesters, methyl and other alkylphosphonates, such as 3'-alkylene phosphonates and chiral phosphonates, phosphinates, and phosphoramidates including 3'-aminophosphorumidates. Similarly, it includes aminoalkyl phosphoramidates, thionophosphorumidates, thionoalkyl phosphonates, thionoalkyl phosphotryesters, and boranophosphates having canonical 3'-5' bonds, their 2'-5' bond analogues, and those with reverse polarity where adjacent pairs of nucleoside units are bonded from 3'-5' to 5'-3' or 2'-5' to 5'-2'. Various salts, mixed salts, and free acid forms are also covered.
[0069] In other embodiments of the present invention, suitable RNA mimics can be used to create RNA interference. In these embodiments, both the sugar and nucleoside bonds of the nucleotide units, i.e., the backbone, are replaced with novel groups. The base units are maintained for hybridization with suitable nucleic acid target compounds. Peptide nucleic acids (PNAs), which may be used as OCA2 modulators according to some embodiments of the present disclosure, are RNA mimics with excellent hybridization properties and oligomeric structures. Instead of phosphodiester bonds, PNAs are composed of peptide bonds, and their nucleic acid bases are directly attached to the N-methylglycine backbone. Due to their properties, PNAs are more stable and less susceptible to degradation, making them an effective method for RNA interference. The nucleic acid bases are retained and directly or indirectly bonded to the aza nitrogen atom of the amide portion of the backbone. The preparation of PNA compounds is known in the art. Additional PNA compounds suitable for use in iRNA of the present invention exist (e.g., Nielsen et al., Science, 1991, 254, 1497-1500).
[0070] In another embodiment, at least one modifier targets at least one region in the OCA2 transcript.
[0071] In another embodiment, at least one regulator targets at least one region in the OCA2 gene.
[0072] In some additional embodiments, at least one regulator targets several regions of the OCA2 gene or OCA2 transcript, for example, 2 to 10, 2 to 9, 2 to 8, 2 to 7, 2 to 6, 2 to 5, or 2 to 4 regions.
[0073] In certain embodiments, at least one regulator targets at least one region in the OCA2 transcript that is sensitive to RNA-induced silencing complex (RISC) mediated cleavage.
[0074] In another embodiment, at least one regulator targets at least one region in the OCA2 transcript by inhibiting translation by blocking ribosome access to the transcript (mRNA).
[0075] In some other embodiments, at least one regulator targets at least one region in the OCA2 transcript that is sensitive to RNA-induced silencing complex (RISC)-mediated cleavage (which may include degradation of the transcript (mRNA) by the RISC Argonaut protein and by the exoribonuclease Xrn1).
[0076] In some further embodiments, at least one regulator targets at least one region in the OCA2 transcript via RNase H-mediated cleavage. In some specific embodiments where at least one regulator is an ASO, the at least one regulator can form a double helix with the mRNA target, which recruits the RNase H enzyme to cleave the mRNA.
[0077] In some further embodiments, at least one regulator targets at least one region in the OCA2 transcript via steric hindrance. In some specific embodiments where the at least one regulator is an ASO, the at least one regulator can bind to mRNA and block soap to the ribosome, thereby preventing translation.
[0078] In some further embodiments, at least one regulator targets at least one region in the OCA2 transcript via splicing regulation. In some specific embodiments where the at least one regulator is an ASO, the at least one regulator can exclude or include a specific exon in the final mRNA by altering the splicing of the premRNA.
[0079] In some further embodiments, at least one regulator targets at least one region in the OCA2 transcript via the activation of nonsense-mediated disintegration. In some specific embodiments where at least one regulator is an ASO, the at least one regulator can target mRNA having a premature termination codon (PTC) to induce nonsense-mediated disintegration and result in mRNA degradation.
[0080] In some embodiments, the modifier may increase the expression and / or activity and / or stability of OCA2. According to some embodiments of the present disclosure, the OCA2 modifier may increase the expression and / or activity of OCA2 in, for example, cells, tissues, anterior chamber, or any other compartment of an ocular object by at least about 5%, 6%, 7%, 8%, 9%, 10%, 11%, 12%, 13%, 14%, 15%, 16%, 17%, 18%, 19%, 20%, 21%, 22%, 23%, 24%, 25%, 26%, 27%, 28%, 29%, 30%, 31%, 32%, 33%, 34%, 35%, 36%, 37%, 38%, 39%, 40%, 41%, 42%, 43%, 44% It may increase by 45%, 46%, 47%, 48%, 49%, 50%, 51%, 52%, 53%, 54%, 55%, 56%, 57%, 58%, 59%, 60%, 61%, 62%, 63%, 64%, 65%, 66%, 67%, 68%, 69%, 70%, 71%, 72%, 73%, 74%, 75%, 76%, 77%, 78%, 79%, 80%, 81%, 82%, 83%, 84%, 85%, 86%, 87%, 88%, 89%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, or at least about 99% or more.
[0081] In certain embodiments, the OCA2 modulator affects the level of melanin in the iris tissue of the subject. In some embodiments, the OCA2 modulator affects the level of eumelanin. In some other embodiments, the OCA2 modulator affects the level of pheomelanin. In some other embodiments, the OCA2 modulator affects the average maturation of melanosomes.
[0082] In some embodiments, the modifier inhibits and / or reduces the expression and / or activity and / or stability of OCA2. Therefore, according to some embodiments of the present disclosure, the OCA2 modifier reduces the expression and / or activity of OCA2 in, for example, ocular cells (e.g., iris interstitial cells), tissues, the anterior chamber, or any other compartment of the ocular object by at least about 5%, 6%, 7%, 8%, 9%, 10%, 11%, 12%, 13%, 14%, 15%, 16%, 17%, 18%, 19%, 20%, 21%, 22%, 23%, 24%, 25%, 26%, 27%, 28%, 29%, 30%, 31%, 32%, 33%, 34%, 35%, 36%, 37%, 38%, 39%, 40%, 41%, 420%, 41%, 41%, 40%, 40%, 40%, 40%, 40%, 41%, 41%, 40%, 40%, 40%, 40%, 40%, 40%, 40%, 41%, 40%, 40%, 40%, 40%, 40%, 40%, 40%, 40%, 40%, 40%, 40%, It may be reduced / inhibited by 3%, 44%, 45%, 46%, 47%, 48%, 49%, 50%, 51%, 52%, 53%, 54%, 55%, 56%, 57%, 58%, 59%, 60%, 61%, 62%, 63%, 64%, 65%, 66%, 67%, 68%, 69%, 70%, 71%, 72%, 73%, 74%, 75%, 76%, 77%, 78%, 79%, 80%, 81%, 82%, 83%, 84%, 85%, 86%, 87%, 88%, 89%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, or at least about 99% or more.
[0083] If provided, it is understood that percentage values such as 10%, 50%, 120%, and 500% are interchangeable with "multiple change" values, i.e., 0.1, 0.5, 1.2, and 5, respectively.
[0084] The reduction / inhibition or increase described above may be assessed by a decrease or increase in the absolute or relative level of one or more variables related to OCA2 expression and / or activity and / or stability, compared to a control level. The control level may be determined from any type of control available in the art, e.g., a pre-dosing baseline level, or an untreated or unexposed / uncontacted control of the OCA2 modifiers of this disclosure (e.g., a buffer-only control or an inactivator control), specifically from a similar subject, cell, cell population, or sample treated with any of the cells (e.g., iris stromal cells).
[0085] The reduction in expression can be assessed using any method currently available in the art. To determine the reduction in OCA2 expression, the level of protein mRNA expression can be quantified using methods common to those skilled in the art, such as Northern blotting and qRT-PCR. In addition, the level of protein in OCA2 (also called P protein) can be measured using methods routine to those skilled in the art, including but not limited to Western blotting and immunological techniques. Alternatively, the success of the inhibition can be assessed by analyzing downstream phenotypic effects, such as melanosome maturity, pigment density, and pH within melanosomes.
[0086] In certain embodiments, the inhibition reduces the level of melanin in the iris tissue of the subject. As used herein, “melanin” is a natural pigment produced by specialized cells known as melanocytes. It performs a variety of functions throughout the body, including protection against UV irradiation and determining the coloration of tissues such as skin, hair, and eyes. In the eye, melanin plays a crucial role in the iris, the colored part of the eye. The amount and distribution of melanin in the iris contribute to the spectrum of eye color observed in an individual. Specifically, there are two main types of melanin involved in eye coloration: eumelanin and pheomelanin. Eumelanin is responsible for darker pigmentation and contributes to the brown and black hues of the eye. Pheomelanin is associated with lighter pigmentation and contributes to red and yellow hues, which are often seen in lighter-colored eyes such as blue or green.
[0087] In some embodiments, the inhibition reduces the level of eumelanin. In some other embodiments, the inhibition reduces the level of pheomelanin.
[0088] According to some embodiments of this disclosure, the OCA2 modulator causes the levels of melanin, specifically eumelanin and / or pheomelanin, in the cells of the eye (e.g., iris interstitial cells), tissues, anterior chamber, or any other compartment of the ocular object to be at least about 5%, 6%, 7%, 8%, 9%, 10%, 11%, 12%, 13%, 14%, 15%, 16%, 17%, 18%, 19%, 20%, 21%, 22%, 23%, 24%, 25%, 26%, 27%, 28%, 29%, 30%, 31%, 32%, 33%, 34%, 35%, 36%, 37%, 38%, 39%, 40%, 41%, They may be reduced / inhibited by 42%, 43%, 44%, 45%, 46%, 47%, 48%, 49%, 50%, 51%, 52%, 53%, 54%, 55%, 56%, 57%, 58%, 59%, 60%, 61%, 62%, 63%, 64%, 65%, 66%, 67%, 68%, 69%, 70%, 71%, 72%, 73%, 74%, 75%, 76%, 77%, 78%, 79%, 80%, 81%, 82%, 83%, 84%, 85%, 86%, 87%, 88%, 89%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, or at least about 99% or more.
[0089] In some further embodiments, such inhibition reduces the average maturation of melanosomes. As used herein, “melanosome” refers to a specialized organelle found within melanocytes, which are cells involved in melanin production. These organelles are crucial for the synthesis, storage, and transport of melanin within the cell, as well as its eventual migration to surrounding tissues. In the eye, melanin production occurs within melanosomes located in melanocytes of the iris. These melanosomes produce either eumelanin or pheomelanin, depending on genetic and environmental factors. The type and amount of melanin synthesized within these melanosomes determines the color of the iris. Melanosomes in the iris vary in size, shape, and distribution among individuals, which can affect the intensity and hue of eye color. For example, individuals with darker eye color typically have larger, more densely packed melanosomes containing higher levels of eumelanin, while individuals with lighter eye color have fewer, smaller melanosomes, often containing more pheomelanin.
[0090] In some embodiments, the inhibition reduces the average maturity of melanosomes by at least approximately 5%, 6%, 7%, 8%, 9%, 10%, 11%, 12%, 13%, 14%, 15%, 16%, 17%, 18%, 19%, 20%, 21%, 22%, 23%, 24%, 25%, 26%, 27%, 28%, 29%, 30%, 31%, 32%, 33%, 34%, 35%, 36%, 37%, 38%, 39%, 40%, 41%, 42%, 43%, 44%, 45%, 46%, 47%, 48%, 49%, Reduce by 50%, 51%, 52%, 53%, 54%, 55%, 56%, 57%, 58%, 59%, 60%, 61%, 62%, 63%, 64%, 65%, 66%, 67%, 68%, 69%, 70%, 71%, 72%, 73%, 74%, 75%, 76%, 77%, 78%, 79%, 80%, 81%, 82%, 83%, 84%, 85%, 86%, 87%, 88%, 89%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, or at least approximately 99% or more.
[0091] In some specific embodiments, the inhibition occurs in the iris interstitium.
[0092] In some more specific embodiments, the OCA2 modifier reduces the expression and / or activity and / or stability of OCA2, which in turn lightens the eye color of the subject.
[0093] In some more specific embodiments, the at least one OCA2 modulator targets the iris interstitial tissue in question.
[0094] As used herein, the iris interstitium is the connective tissue layer of the iris located between the anterior and posterior layers of the iris. It consists of fibroblasts, collagen fibers, blood vessels, and pigment cells called interstitial melanocytes. The iris interstitium gives the iris its structural integrity and contributes to its color, primarily through the distribution of pigment cells. In some embodiments, the OCA2 modifier targets the iris interstitial melanocytes of the subject.
[0095] In some embodiments, the at least one OCA2 regulator targets at least one cell type from among the pigment epithelium, uvea, choroid, ciliary body, retinal pigment epithelium (RPE), and / or iris pigment epithelium (IPE).
[0096] In some embodiments, the at least one OCA2 modulator targets pigment epithelial cells. As used herein, pigment epithelial cells form the retinal pigment epithelium layer located between the neuroretina and the choroid. The pigment epithelium prevents light reflection and scattering within the eye by helping to absorb excess light. These cells also play a role in the regeneration of photoreceptor pigments.
[0097] In some embodiments, the at least one OCA2 modifier targets cells of the uvea. The uvea is the intermediate layer of the eye, consisting of the iris, ciliary body, and choroid. Cells of the uvea include melanocytes, fibroblasts, and vascular-associated cells. Melanocytes contribute to pigmentation in the iris and choroid, contributing to eye color and light absorption. Fibroblasts contribute to the structural integrity of the uvea. Vascular-associated cells include endothelial cells and pericytes, which are involved in maintaining vascular function.
[0098] In some embodiments, the at least one OCA2 modulator targets choroidal cells. The choroid is a vascular layer located between the retina and the sclera (the white outer layer of the eye). Choroidal cells include melanocytes, fibroblasts, endothelial cells, and pericytes. Melanocytes contribute to the formation of pigment in the choroid, assisting in light absorption and reducing intraocular scattering. Endothelial and pericytes are involved in regulating blood flow and nutrient exchange within the choroidal vascular system.
[0099] In some embodiments, the at least one OCA2 modulator targets cells of the ciliary body (CB). The ciliary body is a muscular structure located behind the iris. The cells of the ciliary body include epithelial cells, myocytes, and secretory cells. Epithelial cells are involved in the production of aqueous humor, the fluid that nourishes the cornea and lens. Myocytes control the shape of the lens for accommodation (focusing at different distances). Secretory cells produce components of aqueous humor and regulate its secretion and outflow.
[0100] In some embodiments, the at least one OCA2 modulator targets cells of the retinal pigment epithelium (RPE). The retinal pigment epithelium is a monolayer of cells located between the neuroretina and the choroid. RPE cells provide metabolic support to retinal photoreceptor cells (rods and cones). They phagocytose shed photoreceptor outer segments and recycle the visual pigment. RPE cells also contribute to the blood-retinal barrier, regulating the transport of nutrients and waste products between the retina and the choroid.
[0101] In some embodiments, the at least one OCA2 modulator targets cells of the iris pigment epithelium (IPE). The IPE is a layer of pigment cells located on the posterior surface of the iris facing the anterior chamber of the eye. These cells contribute to the color of the iris and help control the amount of light entering the eye by regulating the size of the pupil. IPE cells also play a role in the production and circulation of aqueous humor, the fluid that fills the anterior chamber of the eye.
[0102] In some embodiments, the at least one modulator penetrates through the cornea and / or enters the anterior chamber of the eye.
[0103] In some embodiments, the at least one regulator escapes destruction by the endolysosomal system.
[0104] In some embodiments, the at least one modifier does not activate the immune system.
[0105] In some embodiments, the at least one modifier is encapsulated within at least one nanocarrier or coated with at least one nanocarrier.
[0106] In some embodiments, the at least one OCA2 protein regulator comprises at least one nucleic acid molecule, or any vector or host cell containing the same.
[0107] In some further embodiments, the method of the present disclosure may further include the step of exposing the object to at least one light source. In some embodiments, the step may accelerate the lightening of the eye color.
[0108] In some embodiments, any form of light exposure, such as from the sun, ambient light, or therapeutic light, may be used at any preferred time interval, any preferred intensity, and / or any preferred wavelength, so as to reduce melanin levels in the iris tissue of interest.
[0109] The procedure may include additional steps that can accelerate melanin breakdown and / or be linked to the inhibition of new melanin production.
[0110] In some further embodiments, the method of the present disclosure may further include the step of administering an additional pharmacological agent for inhibiting melanin production.
[0111] In some further embodiments, the method of the present disclosure may further include the step of requiring the subject to be deprived of water for an extended period.
[0112] Autophagy facilitates the degradation of proteins, including those in melanosomes, which can lead to a decrease in melanosome and melanin levels in cells. For this reason, in some embodiments, autophagy may be accelerated or enhanced. In particular, actions such as prolonged dehydration can promote autophagy, and genetic predisposition may also play a role. Using these modified animals as models, it may be possible to genetically modify subjects to exhibit increased autophagy. In some embodiments, these models are utilized, or subjects are required to undergo prolonged dehydration, to achieve the described effects.
[0113] In some embodiments, administration of an effective amount of at least one oculocutaneous albinism 2 (OCA2) protein modulator may be repeated several times, for example, 2 to 100 times, and / or at different intervals, for example, 1 day to about 1 week.
[0114] In some embodiments, administration of an effective amount of at least one oculocutaneous albinism 2 (OCA2) protein modulator may be repeated about 1, 2, 3, 4, 5, 6, 7, 8, 9, 10, 11, 12, 13, 14, 15, 16, 17, 18, 19, 20, 21, 22, 23, 24, 25, 26, 27, 28, 29, 30, 31, 32, 33, 34, 35, 36, 37, 38, 39, 40, 41, 42, 43, 44, 45, 46, 47, 48, 49, or 50 times, or about 60, 70, 80, 90, 100, 110, 120, 130, 140, 150, 160, 170, 180, 190, or 200 times.
[0115] In some further embodiments, the oculocutaneous albinism 2 (OCA2) protein regulator or any composition thereof and any component thereof may be administered once daily or multiple times daily, preferably every 1 to 60 days or every 1 to 365 days. Such application may be carried out once, twice, three, four, five, or six times per day, or it is specifically intended that it may be carried out once daily, once every two days, once every three days, once every four days, once every five days, once every six days, once every week, two weeks, three weeks, four weeks, one month, two months, or even once every few months to one year. The application of the composition / or any component thereof of the present invention may continue for one day, two days, three days, four days, five days, six days, one week, two weeks, three weeks, four weeks, one month, two months, three months, or even longer, for example, throughout the entire life of the subject.
[0116] In some embodiments, such repetition may be required due to the re-pigmentation of the eye tissue in question.
[0117] In some embodiments, the at least one OCA2 modulator is administered by ocular administration.
[0118] In certain embodiments, the at least one OCA2 modulator is administered by topical administration. In some embodiments, the topical administration is performed on the eye of the subject.
[0119] In some embodiments, the at least one OCA2 modifier is included in the eye drop formulation.
[0120] In some alternative embodiments, the at least one OCA2 modulator is administered into the anterior chamber of the eye.
[0121] In some embodiments, the methods disclosed herein are for cosmetic purposes.
[0122] In some embodiments, the subject is a healthy subject.
[0123] The term "healthy" refers to a state of being free from disease, injury, or illness / disability. In some specific embodiments, a healthy subject refers to a subject free from eye disorders. In some specific embodiments, a healthy subject refers to a subject free from cancer. In some more specific embodiments, a healthy subject refers to a subject free from melanocyte carcinoma.
[0124] In some embodiments, this disclosure provides non-therapeutic methods. In some further embodiments, this disclosure provides cosmetic methods.
[0125] In some alternative embodiments, the subject is suffering from a disease.
[0126] In some specific embodiments, the disease may be any one of the following: hyperpigmentation eye disorders, hyperpigmentation, side effects of glaucoma drugs, acquired heterochromia (e.g., due to Horner's syndrome or Fuchs iridocyclitis) and congenital heterochromia (e.g., due to genetic syndromes such as Waardenburg syndrome), bilateral diffuse uveal melanocyte proliferation (BDUMP), ocular nevi (e.g., choroidal nevi), pigment scattering syndromes, ocular melanoma, complexion-associated melanosis, primary acquired melanosis, plaques, Risch nodules, melanocytoma, ocular / oculocutaneous melanocytosis (e.g., nevus of Ota), and benign ocular growth or any pigmented eye disorder, as well as any pigmented disorder that appears in the eye but is caused by a systemic condition such as Addison's disease.
[0127] In a further embodiment, the Disclosure provides at least one oculocutaneous albinism 2 (OCA2) protein modulator, or any vehicle, matrix, nanoparticles or microparticles thereof, or any composition comprising them, for use in a method of correcting the eye color of a subject, the method comprising administering an effective amount of the at least one OCA2 protein modulator to the subject.
[0128] It should be noted that all of the above embodiments relating to the methods for correcting eye color as defined above are also applicable to the second aspect of the present disclosure relating to OCA2 modifiers for use in accordance with the present disclosure, and any other aspect of the present disclosure.
[0129] In a third aspect, the Disclosure provides a composition for modifying the eye color of a subject, comprising at least one oculocutaneous albinism 2 (OCA2) protein modulator. Optionally, the compositions of the Disclosure may further comprise any carrier diluent and any suitable excipient.
[0130] In some embodiments, the modifier is at least one gene editing agent adapted to modulate the expression and / or activity and / or stability of OCA2.
[0131] In some embodiments, the at least one regulator comprises at least one nucleic acid molecule.
[0132] In some embodiments, the nucleic acid molecule includes at least one of single-stranded DNA (ssDNA), single-stranded RNA (ssRNA), double-stranded DNA (dsDNA), double-stranded RNA (dsRNA), a nucleic acid molecule having at least one modified nucleotide, and any combination thereof.
[0133] In some specific embodiments, the nucleic acid molecule includes at least one of the following: small interfering RNA (siRNA), antisense oligonucleotide (ASO), guide RNA, short hairpin RNA (shRNA), microRNA (miRNA), peptide nucleic acid (PNA), and locked nucleic acid (LNA).
[0134] In some more specific embodiments, the nucleic acid molecule comprises at least one siRNA molecule, which encodes OCA2 or targets at least one sequence that directly or indirectly controls the level and / or activity and / or stability of OCA2. In some alternative embodiments, the nucleic acid molecule comprises at least one ASO. In a particular embodiment, at least one OCA2 modulator targets at least one region in the OCA2 transcript.
[0135] In other embodiments, at least one regulator targets at least one region in the OCA2 gene.
[0136] In a particular embodiment, at least one regulator targets at least one region in the OCA2 transcript that is sensitive to RNA-induced silencing complex (RISC)-mediated cleavage.
[0137] In certain embodiments, the OCA2 modulator inhibits and / or reduces the expression and / or activity and / or stability of OCA2.
[0138] In some embodiments, this inhibition reduces the level of melanin in the iris tissue of the subject.
[0139] In some specific embodiments, the inhibition reduces the average maturation of melanosomes. In some further specific embodiments, the inhibition reduces the average maturation of melanosomes in the iris interstitium.
[0140] In some embodiments, the OCA2 modifier reduces the expression and / or activity and / or stability of OCA2, which in turn lightens the eye color of the subject.
[0141] In some specific embodiments, the at least one OCA2 modulator targets the iris interstitial tissue in question.
[0142] In some further embodiments, the at least one OCA2 modulator targets the interstitial melanocytes of the subject.
[0143] In some other embodiments, the at least one regulator may target at least one cell type from among the pigment epithelium, uvea, choroid, ciliary body, retinal pigment epithelium (RPE), and / or iris pigment epithelium (IPE).
[0144] In some embodiments, the at least one modulator penetrates through the cornea and enters the anterior chamber of the eye.
[0145] In some embodiments, the at least one regulator escapes destruction by the endolysosomal system.
[0146] In some embodiments, the at least one modifier does not activate the immune system.
[0147] One embodiment of the present invention involves the administration of a nucleic acid molecular agent, for example, an RNA-based nucleic acid molecular agent in a “naked” form, or as “free RNA,” for example, “free siRNA.” The naked nucleic acid molecular agent contains no pharmaceutical components. The naked nucleic acid molecular agent, for example, an RNA-based agent, can be included using a suitable buffer solution. The buffer solution may consist of an acetate, citrate, prolamin, carbonate, or phosphate, or a combination thereof (or any other pharmaceutically acceptable carrier). In one embodiment, the buffer solution is phosphate-buffered saline (PBS). The pH and osmotic pressure of the buffer solution containing the nucleic acid molecular agent, for example, an RNA-based agent, can be adjusted to be suitable for administration to the subject. The advantage of the buffer is its ability to maintain a relatively constant pH in the solution. Even when large amounts of acid or base are added, the buffer remains effective in stabilizing the nucleic acid molecular agent, for example, an RNA-based agent, and maintaining its activity. Furthermore, the buffer is non-toxic and does not adversely affect the biological system. Therefore, it is generally considered biocompatible. The buffer is also suitable for large-scale production.
[0148] Alternatively, other embodiments involve delivering molecules via a drug delivery system. The delivery system may facilitate the passage of drugs through physiological and anatomical barriers such as the tear film and corneal layer, or through the scleroconjunctival pathway, improve their stability within tissues (reducing the possibility of degradation of nucleic acid molecules, e.g., RNA-based drugs, by nuclease enzymes), improve drug uptake by cells (primarily iris stromal melanocytes), and increase the rate of endosome avoidance events.
[0149] Modifying nucleic acid molecules, such as RNA-based drugs, or delivering them using a drug delivery system, prevents the nucleic acid molecules from being rapidly degraded in vivo by endonucleases and exonucleases. Modification of nucleic acid molecules or pharmaceutical carriers can also facilitate the targeting of RNA therapeutic compositions to target tissues, increase the likelihood of loading guide strands into RISC, improve in vivo distribution to target tissues, increase stability against RNases, and prevent undesirable off-target effects. In alternative embodiments, OCA2 modifiers, such as nucleic acid molecules, may be delivered via carriers, such as nanoparticles, dendrimers, polymers, liposomes, and LNPs (e.g., cationic nanoparticles or ionizable lipid nanoparticles).
[0150] For example, in the case of RNA-based drugs, the RNA molecule (negatively charged) can attach to a positively charged cationic delivery system, thereby facilitating binding to the negatively charged cell membrane, enhancing the interaction, and leading to efficient uptake by the cell. The RNA molecule can also be bound to cationic lipids, dendrimers, or polymers, or encapsulated in vesicles or micelles (see, for example, Kim S H., et al. (2008) Journal of Controlled Release 129(2):107-116). Furthermore, the formation of vesicles or micelles prevents the degradation of the RNA molecule. The preparation and administration of cationic iRNA complexes are well within the capabilities of those skilled in the art (see, for example, Sorensen, D R., et al. (2003) J. Mol. Biol 327:761-766, Verma, U N., et al (2003) Clin. Cancer Res. 9:1291-1300, and Arnold, AS et al (2007) J. Hypertens. 25:197-205, which are incorporated herein by reference in their entirety).
[0151] Ionizable cationic lipids with pKa values less than 7 were developed due to their rapid clearance from the circulation of charged LNPs after intravenous injection (see, e.g., Rosin et al., Molecular Therapy, vol.19, no.12, pp. 1286-2200, December 2011). When ionizable lipids exhibit a positive charge, negatively charged molecules such as siRNA and oligonucleotides can be loaded onto LNPs at low pH values (e.g., pH 4). At physiological pH values, LNPs have a low surface charge, allowing them to circulate for longer periods without being hindered by immune cells.
[0152] In certain embodiments, the at least one OCA2 modifier is encapsulated within at least one nanocarrier or coated with at least one nanocarrier. In some embodiments, the nanocarrier is at least one lipid nanoparticle (LNP). As used herein, lipid nanoparticles (LNPs) are colloidal systems composed of lipids and other amphiphilic molecules that self-assemble into a nanoscale structure. These nanoparticles are commonly used as delivery systems for various bioactive molecules such as drugs, genetic materials (such as mRNA or DNA), and contrast agents.
[0153] In some more specific embodiments, the at least one LNP comprises ionizable lipid nanoparticles.
[0154] Substances that can be contained within lipid nanocarriers include ionizable lipids, structural lipids, stabilizing lipids, structured lipids, cationic lipids, and lipids that can reduce immunogenicity. All of these components contribute to the overall functionality of the lipid nanocarrier and can be optimized to enhance its performance and efficacy as a drug delivery system.
[0155] In addition to controlling the charge and stability of lipid nanocarriers, ionizable lipid components can facilitate the uptake of nanocarriers by target cells and help evade the endosomal-lysosome system by altering the bilayer structure of the endosomal membrane to a hexagonal phase. Therefore, active ingredients, such as RNA-based molecules or RNAi (or alternatively, DNA-based molecules), can evade disruption and reach the cytosol, where they can exert their effects on their target mRNA (see, for example, Schlich et al., Bioengineering & Translational Medicine 2021 Mar 20;6(2):e10213).
[0156] Ionizable lipids are neutral in a physiological environment (pH 7.4), but they become charged in acidic environments, such as the gradually acidifying endosomal environment. As neutral molecules in physiological environments such as blood, they are less likely to be sequestered by the immune system due to their neutral molecular structure. In addition, as endosomal maturation begins and the environment becomes more acidic, the heads of ionizable lipids become positive and begin to bind to negatively charged lipids exposed on the endosomal membrane. This binding disrupts the original organization of the endosomal membrane, leading to the formation of a non-bilayer hexagonal (HII) structure, triggering membrane fusion and endosomal disruption, and allowing captured nucleic acids to escape.
[0157] A number of ionizable cationic lipids have been investigated, including 1,2-dilineoil-3-dimethylammonium-propane (DLinDAP), 1,2-dilinoleyloxy-3-N,N-dimethylaminopropane (DLinDMA), 1,2-dilinoleyloxy-keto-N,N-dimethyl-3-aminopropane (DLinKDMA), 1,2-dilinoleyl-4-(2-dimethylaminoethyl)-[1,3]-dioxolane (DLinKC2-DMA), and 4-(dimethylamino)-butanoic acid, (10Z,13Z)-1-(9Z,12Z)-9,12-octadecadiene-1-yl-10,13-nonadecadiene-1-yl ester (DLin-MC3-DMA). Studies have shown that LNP siRNA systems containing these lipids exhibit remarkably good gene silencing properties.
[0158] Structural lipids provide the basic structure and shape of lipid nanocarriers. Generally, these consist of mixtures of lipids such as cholesterol, sterols, and steroids. These components together form a distinct and stable structure.
[0159] Lipids that stabilize lipid nanocarriers prevent aggregation and destabilization during storage or circulation. Several types of stabilizing lipids exist, including amphoteric lipids and phospholipids (e.g., phosphatidylcholine, phosphatidylethanolamine, etc.). The examples provided herein are not intended to be exhaustive.
[0160] Nanoparticles designed to reduce immunogenicity are designed to prevent the immune system from responding to lipid nanocarriers, thereby improving the safety and efficacy of drug delivery systems. Examples include lipids, polymer compounds, and polymer-lipid complexes containing immunosuppressive moieties, as well as pegylated lipids having a polyethylene glycol (PEG) region. Any molecular weight can be used for the PEG region. Depending on the embodiment, the PEG region may have molecular weights of 200, 300, 350, 400, 500, 550, 750, 1000, 1500, 2000, 3000, 3500, 4000, or 5000 Da.
[0161] In some cases, additional lipid components may be added to enhance the delivery of the OCA2 modifier of the present invention. Such components can reduce the side effects of the drug or increase its efficacy. These include targeted moieties and cationic lipids.
[0162] These components may increase tissue specificity and enhance drug accumulation at the designated site of action, and lipid nanocarriers may be intricately modified at specific targeting sites. Similar to the use of GalNAc for targeted hepatic delivery, precise ocular targeting may be achieved by utilizing other conjugates that exhibit high affinity for markers intrinsically expressed by stromal melanocytes in the ocular environment. This strategic modification facilitates targeted delivery of the therapeutic agent to the iris, thereby potentially amplifying therapeutic efficacy while simultaneously reducing systemic distribution and associated adverse effects. Through iterative experiments and optimization processes both in vitro and in silico, the selection and proportion of targeting sites and lipid components may be carefully tailored to meet the urgency of ocular delivery, ensuring enhanced specificity and efficacy when targeting stromal melanocytes in the iris. Lipid selection and lipid ratios may be customized and optimized through trial and error in wet lab and in silico experiments.
[0163] Embodiments of the present invention involve the use of an OCA2-modified nucleic acid agent encapsulated in a lipid formulation to form nucleic acid-lipid particles. The particles of the present invention are substantially nontoxic. Nucleic acid-lipid particles and methods for preparing them have been well described in the art.
[0164] In one embodiment, the ratio of lipids to drugs (mass / mass ratio) (for example, the ratio of lipids to dsRNA) is approximately 1:1 to approximately 50:1.
[0165] In some embodiments, further modifications of the OCA2 modifiers of the compositions and methods of the present invention involve chemically linking a drug or delivery system (i.e., a nanoparticle envelope) to one or more ligands, moieties, or conjugates that enhance the activity, cell distribution, or cell uptake of the drug, and anchoring it to target cells.
[0166] Depending on the embodiment, ligands may modify the distribution, targeting, or lifespan of the drug to which they are conjugated. In one embodiment, ligands provide enhanced affinity to specific targets, such as molecules, cells or cell types, compartments, tissues, organs, or regions of the body, in contrast to compounds lacking such ligands. In some embodiments, ligands do not participate in double-strand pairing in the case of double-stranded nucleic acids.
[0167] Ligands can be cell or tissue targeting agents such as antibodies, lectins, glycoproteins, lipids, or lipid-containing molecules. These targeting groups bind to specific types of cells. In addition, ligands can be substances such as drugs that enhance drug uptake by target cells.
[0168] In a preferred embodiment, the targeted ligand may bind to receptors found on the surface of iris melanocytes, such as SCF receptors, WNT receptors, EGFR receptors, catecholamine receptors, histamine receptors, prostaglandin receptors, or any other ligand that directs the drug to the target iris melanocytes.
[0169] Ligands may be proteins, such as glycoproteins, or peptides, such as molecules bound to a colligand, or antibodies, such as antibodies that bind to a specific cell type, such as melanocytes. Hormones and hormone receptors can also act as ligands. In addition, these may also include lipids (such as cholesterol), lectins, carbohydrates, vitamins (such as vitamin E), cofactors, polyvalent lactose, amino acids (such as tyrosine), and non-peptide species.
[0170] Depending on the embodiment, the ligand bound to the drug may function as a pharmacokinetic modulator (PK modulator). There are many types of PK modulators, including lipophilic substances, bile acids, steroids, phospholipid analogs, peptides, protein binders, PEGs, and vitamins. Examples of PK modulators include cholesterol, fatty acids, cholic acid, lithocholic acid, dialkylglycerides, diacylglycerides, phospholipids, sphingolipids, naproxen, ibuprofen, vitamin E, and biotin.
[0171] Oligonucleotides containing a certain number of phosphorothioate links have been shown to bind to serum proteins, and therefore, shorter oligonucleotides containing multiple phosphorothioate links in their backbone (e.g., oligonucleotides of about 5, 10, 15, or 20 bases) can also be used as ligands (e.g., as PK-modulating ligands). Furthermore, aptamers that bind to serum components (e.g., serum proteins) can also be used as PK-modulating ligands in the embodiments described herein.
[0172] The ligand-conjugated oligonucleotides of the present invention can be synthesized, for example, by attaching a linking molecule using oligonucleotides having pendant-reactive functional groups. These reactive oligonucleotides can directly interact with commercially available ligands, ligands synthesized with protecting groups, or ligands supporting the linking portion. In addition, click chemistry and site-directed conjugation techniques provide alternative strategies for ligand attachment. In some embodiments, the at least one OCA2 modulator is administered by ocular administration.
[0173] In some embodiments, the at least one OCA2 modulator is administered by topical administration. In some more specific embodiments, the topical administration is performed on the eye of the subject.
[0174] In a particular embodiment, the at least one OCA2 modifier is included in the eye drop formulation.
[0175] In some embodiments, compositions according to this disclosure are intended for use as cosmetic compositions.
[0176] In a further embodiment, the present invention provides a pharmaceutical composition comprising at least one oculocutaneous albinism 2 (OCA2) protein modulator and at least one pharmaceutically acceptable carrier, diluent, and / or excipient.
[0177] In some embodiments, the pharmaceutical composition is as defined in the earlier aspects of this disclosure relating to the composition.
[0178] The pharmaceutical compositions of this disclosure may include, but are not limited to, formulations comprising solutions, emulsions, and carriers (e.g., nanocarriers). A variety of components, including, but not limited to, pre-formed liquids, self-emulsifying solids, and self-emulsifying semi-solids, can be used to create these compositions. Formulations targeting melanocytes of the iris are particularly preferred.
[0179] The pharmaceutical formulations of the present invention can be prepared in unit dosage form according to conventional methods well known in the pharmaceutical industry. In such techniques, the active ingredient is associated with a pharmaceutical carrier or excipient. The formulations are typically prepared by homogeneously and closely combining the active ingredient with a liquid carrier, a fine powder solid carrier, or both, and then molding them as necessary.
[0180] The compositions of the present invention can be formulated into any of several dosage forms, such as aqueous, non-aqueous, or suspensions in a mixed medium. The viscosity of the aqueous suspension can also be increased by substances such as sodium carboxymethylcellulose, sorbitol, and / or dextran. Stabilizers may also be included in the suspension.
[0181] In some embodiments, OCA2 modulators or any composition containing the same or specific pharmaceutical compositions according to this disclosure may be administered and dispensed systemically, for example intravenously, by the methods of the present invention in accordance with appropriate medical practice. However, it should be noted that this disclosure may further encompass additional modes of administration. In other examples, the drug or any composition thereof or pharmaceutical composition may be introduced to a site by any preferred route, including but not limited to intraocular injection, anterior chamber, intranasal, topical, oral, subcutaneous, intradermal, intravenous, intramuscular administration, and any combination thereof. In some specific embodiments, the drug may be administered topically by eye drops or eye drop formulations.
[0182] As used herein, eye drops, also known as ophthalmic drops or eye medications, are sterile solutions or suspensions administered directly to the eye for cosmetic, therapeutic, diagnostic, or preventive purposes. Eye drop formulations can vary considerably depending on the desired specific outcome or condition being treated. Common types of eye drop formulations include sterile solutions, suspensions of solid particles dispersed in a liquid vehicle, emulsions (i.e., two-phase formulations containing both aqueous and oil phases stabilized with an emulsifier), gels having semi-solid consistency for extended contact time with the ocular surface, and ophthalmic ointments, which are semi-solid preparations containing one or more active pharmaceutical ingredients (APIs) dispersed in a petrolatum base.
[0183] In some embodiments, the OCA2 modulator or any composition containing the same may be administered in any form of administration, such as subconjunctival, intravitreal, anterior chamber, subretinal, or systemic, via the scleral-conjunctival pathway or other pathways found in between.
[0184] In some other embodiments, the administration of OCA2 modulators or any compositions thereof and pharmaceutical compositions may be via depot injection. Depot injections can release the drug in a consistent manner over a long period of time. Therefore, depot injections may reduce the frequency of administration required to obtain the desired effect, such as inhibition of OCA2 or tissue whitening. Depot injections may be intraocular, subcutaneous, or intramuscular injections. In certain embodiments, the depot injection is an intraocular injection.
[0185] In some embodiments, OCA2 modifiers according to this disclosure or any composition containing them, or specific pharmaceutical compositions, may be administered by topical administration. For topical administration, pharmaceutical compositions and formulations may include transdermal patches, ointments, lotions, creams, gels, drops, suppositories, sprays, liquids, and powders. Conventional pharmaceutical carriers, such as aqueous, powdered, or oily bases, thickeners, etc., may be necessary or desired. Suitable topical formulations include those containing OCA2 modifiers addressed in this invention, combined with lipids, liposomes, fatty acids, fatty acid esters, steroids, chelating agents, or surfactants. Suitable lipids and liposomes include neutral ones (e.g., dioleoylphosphatidyl DOPE ethanolamine, dimyristoylphosphatidylcholine DMPC, distearolyphosphatidyl choline), negative ones (e.g., dimyristoylphosphatidylglycerol DMPG), cationic ones (e.g., dioleoyltetramethylaminopropyl DOTAP and dioleoylphosphatidylethanolamine DOTMA), or ionizable ones.
[0186] In some embodiments, an OCA2 modifier according to this disclosure or any composition containing the same or a particular pharmaceutical composition may be formulated in a solution, such as a buffered saline solution such as PBS, or in a gel for topical administration to the eye, such as in the form of eye drops. In such embodiments, the formulation may include viscosity, tonicity, and wetting agents, as well as preservatives, buffers, and lubricants. These include, but are not limited to, cationic emulsions and / or biopolymers (e.g., poly(lactide-co-glycolide), carbopol, hyaluronic acid, and polyacrylic acid).
[0187] In some further embodiments, an OCA2 modifier according to this disclosure or any composition containing the same or a specific pharmaceutical composition may be administered via a controlled drug delivery device, such as a contact lens. In some embodiments, this does not significantly impair or interfere with the patient's vision. The contact lens consists of an optical path through which the wearer's line of sight passes. Furthermore, the contact lens includes a substantially continuous drug delivery zone, which contains at least one drug to be released by the contact lens near the eye.
[0188] In certain embodiments, the compositions or pharmaceutical compositions of the present disclosure may contain an effective amount of the modifier of the present invention. Furthermore, in some further embodiments, the method of the present invention may refer to the administration of an effective amount of the OCA2 modifier or any composition or specific pharmaceutical composition containing it.
[0189] The term “effective dose” refers to the amount of activator present in the composition / pharmaceutical composition, specifically the amount of the OCA2 modifier described herein, required to provide the desired effect, i.e., a physiological response, when such a composition is administered, by providing the desired level of activator in the bloodstream of the target or at the site of action (e.g., the eye). The exact dose depends on numerous factors, such as the active agent, the activity of the composition, optimized stability during storage, safety profile, familiarity with regulatory authorities, the delivery device used, the physical characteristics of the composition, intended patient use (i.e., the number of doses administered per day), patient considerations, etc., and can be readily determined by those skilled in the art based on the information provided herein. The “effective dose” of the OCA2 modifier of the present invention may be administered in a single dose or in multiple doses totaling an effective dose. The effective dose can be determined using standard clinical procedures for determining the appropriate amount and timing of administration. It is understood that the “effective dose” may be the result of empirical and / or individualized (case-by-case) decisions on the part of the treating healthcare professional and / or individual. The activator may be formulated for immediate action or for sustained release.
[0190] In certain embodiments, the OCA2 modifier or any composition thereof and pharmaceutical composition are administered to a subject as a fixed dose. A “fixed dose” (e.g., a dose in mg units) means that one dose of the drug is used for all subjects, regardless of any specific subject-related factors such as age / weight. In other embodiments, the drug of the present invention is administered to a subject as a weight-based dose. A “weight-based dose” (e.g., a dose in mg / kg units) is the dose of the RNA therapeutic agent that will vary depending on the subject's weight.
[0191] In some embodiments, the pharmaceutical composition is intended for use in a method for correcting the eye color of a subject, the method comprising administering to the subject an effective amount of at least one oculocutaneous albinism 2 (OCA2) protein modulator, or any vehicle, matrix, nanoparticles or microparticles thereof, or any composition containing thereof.
[0192] In some further embodiments, the pharmaceutical composition is intended for use in a method of treating a disease / disorder in a subject that requires treatment, the method comprising administering to the subject an effective amount of at least one oculocutaneous albinism 2 (OCA2) protein modulator, or any vehicle, matrix, nanoparticles or microparticles thereof, or any composition containing thereof.
[0193] In yet another aspect, the disclosure provides nucleic acid molecules for modifying the eye color of a subject, comprising at least one oculocutaneous albinism 2 (OCA2) protein modulator.
[0194] In some embodiments, the modifier is at least one gene editing agent adapted to modulate the expression and / or activity and / or stability of OCA2.
[0195] In some embodiments, the nucleic acid molecule includes at least one of single-stranded DNA (ssDNA), single-stranded RNA (ssRNA), double-stranded DNA (dsDNA), double-stranded RNA (dsRNA), a nucleic acid molecule having at least one modified nucleotide, and any combination thereof.
[0196] In some embodiments, the nucleic acid molecule includes at least one of the following: small interfering RNA (siRNA), antisense oligonucleotide (ASO), guide RNA, short hairpin RNA (shRNA), microRNA (miRNA), peptide nucleic acid (PNA), and locked nucleic acid (LNA).
[0197] In some specific embodiments, the nucleic acid molecule comprises at least one siRNA molecule, which encodes OCA2 or targets at least one sequence that directly or indirectly controls the level and / or activity and / or stability of OCA2.
[0198] In some alternative embodiments, the nucleic acid molecule comprises at least one ASO.
[0199] In some embodiments, the nucleic acid molecule targets at least one region in the OCA2 transcript.
[0200] In another embodiment, the nucleic acid molecule targets at least one region in the OCA2 gene.
[0201] In certain embodiments, the nucleic acid molecule targets at least one region in the OCA2 transcript that is sensitive to RNA-induced silencing complex (RISC)-mediated cleavage.
[0202] In some embodiments, nucleic acid molecules inhibit and / or reduce the expression and / or activity and / or stability of OCA2.
[0203] In some embodiments, this inhibition reduces the level of melanin in the iris tissue of the subject.
[0204] In some specific embodiments, the inhibition reduces the average maturation of melanosomes. In some more specific embodiments, the inhibition reduces the average maturation of melanosomes in the iris interstitium.
[0205] In some embodiments, nucleic acid molecules reduce the expression and / or activity and / or stability of OCA2, which in turn lightens the eye color of the subject.
[0206] In some embodiments, the nucleic acid molecule targets the iris interstitial tissue, and / or in specific embodiments, the nucleic acid molecule targets iris interstitial melanocytes.
[0207] In some embodiments, the nucleic acid molecule targets at least one of the following cells: retinal pigment epithelium, uvea, choroid, ciliary body, retinal pigment epithelium (RPE), and / or iris pigment epithelium (IPE).
[0208] In some embodiments, nucleic acid molecules penetrate through the cornea and enter the anterior chamber of the eye.
[0209] In some embodiments, nucleic acid molecules escape destruction by the endolysosomal system.
[0210] In some embodiments, nucleic acid molecules do not activate the immune system.
[0211] In some embodiments, the nucleic acid molecule is encapsulated in at least one nanocarrier or coated with at least one nanocarrier.
[0212] In certain embodiments, nucleic acid molecules are intended for use as a cosmetic composition.
[0213] In a further embodiment, the Disclosure provides a method for treating a disease / disorder in a subject that requires treatment, the method comprising administering to the subject an effective amount of at least one oculocutaneous albinism 2 (OCA2) protein modulator, or any vehicle, matrix, nanoparticles or microparticles thereof, or any composition containing thereof.
[0214] In some embodiments, the disease or disorder is an OCA2-related disorder. As used herein, “OCA2-related disorder” refers to any disorder / disease affected by the expression and / or activity of OCA2 in a subject. For this reason, an OCA2-related disorder may be any disorder in which treatment / prevention / care may benefit from the modulation of OCA2, i.e., an increase or decrease in the expression and / or activity of OCA2. “OCA2-related disorder” may also refer to a disorder in which treatment / prevention / care or related side effects may benefit from the modulation of OCA2. An example of a disorder in which treatment / prevention / care or related side effects may benefit from the modulation of OCA2 is glaucoma, specifically the discoloration of the eye caused by glaucoma drug therapy. Other examples of disorders in which treatment / prevention / care or related side effects may benefit from the modulation of OCA2 are pigmentary ophthalmos and Fuchs’ iridocyclitis.
[0215] In some specific embodiments, the disease may be any one of the following: hyperpigmentation eye disorders, hyperpigmentation, side effects of glaucoma drugs, acquired heterochromia (e.g., due to Horner's syndrome or Fuchs iridocyclitis) and congenital heterochromia (e.g., due to genetic syndromes such as Waardenburg syndrome), bilateral diffuse uveal melanocyte proliferation (BDUMP), ocular nevi (e.g., choroidal nevi), pigment scattering syndromes, ocular melanoma, complexion-associated melanosis, primary acquired melanosis, microplaques, Risch nodules, melanocytoma, ocular / oculocutaneous melanocytosis (e.g., nevus of Ota), and benign ocular growth or any pigmented eye disorder, as well as any pigmented disorder that appears in the eye but is caused by a systemic condition such as Addison's disease.
[0216] In some embodiments, the disease / disorder is an ocular disorder. In some embodiments, the ocular disorder is one of heterochromia iridum, Horner's syndrome, hyperpigmentation, or ocular glaucoma.
[0217] As used herein, the term “pigmented eye disorder” refers to a group of ocular conditions characterized by abnormal pigmentation within or around the eye. These disorders involve the deposition, migration, or distribution of pigmented substances in various ocular tissues, which can affect vision and eye health. Pigmented eye disorders can involve both the anterior and posterior segments of the eye. Common examples of pigmented eye disorders include, but are not limited to, pigment scattering syndrome (PDS), pigmented glaucoma, ocular melanosis, choroidal nevus, and choroidal melanoma.
[0218] In eye disorders, hyperpigmentation refers to the darkening of intraocular or periocular tissues due to increased melanin production or accumulation. This condition can affect various parts of the eye, including the eyelids, conjunctiva, iris, and retina. Hyperpigmentation can be caused by a variety of factors, including inflammation, trauma, genetic predisposition, certain medications, and underlying systemic diseases. In eye disorders, hyperpigmentation can manifest in different forms, such as blepharopigmentation, conjunctival hyperpigmentation, iris hyperpigmentation, and retinal hyperpigmentation.
[0219] Ocular glaucoma is a group of eye diseases characterized by damage to the optic nerve and is often associated with elevated intraocular pressure (IOP). The optic nerve is responsible for transmitting visual information from the eye to the brain. Damage to this nerve can lead to vision loss, and if left untreated, can eventually result in blindness. There are two main categories of glaucoma: open-angle glaucoma and closed-angle glaucoma.
[0220] Open-angle glaucoma is the most common form of glaucoma. In open-angle glaucoma, the angle of the eye remains open, but the trabecular meshwork, which is responsible for draining aqueous humor (fluid) from the eye, becomes less efficient over time. This leads to a gradual increase in intraocular pressure, which can damage the optic nerve.
[0221] In angle-closure glaucoma, the angle of the eye is blocked or narrowed, preventing proper drainage of aqueous humor. This can lead to a sudden increase in intraocular pressure, known as an acute angle-closure attack. This type of glaucoma requires immediate medical attention because, if left untreated, it can cause rapid vision loss.
[0222] As further referenced in this disclosure, the OCA2 modulators of the present invention may mitigate side effects (such as darkening of the eye) caused by pharmaceuticals used to treat glaucoma.
[0223] Horner's syndrome, also known as Horner's syndrome or oculosympathetic palsy, is a rare condition characterized by a specific combination of symptoms resulting from damage to the sympathetic nervous system, typically affecting one side of the face and eye. The syndrome is named after Johann Friedrich Horner, a Swiss ophthalmologist who first described it in 1869. The classic triad of symptoms associated with Horner's syndrome includes ptosis (drooping eyelids), miosis (constricted pupils), and anhidrosis (abstaining of the eyelids).
[0224] Heterochromia iridum, as used herein, is a condition characterized by a difference in coloration of the iris, the colored portion of the eye surrounding the pupil. This can manifest as one iris being a different color from the other (complete heterochromia iridum) or as a variation in color within a single iris (sectoral or partial heterochromia iridum).
[0225] Fuchs heterochromic iridocyclitis (FHI) is a rare chronic inflammatory eye condition that primarily affects the iris (the colored part of the eye) and the ciliary body (the structure behind the iris that produces aqueous humor). It is characterized by a specific combination of symptoms and findings, including heterochromia (a difference in color between the affected and unaffected eyes), anterior chamber inflammation (iritis), and glaucoma. The key features of Fuchs heterochromia iridocyclitis are heterochromia, anterior chamber inflammation (iritis), and glaucoma.
[0226] In some further embodiments, the hyperpigmentation disorder is caused by prostaglandins and / or prostaglandin analogs used for ocular glaucoma.
[0227] In some specific embodiments, the disease / disorder / condition is caused by glaucoma drug therapy, and more specifically, the disease / disorder / condition refers to discoloration of the eye caused by glaucoma drug therapy.
[0228] In some embodiments, the effect is reversible and / or does not kill melanocytes and / or adversely affects pigment production in other tissues of the eye, such as the retinal pigment epithelium.
[0229] In some embodiments, the composition administered according to the therapeutic method of the present disclosure is as defined in the preceding embodiments above.
[0230] In some embodiments, the at least one OCA2 regulator comprises at least one nucleic acid molecule, any vector containing the same, or a host cell.
[0231] As used herein, a vector refers to a nucleic acid molecule into which a specific sequence is inserted, which can be introduced into a host cell and result in the creation of a transformed host cell. A vector may include a nucleic acid sequence, such as an origin of replication, that enables replication in the host cell. A vector may also include one or more selectable marker genes and other genetic elements known in the art, including a promoter element that directs nucleic acid expression. Many vectors useful for transferring nucleic acids into target cells, such as plasmids, cosmids, minicircles, phages, and viruses, may be applicable in the present invention. A nucleic acid-containing vector may be maintained episomalally as, for example, a plasmid, minicircle DNA, a virus such as cytomegalovirus or adenovirus, or it may be incorporated into the target cell genome via homologous recombination or random insertion, for example, via retroviral vectors such as AAV, MMLV, HIV-1, or ALV.
[0232] The vector may be delivered directly to the target cells. In other words, the cells are brought into contact with the vector containing the nucleic acid molecule of the present invention so that the vector is taken up by the cells. Methods for bringing plasmid-like nucleic acid vectors into contact with cells, such as electroporation, calcium chloride transfection, and lipofection, are well known in the art. DNA can be introduced as a naked nucleic acid, as a nucleic acid complexed with a drug such as a liposome or poloxamer, or it can be delivered by a virus (e.g., adenovirus, AAV).
[0233] More specifically, in some embodiments, the vector may be a viral vector. In some specific embodiments, such a viral vector may be any one of the following: recombinant adeno-associated vector (rAAV), single-stranded AAV (ssAAV), self-complementary rAAV (scAAV), Simian vacuolating virus 40 (SV40) vector, adenovirus vector, helper-dependent adenovirus vector, retrovirus vector, and lentiviral vector.
[0234] As shown above, in some embodiments, viral vectors may be applicable in the present invention. The term “viral vector” refers to a viral particle having replication ability or a replication-deficient viral particle that can transfer nucleic acid molecules into a host.
[0235] In some embodiments, the nucleic acid molecules of the present invention may be contained within an adeno-associated virus (AAV). The term "adenovirus" is synonymous with the term "adenovirus vector." AAV is a single-stranded DNA virus with a small (approximately 20 nm) protein capsule belonging to the family Parvoviridae, and specifically refers to viruses of the genus Adenoviridae. The term Adenoviridae collectively refers to animal adenoviruses of the genus Mastadenovirus, including but not limited to the adenovirus subgenuses of humans, cattle, sheep, horses, dogs, pigs, mice, and monkeys. In particular, human adenoviruses include subgenera A to F and their individual serotypes, as well as human adenovirus types 1, 2, 3, 4, 4a, 5, 6, 7, 8, 9, 10, 11 (AdllA and Ad IIP), 12, 13, 14, 15, 16, 17, 18, 19, 19a, 20, 21, 22, 23, 24, 25, 26, 27, 28, 29, 30, 31, 32, 33, 34, 34a, 35, 35p, 36, 37, 38, 39, 40, 41, 42, 43, 44, 45, 46, 47, 48, and 91, but are not limited to subgenera A to F.
[0236] In some further embodiments, HDAd vectors may be suitable for the methods of the present invention. The Helper-Dependent Adenoviral (HDAd) vector HDAd has innovative features, including the complete absence of viral coding sequences and the ability to mediate high levels of transgene expression with minimal chronic toxicity. HDAd is constructed by removing all viral sequences from the adenovirus vector genome, except for the packaging sequence and reverse terminal repeats, thereby eliminating the problem of residual viral gene expression associated with early-generation adenovirus vectors.
[0237] Furthermore, in some embodiments, SV40 may be used as a suitable vector for the present invention. The SV40 vector (SV40) is a vector derived from a modification that gave icosahedral papovavirus to simian virus-40. Recombinant SV40 vectors are good candidates for gene transfer because they exhibit several distinctive features: SV40 is a well-known virus, non-replicating vectors are easy to produce and can be produced with a titer of 10(12) IU / ml. They also efficiently transduce both resting and dividing cells, deliver sustained transgene expression to a wide range of cell types, and are non-immunogenic. Current drawbacks of rSV40 vectors for gene therapy are their low cloning capacity and the potential risks associated with the random incorporation of the viral genome into the host genome.
[0238] In certain embodiments, a suitable vector that may be used by the present invention may be a retroviral vector. A retroviral vector consists of a proviral sequence capable of accommodating the gene of interest, enabling both integration into the target cell. The vector may also contain a viral and a cellular gene promoter to enhance the expression of the gene of interest in the target cell. The retroviral vector is stably integrated into the target cell genome during division so that the introduced gene is passaged and expressed in all daughter cells. They contain a reverse transcriptase that enables integration into the host genome.
[0239] Furthermore, in some alternative embodiments, lentiviral vectors may be used in the present invention. Lentiviral vectors are derived from lentiviruses, a subclass of retroviruses. Commonly used retroviral vectors are "deficient," meaning they cannot produce the viral proteins necessary for proliferative infection. Methods for introducing retroviral vectors containing the nucleic acid molecules of the present invention into target cells are well known in the art.
[0240] In some alternative embodiments, the vector may be a nonviral vector. More specifically, in some embodiments, such a vector may be one of a plasmid, a minicircle, and linear DNA.
[0241] According to the present invention, non-viral vectors refer to all physical and chemical systems other than viral systems, and generally include any of the following: chemical methods such as cationic liposomes and polymers, or physical methods such as gene guns, electroporation, particulate guns, ultrasound utilization, and magnetofection.
[0242] For example, physical methods applied to in vitro and in vivo gene delivery are based on the transient penetration of the cell membrane by mechanical, electrical, ultrasonic, hydrodynamic, or laser-based energy to facilitate the entry of DNA into the target cell.
[0243] In a more specific embodiment, the vector may be a naked DNA vector. More specifically, such a vector may be, for example, a plasmid, a minicircle, or linear DNA.
[0244] It is understood that all DNA vectors disclosed herein may also be applicable to all different embodiments of the present invention.
[0245] It should be understood that the present invention further provides any vector or vehicle containing any of the nucleic acid molecules disclosed herein, as well as any host cell expressing any nucleic acid molecule disclosed herein.
[0246] In some embodiments, the at least one nucleic acid molecule or any vector or host cell containing it is as described in the earlier aspects of the disclosure described above.
[0247] This disclosure also relates to any vector comprising the nucleic acid molecule as defined above, and any host cell comprising such vector.
[0248] In some embodiments, the at least one OCA2 modulator is administered by ocular administration.
[0249] In some embodiments, the at least one OCA2 modulator is administered topically and / or, in some specific embodiments, into the eye of the subject.
[0250] In a particular embodiment, the at least one OCA2 modifier is included in the eye drop formulation.
[0251] In further embodiments, the Disclosure provides at least one oculocutaneous albinism 2 (OCA2) protein modulator, or any vehicle, matrix, nanoparticles or microparticles thereof, or any composition comprising them, for use in a manner in which a disease / disorder needs to be treated, the manner comprising administering an effective amount of the at least one OCA2 protein modulator to the subject.
[0252] It should be noted that all of the aforementioned embodiments relating to methods for treating the diseases / disorders defined above are also applicable to this aspect of the Disclosure relating to OCA2 modifiers for use in accordance with the Disclosure.
[0253] The terms “to treat,” “to treat,” and “treatment,” or their forms, as used herein, should be understood to mean preventing, enhancing, or delaying the onset of one or more clinical signs of disease activity in a subject with a pathological disorder. Treatment refers to a therapeutic procedure. Those in need of treatment are subjects suffering from a pathological disorder. Specifically, providing “preventive treatment” (for prevention) or “protective treatment” acts protectively against or to prevent something, particularly a condition or disease.
[0254] As used herein, the term “treatment or prevention” refers to the full range of therapeutically positive effects of an administration to a subject, including the inhibition, reduction, mitigation, and reduction of conditions, diseases, and signs thereof, as well as their symptoms or undesirable side effects, and cosmetic difficulties that the patient desires to be altered. More specifically, treatment or prevention of relapse or recurrence of a disease includes preventing or delaying the onset of the disease, preventing or delaying the onset of symptoms, and / or reducing the severity of such symptoms that have developed or are expected to develop. These further include improving existing symptoms, preventing further symptoms, and improving or preventing the underlying causes of symptoms.
[0255] As described above, the methods and compositions provided by the present invention may be used for the treatment of “pathological disorders,” which refer to any abnormal physical or mental condition that interferes with normal function, causing discomfort, dysfunction, or distress to the affected person or those in contact with that person. It should be noted that the terms “disease,” “disorder,” “condition,” and “illness” are used equally herein.
[0256] It should be understood that any of the methods and compositions described herein may be applicable to treat and / or improve any of the disorders disclosed herein or any conditions associated therewith. The terms “associated,” “linked,” and “associated,” used interchangeably herein, should be understood to mean, when referring to a pathological condition herein, at least one of which is a disease, disorder, condition or any pathological condition that shares a causal relationship, coexists more frequently than by chance, or causes a second disease, disorder, condition or pathological condition. More specifically, as used herein, “disease,” “disorder,” “condition,” “pathological condition,” etc., are used interchangeably because they relate to the health or cosmetic preferences of the subject, e.g., undesirable ocular pigment lesions, acquired or congenital heterochromia iridums, and each and all of such terms have meaning.
[0257] This invention relates to the treatment of subjects or patients in need of treatment. “Patient,” “subject,” or “subject in need” means any organism that may be affected by the above-mentioned conditions and for which the treatment and preventive methods described herein are desirable, including humans, livestock and non-livestock mammals, e.g., dogs and cats, cattle, monkeys, horses, and rodents, specifically mouse subjects. More specifically, the methods of this invention are intended for mammals. “Mammalian subject” means any mammal for which the proposed therapy is desirable, including humans, livestock, horses, dogs, and cats, most specifically humans. Therefore, the term “subject” is intended to refer to any animal, human or non-human, preferably a vertebrate, more preferably a mammal. Subjects may include transgenic organisms. It is most preferable that the subject be human.
[0258] As used herein, the term “approximately” indicates a value that may deviate from the stated value by up to 1%, more specifically 5%, more specifically 10%, more specifically 15%, and in some cases up to 20%, and the deviation range includes integer values, and where applicable, non-integer values also constitute a continuous range. As used herein, the term “approximately” means ±10%.
[0259] The indefinite articles "a" and "an" used herein and in the claims should be understood to mean "at least one" unless explicitly stated otherwise. It should be noted that, as used herein and in the appended claims, the singular forms "a," "an," and "the" refer to multiple things unless explicitly stated otherwise by the context.
[0260] As used herein and in the claims, the phrase “and / or” should be understood to mean “either or both” of the elements thus combined, i.e., elements that are sometimes conjunctive and sometimes disjunctive. Any multiple elements listed in “and / or” should similarly be interpreted as “one or more” of the elements thus combined. Other elements besides those specifically identified by the “and / or” clause may exist at their discretion, whether related to or unrelated to those specifically identified elements. Therefore, as a non-restrictive example, a reference to “A and / or B,” when used in conjunction with open-ended language such as “comprising,” could refer in one embodiment to A only (optionally including elements other than B), in another embodiment to B only (optionally including elements other than A), in yet another embodiment to both A and B (optionally including other elements), and so on.
[0261] Where used herein and in the claims, “or” should be understood to have the same meaning as “and / or” as defined above. For example, when separating items in a list, “or” or “and / or” shall be interpreted as inclusive, that is, including at least one of multiple elements or lists of elements, but also including two or more, and optionally including additional unlisted items. Only terms that are explicitly indicated as the opposite, such as “one of ~” or “exactly one of ~” or, where used in the claims, “consisting of ~,” refer to including exactly one element of multiple elements or lists of elements. In general, where used herein, the terms “or” such as “either,” “one of ~,” “one of ~,” or “exactly one of ~,” “essentially consisting of ~,” shall be interpreted only as indicating an exclusive choice (i.e., “one or the other, but not both”) when preceded by a term of exclusivity, and where used in the claims, shall have the usual meaning as used in the field of patent law.
[0262] As used herein and in the claims, the phrase “at least one” with respect to a list of one or more elements means at least one element selected from any one or more of the elements in the list of elements, but not necessarily including at least one of every element specifically enumerated in the list of elements, nor excluding any combination of elements in the list of elements. This definition also allows for the presence of elements other than those specifically identified in the list of elements referred to by the phrase “at least one,” whether related to those specifically identified elements or not, at the discretion of the system. Therefore, as a non-restrictive example, "at least one of A and B" (or equivalently, "at least one of A or B", or equivalently, "at least one of A and / or B") may refer to, in one embodiment, at least one type, optionally including two or more A's and no B (optionally including elements other than B); in another embodiment, at least one type, optionally including two or more B's and no A (optionally including elements other than A); and in yet another embodiment, at least one type of A, optionally including two or more, and at least one type of B, optionally including two or more (and optionally including other elements).
[0263] Furthermore, unless explicitly stated otherwise, in any method claimed herein that includes two or more steps or actions, the order of the steps or actions of the method is not necessarily limited to the order in which the steps or actions of the method are enumerated.
[0264] Throughout this specification and the following examples and claims, all transitional phrases such as “comprising,” “including,” “carrying,” “having,” “containing,” “involving,” “holding,” and “composed of” should be understood to be open-ended, meaning that they include but are not limited to them. Specifically, it should be understood that they include the integers or processes or groups of integers or processes mentioned, but not to exclude any other integers or processes or groups of integers or processes. As described in the United States Patent Office Manual of Patent Examining Procedures, only the transitional phrases “consisting of” and “consisting essentially of” are closed or semi-closed transitional phrases, respectively. More specifically, the terms “comprises,” “comprising,” “includes,” “including,” and “having,” and their conjugations, mean “including but not limited to.” The term "consisting of" means "including and limited to." The term "consisting essentially of" means that the composition, method, or structure may include additional components, steps, and / or parts, but only if the additional components, steps, and / or parts do not substantially alter the basic and novel features of the claimed composition, method, or structure.
[0265] It should be noted that various embodiments of the present invention may be presented in range form. It should be understood that range form is merely for convenience and brevity and should not be interpreted as an inflexible limitation to the scope of the invention. Therefore, a range description should be considered to include all possible subranges specifically disclosed and the individual numerical values within those ranges. For example, a range description such as 1–6 should be considered to specifically disclose subranges such as 1–3, 1–4, 1–5, 2–4, 2–6, 3–6, and the individual numbers within those ranges, e.g., 1, 2, 3, 4, 5, and 6. This applies regardless of the breadth of the range. Whenever a numerical range is shown herein, it is understood to include any cited digits (fractions or integers) within the indicated range. The phrases "ranging / ranges between" the first indicated number and the second indicated number, and "ranging / ranges from" the first indicated number to the second indicated number, are used interchangeably herein and mean to include the first and second indicated numbers as well as all fractions and integers in between.
[0266] As used herein, the term “method” means a mode, means, technique and procedure for accomplishing a given task (including, but not limited to, modes, means, techniques and procedures known to practitioners of the chemical, pharmacological, biological, biochemical and medical fields, or readily developed from known modes, means, techniques and procedures).
[0267] For clarity, certain features of the Invention described in the context of separate embodiments may be provided in combination in a single embodiment. Conversely, various features of the Invention described in the context of a single embodiment for brevity may also be provided separately, in any preferred subcombination, or as suitable for any other described embodiment of the Invention. Certain features described in the context of various embodiments should not be considered essential features of those embodiments unless the embodiments are inoperable without those elements.
[0268] The various embodiments and aspects of the present invention described herein above and claimed in the following claims section are supported by experiment in the following examples.
[0269] While disclosed and described herein, it should be understood that the present invention is not limited to the specific examples, processes, and compositions disclosed herein, and that such processes and compositions may be subject to some variation. It should also be understood that the scope of the present invention is limited only by the appended claims and their equivalents, and that the terms used herein are used solely for the purpose of describing specific embodiments and are not intended to limit them.
[0270] The following examples are representative examples of techniques used by the inventors when carrying out aspects of the present invention. While these techniques are illustrative of preferred embodiments for carrying out the present invention, it should be understood that those skilled in the art will recognize that many modifications can be made in consideration of this disclosure without departing from the spirit and intended scope of the invention. [Examples]
[0271] Without further detail, those skilled in the art will likely be able to make the most of the present invention using the description above. Therefore, the following preferred specific embodiments should be interpreted as merely illustrative and not to limit the present invention as described in the claims.
[0272] Experimental Procedure Melanin absorbance quantitative reagent The following materials and reagents were used: melanin (Sigma, catalog number M0418), ammonium hydroxide (Sigma, catalog number 09859), Dulbecco Modified Eagle Medium (DMEM) (Biowest, catalog number L0102-500), fetal bovine serum (FBS) (Gibco, catalog number 10270-106), penicillin / streptomycin (Pen / Strep) (Gibco, catalog number 15140-122), standard 96-well plate (Greiner, catalog number 655101), UV-star 96-well plate (Greiner, catalog no. 675801), B16-F10 mouse melanoma cells (ATCC, catalog no. CRL-6475), 0.25% trypsin-EDTA (Gibco, catalog no. 25200-072), phosphate-buffered saline (PBS) (Sartorius, catalog no. 02-023-1A), trypan blue (Sigma, catalog no. T8154), T75 flask (Greiner, catalog no. 658170), Nunclon Delta 6-well plate (Thermo, catalog no. 140675), ViewPlate white 96-well plate with clear bottom (Perkin Elmer, catalog no. 6005181), and CellTiter-Glo (Promega).
[0273] Cell Titer Glo Assay The CellTiter-Glo® buffer was thawed, equilibrated to room temperature before use, and stored at 4°C for up to 48 hours. The lyophilized CellTiter-Glo® substrate was brought to room temperature. 10 ml of CellTiter-Glo® buffer was added to the substrate to form the CellTiter-Glo® reagent, which was stored at -20°C when not in use. After 72 hours of incubation, the plate was brought to room temperature for approximately 30 minutes. 100 μl / well of CellTiter-Glo® reagent was added. The plate was shaken on an orbital shaker for 2 minutes to lyse cells. The plate was incubated at room temperature for 10 minutes to stabilize the luminescence signal. Luminescence was recorded using a Clariostar BMG plate reader with an integration time of 1 second per well.
[0274] siRNA transfection and qPCR mRNA (OCA2) in B16-F10 melanoma cells B16-F10 mouse melanoma cells (ATCC CRL-6475) were cultured in DMEM supplemented with FBS and Pen / Strep and passaged using 0.25% trypsin-EDTA. The transfection process involved various test items, including three different OCA2 siRNAs and control siRNAs (scrambled siRNA and GAPDH siRNA (Thermo-Fisher)). The transfection control included untransfected cells and cells treated with Block-iT.
[0275] For 6-well plates, seeding concentrations of 250,000 and 300,000 cells / well were used in expression experiments, reaching 60-80% confluence after 24 hours. The culture medium was changed every 2-3 days. For 96-well plates, seeding concentrations of 7,500 and 10,000 cells / well were used.
[0276] Cell transfection using OptiMEM-lipofectamine The transfection protocol involved preparing an OptiMEM-lipofectamine mixture in a 1.5 ml Eppendorf tube, followed by a master mixture of mRNA in a separate Eppendorf tube. Diluted Lipofectamine RNAiMax reagent was then added to each tube of diluted RNA in a 1:1 ratio. This mixture was incubated at room temperature for 5 minutes before being added to the cells (250 μl / well). The cells were then incubated at 37°C in a 5% CO2 environment. Following transfection, cells were collected at 24 hours for FACS analysis and microscopic observation, and at 48 hours for RNA extraction.
[0277] Transfection of iris samples using OptiMEM-lipofectamine siRNA and lipofectamine were pre-incubated with Opti-MEM to achieve final concentrations of 50 nM for siRNA and 5 μl / ml for lipofectamine. After pre-incubation, 100 μl of siRNA-lipofectamine solution was added to wells containing irises in 500 μl of culture medium. Transfection was performed with a final volume of 600 μl.
[0278] Transfection-controlled microscopy and FACS using BLOCK-iT Lipofectamine RNAiMax (Thermo, catalog number 13778-030) and Block-iT fluorescent oligo (Thermo, catalog number 2013) were diluted separately in OptiMEM (Gibco, catalog number 31985-047). The two solutions were then mixed in a 1:1 ratio and incubated at room temperature for 5 minutes. The RNA-lipid complex was added to cells at a volume of 250 μl per well for 6-well plates and 10 μl per well for 96-well plates. After transfection, cells were incubated at 37°C and evaluated using a fluorescence microscope after 3–6 hours, and using both a fluorescence microscope and flow cytometry (FACS) after 24–48 hours.
[0279] Survival test after transfection Cell survival was evaluated using the Cell Titer Glo assay (Promega) 24 hours after transfection.
[0280] FACS analysis was performed to evaluate transfection efficiency. Cells were washed with PBS, trypsinized, resuspended in growth medium, and then transferred to a 96-well U-bottom plate for analysis.
[0281] RNA extraction and PCR B16-F10 cell pellets were resuspended in TRI Reagent® according to the cell number (100 μl for 10^5 cells or less, 300 μl for 10^6 cells or less, and 600 μl for 5*10^6 cells or less). All samples were standardized to 300 μl with TRI Reagent®. RNA purification: The lysed samples were mixed with an equal volume of 95–100% ethanol and transferred to a Zymo-Spin® IICR column for centrifugation. After DNase I treatment of the column, it was washed with RNA Wash Buffer and Direct-zol® RNA PreWash. RNA was eluted with DNase / RNase-free water and its concentration and purity were measured using a Nanodrop. Reverse transcription of RNA into cDNA was performed as described above.
[0282] Preparation and analysis of mouse ex vivo iris explants The ethical approval of the study design and ethical considerations was granted by the Committee for Ethical Conduct in the Care and Use of Laboratory Animals. This study adheres to the Animal Welfare Law (Animal Studies)-1994 (State of Israel), the Guide for the Care and Use of Laboratory Animals by the Institute of Laboratory Animal Research (ILAR), and the Guidelines of the National Institute of Health (NIH).
[0283] This experiment utilized an ex vivo iris model of C57BL / 6JOlaHsd & DBA2 / J mice. The mice were supplied by Envigo CRS (Israel) LTD. They were specific pathogen-free (SPF). Approximate age: 1-2 months.
[0284] Microscopic dissection of iris specimens: Mice were anesthetized with a ketamine / xylazine mixture and then euthanized. A stereoscopic dissection microscope with a cold light source was used for eye dissection to minimize glare and reflection.
[0285] The iris was dissected as follows: fix the extracted eyeball; make an incision at the corneal margin for entry; separate the eye into anterior and posterior segments and separate the outer periphery; identify and dissect the neuroretina from the posterior cup; make an incision behind the limbus using a sharp razor blade; continue the incision around the eyeball with curved iris scissors; gently remove the lens using fine forceps; create a pie-shaped wedge from the anterior segment; remove the excess sclera, choroid, and retina behind the ciliary body; grasp the center of the cornea with fine forceps and a Tooke knife; break the adhesion between the iris and ciliary body and between the cornea and sclera; transfer the isolated iris-ciliary body fragments to a 24-well plate containing culture medium.
[0286] Culture and viability evaluation of iris samples Culture media and supplements: TC DMEM F12 (Gibco, catalog number 11320074), Pen / Strep (Gibco, catalog number 15140-122), sodium pyruvate (Sartorius, catalog number 03-042-1B), NEAA (Gibco, catalog number 11140-035), FBS (Gibco, catalog number 10270-106), B27 (Gibco, catalog number 17507-044). • Medium A: Contains 10% FBS, 1x NEAA, 1x sodium pyruvate, and 1x Pen / Strep, DMEM F12 • Medium B: Contains 20% FBS, 1x NEAA, 1x sodium pyruvate, and 1x Pen / Strep, DMEM F12 • Medium C: Contains 1x B27, 1x NEAA, 1x sodium pyruvate, and 1x Pen / Strep, DMEM F12
[0287] For the survival test: PrestoBlue® Cell Viability Reagent / 25ml (Rhenium, catalog number A13261) was used.
[0288] Washing protocol: Each iris was transferred to three wells containing sterile culture medium for decontamination.
[0289] Next, one iris was immersed in 70% EtOH for 10 minutes, then washed to obtain a non-viable iris.
[0290] Survival quantification: Presto Blue reagent was warmed to room temperature. 35 μl of Presto Blue was added to the iris in the culture medium. 25 μl of Presto Blue was added to the culture medium. Incubated at 37°C for 2.5 hours. Twelve mouse irises were incubated in 100 μl of medium containing 10% Presto Blue for 2.5 hours. After incubation, 50 μl of each sample was transferred to a black 96-well plate. Absorbance and fluorescence intensity were measured.
[0291] SOX10 knockdown in iris samples Mouse irises collected as described herein were used in this study. The irises were maintained in culture medium A. Various test items were used for the transfection process, including SOX10 siRNA with the following nucleotide chain sequence: Sense: 5'-AGCCAGUAUAUACGACUCUAUCCCG-3', as shown by Sequence ID No. 76, and Antisense: 3'-CGUCGGUCAUAUAUGCUGAGAUAGGGC-5', as shown by sequence number 77. Iris samples treated with scrambled siRNA from Thermo-Fisher (catalog-4390843) were used as negative controls.
[0292] The transfection protocol involved preparing an OptiMEM-lipofectamine mixture in a 1.5 ml Eppendorf tube, followed by a master mixture of mRNA in a separate Eppendorf tube. Diluted Lipofectamine RNAiMax reagent was then added to each tube of diluted RNA in a 1:1 ratio. This mixture was incubated at room temperature for 5 minutes before being added to the iris (100 μl / well). The irises were then incubated at 37°C in a 5% CO2 environment. The medium was replaced 24 hours after transfection. 48 hours after transfection, the irises were collected for RNA extraction.
[0293] RNA extraction from iris samples Some of the reagents used included the DirectZol RNA Miniprep Kit (Zymo Research, catalog number R2053) containing Tri-reagent, Absolute Ethanol (Gadot), Maxima First Strand cDNA Synthesis Kit (Thermo Fisher), Ultrapure Water (Thermo Fisher), Taqman Fast Advanced Master Mix (Thermo Fisher), and PrimeTime Gene Expression Master Mix (IDT).
[0294] For transfection experiments, eight iris tissues were collected from DBA mice. The experimental group was treated with Sox10-siRNA, and the control group was administered scrambled siRNA. SOX10 expression was evaluated 48 hours after transfection. In addition to the eight transfected irises, several other irises were collected, immediately processed for RNA extraction, and their SOX10, GAPDH, and OCA2 expressions were also evaluated without transfection to optimize the RNA extraction process.
[0295] During homogenization and RNA extraction, iris samples were treated with TriReagent and stainless steel beads using a homogenizer set to speed 10 for 3 / 1-minute cycles each. This procedure facilitates subsequent RNA extraction using a column-based kit, strictly following the manufacturer's guidelines. The purity and concentration of the extracted RNA were evaluated using a NanoDrop spectrophotometer. The extraction process was performed using pooled iris samples to increase the amount of RNA.
[0296] Targeted depigmentation of iris interstitial melanocytes in mammals ·Ethics committee approval This study was initiated in accordance with the approval from the Committee for Ethical Conduct in the Care and Use of Laboratory Animals, ensuring compliance with relevant regulations.
[0297] ·Compliance with animal welfare This study ·followed the Animal Welfare Law (Animal Studies) (State of Israel) of 1994, ·and adhered to the ILAR Guide for the Care and Use of Laboratory Animals.
[0298] ·NIH guidelines: supply and documentation The clinical trial applicant provided the test item, storage solution, and special materials along with a comprehensive document covering safety instructions for sample handling, storage, and item identification.
[0299] ·Storage solution and test item materials The storage solution and test items were supplied by Invitrogen and Gibco, and were meticulously catalogued, taking products such as BLOCK-iT™ Alexa Fluor® Red Fluorescent Oligo, Invivofectamine® 3.0 Starter Kit, and Lipofectamine® RNAiMAX Reagent OCA2-siRNA provided by IDT and Thermo-Fisher for example.
[0300] ·Test item preparation / formulation ·Preparation of Invivofectamine® 3.0-Block-iT complex: The preparation involves mixing BLOCK-iT™ Alexa Fluor® with Opti-MEM® medium and then complexing it with the Invivofectamine® 3.0 reagent. The mixture is incubated, diluted, and stored appropriately before in vivo delivery. • Preparation of Lipofectamine-Block-iT complex: This process begins with the preparation of the Block-iT solution, followed by dilution of the Lipofectamine® RNAiMAX reagent, followed by mixing and incubation to form the Lipofectamine® RNAiMAX-Block-iT complex for delivery. Preparation of Lipofectamine-OCA 2-siRNA complex: Add diluted Lipofectamine RNAiMAX reagent to each tube of diluted RNA (1:1 ratio).
[0301] • Group assignment and administration Animals will be assigned to groups based on body weight to ensure a uniform treatment group. The test item will be administered via intravitreous (IVT) or anterior chamber (AC) injection, using an anesthetic protocol detailed for each procedure. Grouping for IVT and AC injections will be described, along with the use of specific instruments for microsurgical procedures.
[0302] This study systematically organizes subjects into specific groups, each distinguished by different dosages, administration routes, and test items used to evaluate the effects on dissected iris specimens. Subjects are designated to receive either Invivofectamine® 3.0-Block-iT or Lipofectamine® RNAiMAX via intravitreous (IVT) or anterior chamber (AC) injection over a range of dosages. Each experimental group includes two subjects, with the exception of the last two control groups, each consisting of only one subject after placeholder treatment (TBD). This setup facilitates thorough examination of effects under various conditions and significantly enriches the test results.
[0303] • Anatomy of the iris: The final phase of the test, conducted 24 hours after administration of the test item, involves anesthetizing the animals with a ketamine / xylazine mixture followed by euthanasia. Eye dissection is performed using a stereoscopic dissection microscope equipped with a cold light source to minimize glare and reflection from metal dissection instruments. The detailed steps of the dissection process outlined in the previous description of the ex vivo case are followed meticulously to ensure accurate examination and analysis of the iris specimen.
[0304] Intravitreal injection procedure: This procedure begins by creating a micropuncture in the conjunctiva of the mouse eye using a 31-gauge needle positioned approximately 1.0 mm into the lateral sclera from the corneal margin at the ciliary body squamous level. This initial step ensures a slight vitreous protrusion to lower intraocular pressure before the IVT injection. To avoid causing traumatic cataracts, the microneedle is inserted into the vitreous humor at a 45° angle. The test item / vehicle is then slowly injected at a controlled rate using a Hamilton syringe for intraocular injection (GA33-34) to achieve a successful unilateral IVT injection. Following the injection, after a short pause, the needle is carefully withdrawn from the site.
[0305] Anterior chamber (intracameral) injection procedure: Similarly, a micropuncture is performed on the cornea using a 31-gauge needle approximately 1.0 mm into the anterior chamber from the corneal margin, and AC injection is initiated. To prevent traumatic cataracts, the microneedle is carefully inserted into the anterior chamber, and then, for a successful unilateral AC injection, the test item / vehicle is slowly injected using a Hamilton syringe for intraocular injection (GA33-34). The needle is then slowly and carefully removed from the injection site.
[0306] Optical microscope: Fix the iris sample or the entire eye in buffered formalin and prepare the tissue specimen for paraffin embedding. Prepare standard 5-micrometer sections and place them on glass slides. Prepare parallel sections for hematoxylin-eosin (HE) staining for histopathological evaluation. Examine the stained slides under a microscope and evaluate them using a commercially available Fontana Mason staining kit.
[0307] Transmission electron microscopy (TEM) preparation: The iris and retina were washed with 1 TBS and placed in 10%, 20%, and 30% gradient sucrose solutions prepared in 1 pin, then cryogenically embedded. The tissue was then embedded in cryogenic embedding solution, frozen in liquid nitrogen, and kept at -20°C until further processing. Sections were cut to a thickness of 10 mm using a Leica cryotome CM1860.
[0308] Pre-TEM embedding: After 48 hours of incubation, transfected and control cells are collected and washed three times with 0.1 M phosphate buffer. These cells are primary fixed for 4 hours with a fixation solution containing 4% paraformaldehyde and 1% gluteraldehyde in 0.1 M phosphate buffer, followed by secondary fixation with 1% osmium tetroxide at 4°C for 1 hour. Subsequently, dehydration is performed by increasing the concentration of ethyl alcohol, i.e., 50%, 70%, 80%, and 90% for 10 minutes each, 95% for 15 minutes twice, and finally 100% for 1 hour. After this step, the samples are treated with propylene oxide for 15 minutes. The samples are embedded using Embed 812, a commercially available fast-setting epoxy adhesive containing epoxy resins (mixtures A and B) and 1.4% DMP-30. Mixture A contained Embed 812 (EMS) and dodecyl succinic anhydride, while mixture B contained Embed 812 (EMS) and nadic methyl anhydride. Hexylene glycol (HG) and resin (R) were combined in a 1:2 ratio, added to a plate, and mixed on a rotor for 2 hours. Next, the resin and hexylene glycol were mixed in a 2:1 ratio for 2 hours, and the resin and hexylene glycol were replaced with 100% resin, and mixed at 60°C for 6 hours, or 3 days. Then, ultrathin sections of the sample were obtained using an ultramicrotome (MTX ULTRAMICROTOME). The specimens were treated with uranyl acetate and lead citrate for 30 minutes and 15 minutes, respectively.
[0309] Illumination and imaging of iris samples All samples (both treatment and control groups) were exposed to a 9W 6500K LED light source located at a distance of 8.5 cm, a distance previously verified as non-harmful to incubated iris samples in previous studies. This proximity was shown not to alter the temperature surrounding the samples, and the constant light exposure protocol was based on previous evidence demonstrating its safety and effectiveness in maintaining the integrity and health of iris samples during testing. Exposure to this specific lighting was continuous throughout the experimental period, with brief interruptions for essential procedures such as photography, viability assessment, and transfection substance administration.
[0310] Imaging was performed at baseline and on day 14 of the experiment (3 days after the fourth transfection, and immediately before fixation and processing for histological evaluation) using a Panasonic Lumix G9 camera equipped with a Laowa 25mm f / 2.8 Ultra Macro 2.5-5x lens. Both backlight and ambient lighting conditions were strictly controlled in terms of their intensity and Kelvin (both 6500K, mimicking the hue of daylight). Photographs were taken at f / 16, ISO 200, and shutter speed 4”. All other photographic parameters, including indoor ceiling light, camera and iris position, vapor level on the plate seal, and proximity to other light sources, were standardized.
[0311] Example 1 Targeting of the OCA2 gene Since the reduction in OCA2 protein levels and the downstream consequences in iris melanocytes and iris tissue are natural in people born with light-colored eyes, targeting OCA2 gene expression makes it possible to achieve the most aesthetically natural results, comparable to those of people born with blue eyes.
[0312] The advantages of this approach are enhanced when compared to the reduction of OCA1 expression and its downstream consequences. OCA1 gene inhibition results in a reduction of tyrosinase enzyme, as well as a reduction in pigment in the retinal pigment epithelium (RPE) and iris pigment epithelium (IPE). This can lead to vision loss and other negative consequences. In contrast to the majority of blue-eyed individuals who inherit mutations that reduce OCA2 expression and are generally healthy with good vision, individuals with light-colored eyes due to reduced tyrosinase activity and OCA1 gene expression suffer from health problems (such as those seen in albinos with red irises and vision loss).
[0313] In this method, large molecules are delivered as eye drops that, for example, penetrate through the cornea, enter the anterior chamber of the eye, efficiently penetrate iris interstitial melanocytes, and evade destruction by the endolysosomal system without damaging other cells or activating the ocular immune system. In addition, biologically targeted therapies are presented to reduce pigmentation in human and animal iris melanocytes both in vivo and in vitro. Furthermore, this method can be delivered as eye drops and includes siRNA and / or antisense oligonucleotides that specifically target pigment production in the iris interstitial. Moreover, this treatment does not affect other ocular functions and does not trigger the immune system. It remains in the anterior chamber of the eye for extended periods without degradation. Furthermore, because the silencing effect of the RNA therapy is temporary, pigment is gradually reformed when treatment is stopped. As a result, a reversible change in eye color occurs without killing melanocytes or adversely affecting pigment production in other tissues of the eye, such as the important retinal pigment epithelium.
[0314] In IPE and RPE cells, regulation of OCA2 does not result in complete cessation of melanosome maturation, as it does in stromal melanocytes. Therefore, OCA2 silencing has little to no effect on the level of pigmentation in these cells. In contrast, tyrosinase inhibition of OCA1 silencing has a significant effect on pigmentation in these cells. First, histological examination using light and electron microscopy shows that the level of pigmentation within IPE does not differ significantly between individuals with blue eyes (whose cells are known to have low OCA2 expression) and individuals with brown eyes. However, there is a significant difference in the amount of pigmentation within the iris interstitium. The majority of people with blue eyes also carry one of several mutations that all reduce OCA2 expression. However, there is evidence that people with blue eyes have normal pigmentation in the iris pigment epithelium (IPE). Appropriately pigmented IPE, observed in both individuals with dark and light-colored eyes but not in albinos with the OCA1 mutation, reflects light back to the external observer without exhibiting the red coloration caused by blood vessels in the ciliary body. In its absence, a pink to red hue is visible.
[0315] Targeted therapy selectively interferes with specific molecular pathways or gene mutations that play a role in the development and progression of disease. These therapies may be more effective and safer than conventional nonspecific therapies. The safety profile of targeted therapy is another advantage. Compared to traditional non-targeted therapies, targeted therapy has fewer side effects, leading to an improved quality of life for patients. This method involves targeted therapy targeting oculocutaneous albinism 2 (OCA2), the level of which determines the amount of pigment produced in iris melanocytes, thereby determining eye color. Individuals with light eyes and individuals with dark eyes exhibit distinct phenotypic differences as a result of SNPs in enhancers upstream of the OCA2 gene that regulate its expression. When OCA2 expression is low in stromal melanocytes, melanosomes do not mature, and pigmentation remains low. This does not appear to occur in ocular pigment epithelial cells (such as IPE and RPE) with low OCA2 expression. Therefore, the majority of individuals with light eyes have reduced OCA2 gene expression due to a small number of SNPs that result in the same phenotype. In contrast, people with dark eyes generally have insufficient expression of the OCA2 gene. Based on this, targeted therapy closely mimics the above SNP to reduce OCA2 levels, giving dysfunctional, immature melanosomes to the iris melanocytes of those born with normal levels of OCA2, thereby reducing their pigmentation and altering their eye color.
[0316] Example 2 Endosome-avoidance modification and composition delivery Since the discovery of siRNA in the 2000s, the scientific community has been greatly stimulated by the potential for developing RNA silencing-based therapies. Many pharmaceutical companies have entered this field in an attempt to develop such therapies. Most of these attempts have failed because large molecules taken up by cells via endocytosis in endosomes cannot escape degradation and reach the cytosol, where the target mRNA molecule is located. Over the past 20 years, extensive research has been conducted on the endosomal system and effective techniques for escaping endosomes. In recent years, siRNA and antisense oligonucleotides with the ability to reach the cytosol and effectively silence target RNA have become commercially available. For example, coating molecules with lipid nanoparticles (LNPs) allows them to escape endosomes at a faster rate.
[0317] RNA therapeutics can be delivered to cells via the process of endocytosis, in which large molecules from the extracellular environment are internalized into the intracellular environment. In several endocytotic pathways, siRNA molecules bind to specific cell surface receptors with or without the help of conjugates (e.g., GalNac, cholesterol, vitamin E). Endosomes are formed when the cell membrane invaginates around the siRNA molecule. Endosomes are then transported to lysosomes, where they are acidified and enzymatically degraded. However, since RNA interference occurs only in the cytoplasm, siRNA molecules cannot silence gene expression within endosomes.
[0318] This limitation can be overcome by making siRNA molecules more resistant to degradation or by making them more permeable to the endosomal lipid bilayer. Specific delivery systems or chemical modifications to siRNA molecules are used to achieve this. The ability of these molecules to escape endosomes can be increased by encapsulating them in LNPs. For example, the endosomal evasion efficiency of LNPs containing β-sitosterol has been demonstrated to be 10 times greater than that of LNPs without β-sitosterol (Herrera M, et L. (2021) Biomator Sci. 9(12):4289-300).
[0319] Therefore, in order to lighten the eye color, eye drops are manufactured in which the active ingredient reaches the iris at a suitable concentration, enters the melanocytes, avoids endosomal-lysosomal degradation, and silences OCA2 expression.
[0320] In addition to nonviral cationic delivery systems, viral vectors such as adeno-associated viruses (AAVs) and lentiviruses represent another class of effective delivery vehicles for RNA-based therapeutics. These viral vectors leverage the innate ability of viruses to enter cells, thereby providing a highly efficient method for introducing RNA molecules into target cells. The use of AAVs or lentiviral vectors enables stable expression of RNA agents, potentially overcoming the challenges associated with degradation and transient expression associated with some nonviral delivery methods. The manipulation and application of such viral delivery systems for therapeutic purposes are well-established and within the scope of the expertise of those skilled in the art, providing a robust platform for the delivery of RNA-based therapies to a wide range of cell types, including those that are difficult to transfect using traditional methods.
[0321] Example 3 Delivery and pharmacokinetics of compositions To deliver a composition locally into the anterior chamber through the cornea, two main methods are available: eye drops and / or direct intraocular injection, such as anterior chamber injection. Most patients prefer the use of eye drops, which can be administered at home without the assistance of a healthcare professional. Alternatively, injections increase bioavailability by bypassing the corneal barrier. However, patients perceive injections as frightening, frightening, and painful. A preferred solution is the use of eye drops designed to reach the iris at sufficient concentration.
[0322] Upon crossing the corneal or scleroconjunctival barrier, molecules can enter melanocytes via endocytosis, evade the endosomal-lysosome system, and ultimately silence OCA2. Compositions administered via topical eye drops have a favorable biological distribution in the iris once their active ingredients reach the anterior chamber, i.e., minimal distribution to the posterior chamber of the eye in animal models, rather than systemic distribution. The pharmacokinetics of these compositions across ocular compartments offer a dual advantage to topical ophthalmic drugs: firstly, they remain at high concentrations for longer periods in the target area, increasing their efficacy; and secondly, they significantly reduce the potential for drug burden and side effects because they do not distribute to other organs.
[0323] As an isolated organ, the eye is relatively protected from systemic dispersal of drugs, thus increasing their efficacy (less degradation and more retention in the target area) and reducing their systemic and extratarget effects. Compositions delivered locally onto the ocular surface can pass through the scleroconjunctival pathway (Leclercq B, Mejlachowicz D, Behar-Cohen F. Ocular Barriers and Their Influence on Gene Therapy Products Delivery. Pharmaceuticals. 2022 May 6;14(5):998). Alternatively, compositions can be delivered via the corneal epithelium by one of two main methods: transcellular passage, which is the tendency of lipophilic molecules, or paracellular passage, which is the tendency of hydrophilic molecules.
[0324] A major challenge in developing gene silencing therapies is the fact that drugs are generally large and charged. This results in pharmacokinetic properties that make drug delivery difficult. In addition, drugs must overcome various barriers to be effective. These barriers include anatomical barriers such as the tear film and corneal or scleral-conjunctival pores, as well as evasion of endocytosis into target cells, stromal melanocytes, and degradation by the endosomal-lysosomal system.
[0325] Compared to other organs, the eyes have the advantage of having immune privileges, meaning that the immune system is relatively less sensitive to foreign substances within the eyeball compared to other organs. Furthermore, because the therapy is administered locally, there is no systemic uptake and no off-target effects are expected. These factors enable safe and effective local treatment of the eyes.
[0326] Example 4 Ophthalmic drugs with RNA interference (RNAi) against OCA2 Eye drops are being developed that induce iris lightening via targeted silencing of the OCA2 gene, effectively inhibiting melanin production in melanocytes of the iris interstitium. This therapeutic approach initiates a gradual depigmentation process by leveraging the natural photofading of existing melanin, which is hindered by the lack of new melanin synthesis to maintain pigment balance. This treatment allows for progression across the natural spectrum of human eye color, from dark brown to various shades of blue-green or gray, depending on the individual's response and treatment duration. Patients undergoing this regimen have autonomy to adjust the treatment intensity to their preference and can stop the lightening process at any desired point along the color spectrum without requiring complete depigmentation. This customization is achieved not by completely discontinuing treatment, but by extending the interval between doses or transitioning to a maintenance dose, thus preserving the achieved eye color.
[0327] The aesthetic outcome of this treatment is to recreate the appearance of naturally lighter eyes, providing a change in iris color that is indistinguishable from that of individuals born with naturally lighter eyes. Adjusting the treatment to a maintenance regimen or increasing the interval between doses maintains the lighter eye color. Conversely, if the treatment is significantly reduced or stopped, the melanocytes in the iris regain their ability to synthesize melanin, initiating a gradual restoration of the iris to its original hue. This repigmentation process is similar to the color change observed in the irises of many infants, where the eyes are initially lighter, gradually darkening as melanin production increases. Through this method, the cycle of depigmentation and repigmentation provides a reversible and personalized solution for altering iris color, reflecting the complex balance of melanin presence within the eye.
[0328] This drug silences the OCA2 gene upon reaching melanocytes in the iris interstitium. Upon administration, the drug specifically targets and inhibits the activity of the OCA2 gene within melanocytes located in the iris interstitium. This inhibition reduces OCA2 expression, which in turn negatively impacts melanosome development and functionality. As melanosomes do not mature effectively and become less functional, pigment synthesis in the iris declines, and overall pigmentation decreases. When there is a thinly pigmented interstitium in the anterior chamber of the eye, light rays are scattered and reflected according to the laws of optics, returning to the observer as bright colors (e.g., blue and green). The manufactured drug consists of an RNA therapeutic agent in the form of siRNA or antisense oligonucleotide (ASO) having at least one complementary sequence to the human OCA2 mRNA sequence. The sequence consists of 15-30 nucleotides selected from OCA2 mRNA, which in some humans contains approximately 3,143 nucleotides, as shown by, for example, SEQ ID NO: 65. RNA therapies generally do not activate the immune system and do not increase cytokine levels, such as TNF-alpha or IFN-alpha levels.
[0329] Example 5 Effect of OCA2-targeted siRNA transfection on melanin levels in B16-F10 cells Melanin absorbance quantification A linear regression for melanin was observed across all spectra tested, with a slightly lower background at OD405nm. We decided to perform melanin measurements in cells at absorbance wavelengths of 360nm, 410nm, and 490nm.
[0330] Cells were incubated with 5% CO2 at 37°C in a suitable medium, according to ATCC recommendations. Examination and recording (including photographs) were performed 24, 48, and 72 hours after seeding. For 96-well plates, viability was measured using the CellTiter-Glo assay. For 6-well plates, cells were incubated for 72 hours prior to collection for RNA extraction, RT-PCR, and qPCR setup.
[0331] As will be further detailed below, absorbance was tested using different methods, either directly on the cells, after lysis, or in culture media of different cell concentrations.
[0332] The conditions for melanin measurement were calibrated using three different concentrations of B16-F10 (created by seeding 3,000, 7,500, and 15,000 cells in a 24-well plate). HEK-293 cells were similarly seeded to serve as negative control cells (melanin-free).
[0333] Melanin absorbance measurement involved evaluating various forms of melanin: 1. Directly onto the cell; 2. Based on the method described in Chung, S., Lim, GJ & Lee, JY, Quantitative analysis of melanin content in a three-dimensional melanoma cell culture. Sci Rep 9,780 (2019); Intracellular cells after lysis in both 3.24-well and 12-well plates.
[0334] We tested the correlation between the amount of seeded cells and melanin levels.
[0335] It was noted that B16 cells produce larger amounts of melanin when they reach confluence (when under stress).
[0336] Of the three methods described above, the only one that showed a correlation between cell volume and spectrophotometric absorbance was the direct measurement on cells, as shown in Figure 1. Measurements on lysed cells and measurements in culture medium did not yield concentration-dependent results and were therefore disregarded. Furthermore, direct measurement on cells is the simplest, least technically dependent, and least "interventional" assay.
[0337] Next, B16 cells were transfected with siRNA targeting the OCA2 gene. Three different sequences of mouse OCA2-targeting siRNA at two concentrations (20 nM and 50 nM) were evaluated for their mRNA knockdown and melanin depigmentation effects on B16 cells. OCA2 siRNA #1-sense: GAUCAUAUUUGAGAUUGUUTT, indicated by SEQ ID NO: 70; Antisense: AACAAUCUCAAAUAUGAUCAG, indicated by SEQ ID NO: 71. OCA2 siRNA #2-sense: CGAUGAUUCCUGUACUCCUTT, indicated by SEQ ID NO: 72; Antisense: AGGAGUACAGGAAUCAUCGTA, indicated by SEQ ID NO: 73. OCA2 siRNA #3-sense: GGUUGCUAAUUUUAGCUGATT, indicated by SEQ ID NO: 74; Antisense: UCAGCUAAAAUUAGCAACCAG, indicated by SEQ ID NO: 75.
[0338] Cells were transfected with the aforementioned siRNA molecules, and transfection efficiency was tested using FACS analysis.
[0339] Forty-eight hours after transfection, cells were harvested, their RNA was extracted, and real-time PCR analysis was performed, including data export, melting curve analysis, and calculation of magnification difference and normalized expression ratio using the 2-ΔΔCt method. RNA extraction was satisfactory, with absorbance ratios between 1.8 and 2.0 at 260 / 280 and between 2.0 and 2.2 at 260 / 230, and the non-template control (NTC) showed a Ct value greater than 35. As shown in Figure 2, transfection with OCA2 siRNA #1 alone resulted in sufficient silencing of OCA2 expression in cells.
[0340] Melanin absorbance after OCA2 knockdown Melanin levels were directly assessed on the cells. Correlating with OCA2 mRNA knockdown, OCA2 siRNA #1 showed a reduction in melanin at all three wavelengths—360, 410, and 490—using spectrophotometric analysis. Figure 3 shows the melanin absorbance at OD 360 nm using the three OCA2 siRNAs described above. OCA2 siRNA #1, with significantly reduced gene expression, also resulted in a remarkable decrease in melanin levels, further demonstrating the association between OCA2 silencing and melanin reduction.
[0341] Example 6 Effect of OCA2-targeted siRNA transfection on melanin levels in uveal melanocytes Primary melanocytes are isolated from the eyes of deceased humans as follows: obtained from eyes provided by eye banks, derived from donors who have agreed that their tissue may be used for research if it is not suitable for transplantation, in accordance with the principles of the Declaration of Helsinki.
[0342] Alternatively, or in addition, the uveal melanoma 92.1 cell line may be used. The cells are any uveal melanocytes: normal, malignant (such as the uveal melanoma 92.1 cell line), or immortalized cells obtained by any method from any mammalian species. Primary cell lines were either taken from primary cell lines, transformed iPSCs, or purchased from cell line suppliers.
[0343] siRNA drug transfection Next, the siRNA molecule is added to the culture along with the transfection agent. The siRNA molecule is purchased from Integrated DNA Technologies (IDT) and transfected according to the manufacturer's instructions.
[0344] Isolated human primary uveal melanocytes are treated with an siRNA-Lipofectamine RNAiMAX mixture according to the manufacturer's standard protocol. Briefly, human primary uveal melanocytes are seeded on separate plates. After 24 hours of incubation (cell monolayer at 60-80% confluence), the cells are transfected with either OCA2-siRNA or siRNA-negative (scrambled siRNA). First, the cells are washed with Opti-MEM GlutaMax medium (Invitrogen, Carlsbad, CA, USA), and then transfected with a transfection mixture prepared separately according to the manufacturer's instructions (diluted siRNA (separate): diluted Lipofectamine RNAiMAX: 1:1) in Opti-MEM GlutaMax medium containing siRNA and Lipofectamine RNAiMAX.
[0345] A concentration range of 1–100 nM is used for both the negative control (described later under "control group") and OCA-2-siRNA. All wells / plates have the same final volume. During transfection, cells are cultured in the presence of the transfection mixture for 4–48 hours, then the transfection mixture is replaced with fresh medium without antibiotics. After incubation in fresh medium for 24 hours, cells are harvested and examined, or reseeded and cultured to examine phenotypic changes over a longer period.
[0346] Preparation of small interfering RNAs (siRNAs) Alternatively, for targeted knockdown of OCA2, OCA2 siRNA is synthesized by Invitrogen (Carlsbad, CA, USA) based on a transcript from the OCA2 gene (NCBI GenBank accession number NM_000275.3). Exemplary nucleotide sequences are as follows: UAAAGAUUCCUGCUUUACAGA (sense strand shown by SEQ ID NO: 67) and UGUAAAGCAGGAAUCUUUAGA (antisense strand shown by SEQ ID NO: 2). Negative control RNA therapeutics are purchased from Thermo Fisher Scientific.
[0347] Analysis of mRNA silencing To quantify OCA2 silencing in iris melanocytes, qRT-PCR is performed on treated and control cultures. First, the cells are lysed and RNA is extracted to prepare the sample. In the next step, the RNA is reverse transcribed into cDNA using reverse transcriptase. After adding primers specific to the OCA2 gene and fluorescent probe, the qRT-PCR reaction is set up. The reaction is analyzed using a qRT-PCR machine and data is collected.
[0348] Alternatively, or in addition, RNA ligase-mediated rapid amplification of cDNA end (RLM-RACE) is used to detect specific gene breaks resulting from OCA2-siRNA (kit purchased from Thermo-Fisher). This procedure amplifies and sequences the ends of the degraded mRNA to detect OCA2-mRNA break events.
[0349] Similar to qRT-PCR, total RNA is first isolated from cultured cells and then reverse transcribed into cDNA using reverse transcriptase. Next, the cDNA is ligated to a specific adapter using RNA ligase. The adapter is designed to bind only to the degraded mRNA produced by RNAi. After ligation of the cDNA, a polymerase chain reaction (PCR) is performed to generate numerous copies of the degraded mRNA. The amplified cDNA is cloned and sequenced to identify specific cleavage sites of the target gene. By analyzing the sequencing data, the specific location and frequency of cleavage events can be determined.
[0350] Analysis of melanin levels: Primary melanocytes are isolated, grown in culture, and transfected in the same manner as described in the previous section. To collect the transfected cells, trypsin / EDTA solution is added to detach the cells, and they are harvested. After harvesting, the cells are washed with PBS, suspended in extraction buffer, heated at high temperature (70-100°C) for 0.5-2 hours, and transferred to wells. The amount of melanin in the sample is measured at 405 nm using a spectrophotometer. The melanin content of the treated cells is then compared with that of control cells that were not transfected with siRNA.
[0351] Alternatively, the above methods, namely the method performed in culture medium and the method performed directly on cells, can be used to quantify melanin.
[0352] Melanin can also be observed using an optical microscope.
[0353] Transmission electron microscope (TEM) The next step involves using a transmission electron microscope to investigate the maturation stage of melanosomes in cells transfected with OCA2-siRNA, and comparing the average maturation stage of melanosomes in treated cells with that of control cells. This will provide an indicator of the effectiveness of the OCA2-siRNA molecule in reducing melanin production. This can then be used to evaluate the potential of OCA2-siRNA as a treatment for iris depigmentation.
[0354] Pre-TEM embedding: Embedding is necessary for observing tissues via transmission electron microscopy (TEM) for several reasons. First, embedding protects the sample from damage during preparation and imaging, thus preserving the tissue's ultrastructure. In addition, it enables the creation of ultrathin sections necessary for TEM imaging. Finally, embedding provides structural support for the tissue sample, allowing it to be sectioned and mounted on a TEM grid.
[0355] A description of typical procedures is provided in the experimental procedures section.
[0356] After appropriate embedding, the samples are examined using a transmission electron microscope (TEM). Cells from each grid are observed and recorded. Average melanosome maturation is compared between the treatment group and the control group.
[0357] Survival Test A viability test is performed to determine whether OCA2-siRNA damages iris melanocytes. The distinction between living and dead cells is based on various mechanisms, including membrane integrity and normal metabolic activity.
[0358] The Trypan Blue staining method is used. The dye penetrates the membranes of dead cells, staining them blue, but not living cells. The percentage of viable cells is determined using a microscope and hemocytometer. By comparing the percentage of viable cells treated with OCA2-siRNA with the percentage of control viable cells, the degree of treatment toxicity can be determined.
[0359] In the alternative MTT assay, the yellow compound MTT is added to cells. This is metabolized by enzymes in the living cells, changing their chemical composition and color to purple. Spectrophotography counts the number of living cells by measuring the absorbance of a specific light wave. The absorbance of cells treated with OCA2-siRNA is then compared to that of control cells.
[0360] As a further alternative, survival can be measured using the CellTiter-Glo assay.
[0361] Example 7 Ex vivo study - Survival of mouse iris explants Mouse iris explants were prepared as detailed above in the experimental procedure section. Ex vivo iris culture and viability evaluation were then performed for 3 weeks.
[0362] Ex vivo-collected human irises have previously been shown to be able to be cultured for extended periods (TENENBAUM E, KORNBLUETH W. Cultivation of Adult Human Iris in Vitro. AMA Arch Ophthalmol. 1958;60(2):312-318, and Ringvold A, Nicolaissen B Jr. Culture of iris tissue from human eyes with and without pseudo exfoliation. Acta Ophthalmol (Copenh). 1990 Jun;68(3):310-6). Due to their thin structure, nutrients can diffuse sufficiently to enable their survival. To conduct efficiency experiments on irises, their survival in cultures and the best conditions were evaluated. Three different rational culture media, namely media A, B, and C (detailed in the experimental procedure), were compared for their ability to maintain iris survival over time.
[0363] First, twelve irises were collected and divided into three groups of four irises each, and cultured in one of the culture media (A, B, or C) for the entire experiment. The culture medium was replaced every 2-3 days to replenish nutrients and remove waste products. To facilitate handling, an insert (Millicell Hanging Cell Culture Insert, PET 0.4um, 24-well (Mercury), catalog: PTHT24H48) was used to remove the irises from their wells for culture medium replacement.
[0364] After collecting the irises, they were placed on inserts in a 24-well plate. The wells were filled with culture medium and stored at low temperatures during transport.
[0365] Bright-field microscopy was used to capture the characteristics of the iris. The iris was examined daily under a microscope for its morphology and cell detachment, and photographs were taken.
[0366] Survival assays were performed using Presto Blue reagent.
[0367] Fluorescence intensity was measured at a gain of 1100. As shown in Figure 4, no significant difference in survival was observed between the different media (A, B, and C - described above) over a three-week period. Fluorescence measurement in this assay was more sensitive than absorbance. The iris maintained most of its viability throughout the entire three-week culture period.
[0368] Transfection and fluorescence microscopy All irises were cultured using culture medium A according to the established protocol detailed earlier. This study incorporated eight iris samples obtained from black mice for the transfection process. The irises were transfected with 50 nM fluorophore-conjugated control siRNA, BLOCK-iT® fluorescent oligonucleotide as a Thermo-Fisher RNAi transfection control, and customized scrambled siRNA conjugated to fluorophores by IDT. To establish a comparative baseline, two additional samples were designated as negative controls that underwent transfection with lipofectamine alone, lacking siRNA. Samples were evaluated 20 hours after transfection using fluorescence microscopy. The transfected irises showed successful fluorophore uptake, resulting in co-localization with the nuclear stain Hoechst, as shown in Figure 5. This co-localization facilitated cell location and demonstrated the feasibility of the transfection process. In contrast, the negative control showed no fluorescence at all, confirming the specificity of the fluorescence signal to the transfection procedure.
[0369] Example 8 Ex vivo trial - Targeting the SOX10 gene as a surrogate. OCA2 is expressed in both stromal melanocytes and iris pigment epithelium (IPE) of the iris. Therefore, treatment of the iris with OCA2 siRNA and the observation of a reduction in OCA2 expression does not necessarily indicate that the reduction is occurring in the target cells (stromal melanocytes). Thus, a decrease in OCA2 expression does not automatically indicate successful delivery to the intended target cell population. Furthermore, IPE constitutes the dominant cell type in the mouse iris, making up the majority of the iris. Consequently, a reduction in OCA2 expression in the relevant stromal melanocytes may be undetectable, even if exclusively achieved in the target cell population, due to the overshadowing effect of high OCA2 expression from IPE cells. This is why a delivery gene surrogate was used.
[0370] Sox10 is a gene expressed in nerve corona-derived cells, including melanocytes.
[0371] In iris tissue, the only cell type that appears to express Sox10 is the target cell (stromal melanocyte) (Mori T, et al. SOX10 Expression as Well as BRAF and GNAQ / 11 Mutations Distinguish Pigmented Ciliary Epithelium Neoplasms From Uveal Melanomas. Invest Ophthalmol Vis Sci. 2017 Oct 1;58(12):5445-5451).
[0372] Silencing SOX10 with siRNA and then observing the reduction in its expression in the iris is the method originally used herein to observe the success of siRNA transfection and function in stromal melanocytes. Assuming that SOX10 can be silenced, the OCA2-siRNA molecule, which has been proven to exert its effects in vitro against the same species of melanocytes, may be able to silence OCA2 in stromal melanocytes.
[0373] Mouse iris tissue was cultured and used for transfection experiments. SOX10 and scrambled siRNA were transfected into the iris tissue at a concentration of 50 nM each, using Lipofectamine RNAiMAX transfection reagent according to the manufacturer's guidelines. The irises were then incubated at 37°C. The culture medium was changed 24 hours after transfection. Finally, the irises were collected for RNA extraction 48 hours after transfection. In addition, a pool of irises that had not been transfected at all was also collected for their RNA and used as an additional control.
[0374] As described above in the experimental procedure, RNA was extracted from the iris. The RNA sample was then reverse transcribed into cDNA using a standard protocol.
[0375] Subsequently, quantitative PCR was performed to evaluate the expression levels of the GAPDH and SOX10 genes.
[0376] To ensure the specificity and reliability of the qPCR results, a no-template control (NTC) and negative controls for the reverse transcription (Neg ctrl RT) were included.
[0377] Quantification of expression: The quantification difference in gene expression was calculated using the 2-ΔΔCt method, normalized to the reference gene GAPDH, and compared with the control sample to determine the relative expression level of SOX10. Figure 6 shows the SOX10 expression in iris samples after SOX10 siRNA transfection.
[0378] Survival under light exposure Ex vivo iris tissue with equivalent survival criteria was cultured overnight (ON) in a standard incubator. The irises were cultured in two separate culture plates. One was exposed to a 9W LED light panel placed 8 cm away to simulate ambient light exposure, while the other was placed at a constant distance from both direct light sources as a control. Temperature measurements were taken throughout the experiment to ensure the safety of the irises.
[0379] The survival of the exposed tissues did not show any significant decrease after overnight exposure to light. For the light-exposed tissues, the fluorescence survival readings ranged from 15,708 to 36,304 relative fluorescence units (RFUs) after 2.5 hours in Presto Blue, with a mean survival of 25,490 ± 8,007 RFUs. In comparison, the unexposed tissues showed survival readings ranging from 12,990 to 31,942 RFUs, with a mean survival of 24,876 ± 6,724 RFUs. Overall, the mean survival of all samples was 25,207 ± 7,141 RFUs. The experiment concluded that there was no significant loss in the survival of ex vivo iris tissue cultured overnight under a 9W LED light panel placed 8 cm away compared to unexposed tissue.
[0380] Example 9 OCA2 pigment depletion test using mouse iris samples Nine mouse iris samples, collected as detailed earlier in this specification, were used in the study. These irises were maintained in medium A and incubated according to the protocol described herein, with medium changes every 2-3 days to preserve their survival, as in the study described earlier. Survival assessments performed three times a week revealed that the irises maintained their survival throughout the study. There were no significant differences in survival between the treatment groups, indicating good tolerability of the treatment. The same OCA2 siRNA sequence [OCA2 siRNA #1 - sense: GAUCAUAUUUGAGAUUGUUTT, indicated by SEQ ID NO: 70; antisense: AACAAUCUCAAAUAUGAUCAG, indicated by SEQ ID NO: 71], which has been proven to reduce OCA2-mRNA levels by more than 50% in vitro, was used in the B16 melanoma cell culture from Example 5 above.
[0381] Iris transfection began on day 1, followed by transfections on days 4, 8, and 11 (a total of four transfections every 3-4 days). Each iris was consistently treated with its assigned treatment throughout the entire experiment (all four transfections). Six irises were treated with either 50 nM or 100 nM OCA2 siRNA ("treatment group"), and three other irises were treated with 100 nM scrambled siRNA ("control group"). To mitigate positional bias within the experimental setup, the groups were distributed across the plate in a scattered manner. Lipofectamine RNAiMAX was used for each transfection as recommended by the manufacturer. After incubating the irises for 24 hours, the medium was changed to remove any residual transfection reagents or siRNA.
[0382] The illumination conditions for the iris samples were meticulously controlled, as detailed in the experimental procedure section.
[0383] Imaging was performed at baseline and on day 14 of the experiment (3 days after the 4th transfection, and immediately before fixation and processing for histological evaluation), using a Panasonic Lumix G9 camera equipped with a Laowa 25mm f / 2.8 Ultra Macro 2.5-5x lens, as detailed in the experimental procedure section.
[0384] After our best efforts, the observable results in the images showed a dramatic change in iris coloration in the OCA2-siRNA-treated group, but no such change was observed in the control group (Figure 8).
[0385] Visual analysis revealed significant and substantial changes in the iris color of the treated subjects (see Figures 8A-8B, with clear differences observed particularly in the periphery of the iris), in stark contrast to the unchanged iris color of the negative control group (see Figures 8C-8D, with no dramatic changes observed, including in the periphery).
[0386] Image analysis The images were further analyzed using ImageJ software. The iris region within the frame was carefully masked to allow for specific analysis of the pixels contained within its boundaries, from which the average saturation was determined. The iris background, being the same white diffuser (cyngustech), was consistent across all images, and when measured for its saturation in each image, it could vary between 0 and 255 for each pixel (0 being no saturation, 255 being the highest saturation). The saturation was then normalized for each iris in each image by subtracting the background saturation. This maintained standardization across all images. The accuracy was further improved by averaging the saturation values from all images for a particular iris in both baseline and 14-day photographs. The pre- and post-processing saturation values for each iris were calculated in this manner.
[0387] In a study published by Andersen et al, 2013 (Andersen JD, et al. Genetic analyses of the human eye colors using a novel objective method for eye color classification. Forensic Sci Int Genet. 2013 Sep;7(5):508-15), researchers analyzed images of different iris colors and measured eye color using the HSV color space. The S component of the HSV color space efficiently separated the blue and brown regions of the iris, showing the maximum difference in pixel values between the blue and brown regions. These researchers concluded that saturation may be preferable in quantitative investigations of eye color.
[0388] The blue color of blue eyes is primarily due to Rayleigh scattering. This scattering effect dilutes color intensity as more wavelengths are mixed, resulting in lower perceived saturation. Because there is less melanin to absorb light, the color is not very vivid (low saturation).
[0389] Brown irises have more melanin than blue irises, but not so much that all light is absorbed. This optimal level of melanin allows brown irises to absorb enough light to reduce scattering, while still reflecting enough light to exhibit the natural color of melanin. As a result, stronger and more vivid colors are obtained, and therefore, higher perceived saturation is achieved.
[0390] In the article by Liu et al., 2010 (Liu F, et al. Digital quantification of human eye color highlights genetic association of three new loci. PLoS Genet. 2010 May 6;6(5):e1000934), the color of the digitally extracted iris (eye) is quantified into two interval dimensions: hue (H) and saturation (S). Meanwhile, the figures in the article clearly show that brown irises are more saturated than blue irises.
[0391] When the iris is rich in melanin, a black iris absorbs most of the light, with very little light reflected back to the observer. This absorption results in a lack of perceived color, and therefore, in terms of color properties, black is associated with the concept of low or no saturation.
[0392] In an analysis of images with different eye colors, both black (very dark brown) and blue irises were significantly less saturated compared to the most saturated brown iris among all images analyzed. In conclusion, brown irises are expected to be more saturated than black (or very dark brown) irises. In the spectrum from 100% black (100% absorption) to brown objects, the closer an object is to perfect black, the less saturated it is, and vice versa.
[0393] The results of the image analysis are presented in detail in Table 1. Iris A-F were assigned to OCA2-siRNA treatment, while X, Y, and Z were given Chambre siRNA. The mean saturation (normalized by background) of the groups was nearly identical at baseline (48 vs. 49 out of 255). In posterior images of the iris, there was a clear distinction between the two groups (67 vs. 53).
[0394] [Table 1]
[0395] The following formula was applied to calculate the rate of change in iris chroma for each iris.
[0396]
number
[0397] As shown in Figure 9, the average saturation change after the experiment clearly showed a trend of increased saturation in the treatment group compared to the control group.
[0398] Histological evaluation: As the saturation of irises treated with OCA2-siRNA increases (a phenomenon associated with lighter brown irises), histological analysis reveals that these irises exhibit less pigmentation compared to those treated with scrambled siRNA and subjected to the same photobleaching conditions. Representative microscopic images are provided in Figure 10.
[0399] The control-treated irises showed no evidence of depigmentation (Figures 10B, 10C). The histological condition of these tissues was similar to that of untreated (without photobleaching, Figure 10C) DBA / 2J mouse irises, which were fixed several hours after dissection without any intervening treatment and observed under a microscope.
[0400] Example 10 Ex vivo study - Depigmentation of human iris explants Human irises are isolated from the eyes of deceased humans as follows: obtained from eyes provided by eye banks, derived from donors who have agreed that their tissue may be used for research if it is not suitable for transplantation, in accordance with the principles of the Declaration of Helsinki.
[0401] The eye is removed, and the uveal tract is excised (a periphery is made in the sclera 8 mm posterior to the corneal margin). The anterior portion of the eyeball, including the anterior sclera, lens, iris, and ciliary body, is removed and placed in a culture dish). After removing the iris from its base, the iris is placed in a culture dish with its posterior surface facing downwards.
[0402] Cells are cultured in medium A in 24-well, 12-well, or larger plates. The medium is replaced every few days.
[0403] Survival is assessed every few days under a microscope in Presto Blue.
[0404] The transfection efficiency is evaluated ex vivo in mice using fluorescently targeted siRNA such as Cy5, as described above, and then observed by fluorescence and confocal microscopy.
[0405] SOX10 knockdown qPCR is performed ex vivo in mice as described.
[0406] Perform the depigmentation assay in mice ex vivo as described.
[0407] Melanin reduction is measured by imaging analysis (as described herein), histological examination, or any other available method designed to quantify melanin levels. After the initial depigmentation phase, the experiment is extended by discontinuing the OCA2 silencing treatment while keeping the iris explants alive in medium A. This discontinuation allows observation of the iris as it may regain its pigment, with the aim of recording the process and rate of regigigmentation, in which the iris returns to its original pigment level. Evaluation of regigigmentation includes monitoring melanin synthesis over time via imaging analysis, histological examination, and other melanin quantification methods, as well as in the initial depigmentation assay.
[0408] Example 11 In vivo study - Targeted depigmentation of iris stromal melanocytes in mammals Rodents (mice or rats), rabbits (e.g., New Zealand rabbits, Dutch belted rabbits, or European rabbits), primates (e.g., cynomolgus macaques), pigs (e.g., domestic pigs), or any other mammals are treated with either intraocular injection or ophthalmic application of OCA2-siRNA. As described herein, the molecules are designed according to specifications (see further details below regarding the siRNA sequence). In this procedure, the mammals are anesthetized with anesthetics such as ketamine (5 mg / kg) and xylazine (5 mg / kg), and then treated with the active ingredient at concentrations ranging from 0.1% to 6% in a volume proportional to the size of the mammal's eye.
[0409] Mammalian-specific OCA2-siRNAs are designed to match their respective OCA2 mRNAs. For example, the OCA2 mRNA sequence in rabbits was retrieved from the National Institutes of Health's GenBank database (>XM_008269748.3 PREDICTED:Oryctolagus cuniculus OCA2 melanosome transmembrane protein (LOC100340522), transcription variant X1). Exemplary nucleotide sequences are as follows: GCAUCUAGAGAACAAAGAUGG (sense strand indicated by SEQ ID NO: 68) and AUCUUUGUUCUCUAGAUGCAU (antisense strand indicated by SEQ ID NO: 69). Further optimization is performed to design the most efficient sequence for silencing, as will be detailed below.
[0410] As previously described (Kodjikian L, et al. (2010) Invest Ophthalmol Vis Sci. 51(8):4125-32), a mixture containing naked OCA2-siRNA / transfection reagent and / or SOX10-siRNA (or fluorophore-conjugated RNA such as BLOCK-iT for surrogate experiments, or for intravitreous distribution experiments) and OCA2-siRNA is injected intravitreously or anteriorly into animal subjects. Negative controls (scrambled siRNA confirmed not to target any mRNA of that species) are administered intraocularly to the opposite eye or control group, and the negative controls may be left untreated or treated with PBS or carrier alone.
[0411] OCA2-siRNA is efficiently taken up by iris melanocytes in vivo. Following intrachorally administered OCA2-siRNA, fluorescently Cy5-labeled siRNA is injected into the iris. The iris is collected several hours to several days later, and the fluorescence distribution is evaluated by either fluorescence or confocal microscopy. Alternatively, ocular tissue is disrupted into single cells, and then sorted for fluorescence by fluorescence-activated cell sorting (FACS) analysis several hours to several days later. The presence of Cy5 staining is consistent with siRNA taken up by cells. Cy5-labeled siRNA is injected into the anterior chamber and then diffused into iris cells / melanocytes, and the fluorescence signal in these cells is measured several hours after injection to evaluate the duration of the fluorescence signal in these cells. When the Cy5 fluorescent dye is taken up by cells, it produces a bright fluorescence signal. This signal can then be measured and used to determine whether the siRNA has been taken up by the cells.
[0412] To reinforce this finding, in-situ hybridization is also used to detect OCA2-siRNA in the iris using a radiolabeled oligonucleotide probe complementary to the guide strand of OCA2-siRNA. By using a "stem-and-loop" qPCR method after a single intracavitary injection, the inventors measure how long after injection OCA2-siRNA remains detectable in the iris and in which cells in the tissue it is detected.
[0413] In addition, to evaluate the in vivo distribution of fluorophore-labeled siRNA in the iris of living subjects, mammals are administered siRNA via eye drops or intraocular injection. Following administration, subjects are anesthetized with isoflurane (1.5-2%) in oxygen at a flow rate of 1.5 L / min. The iris is imaged at predetermined intervals using an IVIS Spectrum imaging system (Perkin Elmer, UK) configured with specific filter settings for fluorophores. Fluorescence intensity and distribution are analyzed using LivingImage software, and a region of interest (ROI) is consistently defined within the iris across all subjects. This approach enables quantitative evaluation of siRNA distribution, which is crucial for understanding its delivery and localization within ocular tissue.
[0414] OCA2-siRNA reduces OCA2-mRNA and / or SOX10 as a surrogate in treated eyes. Several hours to several days after injection, the iris is incised (see ex vivo incision) from the eye injected with OCA2-siRNA and the eye injected with the control, and then disrupted (homogenized) via beads. RNA is extracted and finally (see ex vivo RT-PCR) qPCR analysis is performed to show that OCA2-siRNA reduces target mRNA expression in the treated eye. Comparisons are made between OCA2 mRNA expression levels in animals treated with OCA2-siRNA and control animals. The surrogate gene SOX10 is also silenced and measured to show that precise silencing occurs in melanocytes. The iris is composed of different types of cells, of which both stromal melanocytes and iris pigment epithelium express OCA2 (both synthesize melanin in melanosomes). However, only stromal melanocytes express SOX10. Knockdown of SOX10, a gene expressed only in melanocytes within the iris, demonstrates not only the transfection potential of target cells but also the efficiency of siRNA within these cells and its ability to utilize cellular mechanisms (i.e., RISC) to influence gene expression.
[0415] OCA2-siRNA induces specific RNAi-mediated OCA2-mRNA cleavage in vivo. To verify that siRNA activity was specifically induced by OCA2-siRNA in the iris of animals after intravitreous administration, the presence of OCA2-specific cleavage products in the animal irises was detected using RNA ligase-mediated rapid amplification of cDNA ends (RLM-RACE).
[0416] RACE products generated from eyes injected with OCA2-siRNA and eluted from the gel are then cloned and sequenced to determine whether cleavage occurred at the predicted site in OCA2 mRNA. To demonstrate that only OCA2-siRNA can cleave OCA2-mRNA, the same procedure is used to perform the same analysis on sequenced clones obtained from vehicle-treated eyes (negative control) and OCA2-siRNA-treated eyes to verify that no OCA2-siRNA-mediated cleavage was detected.
[0417] Light source and depigmentation: Melanin in interstitial melanocytes is constantly exposed to light and undergoes photobleaching (which is always the case, but faster under conditions of light exposure), and is thought to be synthesized to maintain pigment balance. Lifelong lightening of the eyes is rare, and when it does occur, it is usually associated with several conditions, such as Fuchs' iridocyclitis, and even some cases of Horner's syndrome (Beynat J, Soichot P, Bidot S, Dugas B, Creuzot-Garcher C, Bron AJ Fr Ophtalmol. 2007 Sep;30(7):e19), because melanocytes are actively synthesizing melanin. It has been shown that new melanosomes are created even in stromal melanocytes taken from the iris of adults (Hu DN, McCormick SA, Orlow SJ, Rosemblat S, Lin AY, Wo K. Melanogenesis by human uveal melanocytes in vitro. Invest Ophthalmol Vis Sci. 1995 Apr;36(5):931-8.). Photobleaching is a physical phenomenon that cannot be prevented from first-line pigment cells in tissues directly exposed to photons.
[0418] Therefore, determining the subject's light exposure during OCA2-siRNA-induced depigmentation affects the duration of depigmentation. Photobleaching is known to occur at a higher rate under conditions of light exposure compared to dark conditions (Mokrzynski K, Sarna M, Sarna T. Photoreactivity and phototoxicity of experimentally photodegraded hair melanosomes from individuals of different skin phototypes. J Photochem Photobiol B. 2023 Jun;243:112704). Human exposure to sunlight varies significantly depending on geographical location, lifestyle, occupation, season, cultural practices, and other parameters. In addition to sunlight, humans are also exposed to artificial light or indoor lighting during their active hours, and the joules of this light vary considerably. Therefore, several lighting conditions can be tested during the experiment, from which recommendations for light exposure can be determined for users who wish to safely accelerate depigmentation without causing harm.
[0419] On the first day of the study, the inventors began by arranging human hair samples uniformly cut from donated young women and young men. The men's hair exhibited a darker pigmentation, characterized by a dark brown to black color, while the women's hair had a lighter brown hue. Before collection, the hair was exposed only to standard washing procedures using shampoo and conditioner, and not to any chemical treatments. The samples were divided into two groups, each containing hair bundles from both individuals, and simultaneously introduced into separate environmental conditions. The control group was stored in a light-shielded environment, while the experimental group was subjected to photobleaching with a 9W 6500K LED light source positioned less than 10 centimeters away. This same lighting setting was later used in the ex vivo depigmentation test. To ensure that the lamp's heat output did not affect the surrounding environment, temperature measurements were meticulously recorded throughout the duration of the experiment to confirm the efficiency of the LED light in minimizing heat generation. While minimal changes were observed on day 10, by day 22, a significant difference in pigmentation was clearly evident in the female hair samples (see Figures 7A and 7B). This experiment was important for calibrating the optimal light intensity required to induce melanin degradation.
[0420] The phenomenon of photobleaching, which tends to lighten in summer and darken in winter, is consistent with findings in individuals with lighter hair color, and various studies have previously demonstrated that LED light can accelerate depigmentation through a process. It is important to note that hair strands lack living cells and become unable to synthesize melanin over time. However, living colored tissues such as the iris maintain melanin homeostasis. In individuals with darker irises, light exposure induces melanin degradation in interstitial melanocytes, a process that is absent or significantly reduced in individuals with lighter-colored eyes. Nevertheless, melanocytes continue to synthesize new melanin, ensuring, for example, that individuals with brown eyes do not experience lightening of eye color upon sun exposure. Changes in eye color typically indicate a pathological condition, according to the American Academy of Ophthalmology (AAO). However, light exposure can act as a catalyst for pigment reduction if melanin synthesis is intentionally inhibited.
[0421] Furthermore, melanin degradation has been shown to accelerate under light exposure compared to darkness. Any form of light exposure, whether from sunlight, ambient light, or therapeutic light, may accelerate pigment reduction and facilitate the lightening of tissue color, including the transition from brown to blue eyes. Additional methods that may accelerate melanin degradation include pharmacological treatments or behavioral interventions, such as prolonged water deprivation, or the use of animal models with a genetic predisposition to faster autophagy, or in combination with inhibition of new melanin production, such as accelerated melanin degradation capacity.
[0422] Phenotype analysis The phenotypic changes in iris color are evaluated by the following method: After injection of OCA2-siRNA, the depigmentation effect of siRNA is further evaluated. Examination of the animal's eye is performed to determine whether anterior iris pigmentation is lost entirely or punctately across the entire iris. The purpose is to determine the pattern and distribution of the downstream effect of silencing. Photographs are taken daily of the eye treated with OCA2-siRNA and the untreated eye or the eye treated with a negative control (PBS / or scrambled siRNA). Changes in eye color are visually (or previously described using computerized software analysis (Andersen JD, et al. (2013) Forensic Science Int) compared in the injected eye (with siRNA) to the control eye (with control scrambled siRNA). Observations were made using Genet.7(5):508-15. This method allows for the empirical quantification of eye color and its changes. The amount of pigmentation is assessed regularly throughout the study (every few hours or every few days). Furthermore, the length of time it takes for the iris to become pale and substantially depigmented is assessed. Measurements are then performed continuously to determine whether the effect persists, reverses, or if other changes occur. The duration of repigmentation is also assessed. Along with the time to become pale, these durations—the treatment interval for depigmentation (achieving lighter eyes), the maintenance interval (maintaining the achieved effect - which can be any of the human eye color spectrum, e.g., from brown to greenish), and the time it takes for the user to return to their original eye color after discontinuation of treatment (natural melanin aggregation in the iris - a similar process that occurs in infants born with blue eyes that turn brown over several weeks to months)—help determine future treatment regimens.
[0423] Microscopic analysis of iris pigment formation To further evaluate the reduction in iris pigmentation, the animals are euthanized and their eyes are removed. Then, a thorough histological examination of the animal tissues is performed using an optical microscope and / or a transmission electron microscope.
[0424] Using a transmission electron microscope (TEM), the maturation stages of melanosomes in the iris of animals are evaluated. The percentage of melanosomes in stages I-II in the iris stroma of animals treated with OCA2-siRNA is compared to that of the iris stroma of control animals. The percentage of stage IV melanosomes in the treated animal irises is also compared to that in the control animal irises. IPE and RPE are also evaluated to determine whether loss of pigmentation occurred similarly there. In this way, it is possible to determine whether the treatment affected melanosomes in the iris stroma and whether it altered the amount of pigmentation in other important ocular tissues.
[0425] Quantification of OCA2 protein quantity: The irises are homogenized in lysis buffer, and total protein is measured using the Bradford protein assay (Roche, Germany). Sample normalization for total protein is performed before the ELISA assay for animal OCA2. This is done to ensure that the amount of OCA2 in each sample is accurately measured. Subsequently, the ELISA assay is used to compare the protein levels of OCA2 in animals injected with OCA2-siRNA and in control animals.
[0426] Harmful effects A slit-lamp examination is performed at baseline, followed by an electroretinography (ERG). The slit-lamp examination is used to examine the structures of the eye, such as the cornea, iris, and lens. This can detect signs of disease or damage. Electroretinography is then used to measure the electrical signals produced by cells at the back of the eye, which can help diagnose certain eye conditions. A series of ophthalmic examinations are performed throughout the study to assess adverse effects and to capture any changes in the eye.
[0427] During the test, all other parameters of the animal (including body weight) will be measured. The cornea and iris will be examined for the presence of pathological changes. The anterior chamber will be examined for inflammation and redness. The lens will be examined to determine its clarity. The conjunctiva, sclera, and posterior chamber of the eye will be thoroughly examined. In addition, OCT will be used to detect structural changes in the eye. The purpose of this examination is to determine whether any changes have occurred in the eye due to the drug, such as the induction of inflammation, the onset of infection, the development of cataracts, glaucoma, or any other eye abnormalities.
[0428] During the experiment, the fur of all animals will be examined for depigmentation or hypopigmentation. In addition, skin samples will be collected and examined under a microscope to assess the maturation of melanosomes in epidermal melanocytes. The intention is to determine depigmentation and regression of the entire melanosome stage. If they occur, it may indicate that OCA2-siRNA inhibits OCA2 expression in hair follicles, which suggests a systemic effect or efflux from topical treatment around the eyes and eyelids.
[0429] Example 12 Screening of eye drop formulations for the in vivo distribution of optimized interstitial melanocytes The formulations to be tested must not only match the physiological pH for compatibility, but also demonstrate stability over time to ensure that the efficacy of the active ingredient is maintained.
[0430] Irritating formulations can lead to increased tear production and potential tissue damage as the eye attempts to counteract such irritation. This reaction can significantly impact the biodistribution of ophthalmic drugs, highlighting the importance of developing non-irritating formulations from the early stages of in vivo testing.
[0431] Viscous compounds, including gels, are noteworthy for their long-term retention within ocular tissues such as the conjunctiva, offering a promising means for long-term drug delivery. This study includes both viscous formulations and aqueous solutions with a consistency up to that of petrolatum, along with an analysis of commercially available eye drops. This multifaceted approach also involves a retrospective analysis of market products and a thorough review of the literature on planned and incidental therapies of drug distribution to the iris. Excipients approved by regulatory agencies such as the FDA (Food and Drug Administration) and EMA (European Medicines Agency) for ocular application are preferred due to their established safety profiles and regulatory familiarity.
[0432] To enhance the duration of drug presence on the ocular surface, viscous materials are considered due to their retention capacity. However, these substances may restrict the release of siRNA molecules. Given that siRNA is water-soluble but needs to cross lipid barriers to effectively reach intraocular targets, exploring various lipid-based liquid or biphasic formulations may yield viable pathways. The application of tight-bonding permeable agents such as benzalkonium chloride (BAK) within approved concentrations may further enhance the permeability of siRNA through key ocular barriers, including the cornea, conjunctiva, sclera, ciliary body, and iris. This strategic approach highlights the need for a delicate balance between formulation stability, compatibility, and permeability to optimize ocular drug delivery.
[0433] A rodent (mouse or rat), or a rabbit (e.g., New Zealand rabbit, Dutch belted rabbit, or European rabbit), a primate (e.g., cynomolgus macaque), or a pig (e.g., domestic pig), or a dog (e.g., domestic dog), or any other mammal is topically treated with eye drops containing OCA2-siRNA that is (partially or completely) complementary to the mRNA of the target species and capable of knocking down its OCA2 expression.
[0434] In this in vivo experiment, a formulation containing siRNA (hereinafter referred to as the "test drug") is administered via a local ocular delivery strategy to enhance its anterior chamber distribution and bypass the ocular barrier. One approach involves immersing an optical contact lens in the test drug and then applying the lens to the eye. Another approach involves placing the test drug directly on the ocular surface and then applying the contact lens to maintain the formulation's position and prevent dispersion due to tear kinetics. Furthermore, in yet another method, the animal subjects are sedated to ensure their eyes remain open, allowing for precise placement of the drug droplet and preventing involuntary blinking or movement from dispersing the drug. Alternatively, the test drug may be applied directly to the eye and then brought into contact with a glass surface to utilize surface tension to prevent spillage of the liquid formulation.
[0435] Repeated administration of eye drops may be considered several times a day, but if sedation is involved, it should be limited to twice a day or less to reduce stress and potential harm to the animal. To promote optimal drug absorption and bioavailability, try prolonged contact between the eye drops and the outside of the eye, ranging from 5 to 20 minutes. Treatment may be unilateral or bilateral.
[0436] Many formulations containing the active ingredient are applied topically as eye drops, as detailed above. After application, each formulation is evaluated for its delivery efficacy by bioanalysis using the same method as described in previous examples. The analysis includes the following:
[0437] Use of conjugate markers, such as fluorophore-conjugated siRNA, beta-galactosidase, or other agents that can indicate tissue and cell distribution under microscopic examination 24 hours after treatment. Consider the potential effects of these conjugates on the pharmacokinetics of the entire molecule.
[0438] A formulation containing either OCA2-siRNA or SOX10-siRNA as the active ingredient is administered. 48 hours after treatment, the iris is collected, its RNA is extracted, and analyzed using qPCR (as previously described) to assess any knockdown effect. This analysis helps determine the in vivo distribution conferred by the formulation.
[0439] The application of in-situ hybridization techniques to further investigate test drug delivery to tissues, and the use of low-resolution IVIS imaging to gain comprehensive insights into the general distribution patterns of the formulation.
[0440] These methods collectively establish a comprehensive framework for evaluating the in vivo distribution of each eye drop formulation and identifying optimal conditions.
[0441] Through this process, the optimal eye drop formulation undergoes rigorous screening to assess its compatibility with the active ingredient, as well as a thorough evaluation of its biodistribution and pharmacokinetic properties. This evaluation includes detailed testing of chemical attributes, such as pH levels, to ensure the safety and stability of the formulation. This, in turn, ensures its efficacy and suitability for use in the eye. In addition, the possibility of efficiently scaling up production is carefully considered.
[0442] In this example, a basic eye drop formulation containing purified water, benzalkonium chloride, sodium chloride, hydroxypropyl methylcellulose, and sodium phosphate buffer is tested for its ability to deliver OCA2-siRNA to the eye. The selection of these components is based on their established use in ocular applications, with a focus on formulation compatibility with ocular tissue and ensuring effective distribution of siRNA within the eye.
[0443] Example 13 Phase 0 Clinical Trial A Phase 0 clinical trial will be conducted to evaluate the safety, tolerability, pharmacokinetics, and pharmacodynamics of microdose topically applied eye drops containing OCA2-siRNA. Ten to fifteen healthy human volunteers, preferably those with already clear eyes to avoid any asymmetry caused by the treatment, will be recruited. Participants must be at least 18 years of age and in good health to participate in the study. Pregnant or breastfeeding women, individuals with a history of eye disease or surgery, and patients with known allergies to any of the drug's components will be excluded from the study.
[0444] A fixed microdose of OCA2-siRNA eye drops will be administered unilaterally to subjects in the study. The OCA2-siRNA drug will be selected according to the siRNA design (details further below). The other eye will be used as a control.
[0445] Volunteers will be closely monitored for any adverse effects or side effects associated with the treatment. These include monitoring volunteers' visual acuity, intraocular pressure, and any changes in the structure or function of the eye. Levels of siRNA in the body will also be measured using bodily fluid samples such as blood, urine, and tears. In addition, skin and hair will be examined for signs of hypopigmentation. Furthermore, the biodistribution of the drug will be assessed through analyses including monitoring of bodily fluid and tissue samples for the presence of OCA2-siRNA.
[0446] Volunteers will be followed up after the treatment period to evaluate the long-term effects of the treatment. The trial will be closely supervised by a team of researchers and physicians. Based on the data collected from the Phase 0 trial, the siRNA eye drops will be evaluated for safety and biodistribution. This precaution ensures that the drug does not cause side effects or distribute to undesirable parts of the body before evaluation in subsequent trials using larger sample sizes.
[0447] Example 14 Phase II / III Clinical Trial The objective of this study is to evaluate the efficacy and safety of topically applied eye drops containing a full dose of OCA2-siRNA. The recruitment process involves recruiting tens to hundreds of healthy human volunteers. Participants must be 18 years of age or older and have eyes other than blue (e.g., brown, light brown) or heterochromia iridum. Individuals who are pregnant or lactating, have eye disease or have undergone surgery, or have a known allergy to any of the drug components will be excluded from the study. Baseline slit-lamp examinations were performed, clinical photographs were taken, and the images were then scanned into a computer and analyzed using a calibrated software package as previously described (Andersen JD, et al. (2013) Forensic Sci Int Genet. 7(5):508-15), and recorded. Throughout the study, follow-up photographs were taken under the same conditions (i.e., lighting conditions, camera angle, time of day, etc.). This ensures that the collected data is accurate and consistent throughout the testing process, and that any changes in iris color may be due to processing rather than changes in the environment or equipment used to collect the data.
[0448] This trial will be conducted in a double-blind, multicenter manner. Randomization will be used to assign participants to either a treatment group receiving a fixed dose of OCA2-siRNA or a placebo eye drop once weekly for several months. The OCA2-siRNA drug will be selected according to (see siRNA design). In this case, the opposite eye will be used as a control. This will allow researchers to compare the effect of OCA2-siRNA with the effect of placebo and determine whether the OCA2-siRNA drug has a positive effect.
[0449] The primary objective of this trial is the achievement of a brighter eye color, as determined by standardized colorimetric / computerized tests (e.g., measuring changes in iris saturation over time, as described above) or visual examination by an ophthalmologist. Secondary endpoints include pigment density and the percentage change in eye color, saturation, and brightness compared to the patient's baseline, as measured by standardized colorimetric tests or computerized image analysis tests. Measurements will be taken at baseline, throughout the trial, and at the end. Another secondary endpoint will assess whether a significant change in color occurred over a set period. Drug side effects will be closely monitored throughout the clinical trial, both systemically and in the tissues of the eye. These include, but are not limited to, routine ophthalmic examinations (such as slit-lamp examinations and optical coherence tomography) and monitoring of systemic side effects such as changes in visual acuity, headache, blood tests, or changes in skin and hair pigmentation.
[0450] control group A control group will be used to evaluate the efficacy and safety of the disclosed treatment. The control group will include, for example, subjects that have not received the intervention, subjects that have received an empty carrier (i.e., a transfection agent / nanocarrier alone that does not contain nucleic acids), or subjects that have received untargeted siRNA sequences containing the same nucleotide composition but with different sequences (letters have been scrambled and sequences have been "BLASTed" to verify that none of the controls targeted mammalian mRNA).
[0451] Example 15 Detailed siRNA sequence The array table is provided in Table 2 below.
[0452] [Table 2]
[0453] The lengths of the sequences presented in the examples herein are illustrative and not limiting. Actual sequences used may vary in length based on the described sequences and may contain additional or fewer nucleotides as described herein.
[0454] Additional siRNA sequences and their targets are disclosed by Sequence IDs 78-200, most of which were found in target regions 375-420, 1270-1370, 1500-1600, 1900-2400, and 2610-3143. This disclosure provides RNA therapeutics (siRNA, ASO, and other RNAs). In embodiments in which the RNA therapeutic is prepared from an siRNA molecule, it comprises at least two nucleotide sequences, a sense sequence, and an antisense sequence. The sense strand is selected from the group of sequences shown in Table 2. The antisense strand of the sense strand is selected from the sequences listed in Table 2. In this embodiment, there is complementarity between these sequences. The antisense sequence is highly complementary to the mRNA sequence produced by OCA2 expression.
[0455] Therefore, the siRNA comprises two oligonucleotides, one of which is listed as the sense strand in Table 2, and the second oligonucleotide is listed as the antisense strand of the sense strand in Table 2. There are embodiments of the present invention in which substantially complementary sequences of the siRNA are contained on separate oligonucleotides. In another embodiment, two substantially complementary sequences of the dsRNA are present on a single oligonucleotide.
[0456] In embodiments in which the RNA therapeutic agent is prepared from an ASO molecule, this molecule contains at least one nucleotide sequence. The ASO sequence is highly complementary to the mRNA sequence produced by OCA2 expression.
[0457] The RNAs presented in Table 2 generally identify some of the sites within the OCA2 transcript that are susceptible to RNA-induced silencing complex (RISC) mediated cleavage or alternative pathways that can reduce gene expression in various ways well known to those skilled in the art. Consequently, the present invention also includes RNA therapeutics that target one or more of these sites. In this context, an RNA therapeutic is defined as one that targets a specific site within an RNA transcript. Given the fact that an RNA therapeutic promotes cleavage at that specific site, the transcript is likely to be cleaved. Examples of RNA therapeutics containing at least 15 consecutive nucleotides from one of the sequences are listed in Table 2. As part of the process, these nucleotide sequences may be coupled with additional nucleotide sequences obtained from a region adjacent to the selected sequence in the OCA2 gene.
[0458] The length of each oligonucleotide, including the RNA therapeutic agent, may range from approximately 15 to approximately 30 nucleotides.
[0459] In embodiments where the RNA therapeutic agent is siRNA, the oligonucleotide is generally long enough to act as a substrate for the Dicer enzyme and / or to be used in the RISC complex. For example, it is well known in the art that dsRNAs longer than 21–23 nucleotides can function as substrates for Dicer. It is also apparent to those skilled in the art that the RNA region targeted for cleavage is usually part of a larger RNA molecule. Most often, this is a messenger RNA (mRNA) molecule.
[0460] When an siRNA molecule is loaded onto an RNA-induced silencing complex (RISC), the antisense strand (guide) of the siRNA molecule recognizes a specific target RNA, such as OCA2-mRNA, and acts as a guide for binding to it. As soon as RISC binds to the target RNA, its catalytic component, the Argonaut, cleaves the RNA, resulting in its degradation. This leads to the knockdown of the corresponding gene, for example, OCA2. By degrading the target mRNA, RISC prevents the target mRNA from being translated into a protein and therefore prevents gene expression. This, in turn, leads to the silencing of the gene that has the desired effect in terms of gene regulation.
[0461] RNA therapeutics can reduce the expression of target genes in a variety of ways, all of which are entirely within the knowledge of those skilled in the art. For example, siRNA may cleave the target mRNA strand by an RNA-induced silencing complex (RISC), or inhibit translation by blocking ribosome access to the mRNA. ASO molecules may achieve similar results, for example, by forming a double helix with the target mRNA, thereby allowing the RNase H enzyme to cleave it, or by binding to the mRNA and blocking its access to the ribosome, thereby preventing translation.
[0462] In each of the examples reported herein, NIH GenBank data is used, utilizing OCA2-mRNA sequences for appropriate mammalian species (e.g., rabbits, monkeys, humans, etc.). To design the RNA therapeutic sequence, the GenBank database is searched for the target species and its OCA2 mRNA sequence is examined.
[0463] Alternatively, if the GenBank database does not contain the OCA2-mRNA sequence required for a particular species under investigation, RNA sequencing (RNA-Seq) can be used to elucidate the target mRNA sequence. This process involves isolating RNA from the target species, then converting it to complementary DNA (cDNA), and subsequent high-throughput sequencing. By analyzing the sequence data, it becomes possible to identify species-specific OCA2-mRNA sequences. In the determination process, small interfering RNAs (siRNAs) are meticulously designed to precisely target and silence the OCA2 gene in a specific species, as described herein. After identifying the mammalian OCA2-mRNA sequence, RNA therapeutics intended to silence this gene are designed as follows:
[0464] Types of RNA nucleotides This method involves administering ribonucleic acid (RNA) as the target. For example, RNA therapeutic agents are siRNAs containing a sense strand and an antisense strand that form a complementary region by creating a double-stranded region consisting of at least 15 consecutive nucleotides that differ from the appropriate mRNA molecular nucleotide sequence by only 4 nucleotides or less. A notable example of this is the human OCA2 mRNA variant 1 sequence in NCBI GenBank, shown by Sequence ID No. 65.
[0465] The RNA therapeutic agents mentioned inhibit the expression of the OCA2 gene within cells, such as those in mammals. These RNA therapeutic agents inhibit OCA2 expression in humans suffering from OCA2-related disorders, or in cases where reducing OCA2 expression may be beneficial, such as in heterochromia iridum or hyperpigmentation disorders of the eye, or for cosmetic purposes.
[0466] Therefore, the present invention relates to RNA therapeutics comprising antisense oligonucleotides, small interfering RNAs (siRNAs), microRNAs (miRNAs), short hairpin RNAs (shRNAs), Dicer-substrate RNAs (dsRNAs), piwi-interacting RNAs (piRNAs), long non-coding RNAs (lncRNAs), CRISPR-Cas9 guide RNAs, and any other RNA therapeutic agents or technologies capable of inhibiting OCA2 expression.
[0467] Algorithm for identifying the optimal silencing sequence Identifying the optimal siRNA sequence for knockdown of any gene expression is a standard practice well within the scope of the skills of those skilled in the art, involving the application of established guidelines, widely available software tools, and conventional wet lab validation methods routinely used by those skilled in the art.
[0468] Target sequences are generally recognized to consist of 15–30 nucleotides in length. However, there is considerable variation in the suitability of specific sequences within this range for guiding the cleavage of any given target RNA. The guidelines and various software packages presented herein provide guidance on identifying the optimal target sequence for any given gene target.
[0469] By utilizing guidelines and algorithms that consider factors such as thermodynamic properties and GC content, and by performing a "BLAST" search to prevent off-target effects, it is possible to predict the most effective and specific sequence in silico. However, the examples described herein do not limit the use of other optimization rules and algorithms. Any other sequence of an OCA2 RNA therapeutic capable of silencing gene expression, or any other method (such as a different algorithm) to optimize the ability of an RNA therapeutic adhering to the principles of this technology to silence OCA2-mRNA, would be preferable as described herein. This means that although the examples presented are limited, any other method following the same principles can be used.
[0470] Logical rationale for siRNA sequence selection: This specification describes screening entire OCA2-mRNA nucleotide sequences to identify sequences that comply with any or all of the optimization techniques, algorithms, and guidelines described herein, as well as other optimization techniques, algorithms, and guidelines available to those skilled in the art. This process efficiently identifies sequences optimized for specific attributes such as stability, efficient target binding, increased potential for RISC-mediated guide chain incorporation, in vivo distribution (e.g., shorter siRNA molecules exhibit reduced molecular weight, potentially facilitating enhanced transport efficiency across the ocular barrier), effective gene silencing, minimal immunogenicity, and increased target specificity, thereby enabling reduced off-target effects and increased safety, among other properties. These optimization guidelines and algorithms are designed to identify sequences with the most desirable features for enhancing the efficiency and specificity of gene silencing.
[0471] RNA therapeutic chains should be 30 bp or less in length. This is because the interferon response triggered by larger RNA molecules alters the expression of nonspecific genes. This response can shift the expression of many genes, leading to side effects and ineffective silencing. The interferon response is significantly more frequently induced when double-stranded RNA therapeutics are longer than 30 bp because longer molecules are more quickly recognized as foreign substances by cells. The cells then activate their interferon response, which shifts the expression of many genes to repel the "foreign" molecule. This can result in nonspecific gene silencing and side effects. This is far less likely to occur with shorter RNA therapeutics (Persengiev SP, et al. (2004) RNA NY N.12-8).
[0472] Due to the presence of regulatory protein binding at several positions or the extremely complex secondary structure, complementary siRNA sequences should be used at several different positions along the 3.1K nucleotide of human OCA2-mRNA, as this may reduce the likelihood of capture.
[0473] Typically, GC bases should constitute 30-65%, preferably 30-55%, of the composition. This is due to the fact that a chain with a high GC content bonds more strongly, as a G nucleotide on one strand establishes three covalent bonds with a C nucleotide on the other strand. This is in contrast to the two covalent bonds between A and T nucleotides. For this reason, a high GC content inhibits double-strand unwinding and reduces the level of gene expression inhibition.
[0474] The use of sequences consisting of more than four consecutive A nucleotides or T nucleotides should be avoided. This is because these sequences indicate the signal ends for the RNA polymerase III enzyme.
[0475] In particular, sequences containing GTCCTTCAA, TGTGT, and CTGAATT are known to induce an immune response and are therefore best avoided (Birmingham, A., et al. Nat Protoc 2, 2068-2078 (2007)).
[0476] Candidate double strands containing five or more consecutive bases of the same base should be excluded. Excluding candidate double strands containing seeds can reduce off-target effects (Vaish N, et al. (2011) Nucleic Acids Res. 39(5):1823-32).
[0477] This is because the homogeneity of the double helix weakens its stability and reduces its likelihood of binding to its target. In addition, the seed can increase the frequency of mismatches, which can also weaken the stability of the double helix.
[0478] BLAST To ensure that the target sequence is not present in any other gene mRNA, and to ensure that silencing is specific to OCA2-mRNA, the target sequence is entered into the NCBI BLAST search engine, and sequences homologous to other genes are excluded. A description of the BLAST algorithm can be found in Altschul et al. (Altschul et al. (1997), Nucleic Acids Res. 25:3389-3402).
[0479] To increase specificity, candidate siRNA sequences are blasted against a broad and unique mRNA database to remove non-unique sequences. Candidate siRNAs that share more than 11–15 consecutive nucleotides with different mRNAs should be ignored, as recommended by Jackson et al. (Jackson AL, et al. (2003) Nat Biotechnol 21(6):635-7).
[0480] As the "BLAST" database grew, the number of candidate siRNAs that exclusively targeted a single specific mRNA decreased significantly. As a result, only siRNAs with more than 2–5 homologous sequences of unigene sequences are preferably discarded.
[0481] Enhancement of siRNA design through advanced in silico simulation By simulating the secondary structure of siRNA sequences and measuring the free energy of the molecules, better candidates can be selected because molecules with higher free energy tend not to fold as easily and are therefore better candidates. Furthermore, by analyzing the thermodynamic properties of the interaction between two RNA sequences, namely the siRNA and its complementary sequence on the mRNA molecule, it is possible to select siRNA candidates with greater activity. The thermodynamic properties also determine which of the strands is more likely to be loaded into RISC, further impacting the effectiveness of gene silencing.
[0482] Using ocular pharmacokinetic models, it is possible to evaluate the in vivo distribution profiles of various siRNA sequences, particularly their length distribution across the ocular barrier and their distribution within the iris. This approach allows for the identification of siRNAs with optimal potential for effective delivery and gene silencing, streamlining the selection of candidates for further development.
[0483] Thermodynamics plays a crucial role in siRNA sequence selection due to its influence on the stability of the siRNA-target mRNA duplex. The balance between enthalpy (binding) and entropy (disordering) forces determines hybridization, which in turn influences the specificity and effectiveness of siRNA-mediated gene silencing. Statistical analysis of published siRNA sequences reveals that functional duplexes typically exhibit lower internal stability at their 5' antisense end compared to non-functional duplexes. This lower stability is critical for target mRNA recognition because it provides the necessary flexibility at the 5' end of the sense strand, facilitating the formation of the functional duplex.
[0484] Another effective method for identifying and distinguishing highly efficient siRNA candidates from less efficient ones is to simulate their docking to Argonaut proteins. Using this computational approach, the physical interactions between the Argonaut proteins and the siRNA candidates can be obtained. As a result, the strength and stability of the complex formed between the two molecules can be evaluated. Furthermore, this allows for the identification of potential weaknesses in the interaction. This enables the selection of candidates with enhanced silencing capabilities by optimizing the Argonaut protein binding ability of the siRNA candidates.
[0485] Docking modeling can also provide information about the orientation and spatial arrangement of candidate siRNAs while bound to the Argonaut protein. Therefore, identifying which siRNA sequences bind to the Argonaut protein in the most efficient conformation is beneficial. This provides an additional opportunity to predict whether the target gene will be optimally silenced.
[0486] Empirical approach Alternatively, an empirical approach is employed in which a “window” or “mask” of a specific size (e.g., 21 nucleotides) is placed literally or figuratively (e.g., in silico) on the target RNA sequence to identify sequences that can be used as target sequences within this size range. For any given target size, the sequence “window” may be gradually moved one nucleotide upstream or downstream to identify the next possible target sequence until the entire set of possible sequences is identified.
[0487] By utilizing the "window method" and then testing siRNA candidates using the assays described in the examples herein or other methods well known in the art, the sequences of RNA therapeutic agents most effective in silencing OCA2 expression can be identified. For example, the sequences identified in Table 2 are predicted to be effective target sequences based on the algorithmic approach and optimization methods described above. However, further optimization of gene inhibition efficiency can be explored by "walking the window" incrementally one nucleotide upstream or downstream of a given sequence to identify sequences with similar or better inhibitory properties.
[0488] Furthermore, it is conceivable that further optimization can be achieved by systematically adding or removing nucleotides to any sequence identified in Table 2, etc., to generate longer or shorter sequences, and then testing these sequences by traversing longer or shorter windows upstream or downstream of the target RNA from the identified point. Further improvements in inhibition efficiency can be achieved by combining this approach for generating novel candidate targets in inhibition assays known in the art and / or as described in the present invention, with testing the efficacy of RNA therapeutics based on these target sequences.
[0489] qualification The sequences described herein can be further modified by introducing modified nucleotides as described herein or as known in the art. Modifications may include adding or modifying overhangs, introducing modified nucleotides, or performing other modifications known in the art or discussed herein, in order to further optimize the siRNA silencing effect.
[0490] These modifications aim to enhance drug stability within tissues or the intracellular environment by reducing its degradation rate, particularly in endosomal settings, and to extend its half-life in aqueous humor and in tissues such as the iris, sclera, conjunctiva, and cornea. In addition, they seek to improve drug delivery to cells, target specific cell types (e.g., iris stromal melanocytes) or locations, boost interactions with enzymes involved in the silencing pathway, increase the likelihood of guide chain uptake by RISC, and reduce off-target effects. These modifications also aim to reduce immunogenicity, minimize systemic absorption, and enhance endosomal evasion for better efficacy.
[0491] Nucleotide selection, length, compatibility with mRNA, overhang In embodiments where the RNA therapeutic agent is dsRNA, the dsRNA includes an antisense strand whose sequence complements at least a portion of the mRNA produced by the expression of the OCA2 gene. In embodiments where the RNA therapeutic agent is an antisense oligonucleotide, the oligonucleotide sequence complements at least a portion of the mRNA produced by the expression of the OCA2 gene.
[0492] Generally, complementary regions are approximately 30 nucleotides or less in length (e.g., approximately 30, 29, 28, 27, 26, 25, 24, 23, 22, 21, 20, 19, 18, 17, 16, or 15 nucleotides). Cells expressing the OCA2 gene (such as human cells) are evaluated, for example, by PCR or branched DNA (bDNA)-based procedures for RNA quantification, and are inhibited by at least approximately 10% in the presence of RNA therapeutics. Protein expression resulting from OCA2 gene activity can be evaluated by Western blotting and enzyme-linked immunosorbent assay (ELISA) for quantification, and by immunohistochemistry (IHC) for tissue localization. Flow cytometry can be used to analyze cell surface markers and intracellular proteins to evaluate the effect of RNA therapeutics on protein levels associated with OCA2 gene expression.
[0493] Under the conditions in which dsRNA is used, the two complementary RNA strands will form a double-stranded structure. The antisense strand of the dsRNA contains a complementarity region that is substantially complementary to the target sequence and generally perfectly complementary. The target sequence may be derived from the mRNA sequence formed during the expression of the OCA2 gene. Since the sense strand is complementary to the antisense strand, the two strands, when combined under appropriate conditions, will combine to form a double-stranded structure. The complementary sequence of the dsRNA can also be contained on a single nucleic acid molecule rather than on separate oligonucleotides, as is known in the art.
[0494] The region complementary to the target sequence is 15 to 30 nucleotides long. This invention is intended to encompass a portion of the intermediate range and length of those described.
[0495] dsRNA (or ASO) may also contain one or more single-stranded nucleotide overhangs, such as 1, 2, 3, or 4 nucleotides. dsRNAs having at least one nucleotide overhang have been reported to exhibit unexpectedly superior inhibitory properties compared to their blunt-end counterparts. Nucleotide overhangs may consist of nucleotide / nucleoside analogs, including deoxynucleotide / nucleoside analogs. Overhangs may be present on either the sense strand or the antisense strand, or a combination of both. dsRNA overhangs may contain nucleotides at the 5', 3', or both ends of either the antisense or sense strand. Depending on the embodiment, longer, extended overhangs may be possible.
[0496] In the development of RNA therapeutics, the choice between blunt-ended dsRNAs and those with nucleotide overhangs is crucial. Blunt-ended dsRNAs are simpler and can excite fewer immunogenic responses, making them preferable for minimizing immune reactions. However, dsRNAs with overhangs surpass them by offering enhanced gene silencing efficacy. This advantage stems from better RISC complex involvement, closer similarity to natural RNA processing products, and the advantage of facilitating more effective gene targeting. However, this enhanced functionality comes with drawbacks. Overhangs are associated with increased immunogenic responses and a higher likelihood of off-target interactions. Therefore, the decision between the two types involves careful trade-offs aimed at maximizing therapeutic efficacy while managing the risks of immune activation and unintended gene interactions.
[0497] Ordering The OCA2 siRNA is designed to target the OCA2 gene transcript from the OCA2 gene (NCBI GenBank accession number NM_000275.3). Its nucleotide sequence is as follows: UAAAGAUUCCUGCUUUACAGA (sense strand shown by SEQ ID NO: 67) and UGUAAAGCAGGAAUCUUUAGA (antisense strand shown by SEQ ID NO: 2). The negative control RNA therapeutic agent is purchased from Thermo-Fisher Scientific.
[0498] purification The purification of siRNA (or ASO) can be achieved through several effective methods. Binding to glass fibers, followed by elution, is a common approach, as is gel purification using 15-20% acrylamide gel, which helps remove excess nucleotides, short oligomers, proteins, and salts. Gel electrophoresis is particularly useful for chemically synthesized siRNA and provides precise size selection. In addition, ion-exchange chromatography and reverse-phase HPLC (high-performance liquid chromatography) have become standards for purifying larger batches, providing high purity and specificity by separating molecules based on charge or hydrophobicity, respectively. Another method, size exclusion chromatography, is used due to its ability to separate based on molecular size and is useful for removing smaller impurities. The choice of purification method may depend on purity, yield, and specific requirements for downstream applications, and any other method known to those skilled in the art may also be used for the purpose of RNA purification.
[0499] Pool of siRNA sequences In some uses of the present invention, for example, pooling 2 to 10, preferably 2 to 4, siRNA sequences targeting the OCA2 gene during in vitro and in vivo experiments is recommended to enhance silencing efficacy by addressing multiple mRNA regions, thereby increasing knockdown efficiency.
Claims
1. A method for correcting the eye color of a subject, comprising administering to the subject an effective amount of at least one oculocutaneous albinism 2 (OCA2) protein modulator, or any vehicle, matrix, nanoparticles or microparticles thereof, or any composition containing thereof.
2. The method according to claim 1, wherein at least one of the regulators comprises at least one nucleic acid molecule.
3. The method according to claim 2, wherein the nucleic acid molecule comprises at least one of single-stranded RNA (ssRNA), single-stranded DNA (ssDNA), double-stranded DNA (dsDNA), double-stranded RNA (dsRNA), a nucleic acid molecule having at least one modified nucleotide, and any combination thereof.
4. The method according to claim 2 or 3, wherein the nucleic acid molecule comprises at least one of the following: small interfering RNA (siRNA), antisense oligonucleotide (ASO), guide RNA, short hairpin RNA (shRNA), microRNA (miRNA), peptide nucleic acid (PNA), and locked nucleic acid (LNA).
5. The method according to claim 4, wherein the nucleic acid molecule comprises at least one siRNA molecule, and the siRNA molecule encodes OCA2 or targets at least one sequence that directly or indirectly controls the level and / or activity and / or stability of OCA2.
6. The method according to any one of claims 1 to 5, wherein at least one of the modifiers targets at least one region in the OCA2 transcript.
7. The method according to any one of claims 1 to 6, wherein the modifier inhibits and / or reduces the expression and / or activity and / or stability of OCA2.
8. The method according to claim 7, wherein the inhibition reduces the level of melanin in the target iris tissue.
9. The method according to any one of claims 1 to 8, wherein the OCA2 modifier reduces the expression and / or activity and / or stability of OCA2, and the reduction causes the eye color of the subject to become lighter.
10. The method according to any one of claims 1 to 9, wherein the at least one OCA2 modulator targets the iris bronchus of the subject.
11. The method according to any one of claims 1 to 10, further comprising the step of exposing the object to a light source.
12. The method according to any one of claims 1 to 11, wherein the at least one OCA2 modulator is administered by ocular administration.
13. The method according to any one of claims 1 to 12, wherein the at least one OCA2 modulator is administered by local administration.
14. The method according to claim 13, wherein at least one OCA2 modifier is included in the eye drop formulation.
15. The method according to any one of claims 1 to 14, for cosmetic purposes.
16. The method according to any one of claims 1 to 15, wherein the subject is healthy.
17. The method according to any one of claims 1 to 15, wherein the subject is suffering from a disease.
18. The method according to claim 17, wherein the disease is one of the following: hyperpigmentation eye disorder, ocular glaucoma, Horner's syndrome, or heterochromia iridum.
19. A method for modifying the eye color of a subject, comprising at least one oculocutaneous albinism 2 (OCA2) protein modulator, or any vehicle, matrix, nanoparticles or microparticles thereof, or any composition comprising them, wherein the method comprises administering an effective amount of the at least one OCA2 protein modulator to the subject.
20. A composition for correcting the eye color of a subject, comprising at least one oculocutaneous albinism 2 (OCA2) protein modulator.
21. The composition according to claim 20, wherein the at least one regulator comprises at least one nucleic acid molecule.
22. The composition according to claim 21, wherein the nucleic acid molecule comprises at least one of single-stranded DNA (ssDNA), single-stranded RNA (ssRNA), double-stranded DNA (dsDNA), double-stranded RNA (dsRNA), a nucleic acid molecule having at least one modified nucleotide, and any combination thereof.
23. The composition according to any one of claims 20 to 22, wherein the nucleic acid molecule comprises at least one of the following: small interfering RNA (siRNA), antisense oligonucleotide (ASO), guide RNA, short hairpin RNA (shRNA), microRNA (miRNA), peptide nucleic acid (PNA), and locked nucleic acid (LNA).
24. The composition according to claim 23, wherein the nucleic acid molecule comprises at least one siRNA molecule, and the siRNA molecule encodes OCA2 or targets at least one sequence that directly or indirectly controls the level and / or activity and / or stability of OCA2.
25. The composition according to any one of claims 20 to 24, wherein the at least one OCA2 modifier targets at least one region in the OCA2 transcript.
26. The composition according to any one of claims 20 to 25, wherein the OCA2 modifier inhibits and / or reduces the expression and / or activity and / or stability of OCA2.
27. The composition according to claim 26, wherein the inhibition reduces the level of melanin in the target iris tissue.
28. The composition according to claim 20 or 27, wherein the OCA2 modifier reduces the expression and / or activity and / or stability of OCA2, and the reduction causes the eye color of the subject to become lighter.
29. The composition according to any one of claims 20 to 28, wherein the at least one OCA2 modulator targets the iris bronchus of the subject.
30. The composition according to any one of claims 20 to 29, wherein the at least one OCA2 modifier is encapsulated in at least one nanocarrier or coated with at least one nanocarrier.
31. The composition according to any one of claims 20 to 30, wherein at least one OCA2 modulator is administered by ocular administration.
32. The composition according to claim 20 or 21, wherein at least one OCA2 modulator is administered by local administration.
33. The composition according to claim 32, wherein at least one OCA2 modifier is contained in the eye drop formulation.
34. A composition according to any one of claims 20 to 33, for use in cosmetics.
35. A pharmaceutical composition comprising at least one oculocutaneous albinism 2 (OCA2) protein modulator and at least one of pharmaceutically acceptable carriers, diluents, and / or excipients.
36. The pharmaceutical composition according to claim 35, wherein the composition is defined in any one of claims 20 to 34.
37. A nucleic acid molecule for modifying the eye color of a subject, comprising at least one oculocutaneous albinism 2 (OCA2) protein modulator.
38. The nucleic acid molecule according to claim 37, comprising at least one of single-stranded DNA (ssDNA), single-stranded RNA (ssRNA), double-stranded DNA (dsDNA), double-stranded RNA (dsRNA), a nucleic acid molecule having at least one modified nucleotide, and any combination thereof.
39. The nucleic acid molecule according to claim 37 or 38, wherein the nucleic acid molecule comprises at least one of the following: small interfering RNA (siRNA), antisense oligonucleotide (ASO), guide RNA, short hairpin RNA (shRNA), microRNA (miRNA), peptide nucleic acid (PNA), and locked nucleic acid (LNA).
40. The nucleic acid molecule according to claim 39, wherein the nucleic acid molecule comprises at least one siRNA molecule, and the siRNA molecule encodes OCA2 or targets at least one sequence that directly or indirectly controls the level and / or activity and / or stability of OCA2.
41. A nucleic acid molecule according to any one of claims 37 to 40, which targets at least one region in an OCA2 transcript.
42. A nucleic acid molecule according to any one of claims 35 to 39, which inhibits and / or reduces the expression and / or activity and / or stability of OCA2.
43. The nucleic acid molecule according to claim 42, wherein the inhibition reduces the level of melanin in the target iris tissue.
44. The nucleic acid molecule according to any one of claims 37 to 43, wherein the at least one OCA2 modifier reduces the expression and / or activity and / or stability of OCA2, and the reduction causes the eye color of the subject to become lighter.
45. The nucleic acid molecule according to any one of claims 37 to 44, wherein the nucleic acid molecule is encapsulated in at least one nanocarrier or coated with at least one nanocarrier.
46. A nucleic acid molecule according to any one of claims 37 to 45, for use in cosmetics.
47. A method for treating a disease / disorder in a subject that requires treatment, comprising administering to the subject an effective amount of at least one oculocutaneous albinism 2 (OCA2) protein modulator, or any vehicle, matrix, nanoparticles or microparticles thereof, or any composition containing thereof.
48. The method according to claim 47, wherein the disease / disorder is an eye disorder.
49. The method according to claim 48, wherein the eye disorder is one of heterochromia iridum, Horner's syndrome, or hyperpigmentation.
50. The method according to any one of claims 47 to 49, wherein the composition is the composition described in claims 20 to 36.
51. The method according to any one of claims 47 to 50, wherein the at least one OCA2 regulator comprises at least one nucleic acid molecule, any vector containing the same, or a host cell.
52. The method according to claim 51, wherein the at least one nucleic acid molecule is one of the nucleic acid molecules described in claims 37 to 46, or any vector or host cell containing the same.
53. The method according to any one of claims 47 to 52, wherein the at least one OCA2 modulator is administered by ocular administration.
54. The method according to any one of claims 47 to 53, wherein the at least one OCA2 modulator is administered by local administration.
55. The method according to claim 54, wherein at least one OCA2 modifier is included in the eye drop formulation.
56. At least one oculocutaneous albinism 2 (OCA2) protein modulator, or any vehicle, matrix, nanoparticles or microparticles thereof, or any composition comprising the same, for use in a method of treating a disease / disorder in a subject that requires treatment therefor, wherein the method comprises administering an effective amount of the at least one OCA2 protein modulator to the subject.