Treatment methods for melanocytic diseases
Nucleic acid molecules and CRISPR systems targeting NRAS and BRAF variants address the limitations of current treatments by inhibiting these variants, effectively reducing the risk of melanoma and eliminating nevi, providing a potential cure for melanocytic diseases.
Patent Information
- Authority / Receiving Office
- JP · JP
- Patent Type
- Applications
- Current Assignee / Owner
- THE FRANCIS CRICK INST LTD
- Filing Date
- 2023-10-27
- Publication Date
- 2026-04-30
AI Technical Summary
Current treatments for melanocytic diseases, such as congenital and acquired melanocytic nevi and melanoma, are inadequate in eliminating nevi and preventing the development of melanoma, particularly in cases driven by NRAS and BRAF variants, and are often resistant to conventional therapies.
Development of nucleic acid molecules and CRISPR nuclease systems that target and inhibit the expression of specific gain-of-function NRAS and BRAF variants, utilizing complementary sequences and receptor-targeted nanoparticles for precise delivery to melanocytes, thereby reducing abnormal cell signaling and potentially eliminating nevi and preventing melanoma.
The nucleic acid molecules and CRISPR systems effectively inhibit the expression of NRAS and BRAF variants, rescuing abnormal cell differentiation signaling and reducing the risk of melanoma, offering a potential cure for nevi and prevention of melanoma development.
Smart Images

Figure 2026513654000039 
Figure 2026513654000040 
Figure 2026513654000041
Abstract
Description
Technical Field
[0001] The present invention relates to novel compositions and methods for treating melanocytic diseases. The present invention relates to novel compositions and methods for treating diseases caused by gain-of-function NRAS and BRAF variants, including cancer, particularly melanoma, congenital melanocytic nevi (CMN), and acquired melanocytic nevi (AMN).
Background Art
[0002] NRAS The NRAS gene encodes a protein called N-Ras that is mainly involved in the regulation of cell division. The signal transmitted by NRAS instructs the cell to proliferate or differentiate. The N-Ras protein is a GTPase. To transmit a signal, the N-Ras protein must be activated by binding to a molecule of GTP. The N-Ras protein is inactivated by converting GTP to GDP. When the N-Ras protein is bound to GDP, the N-Ras protein does not transmit a signal to the nucleus.
[0003] The NRAS gene belongs to a class of genes known as oncogenes. When mutated, an oncogene has the potential to transform normal cells into cancer cells. The NRAS gene is in the Ras family of oncogenes, which includes many other genes, including two others that are very commonly mutated in cancer, namely HRAS and KRAS. All three of these proteins play important roles in cell division, cell differentiation, apoptosis, and other processes. Hereditary mutations in the gene NRAS can cause various "RASopathy" syndromes, most commonly Noonan syndrome. Somatic mutations in this gene have been found in many cancers.
[0004] BRAF BRAF is a human gene that codes for a protein called B-Raf. This gene is also known as the proto-oncogene B-Raf and the v-Raf mouse sarcoma virus oncogene homolog B. This protein is also known as the serine / threonine protein kinase B-Raf. B-Raf is a member of the Raf kinase family of growth signaling protein kinases. This protein plays a role in regulating the MAP kinase / ERK signaling pathway, which affects cell division, differentiation, apoptosis, secretion, and other processes.
[0005] Hereditary mutations in BRAF can cause cardiac-facial-cutaneous syndrome, a disorder characterized by heart disease, intellectual disability, and a distinctive facial appearance. Somatic mutations in this gene have been found in cancers including non-Hodgkin lymphoma, colorectal cancer, malignant melanoma, papillary thyroid carcinoma, non-small cell lung cancer, lung adenocarcinoma, glioblastoma, and brain tumors including pleomorphic astrocyteoma, as well as inflammatory diseases such as Erdheim-Chester disease. Congenital melanocytic nevus (CMN)
[0006] Congenital melanocytic nevi (CMN) can cover up to 80% of the body surface area, and giant CMNs, occurring in 1 in 20,000 births, are usually associated with multiple smaller nevi. CMN can be associated with neurological abnormalities sometimes called neurocutaneous melanosis, but since many of these abnormalities are not melanocytic, this term is now often replaced by CMN syndrome. The most common finding in the central nervous system (CNS) is a lesion of melanin-producing cells in the brain parenchyma, which is found on magnetic resonance imaging in about 20% of children with multiple CMNs. Other neurological associations include communicating hydrocephalus, arachnoid cysts, syringomyelia, tumors (including astrocytoma, choroid plexus papilloma, ependymoma, and pineal germ cell tumor), as well as malformations such as Dandy-Walker or Arnold-Chiari. Neurological symptoms in patients with CMN may be present without radiological abnormalities that may be due to lesions below the resolution of MRI. The risk of neurological symptoms is most strongly correlated with MRI CNS findings, rather than with skin phenotype.
[0007] In addition to developmental abnormalities, CMN is a known risk factor for postnatal melanoma. Absolute risk is associated with the severity of the neurocutaneous phenotype, particularly the presence of MRI CNS findings rather than the cutaneous phenotype. In individuals with a severe cutaneous phenotype, the risk of melanoma peaks in childhood, an age at which it is extremely rare in those without it. Importantly, when melanoma develops, the primary tumor is not always located within the skin, but often within the central nervous system (CNS), and sometimes elsewhere. These melanomas in children are usually highly invasive and resistant to treatment. MEK inhibition has been shown to reduce the symptoms of neurocutaneous melanoma and possibly extend lifespan, but it is not curative and does not eliminate the skin lesions.
[0008] Congenital melanocytic nevi are caused by post-conjugation NRAS missense mutations (somatic mutations occurring in utero) in approximately 67% of cases (when all nevus severity levels are combined) and by intrautero-conjugation BRAF missense mutations in approximately 7% of cases. The disease phenotypes are very similar, with the same clinical diagnosis, clinical appearance, and clinical management. There are slight differences in phenotype, with BRAF-CMN being slightly more likely to develop multiple adipose nodules than NRAS-CMN, but this does not lead to differences in clinical outcomes, including the risk of childhood melanoma.
[0009] Acquired melanocytic nevus Acquired melanocytic nevi (AMN) are caused by the same oncogenic mutations as congenital melanocytic nevi, but BRAF mutations are more common than NRAS mutations, and there is a reversal in frequency, making them clinically indistinguishable in appearance, histology, and outcome. Acquired nevi are caused by somatic mutations in melanocytes or melanocyte stem cells in the skin (i.e., mutations that occur after birth). The mechanism of nevus formation is likely to be very similar between CMN and AMN, given that the mutations are the same and there is a large histological overlap between congenital and acquired nevi, particularly the abnormal cells, which are called nevus cells in both cases. In both cases, the nevus makes melanoma more likely to develop, and it is estimated that 50% of melanomas in the normal population originate from acquired melanocytic nevi. Therefore, the proposed treatments can be used not only to eliminate / treat the nevus but also to prevent the development of melanoma. Furthermore, these treatments have potential applications in the cosmetic industry, allowing for the elimination of nevi for cosmetic reasons if desired.
[0010] Sporadic melanoma In normal populations, melanoma is most commonly caused by the same BRAF and NRAS mutations, in that order of frequency. These can arise either de novo in melanocytes or melanocyte stem cells within the skin, creating new melanocyte lesions, or from pre-existing congenital or, more commonly, acquired melanocyte nevi. Melanoma itself requires not only BRAF or NRAS missense mutations but also additional gene mutations (which may be before or after the NRAS or BRAF mutation) to become cancerous. Nevertheless, driver mutations are essential for the process and disease development. [Overview of the Initiative]
[0011] The present invention provides a nucleic acid molecule comprising a first chain of 10 to 50 linked nucleosides, wherein the first chain contains a sequence that is completely complementary to a sequence having at least 90% identity with an isolength portion of mRNA encoding NRAS or BRAF.
[0012] In some embodiments, the first strand includes a sequence that is perfectly complementary to a sequence having at least 90% identity with an isolength portion of the mRNA encoding a gain-of-function variant of NRAS or BRAF.
[0013] In some embodiments, the first chain consists of 10 to 40 linked nucleosides. In some embodiments, the first chain consists of 10 to 30 linked nucleosides. In some embodiments, the first chain consists of 15 to 30 linked nucleosides. In some embodiments, the first chain consists of 15 to 25 linked nucleosides. In some embodiments, the first chain consists of 15 to 20 linked nucleosides. In some embodiments, the first chain consists of 10 to 20 linked nucleosides. In some embodiments, the first chain consists of 20 to 30 linked nucleosides. In some embodiments, the first chain consists of 20 to 25 linked nucleosides. In some embodiments, the first chain consists of 21 linked nucleosides.
[0014] In some embodiments, the first strand includes a sequence that is perfectly complementary to a sequence having at least 95% identity with an isolength portion of the mRNA encoding the variant NRAS p.(G60R), p.(G60V), p.(G60E), or p.(G60D). In some embodiments, the first strand includes a sequence that is perfectly complementary to a sequence having 100% identity with an isolength portion of the mRNA encoding the variant NRAS p.(G60R), p.(G60V), p.(G60E), or p.(G60D). In some embodiments, the nucleic acid molecule can inhibit the expression of variant NRAS p.(G60R / V / E / D) in vitro by at least 20%, at least 30%, at least 40%, at least 50%, at least 60%, at least 70%, at least 80%, or at least 90%. In some embodiments, nucleic acid molecules inhibit the expression of variant NRAS p.(G60R / V / E / D) in vitro to a greater extent than the inhibition of wild-type NRAS expression in vitro. In some embodiments, nucleic acid molecules can partially or completely rescue abnormal cell differentiation signaling in cells expressing variant NRAS p.(G60R / V / E / D).
[0015] In some embodiments, the first strand includes a sequence that is perfectly complementary to a sequence having at least 95% identity with an isolength portion of the mRNA encoding the variant NRAS p.(Q61K), p.(Q61R), p.(Q61H), p.(Q61L), or p.(Q61P). In some embodiments, the first strand includes a sequence that is perfectly complementary to a sequence having 100% identity with an isolength portion of the mRNA encoding the variant NRAS p.(Q61K), p.(Q61R), p.(Q61H), p.(Q61L), or p.(Q61P). In some embodiments, the nucleic acid molecule can inhibit the expression of variant NRAS p.(Q61K / R / H / L / P) in vitro by at least 20%, at least 30%, at least 40%, at least 50%, at least 60%, at least 70%, at least 80%, or at least 90%. In some embodiments, nucleic acid molecules inhibit the expression of variant NRAS p.(Q61K / R / H / L / P) in vitro to a greater extent than the inhibition of wild-type NRAS expression in vitro. In some embodiments, nucleic acid molecules can partially or completely rescue abnormal cell differentiation signaling in cells expressing variant NRAS p.(Q61K / R / H / L / P).
[0016] In some embodiments, the first strand includes a sequence that is perfectly complementary to a sequence having at least 95% identity with an isolength portion of the mRNA encoding the variant NRAS p.(G12R), p.(G12S), p.(G12D), p.(G12P), p.(G12C), p.(G12A), or p.(G12V). In some embodiments, the first strand includes a sequence that is perfectly complementary to a sequence having 100% identity with an isolength portion of the mRNA encoding the variant NRAS p.(G12R), p.(G12S), p.(G12D), p.(G12P), p.(G12C), p.(G12A), or p.(G12V). In some embodiments, nucleic acid molecules can inhibit the expression of variant NRAS p.(G12R / S / D / P / C / A / V) in vitro by at least 20%, at least 30%, at least 40%, at least 50%, at least 60%, at least 70%, at least 80%, or at least 90%. In some embodiments, nucleic acid molecules inhibit the expression of variant NRAS p.(G12R / S / D / P / C / A / V) in vitro to a greater extent than the inhibition of wild-type NRAS expression in vitro. In some embodiments, nucleic acid molecules can partially or completely rescue abnormal cell differentiation signaling in cells expressing variant NRAS p.(G12R / S / D / P / C / A / V).
[0017] In some embodiments, the first strand includes a sequence that is perfectly complementary to a sequence having at least 95% identity with the isolength portion of the mRNA encoding the variant NRAS p.(G13V), p.(G13D), p.(G13A), p.(G13S), p.(G13C), p.(G13R), p.(G13F), or p.(G13Y). In some embodiments, the first strand includes a sequence that is perfectly complementary to a sequence having 100% identity with the isolength portion of the mRNA encoding the variant NRAS p.(G13V), p.(G13D), p.(G13A), p.(G13S), p.(G13C), p.(G13R), p.(G13F), or p.(G13Y). In some embodiments, nucleic acid molecules can inhibit the expression of variant NRAS p.(G13V / D / A / S / C / R / F / Y) in vitro by at least 20%, at least 30%, at least 40%, at least 50%, at least 60%, at least 70%, at least 80%, or at least 90%. In some embodiments, nucleic acid molecules inhibit the expression of variant NRAS p.(G13V / D / A / S / C / R / F / Y) in vitro to a greater extent than the inhibition of wild-type NRAS expression in vitro. In some embodiments, nucleic acid molecules can partially or completely rescue abnormal cell differentiation signaling in cells expressing variant NRAS p.(G13V / D / A / S / C / R / F / Y).
[0018] In some embodiments, the first strand includes a sequence that is perfectly complementary to a sequence having at least 95% identity with the isolength portion of the mRNA encoding the variant BRAF p.(V600G), p.(V600M), p.(V600D), p.(V600R), p.(V600K), or p.(V600E). In some embodiments, the first strand includes a sequence that is perfectly complementary to a sequence having 100% identity with the isolength portion of the mRNA encoding the variant BRAF p.(V600G), p.(V600M), p.(V600D), p.(V600R), p.(V600K), or p.(V600E). In some embodiments, nucleic acid molecules can inhibit the expression of variant BRAF p.(V600G / M / D / R / K / E) in vitro by at least 20%, at least 30%, at least 40%, at least 50%, at least 60%, at least 70%, at least 80%, or at least 90%. In some embodiments, nucleic acid molecules inhibit the expression of variant BRAF p.(V600G / M / D / R / K / E) in vitro to a greater extent than the inhibition of wild-type BRAF expression in vitro. In some embodiments, nucleic acid molecules can partially or completely rescue abnormal cell differentiation signaling in cells expressing variant BRAF p.(V600G / M / D / R / K / E).
[0019] In some embodiments, the nucleic acid molecule is a single-stranded nucleic acid molecule. In some embodiments, the nucleic acid molecule is a double-stranded nucleic acid molecule.
[0020] In some embodiments, the double-stranded nucleic acid molecule comprises a second chain of 10 to 50 linked nucleosides, the second chain being at least partially complementary to the first chain. In some embodiments, the second chain is at least 80% complementary to the first chain. In some embodiments, the second chain is at least 90% complementary to the first chain. In some embodiments, the second chain is at least 95% complementary to the first chain. In some embodiments, the second chain is fully complementary to the first chain.
[0021] In some embodiments, the second chain consists of 10 to 50 linked nucleosides. In some embodiments, the second chain consists of 10 to 40 linked nucleosides. In some embodiments, the second chain consists of 10 to 30 linked nucleosides. In some embodiments, the second chain consists of 15 to 30 linked nucleosides. In some embodiments, the second chain consists of 15 to 25 linked nucleosides. In some embodiments, the second chain consists of 15 to 20 linked nucleosides. In some embodiments, the second chain consists of 10 to 20 linked nucleosides. In some embodiments, the second chain consists of 20 to 30 linked nucleosides. In some embodiments, the second chain consists of 20 to 25 linked nucleosides. In some embodiments, the second chain consists of 21 linked nucleosides.
[0022] In some embodiments, the first strand is longer than the second strand. In some embodiments, the nucleic acid molecule comprises an overhang of one, two, three, four, five, or more nucleosides at the 3'-end of the first strand. In some embodiments, the nucleic acid molecule comprises an overhang of two nucleosides at the 3'-end of the first strand. In some embodiments, the nucleic acid molecule comprises an overhang of one, two, three, four, five, or more nucleosides at the 5'-end of the first strand. In some embodiments, the nucleic acid molecule comprises an overhang of two nucleosides at the 5'-end of the first strand. In some embodiments, the nucleic acid molecule comprises a second strand that is longer than the first strand. In some embodiments, the nucleic acid molecule comprises an overhang of one, two, three, four, five, or more nucleosides at the 3'-end of the second strand. In some embodiments, the nucleic acid molecule comprises an overhang of two nucleosides at the 3'-end of the second strand. In some embodiments, the nucleic acid molecule comprises an overhang of one, two, three, four, five, or more nucleosides at the 5'-end of the second strand. In some embodiments, the nucleic acid molecule comprises an overhang of two nucleosides at the 5'-end of the second strand. In some embodiments, the nucleic acid molecule comprises an overhang of one, two, three, four, five, or more nucleosides at both the 5'-end and 3'-end of the first strand. In some embodiments, the nucleic acid molecule comprises an overhang of two nucleosides at both the 5'-end and 3'-end of the first strand.
[0023] In some embodiments, the overhang comprises two thymine nucleotides (TT). In some embodiments, the overhang consists of two thymine nucleotides (TT).
[0024] In some embodiments, the second strand is It includes a sequence having at least 80%, at least 90%, or at least 95% identity with a sequence selected from the group consisting of sequence numbers 92 to 110, sequence numbers 130 to 148, sequence numbers 168 to 186, sequence numbers 206 to 224, sequence numbers 244 to 262, sequence numbers 282 to 300, sequence numbers 320 to 338, sequence numbers 358 to 376, sequence numbers 396 to 414, sequence numbers 434 to 452, sequence numbers 472 to 490, sequence numbers 510 to 528, sequence numbers 548 to 566, sequence numbers 587 to 606, sequence numbers 626 to 644, sequence numbers 664 to 682, sequence numbers 702 to 720, sequence numbers 740 to 758, sequence numbers 778 to 796, sequence numbers 817 to 836, sequence numbers 857 to 876, sequence numbers 896 to 914, sequence numbers 934 to 952, sequence numbers 972 to 990, sequence numbers 1011 to 1030, sequence numbers 1052 to 1072, sequence numbers 1092 to 1110, sequence numbers 1130 to 1148, sequence numbers 1168 to 1186, sequence numbers 1207 to 1226, sequence numbers 1247 to 1266, sequence numbers 1287 to 1306, or sequence numbers 1326 to 1344.
[0025] In some embodiments, the second strand is It includes a sequence selected from the group consisting of sequence numbers 92 to 110, sequence numbers 130 to 148, sequence numbers 168 to 186, sequence numbers 206 to 224, sequence numbers 244 to 262, sequence numbers 282 to 300, sequence numbers 320 to 338, sequence numbers 358 to 376, sequence numbers 396 to 414, sequence numbers 434 to 452, sequence numbers 472 to 490, sequence numbers 510 to 528, sequence numbers 5 In some embodiments, the second chain is Sequence IDs 92-110, 130-148, 168-186, 206-224, 244-262, 282-300, 320-338, 358-376, 396-414, 434-452, 472-490, 510-528, 548-566, 587-606, 626-644, 664-682, 702-720, 740-758, The sequence consists of sequences selected from the group comprising: column numbers 778-796, sequence numbers 817-836, 857-876, 896-914, 934-952, 972-990, 1011-1030, 1052-1072, 1092-1110, 1130-1148, 1168-1186, 1207-1226, 1247-1266, 1287-1306, or sequence numbers 1326-1344.
[0027] In some embodiments, the nucleic acid molecule is sequence number 7 (NRAS_c.178G>C_p.G60R), sequence number 9 (NRAS_c.179G>T_p.G60V), sequence number 11 (NRAS_c.179G>A_p.G60E), sequence number 13 (NRAS_c.181C>A_p.Q61K), sequence number 15 (NRAS_c.182A>G_p.Q61R), sequence number 17 (NRAS_c.182A>T_p.Q61L), sequence number 19 (NRAS_c.182A>C_p.Q61P), sequence number 21 (NRAS_c.183A>C_p.Q61H). , SEQ ID NO: 23 (NRAS_c.183A>T_p.Q61H), SEQ ID NO: 25 (NRAS_c.35G>T_p.G12V), SEQ ID NO: 27 (NRAS_c.34G>C_p.G12R), SEQ ID NO: 29 (NRAS_c.35G>A_p.G12D), SEQ ID NO: 31 (NRAS_c.34G>A_p.G12S), SEQ ID NO: 33 (NRAS_c.34_35G>C_p.G12P), SEQ ID NO: 35 (NRAS_c.34G>T_p.G12C), SEQ ID NO: 37 (NRAS_c.35G>C_p.G12A), SEQ ID NO: 39 (NRAS_c.37G>A _p.G13S), SEQ ID NO: 41 (NRAS_c.37G>T_p.G13C), SEQ ID NO: 43 (NRAS_c.37G>C_p.G13R), SEQ ID NO: 45 (NRAS_c.37_38delinsTT_p.G13F), SEQ ID NO: 47 (NRAS_c.37_38delinsTA_p.G13Y), SEQ ID NO: 49 (NRAS_c.38G>T_p.G13V), SEQ ID NO: 51 (NRAS_c.38G>A_p.G13D), SEQ ID NO: 53 (NRAS_c.38G>C_p.G13A), SEQ ID NO: 55 (NRAS_c.180_181delin sTA), SEQ ID NO: 57 (NRAS_c.181_183delinsAAG), SEQ ID NO: 59 (BRAF_c.1799T>GpV600G), SEQ ID NO: 61 (BRAF_c.1798G>ApV600M), SEQ ID NO: 63 (BRAF_c.1799_1800delisAT_p.V600D), SEQ ID NO: 65 (BRAF_c.1798_1799delisCG_p.V600R), SEQ ID NO: 67 (BRAF_c.1798_1799delisAA_p.V600K), SEQ ID NO: 69 (BRAF_c.1799_1800delisAA_p.It specifically targets DNA sequences selected from a list consisting of V600E and sequence number 71 (BRAF_c.1799T>ApV600E).
[0028] The present invention provides a nucleic acid molecule and a compound comprising a targeting site according to the present invention. In some embodiments, the targeting site includes lipid nanoparticles, liposomes, exosomes, antibodies or fragments thereof, antigen-binding domains or fragments thereof, peptides, cell-permeable peptides, conjugate groups, or any combination thereof. In some embodiments, the targeting site includes a conjugate group, and the conjugate group includes one or more carbohydrates.
[0029] In some cases, the present invention provides compounds comprising nucleic acid molecules and nanoparticles according to the present invention. The nanoparticles may be receptor-targeted nanoparticles (RTNPs). Receptor-targeted nanoparticles generally exhibit specificity to a particular receptor, cell type, tissue, organ, or other. Thus, receptor-targeted nanoparticles enable targeted delivery of the nucleic acid molecules of the present invention. Nucleic acid molecules may be encapsulated within nanoparticles or receptor-targeted nanoparticles. Receptor-targeted nanoparticles useful in the present invention may contain peptide sequences that bind to a receptor. The receptor may be a KIT receptor. For example, receptor-targeted nanoparticles may contain a peptide sequence having at least 50%, at least 65%, at least 80%, or at least 100% identity with the sequence ISVYMM (SEQ ID NO: 1349). Receptor-targeted nanoparticles may contain a peptide sequence having at least 50%, at least 65%, at least 80%, or at least 100% identity with the sequence NRVTNN (SEQ ID NO: 1350). The receptor may be an integrin. For example, receptor-targeted nanoparticles may contain peptide sequences that have at least 50%, at least 65%, at least 80%, or at least 100% identity with sequence CRGDCL (SEQ ID NO: 1351). Receptor-targeted nanoparticles may also contain peptide sequences that have at least 50%, at least 65%, at least 80%, or at least 100% identity with sequence CDGRCL (SEQ ID NO: 1352).
[0030] In some embodiments, the conjugate group is monosaccharide, disaccharide, trisaccharide, tetrasaccharide, oligosaccharide, polysaccharide, modified polysaccharide, mannose, galactose, mannose derivative, galactose derivative, D-mannopyranose, L-mannopyranose, D-arabinose, L-galactose, D-xylofuranose, L-xylofuranose, D-glucose, L-glucose, D-galactose, L-galactose, aD-mannopyranose, β-D -Mannofuranose, α-D-mannopyranose, β-D-mannopyranose, α-D-glucopyranose, β-D-glucopyranose, α-D-glucofuranose, β-D-glucofuranose, α-D-fructofuranose, α-D-fructopyranose, α-D-galactopyranose, β-D-galactopyranose, α-D-galactofuranose, β-D-galactofuranose, glucosamine, sialic acid, α-D-galac Tosamin, N-acetylgalactosamine, 2-amino-3-O-[(R)-1-carboxyethyl]-2-deoxy-β-D-glucopyranose, 2-deoxy-2-methylamino-L-glucopyranose, 4,6-dideoxy-4-formamide-2,3-di-O-methyl-D-mannopyranoose, 2-deoxy-2-sulfamino-D-glucopyranose, N-glycoyl-α-neuraminic acid, 5-thio-β-D-glu Contains copyranose, methyl 2,3,4-tri-O-acetyl-1-thio-6-O-trityl-α-D-glucopyranoside, 4-thio-β-D-galactopyranoside, ethyl 3,4,6,7-tetra-O-acetyl-2-deoxy-1,5-dithio-α-D-gluco-heptopyranoside, 2,5-anhydro-D-alononitrile, ribose, D-ribose, D-4-thioribose, L-ribose, or L-4-thioribose.
[0031] In some embodiments, the targeting site is attached to the 3' end of the second chain. In some embodiments, the targeting site is attached to the 5' end of the second chain. In some embodiments, the targeting site is attached to the 5' end of the first chain. In some embodiments, the targeting site is attached to the 3' end of the first chain.
[0032] In some embodiments, at least one nucleoside contains a modified sugar. In some embodiments, at least one nucleoside bond is a modified nucleoside bond. In some embodiments, the modified nucleoside bond is a phosphorothioate or phosphorodithioate nucleoside bond. In some embodiments, the nucleic acid molecule contains 1 to 40 phosphorothioate or phosphorodithioate nucleoside bonds. In some embodiments, the nucleic acid molecule contains 1 to 30 phosphorothioate or phosphorodithioate nucleoside bonds. In some embodiments, the nucleic acid molecule contains 1 to 20 phosphorothioate or phosphorodithioate nucleoside bonds. In some embodiments, the nucleic acid molecule contains 1 to 10 phosphorothioate or phosphorodithioate nucleoside bonds.
[0033] The present invention provides a composition comprising a single-stranded nucleic acid molecule or compound according to the present invention, or a salt thereof, and at least one of pharmaceutically acceptable carriers or diluents. The present invention also provides a prodrug comprising the nucleic acid molecule or compound of the present invention.
[0034] The present invention provides a nucleic acid molecule comprising a nucleotide sequence encoding a CRISPR guide RNA (gRNA), the gRNA hybridizing with a target sequence within a cell, the target sequence encoding a variant allele of NRAS or BRAF.
[0035] The present invention provides a CRISPR nuclease system comprising one or more vectors, the vectors being (a) A promoter operably ligated to at least one nucleotide sequence encoding a CRISPR guide RNA (gRNA), wherein the gRNA hybridizes with a target DNA sequence in the target cell, and the target sequence encodes a variant allele of NRAS or BRAF, (b) A nucleotide sequence encoding a nuclease, for example, a Cas nuclease, wherein components (a) and (b) are nucleotide sequences located on the same or different vectors of the system, The gRNA targets and hybridizes with the target DNA sequence, and the nuclease cleaves the target sequence, altering the expression of the NRAS or BRAF variant allele.
[0036] In some embodiments, the CRISPR nuclease system is packaged in a single adeno-associated virus (AAV) particle. In some embodiments, the nuclease is codon-optimized for expression in cells. In some embodiments, the promoter is operably ligated to at least one, two, three, four, five, six, seven, eight, nine, or ten gRNAs.
[0037] In some embodiments, the gRNA targets DNA sequences encoding variant NRAS p.(G60R), p.(G60V), p.(G60E), or p.(G60D). In some embodiments, the gRNA targets DNA sequences encoding variant NRAS p.(Q61K), p.(Q61R), p.(Q61H), p.(Q61L), or p.(Q61P). In some embodiments, the gRNA targets DNA sequences encoding variant NRAS p.(G12R), p.(G12S), p.(G12D), p.(G12P), p.(G12C), p.(G12A), or p.(G12V). In some embodiments, the gRNA targets a DNA sequence encoding the variant NRAS p.(G13V), p.(G13D), p.(G13A), p.(G13S), p.(G13C), p.(G13R), p.(G13F), or p.(G13Y). In some embodiments, the gRNA targets a DNA sequence encoding the variant BRAF p.(V600G), p.(V600M), p.(V600D), p.(V600R), p.(V600K), or p.(V600E). In some embodiments, the gRNA contains a sequence having at least 80%, at least 90%, or at least 95% identity with a sequence selected from the group consisting of SEQ ID NOs. 1345-1347. In some embodiments, the gRNA contains a sequence selected from the group consisting of SEQ ID NOs. 1345-1347. In some embodiments, the gRNA consists of a sequence selected from the group comprising sequence numbers 1345-1347.
[0038] In some embodiments, the target DNA sequences are: SEQ ID NO: 7 (NRAS_c.178G>C_p.G60R), SEQ ID NO: 9 (NRAS_c.179G>T_p.G60V), SEQ ID NO: 11 (NRAS_c.179G>A_p.G60E), SEQ ID NO: 13 (NRAS_c.181C>A_p.Q61K), SEQ ID NO: 15 (NRAS_c.182A>G_p.Q61R), SEQ ID NO: 17 (NRAS_c.182A>T_p.Q61L), SEQ ID NO: 19 (NRAS_c.182A>C_p.Q61P), SEQ ID NO: 21 (NRAS_c.183A>C_p.Q61 H), SEQ ID NO: 23 (NRAS_c.183A>T_p.Q61H), SEQ ID NO: 25 (NRAS_c.35G>T_p.G12V), SEQ ID NO: 27 (NRAS_c.34G>C_p.G12R), SEQ ID NO: 29 (NRAS_c.35G>A_p.G12D), SEQ ID NO: 31 (NRAS_c.34G>A_p.G12S), SEQ ID NO: 33 (NRAS_c.34_35G>C_p.G12P), SEQ ID NO: 35 (NRAS_c.34G>T_p.G12C), SEQ ID NO: 37 (NRAS_c.35G>C_p.G12A), SEQ ID NO: 39 (NRAS_c.37G) >A_p.G13S), SEQ ID NO: 41 (NRAS_c.37G>T_p.G13C), SEQ ID NO: 43 (NRAS_c.37G>C_p.G13R), SEQ ID NO: 45 (NRAS_c.37_38delinsTT_p.G13F), SEQ ID NO: 47 (NRAS_c.37_38delinsTA_p.G13Y), SEQ ID NO: 49 (NRAS_c.38G>T_p.G13V), SEQ ID NO: 51 (NRAS_c.38G>A_p.G13D), SEQ ID NO: 53 (NRAS_c.38G>C_p.G13A), SEQ ID NO: 55 (NRAS_c.180_181deli nsTA), SEQ ID NO: 57 (NRAS_c.181_183delinsAAG), SEQ ID NO: 59 (BRAF_c.1799T>GpV600G), SEQ ID NO: 61 (BRAF_c.1798G>ApV600M), SEQ ID NO: 63 (BRAF_c.1799_1800delisAT_p.V600D), SEQ ID NO: 65 (BRAF_c.1798_1799delisCG_p.V600R), SEQ ID NO: 67 (BRAF_c.1798_1799delisAA_p.V600K), SEQ ID NO: 69 (BRAF_c.1799_1800delisAA_p.The sequence is selected from V600E), sequence number 71 (BRAF_c.1799T>ApV600E), or a combination thereof.
[0039] The present invention provides a method for treating a patient having a disease or disorder related to or driven by overexpression of NRAS, comprising administering a nucleic acid molecule, compound, composition, prodrug, or CRISPR nuclease system according to the present invention to the patient. The present invention provides a method for treating a patient having a disease or disorder related to or driven by a variant of NRAS, comprising administering a nucleic acid molecule, compound, composition, prodrug, or CRISPR nuclease system according to the present invention to the patient.
[0040] The present invention provides a method for treating patients having a disease or disorder associated with or driven by BRAF overexpression, comprising administering a nucleic acid molecule, compound, composition, prodrug, or CRISPR nuclease system according to the present invention to the patient. The present invention provides a method for treating patients having a disease or disorder associated with or driven by a variant of BRAF, comprising administering a nucleic acid molecule, compound, composition, prodrug, or CRISPR nuclease system according to the present invention to the patient.
[0041] The present invention provides a method for treating a patient having a melanocyte disease, disorder, or lesion, comprising administering a nucleic acid molecule, compound, composition, prodrug, or CRISPR nuclease system according to the present invention to the patient.
[0042] The present invention provides a method for treating a patient having congenital melanocytic nevus (CMN), comprising administering a nucleic acid molecule, compound, composition, prodrug, or CRISPR nuclease system according to the present invention to the patient. The present invention also provides a method for treating a patient having acquired melanocytic nevus (AMN), comprising administering a nucleic acid molecule, compound, composition, prodrug, or CRISPR nuclease system according to the present invention to the patient.
[0043] The present invention provides a method for treating a patient having mosaic disorder, comprising administering a nucleic acid molecule, compound, composition, prodrug, or CRISPR nuclease system according to the present invention to the patient. The present invention also provides a method for treating a patient having cancer, comprising administering a nucleic acid molecule, compound, composition, prodrug, or CRISPR nuclease system according to the present invention to the patient.
[0044] In some embodiments, cancer is selected from a list consisting of melanoma, adrenal cancer, autonomic ganglion cancer, biliary tract cancer, bone cancer, breast cancer, central nervous system cancer, cervical cancer, endometrial cancer, eye cancer, fallopian tube cancer, female reproductive organ cancer, gastrointestinal cancer, reproductive organ cancer, hematopoietic cancer, lymphatic system cancer, kidney cancer, colorectal cancer, liver cancer, lung cancer, meningeal cancer, esophageal cancer, ovarian cancer, pancreatic cancer, parathyroid cancer, penile cancer, perineal cancer, peritoneal cancer, pituitary cancer, placental cancer, pleural cancer, prostate cancer, salivary gland cancer, skin cancer, small intestine cancer, soft tissue cancer, stomach cancer, testicular cancer, thymus cancer, thyroid cancer, upper respiratory tract and gastrointestinal cancer, urinary tract cancer, adnexal cancer, vaginal cancer, and vulvar cancer. In some embodiments, cancer is melanoma. In some embodiments, cancer is blood cancer, meningeal cancer, adrenal cancer, or thyroid cancer.
[0045] The present invention provides a method for treating benign tumors in a subject, comprising administering a nucleic acid molecule, compound, composition, prodrug, or CRISPR nuclease system according to the present invention to the subject. Benign lesions, particularly benign tumors such as colon polyps and thyroid nodules, have been shown to be associated with mutations in NRAS and BRAF (Marotta, V., Bifulco, M. & Vitale, M. Significance of RAS Mutations in Thyroid Benign Nodules and Non-Medullary Thyroid Cancer. Cancers (Basel) 13 (2021); Dos Santos, W. et al. Somatic targeted mutation profiling of colorectal cancer precursor lesions. BMC Med Genomics 15, 143 (2022)). Benign tumors may be associated with variants of NRAS or may be driven by variants of NRAS and / or overexpression of NRAS. In some cases, the method comprises administering a compound or composition that specifically targets a variant allele of NRAS to the subject. In some embodiments, the variant allele of NRAS includes a mutation that causes a p.(Q61K / R / H / L / P) substitution. In some embodiments, the variant allele of NRAS includes a mutation that causes a p.(G12R / S / D / P / C / A / V) substitution. In some embodiments, the variant allele of NRAS includes a mutation that causes a p.(G13V / D / A / S / C / R / F / Y) substitution. In some embodiments, the variant allele of NRAS includes a mutation that causes a p.(G60R / E / D / V) substitution. Benign tumors may be associated with variants of BRAF or may be driven by overexpression of variants of BRAF and / or NRAS. In some cases, the method includes administering a compound or composition that specifically targets a variant allele of BRAF to the target.
[0046] The present invention provides a method for treating polyps, such as colon polyps, in a subject, comprising administering a nucleic acid molecule, compound, composition, prodrug, or CRISPR nuclease system according to the present invention to the subject.
[0047] The present invention provides a method for treating thyroid nodules in a subject, comprising administering a nucleic acid molecule, compound, composition, prodrug, or CRISPR nuclease system according to the present invention to the subject.
[0048] In some embodiments, the nucleic acid molecule, compound, composition, or prodrug according to the present invention is administered in combination with a second therapeutic agent.
[0049] The present invention provides a method for treating a patient having congenital melanocytic nevus (CMN), comprising administering to the patient a compound or composition that specifically targets a variant allele of NRAS. The present invention also provides a method for treating a patient having cancer, comprising administering to the patient a compound or composition that specifically targets a variant allele of NRAS. In some embodiments, the variant allele of NRAS includes a mutation that causes a p.(Q61K / R / H / L / P) substitution. In some embodiments, the variant allele of NRAS includes a mutation that causes a p.(G12R / S / D / P / C / A / V) substitution. In some embodiments, the variant allele of NRAS includes a mutation that causes a p.(G13V / D / A / S / C / R / F / Y) substitution. In some embodiments, the variant allele of NRAS includes a mutation that causes a p.(G60R / E / D / V) substitution.
[0050] The present invention provides a method for treating a patient having a congenital melanocytic nevus (CMN), comprising administering to the patient a compound or composition that specifically targets a variant allele of BRAF. The present invention also provides a method for treating a patient having cancer, comprising administering to the patient a compound or composition that specifically targets a variant allele of BRAF. In some embodiments, the variant allele of BRAF includes a mutation that causes a p.(V600G / M / D / R / K / E) substitution.
[0051] The present invention provides expression constructs comprising nucleic acid molecules, compounds, compositions, prodrugs, or nucleic acid molecules encoding a CRISPR nuclease system according to the present invention. The present invention provides isolated nucleic acid molecules, compounds, compositions, prodrugs, or CRISPR nuclease systems encoding the present invention. The present invention provides vectors comprising isolated nucleic acid molecules according to the present invention. In some embodiments, the vector is a viral vector, a retroviral vector, an expression cassette, or a plasmid. In some embodiments, the vector further comprises an RNA polymerase III or RNA polymerase II promoter. In some embodiments, the RNA polymerase III promoter is a U6 or H1 promoter.
[0052] The present invention provides host cells comprising nucleic acid molecules, compounds, compositions, prodrugs, or CRISPR nuclease systems according to the present invention, isolated nucleic acid molecules according to the present invention, or vectors according to the present invention. In some embodiments, the host cells are mammalian host cells. In some embodiments, the host cells are human host cells.
[0053] In some embodiments, nucleic acid molecules, compounds, compositions, or prodrugs are formulated for delivery by lipid-based nanoparticles, liposomes, exosomes, polymer nanoparticles, inorganic nanoparticles, or ruxolitinib and thalidomide co-delivered polymer electrolyte nanocomplexes (RTNPs). In some embodiments, nucleic acid molecules, compounds, compositions, prodrugs, or CRISPR nuclease systems are not packaged for delivery (gymnotic delivery). In some embodiments, nucleic acid molecules, compounds, compositions, prodrugs, or CRISPR nuclease systems are administered by injection. In some embodiments, nucleic acid molecules, compounds, compositions, prodrugs, or CRISPR nuclease systems are injected using microneedles. In some embodiments, nucleic acid molecules, compounds, compositions, prodrugs, or CRISPR nuclease systems are administered topically. In some embodiments, administration further includes electroporation or ultrasound. [Brief explanation of the drawing]
[0054] [Figure 1]Identification of siRNAs with allele-recognition ability against the NRAS c.181C>A mutation. (a) Experimental design for selecting the optimal siRNA candidate targeting NRAS c.181C>A. (b) siRNAs capable of knocking down variant NRAS transcripts were designed using a “walking” approach across the target mutation (gray vertical bar NRAS c.181C>A). The 3' end of the siRNA complementary sequence is completed with two uracil nucleotides that have been reported to improve their activity. Note that the sequences illustrated in the panel are passenger strands to facilitate interpretation of the corresponding nucleotides. siRNAs 1, 8, and 15 are color-coded for reference in other panels of this figure. (c) The effect of siRNA treatment on NRAS transcript expression was investigated by qPCR. siRNA 8 (blue) and siRNA 15 (red) were selected based on their tendency to reduce variant NRAS transcripts but not WT NRAS transcripts. siRNA1 (green) was included in these experiments as a control because it minimized both variant and WT NRAS expression. (d) Evaluation of allele discrimination ability. Positive values indicate specificity for NRAS c.181C>A mRNA transcripts, and negative values indicate specificity for NRAS WT mRNA transcripts. [Figure 2] Evaluation of candidate siRNA specificity. The qPCR data from the previous experiment was validated using RNA-seq to confirm that the selected candidates selectively minimized the expression of A) variant NRAS compared to B) WT NRAS (n=3, SEM), C) WT KRAS, and D) WT HRAS. E) Volcano plot showing the effect of candidate siRNAs on the transcriptome of variant NRAS cells (E) and WT NRAS cells (F). The circles indicate the location of NRAS in this dataset. G) The analysis of RNA-seq data was narrowed down to the computer-predicted targets of each RNA. BLAST was performed on the human cDNA database for each siRNA sequence. Genes with close homology (i.e., predicted off-targets) were examined in the RNA-seq dataset. The gene with the most reduced expression for each siRNA is illustrated (n=3, SEM). [Figure 3] In vitro proliferation of NRAS variant cells derived from patients with congenital melanocyte nevus (CMN). (a) In vitro culture of CMN patient-derived nevus cells without feeder cells. (b) Ptychographic images of CMN patient-derived nevus cells. (c) Cell counts of CMN-derived nevus cell cultures from four patients over 24 hours. (d) Nuclear SOX10 and cytoplasmic tyrosinase expression in proliferating (EdU) nevus cells (d(i)) and non-dividing (EdU-) cells (ii). (e) Selective proliferation of CMN-derived nevus cells reveals somatic NRAS c.181C>A (patient number) or relatively few NRAS c.182A>G (patient number) appearing as heterozygous reads in Sanger sequencing. (f) Various nevus cell morphologies, from nonpolar cells to more complex and expanded multipolar cells. (g) Evaluation of classification tools presented as confusion matrices. (h) Proportion of each cell morphology in cell lines from four different patients. [Figure 4]Treatment of nevus cells with anti-NRASQ61KsiRNA reduces MAPK activation and proliferation. (a) Experimental design to evaluate proliferation of CMN patient-derived nevus cells after treatment with anti-NRASQ61KsiRNA. (b) Relative levels of NRASWT mRNA normalized to untreated cells after anti-NRASQ61KsiRNA treatment. (c) Relative levels of NRASQ61K mRNA normalized to untreated cells after anti-NRASQ61KsiRNA treatment. (d) Relative levels of total NRAS protein normalized to untreated cells after anti-NRASQ61KsiRNA treatment. (e) Relative activation of the MAPK signaling pathway normalized to untreated cells after anti-NRASQ61KsiRNA treatment. (f) Western blots showing relative levels of total NRAS, pERK, total ERK, and vinculin after anti-NRASQ61KsiRNA treatment in two CMN patient-derived nevus cell cultures. (g) Ptychography images of nevus cells 2 days after siRNA treatment. (h) Cell count for anti-NRASQ61KsiRNA-treated cells over 24 hours. (i) EdU-positive nevus cells (SOX10 / tyrosinase) after trametinib and / or anti-NRASQ61KsiRNA treatment. (j) Quantification of EdU-positive nevus cells normalized to untreated cells after trametinib and / or anti-NRASQ61KsiRNA treatment. All error bars = standard deviation. (b-h) N=4 patients. (i-j) N=3 patients. [Figure 5]Treatment of nevus cells derived from CMN patients with anti-NRASQ61K siRNA and characteristics of nevus cells (expression / morphology). (a) Percentage of each cell morphology in cell lines from four different patients after treatment with anti-NRASQ61K siRNA8. (b-e) Effects of siRNA on nevus cell morphology. N=4, bar=SD, two-sided t-test. (f) Treatment of EdU-positive cells with anti-NRASQ61K siRNA8 (N=9, bar=SD). (g) Treatment of tyrosinase expression with anti-NRASQ61K siRNA8 (N=9, bar=SD). (h) Treatment of SOX10 expression with anti-NRASQ61K siRNA8 (N=9, bar=SD). (i) Treatment of MITF expression with anti-NRASQ61K siRNA8 (N=9, bar=SD). (j) Treatment of nestin expression with anti-NRASQ61K siRNA8 (N=9, bar=SD). [Figure 6] Intradermal delivery of siRNA-containing lipid nanoparticles to nevus cell sites in human and mouse skin. (a) Lipid nanoparticles containing siRNA were injected into the dermis of biopsy material taken from a human with CMN (NRASQ61K-positive patient) using a microneedle. (b) Control skin from the same patient. (c) Lipid nanoparticles containing siRNA were injected into the dermis of a CMN mouse model (Tg(Tyr-NRAS*Q61K)1Bee) using a microneedle. (d) Control skin from the same mouse. [Figure 7] Identification of three sgRNAs covering the NRAS c.(181C>A) mutation. The wild-type allele c.(181C) is highlighted in red, the sgRNA sequence in green, and the corresponding SaCas9 PAM sequence in blue. The bases of locus c.(181) are highlighted in yellow to indicate the change from the wild-type allele c.(181C) to the target variant allele c.(181A). [Figure 8]Enzymatic digestion is used to confirm the correct insertion of sgRNA1-3 into the plasmid vector px601. BciVI enzymatic digestion screening is performed on three colonies (plasmids 1, 2, and 3) to confirm either sgRNA1 or sgRNA2 insertion into the px601 plasmid. This shows EarI enzymatic digestion screening on four colonies (plasmids 1-4) to confirm sgRNA3 insertion into the px601 plasmid. The negative control consists of a px601 plasmid with no attempted insertions. The positive control consists of plasmids previously obtained and confirmed by sequencing to contain the sgRNA1 insertion. The expected fragment size (bp) breakdown is shown below the agarose gel image. Fragmentation size was estimated using the Serial Cloner v.2.6.1 program. [Figure 9] BciVI enzyme screening demonstrating correct insertion of sgRNA1 and sgRNA2 into the px601-GFP plasmid in all tested colonies. Three plasmids were tested for insertion of either sgRNA1 or sgRNA2. The last lane included a negative control of px601-GFP without insertions. GFP sgRNA 1.1, 1.2, and 1.3 were three distinct colonies screened for insertion of sgRNA1 into the px601-GFP plasmid. GFP sgRNA 2.1, 2.2, and 2.3 were three distinct colonies screened for insertion of sgRNA2 into the px601-GFP plasmid. Fragmentation size was estimated using the Serial Cloner v.2.6.1 program. [Figure 10] EarI enzyme screening demonstrating correct insertion of sgRNA3 into px601-GFP plasmids in all tested colonies. Three px601-GFP plasmids (GFP sgRNA 3.1, 3.2, and 3.3) were screened for sgRNA3 insertion. The last lane includes a negative control of px601-GFP without insertion. Fragmentation size was estimated using the Serial Cloner v.2.6.1 program. [Figure 11]T7 enzyme digestion demonstrating the presence of allele-specific gene editing by px601-GFP-sgRNA2 in the HCT116-Q (NRAS variant) cell line. Digestion of an 827 bp PCR product with T7 enzyme yielded two fragments of sizes 372 and 455 bp in positive results. The figure shows triple biological repeats of each sgRNA in both HCT116-P and HCT116-Q cell lines, with the first sample labeled HCT116-P 1.1 being the result of the first repeat of transfection with px601-GFP-sgRNA1 in the HCT116-P cell line. Cells were transfected 48 hours prior to DNA extraction using 250 ng of DNA and 3 μL of Lipofectamine® 2000 per well in a 24-well plate. [Figure 12] Sequencing data of single-cell colonies showing gene editing by sgRNA1 and 2 in the HCT116-Q cell line only. DNA sequences of all edited single-cell colonies compared to both NRAS wild-type sequences and NRAS variant c.(181C>A) sequences. The NRAS c.(181) locus is highlighted in red for the wild-type allele and in yellow for the variant allele. Cells highlighted in blue indicate the result of a gene editing event. Table 1 shows all deletions by px601-GFP-sgRNA2 in HCT116-Q. Table 2 shows insertions by px601-GFP-sgRNA1 in HCT116-Q colony 12, the result shown across two rows despite being a single sample due to the size of the insertion. Table 3 shows all deletions by px601-GFP-sgRNA1 in HCT116-Q colony 18. Table 4 shows the indels induced by px601-GFP-sgRNA1 in colony 16 of HCT116-Q. Single-cell colonies that did not show any gene editing are not shown. [Figure 13]The effects of candidate siRNAs on the MAPK pathway. siRNAs reduced p-ERK in NRAS variant cell lines (c.181C>A, NRASQ61K) compared to NRAS wild-type cell lines (c.181C, NRASWT). Total ERK and GAPDH were included as loading controls for comparison. [Figure 14] Treatment of nevus cells with siRNA8. a. Relative proliferation rate assessed by EdU uptake during the last 24 hours of siRNA8 treatment (48 hours). b. Relative proliferation of nevus cells during 48 hours of treatment (24-48 hours) using ptychography imaging / analysis. c. RNAseq normalized counts for NRAS. The percentage of NRASWT and NRASQ61K transcripts was calculated based on reads covering the locations of NRAS variants. d. Volcano plot illustrating magnification changes and false-find rates. Genes with extremely strong significance and magnification changes are labeled. e. Heatmap illustrating genes in pathways responsive to siRNA8 (*Metascape WP2290 RALA downstream regulatory gene, M53 PID INTEGRIN3 pathway, GO0007346 mitotic cell cycle regulation, GO:0007272 neuronal sheathing, GO:0008366 axon sheathing), as well as melanocyte stem cell and differentiation-related genes that were relatively unaffected. N=7 patients, bars = mean, error bars = SD, unpaired one-sided t-test. N=4 patients, points = mean, error bars = SD, one-way ANOVA. [Figure 15]Targeting of NRAS variants in nevus cells derived from CMN patient tissue. a. Dose-dependent effects on NRASWT (gray) and NRASc.181C>A (black) transcript expression after 48 hours of treatment of nevus cells with different concentrations of siRNA8 (siNRASQ61K). RNAiMAX was used as the delivery vector, and arrows indicate the concentrations recommended by the manufacturer's protocol. Two patient-derived nevus cell lines were tested (individual circles at each time point), and the dotted line represents the average of the two. b. Western blots of protein lysates taken from all nevus patient cell cultures treated with siCTRL or siNRASQ61K for 48 hours. All images are from the same blot. Chemiluminescence imaging was required to detect NRAS protein levels because it was more sensitive than Odyssey. Odysee (fluorescence) was required to assess pERK levels because it allowed for simultaneous measurement of total ERK and pERK using secondary antibodies conjugated to fluorophores of different wavelengths. c, d. Effects of 48-hour siNRASQ61K treatment of nevus cells on NRAS homologs KRAS(g) and HRAS(h). e. Enriched top 10 pathways from genes whose expression was altered by 48-hour siNRASQ61K treatment of nevus cells (criterion: >1x, <-1x, p≦0.05). f. Percentage of nevus cells at each stage of the cell cycle after 48-hour siNRASQ61K treatment (estimated based on DNA content). [Figure 16]Treatment of nevus cells with siNRASQ61K induces endoplasmic reticulum (ER) stress and apoptosis. a. Local ER expression of ARL6IP1 in patient-derived nevus cells. b-e. After 48 hours of treatment with siNRASQ61K, ARL6IP1 mRNA expression decreased (b), ARL6IP1 protein expression decreased (c), ER stress sensor ERN1 (IRE1) expression increased (d), and anti-apoptotic survivor (BIRC5) expression decreased (e). f. Caspase 3 / 7 activity over 7 days in cells treated with siNRASQ61K. N=7 patients (b, d, e), N=8 patients (c), bar = mean, error bar = SD, unpaired one-sided t-test. N=4, bar = mean, error bar = SD, two-way ANOVA (f). [Figure 17] Gene expression and antibody reactivity of nevus cells (NRAS c.181C>A(p.Q61K)) treated with siNRASQ61K for 48 hours. a, TYR, b, SOX10, c, MITF, d, NES, e, DCT, f, CDKN2A, g, P53, and h, RNA-seq data (normalized counts) and relative signal intensity of antibody reactivity for ARL6IP1 (quantification of ARL6IP1 antibody reactivity is described in the text). N=7 (individual values), bar=mean, error bar=SD, paired t-test. i, Immunocytochemical staining showing decreased ARL6IP1 (magenta) expression in response to 48-hour siNRASQ61K treatment. ARL6IP1 was evaluated with antibodies targeting ribophorin 1 (endoplasmic reticulum, green). [Figure 18]Target genes in the HCT116 dataset and endoplasmic reticulum stress-related genes in the nevus cell RNA-seq dataset. a-c, RNA-seq expression data after 48 hours of treatment of HCT116 cells (c.181C>A, NRASQ61K) with siNRASQ61K. a, Volcano plot showing equivalent decreases in ARL6IP1 (ARMER, an apoptosis regulator in the endoplasmic reticulum membrane) and NRAS expression. b, Decrease in ARL6IP1 expression after treatment with siNRASQ61K. c, Decrease in survival (BIRC5) expression after treatment with siNRASQ61K. d-f, RNA-seq expression data of three major ER stress regulators ERN1 (IRE1) (d), EIF2AK3 (PERK) (e), and ATF6 (f) after 48 hours of treatment of nevus cells with siNRASQ61K. g, No statistically significant difference was obtained in qPCR validation of the EIF2AK3 results in RNA-seq. N=7, bars = mean, error bars = standard deviation, independent two-tailed t-test. [Figure 19] Treatment of nevus cells with siNRASQ61K enables efficacy and synergy with trametinib. A. Caspase 3 / 7 activity in patient nevus cells after 5 days of treatment with siNRASQ61K in combination with two concentrations (5 nM and 12.5 nM) of trametinib. B. Caspase 3 / 7 activity in cells treated with 12.5 nM trametinib (dotted line) or without (solid line) in combination with siNRASQ61K over 5 days. N=4 patients, (a) bar=mean, error bar=SD, one-way ANOVA. N=5 technical replicates for each patient, dot=mean, error bar=SD, one-way ANOVA (b). [Figure 20] Effects of low-concentration trametinib and siRNA combination treatment on cell proliferation. Quantification of EdU assay in nevus cells (NRAS c.181C>A(p.Q61K)) (N=4) treated with siNRASQ61K for 5 days in combination with low concentrations (5 nM and 12.5 nM) of trametinib. Cells were treated with EdU during the last 24 hours of the 5-day treatment. [Figure 21]In vivo delivery and knockdown of nevus cell-generating NRAS variants using siRNA8-loaded lipid nanoparticles. A. Intradermal injection of siRNA-cy5 encapsulated in lipid nanoparticles into nevus patient biopsy material. B. siRNA encapsulated in lipid nanoparticles was successfully delivered to dermal cells in nevus patient biopsy material. C. Relatively small amounts of siRNA not encapsulated in lipid nanoparticles were delivered to dermal cells in nevus patient biopsy material. D. Expression of nevus-generating NRAS variants driven by melanocyte-specific tyrosinase promoters generated ectopic pigment cells in the dermis and subcutaneous tissue of Tyr::NRASQ61K mice. E. Ectopic pigment cells were not present in the dermis and subcutaneous tissue of NRASWT mice. F. Intradermal injection of Tyr::NRASQ61K mice using siRNA8 reduced the expression of nevus cell-generating NRAS variants. G. Intradermal injection of Tyr::NRASQ61K mice with siRNA8 did not reduce the expression of endogenous mouse NrasWT. N=8, data pooled together from two experiments, dots = individual mice (filled circles = mice treated for 24 hours, white circles = mice treated for 48 hours), bars = mean, error bars = SD, unpaired one-sided t-test (f, g). [Figure 22]Lipid nanoparticles. a) size (zeta-mean diameter), b) charge (zeta potential), and c) siRNA encapsulation were evaluated for lipid nanoparticles formulated in different ratios. d) Formulation of lipid nanoparticles in a 1:4:1 (lipid:peptide:siRNA) ratio provided better protection of siRNA from RNases than siRNA alone. e) Visualization of RTNPs and f) Particle size distribution calculated using a NanoSight instrument (Malvern). g. Delivery of siRNA-cy5 to nevus cells using RTNP formulated with different peptides (KKKKKKKKKKKKKKKKGACXXXXXXCG) (SEQ ID NO: 1348) having targeting motifs (XXXXXX): ISVYMM (SEQ ID NO: 1349) (reported to bind to KIT), NRVTNN (SEQ ID NO: 1350) (predicted to bind to KIT), CRGDCL (SEQ ID NO: 1351) (reported to bind to α5β1, αvβ5, and αvβ3 integrins), and CDGRCL (SEQ ID NO: 1352) (no known target). [Figure 23] Intradermal delivery of siRNAQ61K in a mouse model of CMN. a. Tyr::NRASQ61K mice (Tg(Tyr-NRAS*Q61K)1Bee) in which the expression of the human disease-causing variant NRAS c.181C>A,p.(Q61K) is driven by an endogenous mouse tyrosinase promoter. b. Mice heterozygous for the transgene exhibit widespread hyperpigmentation of the skin with accumulation of melanin-producing cells in the dermis, highly replicating the human phenotype of CMN. c, d. Skin biopsy material collected 1 hour after a single intradermal injection of c, fluorescent siRNA-Cy5 in lipid nanoparticles, or d. lipid nanoparticles only. [Figure 24]siRNA treatment of BRAF mutant melanoma cell lines. A375 and SKMEL28 are homozygous mutant cell lines, while A2058 and G-361 are heterozygous cell lines. siSCRA was used as a negative control, and siUBB was used as a positive control for caspase activation. A) Proliferation analysis measured by confluence rate. Data are shown as mean ± SD of 3-well cells. B) Apoptosis analysis measured by caspase 3 / 7 activity. Data are shown as mean ± SD of 3-well cells. Statistical difference between siSCRA and siBRAFV600E examined by unpaired t-test, p>0.05. [Figure 25] siRNA treatment of BRAF mutant melanoma cell lines. The results are the same as those shown in Figure 24, but the positive control siUBB is not shown to allow for better visualization of the changes. [Figure 26] siRNA treatment of leptomeningeal melanocytosis (LM). A) Confluence % of primary nevus cell cultures isolated from biopsy material of LM patients and treated with siRNA8 targeting variant NRAS. B) Caspase 3 / 7 activation in primary nevus cell cultures isolated from biopsy material of LM patients and treated with siRNA8 targeting variant NRAS. ****p<0.0001. [Modes for carrying out the invention]
[0055] definition The following provides definitions of terms, technical means, and specific embodiments used herein.
[0056] As used herein, the terms “mosaic” or “genetic mosaic” refer to a condition in multicellular organisms in which a single organism has multiple genotypes as a result of a genetic mutation in a single cell during embryonic or fetal development. Subsequently, all offspring of that cell carry the same mutation, and in addition, the mutation is present only in those cells. The most recent consensus definition is a condition in which multiple genotypes coexist by birth in an individual derived from a single zygote, resulting in a disease phenotype [1], although the phenotype may not appear until some point after birth. Genetic mosaicism can arise from many different molecular mechanisms and can result in mosaicism at different genetic levels—for example, mosaicism can be associated with a single point mutation or aneuploidy of an entire chromosome. A mosaic variant can be passed on to future generations as a germline heterozygous mutation if two conditions are met: firstly, it affects germ cells (which is usually not detectable), and secondly, the mutation is compatible with germline survival (which is often known from epidemiological studies, but not always) [1, 2, 3]. Mosaicism is sometimes used to explain the coexistence of two genotypes in a single individual where a variant or mutation develops after birth.
[0057] As used herein, the term “gain-of-function variant” refers to any variant in a gene that confers a novel or enhanced function to the protein encoded by that gene (i.e., the variant protein), either with respect to its intrinsic function or its effect on interacting molecules or cascades of molecular interactions, which may act through alterations in the protein’s intrinsic activity or through alterations in its interactions with other molecules. A gain-of-function variant may be a deletion, insertion, or substitution of one or more nucleotides in a gene that causes an alteration in the function of the encoded protein. In one embodiment, a gain-of-function variant alters the function of the variant protein or alters its interactions with other proteins. In another embodiment, a gain-of-function mutation may, for example, cause a decrease or elimination of the normal wild-type protein through interaction between the modified variant protein and the normal wild-type protein. In another embodiment, a gain-of-function variant may cause an increase or decrease in the normal function of the protein, resulting in some or all of its activity or downstream effects being increased, exaggerated, or amplified under constitutive and / or related physiological stimuli.
[0058] The term "variant" can encompass both disease-causing gene mutations and benign mutations that do not affect gene function. This includes all types of DNA changes that result in protein alterations, such as deletions, additions, or substitutions of nucleotides or multiple nucleotides in a gene that cause changes in the amino acid sequence of the encoded protein.
[0059] An "expression construct" may be, for example, a viral vector, a retroviral vector, an expression cassette, or a plasmid. An expression construct may also have an RNA polymerase II promoter sequence or an RNA polymerase II promoter sequence, such as the U6 snRNA promoter of the H1 promoter. The expression constructs of the present invention include, but are not limited to, any construct suitable for use in a suitable expression system, retroviral vectors, linear expression cassettes, plasmids, and viruses or virus-derived vectors known in the art. Such expression constructs may include one or more inducible promoters, RNA Pol III promoter systems such as the U6 snRNA promoter or the HI RNA polymerase III promoter, or other promoters known in the art. A construct may include one or both strands of siRNA. An expression construct expressing both strands may include a loop structure linking both strands, or each strand may be transcribed separately from separate promoters within the same construct. Alternatively, each strand may be transcribed from a separate expression construct.
[0060] As used herein, the terms “approximately” or “about,” when applied to one or more values, refer to values similar to the stated baseline values. In some embodiments, unless otherwise specified or evident from the context, the terms “approximately” or “about” refer to values that fall within the range of 25%, 20%, 19%, 18%, 17%, 16%, 15%, 14%, 13%, 12%, 11%, 10%, 9%, 8%, 7%, 6%, 5%, 4%, 3%, 2%, 1%, or less in any direction (greater than or less than) the stated baseline value (unless such numbers exceed 100% of the possible values).
[0061] As used herein, the term “improvement” means the prevention, reduction, or mitigation of a condition, or improvement of disease biomarkers of the condition, severity, or outcome in question. Improvement includes, but is not required, complete recovery from or complete prevention of the disease condition.
[0062] As used herein, the term “equivalent” means a system, set of conditions, effect, or result that is sufficiently similar to a test system, set of conditions, effect, or result to enable a scientifically valid comparison. A person skilled in the art will recognize and understand which system, set of conditions, effect, or result is sufficiently similar to any particular test system, set of conditions, effect, or result described herein to be “equivalent.”
[0063] The term “correlated” as used herein has its usual meaning of “showing correlation with.” Those skilled in the art will understand that two features, items, or values are correlated with each other if they tend to appear and / or change together. In some embodiments, the correlation is statistically significant when its p-value is less than 0.05, and in some embodiments, the correlation is statistically significant when its p-value is less than 0.01. In some embodiments, the correlation is assessed by regression analysis. In some embodiments, the correlation is the correlation coefficient.
[0064] As used herein, the terms “improve,” “increase,” or “decrease,” or their grammatical synonyms, refer to values relative to a baseline measurement, such as a measurement obtained under equivalent conditions as described herein (e.g., a measurement in the same individual before the commencement of the treatment described herein, or in an untreated control individual (or multiple control individuals)).
[0065] As used herein, “polypeptide” is generally a sequence of at least two amino acids linked to one another by peptide bonds. In some embodiments, a polypeptide may contain at least three to five amino acids, each of which is linked to another amino acid by at least one peptide bond. Those skilled in the art will understand that a polypeptide may optionally contain “unnatural” amino acids or other substances that can still be incorporated into the polypeptide chain.
[0066] As used herein, the term “protein” means polypeptide (i.e., a sequence of at least two amino acids linked together by peptide bonds). Proteins may contain non-amino acid sites (e.g., glycoproteins, proteoglycans, etc.) and / or may be otherwise processed or modified. Those skilled in the art will understand that a “protein” may be a complete polypeptide chain (with or without a signal sequence) as produced by a cell, or a characteristic portion thereof. Those skilled in the art will understand that a protein may contain two or more polypeptide chains linked, for example, by one or more disulfide bonds, or associated by other means. Polypeptides may contain L-amino acids, D-amino acids, or both, and may contain any of the various amino acid modifiers or analogues known in the art. Useful modifications include, for example, terminal acetylation, amidation, and methylation. In some embodiments, proteins may contain native amino acids, non-native amino acids, synthetic amino acids, and combinations thereof. The term “peptide” is generally used to refer to polypeptides having a length of less than about 100 amino acids, less than about 50 amino acids, less than 20 amino acids, or less than 10 amino acids.
[0067] As used herein, the terms “subject,” “individual,” or “patient” refer to any organism in which embodiments of the present invention may be used or administered, for example, for experimental, diagnostic, preventive, and / or therapeutic purposes. Typical subjects include animals (e.g., mammals such as mice, rats, rabbits, non-human primates, and humans, insects, parasites, etc.). In preferred embodiments of the present invention, the subject is human.
[0068] As used herein, the terms “target cells” or “target tissue” refer to any cell, cell type, tissue, or organism. In preferred embodiments, the target cells or target tissue are vascular cells, melanocytes, and / or any other cell types containing mutations.
[0069] As used herein, the term “therapeutic regimen” means any method used to partially or completely alleviate, improve, reduce, inhibit, prevent, delay the onset, reduce the severity, and / or decrease the incidence of one or more symptoms or characteristics of a particular disease, disorder, and / or condition. This may include, at the discretion of, the administration of one or more doses separated by regular or varying time intervals. In some embodiments, a therapeutic regimen is designed so that its implementation achieves a particular effect, e.g., reduction or elimination of an adverse condition or disease, and / or correlates with the achievement of such a particular effect (e.g., across a population of relevant cells, tissues, or organisms). In some embodiments, the treatment includes administering one or more therapeutic agents simultaneously, sequentially, or at different times, either at the same time or over different time periods. In some embodiments, a “therapeutic regimen” includes genetic methods such as gene therapy, gene ablation, or other methods known to induce or reduce expression (e.g., transcription, processing, and / or translation of a particular gene product, such as a primary transcript or mRNA).
[0070] As used herein, the term “therapeutic dose” refers to the amount of a therapeutic agent that gives a therapeutic effect to the subject being treated in a reasonable benefit-to-risk ratio applicable to any medical treatment. Such a therapeutic effect may be objective (i.e., measurable by some test or marker) or subjective (i.e., the subject shows signs of or feels an effect). In some embodiments, “therapeutic dose” refers to the amount of a therapeutic agent or composition that is effective in treating, improving, or preventing (e.g., delaying onset or reducing risk) an associated disease or condition, by improving symptoms associated with the disease, preventing or delaying the onset of the disease, and / or reducing the severity or frequency of symptoms of the disease, and / or exhibiting a detectable therapeutic or preventive effect. The therapeutic dose is usually administered in a dosing regimen that may contain multiple unit doses. For any particular therapeutic agent, the therapeutic dose (and / or appropriate unit dose in an effective dosing regimen) may vary, for example, by the route of administration or in combination with other therapeutic agents. Alternatively or additionally, a specific therapeutically effective dose (and / or unit dose) for any particular patient may depend on a variety of factors, including the activity of the particular therapeutic agent used, the specific composition used, the patient's age, weight, overall health, sex, and diet, the timing of administration, route of administration, and / or excretion or metabolic rate of the particular therapeutic agent used, the duration of treatment, and similar factors well known in the medical field.
[0071] As used herein, the term “treatment” (and also “to treat” or “to treat”) means any administration of a therapeutic agent in accordance with a treatment regimen that achieves a desired effect in that it partially or completely alleviates, improves, reduces, inhibits, delays the onset, reduces the severity, and / or reduces the incidence of one or more symptoms or characteristics of a particular disease, disorder, and / or condition. In some embodiments, administration of a therapeutic agent in accordance with a treatment regimen correlates with achieving the desired effect. Such treatment may be for subjects who do not show signs of the disease, disorder, and / or condition in question, and / or for subjects who show only initial signs of the disease, disorder, and / or condition. Alternatively or additionally, such treatment may be for subjects who show one or more established signs of the disease, disorder, and / or condition in question. In some embodiments, treatment may be for subjects who have been diagnosed with the disease, disorder, and / or condition in question. In some embodiments, treatment may be for subjects who are known to have one or more susceptibility factors that are statistically correlated with an increased risk of developing the disease, disorder, and / or condition in question.
[0072] As used herein, “antisense compound” means an oligomeric compound that can hybridize to a target nucleic acid via hydrogen bonding. Examples of antisense compounds include single-stranded and double-stranded compounds, such as antisense oligonucleotides, siRNAs, shRNAs, ssRNAs, and occupation-based compounds.
[0073] As used herein, “antisense inhibition” means a decrease in the level of the target nucleic acid in the presence of an antisense compound complementary to the target nucleic acid, compared to the level of the target nucleic acid in the absence of the antisense compound.
[0074] As used herein, “antisense mechanism” refers to all mechanisms involving hybridization between a compound and a target nucleic acid, the result or effect of which is either targeted degradation or targeted occupation accompanied by, for example, the complication of cellular mechanisms involved in transcription or splicing. “Antisense oligonucleotide” means a single-stranded oligonucleotide having a nucleic acid base sequence that enables hybridization to a corresponding region or segment of a target nucleic acid.
[0075] As used herein, “part” means a defined number of consecutive (i.e., linked) nucleic acid bases of a nucleic acid. In some embodiments, the part is a defined number of consecutive nucleic acid bases of a target nucleic acid. In some embodiments, the part is a defined number of consecutive nucleic acid bases of an antisense compound.
[0076] As used herein, “prevent” means to delay or prevent the onset, development, or progression of a disease, disability, or condition for a period ranging from a few minutes to an indefinite period. “Prevent” also means to reduce the risk of developing a disease, disability, or condition.
[0077] As used herein, "nucleoside" means a compound containing a nucleic acid base moiety and a sugar moiety. Nucleosides include, but are not limited to, naturally occurring nucleosides (found in DNA and RNA) and modified nucleosides. Nucleosides may be linked to a phosphate moiety.
[0078] As used herein, "chemical modification" or "chemically modified" means a chemical difference in a compound compared to its naturally occurring counterpart. Chemical modifications of oligonucleotides include nucleoside modifications (including sugar site modifications and nucleic acid base modifications), as well as nucleoside bond modifications. With respect to oligonucleotides, chemical modifications do not include differences in nucleic acid base sequence alone.
[0079] As used herein, "furanosyl" means a structure comprising a five-membered ring containing four carbon atoms and one oxygen atom.
[0080] As used herein, “naturally occurring sugar moieties” means ribofuranosyl found in naturally occurring RNA or deoxyribofuranosyl found in naturally occurring DNA. “Naturally occurring sugar moieties” as referred herein are also referred to as “unmodified sugar moieties.” In particular, such “naturally occurring sugar moieties” or “unmodified sugar moieties” as referred herein have -H (DNA sugar moiety) or -OH (RNA sugar moiety) at the 2' position of the sugar moiety, and especially -H (DNA sugar moiety) at the 2' position of the sugar moiety.
[0081] As used herein, “sugar moiety” means a naturally occurring sugar moiety or modified sugar moiety of a nucleoside. As used herein, “modified sugar moiety” means a substituted sugar moiety or sugar substitute.
[0082] As used herein, “substituted sugar moiety” means a substituted furanosyl. Substituted sugar moieties include, but are not limited to, furanosyls having substituents at the 2', 3', 5', and / or 4' positions. Certain substituted sugar moieties are bicyclic sugar moieties.
[0083] As used herein, “2'-substituted sugar moiety” means a furanosyl ring containing a substituent other than H or OH at the 2' position. Unless otherwise indicated, a 2'-substituted sugar moiety is not a bicyclic sugar moiety (i.e., the 2' substituent of the 2'-substituted sugar moiety does not form a bridge to another atom of the furanosyl ring).
[0084] As used herein, "MOE" means -OCH2CH2OCH3.
[0085] As used herein, "2'-F nucleoside" refers to a nucleoside containing a sugar with fluorine at the 2' position. Unless otherwise indicated, the fluorine in 2'-F nucleosides is located at the ribo position (replacing the OH group of natural ribose). While double-stranded RNA chains hybridized with uniformly modified 2'-fluorinated (ribo) oligonucleotides are not RNase H substrates, ara analogs retain RNase H activity.
[0086] As used herein, the term “sugar substitute” means a structure that does not contain furanosyl and can replace the naturally occurring sugar moiety of a nucleoside, resulting in nucleoside subunits that can be linked together and / or linked to other nucleosides to form oligomeric compounds that can hybridize into complementary oligomeric compounds. Such structures include rings with a different number of atoms than furanosyl (e.g., 4, 6, or 7-membered rings), substitution of the oxygen of furanosyl with a non-oxygen atom (e.g., carbon, sulfur, or nitrogen), or both changes in the number of atoms and substitution of oxygen. Such structures may also include substitutions corresponding to those described for substituted sugar moieties (e.g., 6-membered carbon bicyclic sugar substitutes with optional additional substituents). Sugar substitutes also include more complex sugar substitutions (e.g., acyclic systems of peptide nucleic acids). Sugar substitutes include, but are not limited to, morpholino, cyclohexenyl, and cyclohexitol.
[0087] As used herein, “bicyclic sugar moiety” means a modified sugar moiety comprising a 4- to 7-membered ring (including, but not limited to, a furanosyl), the 4- to 7-membered ring comprising a bridge that connects two of its atoms to form a second ring, resulting in a bicyclic structure. In some embodiments, the 4- to 7-membered ring is a sugar ring. In some embodiments, the 4- to 7-membered ring is a furanosyl. In certain such embodiments, the bridge connects the 2'-carbon and 4'-carbon of the furanosyl.
[0088] As used herein, “nucleotide” means a nucleoside further containing phosphate linking groups. As used herein, “linked nucleoside” may or may not be linked by phosphate bonds and therefore includes, but is not limited to, “linked nucleotides.” As used herein, “linked nucleoside” is a nucleoside linked in a continuous sequence (i.e., there are no additional nucleosides between the linked nucleosides).
[0089] As used herein, “nucleic acid base” means a group of atoms capable of linking to a sugar moiety to form a nucleoside that can be incorporated into an oligonucleotide, and which can bind to naturally occurring complementary nucleic acid bases of another oligonucleotide or nucleic acid. Nucleic acid bases may be naturally occurring or modified.
[0090] As used herein, the terms “unmodified nucleic acid bases” or “naturally occurring nucleic acid bases” mean the naturally occurring heterocyclic nucleic acid bases of RNA or DNA, namely the purine bases adenine (A) and guanine (G), and the pyrimidine bases thymine (T), cytosine (C) (including 5-methyl C), and uracil (U).
[0091] As used herein, “modified nucleic acid base” means any nucleic acid base that is not naturally occurring. As used herein, “modified nucleoside” means a nucleoside that contains at least one chemical modification compared to a naturally occurring RNA or DNA nucleoside. Modified nucleosides may contain modified sugar sites and / or modified nucleic acid bases.
[0092] As used herein, “bicyclic nucleoside” or “BNA” means a nucleoside containing a bicyclic sugar moiety. As used herein, “locked nucleic acid nucleoside” or “LNA” means a nucleoside containing a bicyclic sugar moiety containing a 4'-CH2-O-2' bridge. As used herein, “2'-substituted nucleoside” means a nucleoside containing a substituent other than H or OH at the 2' position of the sugar moiety. Unless otherwise indicated, a 2'-substituted nucleoside is not a bicyclic nucleoside.
[0093] As used herein, “deoxynucleoside” means a nucleoside containing a 2'-H furanosyl sugar moiety, as found in naturally occurring deoxyribonucleosides (DNA). In some embodiments, the 2'-deoxynucleoside may contain a modified nucleic acid base or an RNA nucleic acid base (e.g., uracil).
[0094] As used herein, “oligonucleotide” means a compound comprising multiple linked nucleosides. In some embodiments, the oligonucleotide comprises one or more unmodified ribonucleosides (RNA) and / or unmodified deoxyribonucleosides (DNA) and / or one or more modified nucleosides.
[0095] As used herein, “modified oligonucleotide” means an oligonucleotide comprising at least one modified nucleoside and / or at least one modified nucleoside linkage.
[0096] As used herein, “linking” or “linking group” means a group of atoms that links two or more other groups of atoms together.
[0097] As used herein, “nucleoside bond” means a covalent bond between adjacent nucleosides in an oligonucleotide.
[0098] As used herein, “naturally occurring nucleoside bond” means a 3'-5' phosphodiester bond. As used herein, “modified nucleoside bond” means any nucleoside bond other than naturally occurring nucleoside bonds. In particular, “modified nucleoside bond” as referred herein may include modified phosphate linking groups such as phosphorothioate or phosphorodithioate nucleoside bonds.
[0099] As used herein, “terminal nucleoside bond” means a bond between the last two nucleosides of an oligonucleotide or its defined region.
[0100] As used herein, “phosphorus linking group” means a linking group containing a phosphorus atom, and may include naturally occurring phosphorus linking groups such as those found in naturally occurring RNA or DNA, e.g., phosphodiester linking groups, or modified phosphorus linking groups not commonly found in naturally occurring RNA or DNA, e.g., phosphorothioate or phosphorodithioate linking groups. Therefore, phosphorus linking groups include, but are not limited to, phosphodiesters, phosphorothioates, phosphorodithioates, phosphonates, phosphoramidates, phosphorothioamidates, thionoalkylphosphonates, phosphotryesters, thionoalkylphosphotryesters, and boranophosphates.
[0101] As used herein, "internucleoside phosphate linking group" means a phosphate linking group that directly links two nucleosides.
[0102] As used herein, “oligomer compound” means a polymer structure comprising two or more substructures. In some embodiments, the oligomer compound comprises an oligonucleotide, such as a modified oligonucleotide. In some embodiments, the oligomer compound further comprises one or more conjugate groups and / or terminal groups and / or ligands. In some embodiments, the oligomer compound consists of an oligonucleotide. In some embodiments, the oligomer compound comprises a backbone of one or more linked monomer sugar moieties, each linked monomer sugar moiety directly or indirectly bonded to a heterocyclic base moiety. In some embodiments, the oligomer compound may also comprise monomer sugar moieties not bonded to a heterocyclic base moiety, thereby providing a debase site.
[0103] As used herein, “end group” means one or more atoms bonded to either or both of the 3' and 5' ends of an oligonucleotide. In some embodiments, the end group comprises one or more end group nucleosides.
[0104] As used herein, “conjugate” or “conjugate group” means an atom or group of atoms bonded to an oligonucleotide or oligomeric compound. In some embodiments, a conjugate group links a ligand to a modified oligonucleotide or oligomeric compound. Generally, conjugate groups can modify one or more properties of the compound to which they are bonded, including but not limited to pharmacodynamic, pharmacokinetic, binding, absorption, cell distribution, cell uptake, charge, and / or clearance properties.
[0105] As used herein, “conjugate linker” or “linker” in relation to a conjugate group means a portion of the conjugate group which includes any atom or group of atoms that covalently bond an oligonucleotide to another portion of the conjugate group. In some embodiments, the bonding site on the oligomer compound is the 3'-oxygen atom of the 3'-hydroxyl group of the 3'-terminal nucleoside of the oligonucleotide. In some embodiments, the bonding site on the oligomer compound is the 5'-oxygen atom of the 5'-hydroxyl group of the 5'-terminal nucleoside of the oligonucleotide. In some embodiments, the bond for forming the bond to the oligomer compound is a cleavable bond. In certain such embodiments, such a cleavable bond constitutes all or part of the cleavable site.
[0106] In some embodiments, the conjugate group comprises a cleavable moiety (e.g., a cleavable bond or cleavable nucleoside) and a ligand moiety that may contain one or more ligands, such as a carbohydrate cluster moiety, for example, an N-acetyl-galactosamine cluster moiety also referred to as "GalNAc". In some embodiments, the carbohydrate cluster moiety is identified by the number of ligands and what the ligands are. For example, in some embodiments, the carbohydrate cluster moiety contains two GalNAc groups. For example, in some embodiments, the carbohydrate cluster moiety contains three GalNAc groups, which is particularly preferred. In some embodiments, the carbohydrate cluster moiety contains four GalNAc groups. Such ligand moieties are bound to the oligomeric compound via cleavable sites, such as cleavable bonds or cleavable nucleosides. The ligands can be arranged in a linear or branched configuration, such as a bifurcated or trifurcated configuration.
[0107] As used herein, “cleavable site” means a bond or group that can be cleaved under physiological conditions. In some embodiments, the cleavable site is cleaved within a cell or intracellular compartment, such as an endosome or lysosome. In some embodiments, the cleavable site is cleaved by an endogenous enzyme such as a nuclease. In some embodiments, the cleavable site comprises an atomic group having one, two, three, four, or more than four cleavable bonds. In some embodiments, the cleavable site is a phosphodiester bond.
[0108] As used herein, “cleavable bond” means any chemical bond that can be cleaved. As used herein, “carbohydrate cluster” means a compound having one or more carbohydrate residues bonded to a linker group.
[0109] As used herein, “modified carbohydrate” means any carbohydrate having one or more chemical modifications compared to naturally occurring carbohydrates. As used herein, “carbohydrate derivative” means any compound that can be synthesized using a carbohydrate as a starting material or intermediate.
[0110] As used herein, “carbohydrate” means a naturally occurring carbohydrate, a modified carbohydrate, or a carbohydrate derivative. Carbohydrates are biomolecules containing carbon (C), hydrogen (H), and oxygen (O) atoms. Carbohydrates may include monosaccharides, disaccharides, trisaccharides, tetrasaccharides, oligosaccharides, or polysaccharides, for example, one or more galactose moieties, one or more lactose moieties, one or more N-acetyl-galactosamine moieties, and / or one or more mannose moieties. Carbohydrates with a particularly preferred N-acetyl-galactosamine moiety are those with a particularly preferred N-acetyl-galactosamine moiety.
[0111] As used herein, “chain” means an oligomeric compound containing linked nucleosides. As used herein, “single strand” or “single-stranded” means an oligomeric compound containing linked nucleosides connected in a continuous sequence without any cleavage. Such a single strand may contain regions of sufficient self-complementarity to form a stable self-double helix in a hairpin structure.
[0112] As used herein, “hairpin” means a single-stranded oligomeric compound containing a double helix formed by base pairing between sequences in a self-complementary and oppositely oriented chain. As used herein, “hairpin loop” means an unpaired loop of linked nucleosides within a hairpin, formed as a result of hybridization of self-complementary sequences. The resulting structure appears loop-shaped or U-shaped.
[0113] As used herein, “orientation” means the chemical orientation of an oligonucleotide from end to end based on the chemical convention of numbering carbon atoms in the sugar moiety, meaning that there is a 5' end defined by the 5' carbon of the sugar moiety and a 3' end defined by the 3' carbon of the sugar moiety. In a double-stranded or bistranded oligonucleotide, each strand extends from 5' to 3' in opposite directions to allow base pairing between them.
[0114] As used herein, “double helix” means that two or more complementary chain regions or chains of an oligonucleotide or multiple oligonucleotides have hybridized together by non-covalent sequence-specific interactions between them. Most commonly, hybridization in a double helix occurs between the nucleic acid bases adenine (A) and thymine (T), and / or between (A) adenine and uracil (U), and / or between guanine (G) and cytosine (C). A double helix is part of a single-stranded structure, and self-complementarity leads to hybridization or is a result of hybridization between the respective chains in a double-stranded construct.
[0115] As used herein, “double strand” or “double stranded” means a pair of oligomeric compounds that are hybridized with one another. In some embodiments, the double-stranded oligomeric compound comprises a first and a second oligomeric compound.
[0116] As used herein, “expression” means the process by which a gene ultimately produces a protein. Expression includes, but is not limited to, transcription, post-transcriptional modifications (e.g., splicing, polyadenylation, 5' cap addition), and translation.
[0117] As used herein, “transcription” or “transcribed” refers to the first step in several steps of DNA-based gene expression, in which a target sequence of DNA is copied to RNA (particularly mRNA) by the enzyme RNA polymerase. During transcription, the DNA sequence is read by RNA polymerase, which produces a complementary antiparallel RNA sequence called the primary transcript.
[0118] As used herein, “target sequence” means a nucleoside sequence in which an oligomeric compound is intended to hybridize to produce desired activity for a particular disease or gene function. Oligonucleotides are sufficiently complementary to their target sequences to enable hybridization under physiological conditions.
[0119] As used herein, “nucleic acid base complementarity” or “complementarity” means, with respect to nucleic acid bases, a nucleic acid base that can base-pair with another nucleic acid base. For example, in DNA, adenine (A) is complementary to thymine (T). For example, in RNA, adenine (A) is complementary to uracil (U). In both DNA and RNA, guanine (G) is complementary to cytosine (C). In some embodiments, complementary nucleic acid bases mean nucleic acid bases of an oligomeric compound that can base-pair with nucleic acid bases of a target sequence. For example, if a nucleic acid base at a particular position in an oligomeric compound can hydrogen-bond with a nucleic acid base at a particular position in a target sequence, the positions of the hydrogen bonds between the oligomeric compound and the target sequence are considered complementary in their nucleic acid base pairing. Nucleic acid bases with certain modifications can still be nucleic acid base complementarity because they can maintain their ability to pair with the corresponding nucleic acid bases.
[0120] As used herein, “non-complementary” with respect to nucleic acid bases means a pair of nucleic acid bases that do not form hydrogen bonds with each other. As used herein, “complementary” with respect to oligomeric compounds (e.g., linked nucleosides, oligonucleotides) means the ability of such oligomeric compounds or regions thereof to hybridize to a target sequence or a region of the oligomeric compound itself through nucleic acid base complementarity.
[0121] Complementary oligomer compounds do not need to have nucleic acid base complementarity at each nucleoside. Rather, some mismatches are acceptable. In some embodiments, the complementary oligomer compound or region is complementary at 70% of the nucleic acid bases (70% complementary). In some embodiments, the complementary oligomer compound or region is at least 80% complementary. In some embodiments, the complementary oligomer compound or region is at least 90% complementary. In some embodiments, the complementary oligomer compound or region is at least 95% complementary. In some embodiments, the complementary oligomer compound or region is at least 100% complementary.
[0122] As used herein, “self-complementarity” in relation to oligomeric compounds means a compound that can fold itself back to form a double helix as a result of nucleic acid base hybridization of the internal complementary chain region. Depending on how close and / or how long the chain regions are, the compound may form a hairpin loop, junction, bulge, or internal loop.
[0123] As used herein, “mismatch” means a nucleic acid base of an oligomer compound that cannot pair with the nucleic acid base at the corresponding position in the target sequence, or with the nucleic acid base at the corresponding position in the oligomer compound itself when the oligomer compound hybridizes as a result of self-complementarity, when the oligomer compound and the target sequence and / or the self-complementary regions of the oligomer compound are aligned.
[0124] As used herein, “hybridization” means the pairing of complementary oligomeric compounds (e.g., an oligomeric compound and its target sequence). While not limited to a specific mechanism, the most common mechanism of pairing involves hydrogen bonding between complementary nucleic acid bases, which may be Watson-Crick, Hoogsteen, or reverse Hoogsteen hydrogen bonds.
[0125] As used herein, "specifically hybridizes" means the ability of an oligomeric compound to hybridize with one nucleic acid site with a higher affinity than it would to hybridize with another nucleic acid site.
[0126] As used herein, “fully complementary” with respect to an oligomeric compound or its region means that each nucleic acid base of the oligomeric compound or its region can pair with a nucleic acid base of a complementary nucleic acid target sequence or a self-complementary region of the oligomeric compound. Therefore, a fully complementary oligomeric compound or its region does not contain mismatched or non-hybridized nucleic acid bases with respect to its target sequence or the self-complementary region of the oligomeric compound.
[0127] As used herein, “complementarity percentage” refers to the proportion of nucleic acid bases in the oligomer compound that are complementary to the isolength portion of the target nucleic acid. The complementarity percentage is calculated by dividing the number of nucleic acid bases in the oligomer compound that are complementary to the nucleic acid bases at the corresponding positions in the target nucleic acid by the total length of the oligomer compound.
[0128] As used herein, “identity percentage” means the number of nucleic acid bases in the first nucleic acid that are of the same type (regardless of chemical modification) as the nucleic acid base at the corresponding position in the second nucleic acid, divided by the total number of nucleic acid bases in the first nucleic acid.
[0129] As used herein, “modulation” means a change in the quantity or quality of a molecule, function, or activity compared to the quantity or quality of the molecule, function, or activity before modification. For example, modification includes any change that increases (stimulates or induces) or decreases (inhibits or reduces) gene expression.
[0130] The nucleic acid molecules described herein can inhibit the expression of variant NRAS by at least 20%, at least 30%, at least 40%, at least 50%, at least 60%, at least 70%, at least 80%, or at least 90% in vitro. The nucleic acid molecules described herein can also preferentially inhibit the expression of variant NRAS compared to wild-type NRAS. In other words, the nucleic acid molecules described herein can inhibit the expression of variant NRAS to a greater extent than wild-type NRAS. For example, variant NRAS expression may be inhibited by 2, 3, 4, 5 or more times compared to wild-type NRAS. The nucleic acid molecules described herein may inhibit the expression of variant NRAS but not necessarily inhibit the expression of wild-type NRAS.
[0131] As used herein, “type of modification” or a “type” of nucleoside means a chemical modification of a nucleoside, and includes modified and unmodified nucleosides. Therefore, unless otherwise indicated, “nucleoside having the first type of modification” may be an unmodified nucleoside.
[0132] As used herein, “differently modified” means different chemical modifications or chemical substituents, including the absence of modification. Therefore, for example, an MOE nucleoside and a naturally occurring unmodified RNA nucleoside are “differently modified,” even if the naturally occurring nucleoside is unmodified. Similarly, DNA and RNA oligonucleotides are “differently modified,” even if both are naturally occurring unmodified nucleosides. Nucleosides that are identical except for containing different nucleic acid bases are not differently modified. For example, a nucleoside containing a 2'-OMe modified sugar site and an unmodified adenine nucleic acid base, and a nucleoside containing a 2'-OMe modified sugar site and an unmodified thymine nucleic acid base, are not differently modified.
[0133] As used herein, “same type of modification” refers to modifications that are identical to one another, and includes the absence of modification. Therefore, for example, two unmodified RNA nucleosides have “same type of modification,” even though these RNA nucleosides are unmodified. Nucleosides having such same type of modification may contain different nucleic acid bases.
[0134] As used herein, “region” or “regions” or “portion” or “portions” means a plurality of linked nucleosides having the functions or characteristics defined herein, particularly with respect to the claims and definitions provided herein. Typically, such a region or portion comprises at least 10, at least 11, at least 12, or at least 13 linked nucleosides. For example, such a region may contain 13 to 20 linked nucleosides, e.g., 13 to 16 or 18 to 20 linked nucleosides. Typically, a first region as defined herein consists essentially of 18 to 20 nucleosides, and a second region as defined herein consists essentially of 13 to 16 linked nucleosides.
[0135] As used herein, “pharmaceutically acceptable carrier or diluent” means any substance suitable for use in administration to animals. In some embodiments, the pharmaceutically acceptable carrier or diluent is sterile saline. In some embodiments, such sterile saline is pharmaceutical-grade saline.
[0136] As used herein, “substituent” and “substituent group” mean an atom or group that replaces an atom or group of a named parent compound. For example, a substituent of a modified nucleoside is any atom or group different from the atom or group found in a naturally occurring nucleoside (for example, a modified 2'-substituent is any atom or group other than H or OH at the 2' position of the nucleoside). Substituents may be protected or unprotected. In some embodiments, the compounds of this disclosure have substituents at one or more positions of the parent compound. Substituents may also be further substituted with other substituents, either directly on the parent compound or via linking groups such as oxygen, alkyl, or hydrocarbyl groups.
[0137] Such substituents may exist as modifications of the sugar moiety, particularly as substituents located at the 2' position of the sugar moiety. Unless otherwise indicated, suitable groups for use as substituents include, but are not limited to, one or more of the following: halo, hydroxyl, alkyl, alkenyl, alkynyl, acyl, carboxyl, alkoxy, alkoxyalkylene, and amino substituents. Certain substituents described herein may represent modifiers directly bonded to the ring of the sugar moiety (e.g., a halo such as a fluoro bonded directly to the sugar ring) or modifiers indirectly bonded to the ring of the sugar moiety via an oxygen-bonding atom directly bonded to the sugar moiety (e.g., an alkoxyalkylene such as methoxyethylene bonded to an oxygen atom, which as a whole provides the MOE substituent described herein bonded at the 2' position of the sugar moiety).
[0138] As used herein, “alkyl” means a saturated linear or branched monovalent C1-6 hydrocarbon radical, and methyl is the most preferred alkyl as a substituent at the 2' position of the sugar moiety. Alkyl alkyls are typically bonded to the oxygen-linked atom at the 2' position of the sugar, and therefore, as a whole, provide an -O alkyl substituent, such as an -OCH3 substituent, to the sugar moiety of the oligomeric compounds according to the present invention. This will be well understood by those skilled in the art.
[0139] As used herein, "alkylene" means a saturated straight-chain or branched-chain divalent hydrocarbon radical of the general formula -CnH2n-, where n is 1 to 6. Methylene or ethylene are preferred alkylenes.
[0140] As used herein, "alkenyl" refers to a monovalent unsaturated C in a straight or branched chain. 2~6 Meaning hydrocarbon radicals, ethenyl or propenyl are the most preferred alkenyl substituents at the 2' position of the sugar moiety. As will be well understood in the art, the degree of unsaturation present in an alkenyl radical is the presence of at least one carbon-to-carbon double bond. The alkenyl group is typically bonded to the oxygen-linked atom at the 2' position of the sugar, and therefore, as a whole, provides the sugar moiety of the oligomeric compounds according to the present invention with an -O alkenyl substituent such as an -OCH2CH=CH2 substituent. This will be well understood by those skilled in the art.
[0141] As used herein, “alkynyl” means a linear or branched unsaturated C2-6 hydrocarbon radical, where ethynyl is the most preferred alkynyl substituent at the 2' position of the sugar moiety. As will be well understood in the art, the degree of unsaturation present in an alkynyl radical is the presence of at least one carbon-to-carbon triple bond. The alkynyl group is typically bonded to the oxygen-linked atom at the 2' position of the sugar, and therefore, as a whole, provides an -O alkynyl substituent to the sugar moiety of the oligomeric compound according to the present invention. This will be well understood by those skilled in the art.
[0142] As used herein, "carboxyl" refers to a radical having the general formula -CO2H.
[0143] As used herein, “acyl” means a radical formed by removing a hydroxyl group from a carboxyl radical as defined herein, having the general formula -C(O)-X, where X is typically C 1~6 It is alkyl.
[0144] As used herein, "alkoxy" means C 1~6 This refers to a radical formed between an alkyl group (such as an alkyl group) and an oxygen atom, where the oxygen atom is used to bond the alkoxy group to a parent molecule (e.g., at the 2' position of a sugar moiety) or to another group such as an alkylene group as defined herein. Examples of alkoxy groups include, but are not limited to, methoxy, ethoxy, propoxy, isopropoxy, n-butoxy, sec-butoxy, and tert-butoxy. The alkoxy groups used herein may optionally include further substituents.
[0145] As used herein, alkoxyalkylene means an alkoxy group as defined herein that is bonded to an alkylene group, similarly defined herein, the oxygen atom of the alkoxy group is bonded to the alkylene group, and the alkylene is bonded to the parent molecule. The alkylene group is typically bonded to the 2' oxygen-linked atom of the sugar, and thus, as a whole, provides an -O alkylene alkoxy substituent, such as an -OCH2CH2OCH3 substituent, to the sugar moiety of the oligomeric compound according to the present invention. This is well understood by those skilled in the art and is generally referred to as a MOE substituent, as defined herein and as known in the art.
[0146] As used herein, “amino” includes primary, secondary, and tertiary amino groups. As used herein, “halo” and “halogen” mean atoms selected from fluorine, chlorine, bromine, and iodine.
[0147] Furthermore, it will be understood that nucleic acid molecules or compounds described herein may have one or more non-hybridized nucleosides (overhangs) and / or one or more internal non-hybridized nucleosides (mismatches) at one or both ends of one or both chains, provided that there is sufficient complementarity to maintain hybridization under physiologically relevant conditions. Alternatively, the oligomeric compounds described herein may have at least one blunt end.
[0148] The term “comprising” is used herein to mean including the specified method steps or elements, but not to include an exclusive list, and therefore additional steps or elements may exist.
[0149] Furthermore, insofar as the term “includes” is used in either the detailed description or the claims, such term is intended to be as comprehensive as “comprising,” as the term “comprising” is interpreted when used as a transitional term in a claim.
[0150] Microneedles, microneedle patches, or microarray patches are micron-scale medical devices used to administer therapeutic agents. Microneedles can be used for transdermal drug delivery applications, as well as for intraocular, intravaginal, transungual, cardiac, vascular, gastrointestinal, and cochlear delivery of drugs. Microneedles are typically constructed by various methods, including photolithography processes or micromolding. These methods involve etching microstructures into resin or silicon to cast the microneedles. Microneedles are made from a variety of materials, including silicon, titanium, stainless steel, and polymers. Some microneedles are made of the drug to be delivered to the body, and are shaped into needles to penetrate the skin. Microneedles vary in size, shape, and function, but all are used as alternatives to other delivery methods such as conventional subcutaneous injection needles or other injection devices.
[0151] Microneedles are typically applied as a single needle or in small arrays. The arrays used are collections of microneedles ranging from just a few to several hundred, and are attached to an applicator, sometimes a patch, or other solid stamping device. The array is applied to the patient's skin and given time to allow for effective drug delivery. The size of individual microneedles can be optimized according to the desired size of the microneedle, such as the target depth of the microneedle or the strength requirements of the needle to avoid rupture in specific tissue types.
[0152] Solid microneedles are designed as a two-part system, where first, a microneedle array is applied to the skin, creating tiny wells just deep enough to penetrate the outermost layer of skin, and then the drug is applied via a transdermal patch. Solid microneedles are already being used by dermatologists in collagen induction therapy, a method that uses repeated microneedle punctures of the skin to induce the expression and deposition of the skin proteins collagen and elastin.
[0153] Hollow microneedles are similar to solid microneedles in materials. They contain a reservoir that delivers drugs directly to the site. Because drug delivery depends on the flow rate of the microneedles, this type of array can become clogged due to excessive swelling or a faulty design.
[0154] Coated microneedles are typically designed from polymers or metals. In this method, the drug is applied directly to the microneedle array rather than through other patches or applicators. Coated microneedles are often coated with other surfactants or thickeners to ensure proper drug delivery.
[0155] Dissolvable microneedles encapsulate drugs in non-toxic polymers that dissolve upon entering the skin. These polymers allow for drug delivery to the skin and can be broken down within the body. Polymers such as fibroin are silk-based proteins that can be molded into microneedle-like structures and dissolve upon entering the body.
[0156] Hydrogel-forming microneedles contain a drug encapsulated within a polymer. These microneedles can penetrate the stratum corneum and draw in interstitial fluid, causing the polymer to swell. The drug then enters the skin through the swollen matrix.
[0157] Different methods for producing lipid-encapsulated RNA nanoparticles are known to those skilled in the art. Techniques are known for preparing lipid-encapsulated RNA nanoparticles using an ethanol injection process with a static mixer providing a turbulent environment, in which the vesicles are combined with therapeutic molecules after formation. Other techniques are known for forming lipid-encapsulated RNA nanoparticles using non-turbulent mixing and a series of sequential stepwise dilutions. The particles can also be formed by spraying lipids from an organic solution pipe through an orifice and introducing them into nucleic acids in an aqueous solution flowing through the orifice. Parameters for producing lipid-encapsulated RNA nanoparticles can be modified according to desired properties.
[0158] Nanodelivery systems, such as ruxolitinib and thalidomide co-delivery polymer electrolyte nanocomplexes (RTNPs), can be manipulated to mimic viruses while maintaining the safety of non-viral particles. One approach is to facilitate delivery to specific cell types by incorporating peptides into particles that have affinity for cell surface receptors or other proteins specific to the target cell type. Peptides targeting specific cell types are not yet known, and experiments (e.g., phage display library biopanning) can be used to identify novel amino acid sequences with affinity for the target cell type.
[0159] Along with selecting the optimal lipids for this purpose, modular approaches exist to test hypotheses and identify the attributes that best deliver cargo to the target cell type [3]. Recent studies have used existing literature to design peptides targeting specific skin cell types, namely fibroblasts, melanocytes, and keratinocytes [4]. However, we expect that an unbiased approach to identifying novel cell-targeting peptides using phage display libraries will reveal the peptides most effective for this purpose. Furthermore, target cells are often pathological and / or differ from their closest equivalent cells in healthy humans. Therefore, it is important to conduct studies specifically focused on these cells in order to most effectively target nanodelivery systems.
[0160] In some embodiments, a reconstituted viral envelope is used to encapsulate and deliver siRNA. The reconstituted membrane vesicle may contain viral spike protein and additionally added cationic lipids. The siRNA-loaded vesicle is taken up by receptor-mediated endocytosis and can escape endosomal degradation by fusion with the endosomal membrane. Functional siRNA delivery has been demonstrated in vitro and in vivo. As with some viral approaches, the drawbacks of this system are the difficulty of repeated administration and limited control over transducible cell types.
[0161] In some embodiments, DNA encoding siRNA may be delivered by a virus for in vivo gene silencing. To improve specificity, the virus's innate directivity to a particular cell type may be used. In some embodiments, the virus's innate directivity may be redirected to therapeutically useful receptors on the surface of target cells. Examples include novel targeting of mouse coronavirus to the human epidermal growth factor receptor, inducing adenoviruses toward their associated receptor (FGFR1) via fibroblast growth factor ligands for delivery to gliomas, or adenovirus delivery to angiogenic endothelium via RGD-peptide that binds to alpha-v-integrin. One particular advantage of the viral delivery approach is the efficient transduction of cells.
[0162] In some embodiments, the compounds of the present invention may be delivered by nonviral delivery. While viral vectors offer many of the desired features for efficient nucleic acid delivery, nonviral vectors offer other advantages. Key advantages of synthetic vector systems include safety (related to non-immunogenicity and low integration frequency) and ease of large-scale production. In addition, they can be adapted to a wide variety of nucleic acid sizes and allow for easy modification.
[0163] In non-viral delivery systems, it may be necessary to incorporate functional groups into the compounds of the present invention. Cationic functional groups are typically required to bind to and condense nucleic acids, thereby protecting them from nucleases and (importantly for siRNA) increasing the apparent molecular weight above the renal clearance cutoff.
[0164] Nucleic acid molecules that target multiple variants In some cases, the nucleic acid molecules described herein may be used to target two different NRAS variants, particularly two or more NRAS alleles at the same position. For example, a single nucleic acid molecule containing a sequence targeting Q61K may be adapted to also target Q61R, since this mutation involves substitutions at different positions in the nucleotide sequence (C181A for Q61K, and A182G for Q61R). Thus, this single nucleic acid molecule may contain sequences complementary to AG at positions 181 and 182 to target both the Q61K and Q61R variants. The above are merely examples, and various combinations of NRAS variants (e.g., Q61K and Q61L, Q61K and Q61H, etc.) can be targeted using the nucleic acid molecules described herein.
[0165] A nucleic acid molecule is described herein that contains a sequence that is at least 80% complementary to a sequence having at least 80% identity with the isolength portion of the mRNA encoding a first variant NRAS, and is at least 80% complementary to a sequence having at least 80% identity with the isolength portion of the mRNA encoding a second variant NRAS, wherein the second variant NRAS is different from the first variant NRAS. A nucleic acid molecule is described herein that contains a sequence that is at least 80% complementary to a sequence having at least 80% identity with the isolength portion of the mRNA encoding a second variant NRAS. For example, a nucleic acid molecule is described herein that contains a sequence that is at least 80% complementary to a sequence having at least 80% identity with the isolength portion of the mRNA encoding variant NRAS p.(Q61K), and is at least 80% complementary to a sequence having at least 80% identity with the isolength portion of the mRNA encoding variant NRAS p.(Q61R). A nucleic acid molecule may include a first strand containing a sequence that has at least 80% identity with a sequence selected from the group consisting of SEQ ID NOs. 187 to 205, and also has at least 80% identity with a sequence selected from the group consisting of SEQ ID NOs. 225 to 243.
[0166] Pharmaceutical composition of drugs As used herein, “pharmaceutical composition” means a mixture of substances suitable for administration to an individual. For example, a pharmaceutical composition may comprise one or more active agents and a sterile aqueous solution.
[0167] As used herein, “pharmaceutically acceptable salt” means a physiologically and pharmaceutically acceptable salt of an antisense compound, i.e., a salt that retains the desired biological activity of the parent oligonucleotide and does not impart any undesirable toxicological effects thereto.
[0168] Other aspects of the present invention also relate to pharmaceuticals or diagnostic aids comprising compositions or nucleic acids according to the present invention, and, where appropriate, suitable excipients and additives such as physiological saline, stabilizers, or protease inhibitors.
[0169] Antisense mechanism In some embodiments, the antisense compound has chemically modified subunits arranged in a pattern or motif, which confer properties to the antisense compound such as improved inhibitory activity, increased binding affinity to target nucleic acids, or resistance to degradation by in vivonucleases.
[0170] Chimeric antisense compounds typically contain at least one region modified to confer increased resistance to nuclease degradation, increased cellular uptake, increased binding affinity to target nucleic acids, and / or increased inhibitory activity. A second region of the chimeric antisense compound may confer other desired properties, such as functioning as a substrate for cellular endonuclease RNase H, which cleaves the RNA strand of an RNA:DNA double helix.
[0171] Antisense activity can arise from any mechanism involving hybridization between an antisense compound (e.g., an oligonucleotide) and a target nucleic acid, which ultimately results in a biological effect. In some embodiments, the amount and / or activity of the target nucleic acid is regulated. In some embodiments, the amount and / or activity of the target nucleic acid is reduced. In some embodiments, hybridization of an antisense compound with a target nucleic acid ultimately results in target nucleic acid degradation. In some embodiments, hybridization of an antisense compound with a target nucleic acid does not result in target nucleic acid degradation. In certain such embodiments, the presence (occupation) of the antisense compound hybridized with the target nucleic acid results in the regulation of antisense activity. In some embodiments, antisense compounds having a particular chemical motif or pattern of chemical modification are particularly suitable for utilizing one or more mechanisms. In some embodiments, antisense compounds function through two or more mechanisms and / or mechanisms that have not yet been elucidated. Therefore, the antisense compounds described herein are not limited by a particular mechanism.
[0172] Antisense mechanisms include, but are not limited to, RNase H-mediated antisense, RNAi mechanisms utilizing the RISC pathway, including siRNA, ssRNA, and microRNA mechanisms, and occupation-based mechanisms. A particular antisense compound may act through two or more such mechanisms and / or additional mechanisms.
[0173] RNase H-mediated antisense. In some embodiments, antisense activity is at least partially mediated by the degradation of target RNA by RNase H. RNase H is a cellular endonuclease that cleaves the RNA strand in RNA:DNA double helix. It is known in the art that single-stranded antisense compounds that are "DNA-like" induce RNase H activity in mammalian cells. Therefore, antisense compounds comprising at least a portion of DNA or a DNA-like nucleoside may activate RNase H and result in cleavage of target nucleic acid. In some embodiments, antisense compounds that utilize RNase H comprise one or more modified nucleosides. In some embodiments, such antisense compounds comprise at least one block of 1 to 8 modified nucleosides. In certain such embodiments, the modified nucleosides do not support RNase H activity.
[0174] RNAi compounds. In some embodiments, antisense compounds are interfering RNA compounds (RNAi), including double-stranded RNA compounds (also referred to as short interfering RNA or siRNA) and single-stranded RNAi compounds (or ssRNA). Such compounds act to degrade and / or sequestrate target nucleic acids at least partially via the RISC pathway (hence microRNA / microRNA mimetic compounds). In some embodiments, antisense compounds include modifications that make them particularly suitable for such mechanisms.
[0175] Conjugate In some embodiments, the Disclosure provides conjugated antisense compounds. In some embodiments, the Disclosure provides conjugated antisense compounds comprising an antisense oligonucleotide complementary to a nucleic acid transcript. In some embodiments, the Disclosure provides a method comprising contacting cells with a conjugated antisense compound comprising an antisense oligonucleotide complementary to a nucleic acid transcript. In some embodiments, the Disclosure provides a method comprising contacting cells with a conjugated antisense compound comprising an antisense oligonucleotide and reducing the amount or activity of nucleic acid transcripts within the cells.
[0176] The asialoglycoprotein receptor (ASGP-R) has been previously described. See, for example, Park et al., PNAS vol.102, No.47, pp 17125-17129 (2005). Such receptors are expressed in hepatocytes, particularly hepatic parenchymal cells. Furthermore, compounds containing a cluster of three N-acetylgalactosamine (GalNAc) ligands have been shown to bind to ASGP-R, leading to the uptake of the compound into the cell. See, for example, Khorev et al., Bioorganic and Medicinal Chemistry, 16, 9, pp 5216-5231 (May 2008).
[0177] Therefore, conjugates containing such GalNAc clusters have been used to promote the uptake of specific compounds into hepatocytes, specifically hepatocytes. For example, certain GalNAc-containing conjugates have been shown to increase the activity of double-stranded siRNA compounds in hepatocytes in vivo. In such cases, the GalNAc-containing conjugate is typically bound to the sense strand of the siRNA double-stranded compound. There is little concern that the conjugate will interfere with activity because the sense strand is discarded before the antisense strand can ultimately hybridize with the target nucleic acid. Disclosed herein are conjugated single-stranded antisense compounds that exhibit improved potency in hepatocytes in vivo compared to the same antisense compound without a conjugate.
[0178] In some embodiments, the conjugate group described herein includes a cleavable site. As stated above, while it is not desirable to be constrained by the mechanism, it is logical that the conjugate should remain on the compound for a length sufficient to result in enhanced uptake, after which it is desirable that some portion, or ideally all, of the conjugate be cleaved so that the parent compound (e.g., the antisense compound) is released in its most active form. In some embodiments, the cleavable site is a cleavable nucleoside. Such embodiments utilize an endogenous nuclease in the cell by attaching the remainder of the conjugate (cluster) to an antisense oligonucleotide via the nucleoside by one or more cleavable bonds, such as a phosphodiester bond. In some embodiments, the cluster is attached to the cleavable nucleoside by a phosphodiester bond. In some embodiments, the cleavable nucleoside is attached to the antisense oligonucleotide (antisense compound) by a phosphodiester bond. In some embodiments, the conjugate group may include two or three cleavable nucleosides. In such embodiments, such cleavable nucleosides are linked to one another, to an antisense compound, and / or to a cluster via cleavable bonds (such as phosphodiester bonds). Certain conjugates herein do not contain cleavable nucleosides but instead contain cleavable bonds. It has been shown that sufficient cleavage of a conjugate from an oligonucleotide is brought about by at least one easily cleavable bond (cleavable bond) in the cell.
[0179] In some embodiments, the conjugated antisense compound is a prodrug. Such a prodrug is administered to an animal and ultimately metabolized to a more active form. For example, the conjugated antisense compound is cleaved, and all or part of the conjugate is removed, resulting in an active (or more active) form of the antisense compound lacking all or part of the conjugate.
[0180] In some embodiments, the conjugate is attached to the 5' end of the oligonucleotide. Certain such 5' conjugates are cleaved more efficiently than controls having a similar conjugate group attached to the 3' end. In some embodiments, improved activity may correlate with improved cleavage. In some embodiments, oligonucleotides with a conjugate at the 5' end are more efficient than oligonucleotides with a conjugate at the 3' end. In some embodiments, oligonucleotides with a conjugate at the 3' end are more efficient than oligonucleotides with a conjugate at the 5' end. The 5' attachment allows for simpler oligonucleotide synthesis.
[0181] Typically, oligonucleotides are synthesized on a solid support in the 3'-5' direction. To produce 3'-conjugated oligonucleotides, a pre-conjugated 3' nucleoside is usually conjugated to a solid support, and then the oligonucleotide is constructed as usual. However, conjugating the conjugated nucleoside to the solid support complicates the synthesis. Furthermore, when using this approach, the conjugate remains present throughout the entire oligonucleotide synthesis and may be degraded during subsequent steps or may limit the types of reactions and reagents that can be used. Using the structures and techniques described herein for 5'-conjugated oligonucleotides, oligonucleotides can be synthesized using standard automated techniques, and the conjugate can be introduced either with the last (most 5') nucleoside or after the oligonucleotide has been cleaved from the solid support.
[0182] In view of the technical field and this disclosure, those skilled in the art can easily prepare any of the conjugates and conjugate oligonucleotides described herein. Furthermore, the synthesis of certain such conjugates and conjugate oligonucleotides disclosed herein is easier and / or requires few steps, and is therefore less expensive than the synthesis of previously disclosed conjugates, offering advantages in production. For example, the synthesis of certain conjugate groups consists of fewer synthesis steps compared to previously described conjugate groups, resulting in increased yield.
[0183] Conjugate Linker In some embodiments, the conjugate group includes a linker. In certain such embodiments, the linker is covalently bonded to a cleavable site. In certain such embodiments, the linker is covalently bonded to an antisense oligonucleotide. In some embodiments, the linker is covalently bonded to a cell targeting site. In some embodiments, the linker further includes a covalent bond to a solid support. In some embodiments, the linker further includes a covalent bond to a protein binding site. In some embodiments, the linker further includes a covalent bond to a solid support and further includes a covalent bond to a protein binding site. In some embodiments, the linker includes multiple positions for tether ligand binding. In some embodiments, the linker includes multiple positions for tether ligand binding and is not bonded to a branching group. In some embodiments, the linker further includes one or more cleavable bonds. In some embodiments, the conjugate group does not include a linker.
[0184] In some embodiments, the linker comprises at least a linear group containing a group selected from alkyl, amide, disulfide, polyethylene glycol, ether, thioether (-S-), and hydroxylamino (-ON(H)-) groups. In some embodiments, the linear group comprises a group selected from alkyl, amide, and ether groups. In some embodiments, the linear group comprises a group selected from alkyl and ether groups. In some embodiments, the linear group comprises at least one phosphorus linking group. In some embodiments, the linear group comprises at least one phosphodiester group. In some embodiments, the linear group comprises at least one neutral linking group. In some embodiments, the linear group is covalently bonded to a cell targeting site and a cleavable site. In some embodiments, the linear group is covalently bonded to a cell targeting site and an antisense oligonucleotide. In some embodiments, the linear group is covalently bonded to a cell targeting site, a cleavable site, and a solid support. In some embodiments, the linear group is covalently bonded to a cell targeting site, a cleavable site, a solid support, and a protein binding site. In some embodiments, the linear group includes one or more cleavable bonds.
[0185] In some embodiments, the linker includes a linear group covalently bonded to the scaffolding group. In some embodiments, the scaffolding includes a branched aliphatic group comprising a group selected from alkyl, amide, disulfide, polyethylene glycol, ether, thioether, and hydroxylamino groups. In some embodiments, the scaffolding includes a branched aliphatic group comprising a group selected from alkyl, amide, and ether groups. In some embodiments, the scaffolding includes at least one monocyclic or polycyclic ring system. In some embodiments, the scaffolding includes at least two monocyclic or polycyclic ring systems. In some embodiments, a linear group is covalently bonded to the scaffolding group, and the scaffolding group is covalently bonded to a cleavable site and a linker. In some embodiments, a linear group is covalently bonded to the scaffolding group, and the scaffolding group is covalently bonded to a cleavable site, a linker, and a solid support. In some embodiments, a linear group is covalently bonded to the scaffolding group, and the scaffolding group is covalently bonded to a cleavable site, a linker, and a protein binding site. In some embodiments, linear groups are covalently bonded to scaffolding groups, which in turn are covalently bonded to cleavable sites, linkers, protein-binding sites, and solid supports. In some embodiments, the scaffolding groups include one or more cleavable bonds.
[0186] In some embodiments, the linker includes a protein binding site. In some embodiments, the protein binding site is, for example, cholesterol, cholic acid, adamantane acetate, 1-pyrene butyric acid, dihydrotestosterone, 1,3-bis-0(hexadecyl)glycerol, geranyloxyhexyl group, hexadecylglycerol, borneol, menthol, 1,3-propanediol, heptadecyl group, palmitic acid, myristic acid, 03-(oleoyl)lithocholic acid, 03-(oleoyl)cholenic acid, dimethoxytrityl, or phenoxadiyl Lipids, vitamins (e.g., folic acid, vitamin A, vitamin E, biotin, pyridoxal), peptides, carbohydrates (e.g., monosaccharides, disaccharides, trisaccharides, tetrasaccharides, oligosaccharides, polysaccharides), endosomal soluble components, steroids (e.g., uvaol, hecigenin, diosgenin), terpenes (e.g., triterpenes, e.g., sarsapogenin, friedelin, epifridellanolic acid derivative lithocholic acid), or cationic lipids. In some embodiments, the protein binding site is C 16 ~C 22 These are long-chain saturated or unsaturated fatty acids, cholesterol, cholic acid, vitamin E, adamantane, or 1-pentafluoropropyl.
[0187] Combination therapy In some embodiments, the present invention is characterized by a composition (e.g., one or more compositions, formulations, or drug formulations) or pharmaceutical combination comprising a double-stranded ribonucleic acid molecule, or a compound or composition comprising a double-stranded ribonucleic acid molecule and a conjugate according to the present invention, and a second therapeutic agent. In some embodiments, the present invention is characterized by a composition (e.g., one or more compositions, formulations, or drug formulations) or pharmaceutical combination comprising the therapeutic agent according to the present invention and a second therapeutic agent.
[0188] In some embodiments, the composition comprises a pharmaceutically acceptable carrier or diluent. In some embodiments, the compound comprising a double-stranded ribonucleic acid molecule, or a double-stranded ribonucleic acid molecule and a conjugate, and the second agent may be present in a single composition or in two or more different compositions. The compound comprising a double-stranded ribonucleic acid molecule, or a double-stranded ribonucleic acid molecule and a conjugate, and the second agent may be administered via the same route of administration or via different routes of administration. The compound comprising a double-stranded ribonucleic acid molecule, or a double-stranded ribonucleic acid molecule and a conjugate, and the second agent may be administered simultaneously or sequentially. In some embodiments, the pharmaceutically acceptable combination comprises the compound comprising a double-stranded ribonucleic acid molecule, or a double-stranded ribonucleic acid molecule and a conjugate, and the second agent separately or together.
[0189] The methods of the present invention described herein may include administering a nucleic acid molecule, compound, composition, or produg described herein in combination with a second therapeutic agent. The second therapeutic agent may be an anticancer agent or a chemotherapeutic agent. For example, the second therapeutic agent may be a protein kinase inhibitor such as a MEK inhibitor. The second therapeutic agent may be trametinib. The second therapeutic agent may be administered simultaneously, separately, or sequentially with the nucleic acid molecule, compound, composition, or produg described herein. Furthermore, a pharmaceutical composition comprising a double-stranded ribonucleic acid molecule described herein in combination with trametinib is described herein.
[0190] NRAS and BRAF combination Compositions comprising two nucleic acid molecules, wherein the first nucleic acid molecule targets the variant NRAS and the second nucleic acid molecule targets the variant BRAF, are also described herein. Such compositions can be advantageously used for the treatment, reduction, or removal of acquired nevi (common moles). Acquired nevi express either one of the variants NRAS or BRAF (i.e., they do not have both mutations). The inventors utilize this expression pattern by providing compositions that can target both variants NRAS and BRAF. This avoids the need to perform sequencing analysis first to determine which variant is present in the nevus, as the composition can target both the NRAS and BRAF variants. Such compositions are advantageous because they do not require genotyping before administration. Furthermore, the treatment, reduction, or removal of acquired nevi may offer benefits in preventing cancers such as melanoma.
[0191] Accordingly, compositions comprising a first nucleic acid molecule and a second nucleic acid molecule are provided herein, the first nucleic acid molecule comprising a first strand of 10 to 50 linked nucleosides, the first strand comprising a sequence that is fully complementary to a sequence having at least 90% identity with an isolength portion of mRNA encoding the variant NRAS, and the second nucleic acid molecule comprising a first strand of 10 to 50 linked nucleosides, the first strand comprising a sequence that is fully complementary to a sequence having at least 90% identity with an isolength portion of mRNA encoding the variant BRAF. The compositions may comprise any nucleic acid molecule described herein for targeting NRAS in combination with any nucleic acid molecule described herein for targeting BRAF.
[0192] One advantage of this composition is that genotyping or sequencing of acquired nevi is not required before administration. Accordingly, the composition may contain multiple siRNAs targeting different NRAS variants / aleles and / or multiple siRNAs targeting different BRAF variants. For example, the composition may contain siRNAs targeting NRAS Q61K, siRNAs targeting NRAS Q61R, and siRNAs targeting NRAS Q61L together with siRNAs targeting BRAF V600E and siRNAs targeting BRAF V600K. The composition may contain at least two, at least three, at least four, at least five, or at least six nucleic acid molecules targeting NRAS variants, where at least two, at least three, at least four, at least five, or at least six nucleic acid molecules target different NRAS variants. The composition may comprise at least two, at least three, at least four, at least five, or at least six nucleic acid molecules that target BRAF variants, with at least two, at least three, at least four, at least five, or at least six nucleic acid molecules targeting different BRAF variants. The composition may comprise at least three nucleic acid molecules that target NRAS variants, with at least three nucleic acid molecules targeting different NRAS variants, and at least two nucleic acid molecules that target BRAF variants, with at least two nucleic acid molecules targeting different BRAF variants. The composition may comprise at least two nucleic acid molecules that target NRAS variants, with at least two nucleic acid molecules targeting different NRAS variants, and at least two nucleic acid molecules that target BRAF variants, with at least two nucleic acid molecules targeting different BRAF variants. The composition comprises at least three nucleic acid molecules that target an NRAS variant, wherein the three nucleic acid molecules may include at least three nucleic acid molecules that target different NRAS variants and at least one nucleic acid molecule that targets a BRAF variant.The composition comprises at least two nucleic acid molecules that target an NRAS variant, wherein the two nucleic acid molecules may include at least two nucleic acid molecules that target different NRAS variants and at least one nucleic acid molecule that targets a BRAF variant.
[0193] The composition may also contain different ratios of nucleic acid molecules targeting variant NRAS and variant BRAF. Variant BRAF is a more common cause of acquired melanocytic nevi compared to variant NRAS. However, there are more variant NRAS alleles compared to variant BRAF alleles. The ratio of variant NRAS-targeting nucleic acid molecules to variant BRAF-targeting nucleic acid molecules may be changed as appropriate.
[0194] The first strand of the first nucleic acid molecule may contain a sequence that is fully complementary to a sequence having at least 90% identity with the isolength portion of the mRNA encoding variant NRAS, wherein variant NRAS contains mutations at positions Q61, G60, G12, and / or G13 compared to wild-type NRAS, and the first strand of the second nucleic acid molecule may contain a sequence that is fully complementary to a sequence having at least 90% identity with the isolength portion of the mRNA encoding variant BRAF, wherein variant BRAF contains a mutation at position V600 compared to wild-type BRAF.
[0195] The first strand of the first nucleic acid molecule may contain a sequence that is perfectly complementary to a sequence having at least 90% identity with the isolength portion of the mRNA encoding variant NRAS, and variant NRAS contains a mutation at position Q61 compared to wild-type NRAS. The first strand of the second nucleic acid molecule may contain a sequence that is perfectly complementary to a sequence having at least 90% identity with the isolength portion of the mRNA encoding variant BRAF, and variant BRAF contains a mutation at position V600 compared to wild-type BRAF.
[0196] The first strand of the first nucleic acid molecule may contain a sequence that is perfectly complementary to a sequence having at least 90% identity with the isolength portion of the mRNA encoding variant NRAS, and variant NRAS contains a mutation at position G60 compared to wild-type NRAS. The first strand of the second nucleic acid molecule may contain a sequence that is perfectly complementary to a sequence having at least 90% identity with the isolength portion of the mRNA encoding variant BRAF, and variant BRAF contains a mutation at position V600 compared to wild-type BRAF.
[0197] The first strand of the first nucleic acid molecule may contain a sequence that is perfectly complementary to a sequence having at least 90% identity with the isolength portion of the mRNA encoding variant NRAS, and variant NRAS contains a mutation at position G12 compared to wild-type NRAS. The first strand of the second nucleic acid molecule may contain a sequence that is perfectly complementary to a sequence having at least 90% identity with the isolength portion of the mRNA encoding variant BRAF, and variant BRAF contains a mutation at position V600 compared to wild-type BRAF.
[0198] The first strand of the first nucleic acid molecule may contain a sequence that is perfectly complementary to a sequence having at least 90% identity with the isolength portion of the mRNA encoding variant NRAS, and variant NRAS contains a mutation at position G13 compared to wild-type NRAS. The first strand of the second nucleic acid molecule may contain a sequence that is perfectly complementary to a sequence having at least 90% identity with the isolength portion of the mRNA encoding variant BRAF, and variant BRAF contains a mutation at position V600 compared to wild-type BRAF.
[0199] The first strand of the first nucleic acid molecule may contain a sequence that is perfectly complementary to a sequence having at least 90% identity with an isolength portion of mRNA encoding the variant NRAS p.(Q61K), p.(Q61R), p.(Q61H), p.(Q61L), or p.(Q61P), and the first strand of the second nucleic acid molecule may contain a sequence that is perfectly complementary to a sequence having at least 90% identity with an isolength portion of mRNA encoding the variant BRAF p.(V600G), p.(V600M), p.(V600D), p.(V600R), p.(V600K), or p.(V600E).
[0200] The first strand of the first nucleic acid molecule may contain a sequence that is perfectly complementary to a sequence having at least 90% identity with the isolength portion of the mRNA encoding the variant NRAS p.(Q61K), p.(Q61R), p.(Q61H), p.(Q61L), or p.(Q61P), and the first strand of the second nucleic acid molecule may contain a sequence that is perfectly complementary to a sequence having at least 90% identity with the isolength portion of the mRNA encoding the variant BRAF p.(V600E).
[0201] The first strand of the first nucleic acid molecule may contain a sequence that is perfectly complementary to a sequence having at least 90% identity with the isolength portion of the mRNA encoding the variant NRAS p.(Q61K), and the first strand of the second nucleic acid molecule may contain a sequence that is perfectly complementary to a sequence having at least 90% identity with the isolength portion of the mRNA encoding the variant BRAF p.(V600E).
[0202] The first strand of the first nucleic acid molecule may contain a sequence that is perfectly complementary to a sequence having at least 90% identity with the isolength portion of the mRNA encoding the variant NRAS p.(Q61R), and the first strand of the second nucleic acid molecule may contain a sequence that is perfectly complementary to a sequence having at least 90% identity with the isolength portion of the mRNA encoding the variant BRAF p.(V600E).
[0203] The first strand of the first nucleic acid molecule may contain a sequence that is perfectly complementary to a sequence having at least 90% identity with the isolength portion of the mRNA encoding the variant NRAS p.(Q61H), and the first strand of the second nucleic acid molecule may contain a sequence that is perfectly complementary to a sequence having at least 90% identity with the isolength portion of the mRNA encoding the variant BRAF p.(V600E).
[0204] The first strand of the first nucleic acid molecule may contain a sequence that is perfectly complementary to a sequence having at least 90% identity with the isolength portion of the mRNA encoding the variant NRAS p.(Q61L), and the first strand of the second nucleic acid molecule may contain a sequence that is perfectly complementary to a sequence having at least 90% identity with the isolength portion of the mRNA encoding the variant BRAF p.(V600E).
[0205] The first strand of the first nucleic acid molecule may contain a sequence that is perfectly complementary to a sequence having at least 90% identity with the isolength portion of the mRNA encoding the variant NRAS p.(Q61P), and the first strand of the second nucleic acid molecule may contain a sequence that is perfectly complementary to a sequence having at least 90% identity with the isolength portion of the mRNA encoding the variant BRAF p.(V600E).
[0206] The first strand of the first nucleic acid molecule may contain a sequence that is perfectly complementary to a sequence having at least 90% identity with the isolength portion of the mRNA encoding the variant NRAS p.(Q61K), and the first strand of the second nucleic acid molecule may contain a sequence that is perfectly complementary to a sequence having at least 90% identity with the isolength portion of the mRNA encoding the variant BRAF p.(V600G).
[0207] The first strand of the first nucleic acid molecule may contain a sequence that is perfectly complementary to a sequence having at least 90% identity with the isolength portion of the mRNA encoding the variant NRAS p.(Q61K), and the first strand of the second nucleic acid molecule may contain a sequence that is perfectly complementary to a sequence having at least 90% identity with the isolength portion of the mRNA encoding the variant BRAF p.(V600M).
[0208] The first strand of the first nucleic acid molecule may contain a sequence that is perfectly complementary to a sequence having at least 90% identity with the isolength portion of the mRNA encoding the variant NRAS p.(Q61K), and the first strand of the second nucleic acid molecule may contain a sequence that is perfectly complementary to a sequence having at least 90% identity with the isolength portion of the mRNA encoding the variant BRAF p.(V600D).
[0209] The first strand of the first nucleic acid molecule may contain a sequence that is perfectly complementary to a sequence having at least 90% identity with the isolength portion of the mRNA encoding the variant NRAS p.(Q61K), and the first strand of the second nucleic acid molecule may contain a sequence that is perfectly complementary to a sequence having at least 90% identity with the isolength portion of the mRNA encoding the variant BRAF p.(V600R).
[0210] The first strand of the first nucleic acid molecule may contain a sequence that is perfectly complementary to a sequence having at least 90% identity with the isolength portion of the mRNA encoding the variant NRAS p.(Q61K), and the first strand of the second nucleic acid molecule may contain a sequence that is perfectly complementary to a sequence having at least 90% identity with the isolength portion of the mRNA encoding the variant BRAF p.(V600K).
[0211] The first strand of the first nucleic acid molecule may contain a sequence that is perfectly complementary to a sequence having at least 80% identity with the isolength portion of the mRNA encoding the variant NRAS p.(Q61K), and the first strand of the second nucleic acid molecule may contain a sequence that is perfectly complementary to a sequence having at least 80% identity with the isolength portion of the mRNA encoding the variant BRAF p.(V600E).
[0212] The first strand of the first nucleic acid molecule may contain a sequence that is perfectly complementary to a sequence having at least 85% identity with the isolength portion of the mRNA encoding the variant NRAS p.(Q61K), and the first strand of the second nucleic acid molecule may contain a sequence that is perfectly complementary to a sequence having at least 85% identity with the isolength portion of the mRNA encoding the variant BRAF p.(V600E).
[0213] The first strand of the first nucleic acid molecule may contain a sequence that is perfectly complementary to a sequence having at least 90% identity with the isolength portion of the mRNA encoding the variant NRAS p.(Q61K), and the first strand of the second nucleic acid molecule may contain a sequence that is perfectly complementary to a sequence having at least 90% identity with the isolength portion of the mRNA encoding the variant BRAF p.(V600E).
[0214] The first strand of the first nucleic acid molecule may contain a sequence that is perfectly complementary to a sequence having at least 95% identity with the isolength portion of the mRNA encoding the variant NRAS p.(Q61K), and the first strand of the second nucleic acid molecule may contain a sequence that is perfectly complementary to a sequence having at least 95% identity with the isolength portion of the mRNA encoding the variant BRAF p.(V600E).
[0215] The first strand of the first nucleic acid molecule may contain a sequence that is perfectly complementary to a sequence having 100% identity with the isolength portion of the mRNA encoding the variant NRAS p.(Q61K), and the first strand of the second nucleic acid molecule may contain a sequence that is perfectly complementary to a sequence having 100% identity with the isolength portion of the mRNA encoding the variant BRAF p.(V600E).
[0216] In some cases, the variant NRAS p.(Q61K) arises from a c.C181A mutation in the NRAS genome sequence. The first strand of the first nucleic acid molecule may contain a sequence that is at least 80%, at least 90%, or at least 95% identical to a sequence selected from the group consisting of SEQ ID NOs. 206-224. The first strand of the first nucleic acid molecule may contain a sequence selected from the group consisting of SEQ ID NOs. 206-224. The first strand of the first nucleic acid molecule may consist of a sequence selected from the group consisting of SEQ ID NOs. 206-224. The first strand of the first nucleic acid molecule may contain a sequence that is at least 80%, at least 90%, or at least 95% identical to the sequence described in SEQ ID NO. 213. The first strand of the first nucleic acid molecule may contain the sequence described in SEQ ID NO. 213. The first strand of the first nucleic acid molecule may consist of the sequence described in SEQ ID NO. 213.
[0217] In some cases, the variant NRAS p.(Q61K) arises from a c.C181A mutation in the NRAS genome sequence. The first strand of the first nucleic acid molecule may contain a sequence that is at least 80%, at least 90%, or at least 95% identical to a sequence selected from the group consisting of SEQ ID NOs. 187-205. The first strand of the first nucleic acid molecule may contain a sequence selected from the group consisting of SEQ ID NOs. 187-205. The first strand of the first nucleic acid molecule may consist of a sequence selected from the group consisting of SEQ ID NOs. 187-205. The first strand of the first nucleic acid molecule may contain a sequence that is at least 80%, at least 90%, or at least 95% identical to the sequence described in SEQ ID NO. 194. The first strand of the first nucleic acid molecule may contain the sequence described in SEQ ID NO. 194. The first strand of the first nucleic acid molecule may consist of the sequence described in SEQ ID NO. 194.
[0218] In some cases, the variant BRAF p.(V600E) arises from the c.1799_1800delisAA mutation in the BRAF genome sequence. The first strand of the second nucleic acid molecule may contain a sequence having at least 80%, at least 90%, or at least 95% identity with a sequence selected from the group consisting of SEQ ID NOs. 1287-1306. The first strand of the second nucleic acid molecule may contain a sequence selected from the group consisting of SEQ ID NOs. 1287-1306.
[0219] In some cases, the variant BRAF p.(V600E) arises from the c.1799_1800delisAA mutation in the BRAF genome sequence. The first strand of the second nucleic acid molecule may contain a sequence having at least 80%, at least 90%, or at least 95% identity with a sequence selected from the group consisting of SEQ ID NOs. 1267-1286. The first strand of the second nucleic acid molecule may contain a sequence selected from the group consisting of SEQ ID NOs. 1267-1286. The first strand of the second nucleic acid molecule may consist of a sequence selected from the group consisting of SEQ ID NOs. 1267-1286.
[0220] In some cases, the variant BRAF p.(V600E) arises from the c.T1799A mutation in the BRAF genome sequence. The first strand of the second nucleic acid molecule may contain a sequence that has at least 80%, at least 90%, or at least 95% identity with a sequence selected from the group consisting of SEQ ID NOs. 1326-1344. The first strand of the second nucleic acid molecule may contain a sequence selected from the group consisting of SEQ ID NOs. 1326-1344. The first strand of the second nucleic acid molecule may consist of a sequence selected from the group consisting of SEQ ID NOs. 1326-1344.
[0221] In some cases, the variant BRAF p.(V600E) arises from the c.T1799A mutation in the BRAF genome sequence. The first strand of the second nucleic acid molecule may contain a sequence having at least 80%, at least 90%, or at least 95% identity with a sequence selected from the group consisting of SEQ ID NOs. 1307-1325. The first strand of the second nucleic acid molecule may contain a sequence selected from the group consisting of SEQ ID NOs. 1307-1325. The first strand of the second nucleic acid molecule may consist of a sequence selected from the group consisting of SEQ ID NOs. 1307-1325.
[0222] The first strand of the first nucleic acid molecule may contain a sequence having at least 80%, at least 90%, or at least 95% identity with a sequence selected from the group consisting of SEQ ID NOs. 206 to 224, and the first strand of the second nucleic acid molecule may contain a sequence having at least 80%, at least 90%, or at least 95% identity with a sequence selected from the group consisting of SEQ ID NOs. 1287 to 1306.
[0223] The first strand of the first nucleic acid molecule may contain a sequence having at least 80%, at least 90%, or at least 95% identity with a sequence selected from the group consisting of SEQ ID NOs: 187 to 205, and the first strand of the second nucleic acid molecule may contain a sequence having at least 80%, at least 90%, or at least 95% identity with a sequence selected from the group consisting of SEQ ID NOs: 1267 to 1286.
[0224] The first strand of the first nucleic acid molecule may contain a sequence having at least 80%, at least 90%, or at least 95% identity with a sequence selected from the group consisting of SEQ ID NOs. 206 to 224, and the first strand of the second nucleic acid molecule may contain a sequence having at least 80%, at least 90%, or at least 95% identity with a sequence selected from the group consisting of SEQ ID NOs. 1326 to 1344.
[0225] The first strand of the first nucleic acid molecule may contain a sequence having at least 80%, at least 90%, or at least 95% identity with a sequence selected from the group consisting of SEQ ID NOs: 187-205, and the first strand of the second nucleic acid molecule may contain a sequence having at least 80%, at least 90%, or at least 95% identity with a sequence selected from the group consisting of SEQ ID NOs: 1307-1325.
[0226] The first strand of the first nucleic acid molecule may contain a sequence having at least 80%, at least 90%, or at least 95% identity with the sequence described in Sequence ID No. 213, and the first strand of the second nucleic acid molecule may contain a sequence having at least 80%, at least 90%, or at least 95% identity with the sequence described in Sequence ID No. 1334.
[0227] The first strand of the first nucleic acid molecule may contain a sequence having at least 80%, at least 90%, or at least 95% identity with the sequence described in Sequence ID No. 194, and the first strand of the second nucleic acid molecule may contain a sequence having at least 80%, at least 90%, or at least 95% identity with the sequence described in Sequence ID No. 1315.
[0228] Furthermore, this specification describes a pharmaceutical composition comprising, for example, a first nucleic acid molecule targeting variant NRAS and a second nucleic acid molecule targeting variant BRAF.
[0229] Furthermore, methods for treating acquired nevi in subjects are described herein. Treatment may mean removing, reducing, or preventing acquired nevi. The method may include administering to a subject a composition described herein, or a pharmaceutical composition described herein, having a first nucleic acid molecule targeting variant NRAS and a second nucleic acid molecule targeting variant BRAF. Alternatively, the method may include administering to a subject the first nucleic acid molecule in combination with the second nucleic acid molecule, said administration being performed simultaneously or sequentially in any order, wherein the first nucleic acid molecule targets variant NRAS, preferably Q61K, as described herein, and the second nucleic acid molecule targets variant BRAF, preferably V600E, as described herein.
[0230] Methods for preventing melanoma in subjects are also described herein. These methods may involve administering to a subject a composition described herein, or a pharmaceutical composition described herein, which comprises a first nucleic acid molecule targeting variant NRAS, preferably Q61K, and a second nucleic acid molecule targeting variant BRAF, preferably V600E.
[0231] Furthermore, compositions described herein, comprising first and second nucleic acid molecules (targeting variants NRAS and BRAF) for use in a method for treating acquired nevi and for use in a method for preventing melanoma, are also described herein.
[0232] Furthermore, the use of the compositions described herein for reducing or removing acquired nevi in subjects is also provided herein.
[0233] It will be understood that the nucleic acid molecules targeting variant NRAS and the nucleic acid molecules targeting variant BRAF may be provided together as part of a single composition or separately. If provided separately, the first and second nucleic acid molecules may be administered to the target simultaneously or sequentially in any order.
[0234] Furthermore, a kit comprising a first nucleic acid molecule targeting the variant NRAS described herein and a second nucleic acid molecule targeting the variant BRAF described herein is also described herein. The kit may comprise (a) a first nucleic acid molecule comprising a first strand of 10 to 50 linked nucleosides, wherein the first strand contains a sequence that is completely complementary to a sequence having at least 90% identity with the isolength portion of the mRNA encoding the variant NRAS, and (b) a second nucleic acid molecule comprising a first strand of 10 to 50 linked nucleosides, wherein the first strand contains a sequence that is completely complementary to a sequence having at least 90% identity with the isolength portion of the mRNA encoding the variant BRAF.
[0235] Route of administration A drug or pharmaceutical composition may be administered by various routes, including oral, parenteral, sublingual, intradermal, transdermal, rectal, transmucosal, topical, inhalation, buccal administration, intrathoracic, intravenous, intraarterial, intraperitoneal, subcutaneous, intramuscular, intranasal, intrathecal, and / or intraarticular, or combinations thereof. In some embodiments, the drug or pharmaceutical composition is administered orally. In some embodiments, the drug or pharmaceutical composition is administered intravenously. In some embodiments, the drug or pharmaceutical composition is administered topically. In some embodiments, the drug or pharmaceutical composition is administered by microneedle injection. In some embodiments, the drug or pharmaceutical composition is administered by microneedle injection into the dermis.
[0236] CRISPR As used herein, “CRISPR nuclease system” refers collectively to transcripts and other elements involved in directing the expression or activity of CRISPR-related ("Cas") genes, including the sequence encoding the Cas gene, the guide sequence (also referred to as the “spacer” in the context of the endogenous CRISPR system), or other sequences and transcripts from the CRISPR locus.
[0237] In some embodiments, one or more elements of the CRISPR system are derived from a type I, type II, or type III CRISPR system. In some embodiments, one or more elements of the CRISPR system are derived from a specific organism that contains an endogenous CRISPR system, such as Streptococcus pyogenes. The CRISPR system is characterized by elements that facilitate the formation of the CRISPR complex at a site of a target sequence.
[0238] In the context of CRISPR complex formation, the “target sequence” refers to a sequence designed to be complementary to the guide sequence, and hybridization between the target sequence and the guide sequence facilitates CRISPR complex formation. Complete complementarity is not necessarily required, as long as there is sufficient complementarity to induce hybridization and facilitate CRISPR complex formation. The target sequence may include any polynucleotide, such as DNA or RNA polynucleotides. In some embodiments, the target sequence is located in the nucleus or cytoplasm of a cell. In some embodiments, the target sequence may be located within an organelle of a eukaryotic cell, for example, in a mitochondria or chloroplast.
[0239] When using multiple different guide sequences, a single expression construct may be used to target CRISPR activity to multiple different corresponding target sequences within the cell. For example, a single vector may contain about one, two, three, four, five, six, seven, eight, nine, ten, fifteen, twenty, or more guide sequences. In some embodiments, a vector containing about one, two, three, four, five, six, seven, eight, nine, ten, or more guide sequences may be provided and optionally delivered to cells. In some embodiments, the vector includes a regulatory element operably linked to an enzyme-coding sequence encoding a CRISPR enzyme, such as a Cas protein, also referred to as a Cas enzyme.
[0240] Non-exclusive examples of Cas proteins (or Cas enzymes) include Cas1, Cas1.13, Cas2, Cas3, Cas4, Cas5, Cas6, Cas7, Cas8, Cas9 (also known as Csnl and Csx12), Cas10, Csy1, Csy2, Csy3, Csel, Cse2, Cscl, Csc2, Csa5, Csn2, and Csm 2. Examples include Csm3, Csm4, Csm5, Csm6, Cmr1, Cmr3, Cmr4, Cmr5, Crnr6, Csbl, Csb2, Csb3, Csx17, Csx14, Csx10, Csx16, CsaX, Csx3, Csx1, Csx15, Csf1, Csf2, Csf3, Csf4, their hornologs, or their modifiers.
[0241] These enzymes are known; for example, the amino acid sequence of the S. pyogenes Cas9 protein can be found in the SwissProt database under accession number Q99ZW2. In some embodiments, the CRISPR enzyme, e.g., Cas9, has DNA cleavage activity. In some embodiments, the CRISPR enzyme is Cas9, which may be Cas9 derived from S. pyogenes or S. pneumoniae.
[0242] In some embodiments, the CRISPR enzyme induces a cleavage of one or both strands at a location within the target sequence, such as within the target sequence and / or within a complementary sequence of the target sequence. In some embodiments, the CRISPR enzyme induces a cleavage of one or both strands within approximately 1, 2, 3, 4, 5, 6, 7, 8, 9, 10, 15, 20, 25, 50, 100, 200, 500, or more base pairs from the first or last nucleotide of the target sequence.
[0243] nucleic acid molecule The nucleic acid molecules described herein may include a first strand containing a sequence that is perfectly complementary to a sequence having at least 90% identity with an isolength portion of mRNA encoding a gain-of-function variant of NRAS (e.g., an NRAS variant). The nucleic acid molecules described herein may include a first strand containing a sequence that is perfectly complementary to a sequence having at least 95% identity with an isolength portion of mRNA encoding a gain-of-function variant of NRAS (e.g., an NRAS variant). The nucleic acid molecules described herein may include a first strand containing a sequence that is perfectly complementary to a sequence having at least 99% identity with an isolength portion of mRNA encoding a gain-of-function variant of NRAS (e.g., an NRAS variant).
[0244] The nucleic acid molecules described herein may include a first strand containing a sequence that is fully complementary to a sequence having at least 95% identity with the isolength portion of the mRNA encoding a variant NRAS. The variant NRAS may have mutations at positions Q61, G60, G12, and / or G13 compared to the wild-type NRAS. For example, a variant NRAS that differs from the wild-type NRAS at position Q61 may be referred to as the "Q61 variant."
[0245] In some embodiments, variant NRAS differs from wild-type NRAS at the G60 position. Variant NRAS may be a G60R variant. Variant NRAS may be a G60V variant. Variant NRAS may be a G60E variant.
[0246] The NRAS G60R variant can arise from a c.178G>C (c.G178C) mutation in the NRAS genome sequence. The NRAS G60V variant can arise from a c.179G>T (c.G179T) mutation in the NRAS genome sequence. The NRAS G60E variant can arise from a c.179G>A (c.G179A) mutation in the NRAS genome sequence.
[0247] In some embodiments, variant NRAS differs from wild-type NRAS at the Q61 position. Variant NRAS may be a Q61K variant. Variant NRAS may be a Q61H variant. Variant NRAS may be a Q61R variant. Variant NRAS may be a Q61L variant. Variant NRAS may be a Q61P variant.
[0248] The NRAS Q61K variant can arise from a c.181C>A (c.C181A) mutation in the NRAS genome sequence. The NRAS Q61H variant can arise from a c.183A>C (c.A183C) mutation in the NRAS genome sequence. The NRAS Q61H variant can arise from a c.183A>T (c.A183T) mutation in the NRAS genome sequence. The NRAS Q61R variant can arise from a c.182A>G (c.A182G) mutation in the NRAS genome sequence. The NRAS Q61L variant can arise from a c.182A>T (c.A182T) mutation in the NRAS genome sequence. The NRAS Q61P variant can arise from a c.182A>C (c.A182C) mutation in the NRAS genome sequence.
[0249] In some embodiments, variant NRAS differs from wild-type NRAS at the G12 position. Variant NRAS may be a G12V variant. Variant NRAS may be a G12R variant. Variant NRAS may be a G12D variant. Variant NRAS may be a G12S variant. Variant NRAS may be a G12P variant. Variant NRAS may be a G12C variant. Variant NRAS may be a G12A variant.
[0250] Variant G12V can arise from a c.35G>T (c.G35T) mutation in the NRAS genome sequence. Variant G12R can arise from a c.34G>C (c.G34C) mutation in the NRAS genome sequence. Variant G12D can arise from a c.35G>A (c.G35A) mutation in the NRAS genome sequence. Variant G12S can arise from a c.34G>A (c.G34A) mutation in the NRAS genome sequence. Variant G12P can arise from a c.34_35 inversion or a double nucleotide change from GG to CC in the NRAS genome sequence. Variant G12C can arise from a c.34G>T (c.G34T) mutation in the NRAS genome sequence. Variant G12A can arise from a c.35G>C (c.G35C) mutation in the NRAS genome sequence.
[0251] In some embodiments, variant NRAS differs from wild-type NRAS at position G13. Variant NRAS may be a G13S variant. Variant NRAS may be a G13C variant. Variant NRAS may be a G13R variant. Variant NRAS may be a G13F variant. Variant NRAS may be a G13Y variant. Variant NRAS may be a G13V variant. Variant NRAS may be a G13D variant. Variant NRAS may be a G13A variant.
[0252] Variant G13S can arise from a c.37G>A (c.G37A) mutation in the NRAS genome sequence. Variant G13C can arise from a c.37G>T (c.G37T) mutation in the NRAS genome sequence. Variant G13R can arise from a c.37G>C (c.G37C) mutation in the NRAS genome sequence. Variant G13F can arise from a c.37_38 deletion and TT insertion in the NRAS genome sequence. Variant G13Y can arise from a c.37_38 deletion and TA insertion in the NRAS genome sequence. Variant G13V can arise from a c.38G>T (c.G38T) mutation in the NRAS genome sequence. Variant G13D can arise from a c.38G>A (c.G38A) mutation in the NRAS genome sequence. The G13A variant can arise from the c.38G>C (c.G38C) mutation in the NRAS genome sequence.
[0253] The nucleic acid molecules described herein may specifically target the variant NRAS sequence. As used herein, “specifically target” refers to the preferential hybridization of the nucleic acid molecule to the target sequence, in this case the variant NRAS sequence.
[0254] The nucleic acid molecules described herein may include a first strand containing a sequence that is fully complementary to a sequence having at least 95% identity with the isolength portion of the mRNA encoding the variant BRAF. The variant BRAF may have a mutation at position V600 compared to wild-type BRAF. For example, a variant BRAF that differs from wild-type BRAF at position V600 may be referred to as the "V600 variant."
[0255] In some embodiments, variant BRAF differs from wild-type BRAF at the V600 level. Variant BRAF may be a V600G variant. Variant BRAF may be a V600M variant. Variant BRAF may be a V600D variant. Variant BRAF may be a V600R variant. Variant BRAF may be a V600K variant. Variant BRAF may be a V600E variant.
[0256] The BRAF V600G variant can arise from a c.1799T>G (c.T1799G) mutation in the BRAF genome sequence. The BRAF V600M variant can arise from a c.1798G>A (c.G1798A) mutation in the BRAF genome sequence. The BRAF V600D variant can arise from a c.1799_1800delisAT mutation in the BRAF genome sequence. The BRAF V600R variant can arise from a c.1798_1799delisCG mutation in the BRAF genome sequence. The BRAF V600K variant can arise from a c.1798_1799delisAA mutation in the BRAF genome sequence. The BRAF V600E variant can arise from a c.1799_1800delisAA mutation in the BRAF genome sequence. The BRAF V600E variant can arise from the c.1799T>A (c.T1799A) mutation in the BRAF genome sequence.
[0257] The nucleic acid molecules described herein may specifically target the sequence of variant BRAF. As used herein, “specifically target” refers to the preferential hybridization of the nucleic acid molecule to the desired sequence, in this case the sequence of variant BRAF.
[0258] The nucleic acid molecules described herein can inhibit the expression of the G60R variant NRAS and can specifically target nucleic acid molecules having the sequence GACATACTGGATACAGCTCGACAAGAAGAGTACAGTG (SEQ ID NO: 7). The nucleic acid molecules described herein can inhibit the expression of the G60V variant NRAS and can specifically target nucleic acid molecules having the sequence ACATACTGGATACAGCTGTACAAGAAGAGTACAGTGC (SEQ ID NO: 9). The nucleic acid molecules described herein can inhibit the expression of the G60E variant NRAS and can specifically target nucleic acid molecules having the sequence ACATACTGGATACAGCTGAACAAGAAGAGTACAGTGC (SEQ ID NO: 11). The nucleic acid molecules described herein can inhibit the expression of the Q61K variant NRAS and can specifically target nucleic acid molecules having the sequence ATACTGGATACAGCTGGAAAAGAAGAGTACAGTGCCA (SEQ ID NO: 13). The nucleic acid molecules described herein can inhibit the expression of the Q61R variant NRAS and can specifically target nucleic acid molecules having the sequence TACTGGATACAGCTGGACGAGAAGAGTACAGTGCCAT (SEQ ID NO: 15). The nucleic acid molecules described herein can inhibit the expression of the Q61L variant NRAS and can specifically target nucleic acid molecules having the sequence TACTGGATACAGCTGGACTAGAAGAGTACAGTGCCAT (SEQ ID NO: 17). The nucleic acid molecules described herein can inhibit the expression of the Q61P variant NRAS and can specifically target nucleic acid molecules having the sequence TACTGGATACAGCTGGACCAGAAGAGTACAGTGCCAT (SEQ ID NO: 19). The nucleic acid molecules described herein can inhibit the expression of the Q61H variant NRAS and can specifically target nucleic acid molecules having the sequence ACTGGATACAGCTGGACACGAAGAGTACAGTGCCATG (SEQ ID NO: 21). The nucleic acid molecules described herein can inhibit the expression of the Q61H variant NRAS and can specifically target nucleic acid molecules having the sequence ACTGGATACAGCTGGACATGAAGAGTACAGTGCCATG (SEQ ID NO: 23).
[0259] The nucleic acid molecules described herein can inhibit the expression of the G12V variant NRAS and can specifically target nucleic acid molecules having the sequence TGGTGGTGGTTGGAGCAGTTGGTGTTGGGAAAAGCGC (SEQ ID NO: 25). The nucleic acid molecules described herein can inhibit the expression of the G12R variant NRAS and can specifically target nucleic acid molecules having the sequence CTGGTGGTGGTTGGAGCACGTGGTGTTGGGAAAAGCG (SEQ ID NO: 27). The nucleic acid molecules described herein can inhibit the expression of the G12D variant NRAS and can specifically target nucleic acid molecules having the sequence TGGTGGTGGTTGGAGCAGATGGTGTTGGGAAAAGCGC (SEQ ID NO: 29). The nucleic acid molecules described herein can inhibit the expression of the G12S variant NRAS and can specifically target nucleic acid molecules having the sequence CTGGTGGTGGTTGGAGCAAGTGGTGTTGGGAAAAGCGC (SEQ ID NO: 31). The nucleic acid molecules described herein can inhibit the expression of the G12P variant NRAS and can specifically target nucleic acid molecules having the sequence TGGTGGTGGTTGGAGCACCTGGTGTTGGGAAAAGCGC (SEQ ID NO: 33). The nucleic acid molecules described herein can inhibit the expression of the G12C variant NRAS and can specifically target nucleic acid molecules having the sequence CTGGTGGTGGTTGGAGCATGTGGTGTTGGGAAAAGCGC (SEQ ID NO: 35). The nucleic acid molecules described herein can inhibit the expression of the G12A variant NRAS and can specifically target nucleic acid molecules having the sequence TGGTGGTGGTTGGAGCAGCTGGTGTTGGGAAAAGCGC (SEQ ID NO: 37). The nucleic acid molecules described herein can inhibit the expression of the G13S variant NRAS and can specifically target nucleic acid molecules having the sequence GTGGTGGTTGGAGCAGGTAGTGTTGGGAAAAGCGCAC (SEQ ID NO: 39). The nucleic acid molecules described herein can inhibit the expression of the G13C variant NRAS and can specifically target nucleic acid molecules having the sequence GTGGTGGTTGGAGCAGGTTGTGTTGGGAAAAGCGCAC (SEQ ID NO: 41).The nucleic acid molecules described herein can inhibit the expression of the G13R variant NRAS and can specifically target nucleic acid molecules having the sequence GTGGTGGTTGGAGCAGGTCGTGTTGGGAAAAGCGCAC (SEQ ID NO: 43). The nucleic acid molecules described herein can inhibit the expression of the G13F variant NRAS and can specifically target nucleic acid molecules having the sequence GTGGTGGTTGGAGCAGGTTTTGTTGGGAAAAGCGCAC (SEQ ID NO: 45). The nucleic acid molecules described herein can inhibit the expression of the G13Y variant NRAS and can specifically target nucleic acid molecules having the sequence GTGGTGGTTGGAGCAGGTTATGTTGGGAAAAGCGCAC (SEQ ID NO: 47). The nucleic acid molecules described herein can inhibit the expression of the G13V variant NRAS and can specifically target nucleic acid molecules having the sequence GTGGTGGTTGGAGCAGGTGTTGTTGGGAAAAGCGCAC (SEQ ID NO: 49). The nucleic acid molecules described herein can inhibit the expression of the G13D variant NRAS and can specifically target nucleic acid molecules having the sequence TGGTGGTTGGAGCAGGTGATGTTGGGAAAAGCGCACT (SEQ ID NO: 51). The nucleic acid molecules described herein can inhibit the expression of the G13A variant NRAS and can specifically target nucleic acid molecules having the sequence TGGTGGTTGGAGCAGGTGCTGTTGGGAAAAGCGCACT (SEQ ID NO: 53).
[0260] The nucleic acid molecules described herein can inhibit the expression of variant NRAS and can specifically target nucleic acid molecules having the sequence ATACTGGATACAGCTGGTAAAGAAGAGTACAGTGCCA (SEQ ID NO: 55). The nucleic acid molecules described herein can inhibit the expression of variant NRAS and can specifically target nucleic acid molecules having the sequence ATACTGGATACAGCTGGAAAGGAAGAGTACAGTGCCA (SEQ ID NO: 57).
[0261] The nucleic acid molecules described herein can inhibit the expression of the V600G variant BRAF and can specifically target nucleic acid molecules having the sequence ATTTTGGTCTAGCTACAGGGAAATCTCGATGGAGTGG (SEQ ID NO: 59). The nucleic acid molecules described herein can inhibit the expression of the V600M variant BRAF and can specifically target nucleic acid molecules having the sequence GATTTTGGTCTAGCTACAATGAAATCTCGATGGAGTG (SEQ ID NO: 61). The nucleic acid molecules described herein can inhibit the expression of the V600D variant BRAF and can specifically target nucleic acid molecules having the sequence ATTTTGGTCTAGCTACAGATAAATCTCGATGGAGTGG (SEQ ID NO: 63). The nucleic acid molecules described herein can inhibit the expression of the V600R variant BRAF and can specifically target nucleic acid molecules having the sequence GATTTTTGGTCTAGCTACACGGAAATCTCGATGGAGTG (SEQ ID NO: 65). The nucleic acid molecules described herein can inhibit the expression of the V600K variant BRAF and can specifically target nucleic acid molecules having the sequence GATTTTTGGTCTAGCTACAAAGAAATCTCGATGGAGTG (SEQ ID NO: 67). The nucleic acid molecules described herein can inhibit the expression of the V600E variant BRAF and can specifically target nucleic acid molecules having the sequence ATTTTGGTCTAGCTACAGAAAAATCTCGATGGAGTGG (SEQ ID NO: 69). The nucleic acid molecules described herein can inhibit the expression of the V600E variant BRAF and can specifically target nucleic acid molecules having the sequence ATTTTGGTCTAGCTACAGAGAAATCTCGATGGAGTGG (SEQ ID NO: 71).
[0262] Sequence identity The antisense compounds provided herein may also have a defined identity percentage for a particular nucleotide sequence, sequence number, or compound, or portion thereof. When used herein, an antisense compound is identical to a sequence disclosed herein if it has the same nucleic acid base pairing ability. For example, an RNA containing uracil instead of thymidine in a disclosed DNA sequence is considered identical to that DNA sequence because both uracil and thymidine pair with adenine. Shortened and extended forms of the antisense compounds described herein, as well as compounds having non-identical bases to the antisense compounds provided herein, are also intended. Non-identical bases may be adjacent to each other or dispersed throughout the antisense compound. The identity percentage of an antisense compound is calculated according to the number of bases that have the same base pairings to the sequence it is being compared to.
[0263] In some embodiments, the antisense compound or portion thereof is at least 70%, 75%, 80%, 85%, 90%, 95%, 96%, 97%, 98%, 99%, or 100% identical to one or more of the antisense compounds or sequence numbers disclosed herein.
[0264] In some embodiments, a portion of the antisense compound is compared to an isolength portion of the target nucleic acid. In certain embodiments, 8, 9, 10, 11, 12, 13, 14, 15, 16, 17, 18, 19, 20, 21, 22, 23, 24, 25, 26, 27, 28, 29, 30, 31, 32, 33, 34, 35, 36, 37, 38, 39, 40, 41, 42, 43, 44, 45, 46, 47, 48, 49, or 50 nucleic acid base portions are compared to an isolength portion of the target nucleic acid.
[0265] In some embodiments, a portion of an antisense oligonucleotide is compared to an isolength portion of a target nucleic acid. In certain embodiments, 8, 9, 10, 11, 12, 13, 14, 15, 16, 17, 18, 19, 20, 21, 22, 23, 24, 25, 26, 27, 28, 29, 30, 31, 32, 33, 34, 35, 36, 37, 38, 39, 40, 41, 42, 43, 44, 45, 46, 47, 48, 49, or 50 nucleic acid base portions are compared to an isolength portion of a target nucleic acid. A nucleoside is a base-sugar combination. A nucleotide is a nucleoside that further contains a phosphate group covalently bonded to the sugar portion of the nucleoside. Oligonucleotides are formed by the covalent bonds of adjacent nucleosides to form linear polymer oligonucleotides. Within the oligonucleotide structure, it is mentioned that phosphate groups typically form internucleoside bonds between oligonucleotides.
[0266] Modification of antisense compounds includes substitutions or alterations to nucleoside bonds, sugar moieties, or nucleic acid bases. Modified antisense compounds are often preferred over their natural forms due to desirable properties such as improved cellular uptake, increased affinity for nucleic acid targets, increased stability in the presence of nucleases, or increased inhibitory activity.
[0267] Sequence complementarity An antisense compound and a target nucleic acid are complementary if a sufficient number of nucleic acid bases in the antisense compound can form hydrogen bonds with the corresponding nucleic acid bases of the target nucleic acid to produce the desired effect (e.g., inhibition of target gene expression).
[0268] Non-complementary nucleic acid bases between the antisense compound and the nucleic acid may be acceptable as long as the antisense compound maintains a state that allows for specific hybridization to the target nucleic acid. Furthermore, the antisense compound may hybridize across one or more segments of the nucleic acid so that intervening or adjacent segments do not participate in the hybridization event (e.g., loop structures, mismatches, or hairpin structures).
[0269] In certain embodiments, the antisense compounds provided herein, or particular portions thereof, are 70%, 80%, 85%, 86%, 87%, 88%, 89%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, or 99%, or 100% complementary, or at least as complementary as, a nucleic acid, target region, target segment, or particular portions thereof. The percent complementarity between the antisense compound and the target nucleic acid can be determined using conventional methods.
[0270] For example, an antisense compound in which 18 out of 20 nucleic acid bases are complementary to the target region and thus specifically hybridizes represents 90% complementarity. In this example, the remaining non-complementary nucleic acid bases may be clustered or interspersed with complementary nucleic acid bases and need not be adjacent to one another or to complementary nucleic acid bases. The percent complementarity of an antisense compound with a region of a target nucleic acid can be routinely determined using the BLAST program (Basic Local Alignment Search Tool) known in the art. Percent homology, sequence identity, or complementarity can be determined, for example, by the Gap program using default settings.
[0271] The invention is further illustrated by the following examples. These examples illustrate embodiments of the invention but should be understood as being provided merely by way of illustration. From the foregoing discussion and these examples, those skilled in the art can identify the essential characteristics of the invention and can make various changes and modifications to the invention to adapt it to various uses and conditions without departing from the spirit and scope thereof. Accordingly, various modifications of the invention will be apparent to those skilled in the art from the foregoing description in addition to those shown and described herein. Such modifications are also intended to fall within the scope of the appended claims.
Examples
[0272] Example 1 - Identification and Validation of Variant NRAS-Specific siRNAs Identification of siRNAs with allele-recognition ability against NRAS c.181C>A mutations We designed an experiment to identify siRNA sequences that can distinguish between the wild-type allele NRAS and the NRAS allele with the c.181C>A mutation. The experimental design is shown in Figure 1(a). Briefly, we designed siRNAs that could potentially knock down variant NRAS transcripts using a “walking” approach across the target mutation (gray vertical bar NRAS c.181C>A). The 3' end of the siRNA complementary sequence is completed with two uracil nucleotides that have been reported to improve their activity. Note that the sequences illustrated in the panel are passenger (sense) strands to facilitate interpretation of the corresponding nucleotides.
[0273] HCT116 colorectal cancer WT (CrownBio, C8052C-WT) and homozygous NRAS c.181C>A;p.Q61K (CrownBio, C6072C) was treated with siRNA for 48 hours. RNA was extracted, reverse transcribed into cDNA, and analyzed by qPCR. Allele discrimination ability against the target NRAS c.181C>A transcript was measured based on a simple statistical analysis (i.e., a statistically significant reduction in the target allele and a statistically insignificant reduction in the non-target allele). To extend this evaluation, we also considered the results of an equation that either allows or does not allow targeting of the non-target allele (Takahashi and Hohjoh 2014).
[0274] As shown in Figure 1, a total of 19 siRNAs were tested. Of these, siRNAs 8 and 15 showed excellent allele discrimination between wt and c.181C>A variant NRAS and were able to significantly reduce the expression of variant NRAS without affecting wild-type NRAS expression.
[0275] Next, the qPCR data obtained from this initial study were validated using an RNA-seq approach. In short, this involved HCT116 colorectal cancer WT (CrownBio, C8052C-WT) and homozygous NRAS. c.181C>A;p.Q61K (CrownBio, C6072C) was treated with siRNA for 48 hours. RNA was extracted and then analyzed by RNA-seq. The results of the RNA-seq analysis are shown in Figure 14.
[0276] As shown in Figure 2A, siRNAs 1, 8, and 15 significantly reduced the expression of variant NRAS. Figures 2E, F, and G show the effects of candidate siRNAs 1, 8, and 15 on the transcriptome. Figures 2E, F, and G show the predicted off-target effects of each siRNA and the extent to which the expression of each of their targets is affected after siRNA treatment. In particular, siRNAs 8 and 15 showed minimal disruption of predicted off-target expression, indicating good potential as regulators of variant NRAS. siRNA 8 also did not affect the expression of NRAS homologs KRAS and HRAS in non-variant cells (Figures 2C and 2D).
[0277] Effects of identified siRNAs on downstream signaling pathways and cell morphology We identified several candidate siRNAs that can selectively regulate the expression of variant NRAS, and analyzed the effects of these siRNAs on the MAPK pathway by Western blotting. (HCT116 colorectal cancer WT (CrownBio, C8052C-WT) and homozygous NRAS) c.181C>A;p.Q61K (CrownBio, C6072C) was treated with candidate siRNAs (siRNA1, siRNA8, and siRNA15) for 48 hours. Proteins were extracted and then examined by Western blotting.
[0278] As shown in Figure 13, the candidate siRNAs did not alter the amount of phosphorylated ERK in WT NRAS cancer cells compared to controls. However, in variant NRAS cells, phosphorylated ERK was reduced after treatment with candidate siRNAs 1, 8, and 15. These results demonstrate that the candidate siRNAs can modulate variant NRAS expression and influence downstream signaling pathways.
[0279] Example 2 - Inhibition of variant NRAS in cells derived from patients with congenital melanocytic nevus (CMN) First, we characterized nevus cells derived from CMN patients. Briefly, nevus cells were collected from CMN patient biopsy material, cultured, and grown. The cells were fixed and labeled with antibodies targeting SOX10 and tyrosinase. The cells were sequenced using Sanger sequencing. Morphology was analyzed using CellProfiler Analyst (by training a machine learning classifier model) with images acquired from Livecyte microscopy.
[0280] The results of the characterization are shown in Figure 3. In particular, Figure 3E shows the NRAS mutations identified by Sanger sequencing in nevus cells derived from CMN patients. Both c.181C>A and c.182A>G mutations were identified.
[0281] After characterizing nevus cells derived from CMN patients, the effects of variant NRAS inhibition on cell morphology, proliferation, and downstream signaling pathways were evaluated.
[0282] In short, nevus cells were collected from CMN patient biopsy material, cultured, and grown. Cells were treated with either siRNA8 or scrambled RNA as a control for 48 hours. Cellular RNA was extracted, reverse transcribed to cDNA, and analyzed by qPCR. Proteins were extracted and analyzed using antibodies targeting total NRAS (i.e., both WT and NRASQ61K proteins, as no antibody targets only WT or variant NRASQ61K protein). The last 24 hours of cell proliferation after siRNA treatment were analyzed by Livecyte microscopy and ptychography. The number of cells undergoing cell division during the last 24 hours after siRNA treatment was analyzed by EdU uptake and imaged using a standard fluorescence microscope. Images were quantified using CellProfiler software.
[0283] The results are shown in Figure 4. siRNA8 treatment significantly reduced the expression of variant NRAS c.181C>A (Figure 4C) and also significantly reduced total NRAS protein (Figure 4D), confirming that mRNA-level knockdown leads to decreased protein expression. The ratio of phosphorylated ERK to total ERK was also significantly reduced in siRNA8-treated cells (Figures 4E, 4F), again demonstrating that NRAS regulation in CMN patient-derived nevus cells can affect downstream signaling pathways. siRNA8 treatment of CMN patient-derived nevus cells also significantly reduced cell proliferation compared to untreated cells and scrambled RNA controls (Figure 4H).
[0284] Next, the combined effects of variant NRAS inhibition and trametinib treatment were evaluated. Trametinib is an anticancer drug used to treat melanoma. As expected, trametinib treatment alone reduced the proliferation of nevus cells derived from CMN patients in a dose-dependent manner (Figure 4I). Inhibition of variant NRAS by siRNA8 treatment further reduced the proliferation of trametinib-treated cells (Figures 4I, 4J).
[0285] Nevus cells were collected from CMN patient biopsy material, cultured, and grown. Cells were treated with siRNA for 48 hours. The last 24 hours of cell proliferation after siRNA treatment were analyzed using Livecyte microscopy and ptychography. Cell morphologies were assigned based on machine learning (see CellProfiler Analyst software, Figure "In vitro proliferation of NRAS variant cells derived from congenital melanocytic nevus (CMN) patients"). Immunofluorescence was performed using antibodies targeting specific proteins associated with stem cells and melanocyte cells. Images were quantified using CellProfiler software. These data are shown in Figure 5.
[0286] siRNA8 also reduces the proportion of nonpolar cells in primary nevus cell cultures. Label-free ptychography imaging of nevus cell morphology and behavior in samples from four patients revealed diverse morphologies within each sample (Figures 3 and 4). Therefore, morphologies were classified using machine learning tools into relative proportions of nonpolar, bipolar, multipolar, and large, multinucleated cells likely to be senescent (Figure 3). The proportions of each cell type were consistent across patients (Figure 3h). Nonpolar morphologies generally appeared transiently before cell division, particularly division into three daughter cells. Single-dose siRNA8 treatment induced a significant reduction in the proportion of nonpolar cells at 48 hours, with no changes observed in other subtypes (Figures 5b-e). Flow cytometry based on DNA content (DAPI intensity) analysis did not detect any effect on cell cycle stage after 48 hours of siRNA8 treatment.
[0287] Baseline characterization of nevus cells to confirm melanocyte lineage included characterization of MITF, DCT, and nestin (Figure 5), as well as aging markers P53 (TP53) and P16 (CDKN2A), in addition to immunocytochemistry-based SOX10 and tyrosinase expression. Despite increased DCT expression and slight decreases in NES expression observed in RNA-seq datasets, all immunocytochemical markers remained unaffected by siRNA8 treatment at 48 hours.
[0288] siRNA8 treatment of primary CMN cells suppressed the anti-apoptotic marker ARL6IP1. RNA sequencing was performed on primary nevus cell lines before and after siRNA8 treatment to investigate both on-target and off-target effects. Variant NRAS expression was significantly and preferentially downregulated compared to the wild type (Figure 14C), while highly homologous genes KRAS (Figure 15C) and HRAS (Figure 15D) were unaffected. Pathway analysis of differentially expressed genes identified enrichment of pathways mainly related to the cell cycle (Figures 14E, 15E, and Supplementary Data Table 2). The RAL and integrin pathways were also enriched, along with pathways related to neuron sheath formation (Figures 14E, 15E, and Supplementary Data Table 2). In contrast, genes related to melanocyte differentiation were largely unaffected, except for increased DCT expression (Figures 14E, 17E). Importantly, the most significantly expressed differentially expressed gene was ADP-ribosylated factor-like GTPase-6 interacting protein 1 or ARL6IP1, also known as endoplasmic reticulum membrane apoptosis regulator or ARMER (Figure 14A).
[0289] siRNA8 treatment induces apoptosis in primary CMN cell cultures. As highlighted above, ARL6IP1 is highly expressed in melanoblasts (Figure 17H) and is distributed throughout the ER membrane in a pattern similar but not identical to that of the rough endoplasmic reticulum-associated protein ribophorin 1 (RPN1) (Figure 16A). Validation experiments demonstrated that 48-hour siRNA8 treatment resulted in suppression of the ARL6IP1 gene (Figure 16B) and protein (Figures 16C and 17I) in all patient strains. ARL6IP1 was also significantly downregulated in the siRNA8-treated HCT116 cell dataset (Figures 18A, 18B). ARL6IP1 is known to play a role in protecting cells from the apoptotic effects of ER stress, and oncogenic NRAS activity has been shown to drive resistance to ER stress. Therefore, the inventors examined the expression of the major ER stress-induced apoptosis regulators ERN1, EIF2AK3, and ATF6. ERN1 and EIFAK3 were significantly increased on RNAseq (Figures 18D - F), but only ERN1 was found to be significantly upregulated by qPCR at 48 hours in response to siNRASQ61K treatment (Figures 16D and 18G). At the same time, the inventors identified a significant decrease in BIRC5 expression by siRNA8 treatment in both melanoblast (Figure 16E) and HCT116 cell datasets (Figure 18C). BIRC5 encodes survivin, a protein important in protecting against RAS-induced apoptosis.
[0290] Considering these early indicators of apoptosis pathway activation in RNAseq at 48 hours, the inventors measured apoptosis using caspase 3 / 7 activation in live imaging of cells from four melanotic patients over 7 days. All melanoblast cultures treated with a single dose of siRNA8 showed a significant increase in apoptosis levels by day 7 in all patients compared to untreated cells and control siRNA, which was measurable at 3 - 4 days (Figure 16F).
[0291] siRNA8 treatment in primary nevus cell cultures enables the efficacy of MEKi. Next, the efficacy of siRNA8 treatment was compared to that of the MEK inhibitor (MEKi) trametinib, the only drug therapy currently being attempted in vivo in CMN patients. Individually, at the doses used, the efficacy of siRNA8 and trametinib alone was similar (Figure 4i, j). However, the combined efficacy of siRNA8 and trametinib in reducing proliferation was significantly higher than that of trametinib alone at 48 hours (Figure 4i, j, and Figure 20). Unlike its effect on CMN cell proliferation in culture, MEKi trametinib alone did not affect caspase 3 / 7 activity (Figure 19). However, the addition of 12.5 nM trametinib to siRNA8-treated cells significantly increased the induction of apoptosis seen with siRNA8 treatment alone, an effect not observed with the addition of trametinib to siCTRL-treated cells (Figure 19).
[0292] The data above demonstrate that manipulating variant NRAS has therapeutic utility in rescuing hyperactivation of the ERK pathway and reducing the proliferation of nevus cells derived from CMN patients. Given that CMN individuals are at a much higher risk of developing melanoma compared to non-CMN individuals, modulating variant NRAS also offers an opportunity to mitigate melanoma risk by rescuing the effects associated with gain-of-function NRAS mutations. Importantly, the data contained herein support that silencing variant NRAS alleles leads to the induction of apoptosis in diseased cells. This confirms the utility of targeting NRAS variants as an approach in both CMN and melanoma treatment.
[0293] Example 3 - Injection of NRAS-targeted siRNA into the dermis Materials and methods TYR::NRASQ61K mice were euthanized and depilated. 50 µl of siRNA-cy5, prepared with cationic lipid nanoparticles (DOTMA+DOPE+peptide KKKKKKKKKKKKKKKKGACISVYMMCG) (SEQ ID NO: 1353) mixed in isotonic sucrose buffer (300 mOsmol) in a 1:4:1 ratio (lipid:peptide:siRNA), was injected into the dermis. Injection with sucrose vehicle buffer alone is shown as a negative control. The injection sites were immediately isolated, fixed, cryoprotected, and then frozen-sectioned. The sections were stained with Hoechst to observe the DNA (i.e., nucleus). siRNA-cy5 is shown in white in Figure 6.
[0294] result Since the dermis is the primary site of nevus cells in the CMN, we conducted experiments to investigate whether siRNA could be delivered to the dermis without problems by injection in mice. The distribution of siRNA after intradermal injection into mouse skin was examined by tracking siRNA-Cy5. siRNA can be observed in the dermis, the primary site of nevus cells in the CMN. The dotted line indicates the boundary between the epidermis and dermis.
[0295] The results shown in Figure 6 support the idea that siRNA can be successfully delivered to the location of nevus cells in vivo by injection.
[0296] While siRNA is used as the targeting modality in the above examples, any targeting modality capable of modulating variant NRAS expression would be useful in this context. With this in mind, we have sought to provide a guide RNA that enables selective targeting of variant NRAS via CRISPR editing.
[0297] Example 4 - CRISPR Editing The CRISPR-Cas9 system has two main components: the Cas9 endonuclease and a single-stranded guide RNA. Both parts play a role in targeting. The sgRNA is a single-stranded RNA molecule produced as a result of the fusion of a custom-designed short CRISPR RNA (crRNA) complementary to the target DNA sequence with a transactivating crRNA (tracrRNA) scaffold. This sgRNA can guide the Cas9 system to any complementary sequence, but the Cas9 nuclease will not be activated unless it detects a protospacer-adjacent motif (PAM). A PAM sequence is a short sequence of nucleotides recognized by the C-terminal domain within the nuclease lave of the Cas9 enzyme. Once the Cas9-sgRNA complex is formed, the complex scans the genome for the presence of PAM sites through hydrogen bonding of the C-terminal domain to DNA via a major glove. Upon recognizing the PAM sequence, Cas9 allows localized DNA lysis and the entry of the sgRNA strand, resulting in the formation of an R-loop. Subsequently, if the sgRNA aligns with a potential target site and there is high homology between the sequences, it enables the activation of two nuclease domains, HNH and RuvC, resulting in a double-strand DNA break.
[0298] Many homologs of Cas9 have been found in numerous different bacterial species, including S. pyogenes (Sp), S. aureus (Sa), S. thermophiles, and N. 162 meningitides, and each of these Cas9 homologs has a different PAM recognition sequence.
[0299] To construct an allele-specific sgRNA, either the sgRNA or the PAM sequence must contain the NRAS c.(181C>A) mutation. In NRAS, no PAM sequence specific to -NGG- (where N may be any nucleotide) was found that either incorporated the mutation for use with this endonuclease or was close enough to the mutation. Instead, using Benchling (October 2016; Benchling Inc.), -NNGRRT- (where N is any nucleotide and R is A or G) was located close enough so that the sgRNA could contain the NRAS c.(181C>A) mutation (Figure 7). The 21-nucleotide sequences of the three sgRNAs corresponding to the three PAM sites are shown in Figure 7.
[0300] Three sgRNAs were inserted into the plasmid via restriction enzyme digestion of the backbone and ligation of the sgRNA DNA template. The px601 plasmid vector (Addgene plasmid #61591; Addgene, MA, USA) was selected because it contained a site that allowed for the insertion of SaCas9 and the sgRNA DNA template into the plasmid via Golden Gate cloning.
[0301] Plasmids were provided in chemically competent E. coli (Stbl3), and the E. coli were grown in selective medium for 16 hours. A portion of the bacterial suspension was removed for plasmid extraction. Plasmid identity was confirmed by enzymatic digestion of the plasmid using HincIII enzyme (New England Biolabs, MA, USA). After confirmation, the plasmid was linearized using BsaI enzyme (New England Biolabs, MA, USA) to enable Golden Gate cloning.
[0302] The sgRNA DNA inserts incorporated the relevant overhangs into their design before synthesis. The plasmids and inserts were then ligated together and transformed into chemically competent E. coli (ThermoFisher Scientific, MA, USA). E. coli was streaked onto selective agar and incubated for 16 hours to produce single-cell colonies. Selected single-cell colonies were further expanded in selective medium suspension for another 16 hours. A certain percentage of bacterial cell suspension was used for plasmid extraction to screen colonies for correct insertion of sgRNA DNA inserts into the px601 plasmid backbone. Screening consisted of enzymatic digestion and Sanger sequencing (Figures 6-8). Plasmids extracted from bacterial colonies were digested with BciVI enzyme to confirm the correct insertion of either sgRNA1 or sgRNA2. Figure 8A shows that plasmid 1 contains the sgRNA2 insert and was therefore named px601-sgRNA2. px601-sgRNA1 had been identified in a previous screening and was used as a positive control for enzyme activity in Figure 8A. Figure 9 shows that all three tested colonies contained the sgRNA1 insertion in the px601-GFP backbone; therefore, GFP sgRNA1.1 was moved to the next step and named px601-GFP-sgRNA1. Figure 9 shows that all three tested colonies contained the sgRNA2 insertion in the px601-GFP backbone; therefore, GFP sgRNA2.1 was moved to the next step and named px601-GFP-sgRNA2. To confirm the correct insertion of sgRNA3, plasmids extracted from bacterial colonies were digested with EarI enzyme (New England Biolabs, MA, USA, Figure 8B, Figure 10). Figure 8B shows that plasmid 3 contained the sgRNA3 insertion and was therefore named px601-sgRNA3. Figure 10 shows that all three tested colonies contained an sgRNA3 insertion within the px601-GFP backbone; therefore, GFP sgRNA3.1 was advanced to the next stage and named px601-GFP-sgRNA3. The positive results of the enzyme screening (Figures 6-8) were confirmed by Sanger sequencing.This resulted in the generation of px601-sgRNA1, px601-sgRNA2, and px601-sgRNA3; px601-GFP-sgRNA1, px601-GFP-sgRNA2, and px601-GFP-sgRNA3.
[0303] The positive DNA samples obtained from Figures [22 (in the paper)],
[23] , and 24 were sent for Sanger sequencing to confirm the insertion of the relevant sgRNA oligonucleotide into the px601 or px601-GFP backbone. Figure 25 shows the resulting chromatogram. The relevant insertion sequences are highlighted in the chromatogram. The sgRNA sequences can be seen in Figure 20, and the sgRNA DNA oligonucleotide sequences of each insertion can be seen in Table 6. The chromatograms were prepared using Snap Gene Viewer (GSL Biotech LLC, IL, USA).
[0304] Optimization of transfection of HCT116 cell line with GFP-containing plasmids The objective of this experiment was to maximize transfection efficiency. This is necessary to provide the best opportunity to observe any genome editing while using the CRISPR-Cas9 system. To achieve this objective, a plasmid containing the GFP protein (pEGFP-N1; Clontech, CA, USA) was transfected into the HCT116-Q cell line using Lipofectamine® 2000 (ThermoFisher Scientific, Waltham, MA, USA). The GFP plasmid was used because the plasmid containing the CRISPR-Cas9 system did not have a selectable marker. HCT116-Q cells were seeded in 24-well plates at two different densities, 1.8 × 10⁵ and 2.2 × 10⁵, and left overnight in a 5% CO₂ incubator at 37°C. Observing the two different seeding densities, it was found that the 2.2 × 10⁵ wells exceeded the confluence recommended for transfection; therefore, only the 1.8 × 10⁵ wells were advanced to the next step for transfection. Three quantities of plasmid DNA (250, 500, and 750 ng) were used with three volumes of Lipofectamine® 2000 (1, 2, and 3 pL). This transfection optimization protocol was performed on three biological triplicates. After 48 hours, the cells were subjected to flow cytometry. Cells were initially selected for health by utilizing forward and lateral scattering within a normal range. Subsequently, cells were measured for the presence and abundance of fluorescence. Non-transfected cells were used as a negative fluorescence control to determine the percentage of fluorescently active cells, thereby introducing a gate to provide transfection efficiency. The same gating was applied to all biological replicas (Figure 26).
[0305] Transfection with 1 pL of Lipofectamine® 2000 resulted in the poorest overall transfection, with approximately 10% GFP fluorescence. All remaining combinations had comparable transfection efficiencies, with both the 2 pL and 3 pL Lipofectamine® combinations achieving approximately 50% transfection efficiency. All controls showed very low transfection rates. Based on these results, subsequent plasmid transfection should be performed using 250 ng of DNA and 3 pL of Lipofectamine® 2000 (Figure 27).
[0306] Determination of editing efficiency in the HCT116 cell line px601-sgRNA was transfected into the HCT116 cell line. After seeding, the optimized formulation was applied to the cells 24 hours later, and the cells were incubated for 48 hours. Subsequently, the cells were lysed and DNA was extracted. PCR was performed on the target region, and after purifying the PCR product, genome editing was determined using the T7 assay (Figure 28).
[0307] The assay included several controls to aid in detection of defects. The samples used were px601-sgRNA1 (sgRNA1), px601-sgRNA2 (sgRNA2), px601-sgRNA3 (sgRNA3), px601 without sgRNA (px601), CFTR transfection control plasmid, lipofectamine 2000 alone control (L2K), non-transfection control (Unt), and T7 control (T7 control). All samples were performed uncut (no T7 added) and tested (T7 added), as indicated by "2" or "+". The px601 plasmid without sgRNA was transfected, and this control was used to demonstrate the effect of adding the Cas9 plasmid without guidance. Plasmids known to target CFTR were used as positive controls for transfection, and the efficacy of these plasmids had been demonstrated by previous members of the lab in different cell lines. The confounding effect of adding only Lipofectamine® 2000 was determined using a Lipofectamine® 2000 monocontrol. A non-transfection control was also provided to show what an unedited baseline would show. Finally, a T7 assay control was provided, designed to show whether the T7 assay was functioning, which was achieved by providing a sample of genomic DNA showing the occurrence of gene editing within the CFTR gene, which was amplified by PCR, purified, and digested with T7. The experiment was performed in three biological triplicates.
[0308] A positive result for gene editing was expected to indicate that the PCR product was digested, generating two shorter DNA fragments of the original PCR product's full length. For the plasmid targeting NRAS, the PCR product was 827 bp, and if gene editing occurred at the target site, two fragments of sizes 372 and 455 bp were observed. An example of a positive T7 result was seen in the T7 control in all three replicates, where the PCR product of a region of the CFTR gene was approximately 840 bp, and if editing occurred, two fragments of sizes 210 and 630 bp were present. Because these DNA fragments were observed, it could be concluded that the T7 assay functioned correctly. However, the transfection control in the form of the CFTR-targeted plasmid did not show editing. Furthermore, all three px601-sgRNA samples did not show editing. The other negative controls, px601 without a guide, Lipofectamine® 2000 alone, and non-transfection samples all showed no editing. This led to the conclusion that the transfection may not have worked as expected. To proceed, it would be useful to verify that the transfection worked correctly by using tagged Cas9.
[0309] Single-cell sorting of GFP-positive cells to aid in gene editing identification. A novel px601-GFP plasmid containing guide RNA was transfected into both parental (wild-type c.(181C)) and variant (homozygous c.(181C>A)) HCT116 cell lines. Cells were incubated for 48 hours and then sorted (Figure 29). Cell sorting was performed using GFP-tagged flow cytometry to enrich the CRISPR-Cas9 transfected cells.
[0310] Furthermore, single-cell colonies of GFP-positive cells were generated by single-cell sorting using flow cytometry. After a period of expansion and growth, these colonies were collected for DNA extraction and sequencing. In addition, surplus GFP-positive cells not used for seeding the single-cell colonies were collected to form a "GFP-positive mixed population" of cells. DNA and proteins were extracted from these cells, and the DNA was used to examine whether editing occurred within the population, while the proteins were used to examine the effect of editing on MAPK pathway activation by Western blot analysis of ERK phosphorylation status.
[0311] Investigation of the presence of gene editing in a GFP-positive mixed population transfected with px601-GFP-sgRNA As previously mentioned, surplus GFP-positive cells not used to generate single-cell colonies were collected as triplicate GFP-positive mixed populations. These populations were expanded until both DNA and protein could be extracted. The target sites were amplified using PCR, and the PCR products were subjected to a T7 assay. Briefly, this involved lysing and re-annealing the PCR products, digesting the annealed PCR products with T7 endonuclease I (New England Biolabs®, MA, USA), and examining the results on an agarose gel using electrophoresis. Figure 30 shows clear gene editing in the HCT116-Q (NRAS variant) cell line transfected with px601-GFP-sgRNA2, confirmed by digestion of the PCR products in all three triplicate samples. Detectable editing by this method was not observed with transfection of HCT116-Q using px601-GFP-sgRNA1 or px601-GFP-sgRNA3, nor with HCT116-P (non-NRAS variant).
[0312] Investigation of the presence of gene editing in a single-cell population transfected with px601-GFP-sgRNA After confirming that the GFP-positive mixed population had undergone gene editing, single-cell colonies were examined. Following single-cell sorting, the single-cell colonies were expanded and grown before DNA extraction. The target region was amplified by PCR and sequenced by Sanger sequencing.
[0313] Gene editing was performed only in the HCT116-Q cell line using both px601-GFP-sgRNA1 and px601-GFP-sgRNA2 (Figure 31). Of the 18 single-cell colonies sequenced from HCT116-Q transfected with px601-GFP-sgRNA1, 2 colonies showed gene editing, while the 19 single-cell colonies HCT116-P transfected with px601-GFP-sgRNA1 did not show gene editing. Of the 16 single-cell colonies sequenced from HCT116-Q transfected with px601-GFP-sgRNA2, 8 colonies showed gene editing, while the 9 single-cell colonies HCT116-P transfected with px601-GFP-sgRNA2 did not show gene editing. For px601-GFP-sgRNA3, no gene editing was detected in 21 and 7 sequenced single-cell colonies, respectively, for both HCT116-Q and HCT116-P.
[0314] Based on these findings, we concluded that the gene editing rate for px601-GFP-sgRNA1 was 11%, and for px601-GFP-sgRNA2 it was 50%, both of which exhibited allele-specific editing of only the variant allele.
[0315] Determination of the gene editing effect of GFP-positive mixed populations on the activation state of the MAPK signaling pathway. Having determined the presence of gene editing in NRAS using an allele-specific method, GFP-positive mixed samples were further examined to reveal potential alterations in the downstream MAPK signaling pathway by investigating the ERK phosphorylation status. After DNA was isolated for gene editing analysis (Figure 30), proteins were also extracted. ERK, phosphorylated ERK, and histone 3 (H3) were blotted in each of the three consecutive samples (Figure 32). The resulting blots were quantified using densitometry (Figure 33), and values were normalized to the relevant non-transfection control (Unt) to obtain the ratio of phosphorylated ERK to total ERK, providing a marker of MAPK signaling activation.
[0316] Compared to untransfected controls, transfection with sgRNA resulted in a non-significant decrease in the relative phosphorylation state of ERK (Figure 33). The greatest change was observed in HCT116-Q transfected with sgRNA2 (HCT116-P: 0.122 ± 0.080; HCT116-Q: 0.023 ± 0.017; mean ± standard deviation; p = 0.125), which was consistent with gene editing previously observed in these samples.
[0317] CRISPR-Cas9 Conclusion The primary objective was to achieve allele-specific gene editing of the NRASc.(181A) allele. This involved designing three sgRNAs specific to a variant allele that covered the c.(181) locus and were sufficiently close to utilize the SaCas9-specific PAM site. These sgRNAs were successfully cloned into a GFP-containing p601 plasmid and confirmed by both enzymatic digestion and Sanger sequencing. Transfection of the HCT116 cell line was optimized with the GFP-containing plasmid using flow cytometry. After optimization, cells were transfected with the px601-GFP-sgRNA plasmid and sorted by flow cytometry. Mixed and single-cell clones showed complete allele-specific targeting and knockdown of the NRAS gene, confirmed at the DNA level. Overall, sgRNA2 appeared to be the most promising guide, while sgRNA1 also showed good activity.
[0318] Example 5 - Design and testing of receptor-targeted nanoparticles (RTNPs) Materials and methods The lipids for cationic nanoparticles were resuspended and mixed to a total lipid concentration of 1 mg / ml in 100% ethanol: 49.5% cationic lipid DOTMA (DOTMA 1,2-di-O-octadecenyl-3-trimethylammoniumpropane (chloride salt). Molecular weight: 670.575 [CAS: 104872-42-6; Avanti SKU: 890898 P]). 49.5% neutral lipid DOPE (18:1(Δ9-cis)PE(DOPE) 1,2-dioleoyl-sn-glycero-3-phosphoethanolamine. Molecular weight: 744.034 [CAS: 4004-05-1; Avanti SKU: 850725P]). 1% PEGylated lipid (DPPE-PEG(2000) azide 1,2-dipalmitoyl-sn-glycero-3-phosphoethanolamine-N-azide (polyethylene glycol)-2000 (ammonium salt). Molecular weight: 2760.38 [CAS: Not applicable; Avanti SKU: 880231P]). The peptide (27 amino acids, Lys-Lys Lys-Lys-Lys-Lys-Lys-Lys-Lys-Lys-Lys-Lys-Lys-Lys-Lys-Gly-Ala-Cys-Ile-Ser-Val-Tyr-Met-Met-Cys-Gly(KKKKKKKKKKKKKKKKGACISVYMMCG(SEQ ID NO: 1353))[AMSBIO]) is resuspended in 95% ethanol at a concentration of 10 mg / ml.
[0319] Self-assembly of lipid nanoparticles is initiated by mixing lipids, peptides, and siRNA in that order, in a ratio of 1:4:1 (lipids:peptides:siRNA) unless otherwise specified. Three volumes of water must be used for every one volume of ethanol (i.e., siRNA must be added in three volumes of water for every one volume of ethanol from the lipid and peptide stocks). Lipid nanoparticles containing siRNA were dialyzed (GeBaFlex-tube-dialysis kit MWCO 8kDa, Generon), and the ethanol was replaced with water, with the water being replaced three times over 24 hours.
[0320] RTNPs were concentrated by loading the dialyzed sample onto a centrifugal filter unit (Amicron Ultra, Merck) and centrifugating at the rates / times outlined in the protocol. The concentrated nanoparticles were resuspended in sucrose solution (275-300 mOsm) using a sterile filter (syringe filter PTFE 25 mm 0.2 ulm NSTR, Fisher 15141499). The hydrodynamic size and charge of the lipid nanoparticles were measured using a Malvern Zetasizer. The RNase protection assay was performed by treating formulated lipid nanoparticles or siRNA alone with 2 μg / ml RNase A, followed by incubation at 37°C for 1, 2, or 4 hours. Digestion was stopped by adding 1 μl of RNase inhibitor. The nanoparticles were then dissolved in 16.4 mM SDS and subsequently electrophoresed on an agarose gel. The inclusion assay was performed by loading formulated lipid nanoparticles onto an agarose gel and confirming the release of siRNA after electrophoresis.
[0321] result The delivery system for siRNA treatment was designed with extrapolation to human trials in mind. While the inventors had already incorporated allele targeting into the siRNA design, additional cell type targeting was deemed desirable to keep the final required dose as low as possible. The KIT receptor was selected as the most melanocyte-specific cell surface target compared to other skin cells based on single-cell expression data, and because its peptide sequence for targeting had already been established in previous publications.
[0322] Optimization of self-assembling receptor-targeted nanoparticles (RTNPs) protects siRNA from degradation and enables delivery to human skin explants. Self-assembling RTNPs have been previously described as a highly effective method for intracellular delivery of siRNA. siRNA8-RTNPs were prepared by optimizing the RTNP formulation using variable peptide content while maintaining an equal ratio of siRNA to lipid (Figures 22A-C). Average nanoparticle diameter was evaluated using dynamic light scattering at approximately 200 nm (Figures 22A, 22F). The addition of increased peptides transformed the lipid nanoparticles from anionic to cationic (Figure 22B), simultaneously resulting in increased siRNA encapsulation. Encapsulation was complete at ratios of 1:3:1 and 1:4:1 (lipid:peptide:siRNA) (Figure 22C), protecting siRNA from RNase degradation (Figure 22D). Treatment of nevus cells with RTNPs containing peptide sequences reported to bind to the KIT receptor resulted in more effective siRNA delivery than the control (Figure 22G). siRNA8-RTNP was successfully delivered to the dermis of CMN patient skin exgrafts after intradermal injection (Figures 21A and 21B).
[0323] Example 6 - Treatment of a mouse model of CMN with siRNA8-RTNP Materials and methods Tyr::NRASQ61K mice (ages 41-45 weeks, 3 females, 5 males) were shaved with clippers and intradermally injected with 450 μg of RTNP prepared in sucrose solution (295 mOsmol) on both sides of the dorsal midline using an insulin needle (30G). The injection sites were marked by drawing around the bleb with a marker pen. After 48 hours, the mice were euthanized, and 4 mm punch biopsy material was collected from each site. The biopsy material was stored in RNAlater (Invitrogen AM7021) before RNA extraction.
[0324] result Cy5-siRNA in RTNP can be delivered to the mouse dermis without issue. To demonstrate in vivo delivery, Cy5-tagged control siRNA embedded in RTNP was injected into the mouse dermis, and the skin was fixed after 1 hour. Fluorescence was visualized after paraffin embedding and H&E staining to confirm unimpeded delivery to the dermis (Figure 23C, Figure 23D).
[0325] Treatment with siRNA8-RTNP induces selective knockdown of the humanized variant NRAS. Next, treatment with siRNA8-RTNP was tested in a mouse model of CMN (Tg(Tyr-NRAS*Q61K)1Bee; MGI:376864540) (Figure 23A), which had hyperpigmented skin and excessive melanin-producing cells in the dermis (Figures 21D, 21E, and 23B). Eight mice were shaved immediately before the procedure, and two separate intradermal injections of siRNA8-RTNP were administered to the dorsal skin. In addition, the same injections of RTNP containing untargeted siRNA were administered to adjacent sites as a control. siRNA8-RTNP induced knockdown of the transgenic variant NRAS allele at 24 and 48 hours (Figure 21F), but did not induce knockdown of the WT endogenous Nras allele (Figure 21G). At this point, there were no macroscopically observable side effects at the injection site, or in the behavior or overall health of the mice.
[0326] The findings described above demonstrate targeted silencing of variant NRAS in primary patient nevus cells, patient skin explants, and in vivo in humanized transgenic mice. Importantly, variant allele silencing induces apoptosis in nevus cells in vitro through a previously unknown association with the ER stress-induced apoptotic pathway. These results illustrate the potential usefulness of variant NRAS targeting to promote remission of benign lesions, treat CMN, and prevent the development of malignant diseases.
[0327] Example 7 - Inhibition of variant BRAF in BRAF mutant melanoma cell lines Materials and methods The siRNA inhibitory effect of variant BRAF was investigated in homozygous (A375, SKMEL28) and heterozygous (A2058, G-361) cell lines. Cells were treated either with siBRAFV600E (antisense strand SEQ ID NO: 1334, sense strand SEQ ID NO: 1315) to selectively target variant BRAF, or with siBRAF to non-selectively target BRAF. siSCRA was used as a negative control, and siUBB, which knocks down the essential gene UBB, was used as a positive control for caspase 3 / 7 activation.
[0328] result Figure 24 shows the results including positive control siUBB. Figure 25 shows the same results without displaying siUBB due to necessary scaling, making it easier to read. As shown in Figure 25A, treatment of cells with allele-specific siBRAFV600E significantly reduced proliferation in A375, A2058, and G-361 cell lines compared to control siSCRA. siBRAFV600E also performed better than non-selective siRNA (siBRAF). As shown in Figure 25B, siBRAFV600E treatment also induced apoptosis in heterozygous cell lines.
[0329] The results shown above demonstrate that apoptosis can be induced in melanoma cells by directly targeting oncogenic BRAF variants. Furthermore, allele-targeted siRNA performed better than untargeted siRNA.
[0330] Example 8 - Inhibition of variant NRAS in leptomeningeal melanocytosis Nevus cells were collected from patients with leptomeningeal melanocytosis, cultured, and grown. In leptomeningeal melanocytosis, patients have dysplastic (between benign and malignant) leptomeningeal disease. Primary nevus cell cultures were treated with a single dose of siRNA8, and apoptosis was measured using caspase 3 / 7 activation in live cell imaging. SiUBB was used as a positive control, while untreated, liposome-only, and siNon-target were used as negative controls.
[0331] As shown in Figure 26B, inhibition of variant NRAS by treatment with siRNA8 induces apoptosis. Compared to siRNANon-target, significantly more caspase 3 / 7 activation was observed in primary nevus cell cultures treated with siRNA8 (p<0.0001). In addition, the confluence of siRNA8-treated cells was significantly lower compared to the control (p<0.0001).
[0332] The results described above demonstrate that targeting variant NRAS induces apoptosis in leptomeningeal melanocytosis, providing evidence for the usefulness of this approach in different histological types.
[0333] Example 9 - Combination therapy of NRAS and BRAF in acquired nevi Individuals with acquired nevi will be recruited, randomized, and assigned to either a placebo (control) or treatment condition according to a standard protocol. In the treatment condition, individuals will be administered a composition containing siRNA targeting NRAS and BRAF variants and pharmaceutically acceptable excipients. In the placebo condition, individuals will be administered the same composition without siRNA. Placebo or treatment will be administered by microneedle injection into the dermis or by topical application. Repeated doses may be administered. Nevus size, surface area, color, and shape will be measured before administration (baseline) and again at specified post-administration times, such as 4 weeks after administration. Changes in nevus size and surface area will be calculated compared to baseline and statistically compared between the placebo and treatment conditions.
[0334] Equivalents and range Those skilled in the art will understand that the present invention is defined by the appended claims and not by the examples included herein or by other descriptions of specific embodiments.
[0335] Similarly, the singular forms "a," "an," and "the" refer to multiple objects unless otherwise specified by the context.
[0336] Unless otherwise defined above, all technical and scientific terms used herein have the same meaning as commonly understood by those skilled in the art. Any methods and materials similar to or equivalent to those described herein may also be used in carrying out or testing the present invention. Generally, the terminology and techniques used herein in relation to cell and tissue culture, molecular biology, immunology, genetics, and protein and nucleic acid chemistry are well known and commonly used in the art, or are in accordance with the manufacturer's specifications.
[0337] All publications, patents, and patent applications referenced herein are incorporated herein by reference in the same manner as each individual publication, patent, or patent application is specifically and individually indicated herein. In addition, any citation or identification of any reference in this application should not be construed as an admission that such reference is available as prior art of the present invention. Section headings should not necessarily be construed as restrictive to the extent in which they are used.
[0338] array TIFF2026513654000001.tif222170TIFF2026513654000002.tif232170TIFF2026513654000003.tif219170TIFF2026513654000004.tif232170TIFF2026513654000005.tif231170TIFF2026513654000006.tif231170TIFF2026513654000007.tif231170TIFF2026513654000008.tif231170TIFF2026513654000009.tif231170TIFF2026513654000010.tif231170TIFF2026513654000011.tif231170TIFF2026513654000012.tif231170TIFF2026513654000013.tif231170TIFF2026513654000014.tif227170TIFF2026513654000015.tif229170TIFF2026513654000016.tif231170TIFF2026513654000017.tif231170TIFF2026513654000018.tif231170TIFF2026513654000019.tif227170TIFF2026513654000020.tif227170TIFF2026513654000021.tif227170TIFF2026513654000022.tif230170TIFF2026513654000023.tif231170TIFF2026513654000024.tif229170TIFF2026513654000025.tif227170TIFF2026513654000026.tif227170TIFF2026513654000027.tif227170TIFF2026513654000028.tif227170TIFF2026513654000029.tif227170TIFF2026513654000030.tif227170TIFF2026513654000031.tif227170TIFF2026513654000032.tif227170TIFF2026513654000033.tif227170TIFF2026513654000034.tif227170TIFF2026513654000035.tif227170TIFF202651 3654000036.tif227170TIFF2026513654000037.tif227170TIFF2026513654000038.tif99170.
[0339] Clause This application also provides the following embodiments: 1. A nucleic acid molecule comprising a first strand of 10 to 50 linked nucleosides, wherein the first strand contains a sequence that is completely complementary to a sequence having at least 90% identity with an isolength portion of mRNA encoding NRAS or BRAF. 2. The nucleic acid molecule according to Embodiment 1, wherein the first strand comprises a sequence that is completely complementary to a sequence having at least 90% identity with an isolength portion of mRNA encoding a gain-of-function variant of NRAS or BRAF. 3. A nucleic acid molecule according to any prior embodiment, wherein the first strand comprises a sequence that is completely complementary to a sequence having at least 90% identity with an isolength portion of the mRNA encoding NRAS. 4. A nucleic acid molecule according to any prior embodiment, wherein the first strand comprises a sequence that is completely complementary to a sequence having at least 90% identity with an isolength portion of mRNA encoding a gain-of-function variant of NRAS. 5. The nucleic acid molecule according to Embodiment 1 or 2, wherein the first strand comprises a sequence that is completely complementary to a sequence having at least 90% identity with the isolength portion of the mRNA encoding BRAF. 6. A nucleic acid molecule according to any one of Embodiments 1, 2, or 5, wherein the first strand comprises a sequence that is completely complementary to a sequence having at least 90% identity with an isolength portion of mRNA encoding a gain-of-function variant of BRAF. 7. A nucleic acid molecule according to any prior embodiment, wherein the first chain consists of 10 to 40 linked nucleosides. 8. A nucleic acid molecule according to any prior embodiment, wherein the first chain consists of 10 to 30 linked nucleosides. 9. A nucleic acid molecule according to any prior embodiment, wherein the first chain consists of 15 to 30 linked nucleosides. 10. A nucleic acid molecule according to any prior embodiment, wherein the first chain consists of 15 to 25 linked nucleosides. 11. A nucleic acid molecule according to any prior embodiment, wherein the first chain consists of 15 to 20 linked nucleosides. 12. A nucleic acid molecule according to any prior embodiment, wherein the first chain consists of 10 to 20 linked nucleosides. 13. A nucleic acid molecule according to any prior embodiment, wherein the first chain consists of 20 to 30 linked nucleosides. 14. A nucleic acid molecule according to any prior embodiment, wherein the first chain consists of 20 to 25 linked nucleosides. 15. A nucleic acid molecule according to any prior embodiment, wherein the first chain consists of 21 linked nucleosides. 16. A nucleic acid molecule according to any prior embodiment, wherein the first strand comprises a sequence that is completely complementary to a sequence having at least 95% identity with an isolength portion of the mRNA encoding the variant NRAS p.(G60R), p.(G60V), p.(G60E), or p.(G60D). 17. A nucleic acid molecule according to any prior embodiment, wherein the first strand comprises a sequence that is completely complementary to a sequence having 100% identity with an isolength portion of mRNA encoding variant NRAS p.(G60R), p.(G60V), p.(G60E), or p.(G60D). 18. A nucleic acid molecule according to any prior embodiment, which can inhibit the expression of variant NRAS p.(G60R / V / E / D) in vitro by at least 20%, at least 30%, at least 40%, at least 50%, at least 60%, at least 70%, at least 80%, or at least 90%. 19. A nucleic acid molecule according to any prior embodiment, wherein the nucleic acid molecule inhibits the expression of variant NRAS p.(G60R / V / E / D) in vitro to a greater extent than the inhibition of wild-type NRAS expression in vitro. 20. A nucleic acid molecule according to any prior embodiment, which can partially or completely rescue abnormal cell differentiation signaling in cells expressing variant NRAS p.(G60R / V / E / D). 21. A nucleic acid molecule according to any one of Embodiments 16 to 20, wherein the variant NRAS p.(G60R) is generated by the c.G178C mutation in the NRAS genome sequence. 22. The nucleic acid molecule according to Embodiment 21, wherein the first strand contains a sequence having at least 80%, at least 90%, or at least 95% identity with a sequence selected from the group consisting of SEQ ID NOs. 73 to 91. 23. A nucleic acid molecule according to Embodiment 21 or 22, wherein the first strand comprises a sequence selected from the group consisting of SEQ ID NOs: 73 to 91. 24. A nucleic acid molecule according to any one of embodiments 21 to 23, wherein the first chain consists of a sequence selected from the group consisting of sequence numbers 73 to 91. 25. A nucleic acid molecule according to any one of Embodiments 16 to 20, wherein the variant NRAS p.(G60V) is generated by a c.G179T mutation in the NRAS genome sequence. 26. The nucleic acid molecule according to Embodiment 25, wherein the first strand contains a sequence having at least 80%, at least 90%, or at least 95% identity with a sequence selected from the group consisting of SEQ ID NOs: 111 to 129. 27. A nucleic acid molecule according to Embodiment 25 or 26, wherein the first strand comprises a sequence selected from the group consisting of SEQ ID NOs: 111 to 129. 28. A nucleic acid molecule according to any one of embodiments 25 to 27, wherein the first chain consists of a sequence selected from the group consisting of sequence numbers 111 to 129. 29. A nucleic acid molecule according to any one of Embodiments 16 to 20, wherein the variant NRAS p.(G60E) is generated by the c.G179A mutation in the NRAS genome sequence. 30. The nucleic acid molecule according to Embodiment 29, wherein the first strand contains a sequence having at least 80%, at least 90%, or at least 95% identity with a sequence selected from the group consisting of SEQ ID NOs: 149 to 167. 31. A nucleic acid molecule according to Embodiment 29 or 30, wherein the first strand comprises a sequence selected from the group consisting of SEQ ID NOs: 149 to 167. 32. A nucleic acid molecule according to any one of embodiments 29 to 31, wherein the first chain consists of a sequence selected from the group consisting of sequence numbers 149 to 167. 33. A nucleic acid molecule according to any one of Embodiments 1 to 4 or 7 to 15, wherein the first strand comprises a sequence that is completely complementary to a sequence having at least 95% identity with an isolength portion of the mRNA encoding the variant NRAS p.(Q61K), p.(Q61R), p.(Q61H), p.(Q61L), or p.(Q61P). 34. A nucleic acid molecule according to any one of Embodiments 1-4, 7-15, or 33, wherein the first strand comprises a sequence that is completely complementary to a sequence having 100% identity with an isolength portion of mRNA encoding a variant NRAS p.(Q61K), p.(Q61R), p.(Q61H), p.(Q61L), or p.(Q61P). 35. A nucleic acid molecule according to any one of Embodiments 1-4, 7-15, or 33-34, which can inhibit the expression of variant NRAS p.(Q61K / R / H / L / P) by at least 20%, at least 30%, at least 40%, at least 50%, at least 60%, at least 70%, at least 80%, or at least 90% in vitro. 36. A nucleic acid molecule according to any one of embodiments 1-4, 7-15, or 33-35, wherein the nucleic acid molecule inhibits the expression of variant NRAS p.(Q61K / R / H / L / P) in vitro to a greater extent than the inhibition of wild-type NRAS expression in vitro. 37. A nucleic acid molecule according to any one of embodiments 1-4, 7-15, or 33-36, which can partially or completely rescue abnormal cell differentiation signaling in cells expressing the variant NRAS p.(Q61K / R / H / L / P). 38. A nucleic acid molecule according to any one of embodiments 33 to 37, wherein the variant NRAS p.(Q61K) is generated by a c.C181A mutation in the NRAS genome sequence. 39. The nucleic acid molecule according to Embodiment 38, wherein the first strand contains a sequence having at least 80%, at least 90%, or at least 95% identity with a sequence selected from the group consisting of SEQ ID NOs: 187 to 205. 40. A nucleic acid molecule according to Embodiment 38 or 39, wherein the first strand comprises a sequence selected from the group consisting of SEQ ID NOs: 187 to 205. 41. A nucleic acid molecule according to any one of embodiments 38 to 40, wherein the first strand consists of a sequence selected from the group consisting of sequence numbers 187 to 205. 42. A nucleic acid molecule according to any one of embodiments 33 to 37, wherein the variant NRAS p.(Q61R) is generated by the c.A182G mutation in the NRAS genome sequence. 43. The nucleic acid molecule according to Embodiment 42, wherein the first strand contains a sequence having at least 80%, at least 90%, or at least 95% identity with a sequence selected from the group consisting of Sequence IDs 225 to 243. 44. A nucleic acid molecule according to Embodiment 42 or 43, wherein the first strand comprises a sequence selected from the group consisting of SEQ ID NOs: 225 to 243. 45. A nucleic acid molecule according to any one of embodiments 42 to 44, wherein the first strand consists of a sequence selected from the group consisting of sequence numbers 225 to 243. 46. A nucleic acid molecule according to any one of embodiments 33 to 37, wherein the variant NRAS p.(Q61L) is generated by the c.A182T mutation in the NRAS genome sequence. 47. The nucleic acid molecule according to Embodiment 46, wherein the first strand contains a sequence having at least 80%, at least 90%, or at least 95% identity with a sequence selected from the group consisting of SEQ ID NOs. 263 to 281. 48. A nucleic acid molecule according to Embodiment 46 or 47, wherein the first strand comprises a sequence selected from the group consisting of SEQ ID NOs. 263 to 281. 49. A nucleic acid molecule according to any one of embodiments 46 to 48, wherein the first strand consists of a sequence selected from the group consisting of sequence numbers 263 to 281. 50. A nucleic acid molecule according to any one of embodiments 33 to 37, wherein the variant NRAS p.(Q61P) is generated by the c.A182C mutation in the NRAS genome sequence. 51. The nucleic acid molecule according to Embodiment 50, wherein the first strand contains a sequence having at least 80%, at least 90%, or at least 95% identity with a sequence selected from the group consisting of SEQ ID NOs: 301 to 319. 52. A nucleic acid molecule according to Embodiment 50 or 51, wherein the first strand comprises a sequence selected from the group consisting of SEQ ID NOs: 301 to 319. 53. A nucleic acid molecule according to any one of embodiments 50 to 52, wherein the first chain consists of a sequence selected from the group consisting of sequence numbers 301 to 319. 54. A nucleic acid molecule according to any one of embodiments 33 to 37, wherein the variant NRAS p.(Q61H) is generated by a c.A183C mutation in the NRAS genome sequence. 55. The nucleic acid molecule according to Embodiment 54, wherein the first strand contains a sequence having at least 80%, at least 90%, or at least 95% identity with a sequence selected from the group consisting of SEQ ID NOs: 339 to 357. 56. A nucleic acid molecule according to Embodiment 54 or 55, wherein the first strand comprises a sequence selected from the group consisting of SEQ ID NOs: 339 to 357. 57. A nucleic acid molecule according to any one of embodiments 54 to 56, wherein the first strand consists of a sequence selected from the group consisting of sequence numbers 339 to 357. 58. A nucleic acid molecule according to any one of embodiments 33 to 37, wherein the variant NRAS p.(Q61H) is generated by a c.A183T mutation in the NRAS genome sequence. 59. The nucleic acid molecule according to Embodiment 58, wherein the first strand contains a sequence having at least 80%, at least 90%, or at least 95% identity with a sequence selected from the group consisting of SEQ ID NOs: 377 to 395. 60. A nucleic acid molecule according to Embodiment 58 or 59, wherein the first strand comprises a sequence selected from the group consisting of SEQ ID NOs: 377 to 395. 61. A nucleic acid molecule according to any one of embodiments 58 to 60, wherein the first strand consists of a sequence selected from the group consisting of sequence numbers 377 to 395. 62. A nucleic acid molecule according to any one of embodiments 33 to 37, wherein the variant NRAS is generated by the c.180_181delinsTA mutation in the NRAS genome sequence. 63. The nucleic acid molecule according to Embodiment 62, wherein the first strand contains a sequence having at least 80%, at least 90%, or at least 95% identity with a sequence selected from the group consisting of SEQ ID NOs: 991 to 1010. 64. A nucleic acid molecule according to embodiment 62 or 63, wherein the first strand comprises a sequence selected from the group consisting of sequence numbers 991 to 1010. 65. A nucleic acid molecule according to any one of embodiments 62 to 64, wherein the first strand consists of a sequence selected from the group consisting of sequence numbers 991 to 1010. 66. A nucleic acid molecule according to any one of embodiments 33 to 37, wherein the variant NRAS is generated by the c.181_183delinsAAG mutation in the NRAS genome sequence. 67. The nucleic acid molecule according to Embodiment 66, wherein the first strand contains a sequence having at least 80%, at least 90%, or at least 95% identity with a sequence selected from the group consisting of SEQ ID NOs: 1031 to 1051. 68. A nucleic acid molecule according to embodiment 66 or 67, wherein the first strand comprises a sequence selected from the group consisting of SEQ ID NOs: 1031 to 1051. 69. A nucleic acid molecule according to any one of embodiments 66 to 68, wherein the first strand consists of a sequence selected from the group consisting of sequence numbers 1031 to 1051. 70. A nucleic acid molecule according to any one of Embodiments 1 to 4 or 7 to 15, wherein the first strand comprises a sequence that is completely complementary to a sequence having at least 95% identity with an isolength portion of mRNA encoding a variant NRAS p.(G12R), p.(G12S), p.(G12D), p.(G12P), p.(G12C), p.(G12A), or p.(G12V). 71. A nucleic acid molecule according to any one of Embodiments 1-4, 7-15, or 70, wherein the first strand comprises a sequence that is completely complementary to a sequence having 100% identity with an isolength portion of mRNA encoding a variant NRAS p.(G12R), p.(G12S), p.(G12D), p.(G12P), p.(G12C), p.(G12A), or p.(G12V). 72. A nucleic acid molecule according to any one of Embodiments 1-4, 7-15, or 70-71, which can inhibit the expression of variant NRAS p.(G12R / S / D / P / C / A / V) in vitro by at least 20%, at least 30%, at least 40%, at least 50%, at least 60%, at least 70%, at least 80%, or at least 90%. 73. A nucleic acid molecule according to any one of Embodiments 1-4, 7-15, or 70-72, wherein the nucleic acid molecule inhibits the expression of variant NRAS p.(G12R / S / D / P / C / A / V) in vitro to a greater extent than the inhibition of wild-type NRAS expression in vitro. 74. A nucleic acid molecule according to any one of embodiments 1-4, 7-15, or 70-73, which can partially or completely rescue abnormal cell differentiation signaling in cells expressing variant NRAS p.(G12R / S / D / P / C / A / V). 75. A nucleic acid molecule according to any one of embodiments 70 to 74, wherein the variant NRAS p.(G12V) is generated by a c.G35T mutation in the NRAS genome sequence. 76. The nucleic acid molecule according to Embodiment 75, wherein the first strand contains a sequence having at least 80%, at least 90%, or at least 95% identity with a sequence selected from the group consisting of SEQ ID NOs: 415 to 433. 77. A nucleic acid molecule according to embodiment 75 or 76, wherein the first strand comprises a sequence selected from the group consisting of SEQ ID NOs: 415 to 433. 78. A nucleic acid molecule according to any one of embodiments 75 to 77, wherein the first strand consists of a sequence selected from the group consisting of sequence numbers 415 to 433. 79. A nucleic acid molecule according to any one of embodiments 70 to 74, wherein the variant NRAS p.(G12R) is generated by a c.G34C mutation in the NRAS genome sequence. 80. The nucleic acid molecule according to Embodiment 79, wherein the first strand contains a sequence having at least 80%, at least 90%, or at least 95% identity with a sequence selected from the group consisting of SEQ ID NOs. 453 to 471. 81. A nucleic acid molecule according to Embodiment 79 or 80, wherein the first strand comprises a sequence selected from the group consisting of SEQ ID NOs. 453 to 471. 82. A nucleic acid molecule according to any one of embodiments 79 to 81, wherein the first chain consists of a sequence selected from the group consisting of sequence numbers 453 to 471. 83. A nucleic acid molecule according to any one of embodiments 70 to 74, wherein the variant NRAS p.(G12D) is generated by a c.G35A mutation in the NRAS genome sequence. 84. The nucleic acid molecule according to Embodiment 83, wherein the first strand contains a sequence having at least 80%, at least 90%, or at least 95% identity with a sequence selected from the group consisting of SEQ ID NOs: 491 to 509. 85. A nucleic acid molecule according to Embodiment 83 or 84, wherein the first strand comprises a sequence selected from the group consisting of SEQ ID NOs: 491 to 509. 86. A nucleic acid molecule according to any one of embodiments 83 to 85, wherein the first strand consists of a sequence selected from the group consisting of sequence numbers 491 to 509. 87. A nucleic acid molecule according to any one of embodiments 70 to 74, wherein the variant NRAS p.(G12S) is generated by a c.G34A mutation in the NRAS genome sequence. 88. The nucleic acid molecule according to Embodiment 87, wherein the first strand includes a sequence having at least 80%, at least 90%, or at least 95% identity with a sequence selected from the group consisting of SEQ ID NOs. 529 to 547. 89. A nucleic acid molecule according to Embodiment 87 or 88, wherein the first strand comprises a sequence selected from the group consisting of SEQ ID NOs. 529 to 547. 90. A nucleic acid molecule according to any one of embodiments 87 to 89, wherein the first strand consists of a sequence selected from the group consisting of sequence numbers 529 to 547. 91. A nucleic acid molecule according to any one of embodiments 70 to 74, wherein the variant NRAS p.(G12P) is generated by a c.G34C / G35C mutation in the NRAS genome sequence. 92. The nucleic acid molecule according to Embodiment 91, wherein the first strand contains a sequence having at least 80%, at least 90%, or at least 95% identity with a sequence selected from the group consisting of SEQ ID NOs. 567 to 586. 93. A nucleic acid molecule according to Embodiment 91 or 92, wherein the first strand comprises a sequence selected from the group consisting of SEQ ID NOs. 567 to 586. 94. A nucleic acid molecule according to any one of embodiments 91 to 93, wherein the first chain consists of a sequence selected from the group consisting of sequence numbers 567 to 586. 95. A nucleic acid molecule according to any one of embodiments 70 to 74, wherein the variant NRAS p.(G12C) is generated by a c.G34T mutation in the NRAS genome sequence. 96. The nucleic acid molecule according to Embodiment 95, wherein the first strand contains a sequence having at least 80%, at least 90%, or at least 95% identity with a sequence selected from the group consisting of SEQ ID NOs. 607 to 625. 97. A nucleic acid molecule according to embodiment 95 or 96, wherein the first strand comprises a sequence selected from the group consisting of sequence numbers 607 to 625. 98. A nucleic acid molecule according to any one of embodiments 95 to 97, wherein the first chain consists of a sequence selected from the group consisting of sequence numbers 607 to 625. 99. A nucleic acid molecule according to any one of embodiments 70 to 74, wherein the variant NRAS p.(G12A) is generated by a c.G35C mutation in the NRAS genome sequence. 100. The nucleic acid molecule according to Embodiment 99, wherein the first strand contains a sequence having at least 80%, at least 90%, or at least 95% identity with a sequence selected from the group consisting of SEQ ID NOs. 645 to 663. 101. A nucleic acid molecule according to Embodiment 99 or 100, wherein the first strand comprises a sequence selected from the group consisting of SEQ ID NOs: 645 to 663. 102. A nucleic acid molecule according to any one of embodiments 99 to 101, wherein the first strand consists of a sequence selected from the group consisting of sequence numbers 645 to 663. 103. A nucleic acid molecule according to any one of Embodiments 1 to 4 or 7 to 15, wherein the first strand comprises a sequence that is completely complementary to a sequence having at least 95% identity with an isolength portion of the mRNA encoding the variant NRAS p.(G13V), p.(G13D), p.(G13A), p.(G13S), p.(G13C), p.(G13R), p.(G13F), or p.(G13Y). 104. A nucleic acid molecule according to any one of Embodiments 1-4, 7-15, or 103, wherein the first strand contains a sequence that is completely complementary to a sequence having 100% identity with an isolength portion of mRNA encoding variant NRAS p.(G13V), p.(G13D), p.(G13A), p.(G13S), p.(G13C), p.(G13R), p.(G13F), or p.(G13Y). 105. A nucleic acid molecule according to any one of Embodiments 1-4, 7-15, or 103-104, which can inhibit the expression of variant NRAS p.(G13V / D / A / S / C / R / F / Y) in vitro by at least 20%, at least 30%, at least 40%, at least 50%, at least 60%, at least 70%, at least 80%, or at least 90%. 106. A nucleic acid molecule according to any one of Embodiments 1-4, 7-15, or 103-105, wherein the nucleic acid molecule inhibits the expression of variant NRAS p.(G13V / D / A / S / C / R / F / Y) in vitro to a greater extent than the inhibition of wild-type NRAS expression in vitro. 107. A nucleic acid molecule according to any one of embodiments 1-4, 7-15, or 103-106, which can partially or completely rescue abnormal cell differentiation signaling in cells expressing the variant NRAS p.(G13V / D / A / S / C / R / F / Y). 108. A nucleic acid molecule according to any one of embodiments 103 to 107, wherein the variant NRAS p.(G13S) is generated by a c.G37A mutation in the NRAS genome sequence. 109. The nucleic acid molecule according to Embodiment 108, wherein the first strand contains a sequence having at least 80%, at least 90%, or at least 95% identity with a sequence selected from the group consisting of SEQ ID NOs. 683 to 701. 110. A nucleic acid molecule according to embodiment 108 or 109, wherein the first strand comprises a sequence selected from the group consisting of sequence numbers 683 to 701. 111. A nucleic acid molecule according to any one of embodiments 108 to 110, wherein the first chain consists of a sequence selected from the group consisting of sequence numbers 683 to 701. 112. A nucleic acid molecule according to any one of embodiments 103 to 107, wherein the variant NRAS p.(G13C) is generated by a c.G37T mutation in the NRAS genome sequence. 113. The nucleic acid molecule according to Embodiment 112, wherein the first strand contains a sequence having at least 80%, at least 90%, or at least 95% identity with a sequence selected from the group consisting of SEQ ID NOs. 721 to 739. 114. A nucleic acid molecule according to Embodiment 112 or 113, wherein the first strand comprises a sequence selected from the group consisting of SEQ ID NOs. 721 to 739. 115. A nucleic acid molecule according to any one of embodiments 112 to 114, wherein the first chain consists of a sequence selected from the group consisting of sequence numbers 721 to 739. 116. A nucleic acid molecule according to any one of embodiments 103 to 107, wherein the variant NRAS p.(G13R) is generated by a c.G37C mutation in the NRAS genome sequence. 117. The nucleic acid molecule according to Embodiment 116, wherein the first strand contains a sequence having at least 80%, at least 90%, or at least 95% identity with a sequence selected from the group consisting of SEQ ID NOs. 759 to 777. 118. A nucleic acid molecule according to embodiment 116 or 117, wherein the first strand comprises a sequence selected from the group consisting of sequence numbers 759 to 777. 119. A nucleic acid molecule according to any one of embodiments 116 to 118, wherein the first strand consists of a sequence selected from the group consisting of sequence numbers 759 to 777. 120. A nucleic acid molecule according to any one of embodiments 103 to 107, wherein the variant NRAS p.(G13F) is generated by the c.37_38delinsTT mutation in the NRAS genome sequence. 121. The nucleic acid molecule according to Embodiment 120, wherein the first strand contains a sequence having at least 80%, at least 90%, or at least 95% identity with a sequence selected from the group consisting of SEQ ID NOs. 797 to 816. 122. A nucleic acid molecule according to Embodiment 120 or 121, wherein the first strand comprises a sequence selected from the group consisting of SEQ ID NOs: 797 to 816. 123. A nucleic acid molecule according to any one of embodiments 120 to 122, wherein the first strand consists of a sequence selected from the group consisting of sequence numbers 797 to 816. 124. A nucleic acid molecule according to any one of embodiments 103 to 107, wherein the variant NRAS p.(G13Y) is generated by the c.37_38delinsTA mutation in the NRAS genome sequence. 125. The nucleic acid molecule according to Embodiment 124, wherein the first strand contains a sequence having at least 80%, at least 90%, or at least 95% identity with a sequence selected from the group consisting of SEQ ID NOs: 837 to 856. 126. A nucleic acid molecule according to Embodiment 124 or 125, wherein the first strand comprises a sequence selected from the group consisting of SEQ ID NOs. 837 to 856. 127. A nucleic acid molecule according to any one of embodiments 124 to 126, wherein the first strand consists of a sequence selected from the group consisting of sequence numbers 837 to 856. 128. A nucleic acid molecule according to any one of embodiments 103 to 107, wherein the variant NRAS p.(G13V) is generated by a c.G38T mutation in the NRAS genome sequence. 129. The nucleic acid molecule according to Embodiment 128, wherein the first strand contains a sequence having at least 80%, at least 90%, or at least 95% identity with a sequence selected from the group consisting of SEQ ID NOs. 877 to 895. 130. A nucleic acid molecule according to Embodiment 128 or 129, wherein the first strand comprises a sequence selected from the group consisting of SEQ ID NOs. 877 to 895. 131. A nucleic acid molecule according to any one of embodiments 128 to 130, wherein the first strand consists of a sequence selected from the group consisting of sequence numbers 877 to 895. 132. A nucleic acid molecule according to any one of embodiments 103 to 107, wherein the variant NRAS p.(G13D) is generated by a c.G38A mutation in the NRAS genome sequence. 133. The nucleic acid molecule according to Embodiment 132, wherein the first strand contains a sequence having at least 80%, at least 90%, or at least 95% identity with a sequence selected from the group consisting of SEQ ID NOs: 915 to 933. 134. A nucleic acid molecule according to Embodiment 132 or 133, wherein the first strand comprises a sequence selected from the group consisting of SEQ ID NOs: 915 to 933. 135. A nucleic acid molecule according to any one of embodiments 132 to 134, wherein the first strand consists of a sequence selected from the group consisting of sequence numbers 915 to 933. 136. A nucleic acid molecule according to any one of embodiments 103 to 107, wherein the variant NRAS p.(G13A) is generated by a c.G38C mutation in the NRAS genome sequence. 137. The nucleic acid molecule according to Embodiment 136, wherein the first strand contains a sequence having at least 80%, at least 90%, or at least 95% identity with a sequence selected from the group consisting of SEQ ID NOs. 953 to 971. 138. A nucleic acid molecule according to Embodiment 136 or 137, wherein the first strand comprises a sequence selected from the group consisting of SEQ ID NOs. 953 to 971. 139. A nucleic acid molecule according to any one of embodiments 136 to 138, wherein the first strand consists of a sequence selected from the group consisting of sequence numbers 953 to 971. 140. A nucleic acid molecule according to any one of Embodiments 1-2 or 5-15, wherein the first strand comprises a sequence that is completely complementary to a sequence having at least 95% identity with an isolength portion of mRNA encoding the variant BRAF p.(V600G), p.(V600M), p.(V600D), p.(V600R), p.(V600K), or p.(V600E). 141. A nucleic acid molecule according to any one of Embodiments 1-2, 5-15, or 140, wherein the first strand comprises a sequence that is completely complementary to a sequence having 100% identity with an isolength portion of mRNA encoding the variant BRAF p.(V600G), p.(V600M), p.(V600D), p.(V600R), p.(V600K), or p.(V600E). 142. A nucleic acid molecule according to any one of Embodiments 1-2, 5-15, or 140-141, which can inhibit the expression of variant BRAF p.(V600G / M / D / R / K / E) in vitro by at least 20%, at least 30%, at least 40%, at least 50%, at least 60%, at least 70%, at least 80%, or at least 90%. 143. A nucleic acid molecule according to any one of Embodiments 1-2, 5-15, or 140-142, wherein the nucleic acid molecule inhibits the expression of variant BRAF p.(V600G / M / D / R / K / E) in vitro to a greater extent than the inhibition of wild-type BRAF expression in vitro. 144. A nucleic acid molecule according to any one of Embodiments 1-2, 5-15, or 140-143, which can partially or completely rescue abnormal cell differentiation signaling in cells expressing variant BRAF p.(V600G / M / D / R / K / E). 145. A nucleic acid molecule according to any one of embodiments 140 to 144, wherein the variant BRAF p.(V600G) is generated by the c.T1799G mutation in the BRAF genome sequence. 146. The nucleic acid molecule according to Embodiment 145, wherein the first strand contains a sequence having at least 80%, at least 90%, or at least 95% identity with a sequence selected from the group consisting of SEQ ID NOs: 1073 to 1091. 147. A nucleic acid molecule according to Embodiment 145 or 146, wherein the first strand comprises a sequence selected from the group consisting of SEQ ID NOs: 1073 to 1091. 148. A nucleic acid molecule according to any one of embodiments 145 to 147, wherein the first strand consists of a sequence selected from the group consisting of sequence numbers 1073 to 1091. 149. A nucleic acid molecule according to any one of embodiments 140 to 144, wherein the variant BRAF p.(V600M) is generated by the c.G1798A mutation in the BRAF genome sequence. 150. The nucleic acid molecule according to Embodiment 149, wherein the first strand contains a sequence having at least 80%, at least 90%, or at least 95% identity with a sequence selected from the group consisting of SEQ ID NOs: 1111 to 1129. 151. A nucleic acid molecule according to Embodiment 149 or 150, wherein the first strand comprises a sequence selected from the group consisting of SEQ ID NOs: 1111 to 1129. 152. A nucleic acid molecule according to any one of embodiments 149 to 151, wherein the first chain consists of a sequence selected from the group consisting of sequence numbers 1111 to 1129. 153. A nucleic acid molecule according to any one of embodiments 140 to 144, wherein the variant BRAF p.(V600D) is generated by the c.1799_1800delisAT mutation in the BRAF genome sequence. 154. The nucleic acid molecule according to Embodiment 153, wherein the first strand contains a sequence having at least 80%, at least 90%, or at least 95% identity with a sequence selected from the group consisting of SEQ ID NOs: 1149 to 1167. 155. A nucleic acid molecule according to Embodiment 153 or 154, wherein the first strand comprises a sequence selected from the group consisting of SEQ ID NOs: 1149 to 1167. 156. A nucleic acid molecule according to any one of embodiments 153 to 155, wherein the first strand consists of a sequence selected from the group consisting of sequence numbers 1149 to 1167. 157. A nucleic acid molecule according to any one of Embodiments 140 to 144, wherein the variant BRAF p.(V600R) is generated by the c.1798_1799delisCG mutation in the BRAF genome sequence. 158. The nucleic acid molecule according to Embodiment 157, wherein the first strand contains a sequence having at least 80%, at least 90%, or at least 95% identity with a sequence selected from the group consisting of SEQ ID NOs: 1187 to 1206. 159. A nucleic acid molecule according to Embodiment 157 or 158, wherein the first strand comprises a sequence selected from the group consisting of SEQ ID NOs: 1187 to 1206. 160. A nucleic acid molecule according to any one of embodiments 157 to 159, wherein the first strand consists of a sequence selected from the group consisting of sequence numbers 1187 to 1206. 161. A nucleic acid molecule according to any one of embodiments 140 to 144, wherein the variant BRAF p.(V600K) is generated by the c.1798_1799delisAA mutation in the BRAF genome sequence. 162. The nucleic acid molecule according to Embodiment 161, wherein the first strand comprises a sequence having at least 80%, at least 90%, or at least 95% identity with a sequence selected from the group consisting of SEQ ID NOs. 1227 to 1246. 163. A nucleic acid molecule according to Embodiment 161 or 162, wherein the first strand comprises a sequence selected from the group consisting of SEQ ID NOs: 1227 to 1246. 164. A nucleic acid molecule according to any one of embodiments 161 to 163, wherein the first strand consists of a sequence selected from the group consisting of sequence numbers 1227 to 1246. 165. A nucleic acid molecule according to any one of embodiments 140 to 144, wherein the variant BRAF p.(V600E) is generated by the c.1799_1800delisAA mutation in the BRAF genome sequence. 166. The nucleic acid molecule according to Embodiment 165, wherein the first strand comprises a sequence having at least 80%, at least 90%, or at least 95% identity with a sequence selected from the group consisting of SEQ ID NOs: 1267 to 1286. 167. A nucleic acid molecule according to embodiment 165 or 166, wherein the first strand comprises a sequence selected from the group consisting of sequence numbers 1267 to 1286. 168. A nucleic acid molecule according to any one of embodiments 165 to 167, wherein the first strand consists of a sequence selected from the group consisting of sequence numbers 1267 to 1286. 169. A nucleic acid molecule according to any one of embodiments 140 to 144, wherein the variant BRAF p.(V600E) is generated by the c.T1799A mutation in the BRAF genome sequence. 170. The nucleic acid molecule according to Embodiment 169, wherein the first strand contains a sequence having at least 80%, at least 90%, or at least 95% identity with a sequence selected from the group consisting of SEQ ID NOs: 1307 to 1325. 171. A nucleic acid molecule according to Embodiment 169 or 170, wherein the first strand comprises a sequence selected from the group consisting of SEQ ID NOs. 1307 to 1325. 172. A nucleic acid molecule according to any one of embodiments 169 to 171, wherein the first chain consists of a sequence selected from the group consisting of sequence numbers 1307 to 1325. 173. A nucleic acid molecule according to any prior embodiment, wherein the nucleic acid molecule is a single-stranded nucleic acid molecule. 174. A nucleic acid molecule according to any one of Embodiments 1 to 172, wherein the nucleic acid molecule is a double-stranded nucleic acid molecule. 175. The nucleic acid molecule according to Embodiment 174, wherein the double-stranded nucleic acid molecule comprises a second chain of 10 to 50 linked nucleosides, the second chain being at least partially complementary to the first chain. 176. The nucleic acid molecule according to Embodiment 175, wherein the second chain is at least 80% complementary to the first chain. 177. The nucleic acid molecule according to Embodiment 175 or 176, wherein the second chain is at least 90% complementary to the first chain. 178. A nucleic acid molecule according to any one of embodiments 175 to 177, wherein the second chain is at least 95% complementary to the first chain. 179. A nucleic acid molecule according to any one of embodiments 175 to 178, wherein the second strand is completely complementary to the first strand. 180. A nucleic acid molecule according to any one of embodiments 175 to 179, wherein the second chain consists of 10 to 40 linked nucleosides. 181. A nucleic acid molecule according to any one of embodiments 175 to 179, wherein the second chain consists of 10 to 30 linked nucleosides. 182. A nucleic acid molecule according to any one of embodiments 175 to 179, wherein the second chain consists of 15 to 30 linked nucleosides. 183. A nucleic acid molecule according to any one of embodiments 175 to 179, wherein the second chain consists of 15 to 25 linked nucleosides. 184. A nucleic acid molecule according to any one of embodiments 175 to 179, wherein the second chain consists of 15 to 20 linked nucleosides. 185. A nucleic acid molecule according to any one of embodiments 175 to 179, wherein the second chain consists of 10 to 20 linked nucleosides. 186. A nucleic acid molecule according to any one of embodiments 175 to 179, wherein the second chain consists of 20 to 30 linked nucleosides. 187. A nucleic acid molecule according to any one of embodiments 175 to 179, wherein the second chain consists of 20 to 25 linked nucleosides. 188. A nucleic acid molecule according to any one of embodiments 175 to 179, wherein the second chain consists of 21 linked nucleosides. 189. A nucleic acid molecule according to any one of embodiments 175 to 188, wherein the first chain is longer than the second chain. 190. A nucleic acid molecule according to any one of embodiments 175 to 189, having one, two, three, four, five or more nucleoside overhangs at the 3' end of the first strand. 191. A nucleic acid molecule according to any one of embodiments 175 to 190, having two nucleoside overhangs at the 3' end of the first strand. 192. A nucleic acid molecule according to any one of embodiments 175 to 191, having one, two, three, four, five or more nucleoside overhangs at the 5' end of the first chain. 193. A nucleic acid molecule according to any one of embodiments 175 to 192, having two nucleoside overhangs at the 5' end of the first strand. 194. A nucleic acid molecule according to any one of embodiments 175 to 188, wherein the second chain is longer than the first chain. 195. A nucleic acid molecule according to Embodiments 175-188 or 194, having one, two, three, four, five or more nucleoside overhangs at the 3' end of the second strand. 196. A nucleic acid molecule according to any one of embodiments 175-188 or 194-195, having two nucleoside overhangs at the 3' end of the second strand. 197. A nucleic acid molecule according to any one of embodiments 175-188 or 194-196, having one, two, three, four, five or more nucleoside overhangs at the 5' end of the second strand. 198. A nucleic acid molecule according to any one of embodiments 175-188 or 194-197, having two nucleoside overhangs at the 5' end of the second strand. 199. A nucleic acid molecule according to any one of embodiments 175-188 or 194-198, having one, two, three, four, five or more nucleoside overhangs at both the 5' and 3' ends of the first strand. 200. A nucleic acid molecule according to any one of embodiments 175-188 or 194-199, having two nucleoside overhangs at both the 5' and 3' ends of the first strand. 201. A nucleic acid molecule according to any one of Embodiments 190-193 or 194-200, wherein the overhang comprises two thymine nucleotides (TT). 202. A nucleic acid molecule according to any one of embodiments 190-193 or 194-200, wherein the overhang consists of two thymine nucleotides (TT). 203. The second chain, (a) Sequence IDs 92-110, (b) Sequence IDs 130-148, (c) Sequence IDs 168-186, (d) Sequence IDs 206-224, (e) Sequence IDs 244-262, (f) Sequence IDs 282-300, (g) Sequence IDs 320-338, (h) Sequence numbers 358-376, (i) Sequence IDs 396-414, (j) Sequence IDs 434-452, (k) Sequence IDs 472-490, (l) Sequence IDs 510-528, (m) Sequence IDs 548-566, (n) Sequence numbers 587-606, (o) Sequence numbers 626-644, (p) Sequence IDs 664-682, (q) Sequence IDs 702-720, (r) Sequence IDs 740-758, (s) Sequence IDs 778-796, (t) Sequence numbers 817-836, (u) Sequence numbers 857-876, (v) Sequence IDs 896-914, (w) Sequence numbers 934-952, (x) Sequence numbers 972-990, (y) Sequence numbers 1011-1030, (z) Sequence numbers 1052-1072, (aa) Sequence IDs 1092-1110, (bb) Sequence IDs 1130-1148, (cc) Sequence numbers 1168-1186, (dd) Sequence numbers 1207-1226, (ee) Sequence numbers 1247-1266, (ff) Sequence numbers 1287-1306, or A nucleic acid molecule according to any one of embodiments 175 to 202, comprising a sequence having at least 80%, at least 90%, or at least 95% identity with a sequence selected from the group consisting of sequence numbers 1326 to 1344. 204. The second chain, (a) Sequence IDs 92-110, (b) Sequence IDs 130-148, (c) Sequence IDs 168-186, (d) Sequence IDs 206-224, (e) Sequence IDs 244-262, (f) Sequence IDs 282-300, (g) Sequence IDs 320-338, (h) Sequence numbers 358-376, (i) Sequence IDs 396-414, (j) Sequence IDs 434-452, (k) Sequence IDs 472-490, (l) Sequence IDs 510-528, (m) Sequence IDs 548-566, (n) Sequence numbers 587-606, (o) Sequence numbers 626-644, (p) Sequence IDs 664-682, (q) Sequence IDs 702-720, (r) Sequence IDs 740-758, (s) Sequence IDs 778-796, (t) Sequence numbers 817-836, (u) Sequence numbers 857-876, (v) Sequence IDs 896-914, (w) Sequence numbers 934-952, (x) Sequence numbers 972-990, (y) Sequence numbers 1011-1030, (z) Sequence numbers 1052-1072, (aa) Sequence IDs 1092-1110, (bb) Sequence IDs 1130-1148, (cc) Sequence numbers 1168-1186, (dd) Sequence numbers 1207-1226, (ee) Sequence numbers 1247-1266, (ff) Sequence numbers 1287-1306, or (gg) A nucleic acid molecule according to Embodiments 175 to 203, comprising a sequence selected from the group consisting of SEQ ID NOs. 1326 to 1344. 205. The second chain, (a) Sequence IDs 92-110, (b) Sequence IDs 130-148, (c) Sequence IDs 168-186, (d) Sequence IDs 206-224, (e) Sequence IDs 244-262, (f) Sequence IDs 282-300, (g) Sequence IDs 320-338, (h) Sequence numbers 358-376, (i) Sequence IDs 396-414, (j) Sequence IDs 434-452, (k) Sequence IDs 472-490, (l) Sequence IDs 510-528, (m) Sequence IDs 548-566, (n) Sequence numbers 587-606, (o) Sequence numbers 626-644, (p) Sequence IDs 664-682, (q) Sequence IDs 702-720, (r) Sequence IDs 740-758, (s) Sequence IDs 778-796, (t) Sequence numbers 817-836, (u) Sequence numbers 857-876, (v) Sequence IDs 896-914, (w) Sequence numbers 934-952, (x) Sequence numbers 972-990, (y) Sequence numbers 1011-1030, (z) Sequence numbers 1052-1072, (aa) Sequence IDs 1092-1110, (bb) Sequence IDs 1130-1148, (cc) Sequence numbers 1168-1186, (dd) Sequence numbers 1207-1226, (ee) Sequence numbers 1247-1266, (ff) Sequence numbers 1287-1306, or (gg) A nucleic acid molecule according to any one of embodiments 175 to 204, comprising a sequence selected from the group consisting of sequence numbers 1326 to 1344. 206. A nucleic acid molecule according to any one of embodiments 175 to 205, comprising a first strand and a second strand, the nucleic acid molecule comprising a pair of sequences selected from the list consisting of SEQ ID NOs: 73 and 92, SEQ ID NOs: 74 and 93, SEQ ID NOs: 75 and 94, SEQ ID NOs: 76 and 95, SEQ ID NOs: 77 and 96, SEQ ID NOs: 78 and 97, SEQ ID NOs: 79 and 98, SEQ ID NOs: 80 and 99, SEQ ID NOs: 81 and 100, SEQ ID NOs: 82 and 101, SEQ ID NOs: 83 and 102, SEQ ID NOs: 84 and 103, SEQ ID NOs: 85 and 104, SEQ ID NOs: 86 and 105, SEQ ID NOs: 87 and 106, SEQ ID NOs: 88 and 107, SEQ ID NOs: 89 and 108, SEQ ID NOs: 90 and 109, and SEQ ID NOs: 91 and 110. 207. A nucleic acid molecule according to any one of embodiments 175 to 205, wherein the nucleic acid molecule comprises a first strand and a second strand containing a pair of sequences selected from the list consisting of SEQ ID NOs: 111 and 130, SEQ ID NOs: 112 and 131, SEQ ID NOs: 113 and 132, SEQ ID NOs: 114 and 133, SEQ ID NOs: 115 and 134, SEQ ID NOs: 116 and 135, SEQ ID NOs: 117 and 136, SEQ ID NOs: 118 and 137, SEQ ID NOs: 119 and 138, SEQ ID NOs: 120 and 139, SEQ ID NOs: 121 and 140, SEQ ID NOs: 122 and 141, SEQ ID NOs: 123 and 142, SEQ ID NOs: 124 and 143, SEQ ID NOs: 125 and 144, SEQ ID NOs: 126 and 145, SEQ ID NOs: 127 and 146, SEQ ID NOs: 128 and 147, and SEQ ID NOs: 129 and 148. 208. A nucleic acid molecule according to any one of embodiments 175 to 205, wherein the nucleic acid molecule comprises a first strand and a second strand containing a pair of sequences selected from the list consisting of SEQ ID NOs: 149 and 168, SEQ ID NOs: 150 and 169, SEQ ID NOs: 151 and 170, SEQ ID NOs: 152 and 171, SEQ ID NOs: 153 and 172, SEQ ID NOs: 154 and 173, SEQ ID NOs: 155 and 174, SEQ ID NOs: 156 and 175, SEQ ID NOs: 157 and 176, SEQ ID NOs: 158 and 177, SEQ ID NOs: 159 and 178, SEQ ID NOs: 160 and 179, SEQ ID NOs: 161 and 180, SEQ ID NOs: 162 and 181, SEQ ID NOs: 163 and 182, SEQ ID NOs: 164 and 183, SEQ ID NOs: 165 and 184, SEQ ID NOs: 166 and 185, and SEQ ID NOs: 167 and 186. 209. A nucleic acid molecule according to any one of embodiments 175 to 205, wherein the nucleic acid molecule comprises a first strand and a second strand containing a pair of sequences selected from the list consisting of SEQ ID NOs: 187 and 206, SEQ ID NOs: 188 and 207, SEQ ID NOs: 189 and 208, SEQ ID NOs: 190 and 209, SEQ ID NOs: 191 and 210, SEQ ID NOs: 192 and 211, SEQ ID NOs: 193 and 212, SEQ ID NOs: 194 and 213, SEQ ID NOs: 195 and 214, SEQ ID NOs: 196 and 215, SEQ ID NOs: 197 and 216, SEQ ID NOs: 198 and 217, SEQ ID NOs: 199 and 218, SEQ ID NOs: 200 and 219, SEQ ID NOs: 201 and 220, SEQ ID NOs: 202 and 221, SEQ ID NOs: 203 and 222, SEQ ID NOs: 204 and 223, and SEQ ID NOs: 205 and 224. 210. A nucleic acid molecule according to any one of embodiments 175 to 205, comprising a first strand and a second strand containing a pair of sequences selected from the list consisting of SEQ ID NOs: 225 and 244, SEQ ID NOs: 226 and 245, SEQ ID NOs: 227 and 246, SEQ ID NOs: 228 and 247, SEQ ID NOs: 229 and 248, SEQ ID NOs: 230 and 249, SEQ ID NOs: 231 and 250, SEQ ID NOs: 232 and 251, SEQ ID NOs: 233 and 252, SEQ ID NOs: 234 and 253, SEQ ID NOs: 235 and 254, SEQ ID NOs: 236 and 255, SEQ ID NOs: 237 and 256, SEQ ID NOs: 238 and 257, SEQ ID NOs: 239 and 258, SEQ ID NOs: 240 and 259, SEQ ID NOs: 241 and 260, SEQ ID NOs: 242 and 261, and SEQ ID NOs: 243 and 262. 211. A nucleic acid molecule according to any one of embodiments 175 to 205, wherein the nucleic acid molecule comprises a first strand and a second strand containing a pair of sequences selected from the list consisting of SEQ ID NOs: 263 and 282, SEQ ID NOs: 264 and 283, SEQ ID NOs: 265 and 284, SEQ ID NOs: 266 and 285, SEQ ID NOs: 267 and 286, SEQ ID NOs: 268 and 287, SEQ ID NOs: 269 and 288, SEQ ID NOs: 270 and 289, SEQ ID NOs: 271 and 290, SEQ ID NOs: 272 and 291, SEQ ID NOs: 273 and 292, SEQ ID NOs: 274 and 293, SEQ ID NOs: 275 and 294, SEQ ID NOs: 276 and 295, SEQ ID NOs: 277 and 296, SEQ ID NOs: 278 and 297, SEQ ID NOs: 279 and 298, SEQ ID NOs: 280 and 299, and SEQ ID NOs: 281 and 300. 212. A nucleic acid molecule according to any one of embodiments 175 to 205, wherein the nucleic acid molecule comprises a first strand and a second strand containing a pair of sequences selected from the list consisting of SEQ ID NOs: 301 and 320, SEQ ID NOs: 302 and 321, SEQ ID NOs: 303 and 322, SEQ ID NOs: 304 and 323, SEQ ID NOs: 305 and 324, SEQ ID NOs: 306 and 325, SEQ ID NOs: 307 and 326, SEQ ID NOs: 308 and 327, SEQ ID NOs: 309 and 328, SEQ ID NOs: 310 and 329, SEQ ID NOs: 311 and 330, SEQ ID NOs: 312 and 331, SEQ ID NOs: 313 and 332, SEQ ID NOs: 314 and 333, SEQ ID NOs: 315 and 334, SEQ ID NOs: 316 and 335, SEQ ID NOs: 317 and 336, SEQ ID NOs: 318 and 337, and SEQ ID NOs: 319 and 338. 213. A nucleic acid molecule according to any one of embodiments 175 to 205, wherein the nucleic acid molecule comprises a first strand and a second strand containing a pair of sequences selected from the list consisting of SEQ ID NOs: 339 and 358, SEQ ID NOs: 340 and 359, SEQ ID NOs: 341 and 360, SEQ ID NOs: 342 and 361, SEQ ID NOs: 343 and 362, SEQ ID NOs: 344 and 363, SEQ ID NOs: 345 and 364, SEQ ID NOs: 346 and 365, SEQ ID NOs: 347 and 366, SEQ ID NOs: 348 and 367, SEQ ID NOs: 349 and 368, SEQ ID NOs: 350 and 369, SEQ ID NOs: 351 and 370, SEQ ID NOs: 352 and 371, SEQ ID NOs: 353 and 372, SEQ ID NOs: 354 and 373, SEQ ID NOs: 355 and 374, SEQ ID NOs: 356 and 375, and SEQ ID NOs: 357 and 376. 214. A nucleic acid molecule according to any one of embodiments 175 to 205, comprising a first strand and a second strand containing a pair of sequences selected from the list consisting of SEQ ID NOs: 377 and 396, SEQ ID NOs: 378 and 397, SEQ ID NOs: 379 and 398, SEQ ID NOs: 380 and 399, SEQ ID NOs: 381 and 400, SEQ ID NOs: 382 and 401, SEQ ID NOs: 383 and 402, SEQ ID NOs: 384 and 403, SEQ ID NOs: 385 and 404, SEQ ID NOs: 386 and 405, SEQ ID NOs: 387 and 406, SEQ ID NOs: 388 and 407, SEQ ID NOs: 389 and 408, SEQ ID NOs: 390 and 409, SEQ ID NOs: 391 and 410, SEQ ID NOs: 392 and 411, SEQ ID NOs: 393 and 412, SEQ ID NOs: 394 and 413, and SEQ ID NOs: 395 and 414. 215. A nucleic acid molecule according to any one of embodiments 175 to 205, wherein the nucleic acid molecule comprises a first strand and a second strand containing a pair of sequences selected from the list consisting of SEQ ID NOs: 415 and 434, SEQ ID NOs: 416 and 435, SEQ ID NOs: 417 and 436, SEQ ID NOs: 418 and 437, SEQ ID NOs: 419 and 438, SEQ ID NOs: 420 and 439, SEQ ID NOs: 421 and 440, SEQ ID NOs: 422 and 441, SEQ ID NOs: 423 and 442, SEQ ID NOs: 424 and 443, SEQ ID NOs: 425 and 444, SEQ ID NOs: 426 and 445, SEQ ID NOs: 427 and 446, SEQ ID NOs: 428 and 447, SEQ ID NOs: 429 and 448, SEQ ID NOs: 430 and 449, SEQ ID NOs: 431 and 450, SEQ ID NOs: 432 and 451, and SEQ ID NOs: 433 and 452. 216. A nucleic acid molecule according to any one of embodiments 175 to 205, wherein the nucleic acid molecule comprises a first strand and a second strand containing a pair of sequences selected from the list consisting of SEQ ID NOs: 453 and 472, SEQ ID NOs: 454 and 473, SEQ ID NOs: 455 and 474, SEQ ID NOs: 456 and 475, SEQ ID NOs: 457 and 476, SEQ ID NOs: 458 and 477, SEQ ID NOs: 459 and 478, SEQ ID NOs: 460 and 479, SEQ ID NOs: 461 and 480, SEQ ID NOs: 462 and 481, SEQ ID NOs: 463 and 482, SEQ ID NOs: 464 and 483, SEQ ID NOs: 465 and 484, SEQ ID NOs: 466 and 485, SEQ ID NOs: 467 and 486, SEQ ID NOs: 468 and 487, SEQ ID NOs: 469 and 488, SEQ ID NOs: 470 and 489, and SEQ ID NOs: 471 and 490. 217. A nucleic acid molecule according to any one of embodiments 175 to 205, wherein the nucleic acid molecule comprises a first strand and a second strand, each containing a pair of sequences selected from the list consisting of SEQ ID NOs: 491 and 510, SEQ ID NOs: 492 and 511, SEQ ID NOs: 493 and 512, SEQ ID NOs: 494 and 513, SEQ ID NOs: 495 and 514, SEQ ID NOs: 496 and 515, SEQ ID NOs: 497 and 516, SEQ ID NOs: 498 and 517, SEQ ID NOs: 499 and 518, SEQ ID NOs: 500 and 519, SEQ ID NOs: 501 and 520, SEQ ID NOs: 502 and 521, SEQ ID NOs: 503 and 522, SEQ ID NOs: 504 and 523, SEQ ID NOs: 505 and 524, SEQ ID NOs: 506 and 525, SEQ ID NOs: 507 and 526, SEQ ID NOs: 508 and 527, and SEQ ID NOs: 509 and 528. 218. A nucleic acid molecule according to any one of embodiments 175 to 205, wherein the nucleic acid molecule comprises a first strand and a second strand, each containing a pair of sequences selected from the list consisting of SEQ ID NOs: 529 and 548, SEQ ID NOs: 530 and 549, SEQ ID NOs: 531 and 550, SEQ ID NOs: 532 and 551, SEQ ID NOs: 533 and 552, SEQ ID NOs: 534 and 553, SEQ ID NOs: 535 and 554, SEQ ID NOs: 536 and 555, SEQ ID NOs: 537 and 556, SEQ ID NOs: 538 and 557, SEQ ID NOs: 539 and 558, SEQ ID NOs: 540 and 559, SEQ ID NOs: 541 and 560, SEQ ID NOs: 542 and 561, SEQ ID NOs: 543 and 562, SEQ ID NOs: 544 and 563, SEQ ID NOs: 545 and 564, SEQ ID NOs: 546 and 565, and SEQ ID NOs: 547 and 566. 219. A nucleic acid molecule according to any one of embodiments 175 to 205, wherein the nucleic acid molecule comprises a first strand and a second strand, each containing a pair of sequences selected from the list consisting of SEQ ID NOs: 567 and 587, SEQ ID NOs: 568 and 588, SEQ ID NOs: 569 and 589, SEQ ID NOs: 570 and 590, SEQ ID NOs: 571 and 591, SEQ ID NOs: 572 and 592, SEQ ID NOs: 573 and 593, SEQ ID NOs: 574 and 594, SEQ ID NOs: 575 and 595, SEQ ID NOs: 576 and 596, SEQ ID NOs: 577 and 597, SEQ ID NOs: 578 and 598, SEQ ID NOs: 579 and 599, SEQ ID NOs: 580 and 600, SEQ ID NOs: 581 and 601, SEQ ID NOs: 582 and 602, SEQ ID NOs: 583 and 603, SEQ ID NOs: 584 and 604, SEQ ID NOs: 585 and 605, and SEQ ID NOs: 586 and 606. 220. A nucleic acid molecule according to any one of embodiments 175 to 205, wherein the nucleic acid molecule comprises a first strand and a second strand containing a pair of sequences selected from the list consisting of SEQ ID NOs: 607 and 626, SEQ ID NOs: 608 and 627, SEQ ID NOs: 609 and 628, SEQ ID NOs: 610 and 629, SEQ ID NOs: 611 and 630, SEQ ID NOs: 612 and 631, SEQ ID NOs: 613 and 632, SEQ ID NOs: 614 and 633, SEQ ID NOs: 615 and 634, SEQ ID NOs: 616 and 635, SEQ ID NOs: 617 and 636, SEQ ID NOs: 618 and 637, SEQ ID NOs: 619 and 638, SEQ ID NOs: 620 and 639, SEQ ID NOs: 621 and 640, SEQ ID NOs: 622 and 641, SEQ ID NOs: 623 and 642, SEQ ID NOs: 624 and 643, and SEQ ID NOs: 625 and 644. 221. A nucleic acid molecule according to any one of embodiments 175 to 205, wherein the nucleic acid molecule comprises a first strand and a second strand containing a pair of sequences selected from the list consisting of SEQ ID NOs: 645 and 664, SEQ ID NOs: 646 and 665, SEQ ID NOs: 647 and 666, SEQ ID NOs: 648 and 667, SEQ ID NOs: 649 and 668, SEQ ID NOs: 650 and 669, SEQ ID NOs: 651 and 670, SEQ ID NOs: 652 and 671, SEQ ID NOs: 653 and 672, SEQ ID NOs: 654 and 673, SEQ ID NOs: 655 and 674, SEQ ID NOs: 656 and 675, SEQ ID NOs: 657 and 676, SEQ ID NOs: 658 and 677, SEQ ID NOs: 659 and 678, SEQ ID NOs: 660 and 679, SEQ ID NOs: 661 and 680, SEQ ID NOs: 662 and 681, and SEQ ID NOs: 663 and 682. 222. A nucleic acid molecule according to any one of embodiments 175 to 205, wherein the nucleic acid molecule comprises a first strand and a second strand containing a pair of sequences selected from the list consisting of SEQ ID NOs: 683 and 702, SEQ ID NOs: 684 and 703, SEQ ID NOs: 685 and 704, SEQ ID NOs: 686 and 705, SEQ ID NOs: 687 and 706, SEQ ID NOs: 688 and 707, SEQ ID NOs: 689 and 708, SEQ ID NOs: 690 and 709, SEQ ID NOs: 691 and 710, SEQ ID NOs: 692 and 711, SEQ ID NOs: 693 and 712, SEQ ID NOs: 694 and 713, SEQ ID NOs: 695 and 714, SEQ ID NOs: 696 and 715, SEQ ID NOs: 697 and 716, SEQ ID NOs: 698 and 717, SEQ ID NOs: 699 and 718, SEQ ID NOs: 700 and 719, and SEQ ID NOs: 701 and 720. 223. A nucleic acid molecule according to any one of embodiments 175 to 205, wherein the nucleic acid molecule comprises a first strand and a second strand, each containing a pair of sequences selected from the list consisting of SEQ ID NOs: 721 and 740, SEQ ID NOs: 722 and 741, SEQ ID NOs: 723 and 742, SEQ ID NOs: 724 and 743, SEQ ID NOs: 725 and 744, SEQ ID NOs: 726 and 745, SEQ ID NOs: 727 and 746, SEQ ID NOs: 728 and 747, SEQ ID NOs: 729 and 748, SEQ ID NOs: 730 and 749, SEQ ID NOs: 731 and 750, SEQ ID NOs: 732 and 751, SEQ ID NOs: 733 and 752, SEQ ID NOs: 734 and 753, SEQ ID NOs: 735 and 754, SEQ ID NOs: 736 and 755, SEQ ID NOs: 737 and 756, SEQ ID NOs: 738 and 757, and SEQ ID NOs: 739 and 758. 224. A nucleic acid molecule according to any one of embodiments 175 to 205, comprising a first strand and a second strand, the nucleic acid molecule comprising a pair of sequences selected from among sequence numbers 759 and 778, 760 and 779, 761 and 780, 762 and 781, 763 and 782, 764 and 783, 765 and 784, 766 and 785, 767 and 786, 768 and 787, 769 and 788, 770 and 789, 771 and 790, 772 and 791, 773 and 792, 774 and 793, 775 and 794, 776 and 795, and 777 and 796. 225. A nucleic acid molecule according to any one of embodiments 175 to 205, comprising a first strand and a second strand containing a pair of sequences selected from the list consisting of SEQ ID NOs: 797 and 817, SEQ ID NOs: 798 and 818, SEQ ID NOs: 799 and 819, SEQ ID NOs: 800 and 820, SEQ ID NOs: 801 and 821, SEQ ID NOs: 802 and 822, SEQ ID NOs: 803 and 823, SEQ ID NOs: 804 and 824, SEQ ID NOs: 805 and 825, SEQ ID NOs: 806 and 826, SEQ ID NOs: 807 and 827, SEQ ID NOs: 808 and 828, SEQ ID NOs: 809 and 829, SEQ ID NOs: 810 and 830, SEQ ID NOs: 811 and 831, SEQ ID NOs: 812 and 832, SEQ ID NOs: 813 and 833, SEQ ID NOs: 814 and 834, SEQ ID NOs: 815 and 835, and SEQ ID NOs: 816 and 836. 226. A nucleic acid molecule according to any one of embodiments 175 to 205, comprising a first strand and a second strand containing a pair of sequences selected from the list consisting of SEQ ID NOs: 837 and 857, SEQ ID NOs: 838 and 858, SEQ ID NOs: 839 and 859, SEQ ID NOs: 840 and 860, SEQ ID NOs: 841 and 861, SEQ ID NOs: 842 and 862, SEQ ID NOs: 843 and 863, SEQ ID NOs: 844 and 864, SEQ ID NOs: 845 and 865, SEQ ID NOs: 846 and 866, SEQ ID NOs: 847 and 867, SEQ ID NOs: 848 and 868, SEQ ID NOs: 849 and 869, SEQ ID NOs: 850 and 870, SEQ ID NOs: 851 and 871, SEQ ID NOs: 852 and 872, SEQ ID NOs: 853 and 873, SEQ ID NOs: 854 and 874, SEQ ID NOs: 855 and 875, and SEQ ID NOs: 856 and 876. 227. A nucleic acid molecule according to any one of embodiments 175 to 205, comprising a first strand and a second strand containing a pair of sequences selected from the list consisting of SEQ ID NOs: 877 and 896, SEQ ID NOs: 878 and 897, SEQ ID NOs: 879 and 898, SEQ ID NOs: 880 and 899, SEQ ID NOs: 881 and 900, SEQ ID NOs: 882 and 901, SEQ ID NOs: 883 and 902, SEQ ID NOs: 884 and 903, SEQ ID NOs: 885 and 904, SEQ ID NOs: 886 and 905, SEQ ID NOs: 887 and 906, SEQ ID NOs: 888 and 907, SEQ ID NOs: 889 and 908, SEQ ID NOs: 890 and 909, SEQ ID NOs: 891 and 910, SEQ ID NOs: 892 and 911, SEQ ID NOs: 893 and 912, SEQ ID NOs: 894 and 913, and SEQ ID NOs: 895 and 914. 228. A nucleic acid molecule according to any one of embodiments 175 to 205, wherein the nucleic acid molecule comprises a first chain and a second chain, each containing a pair of sequences selected from the list consisting of SEQ ID NOs: 915 and 934, SEQ ID NOs: 916 and 935, SEQ ID NOs: 917 and 936, SEQ ID NOs: 918 and 937, SEQ ID NOs: 919 and 938, SEQ ID NOs: 920 and 939, SEQ ID NOs: 921 and 940, SEQ ID NOs: 922 and 941, SEQ ID NOs: 923 and 942, SEQ ID NOs: 924 and 943, SEQ ID NOs: 925 and 944, SEQ ID NOs: 926 and 945, SEQ ID NOs: 927 and 946, SEQ ID NOs: 928 and 947, SEQ ID NOs: 929 and 948, SEQ ID NOs: 930 and 949, SEQ ID NOs: 931 and 950, SEQ ID NOs: 932 and 951, and SEQ ID NOs: 933 and 952. 229. A nucleic acid molecule according to any one of embodiments 175 to 205, wherein the nucleic acid molecule comprises a first chain and a second chain, each containing a pair of sequences selected from the list consisting of SEQ ID NOs: 953 and 972, SEQ ID NOs: 954 and 973, SEQ ID NOs: 955 and 974, SEQ ID NOs: 956 and 975, SEQ ID NOs: 957 and 976, SEQ ID NOs: 958 and 977, SEQ ID NOs: 959 and 978, SEQ ID NOs: 960 and 979, SEQ ID NOs: 961 and 980, SEQ ID NOs: 962 and 981, SEQ ID NOs: 963 and 982, SEQ ID NOs: 964 and 983, SEQ ID NOs: 965 and 984, SEQ ID NOs: 966 and 985, SEQ ID NOs: 967 and 986, SEQ ID NOs: 968 and 987, SEQ ID NOs: 969 and 988, SEQ ID NOs: 970 and 989, and SEQ ID NOs: 971 and 990. 230. Nucleic acid molecules, SEQ ID NOs: 991 and 1011, 992 and 1012, 993 and 1013, 994 and 1014, 995 and 1015, 996 and 1016, 997 and 1017, 998 and 1018, 999 and 1019, 1000 and 1020, 1001 and 1021, 1002 and sequence number A nucleic acid molecule according to any one of embodiments 175 to 205, comprising a first strand and a second strand, each containing a pair of sequences selected from the list consisting of sequence 1022, sequence numbers 1003 and 1023, sequence numbers 1004 and 1024, sequence numbers 1005 and 1025, sequence numbers 1006 and 1026, sequence numbers 1007 and 1027, sequence numbers 1008 and 1028, sequence numbers 1009 and 1029, and sequence numbers 1010 and 1030. 231. Nucleic acid molecules, SEQ ID NOs: 1031 and 1052, 1032 and 1053, 1033 and 1054, 1034 and 1055, 1035 and 1056, 1036 and 1057, 1037 and 1058, 1038 and 1059, 1039 and 1060, 1040 and 1061, 1041 and 1062, 1042 and 1063 A nucleic acid molecule according to any one of embodiments 175 to 205, comprising a first strand and a second strand containing a pair of sequences selected from the list consisting of SEQ ID NOs: 1043 and 1064, SEQ ID NOs: 1044 and 1065, SEQ ID NOs: 1045 and 1066, SEQ ID NOs: 1046 and 1067, SEQ ID NOs: 1047 and 1068, SEQ ID NOs: 1048 and 1069, SEQ ID NOs: 1049 and 1070, SEQ ID NOs: 1050 and 1071, and SEQ ID NOs: 1051 and 1072. 232. Nucleic acid molecules, SEQ ID NOs: 1073 and 1092, 1074 and 1093, 1075 and 1094, 1076 and 1095, 1077 and 1096, 1078 and 1097, 1079 and 1098, 1080 and 1099, 1081 and 1100, 1082 and 1101, 1083 and 1102 A nucleic acid molecule according to any one of embodiments 175 to 205, comprising a first strand and a second strand containing a pair of sequences selected from the list consisting of SEQ ID NOs: 1084 and 1103, SEQ ID NOs: 1085 and 1104, SEQ ID NOs: 1086 and 1105, SEQ ID NOs: 1087 and 1106, SEQ ID NOs: 1088 and 1107, SEQ ID NOs: 1089 and 1108, SEQ ID NOs: 1090 and 1109, and SEQ ID NOs: 1091 and 1110. 233. Nucleic acid molecules, SEQ ID NOs: 1111 and 1130, SEQ ID NOs: 1112 and 1131, SEQ ID NOs: 1113 and 1132, SEQ ID NOs: 1114 and 1133, SEQ ID NOs: 1115 and 1134, SEQ ID NOs: 1116 and 1135, SEQ ID NOs: 1117 and 1136, SEQ ID NOs: 1118 and 1137, SEQ ID NOs: 1119 and 1138, SEQ ID NOs: 1120 and 1139, SEQ ID NOs: 1121 and 1140 A nucleic acid molecule according to any one of embodiments 175 to 205, comprising a first strand and a second strand, each containing a pair of sequences selected from the list consisting of SEQ ID NOs: 1122 and 1141, SEQ ID NOs: 1123 and 1142, SEQ ID NOs: 1124 and 1143, SEQ ID NOs: 1125 and 1144, SEQ ID NOs: 1126 and 1145, SEQ ID NOs: 1127 and 1146, SEQ ID NOs: 1128 and 1147, and SEQ ID NOs: 1129 and 1148. 234. Nucleic acid molecules, SEQ ID NOs: 1149 and 1168, 1150 and 1169, 1151 and 1170, 1152 and 1171, 1153 and 1172, 1154 and 1173, 1155 and 1174, 1156 and 1175, 1157 and 1176, 1158 and 1177, 1159 and 1178 A nucleic acid molecule according to any one of embodiments 175 to 205, comprising a first strand and a second strand, each containing a pair of sequences selected from the list consisting of SEQ ID NOs: 1160 and 1179, SEQ ID NOs: 1161 and 1180, SEQ ID NOs: 1162 and 1181, SEQ ID NOs: 1163 and 1182, SEQ ID NOs: 1164 and 1183, SEQ ID NOs: 1165 and 1184, SEQ ID NOs: 1166 and 1185, and SEQ ID NOs: 1167 and 1186. 235. Nucleic acid molecules, SEQ ID NOs: 1187 and 1207, 1188 and 1208, 1189 and 1209, 1190 and 1210, 1191 and 1211, 1192 and 1212, 1193 and 1213, 1194 and 1214, 1195 and 1215, 1196 and 1216, 1197 and 1217, 1198 A nucleic acid molecule according to any one of embodiments 175 to 205, comprising a first strand and a second strand, each containing a pair of sequences selected from the list consisting of SEQ ID NOs: 1218, 1199 and 1219, 1200 and 1220, 1201 and 1221, 1202 and 1222, 1203 and 1223, 1204 and 1224, 1205 and 1225, and 1206 and 1226. 236. Nucleic acid molecules, SEQ ID NOs: 1227 and 1247, 1228 and 1248, 1229 and 1249, 1230 and 1250, 1231 and 1251, 1232 and 1252, 1233 and 1253, 1234 and 1254, 1235 and 1255, 1236 and 1256, 1237 and 1257, 1238 A nucleic acid molecule according to any one of embodiments 175 to 205, comprising a first strand and a second strand containing a pair of sequences selected from the list consisting of SEQ ID NOs: 1258, 1239 and 1259, 1240 and 1260, 1241 and 1261, 1242 and 1262, 1243 and 1263, 1244 and 1264, 1245 and 1265, and 1246 and 1266. 237. Nucleic acid molecules, SEQ ID NOs: 1267 and 1287, 1268 and 1288, 1269 and 1289, 1270 and 1290, 1271 and 1291, 1272 and 1292, 1273 and 1293, 1274 and 1294, 1275 and 1295, 1276 and 1296, 1277 and 1297, 1278 A nucleic acid molecule according to any one of embodiments 175 to 205, comprising a first strand and a second strand containing a pair of sequences selected from the list consisting of SEQ ID NOs: 1298, 1279 and 1299, 1280 and 1300, 1281 and 1301, 1282 and 1302, 1283 and 1303, 1284 and 1304, 1285 and 1305, and 1286 and 1306. 238. Nucleic acid molecules, SEQ ID NOs: 1307 and 1326, 1308 and 1327, 1309 and 1328, 1310 and 1329, 1311 and 1330, 1312 and 1331, 1313 and 1332, 1314 and 1333, 1315 and 1334, 1316 and 1335, 1317 and 1336 A nucleic acid molecule according to any one of embodiments 175 to 205, comprising a first strand and a second strand, each containing a pair of sequences selected from the list consisting of SEQ ID NOs: 1318 and 1337, SEQ ID NOs: 1319 and 1338, SEQ ID NOs: 1320 and 1339, SEQ ID NOs: 1321 and 1340, SEQ ID NOs: 1322 and 1341, SEQ ID NOs: 1323 and 1342, SEQ ID NOs: 1324 and 1343, and SEQ ID NOs: 1325 and 1344. 239. A nucleic acid molecule according to any one of embodiments 206 to 238, wherein the nucleic acid molecule comprises a first strand and a second strand consisting of a pair of sequences selected from the list of embodiments 206 to 238. 240. A nucleic acid molecule according to any one of embodiments 206 to 238, wherein the nucleic acid molecule comprises a first strand and a second strand consisting of a pair of sequences selected from the list of embodiments 206 to 238. 241. Nucleic acid molecules include: SEQ ID NO: 7 (NRAS_c.178G>C_p.G60R), SEQ ID NO: 9 (NRAS_c.179G>T_p.G60V), SEQ ID NO: 11 (NRAS_c.179G>A_p.G60E), SEQ ID NO: 13 (NRAS_c.181C>A_p.Q61K), SEQ ID NO: 15 (NRAS_c.182A>G_p.Q61R), SEQ ID NO: 17 (NRAS_c.182A>T_p.Q61L), SEQ ID NO: 19 (NRAS_c.182A>C_p.Q61P), SEQ ID NO: 21 (NRAS_c.183A>C_p.Q61H), SEQ ID NO: 2 3(NRAS_c.183A>T_p.Q61H), SEQ ID NO: 25(NRAS_c.35G>T_p.G12V), SEQ ID NO: 27(NRAS_c.34G>C_p.G12R), SEQ ID NO: 29(NRAS_c.35G>A_p.G12D), SEQ ID NO: 31(NRAS_c.34G>A_p.G12S), SEQ ID NO: 33(NRAS_c.34_35G>C_p.G12P), SEQ ID NO: 35(NRAS_c.34G>T_p.G12C), SEQ ID NO: 37(NRAS_c.35G>C_p.G12A), SEQ ID NO: 39(NRAS_c.37G>A_p.G 13S), SEQ ID NO: 41 (NRAS_c.37G>T_p.G13C), SEQ ID NO: 43 (NRAS_c.37G>C_p.G13R), SEQ ID NO: 45 (NRAS_c.37_38delinsTT_p.G13F), SEQ ID NO: 47 (NRAS_c.37_38delinsTA_p.G13Y), SEQ ID NO: 49 (NRAS_c.38G>T_p.G13V), SEQ ID NO: 51 (NRAS_c.38G>A_p.G13D), SEQ ID NO: 53 (NRAS_c.38G>C_p.G13A), SEQ ID NO: 55 (NRAS_c.180_181delinsT A) Sequence ID 57 (NRAS_c.181_183delinsAAG), Sequence ID 59 (BRAF_c.1799T>GpV600G), Sequence ID 61 (BRAF_c.1798G>ApV600M), Sequence ID 63 (BRAF_c.1799_1800delisAT_p.V600D), Sequence ID 65 (BRAF_c.1798_1799delisCG_p.V600R), Sequence ID 67 (BRAF_c.1798_1799delisAA_p.V600K), Sequence ID 69 (BRAF_c.1799_1800delisAA_p.A nucleic acid molecule according to any prior embodiment, specifically targeting a DNA sequence selected from the list consisting of V600E) and SEQ ID NO: 71 (BRAF_c.1799T>ApV600E). 242. A compound comprising a nucleic acid molecule and a targeting site as described in any prior embodiment. 243. The compound according to Embodiment 242, wherein the targeting site comprises lipid nanoparticles, liposomes, exosomes, antibodies or fragments thereof, antigen-binding domains or fragments thereof, peptides, cell-permeable peptides, conjugate groups, or any combination thereof. 244. The compound according to Embodiment 242 or 243, wherein the targeting site comprises a conjugate group, and the conjugate group comprises one or more carbohydrates. 245. The conjugate group is monosaccharide, disaccharide, trisaccharide, tetrasaccharide, oligosaccharide, polysaccharide, modified polysaccharide, mannose, galactose, mannose derivative, galactose derivative, D-mannopyranose, L-mannopyranose, D-arabinose, L-galactose, D-xylofuranose, L-xylofuranose, D-glucose, L-glucose, D-galactose, L-galactose, aD-mannofuranose, β-D-mannofuranose, α-D-mannopyranose, β-D-mannopyranose, α-D-glucopyranose, β-D-glucopyranose, α-D-glucofuranose, β-D-glucofuranose, α-D-fructofuranose, α-D-fructopyranose, α-D-galactopyranose, β-D-galactopyranose, α-D-galactofuranose, β-D-galactofuranose, glucosamine, sialic acid, α-D-galactosamine, N-acetylga Lactosamine, 2-amino-3-O-[(R)-1-carboxyethyl]-2-deoxy-β-D-glucopyranose, 2-deoxy-2-methylamino-L-glucopyranose, 4,6-dideoxy-4-formamide-2,3-di-O-methyl-D-mannopyranoose, 2-deoxy-2-sulfamino-D-glucopyranose, N-glycoyl-α-neuraminic acid, 5-thio-β-D-glucopyranose, methyl 2,3 The compound according to Embodiment 244, comprising 4-tri-O-acetyl-1-thio-6-O-trityl-α-D-glucopyranoside, 4-thio-β-D-galactopyranoside, ethyl 3,4,6,7-tetra-O-acetyl-2-deoxy-1,5-dithio-αD-gluco-heptopyranoside, 2,5-anhydro-D-alononitrile, ribose, D-ribose, D-4-thioribose, L-ribose, or L-4-thioribose. 246. The compound according to any one of embodiments 242 to 245, wherein the targeting site is linked to the 3' end of the second chain. 247. The compound according to any one of embodiments 242 to 245, wherein the targeting site is linked to the 5' end of the second chain. 248. The compound according to any one of embodiments 242 to 245, wherein the targeting site is linked to the 5' end of the first chain. 249. The compound according to any one of embodiments 242 to 245, wherein the targeting site is linked to the 3' end of the first chain. 250. A nucleic acid molecule or compound according to any prior embodiment, wherein at least one nucleoside comprises a modified sugar. 251. A nucleic acid molecule or compound according to any prior embodiment, wherein at least one nucleoside bond is a modified nucleoside bond. 252. The nucleic acid molecule or compound according to Embodiment 251, wherein the modified nucleoside bond is a phosphorothioate or phosphorodithioate nucleoside bond. 253. A nucleic acid molecule or compound according to Embodiment 251 or 252, comprising 1 to 40 phosphorothioate or phosphorodithioate nucleoside interbonds. 254. A nucleic acid molecule or compound according to Embodiment 251 or 252, comprising 1 to 30 phosphorothioate or phosphorodithioate nucleoside interbonds. A nucleic acid molecule or compound according to Embodiment 251 or 252, comprising 255.1 to 20 phosphorothioate or phosphorodithioate nucleoside interbondings. 256. A nucleic acid molecule or compound according to Embodiment 251 or 252, comprising 1 to 10 phosphorothioate or phosphorodithioate nucleoside interbonds. 257. A composition comprising a single-stranded nucleic acid molecule or compound, or a salt thereof, as described in any prior embodiment, and at least one of pharmaceutically acceptable carriers or diluents. 258. A prodrug comprising a nucleic acid molecule or compound as described in any of Embodiments 1 to 256. 259. A nucleic acid molecule comprising a nucleotide sequence encoding a CRISPR guide RNA (gRNA), wherein the gRNA hybridizes with an intracellular target sequence, and the target sequence encodes a variant allele of NRAS or BRAF. 260. A CRISPR nuclease system comprising one or more vectors, wherein the ve...
Claims
1. A nucleic acid molecule comprising a first chain of 10 to 50 linked nucleosides, wherein the first chain contains a sequence that is completely complementary to a sequence having at least 90% identity with an isolength portion of mRNA encoding NRAS or BRAF.
2. The nucleic acid molecule according to any one of the prior claims, wherein the first strand comprises a sequence that is completely complementary to a sequence having at least 90% identity with an isolength portion of mRNA encoding a gain-of-function variant of NRAS.
3. The nucleic acid molecule according to claim 1, wherein the first strand comprises a sequence that is completely complementary to a sequence having at least 90% identity with an isolength portion of mRNA encoding a gain-of-function variant of BRAF.
4. The nucleic acid molecule according to any one of the prior claims, wherein the first chain consists of 20 to 25 linked nucleosides.
5. The nucleic acid molecule according to any one of the prior claims, wherein the first chain consists of 21 linked nucleosides.
6. A nucleic acid molecule according to any one of claims 1, 2, 4, or 5, wherein the first strand comprises a sequence that is completely complementary to a sequence having at least 95% identity with an isolength portion of mRNA encoding the variant NRAS p. (G60R), p. (G60V), p. (G60E), or p. (G60D).
7. A nucleic acid molecule according to any one of claims 1, 2, 4, or 5, wherein the first strand comprises a sequence that is completely complementary to a sequence having at least 95% identity with an isolength portion of mRNA encoding a variant NRAS p. (Q61K), p. (Q61R), p. (Q61H), p. (Q61L), or p. (Q61P).
8. A nucleic acid molecule according to any one of claims 1, 2, 4, or 5, wherein the first strand comprises a sequence that is completely complementary to a sequence having at least 95% identity with an isolength portion of mRNA encoding a variant NRAS p. (G12R), p. (G12S), p. (G12D), p. (G12P), p. (G12C), p. (G12A), or p. (G12V).
9. A nucleic acid molecule according to any one of claims 1, 2, 4, or 5, wherein the first strand comprises a sequence that is completely complementary to a sequence having at least 95% identity with an isolength portion of mRNA encoding a variant NRAS p. (G13V), p. (G13D), p. (G13A), p. (G13S), p. (G13C), p. (G13R), p. (G13F), or p. (G13Y).
10. A nucleic acid molecule according to any one of claims 1, 3, 4, or 5, wherein the first strand comprises a sequence that is completely complementary to a sequence having at least 95% identity with an isolength portion of mRNA encoding a variant BRAF p. (V600G), p. (V600M), p. (V600D), p. (V600R), p. (V600K), or p. (V600E).
11. The nucleic acid molecule according to any one of the prior claims, wherein the nucleic acid molecule is a single-stranded nucleic acid molecule.
12. The nucleic acid molecule according to any one of claims 1 to 10, wherein the nucleic acid molecule is a double-stranded nucleic acid molecule.
13. The nucleic acid molecule according to claim 12, wherein the double-stranded nucleic acid molecule comprises a second chain of 10 to 50 linked nucleosides, and the second chain is at least partially complementary to the first chain.
14. The nucleic acid molecule according to claim 13, wherein the second chain is at least 95% complementary to the first chain.
15. The nucleic acid molecule according to claim 13 or 14, having one, two, three, four, five or more nucleoside overhangs at both the 5' and 3' ends of the first chain.
16. The nucleic acid molecule according to any one of claims 13 to 15, wherein the first chain has two nucleoside overhangs at both the 5' end and the 3' end, and optionally the overhangs comprise two thymine nucleotides (TT).
17. The nucleic acid molecules are: SEQ ID NO: 7 (NRAS_c.178G>C_p.G60R), SEQ ID NO: 9 (NRAS_c.179G>T_p.G60V), SEQ ID NO: 11 (NRAS_c.179G>A_p.G60E), SEQ ID NO: 13 (NRAS_c.181C>A_p.Q61K), SEQ ID NO: 15 (NRAS_c.182A>G_p.Q61R), SEQ ID NO: 17 (NRAS_c.182A>T_p.Q61L), SEQ ID NO: 19 (NRAS_c.182A>C_p.Q61P), SEQ ID NO: 21 (NRAS_c.183A>C_p.Q61H), SEQ ID NO: 23 (NR AS_c. 183A>T_p. Q61H), Sequence ID 25 (NRAS_c.35G>T_p.G12V), Sequence ID 27 (NRAS_c.34G>C_p.G12R), Sequence ID 29 (NRAS_c.35G>A_p.G12D), Sequence ID 31 (NRAS_c.34G>A_p.G12S), Sequence ID 33 (NRAS_c.34_35G>C_p.G12P), Sequence ID 35 (NRAS_c.34G>T_p.G12C), Sequence ID 37 (NRAS_c.35G>C_p.G12A), Sequence ID 39 (NRAS_c.37G>A_p.G13S), Distribution Column number 41 (NRAS_c.37G>T_p.G13C), Sequence ID 43 (NRAS_c.37G>C_p.G13R), Sequence ID 45 (NRAS_c.37_38delinsTT_p.G13F), Sequence ID 47 (NRAS_c.37_38delinsTA_p.G13Y), Sequence ID 49 (NRAS_c.38G>T_p.G13V), Sequence ID 51 (NRAS_c.38G>A_p.G13D), Sequence ID 53 (NRAS_c.38G>C_p.G13A), Sequence ID 55 (NRAS_c.180_181delinsTA), Sequence ID 57 (NRAS_c.181_183delinsAAG), Sequence ID 59 (BRAF_c.1799T>G.p.V600G), Sequence ID 61 (BRAF_c.1798G>A.p.V600M), Sequence ID 63 (BRAF_c.1799_1800delisAT_p.V600D), Sequence ID 65 (BRAF_c.1798_1799delisCG_p.V600R), Sequence ID 67 (BRAF_c.1798_1799delisAA_p.V600K), Sequence ID 69 (BRAF_c.1799_1800delisAA_p.V600E),A nucleic acid molecule according to any one of the prior claims, which specifically targets a DNA sequence selected from the list consisting of and SEQ ID NO: 71 (BRAF_c.1799T>A.p.V600E).
18. A compound comprising a nucleic acid molecule and a targeting site as described in any one of the prior claims.
19. The compound according to claim 18, wherein the targeting site comprises lipid nanoparticles, liposomes, exosomes, antibodies or fragments thereof, antigen-binding domains or fragments thereof, peptides, cell-permeable peptides, conjugate groups, or any combination thereof.
20. The compound according to claim 18 or 19, wherein the targeting site comprises a conjugate group, and the conjugate group comprises one or more carbohydrates.
21. A nucleic acid molecule or compound according to any one of the prior claims, wherein at least one nucleoside comprises a modified sugar.
22. A nucleic acid molecule or compound according to any one of the prior claims, wherein at least one nucleoside bond is a modified nucleoside bond.
23. A composition comprising a single-stranded nucleic acid molecule or compound, or a salt thereof, as described in any one of the prior claims, and at least one of pharmaceutically acceptable carriers or diluents.
24. A nucleic acid molecule, compound, or composition according to any one of the prior claims, for use in a method of treating a patient having a disease or disorder associated with or driven by the overexpression of NRAS or BRAF.
25. A nucleic acid molecule, compound, or composition according to any one of claims 1 to 23, for use in a method of treating a patient having a melanocytic disease, disorder, or lesion, wherein optionally the melanocytic disease, disorder, or lesion is a congenital melanocytic nevus (CMN), an acquired melanocytic nevus (AMN), or a melanoma.
26. A composition comprising a first nucleic acid molecule and a second nucleic acid molecule, The first nucleic acid molecule comprises a first chain of 10 to 50 linked nucleosides, wherein the first chain comprises a sequence that is completely complementary to a sequence having at least 90% identity with the isolength portion of mRNA encoding NRAS. A composition wherein the second nucleic acid molecule comprises a first chain of 10 to 50 linked nucleosides, the first chain comprising a sequence that is completely complementary to a sequence having at least 90% identity with the isolength portion of the mRNA encoding BRAF.
27. The composition according to claim 26, wherein the first nucleic acid molecule is as defined in any one of claims 2, 4 to 9, or 11 to 17, and the second nucleic acid molecule is as defined in any one of claims 3 to 5 or 10 to 17.
28. (a) The first strand of the first nucleic acid molecule comprises a sequence that is completely complementary to a sequence having at least 90% identity with the isolength portion of the mRNA encoding the variant NRAS, wherein the variant NRAS comprises mutations at positions Q61, G60, G12, and / or G13 compared to the wild-type NRAS. (b) The composition according to claim 26 or 27, wherein the first strand of the second nucleic acid molecule comprises a sequence that is completely complementary to a sequence having at least 90% identity with an isolength portion of the mRNA encoding variant BRAF, and the variant BRAF comprises a mutation at position V600 compared to wild-type BRAF.
29. (a) The first strand of the first nucleic acid molecule contains a sequence that is completely complementary to a sequence having at least 90% identity with the isolength portion of the mRNA encoding the variant NRAS, and the variant NRAS contains a mutation at position Q61 compared to the wild-type NRAS. (b) The composition according to any one of claims 26 to 28, wherein the first strand of the second nucleic acid molecule comprises a sequence that is completely complementary to a sequence having at least 90% identity with an isolength portion of the mRNA encoding variant BRAF, and the variant BRAF comprises a mutation at position V600 compared to wild-type BRAF.
30. (a) The first strand of the first nucleic acid molecule contains a sequence that is completely complementary to a sequence having at least 90% identity with an isolength portion of mRNA encoding the variant NRAS p. (Q61K), p. (Q61R), p. (Q61H), p. (Q61L), or p. (Q61P), (b) The composition according to any one of claims 26 to 29, wherein the first strand of the second nucleic acid molecule comprises a sequence that is completely complementary to a sequence having at least 90% identity with an isolength portion of mRNA encoding the variant BRAF p. (V600G), p. (V600M), p. (V600D), p. (V600R), p. (V600K), or p. (V600E).
31. (a) The first strand of the first nucleic acid molecule comprises a sequence that is completely complementary to a sequence having at least 90% identity with an isolength portion of mRNA encoding the variant NRAS p. (G60R), p. (G60V), p. (G60E), or p. (G60D), (b) The composition according to any one of claims 26 to 29, wherein the first strand of the second nucleic acid molecule comprises a sequence that is completely complementary to a sequence having at least 90% identity with an isolength portion of mRNA encoding the variant BRAF p. (V600G), p. (V600M), p. (V600D), p. (V600R), p. (V600K), or p. (V600E).
32. (a) The first strand of the first nucleic acid molecule contains a sequence that is completely complementary to a sequence having at least 90% identity with an isolength portion of mRNA encoding a variant NRAS p. (G12R), p. (G12S), p. (G12D), p. (G12P), p. (G12C), p. (G12A), or p. (G12V), (b) The composition according to any one of claims 26 to 29, wherein the first strand of the second nucleic acid molecule comprises a sequence that is completely complementary to a sequence having at least 90% identity with an isolength portion of mRNA encoding the variant BRAF p. (V600G), p. (V600M), p. (V600D), p. (V600R), p. (V600K), or p. (V600E).
33. (a) The first strand of the first nucleic acid molecule contains a sequence that is completely complementary to a sequence having at least 90% identity with an isolength portion of mRNA encoding a variant NRAS p. (G13V), p. (G13D), p. (G13A), p. (G13S), p. (G13C), p. (G13R), p. (G13F), or p. (G13Y), (b) The composition according to any one of claims 26 to 29, wherein the first strand of the second nucleic acid molecule comprises a sequence that is completely complementary to a sequence having at least 90% identity with an isolength portion of mRNA encoding the variant BRAF p. (V600G), p. (V600M), p. (V600D), p. (V600R), p. (V600K), or p. (V600E).
34. (a) The first strand of the first nucleic acid molecule contains a sequence that is completely complementary to a sequence having at least 90% identity with an isolength portion of mRNA encoding the variant NRAS p. (Q61K), p. (Q61R), p. (Q61H), p. (Q61L), or p. (Q61P), (b) The composition according to any one of claims 26 to 30, wherein the first strand of the second nucleic acid molecule comprises a sequence that is completely complementary to a sequence having at least 90% identity with an isolength portion of mRNA encoding variant BRAF p. (V600E).
35. (a) The first strand of the first nucleic acid molecule comprises a sequence that is completely complementary to a sequence having at least 90% identity with the isolength portion of the mRNA encoding the variant NRAS p. (Q61K), (b) The composition according to any one of claims 26 to 30, wherein the first strand of the second nucleic acid molecule comprises a sequence that is completely complementary to a sequence having at least 90% identity with an isolength portion of mRNA encoding the variant BRAF p. (V600G), p. (V600M), p. (V600D), p. (V600R), p. (V600K), or p. (V600E).
36. (a) The first strand of the first nucleic acid molecule comprises a sequence that is completely complementary to a sequence having at least 90% identity with the isolength portion of the mRNA encoding the variant NRAS p. (Q61K), (b) The composition according to any one of claims 26 to 30, wherein the first strand of the second nucleic acid molecule comprises a sequence that is completely complementary to a sequence having at least 90% identity with an isolength portion of mRNA encoding variant BRAF p. (V600E).
37. (a) The first strand of the first nucleic acid molecule comprises a sequence that is completely complementary to a sequence having at least 95% identity with the isolength portion of the mRNA encoding the variant NRAS p. (Q61K), (b) The composition according to any one of claims 26 to 30 or 36, wherein the first strand of the second nucleic acid molecule comprises a sequence that is completely complementary to a sequence having at least 95% identity with an isolength portion of mRNA encoding variant BRAF p. (V600E).
38. (a) The first strand of the first nucleic acid molecule contains a sequence that is completely complementary to a sequence having 100% identity with the isolength portion of the mRNA encoding the variant NRAS p. (Q61K), (b) The composition according to any one of claims 26 to 29, 36, or 37, wherein the first strand of the second nucleic acid molecule comprises a sequence that is completely complementary to a sequence having 100% identity with an isolength portion of mRNA encoding variant BRAF p. (V600E).
39. The composition according to any one of claims 26 to 30 or 34 to 38, wherein the variant NRAS p. (Q61K) is produced by a c. C181A mutation in the NRAS genome sequence.
40. The composition according to any one of claims 26 to 30 or 34 to 39, wherein the first chain of the first nucleic acid molecule contains a sequence having at least 80%, at least 90%, or at least 95% identity with a sequence selected from the group consisting of SEQ ID NOs: 206 to 224.
41. The composition according to any one of claims 26 to 30 or 34 to 40, wherein the first chain of the first nucleic acid molecule comprises a sequence selected from the group consisting of SEQ ID NOs: 206 to 224.
42. The composition according to any one of claims 26 to 30 or 34 to 41, wherein the first chain of the first nucleic acid molecule consists of a sequence selected from the group consisting of SEQ ID NOs: 206 to 224.
43. The composition according to any one of claims 26 to 42, wherein the variant BRAF p. (V600E) is produced by the c. 1799_1800delisAA mutation in the BRAF genome sequence.
44. The composition according to any one of claims 26 to 43, wherein the first chain of the second nucleic acid molecule contains a sequence having at least 80%, at least 90%, or at least 95% identity with a sequence selected from the group consisting of SEQ ID NOs: 1287 to 1306.
45. The composition according to any one of claims 26 to 44, wherein the first chain of the second nucleic acid molecule comprises a sequence selected from the group consisting of SEQ ID NOs: 1287 to 1306.
46. The composition according to any one of claims 26 to 45, wherein the first chain of the second nucleic acid molecule consists of a sequence selected from the group consisting of SEQ ID NOs: 1287 to 1306.
47. The composition according to any one of claims 26 to 42, wherein the variant BRAF p. (V600E) is produced by a c. T1799A mutation in the BRAF genome sequence.
48. The composition according to any one of claims 26 to 42 or 47, wherein the first chain of the second nucleic acid molecule contains a sequence having at least 80%, at least 90%, or at least 95% identity with a sequence selected from the group consisting of SEQ ID NOs: 1326 to 1344.
49. The composition according to any one of claims 26 to 42, 47, or 48, wherein the first chain of the second nucleic acid molecule comprises a sequence selected from the group consisting of SEQ ID NOs: 1326 to 1344.
50. The composition according to any one of claims 26 to 42 or 47 to 49, wherein the first chain of the second nucleic acid molecule consists of a sequence selected from the group consisting of SEQ ID NOs: 1326 to 1344.
51. The composition according to any one of claims 26 to 30 or 34 to 50, wherein the first chain of the first nucleic acid molecule contains a sequence having at least 80%, at least 90%, or at least 95% identity with the sequence described in SEQ ID NO:
213.
52. The composition according to any one of claims 26 to 42 or 47 to 51, wherein the first chain of the second nucleic acid molecule contains a sequence having at least 80%, at least 90%, or at least 95% identity with the sequence described in Sequence ID No. 1334.
53. The composition according to any one of claims 26 to 30, 34 to 42, or 47 to 52, wherein the first chain of the first nucleic acid molecule comprises a sequence having at least 95% identity with the sequence described in SEQ ID NO: 213, and the first chain of the second nucleic acid molecule comprises a sequence having at least 95% identity with the sequence described in SEQ ID NO: 1334.
54. The composition according to any one of claims 26 to 30, 34 to 42, or 47 to 53, wherein the first chain of the first nucleic acid molecule comprises the sequence described in SEQ ID NO: 213, and the first chain of the second nucleic acid molecule comprises the sequence described in SEQ ID NO: 1334.
55. The composition according to any one of claims 26 to 54, comprising at least two nucleic acid molecules that target a variant NRAS, wherein the at least two nucleic acid molecules that target a variant NRAS target different NRAS alleles.
56. The composition according to any one of claims 26 to 55, comprising at least three nucleic acid molecules that target a variant NRAS, wherein the at least three nucleic acid molecules that target a variant NRAS target different NRAS alleles.
57. A pharmaceutical composition comprising the composition according to any one of claims 26 to 56 and a pharmaceutically acceptable excipient.
58. A method for treating acquired nevus in a subject, comprising administering to the subject a therapeutically effective amount of the composition according to any one of claims 26 to 56 or the pharmaceutical composition according to claim 55.
59. A method for treating acquired nevi in a subject, comprising administering a first nucleic acid molecule to the subject in combination with a second nucleic acid molecule, wherein the administration is performed simultaneously or sequentially in any order. A method wherein the first nucleic acid molecule is as defined in any of claims 2, 4-9, 11-17, 26-30, or 34-42, and the second nucleic acid molecule is as defined in any of claims 3-5, 10-17, or 26-56.
60. A method for preventing melanoma in a subject, comprising administering to the subject a therapeutically effective amount of the composition according to any one of claims 26 to 56 or the pharmaceutical composition according to claim 55.
61. A composition according to any one of claims 26 to 56 or a pharmaceutical composition according to claim 55 for use in a method for treating acquired nevi in a subject.
62. A composition according to any one of claims 26 to 56 or a pharmaceutical composition according to claim 55 for use in a method for preventing melanoma in a subject.
63. Use of the composition according to any one of claims 26 to 56 or the pharmaceutical composition according to claim 55 for reducing or removing acquired nevi.
64. A cosmetic method for reducing or removing acquired nevi in a subject, comprising administering to the subject a composition according to any one of claims 26 to 56.
65. Non-therapeutic methods for reducing or removing acquired nevi.