Compounds, compositions, and methods

Abstract

This disclosure generally relates to small molecule inhibitors of sterile alpha and TIR motif-containing 1 (SARM1) protein, or pharmaceutically acceptable salts thereof, isotopically enriched analogs, stereoisomers, mixtures of stereoisomers, or prodrugs, methods for producing them and intermediates thereof, and methods for using them. This disclosure also provides kits, compounds, or pharmaceutically acceptable salts thereof, isotopically enriched analogs, stereoisomers, mixtures of stereoisomers, or prodrugs, including pharmaceutical compositions, compounds, or pharmaceutically acceptable salts thereof, isotopically enriched analogs, stereoisomers, mixtures of stereoisomers, or prodrugs, and methods for using (or administering) and preparing them.

Description

[Technical Field]

[0001] Cross-reference of related applications This application claims priority under U.S. Patent Provisional Application No. 63 / 496,375, filed April 14, 2023, and U.S. Patent Provisional Application No. 63 / 580,951, filed September 6, 2023, the contents of which are incorporated herein by reference in their entirety.

[0002] This disclosure generally relates to small molecule modulators of sterile alpha and TIR motif-containing 1 (SARM1) proteins, and their use as therapeutic agents. [Background technology]

[0003] Neurodegenerative diseases are a class of progressive neurological diseases in which nerve cells become dysfunctional and eventually die. The breakdown of neurons in patients with neurodegenerative diseases can lead to a variety of symptoms, including mood and behavioral changes, emotional distress, sensory disturbances, motor and cognitive impairments, and memory loss, which can progress to dementia, where the person becomes unable to move or speak, and ultimately to death.

[0004] Axonal degeneration is identified as a significant pathological condition in most neurodegenerative diseases. Axons are vulnerable to both mechanical damage (Wallerian degeneration) and disease (Wallerian degeneration).

[0005] In healthy axons, the N-terminus of SARM1 interacts with the TIR domain, leading to TIR dimerization and subsequent NAD + It prevents enzymatic cleavage. However, under neuronal damage or disease conditions, the N-terminal TIR domain interaction of SARM1 is disrupted, leading to TIR multimerization, followed by rapid loss of NAD+ and associated axonal degeneration. [Overview of the Initiative] [Means for solving the problem]

[0006] (Detailed description of the invention) Compounds useful for treating and / or preventing diseases mediated at least partially by SARM1, or pharmaceutically acceptable salts thereof, isotopically enriched analogs, stereoisomers, mixtures of stereoisomers, or prodrugs thereof, are provided herein.

[0007] In certain embodiments, compounds that inhibit SARM1 are provided.

[0008] In another embodiment, a pharmaceutical composition is provided comprising a compound as described herein, or a pharmaceutically acceptable salt thereof, an isotopically concentrated analog, a stereoisomer, a mixture of stereoisomers, or a prodrug, and a pharmaceutically acceptable carrier.

[0009] In another embodiment, a method is provided for treating a disease or condition mediated at least partially by SARM1, comprising administering a therapeutically effective amount of the compound disclosed herein, or a pharmaceutically acceptable salt thereof, an isotopically concentrated analog, a stereoisomer, a mixture of stereoisomers, or a prodrug thereof, to a subject in need.

[0010] This disclosure also provides kits, compounds, or pharmaceutically acceptable salts thereof, isotopically enriched analogs, stereoisomers, mixtures of stereoisomers, or prodrugs, and methods for using (or administering) and preparing intermediates thereof.

[0011] This disclosure further provides a compound, or a pharmaceutically acceptable salt thereof, an isotopically concentrated analog, a stereoisomer, a mixture of stereoisomers, or a prodrug or composition thereof, for use in methods of treating diseases, disorders, or conditions mediated at least partially by SARM1.

[0012] Furthermore, this disclosure provides the use of a compound, a pharmaceutically acceptable salt thereof, an isotopically enriched analog, a stereoisomer, a mixture of stereoisomers, or a prodrug or composition thereof in the manufacture of a pharmaceutical product for the treatment of a disease, disorder, or condition mediated at least partially by SARM1.

[0013] The description herein describes exemplary embodiments of the technology. However, it should be recognized that such descriptions are not intended to limit the scope of the disclosure, but rather to provide a description of exemplary embodiments. [Modes for carrying out the invention]

[0014] 1.Definition A dash ("-") without a space between two letters or symbols is used to indicate the bonding point of a substituent. For example, -C(O)NH2 is bonded via a carbon atom. Dashes at the beginning or end of a chemical group are for convenience only, and chemical groups may be represented with or without one or more dashes without losing their usual meaning. Dashed or wavy lines drawn through lines in a structure indicate specific bonding points of a group. Unless chemically or structurally required, the order in which chemical groups are described or named does not indicate or suggest orientation or stereoselectivity.

[0015] Prefix “C” u-v " means that the following group has u to v carbon atoms. For example, "C 1-6 The term "alkyl" means that an alkyl group has 1 to 6 carbon atoms.

[0016] References to values ​​or parameters “approximately” in this specification include (and are described) embodiments relating to the value or parameter itself. In certain embodiments, the term “approximately” includes ±10% of the indicated amount. In other embodiments, the term “approximately” includes ±5% of the indicated amount. In certain other embodiments, the term “approximately” includes ±1% of the indicated amount. Also, the term “approximately X” includes the description of “X.” Furthermore, the singular forms “a” and “the” include plural references unless explicitly indicated otherwise in the context. Thus, for example, a reference to “compound” includes multiple such compounds, and a reference to “assay” includes one or more assays and their equivalents well known to those skilled in the art.

[0017] "Alkyl" refers to an unbranched or branched saturated hydrocarbon chain. As used herein, alkyl has 1 to 20 carbon atoms (i.e., C 1-20 Alkyl), having 1 to 12 carbon atoms (i.e., C 1-12 Alkyl), having 1 to 8 carbon atoms (i.e., C 1-8 Alkyl), having 1 to 6 carbon atoms (i.e., C 1-6 Alkyl) or having 1 to 4 carbon atoms (i.e., C 1-4 Alkyl). Examples of alkyl groups include, for example, methyl, ethyl, propyl, isopropyl, n-butyl, sec-butyl, isobutyl, tert-butyl, pentyl, 2-pentyl, isopentyl, neopentyl, hexyl, 2-hexyl, 3-hexyl, and 3-methylpentyl. When an alkyl residue having a specific number of carbon atoms is given a chemical name or identified by a molecular formula, all isomers at that number of carbon atoms may be included. For example, "butyl" includes n-butyl (i.e., -(CH2)3CH3), sec-butyl (i.e., -CH(CH3)CH2CH3), isobutyl (i.e., -CH2CH(CH3)2), and tert-butyl (i.e., -C(CH3)3), and "propyl" includes n-propyl (i.e., -(CH2)2CH3) and isopropyl (i.e., -CH(CH3)2).

[0018] Certain alternative chemical names commonly used may also be employed. For example, divalent groups such as divalent "alkyl" groups, divalent "aryl" groups, and divalent heteroaryl groups may also be referred to as "alkylene" groups or "alkylenyl" groups (e.g., methylenyl, ethylenyl, and propylenyl), "arylene" groups or "arylenyl" groups (e.g., phenylenyl or naphthylenyl, or in the case of heteroarylene, quinolinyl), respectively. Also, unless otherwise explicitly stated, when a combination of groups is referred to in this specification as a part, for example, as arylalkyl or aralkyl, the last-mentioned group contains the atom to which the portion is attached to the remainder of the molecule.

[0019] "Alkenyl" contains at least one (e.g., 1 to 3, or 1) carbon-carbon double bond and has 2 to 20 carbon atoms (i.e., C 2-20 alkenyl), has 2 to 12 carbon atoms (i.e., C 2-12 alkenyl), has 2 to 8 carbon atoms (i.e., C 2-8 alkenyl), has 2 to 6 carbon atoms (i.e., C 2-6 alkenyl), or has 2 to 4 carbon atoms (i.e., C 2-4 alkenyl) alkyl group. Examples of alkenyl groups include, for example, ethenyl, propenyl, butadienyl (including 1,2-butadienyl and 1,3-butadienyl).

[0020] "Alkynyl" contains at least one (e.g., 1 to 3, or 1) carbon-carbon triple bond and has 2 to 20 carbon atoms (i.e., C 2-20 alkynyl), has 2 to 12 carbon atoms (i.e., C 2-12 alkynyl), has 2 to 8 carbon atoms (i.e., C 2-8 alkynyl), has 2 to 6 carbon atoms (i.e., C 2-6 alkynyl), or has 2 to 4 carbon atoms (i.e., C 2-4Alkynyl refers to an alkyl group. The term "alkynyl" also includes groups having one triple bond and one double bond.

[0021] "Alkoxy" refers to the group "alkyl-O-". Examples of alkoxy groups include methoxy, ethoxy, n-propoxy, iso-propoxy, n-butoxy, tert-butoxy, sec-butoxy, n-pentoxy, n-hexoxy, and 1,2-dimethylbutoxy.

[0022] "Alkoxyalkyl" refers to the group "alkyl-O-alkyl".

[0023] "Alkylthio" refers to the group "alkyl-S-". "Alkylsulfinyl" refers to the group "alkyl-S(O)-". "Alkylsulfonyl" refers to the group "alkyl-S(O)2-". "Alkylsulfonylalkyl" refers to -alkyl-S(O)2-alkyl.

[0024] "Acyl" refers to the base -C(O)R y And R y , where is hydrogen, alkyl, alkenyl, alkynyl, cycloalkyl, heterocyclyl, aryl, heteroalkyl, or heteroaryl, each of which may be optionally substituted as defined herein. Examples of acyls include, for example, formyl, acetyl, cyclohexylcarbonyl, cyclohexylmethylcarbonyl, and benzoyl.

[0025] "Amide" refers to the group -C(O)NR y R z The "C-amide" group and the -NR group refer to the "C-amide" group and the -NR group. y C(O)R z Both of the "N-amide" groups that refer to R y and R zHowever, independently, these are hydrogen, alkyl, alkenyl, alkynyl, cycloalkyl, heterocyclyl, aryl, heteroalkyl, or heteroaryl, each of which may be optionally substituted as defined herein, or R y and R z However, together they form a cycloalkyl or heterocycline, each of which may be optionally substituted as defined herein.

[0026] "Amino" is the base-NR y R z And R y and R z However, these are independently hydrogen, alkyl, alkenyl, alkynyl, cycloalkyl, heterocyclyl, aryl, heteroalkyl, or heteroaryl, each of which may be optionally substituted as defined herein.

[0027] "Amidino" means -C(NR y )(NR z 2) and R y and R z However, these are independently hydrogen, alkyl, alkenyl, alkynyl, cycloalkyl, heterocyclyl, aryl, heteroalkyl, or heteroaryl, each of which may be optionally substituted as defined herein.

[0028] "Aryl" refers to an aromatic carbocyclic group having a single ring (e.g., monocyclic) or multiple rings including a condensed system (e.g., bicyclic or tricyclic). As used herein, aryl has 6 to 20 ring carbon atoms (i.e., C 6-20 (aryl), having 6 to 12 ring carbon atoms (i.e., C 6-12 (aryl), or having 6 to 10 ring carbon atoms (i.e., C 6-10Aryl groups. Examples of aryl groups include phenyl, naphthyl, fluorenyl, and anthryl. However, aryl groups do not include, or overlap with, heteroaryl groups, which are described below. When one or more aryl groups are fused with a heteroaryl group, the resulting ring system is heteroaryl regardless of the bonding site. When one or more aryl groups are fused with a heterocyclyl group, the resulting ring system is heterocyclyl regardless of the bonding site. When one or more aryl groups are fused with a cycloalkyl group, the resulting ring system is cycloalkyl regardless of the bonding site.

[0029] "Arylalkyl" or "aralkyl" refers to the group "aryl-alkyl-".

[0030] "Carbamoyl" is the base -OC(O)NR y R z The "O-carbamoyl" group and the -NR group refer to these groups. y C(O)OR z Both of the "N-carbamoyl" groups that refer to R y and R z However, these are independently hydrogen, alkyl, alkenyl, alkynyl, cycloalkyl, heterocyclyl, aryl, heteroalkyl, or heteroaryl, each of which may be optionally substituted as defined herein.

[0031] "Carboxyl ester" or "ester" refers to -OC(O)R x and -C(O)OR x Both are, R x This refers to alkyl, alkenyl, alkynyl, cycloalkyl, heterocyclyl, aryl, heteroalkyl, or heteroaryl compounds, each of which may be optionally substituted as defined herein.

[0032] A "cyanoalkyl" refers to an alkyl group as defined above, in which one or more (for example, one or two) hydrogen atoms are replaced by a cyano(-CN) group.

[0033] "Cycloalkyl" refers to a saturated or partially unsaturated cyclic alkyl group having a single ring or multiple rings, including condensed, cross-linked, and spiro-ring systems. The term "cycloalkyl" refers to a cycloalkenyl group (i.e., a cyclic group having at least one double bond) and at least one sp 3 This includes carbocyclic fused ring systems having carbon atoms (i.e., at least one non-aromatic ring). As used herein, cycloalkyls have 3 to 20 ring carbon atoms (i.e., C 3-20 Cycloalkyl), having 3 to 14 ring carbon atoms (i.e., C 3-12 Cycloalkyl), having 3 to 12 ring carbon atoms (i.e., C 3-12 Cycloalkyl), having 3 to 10 ring carbon atoms (i.e., C 3-10 Cycloalkyl), having 3 to 8 ring carbon atoms (i.e., C 3-8 Cycloalkyl, or having 3 to 6 ring carbon atoms (i.e., C 3-6 (Cycloalkyl). Examples of monocyclic groups include cyclopropyl, cyclobutyl, cyclopentyl, cyclohexyl, cycloheptyl, and cyclooctyl. Examples of polycyclic groups include bicyclo[2.2.1]heptanyl, bicyclo[2.2.2]octanyl, adamantyl, norbornyl, dekalinyl, and 7,7-dimethyl-bicyclo[2.2.1]heptanyl. Furthermore, the term cycloalkyl is intended to encompass any non-aromatic ring that can be condensed to an aryl ring, regardless of its bonding to the remainder of the molecule. Moreover, cycloalkyl also includes "spirocycloalkyl," such as spiro[2.5]octanyl, spiro[4.5]decanyl, or spiro[5.5]undecanyl, in the case where there are two substitution positions on the same carbon atom.

[0034] "Cycloalkylalkyl" refers to the group "cycloalkyl-alkyl-".

[0035] "Imino" is the base C(NR y )R zAnd R y and R z Each of these independently refers to hydrogen, alkyl, alkenyl, alkynyl, cycloalkyl, heterocyclyl, aryl, heteroalkyl, or heteroaryl, each of which may be optionally substituted as defined herein.

[0036] "Imide" refers to the group -C(O)NR y C(O)R z And R y and R z Each of these independently refers to hydrogen, alkyl, alkenyl, alkynyl, cycloalkyl, heterocyclyl, aryl, heteroalkyl, or heteroaryl, each of which may be optionally substituted as defined herein.

[0037] "Halogen" or "halo" refers to atoms that occupy Group VIIA of the periodic table, such as fluoro, chloro, bromo, or iodine.

[0038] A "haloalkyl" refers to an unbranched or branched alkyl group as defined above, in which one or more (e.g., 1 to 6 or 1 to 3) hydrogen atoms are replaced by halogens. For example, if a residue is replaced by two or more halogens, it may be referred to by using a prefix corresponding to the number of halogenated moieties bonded. Dihaloalkyls and trihaloalkyls refer to alkyl groups substituted with two ("di") or three ("tri") halo groups, but these do not necessarily have to be the same halogens. Examples of haloalkyls include trifluoromethyl, difluoromethyl, fluoromethyl, trichloromethyl, 2,2,2-trifluoroethyl, 1,2-difluoroethyl, 3-bromo-2-fluoropropyl, and 1,2-dibromoethyl.

[0039] A "haloalkoxy" refers to an alkoxy group as defined above, in which one or more (for example, 1 to 6 or 1 to 3) hydrogen atoms are replaced by halogens.

[0040] A "haloalkoxyalkyl" refers to an alkoxyalkyl group as defined above, in which one or more (for example, 1 to 6 or 1 to 3) hydrogen atoms are replaced by halogens.

[0041] A "hydroxyalkyl" is an alkyl group as defined above, in which one or more (for example, 1 to 6 or 1 to 3) hydrogen atoms are replaced by a hydroxyl group.

[0042] A "heteroalkyl" refers to an alkyl group in which one or more carbon atoms (and any associated hydrogen atoms), excluding one or more terminal carbon atoms, are independently replaced by the same or different heteroatomic groups, provided that the bonding sites to the rest of the molecule are via carbon atoms. The term "heteroalkyl" includes unbranched or branched saturated chains containing carbon and heteroatoms. For example, one, two, or three carbon atoms may be independently replaced by the same or different heteroatomic groups. Examples of heteroatomic groups include -NR y -, -O-, -S-, -S(O)-, -S(O)2-, etc., R y The elements are hydrogen, alkyl, alkenyl, alkynyl, cycloalkyl, heterocyclyl, aryl, heteroalkyl, or heteroaryl, each of which may be optionally substituted as defined herein. Examples of heteroalkyl groups include, for example, ethers (e.g., -CH2OCH3, -CH(CH3)OCH3, -CH2CH2OCH3, -CH2CH2OCH2CH2OCH3, etc.), thioethers (e.g., -CH2SCH3, -CH(CH3)SCH3, -CH2CH2SCH3, -CH2CH2SCH2CH2CH3, etc.), sulfones (e.g., -CH2S(O)2CH3, -CH(CH3)S(O)2CH3, -CH2CH2S(O)2CH3, -CH2CH2S(O)2CH3, etc.), and amines (e.g., -CH2NR y CH3, -CH(CH3)NR y CH3, -CH2CH2NRy CH3, -CH2CH2NR y CH2 CH2NR y CH3 and others, R y Examples include hydrogen, alkyl, alkenyl, alkynyl, cycloalkyl, heterocyclyl, aryl, heteroalkyl, or heteroaryl, each of which may be optionally substituted as defined herein. As used herein, a heteroalkyl comprises 2 to 10 carbon atoms, 2 to 8 carbon atoms, 2 to 4 carbon atoms, and 1 to 3 heteroatoms, 1 to 2 heteroatoms, or 1 heteroatom.

[0043] "Heteroaryl" refers to an aromatic group having a single ring, multiple rings, or multiple fused rings, containing one or more ring heteroatoms independently selected from nitrogen, oxygen, and sulfur. As used herein, heteroaryl has 1 to 20 ring carbon atoms (i.e., C 1-20 Heteroaryl), having 3 to 12 ring carbon atoms (i.e., C 3-12 Heteroaryl) or having 3 to 8 ring carbon atoms (i.e., C 3-8A heteroaryl ring having 1 to 5 ring heteroatoms, 1 to 4 ring heteroatoms, 1 to 3 ring heteroatoms, 1 to 2 ring heteroatoms, or 1 ring heteroatom, each independently having 1 to 4 ring heteroatoms, 1 to 3 ring heteroatoms, 1 to 2 ring heteroatoms, or 1 ring heteroatom, each independently having 1 to 10-membered ring systems, 5 to 7-membered ring systems, or 5 to 6-membered ring systems, each independently having 1 to 4 ring heteroatoms, 1 to 3 ring heteroatoms, 1 to 2 ring heteroatoms, or 1 ring heteroatom, each independently selected from nitrogen, oxygen, and sulfur. Examples of heteroaryl groups include, for example, acridinyl, benzimidazolyl, benzothiazolyl, benzindolyl, benzofuranyl, benzothiazolyl, benzothiadiazolyl, benzonaphthofuranyl, benzoxazolyl, benzothienyl (benzothiophenyl), benzotriazolyl, benzo[4,6]imidazo[1,2-a]pyridyl, carbazolyl, sinnolinyl, dibenzofuranyl, dibenzothiophenyl, furanyl, isothiazolyl, imidazolyl, indazolyl, indolyl, indazolyl, isoindolyl, isoquinolyl Examples include isoxazolyl, naphthilidinyl, oxadiazolyl, oxazolyl, 1-oxidepyridinyl, 1-oxidepyrimidinyl, 1-oxidepyradinyl, 1-oxidepyridazinyl, phenazinyl, phthalazinyl, pteridinyl, purinyl, pyrrolyl, pyrazolyl, pyridinyl, pyridinyl, pyrimidinyl, pyridazinyl, quinazolinyl, quinoxalinyl, quinolinyl, quinuclidinyl, isoquinolinyl, thiazolyl, thiadiazolyl, thiophenyl (i.e., thienyl), triazolyl, tetrazolyl, and triazinyl. Examples of fused heteroaryl rings include, but are not limited to, benzo[d]thiazolyl, quinolinyl, isoquinolinyl, benzo[b]thiophenyl, indazolyl, benzo[d]imidazolyl, pyrazolo[1,5-a]pyridinyl, and imidazo[1,5-a]pyridinyl, in which the heteroaryl can be bonded via one of the rings of the fused system. Any aromatic ring having one or more fused rings containing at least one heteroatom is considered a heteroaryl, regardless of its bond to the rest of the molecule (i.e., via any one of the fused rings).A heteroaryl does not include or overlap with an aryl as defined above.

[0044] "Heteroarylalkyl" refers to the group "heteroaryl-alkyl-".

[0045] A "heterocyclyl" refers to a saturated or partially unsaturated cyclic alkyl group containing one or more ring heteroatoms independently selected from nitrogen, oxygen, and sulfur. The term "heterocyclyl" includes heterocycloalkenyl groups (i.e., heterocyclyl groups having at least one double bond), bridged heterocyclyl groups, condensed heterocyclyl groups, and spiro-heterocyclyl groups. A heterocyclyl may be a single ring or multiple rings, where the multiple rings may be condensed, bridged, or spiro, and contain one or more (e.g., 1 to 3) oxo (=O) or N-oxide (-O) atoms. - ) may include a portion. Any non-aromatic ring containing at least one heteroatom is considered a heterocyclyl, regardless of the bonding (i.e., bonding via carbon atoms or heteroatoms). Furthermore, the term heterocyclyl is intended to encompass any non-aromatic ring containing at least one heteroatom, which may be condensed into a cycloalkyl, aryl, or heteroaryl ring, regardless of bonding to the rest of the molecule. As used herein, a heterocyclyl has 2 to 20 ring carbon atoms (i.e., C 2-20 Heterocyclyls have 2 to 12 ring carbon atoms (i.e., C 2-12 Heterocyclyls have 2 to 10 ring carbon atoms (i.e., C 2-10 Heterocyclyls have 2 to 8 ring carbon atoms (i.e., C 2-8 Heterocyclyls have 3 to 12 ring carbon atoms (i.e., C 3-12 Heterocyclyls have 3 to 8 ring carbon atoms (i.e., C 3-8 Heterocyclyls have 3 to 6 ring carbon atoms (i.e., C 3-6The heterocyclyl group has 1 to 5 ring heteroatoms, 1 to 4 ring heteroatoms, 1 to 3 ring heteroatoms, 1 to 2 ring heteroatoms, or 1 ring heteroatom, independently selected from nitrogen, sulfur, or oxygen. Examples of heterocyclyl groups include, for example, azetidinyl, azepinyl, benzodioxolyl, benzo[b][1,4]dioxepinyl, 1,4-benzodioxanyl, benzopyranyl, benzodioxynyl, benzopyranonyl, benzofuranonyl, dioxolanyl, dihydropyranyl, hydropyranyl, thienyl[1,3]dithianyl, decahydroisoquinolyl, furanoyl, imidazolinyl, imidazolidinyl, indolinyl, indolidinyl, isoindolinyl, isothiazolidinyl, isoxazolidinyl, morpholinyl, octahydroindolinyl Examples include lyl, octahydroisoindolyl, 2-oxopiperazinyl, 2-oxopiperidinyl, 2-oxopyrrolidinyl, oxazolidinyl, oxylanil, oxetanyl, phenothiazinyl, phenoxadinyl, piperidinyl, piperazinyl, 4-piperidonyl, pyrrolidinyl, pyrazolidinyl, quinuclidinyl, thiazolidinyl, tetrahydrofuryl, tetrahydropyranyl, trithianil, tetrahydroquinolinyl, thiomorpholinyl, thiamorpholinyl, 1-oxo-thiomorpholinyl, and 1,1-dioxo-thiomorpholinyl. The term "heterocyclyl" also includes "spiroheterocyclyl" when there are two substitution positions on the same carbon atom. Examples of spiro-heterocyclyl rings include, for example, bicyclic and tricyclic ring systems such as oxabicyclo[2.2.2]octanyl, 2-oxa-7-azaspiro[3.5]nonanyl, 2-oxa-6-azaspiro[3.4]octanyl, and 6-oxa-1-azaspiro[3.3]heptanyl. Examples of condensed heterocyclyl rings include, but are not limited to, 1,2,3,4-tetrahydroisoquinolinyl, 4,5,6,7-tetrahydrothieno[2,3-c]pyridinyl, indolinyl, and isoindolinyl, in which the heterocyclyl can be linked via one of the rings of the condensation system.

[0046] "Heterocyclylalkyl" refers to the group "heterocyclyl-alkyl-".

[0047] "Oxime" refers to the group -CR y (=NOH), where R y is hydrogen, alkyl, alkenyl, alkynyl, cycloalkyl, heterocyclyl, aryl, heteroalkyl, or heteroaryl, each of which may be optionally substituted as defined herein.

[0048] "Sulfonyl" refers to the group -S(O)2R y where R y is hydrogen, alkyl, alkenyl, alkynyl, cycloalkyl, heterocyclyl, aryl, heteroalkyl, or heteroaryl, each of which may be optionally substituted as defined herein. Examples of sulfonyl include methylsulfonyl, ethylsulfonyl, phenylsulfonyl, and toluenesulfonyl.

[0049] "Sulfinyl" refers to the group -S(O)R y where R y is hydrogen, alkyl, alkenyl, alkynyl, cycloalkyl, heterocyclyl, aryl, heteroalkyl, or heteroaryl, each of which may be optionally substituted as defined herein. Examples of sulfinyl include methylsulfinyl, ethylsulfinyl, phenylsulfinyl, and toluenesulfinyl.

[0050] "Sulfonamide" refers to the groups -SO2NR y R z and -NR y SO2R z where R y and R z are each independently hydrogen, alkyl, alkenyl, alkynyl, cycloalkyl, heterocyclyl, aryl, heteroalkyl, or heteroaryl, each of which may be optionally substituted as defined herein.

[0051] "Optional" or "optionally" means that the event or situation described thereafter may or may not occur, and that the description includes both cases in which the event or situation occurs and cases in which it does not. The term "optionally substituted" means that any one or more (e.g., 1 to 5 or 1 to 3) hydrogen atoms on a specified atom or group may or may not be replaced by non-hydrogen parts.

[0052] As used herein, the term "substituted" means any of the above groups (i.e., alkyl, alkenyl, alkynyl, alkylene, alkoxy, haloalkyl, haloalkoxy, cycloalkyl, aryl, heterocyclyl, heteroaryl, and / or heteroalkyl) in which at least one (e.g., 1 to 5 or 1 to 3) hydrogen atoms is substituted, but is not limited to alkyl, alkenyl, alkynyl, alkoxy, alkylthio, acyl, amide, amino, amidino, aryl, aralkyl, azide, carbamoyl, carboxyl, car Ruboxyl ester, cyano, cycloalkyl, cycloalkylalkyl, guanidino, halo, haloalkyl, haloalkoxy, hydroxyalkyl, heteroalkyl, heteroaryl, heteroarylalkyl, heterocyclyl, heterocyclylalkyl, -NHNH2, =NNH2, imino, imide, hydroxy, oxo, oxime, nitro, sulfonyl, sulfinyl, alkylsulfonyl, alkylsulfinyl, thiocyanate, -S(O)OH, -S(O)2OH, sulfonamide, thiol, thioxo, N-oxide, or -Si(R y )3 is replaced by a bond to a non-hydrogen atom, and each R y However, it means that independently, it is hydrogen, alkyl, alkenyl, alkynyl, heteroalkyl, cycloalkyl, aryl, heteroaryl, or heterocyclyl.

[0053] In certain embodiments, "substituted" refers to any of the above alkyl, alkenyl, alkynyl, cycloalkyl, heterocyclyl, aryl, or heteroaryl groups, wherein one or more (e.g., 1 to 5 or 1 to 3) hydrogen atoms are replaced independently with deuterium, halo, cyano, nitro, azido, oxo, alkyl, alkenyl, alkynyl, haloalkyl, cycloalkyl, heterocyclyl, aryl, heteroaryl, -NR g R h 、-NR g C(O)R h 、-NR g C(O)NR g R h 、-NR g C(O)OR h 、-NR g S(O) 1-2 R h 、-C(O)R g 、-C(O)OR g 、-OC(O)OR g 、-OC(O)R g 、-C(O)NR g R h 、-OC(O)NR g R h 、-OR g 、-SR g 、-S(O)R g 、-S(O)2R g 、-OS(O) 1-2 R g 、-S(O) 1-2 OR g 、-NR g S(O) 1-2 NR g R h 、=NSO2R g 、=NOR g 、-S(O) 1-2 NR g R h 、-SF5, -SCF3, or -OCF3. In certain embodiments, "substituted" also refers to any of the above groups, wherein one or more (e.g., 1 to 5 or 1 to 3) hydrogen atoms are replaced with -C(O)R g 、-C(O)OR g 、-C(O)NR g Rh -CH2SO2R g , or -CH2SO2NR g R h It means something that has been replaced by something else. As mentioned above, R g and R h These are the same or different and independently of hydrogen, alkyl, alkenyl, alkynyl, alkoxy, thioalkyl, aryl, aralkyl, cycloalkyl, cycloalkylalkyl, haloalkyl, heterocyclyl, heterocyclylalkyl, heteroaryl, and / or heteroarylalkyl. In certain embodiments, “substituted” is also any of the above groups in which one or more (e.g., 1 to 5 or 1 to 3) hydrogen atoms are replaced by a bond to amino, cyano, hydroxy, imino, nitro, oxo, thioxo, halo, alkyl, alkoxy, alkylamino, thioalkyl, aryl, aralkyl, cycloalkyl, cycloalkylalkyl, haloalkyl, heterocyclyl, N-heterocyclyl, heterocyclylalkyl, heteroaryl, and / or heteroarylalkyl, or R g and R h and R i This means that two of these atoms, together with the atoms to which they are bonded, form a heterocyclyl ring that is optionally substituted with oxo, halo, or alkyl (optionally substituted with oxo, halo, amino, hydroxy, or alkoxy).

[0054] Polymers or similar amorphous structures obtained by defining substituents indefinitely (e.g., substituted aryls having a substituted alkyl group, which themselves are substituted with a substituted aryl group and further substituted with a substituted heteroalkyl group) are not intended to be included herein. Unless otherwise specified, the maximum number of consecutive substitutions in the compounds described herein is three. For example, consecutive substitution of a substituted aryl group containing two other substituted aryl groups is limited to ((substituted aryl)substituted aryl)substituted aryls. Similarly, the above definitions are intended to exclude unacceptable substitution patterns (e.g., a methyl group substituted with five fluorine atoms, or a heteroaryl group having two adjacent oxygen ring atoms). Such unacceptable substitution patterns are well known to those skilled in the art. When used to modify a chemical group, the term “substituted” may describe other chemical groups as defined herein.

[0055] In certain embodiments, as used herein, the phrase "one or more" refers to one to five. In certain embodiments, as used herein, the phrase "one or more" refers to one to three.

[0056] Any compound or structure presented herein is also intended to represent both an unlabeled and an isotopically labeled form of the compound. These forms of a compound may also be referred to as “isotope-enriched analogues.” An isotopically labeled compound has the structure described herein, except that one or more atoms are replaced by atoms having a selected atomic mass or mass number. Examples of isotopes that can be incorporated into the compounds of this disclosure include isotopes of hydrogen, carbon, nitrogen, oxygen, phosphoric acid, fluorine, chlorine, and iodine, for example, respectively. 2 H, 3 H, 11 C, 13 C, 14 C, 13 N, 15 N, 15 O, 17 O, 18 O, 31 P, 32P, 35 S, 18 F, 36 Cl, 123 I, and 125 I is an example. Various isotope-labeled compounds of this disclosure, for example, 3 H and 14 These compounds incorporate radioactive isotopes such as 13C. Such isotope-labeled compounds may be useful in metabolic studies, reaction kinetic studies, detection or imaging techniques, such as positron emission tomography (PET) or single-photon emission computed tomography (SPECT), including drug or substrate tissue distribution assays, or in radiotherapy for patients.

[0057] The term “isotope-enriched analog” includes “deuterated analogs” of compounds described herein, in which one or more hydrogen atoms, such as hydrogen on a carbon atom, are replaced by deuterium. Such compounds exhibit increased resistance to metabolism and are therefore useful for extending the half-life of any compound when administered to mammals, particularly humans. See, for example, Foster, “Deuterium Isotope Effects in Studies of Drug Metabolism,” Trends Pharmacol. Sci. 5(12):524-527 (1984). Such compounds are synthesized by means well known in the art, for example, by using starting materials in which one or more hydrogen atoms are replaced by deuterium.

[0058] The deuterium-labeled or substituted therapeutic compounds of this disclosure may have improved DMPK (drug metabolism and pharmacokinetic) properties with respect to distribution, metabolism, and excretion (ADME). Substitution with heavier isotopes such as deuterium may result in certain therapeutic benefits arising from higher metabolic stability, such as extended in vivo half-life, reduced required dosage, and / or improved therapeutic index. 18 F, 3 H, or 1114C-labeled compounds may be useful in PET, SPECT, or other imaging studies. The isotope-labeled compounds and their prodrugs of this disclosure can generally be prepared by performing the procedures and preparations disclosed in the scheme or examples and described below, by substituting non-isotope labeling reagents with readily available isotope labeling reagents. In this context, deuterium is understood to be a substituent in the compounds described herein.

[0059] The concentrations of such heavier isotopes, particularly deuterium, can be defined by the isotopic enrichment factor. In the compounds of this disclosure, atoms not specifically designated as a particular isotope represent any stable isotope of that atom. Unless otherwise specified, where a position is specifically designated as "H" or "hydrogen," that position is understood to have hydrogen in its naturally occurring isotopic composition. Thus, in the compounds of this disclosure, an atom specifically designated as deuterium (D) represents deuterium.

[0060] In many cases, the compounds of this disclosure can form acidic salts and / or basic salts in the presence of amino and / or carboxyl groups, or similar groups.

[0061] Also provided herein are pharmaceutically acceptable salts, isotopically concentrated analogs, deuterated analogs, stereoisomers, mixtures of stereoisomers, and prodrugs of the compounds described herein. "pharmaceutically acceptable" or "physiologically acceptable" means compounds, salts, compositions, dosage forms, and other materials useful in the preparation of pharmaceutical compositions suitable for veterinary or human pharmaceutical use.

[0062] The term "pharmaceutically acceptable salt" of a given compound refers to a salt that retains the biological efficacy and properties of the given compound and is not biologically or otherwise undesirable. Examples of "pharmaceutically acceptable salts" or "physiologically acceptable salts" include salts with inorganic acids and salts with organic acids. In addition, if the compounds described herein are obtained as acid addition salts, the free base can be obtained by making a solution of its salt basic. Conversely, if the product is a free base, the addition salt, in particular a pharmaceutically acceptable addition salt, can be produced by dissolving the free base in a suitable organic solvent and treating the solution with an acid, following conventional procedures for preparing acid addition salts from basic compounds. Those skilled in the art will recognize the various synthetic methods available for preparing non-toxic, pharmaceutically acceptable addition salts. Pharmaceutically acceptable acid addition salts can be prepared from inorganic or organic acids. Examples of salts derived from inorganic acids include hydrochloric acid, hydrobromic acid, sulfuric acid, nitric acid, and phosphoric acid. Examples of salts derived from organic acids include acetic acid, propionic acid, gluconic acid, glycolic acid, pyruvate, oxalic acid, malic acid, malonic acid, succinic acid, maleic acid, fumaric acid, tartaric acid, citric acid, benzoic acid, cinnamic acid, mandelic acid, methanesulfonic acid, ethanesulfonic acid, p-toluenesulfonic acid, and salicylic acid. Similarly, pharmaceutically acceptable base addition salts can be prepared from inorganic or organic bases. Examples of salts derived from inorganic bases include sodium, potassium, lithium, aluminum, ammonium, calcium, and magnesium salts.Salts derived from organic bases include primary, secondary, and tertiary amines, such as alkylamines (i.e., NH2(alkyl)), dialkylamines (i.e., HN(alkyl)2), trialkylamines (i.e., N(alkyl)3), substituted alkylamines (i.e., NH2(substituted alkyl)), di(substituted alkyl)amines (i.e., HN(substituted alkyl)2), tri(substituted alkyl)amines (i.e., N(substituted alkyl)3), alkenylamines (i.e., NH2(alkenyl)), dialkenylamines (i.e., HN(alkenyl)2), trialkenylamines (i.e., N(alkenyl)3), substituted alkenylamines (i.e., NH2(substituted alkenyl)), and di(substituted alkenyl)amines (i.e., HN(substituted Examples of suitable amines include, but are not limited to, salts of alkenyl 2), tri(substituted alkenyl)amines (i.e., N(substituted alkenyl)3, mono-, di-, or tri-cycloalkylamines (i.e., NH2(cycloalkyl), HN(cycloalkyl)2, N(cycloalkyl)3), mono-, di-, or tri-allylamines (i.e., NH2(aryl), HN(aryl)2, N(aryl)3), or mixed amines. Specific examples of suitable amines, though not exhaustive, include isopropylamine, trimethylamine, diethylamine, tri(iso-propyl)amine, tri(n-propyl)amine, ethanolamine, 2-dimethylaminoethanol, piperazine, piperidine, morpholine, and N-ethylpiperidine.

[0063] Some compounds exist as tautomers. Tautomers exist in equilibrium with each other. For example, amide-containing compounds may exist in equilibrium with imido acid tautomers. Regardless of whether the tautomers are shown and regardless of the nature of the equilibrium between the tautomers, it is understood by those skilled in the art that a compound contains both amide tautomers and imido acid tautomers. Therefore, amide-containing compounds are understood to contain their imido acid tautomers. Similarly, imido acid-containing compounds are understood to contain their amide tautomers.

[0064] The compounds of this disclosure or their pharmaceutically acceptable salts contain chiral centers and can therefore give rise to enantiomers, diastereomers, and other stereoisomeric forms, which can be defined in terms of absolute stereochemistry as (R)- or (S)-, or with respect to amino acids as (D)- or (L)-. This disclosure is intended to include all such conceivable isomers, as well as their racemic and optically pure forms. Optically active (+) and (-), (R)- and (S)-, or (D)- and (L)- isomers can be prepared using chiral synthons or chiral reagents, or separated using prior art, e.g., chromatography and / or fractional recrystallization. Prior art for the preparation / isolation of individual enantiomers includes chiral synthesis from suitable optically pure precursors, or separation of racemates (or racemates of salts or derivatives) using, for example, chiral high-pressure liquid chromatography (HPLC). If a compound described herein contains an olefin double bond or other geometrically asymmetric center, unless otherwise specified, the compound is intended to include both E and Z geometric isomers.

[0065] A "stereoisomer" refers to a compound that has the same atoms bonded together by the same bonds but possesses different, non-interchangeable three-dimensional structures. This disclosure intends various stereoisomers or mixtures thereof and includes "enantiomers," which refer to two stereoisomers that are mirror images of each other and whose molecules cannot overlap.

[0066] A "diastereomer" is a stereoisomer that has at least two asymmetric atoms but is not a mirror image of one another.

[0067] The relative centers of compounds described herein are indicated graphically using the “thick bond” type (bold or parallel lines), and absolute stereochemistry is indicated using the wedge bond type (bold or parallel lines).

[0068] "Prodrug" means any compound that, when administered to a mammalian subject, releases an active parent drug in vivo according to the structure described herein. Prodrugs of the compounds described herein can be prepared by modifying functional groups present in the compounds described herein so that the modifications can be cleaved in vivo to release the parent compound. Prodrugs can be prepared by routine operations or by modifying functional groups present in the compounds so that the modifications can be cleaved in vivo to become the parent compound. Prodrugs include compounds described herein in which a hydroxy, amino, carboxyl, or sulfhydryl group in the compounds described herein is bound to any group that can be cleaved in vivo to regenerate a free hydroxy, amino, or sulfhydryl group, respectively. Examples of prodrugs include, but are not limited to, esters of the hydroxyl functional groups in the compounds described herein (e.g., acetates, formates, and benzoate derivatives), amides, guanidines, and cacarbamates (e.g., N,N-dimethylaminocarbonyl). The preparation, selection, and use of prodrugs are described in T. Higuchi and V. Stella, “Pro-drugs as Novel Delivery Systems,” Vol. 14 of the ACS Symposium Series; “Design of Prodrugs,” ed. H. Bundgaard, Elsevier, 1985; and Bioreversible Carriers in Drug Design, ed. Edward B. Roche, American Pharmaceutical Association and Pergamon Press, 1987, each of which is incorporated herein by reference in whole.

[0069] 2.Compound Compounds that are inhibitors of SARM1 are provided herein. In certain embodiments, a compound of formula I: [ka] Or a pharmaceutically acceptable salt thereof, isotopically enriched analogues, stereoisomers, tautomers, or mixtures of stereoisomers are provided, in the formula, X 1 , X 2 , X 3 , and X 4 Each of these independently determines whether it is N or CR. 6 And, however, X 1 , X 2 , X 3 , and X 4 Two or fewer of these are N; m is 0, 1, 2, 3, 4, 5, 6, or 7; n is 0, 1, or 2; Ring A is C 3-10 A cycloalkyl, heterocyclyl, aryl, or heteroaryl, where each C 3-10 Cycloalkyl, heterocyclyl, aryl, or heteroaryl compounds are independently classified into 1 to 5 Z groups. 1 It is optionally replaced by; L is bond, C 1-4 Alkilen, C 2-4 Alkenylene, or C 2-4 It is alkynylene; R 1 These are hydrogen, halo, cyano, -NO2, and C. 1-6 Alkyl, C 2-6 Alkenil, C 2-6 Alkinyl, C 3-10 Cycloalkyl, heterocyclyl, aryl, heteroaryl, -N(R 11 )2, -OR 11 , -SR 11 , -C(O)R 11 , -C(O)OR 11 ,-S(O)R 11 -S(O)2R 11 ,-C(O)N(R 11 )2, -NR 11 C(O)R 11 , -NR 11 S(O)R 11 , -NR 11 S(O)2R 11 ,-S(O)N(R 11 )2, -S(O)2N(R11 )2, -NR 11 C(O)N(R 11 )2, -NR 11 S(O)N(R 11 )2, -NR 11 S(O)2N(R 11 )2, -OC(O)N(R 11 )2, or -NR 11 C(O)OR 11 And here, each C 1-6 Alkyl, C 2-6 Alkenil, C 2-6 Alkinyl, C 3-10 Cycloalkyl, heterocyclyl, aryl, or heteroaryl compounds are independently classified into 1 to 5 Z groups. 1 It is optionally replaced by; Each R 2 These are independently: halo, cyano, -NO2, C 1-6 Alkyl, C 2-6 Alkenil, C 2-6 Alkinyl, C 3-10 Cycloalkyl, heterocyclyl, aryl, heteroaryl, -N(R 11 )2, -OR 11 , -SR 11 , -C(O)R 11 , -C(O)OR 11 ,-S(O)R 11 -S(O)2R 11 ,-C(O)N(R 11 )2, -NR 11 C(O)R 11 , -NR 11 S(O)R 11 , -NR 11 S(O)2R 11 ,-S(O)N(R 11 )2, -S(O)2N(R 11 )2, -NR 11 C(O)N(R 11 )2, -NR 11 S(O)N(R 11 )2, -NR 11 S(O)2N(R 11 )2, -OC(O)N(R 11 )2, or -NR 11 C(O)OR 11 And here, C1-6 Alkyl, C 2-6 Alkenil, C 2-6 Alkinyl, C 3-10 Cycloalkyl, heterocyclyl, aryl, or heteroaryl compounds are independently classified into 1 to 5 Z groups. 1 It is optionally replaced by; Alternatively, two R's 2 But together, C 3-10 Forms a cycloalkyl or heterocycline, where C 3-10 Cycloalkyl or heterocyclyl molecules independently have 1 to 5 Z 1 It is optionally replaced by; R 4 These are hydrogen, halo, cyano, and C. 1-6 Alkyl, C 2-6 Alkenil, C 2-6 Alkinyl, C 3-10 Cycloalkyl, heterocyclyl, aryl, heteroaryl, -N(R 11 )2, -OR 11 , -SR 11 , -C(O)R 11 , -C(O)OR 11 ,-S(O)R 11 -S(O)2R 11 ,-C(O)N(R 11 )2, -NR 11 C(O)R 11 , -NR 11 S(O)R 11 , -NR 11 S(O)2R 11 ,-S(O)N(R 11 )2, -S(O)2N(R 11 )2, -NR 11 C(O)N(R 11 )2, -NR 11 S(O)N(R 11 )2, -NR 11 S(O)2N(R 11 )2, -OC(O)N(R 11 )2, or -NR 11 C(O)OR 11 And here, C 1-6 Alkyl, C 2-6 Alkenil, C 2-6 Alkinyl, C3-10 Cycloalkyl, heterocyclyl, aryl, or heteroaryl compounds are independently classified into 1 to 5 Z groups. 1 It is optionally replaced by; R 5 These are hydrogen, halo, cyano, and C. 1-6 Alkyl, C 2-6 Alkenil, C 2-6 Alkinyl, C 3-10 Cycloalkyl, heterocyclyl, aryl, heteroaryl, -N(R 11 )2, -OR 11 , -SR 11 , -C(O)R 11 , -C(O)OR 11 ,-S(O)R 11 -S(O)2R 11 ,-C(O)N(R 11 )2, -NR 11 C(O)R 11 , -NR 11 S(O)R 11 , -NR 11 S(O)2R 11 ,-S(O)N(R 11 )2, -S(O)2N(R 11 )2, -NR 11 C(O)N(R 11 )2, -NR 11 S(O)N(R 11 )2, -NR 11 S(O)2N(R 11 )2, -OC(O)N(R 11 )2, or -NR 11 C(O)OR 11 And here, C 1-6 Alkyl, C 2-6 Alkenil, C 2-6 Alkinyl, C 3-10 Cycloalkyl, heterocyclyl, aryl, or heteroaryl compounds are independently classified into 1 to 5 Z groups. 1 It is optionally replaced by; Each R 6 These are independently hydrogen, halo, cyano, -NO2, and C. 1-6 Alkyl, C 2-6 Alkenil, C 2-6 Alkinyl, C 3-10Cycloalkyl, heterocyclyl, aryl, heteroaryl, -N(R 11 )2, -OR 11 , -SR 11 , -C(O)R 11 , -C(O)OR 11 ,-S(O)R 11 -S(O)2R 11 ,-C(O)N(R 11 )2, -NR 11 C(O)R 11 , -NR 11 S(O)R 11 , -NR 11 S(O)2R 11 ,-S(O)N(R 11 )2, -S(O)2N(R 11 )2, -NR 11 C(O)N(R 11 )2, -NR 11 S(O)N(R 11 )2, -NR 11 S(O)2N(R 11 )2, -OC(O)N(R 11 )2, or -NR 11 C(O)OR 11 And here, each C 1-6 Alkyl, C 2-6 Alkenil, C 2-6 Alkinyl, C 3-10 Cycloalkyl, heterocyclyl, aryl, or heteroaryl compounds are independently classified into 1 to 5 Z groups. 1 It is optionally replaced by; Each R 11 These are, independently, hydrogen and C 1-6 Alkyl, C 2-6 Alkenil, C 2-6 Alkinyl, C 3-10 A cycloalkyl, heterocyclyl, aryl, or heteroaryl, where each C 1-6 Alkyl, C 2-6 Alkenil, C 2-6 Alkinyl, C 3-10 Cycloalkyl, heterocyclyl, aryl, or heteroaryl compounds are independently classified into 1 to 5 Z groups. 1a It is optionally replaced by; each Z 1These are independently: halo, cyano, -NO2, C 1-6 Alkyl, C 2-6 Alkenil, C 2-6 Alkinyl, C 1-6 Haloalkyl, C 3-10 Cycloalkyl, heterocyclyl, aryl, heteroaryl, -N(R 12 )2, -OR 12 , -SR 12 , -C(O)R 12 , -C(O)OR 12 ,-S(O)R 12 -S(O)2R 12 ,-C(O)N(R 12 )2, -NR 12 C(O)R 12 , -NR 12 S(O)R 12 , -NR 12 S(O)2R 12 ,-S(O)N(R 12 )2, -S(O)2N(R 12 )2, -NR 12 C(O)N(R 12 )2, -NR 12 S(O)N(R 12 )2, -NR 12 S(O)2N(R 12 )2, -OC(O)N(R 12 )2, or -NR 12 C(O)OR 12 And here, each C 1-6 Alkyl, C 2-6 Alkenil, C 2-6 Alkinyl, C 1-6 Haloalkyl, C 3-10 Cycloalkyl, heterocyclyl, aryl, or heteroaryl compounds are independently classified into 1 to 5 Z groups. 1a It is optionally replaced by; Each R 12 These are, independently, hydrogen and C 1-6 Alkyl, C 2-6 Alkenil, C 2-6 Alkinyl, C 3-10 A cycloalkyl, heterocyclyl, aryl, or heteroaryl, where each C 1-6 Alkyl, C 2-6 Alkenil, C2-6 Alkinyl, C 3-10 Cycloalkyl, heterocyclyl, aryl, or heteroaryl compounds are independently classified into 1 to 5 Z groups. 1b It is optionally replaced by; each Z 1a These are independently: halo, cyano, -NO2, C 1-6 Alkyl, C 2-6 Alkenil, C 2-6 Alkinyl, C 3-10 Cycloalkyl, heterocyclyl, aryl, heteroaryl, -N(R 13 )2, -OR 13 , -SR 13 , -C(O)R 13 , -C(O)OR 13 ,-S(O)R 13 -S(O)2R 13 ,-C(O)N(R 13 )2, -NR 13 C(O)R 13 , -NR 13 S(O)R 13 , -NR 13 S(O)2R 13 ,-S(O)N(R 13 )2, -S(O)2N(R 13 )2, -NR 13 C(O)N(R 13 )2, -NR 13 S(O)N(R 13 )2, -NR 13 S(O)2N(R 13 )2, -OC(O)N(R 13 )2, or -NR 13 C(O)OR 13 And here, each C 1-6 Alkyl, C 2-6 Alkenil, C 2-6 Alkinyl, C 3-10 Cycloalkyl, heterocyclyl, aryl, or heteroaryl compounds are independently classified into 1 to 5 Z groups. 1b It is optionally replaced by; Each R 13 These are, independently, hydrogen and C 1-6 Alkyl, C 2-6 Alkenil, C 2-6 Alkinyl, C 3-10A cycloalkyl, heterocyclyl, aryl, or heteroaryl, where each C 1-6 Alkyl, C 2-6 Alkenil, C 2-6 Alkinyl, C 3-10 Cycloalkyl, heterocyclyl, aryl, or heteroaryl compounds are independently classified into 1 to 5 Z groups. 1b It is optionally replaced by; each Z 1b These are independently: halo, cyano, -OH, -SH, -NH2, -NO2, C 1-6 Alkyl, C 1-6 Haloalkyl, C 2-6 Alkenil, C 2-6 Alkinyl, C 3-10 Cycloalkyl, heterocyclyl, aryl, heteroaryl, -L 1 -C 1-6 Alkyl, -L 1 -C 2-6 Alkenyl, -L 1 -C 2-6 Alkinyl, -L 1 -C 1-6 Haloalkyl, -L 1 -C 3-10 Cycloalkyl, -L 1 -heterocyclyl, -L 1 -aryl, or -L 1 - is heteroaryl; and Each L 1 These are independently -O-, -NH-, -S-, -S(O)-, -S(O)2-, and -N(C 1-6 Alkyl)-,-N(C 2-6 Alkenyl)-, -N(C 2-6 Alkinyl)-, -N(C 1-6 Haloalkyl)-,-N(C) 3-10 Cycloalkyl)-, -N(heterocyclyl)-, -N(aryl)-, -N(heteroaryl)-, -C(O)-, -C(O)O-, -C(O)NH-, -C(O)N(C 1-6 Alkyl)-,-C(O)N(C 2-6 Alkenyl)-,-C(O)N(C 2-6 Alkinyl)-,-C(O)N(C 1-6 Haloalkyl)-,-C(O)N(C3-10 These are cycloalkyl)-, -C(O)N(heterocyclyl)-, -C(O)N(aryl)-, -C(O)N(heteroaryl)-, -NHC(O)-, -NHC(O)O-, -NHC(O)NH-, -NHS(O)-, or -S(O)2NH-; Here, Z 1b Each C 1-6 Alkyl, C 2-6 Alkenil, C 2-6 Alkinyl, C 1-6 Haloalkyl, C 3-10 Cycloalkyl, heterocyclyl, aryl, and heteroaryl, as well as L 1 Furthermore, independently, 1 to 5 halos, cyanos, -OH, -SH, -NH2, -NO2, -SF5, C 1-6 Alkyl, C 2-6 Alkenil, C 2-6 Alkinyl, C 1-6 Haloalkyl, C 1-6 Alkoxy, C 1-6 Haloalkoxy, C 3-10 It may be optionally substituted with a cycloalkyl, heterocyclyl, aryl, or heteroaryl compound.

[0070] In a particular embodiment, the compound of formula I: [ka] Or a pharmaceutically acceptable salt thereof, isotopically enriched analogues, stereoisomers, tautomers, or mixtures of stereoisomers are provided, in the formula, X 1 , X 2 , X 3 , and X 4 Each of these independently determines whether it is N or CR. 6 And, however, X 1 , X 2 , X 3 , and X 4 Two or fewer of these are N; m is 0, 1, 2, 3, 4, 5, 6, or 7; n is 0, 1, or 2; Ring A is C 3-10A cycloalkyl, heterocyclyl, aryl, or heteroaryl, where each C 3-10 Cycloalkyl, heterocyclyl, aryl, or heteroaryl compounds are independently classified into 1 to 5 Z groups. 1 It is optionally replaced by; L is bond, C 1-4 Alkilen, C 2-4 Alkenylene, or C 2-4 It is alkynylene; R 1 These are hydrogen, halo, cyano, -NO2, and C. 1-6 Alkyl, C 2-6 Alkenil, C 2-6 Alkinyl, C 3-10 Cycloalkyl, heterocyclyl, aryl, heteroaryl, -N(R 11 )2, -OR 11 , -SR 11 , -C(O)R 11 , -C(O)OR 11 ,-S(O)R 11 -S(O)2R 11 ,-C(O)N(R 11 )2, -NR 11 C(O)R 11 , -NR 11 S(O)R 11 , -NR 11 S(O)2R 11 ,-S(O)N(R 11 )2, -S(O)2N(R 11 )2, -NR 11 C(O)N(R 11 )2, -NR 11 S(O)N(R 11 )2, -NR 11 S(O)2N(R 11 )2, -OC(O)N(R 11 )2, or -NR 11 C(O)OR 11 And here, each C 1-6 Alkyl, C 2-6 Alkenil, C 2-6 Alkinyl, C 3-10 Cycloalkyl, heterocyclyl, aryl, or heteroaryl compounds are independently classified into 1 to 5 Z groups. 1 It is optionally replaced by; Each R 2 These are independently: halo, cyano, -NO2, C 1-6 Alkyl, C 2-6 Alkenil, C 2-6 Alkinyl, C 3-10 Cycloalkyl, heterocyclyl, aryl, heteroaryl, -N(R 11 )2, -OR 11 , -SR 11 , -C(O)R 11 , -C(O)OR 11 ,-S(O)R 11 -S(O)2R 11 ,-C(O)N(R 11 )2, -NR 11 C(O)R 11 , -NR 11 S(O)R 11 , -NR 11 S(O)2R 11 ,-S(O)N(R 11 )2, -S(O)2N(R 11 )2, -NR 11 C(O)N(R 11 )2, -NR 11 S(O)N(R 11 )2, -NR 11 S(O)2N(R 11 )2, -OC(O)N(R 11 )2, or -NR 11 C(O)OR 11 And here, C 1-6 Alkyl, C 2-6 Alkenil, C 2-6 Alkinyl, C 3-10 Cycloalkyl, heterocyclyl, aryl, or heteroaryl compounds are independently classified into 1 to 5 Z groups. 1 It is optionally replaced by; Alternatively, two R's 2 But together, C 3-10 Forms a cycloalkyl or heterocycline, where C 3-10 Cycloalkyl or heterocyclyl molecules independently have 1 to 5 Z 1 It is optionally replaced by; R 4 These are hydrogen, halo, cyano, and C. 1-6 Alkyl, C2-6 Alkenil, C 2-6 Alkinyl, C 3-10 Cycloalkyl, heterocyclyl, aryl, heteroaryl, -N(R 11 )2, -OR 11 , -SR 11 , -C(O)R 11 , -C(O)OR 11 ,-S(O)R 11 -S(O)2R 11 ,-C(O)N(R 11 )2, -NR 11 C(O)R 11 , -NR 11 S(O)R 11 , -NR 11 S(O)2R 11 ,-S(O)N(R 11 )2, -S(O)2N(R 11 )2, -NR 11 C(O)N(R 11 )2, -NR 11 S(O)N(R 11 )2, -NR 11 S(O)2N(R 11 )2, -OC(O)N(R 11 )2, or -NR 11 C(O)OR 11 And here, C 1-6 Alkyl, C 2-6 Alkenil, C 2-6 Alkinyl, C 3-10 Cycloalkyl, heterocyclyl, aryl, or heteroaryl compounds are independently classified into 1 to 5 Z groups. 1 It is optionally replaced by; R 5 These are hydrogen, halo, cyano, and C. 1-6 Alkyl, C 2-6 Alkenil, C 2-6 Alkinyl, C 3-10 Cycloalkyl, heterocyclyl, aryl, heteroaryl, -N(R 11 )2, -OR 11 , -SR 11 , -C(O)R 11 , -C(O)OR 11 ,-S(O)R 11 -S(O)2R 11,-C(O)N(R 11 )2, -NR 11 C(O)R 11 , -NR 11 S(O)R 11 , -NR 11 S(O)2R 11 ,-S(O)N(R 11 )2, -S(O)2N(R 11 )2, -NR 11 C(O)N(R 11 )2, -NR 11 S(O)N(R 11 )2, -NR 11 S(O)2N(R 11 )2, -OC(O)N(R 11 )2, or -NR 11 C(O)OR 11 And here, C 1-6 Alkyl, C 2-6 Alkenil, C 2-6 Alkinyl, C 3-10 Cycloalkyl, heterocyclyl, aryl, or heteroaryl compounds are independently classified into 1 to 5 Z groups. 1 It is optionally replaced by; Each R 6 These are independently hydrogen, halo, cyano, -NO2, and C. 1-6 Alkyl, C 2-6 Alkenil, C 2-6 Alkinyl, C 3-10 Cycloalkyl, heterocyclyl, aryl, heteroaryl, -N(R 11 )2, -OR 11 , -SR 11 , -C(O)R 11 , -C(O)OR 11 ,-S(O)R 11 -S(O)2R 11 ,-C(O)N(R 11 )2, -NR 11 C(O)R 11 , -NR 11 S(O)R 11 , -NR 11 S(O)2R 11 ,-S(O)N(R 11 )2, -S(O)2N(R 11 )2, -NR 11 C(O)N(R11 )2, -NR 11 S(O)N(R 11 )2, -NR 11 S(O)2N(R 11 )2, -OC(O)N(R 11 )2, or -NR 11 C(O)OR 11 And here, each C 1-6 Alkyl, C 2-6 Alkenil, C 2-6 Alkinyl, C 3-10 Cycloalkyl, heterocyclyl, aryl, or heteroaryl compounds are independently classified into 1 to 5 Z groups. 1 It is optionally replaced by; Each R 11 These are, independently, hydrogen and C 1-6 Alkyl, C 2-6 Alkenil, C 2-6 Alkinyl, C 3-10 A cycloalkyl, heterocyclyl, aryl, or heteroaryl, where each C 1-6 Alkyl, C 2-6 Alkenil, C 2-6 Alkinyl, C 3-10 Cycloalkyl, heterocyclyl, aryl, or heteroaryl compounds are independently classified into 1 to 5 Z groups. 1a It is optionally replaced by; each Z 1 These are independently: halo, cyano, -NO2, C 1-6 Alkyl, C 2-6 Alkenil, C 2-6 Alkinyl, C 1-6 Haloalkyl, C 3-10 Cycloalkyl, heterocyclyl, aryl, heteroaryl, -N(R 12 )2, -OR 12 , -SR 12 , -C(O)R 12 , -C(O)OR 12 ,-S(O)R 12 -S(O)2R 12 ,-C(O)N(R 12 )2, -NR 12 C(O)R 12 , -NR 12 S(O)R 12 , -NR12 S(O)2R 12 ,-S(O)N(R 12 )2, -S(O)2N(R 12 )2, -NR 12 C(O)N(R 12 )2, -NR 12 S(O)N(R 12 )2, -NR 12 S(O)2N(R 12 )2, -OC(O)N(R 12 )2, or -NR 12 C(O)OR 12 And here, each C 1-6 Alkyl, C 2-6 Alkenil, C 2-6 Alkinyl, C 1-6 Haloalkyl, C 3-10 Cycloalkyl, heterocyclyl, aryl, or heteroaryl compounds are independently classified into 1 to 5 Z groups. 1a It is optionally replaced by; Each R 12 These are, independently, hydrogen and C 1-6 Alkyl, C 2-6 Alkenil, C 2-6 Alkinyl, C 3-10 A cycloalkyl, heterocyclyl, aryl, or heteroaryl, where each C 1-6 Alkyl, C 2-6 Alkenil, C 2-6 Alkinyl, C 3-10 Cycloalkyl, heterocyclyl, aryl, or heteroaryl compounds are independently classified into 1 to 5 Z groups. 1a It is optionally replaced by; each Z 1a These are independently: halo, cyano, -OH, -SH, -NH2, -NO2, -SF5, C 1-6 Alkyl, C 2-6 Alkenil, C 2-6 Alkinyl, C 1-6 Haloalkyl, C 1-6 Alkoxy, C 1-6 Haloalkoxy, C 3-10 It is a cycloalkyl, heterocyclyl, aryl, or heteroaryl compound.

[0071] In a particular embodiment, X 1 It is N.

[0072] In a particular embodiment, X 2 , X 3 , and X 4 CR 6 That is the case.

[0073] In a particular embodiment, X 2 It is N.

[0074] In a particular embodiment, X 1 , X 3 , and X 4 CR 6 That is the case.

[0075] In a particular embodiment, X 3 It is N.

[0076] In a particular embodiment, X 1 , X 2 , and X 4 CR 6 That is the case.

[0077] In a particular embodiment, X 1 is N and X 2 and X 4 CR 6 That is the case.

[0078] In a particular embodiment, X 4 It is N.

[0079] In a particular embodiment, X 1 , X 2 , and X 3 CR 6 That is the case.

[0080] In a particular embodiment, X 1 and X 3 It is N.

[0081] In a particular embodiment, X 2 and X 4 CR6 That is the case.

[0082] In a particular embodiment, X 1 and X 4 It is N.

[0083] In a particular embodiment, X 2 and X 3 CR 6 That is the case.

[0084] In a particular embodiment, X 2 and X 4 It is N.

[0085] In a particular embodiment, X 1 and X 3 CR 6 That is the case.

[0086] In a particular embodiment, X 3 and X 4 It is N.

[0087] In a particular embodiment, X 1 and X 2 CR 6 That is the case.

[0088] In a particular embodiment, X 1 is N and X 2 and X 3 CR 6 That is the case.

[0089] In a particular embodiment, X 2 is N and X 1 and X 3 CR 6 That is the case.

[0090] In a particular embodiment, X 3 is N and X 1 and X 2 CR 6 That is the case.

[0091] In certain embodiments, L is a bond or -CH2-.

[0092] In certain embodiments, partial [ka] teeth, [ka] That is the case.

[0093] In a specific method of operation, each R 6 These are independently hydrogen or a halo.

[0094] In a specific method of operation, each R 6 These are independently hydrogen, halo, cyano, and C. 1-6 Alkyl, C 1-6 Haloalkyl, C 3-10 Cycloalkyl, -OC 1-6 Alkyl, or -OC 1-6 It is a haloalkyl group.

[0095] In a specific method of operation, each R 6 These are independently hydrogen, halo, cyano, and C. 1-6 Alkyl, C 1-6 Haloalkyl, C 3-10 Cycloalkyl, or -OC 1-6 It is alkyl.

[0096] In a specific method of operation, each R 6 These are independently hydrogen, fluoro, chloro, cyano, methyl, ethyl, trifluoromethyl, cyclopropyl, methoxy, 2-methoxyethoxymethyl, fluoromethoxy, or difluoromethoxy.

[0097] In a specific method of operation, each R 6 These are independently hydrogen, fluoro, chloro, cyano, methyl, ethyl, trifluoromethyl, cyclopropyl, or methoxy.

[0098] In a specific method of operation, each R6 These are independently hydrogen, fluoro, cyano, methyl, trifluoromethyl, cyclopropyl, or methoxy.

[0099] In a specific method of operation, each R 6 These are independently hydrogen, halo, cyano, hydroxy, or -OC. 1-6 It is alkyl.

[0100] In a specific method of operation, each R 6 These are independently hydrogen, halo, cyano, hydroxy, or methoxy.

[0101] In a specific method of operation, each R 6 These are independently hydrogen, fluoro, chloro, cyano, hydroxy, or methoxy.

[0102] In a specific method of operation, each R 6 These are independently hydrogen, halo, cyano, or -OC. 1-6 It is alkyl.

[0103] In a particular embodiment, R 6 It is not hydroxyl.

[0104] In a particular embodiment, R 6 If it is a hydroxyl group, then that hydroxyl group is either not at the α-position of the N ring or X 1 ~X 4 One or two of them are N.

[0105] In a specific method of operation, each R 6 These are independently hydrogen, halo, cyano, hydroxy, or -OC. 1-6 It is alkyl, however, R 6 If it is a hydroxyl group, then that hydroxyl group is either not at the α-position of the N ring or X 1 ~X 4 One or two of them are N.

[0106] In certain embodiments, partial [ka] teeth, [ka] That is the case.

[0107] In certain embodiments, partial [ka] teeth, [ka] That is the case.

[0108] In certain embodiments, partial [ka] teeth, [ka] That is the case.

[0109] In a specific method of operation, each R 2 Independently, C 1-6 Alkyl or C 3-10 It is a cycloalkyl, where each C 1-6 Alkyl or C 3-10 Cycloalkyl groups independently have 1 to 5 Z 1 It can be arbitrarily replaced with.

[0110] In a specific method of operation, each R 2 Independently, C 1-6 It is alkyl. In a particular embodiment, each R 2 C is replaced by 1 to 3 halos. 1-6 It is alkyl. In a particular embodiment, each R 2 C is a C substituted with 1 to 3 fluorocarbons. 1-6 It is alkyl.

[0111] In a specific method of operation, each R 2 Independently, C 3-10It is a cycloalkyl group.

[0112] In certain embodiments, m is 0 or 1.

[0113] In certain embodiments, m is 0 or 1, and R 2 These are methyl, ethyl, cyclopropyl, or trifluoromethyl.

[0114] In certain embodiments, m is 0 or 1, and R 2 It is methyl.

[0115] In certain embodiments, m is 0 or 1, and R 2 It is ethyl.

[0116] In certain embodiments, m is 0 or 1, and R 2 It is trifluoromethyl.

[0117] In certain embodiments, m is 0 or 1, and R 2 It is cyclopropyl.

[0118] In certain embodiments, n is 1 or 2.

[0119] In certain embodiments, ring A has 1 to 5 Z 1 It is a heteroaryl compound that has been arbitrarily substituted with [the specified compound].

[0120] In a particular embodiment, each Z 1 Independently, cyano, C 1-6 Alkyl, C 1-6 Haloalkyl, C 3-10 Cycloalkyl, or -N(R 12 )2.

[0121] In a specific method of operation, each R 12 It is hydrogen.

[0122] In certain embodiments, ring A has 1 to 5 Z 1It is a heteroaryl compound that has been arbitrarily substituted with [the specified compound].

[0123] In certain embodiments, ring A is cyano, C 1-6 Alkyl, C 1-6 Haloalkyl, C 3-10 Cycloalkyl, or -N(R 12 It is a heteroaryl compound that is arbitrarily substituted with )2.

[0124] In certain embodiments, ring A is cyano, C 1-6 Alkyl, C 1-6 Haloalkyl, C 3-10 It is a cycloalkyl or a heteroaryl optionally substituted with -NH2.

[0125] In certain embodiments, ring A has 1 to 5 Z 1 It is a heterocycline that has been arbitrarily substituted with .

[0126] In a particular embodiment, R 4 is hydrogen, halo, cyano, or C 1-6 It is alkyl.

[0127] In a particular embodiment, R 4 These are hydrogen, fluoro, chloro, bromo, cyano, or methyl.

[0128] In a particular embodiment, R 4 It is hydrogen.

[0129] In a particular embodiment, R 5 This is hydrogen or a halo.

[0130] In a particular embodiment, R 4 is hydrogen, and R 5 This is hydrogen or a halo.

[0131] In a particular embodiment, R 5 These are hydrogen, fluoro, or chloro.

[0132] In a particular embodiment, R5 is hydrogen or fluoro.

[0133] In certain embodiments, R 4 and R 5 are hydrogen.

[0134] In certain embodiments, L is a bond or C 1-4 alkylene.

[0135] In certain embodiments, R 1 is C 1 alkyl optionally substituted with 1 to 5 Z 1-6 groups.

[0136] In certain embodiments, each Z 1 is independently halo.

[0137] In certain embodiments, R 1 is C 1-6 alkyl or C 1-6 haloalkyl.

[0138] In certain embodiments, R 1 is halo, cyano, C 1-6 alkyl, C 3-10 cycloalkyl, aryl, or -OR 11 where C 1-6 alkyl, C 3-10 cycloalkyl, or aryl is optionally substituted with 1 to 5 Z 1 groups.

[0139] In certain embodiments, R 1 is halo, cyano, C 1-6 alkyl, C 3-10 cycloalkyl, aryl, or -OR 11 where C 1-6 alkyl or C 3-10 cycloalkyl is optionally substituted with 1 to 5 Z 1 groups.

[0140] In certain embodiments, R 1These are fluoro, chloro, bromo, cyano, methyl, ethyl, isopropyl, -CH2F, -CHF2, -CF3, -CH2CN, -OCF3, cyclopropyl optionally substituted with methyl, or phenyl.

[0141] In a particular embodiment, R 1 These are fluoro, chloro, cyano, methyl, ethyl, -CF3, -CH2CN, -OCF3, or cyclopropyl.

[0142] In a particular embodiment, R 1 The compounds are fluoro, chloro, cyano, methyl, ethyl, isopropyl, -CHF2, -CF3, -CH2CN, -OCF3, cyclopropyl optionally substituted with methyl, or phenyl.

[0143] In a particular embodiment, each Z 1 These are independently: halo, cyano, and C. 1-6 Alkyl, C 1-6 Haloalkyl, heteroaryl, -OR 12 , or -C(O)OR 12 And here, each C 1-6 Alkyl, C 1-6 Haloalkyl and heteroaryl groups can be independently and optionally substituted with 1 to 5 hydroxy, methoxy, or methyl groups.

[0144] In a particular embodiment, each Z 1 These are independently: halo, cyano, and C. 1-6 Alkyl, C 1-6 Haloalkyl, heteroaryl, C 1-6 Alkoxy, or -C(O)OC 1-6 It is alkyl, where each C 1-6 Alkyl, C 1-6 Haloalkyl and heteroaryl groups can be independently and optionally substituted with 1 to 5 hydroxy, methoxy, or methyl groups.

[0145] In a particular embodiment, each Z 1 These are independently: halo, cyano, and C. 1-6 Alkyl, C1-6 Haloalkyl, C 3-10 Cycloalkyl, or -N(R 12 )2. In a particular embodiment, each R 12 These are, independently, hydrogen, or C 1-6 It is alkyl.

[0146] In a particular embodiment, the compound of formula I: [ka] Or a pharmaceutically acceptable salt thereof, isotopically enriched analogues, stereoisomers, tautomers, or mixtures of stereoisomers are provided, in the formula, X 1 , X 2 , X 3 , and X 4 Each of these independently determines whether it is N or CR. 6 And, however, X 1 , X 2 , X 3 , and X 4 Two or fewer of these are N; m is 0, 1, 2, 3, 4, 5, 6, or 7; n is 0, 1, or 2; Ring A is C 3-10 A cycloalkyl, heterocyclyl, aryl, or heteroaryl, where each C 3-10 Cycloalkyl, heterocyclyl, aryl, or heteroaryl compounds are independently classified into 1 to 5 Z groups. 1 It is optionally replaced by; L is bond, C 1-4 Alkilen, C 2-4 Alkenylene, or C 2-4 It is alkynylene; R 1 These are hydrogen, halo, cyano, -NO2, and C. 1-6 Alkyl, C 2-6 Alkenil, C 2-6 Alkinyl, C 3-10 Cycloalkyl, heterocyclyl, aryl, heteroaryl, -N(R 11 )2, -OR 11 , -SR 11, -C(O)R 11 , -C(O)OR 11 , -S(O)R 11 , -S(O)2R 11 , -C(O)N(R 11 )2, -NR 11 C(O)R 11 , -NR 11 S(O)R 11 , -NR 11 S(O)2R 11 , -S(O)N(R 11 )2, -S(O)2N(R 11 )2, -NR 11 C(O)N(R 11 )2, -NR 11 S(O)N(R 11 )2, -NR 11 S(O)2N(R 11 )2, -OC(O)N(R 11 )2, or -NR 11 C(O)OR 11 where each C 1-6 alkyl, C 2-6 alkenyl, C 2-6 alkynyl, C 3-10 cycloalkyl, heterocyclyl, aryl, or heteroaryl is independently optionally substituted with 1 to 5 Z 1 ; each R 2 is independently halo, cyano, -NO2, C 1-6 alkyl, C 2-6 alkenyl, C 2-6 alkynyl, C 3-10 cycloalkyl, heterocyclyl, aryl, heteroaryl, -N(R 11 )2, -OR 11 , -SR 11 , -C(O)R 11 , -C(O)OR 11 , -S(O)R 11 , -S(O)2R 11 , -C(O)N(R 11 )2, -NR 11 C(O)R 11 , -NR 11 S(O)R 11 , -NR 11 S(O)2R11 ,-S(O)N(R 11 )2, -S(O)2N(R 11 )2, -NR 11 C(O)N(R 11 )2, -NR 11 S(O)N(R 11 )2, -NR 11 S(O)2N(R 11 )2, -OC(O)N(R 11 )2, or -NR 11 C(O)OR 11 And here, C 1-6 Alkyl, C 2-6 Alkenil, C 2-6 Alkinyl, C 3-10 Cycloalkyl, heterocyclyl, aryl, or heteroaryl compounds are independently classified into 1 to 5 Z groups. 1 It is optionally replaced by; Alternatively, two R's 2 But together, C 3-10 Forms a cycloalkyl or heterocycline, where C 3-10 Cycloalkyl or heterocyclyl molecules independently have 1 to 5 Z 1 It is optionally replaced by; R 4 These are hydrogen, halo, cyano, and C. 1-6 Alkyl, C 2-6 Alkenil, C 2-6 Alkinyl, C 3-10 Cycloalkyl, heterocyclyl, aryl, heteroaryl, -N(R 11 )2, -OR 11 , -SR 11 , -C(O)R 11 , -C(O)OR 11 ,-S(O)R 11 -S(O)2R 11 ,-C(O)N(R 11 )2, -NR 11 C(O)R 11 , -NR 11 S(O)R 11 , -NR 11 S(O)2R 11 ,-S(O)N(R 11 )2, -S(O)2N(R 11 )2, -NR11 C(O)N(R 11 )2, -NR 11 S(O)N(R 11 )2, -NR 11 S(O)2N(R 11 )2, -OC(O)N(R 11 )2, or -NR 11 C(O)OR 11 And here, C 1-6 Alkyl, C 2-6 Alkenil, C 2-6 Alkinyl, C 3-10 Cycloalkyl, heterocyclyl, aryl, or heteroaryl compounds are independently classified into 1 to 5 Z groups. 1 It is optionally replaced by; R 5 These are hydrogen, halo, cyano, and C. 1-6 Alkyl, C 2-6 Alkenil, C 2-6 Alkinyl, C 3-10 Cycloalkyl, heterocyclyl, aryl, heteroaryl, -N(R 11 )2, -OR 11 , -SR 11 , -C(O)R 11 , -C(O)OR 11 ,-S(O)R 11 -S(O)2R 11 ,-C(O)N(R 11 )2, -NR 11 C(O)R 11 , -NR 11 S(O)R 11 , -NR 11 S(O)2R 11 ,-S(O)N(R 11 )2, -S(O)2N(R 11 )2, -NR 11 C(O)N(R 11 )2, -NR 11 S(O)N(R 11 )2, -NR 11 S(O)2N(R 11 )2, -OC(O)N(R 11 )2, or -NR 11 C(O)OR 11 And here, C 1-6 Alkyl, C 2-6Alkenil, C 2-6 Alkinyl, C 3-10 Cycloalkyl, heterocyclyl, aryl, or heteroaryl compounds are independently classified into 1 to 5 Z groups. 1 It is optionally replaced by; Each R 6 These are independently hydrogen, halo, cyano, -NO2, and C. 1-6 Alkyl, C 2-6 Alkenil, C 2-6 Alkinyl, C 3-10 Cycloalkyl, heterocyclyl, aryl, heteroaryl, -N(R 11 )2, -OR 11 , -SR 11 , -C(O)R 11 , -C(O)OR 11 ,-S(O)R 11 -S(O)2R 11 ,-C(O)N(R 11 )2, -NR 11 C(O)R 11 , -NR 11 S(O)R 11 , -NR 11 S(O)2R 11 ,-S(O)N(R 11 )2, -S(O)2N(R 11 )2, -NR 11 C(O)N(R 11 )2, -NR 11 S(O)N(R 11 )2, -NR 11 S(O)2N(R 11 )2, -OC(O)N(R 11 )2, or -NR 11 C(O)OR 11 And here, each C 1-6 Alkyl, C 2-6 Alkenil, C 2-6 Alkinyl, C 3-10 Cycloalkyl, heterocyclyl, aryl, or heteroaryl compounds are independently classified into 1 to 5 Z groups. 1 It is optionally replaced by; Each R 11 These are, independently, hydrogen and C 1-6 Alkyl, C 2-6 Alkenil, C 2-6Alkinyl, C 3-10 A cycloalkyl, heterocyclyl, aryl, or heteroaryl, where each C 1-6 Alkyl, C 2-6 Alkenil, C 2-6 Alkinyl, C 3-10 Cycloalkyl, heterocyclyl, aryl, or heteroaryl compounds are independently classified into 1 to 5 Z groups. 1a It is optionally replaced by; each Z 1 These are independently: halo, cyano, -NO2, C 1-6 Alkyl, C 2-6 Alkenil, C 2-6 Alkinyl, C 1-6 Haloalkyl, C 3-10 Cycloalkyl, heterocyclyl, aryl, heteroaryl, -N(R 12 )2, -OR 12 , -SR 12 , -C(O)R 12 , -C(O)OR 12 ,-S(O)R 12 -S(O)2R 12 ,-C(O)N(R 12 )2, -NR 12 C(O)R 12 , -NR 12 S(O)R 12 , -NR 12 S(O)2R 12 ,-S(O)N(R 12 )2, -S(O)2N(R 12 )2, -NR 12 C(O)N(R 12 )2, -NR 12 S(O)N(R 12 )2, -NR 12 S(O)2N(R 12 )2, -OC(O)N(R 12 )2, or -NR 12 C(O)OR 12 and Each R 12 These are, independently, hydrogen and C 1-6 Alkyl, C 2-6 Alkenil, C 2-6 Alkinyl, C 1-6 Haloalkyl, C3-10 It is a cycloalkyl, heterocyclyl, aryl, or heteroaryl compound.

[0147] In a particular embodiment, the compound of formula I: [ka] Or a pharmaceutically acceptable salt thereof, isotopically enriched analogues, stereoisomers, tautomers, or mixtures of stereoisomers are provided, in the formula, X 1 , X 2 , X 3 , and X 4 Each of these independently determines whether it is N or CR. 6 And, however, X 1 , X 2 , X 3 , and X 4 Two or fewer of these are N; m is either 0 or 1; n is 0, 1, or 2; Ring A is a heterocyclyl or heteroaryl, where each heterocyclyl or heteroaryl independently has 1 to 5 Z 1 It is optionally replaced by; L is a combination or C 1-4 It is alkylene; R 1 is Halo, Cyano, C 1-6 Alkyl, or C 1-6 It is a haloalkyl; R 2 These are 1 to 5 Z 1 C arbitrarily substituted with 1-6 It is alkyl; Alternatively, two R's 2 But together, C 3-10 Forms a cycloalkyl or heterocycline, where C 3-10 Cycloalkyl or heterocyclyl molecules independently have 1 to 5 Z 1 It is optionally replaced by; R 4 is hydrogen; R 5 is hydrogen or halo; Each R 6 These are independently hydrogen, halo, cyano, -NO2, and C. 1-6 Alkyl, C 2-6 Alkenil, C 2-6 Alkinyl, C 3-10 Cycloalkyl, heterocyclyl, aryl, heteroaryl, -N(R 11 )2, -OR 11 , -SR 11 , -C(O)R 11 , -C(O)OR 11 ,-S(O)R 11 -S(O)2R 11 ,-C(O)N(R 11 )2, -NR 11 C(O)R 11 , -NR 11 S(O)R 11 , -NR 11 S(O)2R 11 ,-S(O)N(R 11 )2, -S(O)2N(R 11 )2, -NR 11 C(O)N(R 11 )2, -NR 11 S(O)N(R 11 )2, -NR 11 S(O)2N(R 11 )2, -OC(O)N(R 11 )2, or -NR 11 C(O)OR 11 And here, each C 1-6 Alkyl, C 2-6 Alkenil, C 2-6 Alkinyl, C 3-10 Cycloalkyl, heterocyclyl, aryl, or heteroaryl compounds are independently classified into 1 to 5 Z groups. 1 It is optionally replaced by; Each R 11 These are, independently, hydrogen and C 1-6 Alkyl, C 2-6 Alkenil, C 2-6 Alkinyl, C 1-6 Haloalkyl, C 3-10 It is a cycloalkyl, heterocyclyl, aryl, or heteroaryl; each Z 1These are independently: halo, cyano, -NO2, C 1-6 Alkyl, C 2-6 Alkenil, C 2-6 Alkinyl, C 1-6 Haloalkyl, C 3-10 Cycloalkyl, heterocyclyl, aryl, heteroaryl, -N(R 12 )2, -OR 12 , -SR 12 , -C(O)R 12 , -C(O)OR 12 ,-S(O)R 12 -S(O)2R 12 ,-C(O)N(R 12 )2, -NR 12 C(O)R 12 , -NR 12 S(O)R 12 , -NR 12 S(O)2R 12 ,-S(O)N(R 12 )2, -S(O)2N(R 12 )2, -NR 12 C(O)N(R 12 )2, -NR 12 S(O)N(R 12 )2, -NR 12 S(O)2N(R 12 )2, -OC(O)N(R 12 )2, or -NR 12 C(O)OR 12 and Each R 12 These are, independently, hydrogen and C 1-6 Alkyl, C 2-6 Alkenil, C 2-6 Alkinyl, C 1-6 Haloalkyl, C 3-10 It is a cycloalkyl, heterocyclyl, aryl, or heteroaryl compound.

[0148] In a particular embodiment, the compound of formula I: [ka] Or a pharmaceutically acceptable salt thereof, isotopically enriched analogues, stereoisomers, tautomers, or mixtures of stereoisomers are provided, in the formula, X 1 , X 2 , X 3 , and X 4 Each of these independently determines whether it is N or CR. 6 And, however, X 1 , X 2 , X 3 , and X 4 Two or fewer of these are N; m is either 0 or 1; n is 1; Ring A consists of 1 to 5 Z 1 It is a heteroaryl that is optionally substituted with; L is a combination or C 1-4 It is alkylene; R 1 is Halo, Cyano, C 1-6 Alkyl, or C 1-6 It is a haloalkyl; R 2 These are 1 to 5 Z 1 C arbitrarily substituted with 1-6 It is alkyl; R 4 is hydrogen; R 5 is hydrogen or halo; Each R 6 These are independently hydrogen, halo, cyano, -NO2, and C. 1-6 Alkyl, C 2-6 Alkenil, C 2-6 Alkinyl, C 3-10 Cycloalkyl, heterocyclyl, aryl, heteroaryl, -N(R 11 )2, -OR 11 , -SR 11 , -C(O)R 11 , -C(O)OR 11 ,-S(O)R 11 -S(O)2R 11 ,-C(O)N(R 11 )2, -NR 11 C(O)R 11 , -NR 11 S(O)R 11 , -NR 11 S(O)2R 11 ,-S(O)N(R11 )2, -S(O)2N(R 11 )2, -NR 11 C(O)N(R 11 )2, -NR 11 S(O)N(R 11 )2, -NR 11 S(O)2N(R 11 )2, -OC(O)N(R 11 )2, or -NR 11 C(O)OR 11 And here, each C 1-6 Alkyl, C 2-6 Alkenil, C 2-6 Alkinyl, C 3-10 Cycloalkyl, heterocyclyl, aryl, or heteroaryl compounds are independently classified into 1 to 5 Z groups. 1 It is optionally replaced by; Each R 11 These are, independently, hydrogen and C 1-6 Alkyl, C 2-6 Alkenil, C 2-6 Alkinyl, C 1-6 Haloalkyl, C 3-10 It is a cycloalkyl, heterocyclyl, aryl, or heteroaryl; each Z 1 These are independently: halo, cyano, -NO2, C 1-6 Alkyl, C 2-6 Alkenil, C 2-6 Alkinyl, C 1-6 Haloalkyl, C 3-10 Cycloalkyl, heterocyclyl, aryl, heteroaryl, -N(R 12 )2, -OR 12 , -SR 12 , -C(O)R 12 , -C(O)OR 12 ,-S(O)R 12 -S(O)2R 12 ,-C(O)N(R 12 )2, -NR 12 C(O)R 12 , -NR 12 S(O)R 12 , -NR 12 S(O)2R 12 ,-S(O)N(R 12)2, -S(O)2N(R 12 )2, -NR 12 C(O)N(R 12 )2, -NR 12 S(O)N(R 12 )2, -NR 12 S(O)2N(R 12 )2, -OC(O)N(R 12 )2, or -NR 12 C(O)OR 12 and Each R 12 These are, independently, hydrogen and C 1-6 Alkyl, C 2-6 Alkenil, C 2-6 Alkinyl, C 1-6 Haloalkyl, C 3-10 It is a cycloalkyl, heterocyclyl, aryl, or heteroaryl compound.

[0149] In a particular embodiment, the compound of formula I: [ka] Or a pharmaceutically acceptable salt thereof, isotopically enriched analogues, stereoisomers, tautomers, or mixtures of stereoisomers are provided, in the formula, X 1 , X 2 , X 3 , and X 4 Each of these independently determines whether it is N or CR. 6 And, however, X 1 , X 2 , X 3 , and X 4 Two or fewer of these are N; m is either 0 or 1; n is 1; Ring A consists of 1 to 5 Z 1 It is a heteroaryl that is optionally substituted with; L is a combination or C 1-4 It is alkylene; R 1 is Halo, Cyano, C 1-6 Alkyl, or C 1-6 It is a haloalkyl; R2 These are 1 to 5 Z 1 C arbitrarily substituted with 1-6 It is alkyl; R 4 is hydrogen; R 5 is hydrogen; Each R 6 These are independently hydrogen, halo, cyano, -NO2, and C. 1-6 Alkyl, C 2-6 Alkenil, C 2-6 Alkinyl, C 3-10 Cycloalkyl, heterocyclyl, aryl, heteroaryl, -N(R 11 )2, -OR 11 , -SR 11 , -C(O)R 11 , -C(O)OR 11 ,-S(O)R 11 -S(O)2R 11 ,-C(O)N(R 11 )2, -NR 11 C(O)R 11 , -NR 11 S(O)R 11 , -NR 11 S(O)2R 11 ,-S(O)N(R 11 )2, -S(O)2N(R 11 )2, -NR 11 C(O)N(R 11 )2, -NR 11 S(O)N(R 11 )2, -NR 11 S(O)2N(R 11 )2, -OC(O)N(R 11 )2, or -NR 11 C(O)OR 11 And here, each C 1-6 Alkyl, C 2-6 Alkenil, C 2-6 Alkinyl, C 3-10 Cycloalkyl, heterocyclyl, aryl, or heteroaryl compounds are independently classified into 1 to 5 Z groups. 1 It is optionally replaced by; Each R 11 These are, independently, hydrogen and C 1-6 Alkyl, C 2-6Alkenil, C 2-6 Alkinyl, C 1-6 Haloalkyl, C 3-10 It is a cycloalkyl, heterocyclyl, aryl, or heteroaryl; each Z 1 These are independently: halo, cyano, -NO2, C 1-6 Alkyl, C 2-6 Alkenil, C 2-6 Alkinyl, C 1-6 Haloalkyl, C 3-10 Cycloalkyl, heterocyclyl, aryl, heteroaryl, -N(R 12 )2, -OR 12 , -SR 12 , -C(O)R 12 , -C(O)OR 12 ,-S(O)R 12 -S(O)2R 12 ,-C(O)N(R 12 )2, -NR 12 C(O)R 12 , -NR 12 S(O)R 12 , -NR 12 S(O)2R 12 ,-S(O)N(R 12 )2, -S(O)2N(R 12 )2, -NR 12 C(O)N(R 12 )2, -NR 12 S(O)N(R 12 )2, -NR 12 S(O)2N(R 12 )2, -OC(O)N(R 12 )2, or -NR 12 C(O)OR 12 and Each R 12 These are, independently, hydrogen and C 1-6 Alkyl, C 2-6 Alkenil, C 2-6 Alkinyl, C 1-6 Haloalkyl, C 3-10 It is a cycloalkyl, heterocyclyl, aryl, or heteroaryl compound.

[0150] In a particular embodiment, the compound of formula I: [ka] Or a pharmaceutically acceptable salt thereof, isotopically enriched analogues, stereoisomers, tautomers, or mixtures of stereoisomers are provided, in the formula, X 1 , X 2 , X 3 , and X 4 Each of these independently determines whether it is N or CR. 6 And, however, X 1 , X 2 , X 3 , and X 4 Two or fewer of these are N; m is either 0 or 1; n is 1; Ring A consists of 1 to 5 Z 1 It is a heteroaryl that is optionally substituted with; L is a combination or C 1-4 It is alkylene; R 1 is Halo, Cyano, C 1-6 Alkyl, or C 1-6 It is a haloalkyl; R 2 These are 1 to 5 Z 1 C arbitrarily substituted with 1-6 It is alkyl; R 4 is hydrogen; R 5 It is a halo; Each R 6 These are independently hydrogen, halo, cyano, -NO2, and C. 1-6 Alkyl, C 2-6 Alkenil, C 2-6 Alkinyl, C 3-10 Cycloalkyl, heterocyclyl, aryl, heteroaryl, -N(R 11 )2, -OR 11 , -SR 11 , -C(O)R 11 , -C(O)OR 11 ,-S(O)R 11 -S(O)2R 11 ,-C(O)N(R 11)2, -NR 11 C(O)R 11 , -NR 11 S(O)R 11 , -NR 11 S(O)2R 11 ,-S(O)N(R 11 )2, -S(O)2N(R 11 )2, -NR 11 C(O)N(R 11 )2, -NR 11 S(O)N(R 11 )2, -NR 11 S(O)2N(R 11 )2, -OC(O)N(R 11 )2, or -NR 11 C(O)OR 11 And here, each C 1-6 Alkyl, C 2-6 Alkenil, C 2-6 Alkinyl, C 3-10 Cycloalkyl, heterocyclyl, aryl, or heteroaryl compounds are independently classified into 1 to 5 Z groups. 1 It is optionally replaced by; Each R 11 These are, independently, hydrogen and C 1-6 Alkyl, C 2-6 Alkenil, C 2-6 Alkinyl, C 1-6 Haloalkyl, C 3-10 It is a cycloalkyl, heterocyclyl, aryl, or heteroaryl; each Z 1 These are independently: halo, cyano, -NO2, C 1-6 Alkyl, C 2-6 Alkenil, C 2-6 Alkinyl, C 1-6 Haloalkyl, C 3-10 Cycloalkyl, heterocyclyl, aryl, heteroaryl, -N(R 12 )2, -OR 12 , -SR 12 , -C(O)R 12 , -C(O)OR 12 ,-S(O)R 12 -S(O)2R 12 ,-C(O)N(R 12 )2, -NR 12C(O)R 12 , -NR 12 S(O)R 12 , -NR 12 S(O)2R 12 ,-S(O)N(R 12 )2, -S(O)2N(R 12 )2, -NR 12 C(O)N(R 12 )2, -NR 12 S(O)N(R 12 )2, -NR 12 S(O)2N(R 12 )2, -OC(O)N(R 12 )2, or -NR 12 C(O)OR 12 and Each R 12 These are, independently, hydrogen and C 1-6 Alkyl, C 2-6 Alkenil, C 2-6 Alkinyl, C 1-6 Haloalkyl, C 3-10 It is a cycloalkyl, heterocyclyl, aryl, or heteroaryl compound.

[0151] In certain embodiments, compounds selected from Table 1, or pharmaceutically acceptable salts thereof, isotopically enriched analogs, prodrugs, stereoisomers, or mixtures of stereoisomers are provided. [Table 1-1] [Table 1-2] [Table 1-3] [Table 1-4] [Table 1-5] [Table 1-6] [Table 1-7] [Table 1-8] [Table 1-9] [Table 1-10] [Table 1-11] [Table 1-12] [Table 1-13] [Table 1-14] [Table 1-15] [Table 1-16] [Table 1-17] [Table 1-18] [Table 1-19]

[0152] In certain embodiments, compounds selected from Table 2, or pharmaceutically acceptable salts thereof, are provided. [Table 2-1] [Table 2-2] [Table 2-3] Table 2-4 Table 2-5 Table 2-6 Table 2-7 Table 2-8 Table 2-9 Table 2-10 Table 2-11 Table 2-12 Table 2-13 Table 2-14 Table 2-15 Table 2-16 Table 2-17 Table 2-18 Table 2-19 Table 2-20 [Table 2-21] [Table 2-22] [Table 2-23]

[0153] 3. Method "Treatment" or "treating" means an approach to obtain a beneficial or desired outcome, including a clinical outcome. Beneficial or desired clinical outcomes may include one or more of the following: a) inhibiting the disease or condition (e.g., reducing one or more symptoms resulting from the disease or condition, and / or reducing the severity of the disease or condition); b) delaying or cessating the onset of one or more clinical symptoms associated with the disease or condition (e.g., stabilizing the disease or condition, preventing or delaying the worsening or progression of the disease or condition, and / or preventing or delaying the spread of the disease or condition (e.g., metastasis)); and / or c) alleviating the disease, i.e., causing a regression of clinical symptoms (e.g., alleviating the disease state, causing partial or total remission of the disease or condition, enhancing the effects of another drug, slowing the progression of the disease, improving quality of life, and / or extending survival).

[0154] "Prevention" or "prevention" means any treatment of a disease or condition that prevents the development of the clinical symptoms of the disease or condition. In certain embodiments, the compound may be administered to subjects (including humans) who are at risk of the disease or condition or who have a family history of the disease or condition.

[0155] "Subject" means an animal, such as a mammal (including a human), that has been or will be the subject of treatment, observation, or experimentation. The methods described herein may be useful for the treatment and / or veterinary use of humans. In certain embodiments, the subject is a mammal. In certain embodiments, the subject is a human.

[0156] The terms “therapeutic effective dose” or “effective dose” for any compound, pharmaceutically acceptable salt thereof, isotopically concentrated analog, stereoisomer, mixture of stereoisomers, or prodrug described herein mean an amount sufficient to, when administered to a subject, have a therapeutic effect and produce a therapeutic benefit such as symptom relief or slowing of disease progression. For example, a therapeutic effective dose may be an amount sufficient to reduce the symptoms of a disease or condition as described herein. The therapeutic effective dose may vary depending on the subject and disease or condition being treated, the subject’s weight and age, the severity of the disease or condition, and the mode of administration, which can be readily determined by a person skilled in the art.

[0157] The methods described herein may be applied to cell populations in vivo or in vitro. “In vivo” means within a living organism, as in animals or humans. In this regard, the methods described herein may be used therapeutically in organisms. “In vitro” means outside a living organism. Examples of in vitro cell populations include in vitro cell cultures and biological samples, including liquid or tissue samples taken from organisms. Such samples can be obtained by methods well known in the art. Exemplary biological liquid samples include blood, cerebrospinal fluid, urine, and saliva. In this regard, the compounds and compositions described herein may be used for a variety of purposes, including therapeutic and experimental purposes. For example, the compounds and compositions described herein may be used in vitro to determine the optimal schedule and / or dosage of the compounds disclosed for a given indication, cell type, organism, and other parameters. Information gathered from such use may be used experimentally or in a clinic to establish protocols for in vivo treatment. Other possible in vitro uses of the compounds and compositions described herein may be described below or will be apparent to those skilled in the art. The compounds may be further characterized to test for safety or tolerable dosages in human or non-human subjects. Such characteristics may be tested using methods commonly known to those skilled in the art.

[0158] In certain embodiments, compounds, or pharmaceutically acceptable salts thereof, isotopically enriched analogs, stereoisomers, mixtures of stereoisomers, or prodrugs are provided that inhibit the activity of sterile alpha and TIR motif-containing 1 (SARM1) protein. In certain embodiments, the compounds, or pharmaceutically acceptable salts thereof, isotopically enriched analogs, stereoisomers, mixtures of stereoisomers, or prodrugs provided herein inhibit SARM1.

[0159] In certain embodiments, methods are provided for inhibiting SARM1 activity, comprising contacting cells with an effective amount of the compound disclosed herein, or a pharmaceutically acceptable salt thereof, an isotopically enriched analog, a stereoisomer, a mixture of stereoisomers, or a prodrug. Inhibition may be performed in vitro or in vivo.

[0160] In certain embodiments, compounds disclosed herein, or pharmaceutically acceptable salts thereof, isotopically enriched analogs, stereoisomers, mixtures of stereoisomers, or prodrugs are provided for use in inhibiting SARM1 activity (e.g., in vitro or in vivo).

[0161] In certain embodiments, the disclosure provides the use of compounds as disclosed herein, or pharmaceutically acceptable salts thereof, isotopically enriched analogs, stereoisomers, mixtures of stereoisomers, or prodrugs in the manufacture of pharmaceuticals (e.g., in vitro or in vivo) for inhibiting SARM1 activity.

[0162] In certain embodiments, compounds such as those disclosed herein, or pharmaceutically acceptable salts thereof, isotopically enriched analogs, stereoisomers, mixtures of stereoisomers, or prodrugs for inhibiting the NADase activity of SARM1 are provided. In certain embodiments, a method is provided for inhibiting the NADase activity of SARM1 and / or treating neurodegeneration or neurological disease or neuropathy in a subject in need thereof, comprising administering to the subject a therapeutically effective amount of a compound such as those disclosed herein, or pharmaceutically acceptable salts thereof, isotopically enriched analogs, stereoisomers, mixtures of stereoisomers, or prodrugs to the subject in need.

[0163] In certain embodiments, a method is provided for treating a disease or condition mediated at least partially by SARM1, comprising administering to a subject in need a therapeutically effective amount of the compound disclosed herein, or a pharmaceutically acceptable salt thereof, an isotopically concentrated analog, a stereoisomer, a mixture of stereoisomers, or a prodrug thereof.

[0164] In certain embodiments, a method is provided for treating axonal degeneration in a subject in need thereof, comprising administering to the subject a therapeutically effective amount of the compound disclosed herein, or a pharmaceutically acceptable salt thereof, an isotopically enriched analog, a stereoisomer, a mixture of stereoisomers, or a prodrug. In certain embodiments, the compound, or a pharmaceutically acceptable salt thereof, an isotopically enriched analog, a stereoisomer, a mixture of stereoisomers, or a prodrug inhibits axonal degeneration, including axonal degeneration resulting from a decrease or sharp decrease in NAD+. In certain embodiments, the compound, or a pharmaceutically acceptable salt thereof, an isotopically enriched analog, a stereoisomer, a mixture of stereoisomers, or a prodrug prevents degeneration of the axon distal to the axonal injury site.

[0165] In certain embodiments, a method is provided for treating the degradation of peripheral nervous system neurons or a portion thereof, comprising administering a therapeutically effective amount of the compound disclosed herein, or a pharmaceutically acceptable salt thereof, an isotopically concentrated analog, a stereoisomer, a mixture of stereoisomers, or a prodrug, to a subject in need thereof.

[0166] In certain embodiments, a method is provided for treating the degeneration of central nervous system neurons or a portion thereof, comprising administering a therapeutically effective amount of the compound disclosed herein, or a pharmaceutically acceptable salt thereof, an isotopically concentrated analog, a stereoisomer, a mixture of stereoisomers, or a prodrug thereof, to a subject in need thereof.

[0167] In certain embodiments, treatment includes reducing one or more symptoms or characteristics of neurodegeneration.

[0168] In certain embodiments, a method is provided for inhibiting axonal degeneration, comprising administering a therapeutically effective amount of the compound disclosed herein, or a pharmaceutically acceptable salt thereof, an isotopically enriched analog, a stereoisomer, a mixture of stereoisomers, or a prodrug to a subject in need thereof.

[0169] In certain embodiments, methods are provided for treating neurodegeneration or neurological diseases or neuropathy, comprising administering a therapeutically effective amount of the compound disclosed herein, or a pharmaceutically acceptable salt thereof, an isotopically concentrated analog, a stereoisomer, a mixture of stereoisomers, or a prodrug, to a subject in need thereof.

[0170] In certain embodiments, methods are provided for treating neurodegenerative or neurological diseases or disorders associated with axonal degeneration, axonal injury, axonopathy, demyelinating diseases, central pontine myelinlysis, nerve injury diseases or disorders, metabolic diseases, mitochondrial diseases, metabolic axonal degeneration, axonal injury resulting from traumatic axonal injury (TAI) (see Ziogas et al., J. Neuroscience, 2018, 38(16):4031-4032 and WO2020191257), leukoencephalopathy, or leukoatrophy, comprising administering a therapeutically effective amount of the compound disclosed herein, or a pharmaceutically acceptable salt thereof, an isotopically concentrated analog, a stereoisomer, a mixture of stereoisomers, or a prodrug to a subject in need thereof.

[0171] In certain embodiments, compounds such as those disclosed herein, or pharmaceutically acceptable salts thereof, isotopically concentrated analogs, stereoisomers, mixtures of stereoisomers, or prodrugs are provided for use in treating diseases or conditions mediated at least partially by SARM1 in subjects requiring such treatment.

[0172] In certain embodiments, compounds such as those disclosed herein, or pharmaceutically acceptable salts thereof, isotopically enriched analogs, stereoisomers, mixtures of stereoisomers, or prodrugs are provided for use in inhibiting axonal degeneration in subjects where such inhibition is desired.

[0173] In certain embodiments, the disclosure provides the use of compounds as disclosed herein, or pharmaceutically acceptable salts thereof, isotopically enriched analogs, stereoisomers, mixtures of stereoisomers, or prodrugs in the manufacture of pharmaceuticals for inhibiting axonal degeneration in subjects requiring such inhibition.

[0174] In certain embodiments, the Disclosure provides the use of compounds as disclosed herein, or pharmaceutically acceptable salts thereof, isotope-enriched analogs, stereoisomers, mixtures of stereoisomers, or prodrugs in the manufacture of pharmaceuticals for the treatment of neurodegenerative or neurological diseases or disorders, such as axonal degeneration, axonal injury, axonal disease, demyelinating disease, central pontine myelin lysis, nerve injury disease or disorder, metabolic disease, mitochondrial disease, metabolic axonal degeneration, axonal injury resulting from traumatic axonal injury (TAI), leukoencephalopathy, or diseases or disorders associated with leukoatrophy.

[0175] In certain embodiments, the disease or condition is an acute condition. In certain embodiments, the disease or condition is a chronic condition.

[0176] In certain embodiments, the disease or condition is characterized by axonal degeneration in the central nervous system, peripheral nervous system, optic nerve, cranial nerve, or a combination thereof.

[0177] In certain embodiments, the disease or condition is or includes acute injury to the central nervous system, for example, but not limited to, spinal cord injury and / or traumatic brain injury (TBI). In certain embodiments, the disease or condition is or includes chronic injury to the central nervous system, for example, but not limited to, spinal cord injury, traumatic brain injury (TBI), and / or traumatic axonal injury (TAI). In certain embodiments, the disease or condition is or includes chronic traumatic brain disease (CTE).

[0178] In certain embodiments, the disease or condition is a chronic condition affecting the central nervous system, such as, but not limited to, Parkinson's disease (see, e.g., Sajadi, A., et al. Curr. Biology. 2004, 14, 326-330; and Hasbani, DM, et al. Exp. Neurology. 2006, 202, 93-99), amyotrophic lateral sclerosis (see, e.g., White, MA, et al. Acta Neuropath. Comm. 2019, 7(1), 166), multiple sclerosis, Huntington's disease, or Alzheimer's disease.

[0179] In certain embodiments, the disease or condition is acute peripheral neuropathy. In certain embodiments, the disease or condition is chemotherapy-induced peripheral neuropathy (CIPN). See, for example, Geisler, S., et al. Brain. 2016, 139, 3092-3108; Turkeyew, E., et al. J. Peripher. Nerv. Syst. 2017, 22, 162-171; Geisler, S., et al. JCI Insight. 2019, 4(17), e129920; and Cetinkaya-Fisgin, A., et al. Sci. Rep. 2020, 21889. Chemotherapy-induced peripheral neuropathy (CIPN), one example of acute peripheral neuropathy, may be associated with various drugs, including, but are not limited to, thalidomide, epothirone (e.g., ixabepirone), taxanes (e.g., paclitaxel and docetaxel), vinca alkaloids (e.g., vinblastine, vinorelbine, vincristine, and vindesine), proteasome inhibitors (e.g., bortezomib), or platinum-based drugs (e.g., cisplatin, oxaliplatin, and carboplatin).

[0180] In certain embodiments, the disease or condition is a chronic condition affecting the peripheral nervous system, such as, but not limited to, diabetic neuropathy, HIV neuropathy, Charcot-Marie-Tooth disease, or amyotrophic lateral sclerosis (ALS).

[0181] In certain embodiments, the disease or condition is glaucoma (see, for example, Ko, KW, et al. J. Cell Bio. 2020, 219(8), e201912047).

[0182] In certain embodiments, the disease or condition is an acute condition affecting the optic nerve, such as, but not limited to, diabetic optic neuropathy, acute optic neuropathy (AON), or acute angle-closure glaucoma.

[0183] In certain embodiments, the disease or condition is a chronic condition affecting the optic nerve, such as, but not limited to, diabetic optic neuropathy, Leber congenital amaurosis, Leber hereditary optic neuropathy (LHON), primary open-angle glaucoma, or autosomal dominant optic atrophy.

[0184] In certain embodiments, the disease or condition is related to retinal degeneration. In certain embodiments, the disease or condition is Leber congenital amaurosis, for example, Leber congenital amaurosis type 9 (LCA9) (see, for example, Sasaki, Y., et al. eLife. 2020, 9, e62027).

[0185] In certain embodiments, one or more compounds and / or compositions as described herein are useful for treating, for example, a disorder or condition selected from the group consisting of one or more neurodegenerative diseases, neuropathy, or axonopathy. In certain embodiments, one or more compounds and / or compositions as described herein are useful for treating, for example, neuropathy or axonopathy associated with axonal degeneration. In certain embodiments, neuropathy associated with axonal degeneration is hereditary or congenital neuropathy or axonopathy. In certain embodiments, neuropathy associated with axonal degeneration results from a de novo mutation or somatic mutation. In certain embodiments, neuropathy associated with axonal degeneration is selected from a list included herein. In certain embodiments, neuropathy or axonopathy is associated with axonal degeneration, including but not limited to Parkinson's disease, Alzheimer's disease, herpes infection, diabetes mellitus, amyotrophic lateral sclerosis, demyelinating disease, ischemia, stroke, chemical injury, thermal injury, or AIDS.

[0186] In certain embodiments, one or more compounds or compositions as described herein are characterized by reducing one or more symptoms or characteristics of neurodegeneration when administered to a target population. For example, in certain embodiments, the relevant symptoms or characteristics may be selected from the group consisting of the degree, rate, and / or timing of neuronal destruction. In certain embodiments, neuronal destruction may be axonal degradation, synapse loss, dendritic crystal loss, synaptic density loss, dendritic branching loss, axonal branching loss, neuronal density loss, myelin formation loss, neuronal cell body loss, synaptic potentiation loss, action potential potentiation loss, cytoskeletal stability loss, axonal transport loss, ion channel synthesis and turnover loss, neurotransmitter synthesis loss, neurotransmitter release and reuptake capacity loss, axonal potential propagation loss, neuronal abnormal excitation state, and / or decreased neuronal excitability, or include these. In certain embodiments, neuronal destruction is characterized by the inability to maintain an appropriate resting neuronal membrane potential. In certain embodiments, neuronal destruction is characterized by the appearance of inclusion bodies, plaques, and / or neurofibrillary tangles. In certain embodiments, neuronal destruction is characterized by the appearance of stress granules. In certain embodiments, neuronal destruction is characterized by intracellular activation of one or more members of the cysteine-aspartate protease (caspase) family. In certain embodiments, neuronal destruction is characterized by the neuron undergoing programmed cell death (e.g., apoptosis, pyroptosis, feroptosis, and / or necrosis) and / or inflammation.

[0187] In certain embodiments, neurodegeneration or neurological disease or neuropathy is associated with axonal degeneration, axonal injury, axonopathy, demyelinating disease, central pontine myelinlysis, nerve injury disease or disorder, metabolic disease, mitochondrial disease, metabolic axonal degeneration, axonal injury resulting from leukoencephalopathy, or leukoatrophy.In certain embodiments, neurodegeneration or neurological disease or neurological disorder includes spinal cord injury, stroke, multiple sclerosis, progressive multifocal leukoencephalopathy, congenital myelin dysplasia, encephalomyelitis, acute disseminated encephalomyelitis, central pontine myelin breakdown, osmotic hyponatremia, hypoxic demyelination, ischemic demyelination, adrenoleukodystrophy, Alexander disease, Niemann-Pick disease, Pelizaeus-Merzbach disease, periventricular leukomalacia, globoid cell leukodystrophy (Krabbe disease), Waller's degeneration, optic neuritis, transverse myelitis, amyotrophic lateral sclerosis (ALS, Lou Gehren's disease). Leber's disease, Huntington's disease, Alzheimer's disease, Parkinson's disease, Tay-Sachs disease, Gaucher disease, Harler syndrome, traumatic brain injury (TBI), traumatic axonal injury (TAI), post-irradiation injury, neurological complications of chemotherapy (e.g., chemotherapy-induced peripheral neuropathy, CIPN), neuropathy, acute ischemic optic neuropathy, vitamin B12 deficiency, isolation vitamin E deficiency syndrome, Bassen-Kohnzweig syndrome, retinal degeneration, glaucoma, retinitis pigmentosa, traumatic optic nerve injury, Leber's hereditary optic nerve atrophy (neuropathy), Leber's congenital amaurosis (e.g., Leber congenital amaurosis type 9 (LCA9), neuromyelitis optica, metachromatic leukodystrophy, acute hemorrhagic leukoencephalitis, trigeminal neuralgia, Bell's palsy, cerebral ischemia, multiple system atrophy, traumatic glaucoma, tropical spastic paraplegia, human T-lymphotropic virus 1 (HTLV-1) associated myelopathy, West Nile virus brain disease, Lacrosse virus encephalitis, Bunya virus encephalitis, pediatric viral encephalitis, essential tremor, Charcot-Marie-Tooth disease, motor neuron disease, spinal muscular atrophy (SMA), hereditary sensory and autonomic neuropathy (HSAN), adrenal spinal nerve disorders, These include progressive supranuclear palsy (PSP), Friedreich's ataxia, hereditary ataxia, noise-induced hearing loss, congenital hearing loss, Lewy body dementia, frontotemporal dementia, amyloidosis, diabetic neuropathy, HIV neuropathy, enteric neuropathy and axonal disease, Guillain-Barré syndrome, severe acute motor axonal neuropathy (AMAN), Creutzfeldt-Jakob disease, transmissible spongiform encephalopathy, spinocerebellar ataxia, pre-eclampsia, hereditary spastic paraplegia, spastic paraplegia, familial spastic paraplegia, French colonial disease, Strumpel-Lowlein disease, or non-alcoholic steatohepatitis (NASH).

[0188] In certain embodiments, the Disclosure provides inhibitors of SARM1 activity for the treatment of neurodegenerative or neurological diseases or disorders associated with axonal degeneration or axonopathy. The Disclosure also provides methods for treating, preventing, or mitigating axonal degeneration, axonopathy, and neurodegenerative or neurological diseases or disorders associated with axonal degeneration using inhibitors of SARM1 activity. In certain embodiments, the Disclosure provides a method for inhibiting axonal degeneration, comprising administering a therapeutically effective amount of a compound disclosed herein, or a pharmaceutically acceptable salt thereof, an isotopically concentrated analog, a stereoisomer, a mixture of stereoisomers, or a prodrug to a subject in need thereof.

[0189] In certain embodiments, the present disclosure provides methods for treating neurodegenerative or neurological diseases or disorders associated with axonal degeneration, axonal injury, axonopathy, demyelinating diseases, central pontine myelinlysis, nerve injury diseases or disorders, metabolic diseases, mitochondrial diseases, metabolic axonal degeneration, axonal injury resulting from leukoencephalopathy, or leukoatrophy.

[0190] In certain embodiments, neuroses and axonal disorders include, for example, diseases or conditions involving neurons and / or supporting cells such as glial cells, muscle cells, or fibroblasts, and in particular, diseases or conditions involving axonal injury. Axonal injury can result from traumatic injury or non-mechanical injury resulting from disease, condition, or exposure to toxic molecules or drugs. Such injury may result in axonal degeneration or dysfunction and loss of functional neuronal activity. Diseases and conditions that result in or are associated with such axonal injury are one of many neuropathic diseases and conditions. Such neuroses may include peripheral neuropathy, central neuropathy, or a combination thereof. Furthermore, peripheral neuropathy symptoms may result from diseases that focus primarily on the central nervous system, and central nervous system symptoms may result from diseases that are essentially peripheral or systemic.

[0191] In certain embodiments, peripheral neuropathy may involve damage to peripheral nerves and / or may result from nerve disorders or as a consequence of systemic diseases. Some such diseases include infectious diseases such as diabetes, uremia, AIDS or leprosy, nutritional deficiencies, vascular or collagen disorders such as atherosclerosis, or autoimmune diseases such as systemic lupus erythematosus, scleroderma, sarcoidosis, rheumatoid arthritis, and polyarteritis nodosa. In certain embodiments, peripheral neuropathy may result from traumatic (mechanical) damage to nerves, as well as chemical or thermal damage to nerves. Conditions that damage peripheral nerves include: glaucoma, carpal tunnel syndrome, compression or constriction injuries such as direct trauma, penetrating trauma, contusions, fractures, or dislocations; pressure on superficial nerves (ulna, radius, or fibula) that may result from prolonged use of crutches or maintaining the same posture for extended periods, or compression by tumors; intraneuromyellowing; ischemia; and exposure to cold or radiation or toxic substances such as certain drugs or herbicides or insecticides. In particular, nerve damage can result from chemical damage caused by cytotoxic anticancer agents such as taxol, cisplatinin, proteasome inhibitors, or vinca alkaloids such as vincristine. Typical symptoms of such peripheral neuropathy include weakness, numbness, paresthesia (unusual sensations such as burning, tickling, tingling, or stinging), and pain in the arms, hands, legs, and / or feet. In certain embodiments, the neuropathy is associated with mitochondrial dysfunction. Such neuroses may present with decreased energy levels, specifically decreased levels of NAD and ATP.

[0192] In certain embodiments, peripheral neuropathy is a metabolic and endocrine neuropathy encompassing a wide range of peripheral nerve disorders associated with systemic diseases of metabolic origin. These diseases include, for example, diabetes mellitus, hypoglycemia, uremia, hypothyroidism, hepatic failure, polycythemia, amyloidosis, acromegaly, porphyria, lipid / glycolipid metabolism disorders, nutritional / vitamin deficiencies, or mitochondrial disorders. A common feature of these diseases is the involvement of peripheral nerves due to changes in the structure and function of myelin and axons resulting from metabolic pathway dysregulation.

[0193] In certain embodiments, neuropathy includes optic neuropathy such as glaucoma, retinal ganglion degeneration such as that associated with retinitis pigmentosa and extrinsic neuropathy, optic neuritis and / or degeneration including that associated with multiple sclerosis, traumatic injury to the optic nerve which may include damage during tumor removal, hereditary optic neuropathy such as Kell's disease and Leber hereditary optic neuropathy (LHON), ischemic optic neuropathy such as that secondary to giant cell arteritis, metabolic optic neuropathy such as neurodegenerative diseases including Leber neuropathy, nutritional deficiencies such as vitamin B12 or folic acid deficiency, and neuropathy resulting from toxicity or adverse drug reactions such as those caused by ethambutol or cyanide, as well as neuropathy resulting from vitamin deficiencies. Non-arteritic ischemic optic neuropathy is also included as an example of ischemic optic neuropathy.

[0194] In certain embodiments, various neurodegenerative diseases associated with neurosis or axonal disease in the central nervous system can be cited. Such diseases include, for example, progressive dementias such as Alzheimer's disease, senile dementia, Pick's disease, and Huntington's disease; central nervous system diseases affecting muscle function, such as Parkinson's disease, motor neuron disease, and progressive ataxia, such as amyotrophic lateral sclerosis; demyelinating diseases, such as multiple sclerosis; viral encephalitis, such as those caused by enteroviruses, arboviruses, and herpes simplex viruses; and those associated with prion diseases. Mechanical injuries, such as glaucoma, or traumatic injuries to the head and spine can also cause nerve damage and degeneration in the brain and spinal cord. In addition, conditions such as ischemia and stroke, as well as nutritional deficiencies, and chemical toxicity from chemotherapeutic agents can cause central nervous system neurosis.

[0195] In certain embodiments, the Disclosure provides a method for treating neuroses or axonal disorders associated with axonal degeneration. In certain embodiments, the neuroses or axonal disorders associated with axonal degeneration may be, for example, hereditary or congenital, or any of several neuroses or axonal disorders, such as those associated with Parkinson's disease, Alzheimer's disease, herpes infection, diabetes, amyotrophic lateral sclerosis, demyelinating diseases, ischemia or stroke, chemical injury, thermal injury, and AIDS. In addition, neurodegenerative diseases not described above, as well as subsets of the diseases described above, can also be treated using the methods of the Disclosure. Such subsets of diseases may include Parkinson's disease or Alzheimer's disease.

[0196] In certain embodiments, the method comprises administering an effective amount of a compound and / or composition as described herein (e.g., a compound of formula I) to a subject requiring it. In some such embodiments, the subject is at risk of developing a condition characterized by axonal degeneration. In certain embodiments, the subject has a condition characterized by axonal degeneration. In certain embodiments, the subject has been diagnosed with a condition characterized by axonal degeneration. In certain embodiments, the subject is at risk of developing a condition characterized by axonal degeneration. In certain embodiments, the subject is identified as being at risk of axonal degeneration based, for example, on the subject's genotype, a diagnosis of a condition associated with axonal degeneration, and / or exposure to a drug, and / or a condition that induces axonal degeneration.

[0197] In certain embodiments, subjects are at risk of developing neurodegenerative disorders. In certain embodiments, subjects are elderly. In certain embodiments, subjects are known to have genetic risk factors for neurodegeneration. In certain embodiments, subjects have a family history of neurodegenerative disease. In certain embodiments, subjects express one or more copies of known genetic risk factors for neurodegeneration. In certain embodiments, subjects are selected from a population with a high incidence of neurodegeneration. In certain embodiments, subjects have a hexanucleotide repeat expansion in the open reading frame 72 of chromosome 9. In certain embodiments, subjects have one or more copies of the ApoE4 allele.

[0198] In certain embodiments, a neurodegenerative disease, disorder, or condition may be or include traumatic neuronal injury. In certain embodiments, traumatic neuronal injury is blunt trauma, closed head trauma, open head trauma, exposure to concussive and / or explosive forces, or penetrating trauma to a brain cavity or area of ​​body innervation. In certain embodiments, traumatic neuronal injury is a force that deforms, stretches, crushes, or shears an axon. In certain embodiments, the disease or disorder is traumatic brain injury (TBI).

[0199] In certain embodiments, subjects have participated in or are currently participating in activities identified as risk factors for neuronal degradation, such as contact sports or occupations that are likely to cause traumatic neuronal injury or TBI.

[0200] In certain embodiments, a method is provided for treating a neurodegenerative disease, disorder, or condition, comprising administering a compound as described herein and one or more DLK inhibitors or NAMPT inhibitors to a patient in need thereof. In certain embodiments, a combination therapy comprising a compound as described herein and DLK inhibitors and / or NAMPT inhibitors is provided. In certain embodiments, a combination therapy comprising a compound as described herein, a DLK inhibitor, and one or more additional therapeutic agents is provided. In certain embodiments, a combination therapy comprising a compound as described herein, a NAMPT inhibitor, and one or more additional therapeutic agents is provided. In certain embodiments, a combination therapy comprising a compound as described herein, a DLK inhibitor, a NAMPT inhibitor, and one or more additional therapeutic agents is provided.

[0201] In certain embodiments, the DLK inhibitor is a small molecule, polypeptide, peptide fragment, nucleic acid (e.g., siRNA, antisense oligonucleotide, microRNA, or aptamer), antibody, dominant-negative inhibitor, or ribozyme. In certain embodiments, the DLK inhibitor is a small molecule. In certain embodiments, the DLK inhibitor is siRNA. In certain embodiments, the DLK inhibitor is an antisense oligonucleotide. In certain embodiments, the DLK inhibitor is a polypeptide. In certain embodiments, the DLK inhibitor is a peptide fragment. In certain embodiments, the DLK inhibitor is a nucleic acid. In certain embodiments, the DLK inhibitor is an antisense oligonucleotide.

[0202] Exemplary DLK inhibitors are presented in WO2013174780, WO2014111496, WO2014177524, WO2014177060, WO2015091889, WO2016142310, US20180057507, WO2018107072, WO2019241244, WO2020168111, and CN104387391A, which are referred to in their entirety.

[0203] In certain embodiments, the NAMPT inhibitor is a small molecule, polypeptide, peptide fragment, nucleic acid (e.g., siRNA, antisense oligonucleotide, microRNA, or aptamer), antibody, dominant-negative inhibitor, or ribozyme. In certain embodiments, the NAMPT inhibitor is a small molecule. In some embodiments, the NAMPT inhibitor is siRNA. In some embodiments, the NAMPT inhibitor is an antisense oligonucleotide. In certain embodiments, the NAMPT inhibitor is a polypeptide. In some embodiments, the NAMPT inhibitor is a peptide fragment. In certain embodiments, the NAMPT inhibitor is a nucleic acid. In some embodiments, the NAMPT inhibitor is an antisense oligonucleotide.

[0204] In certain embodiments, NAMPT inhibitors prevent the formation of nicotinamide mononucleotide (NMN). In certain embodiments, inhibition of NAMPT inhibits the mammalian NAD+ salvage pathway.

[0205] In certain embodiments, compositions are provided that contain compounds such as those described herein and are formulated for use in combination with DLK inhibitors and / or NAMPT inhibitors for administration to a subject.

[0206] In certain embodiments, compositions comprising compounds such as those described herein are provided for use in combination with DLK inhibitors and / or NAMPT inhibitors. In certain embodiments, such compositions are pharmaceutical compositions comprising at least one pharmaceutically acceptable carrier, diluent, or excipient.

[0207] In certain embodiments, subjects may be those who have received, are about to receive, or are currently receiving chemotherapy for peripheral neuropathy. Examples of chemotherapeutic agents include, but are not limited to, thalidomide, epothilone (e.g., ixabepirone), taxanes (e.g., paclitaxel and docetaxel), vinca alkaloids (e.g., vinblastine, vinorelbine, vincristine, and vindesine), proteasome inhibitors (e.g., bortezomib), and platinum-based drugs (e.g., cisplatin, oxaliplatin, and carboplatin).

[0208] In certain embodiments, SARM1 inhibitors as described herein may be used in combination with one or more other therapies to treat an associated disease, disorder, or condition. In certain embodiments, the administration of a SARM1 inhibitor is modified when used in combination therapy compared to when administered as monotherapy, and alternatively or additionally, the therapy administered in combination with a SARM1 inhibitor as described herein is administered according to a different regime or protocol than when administered alone or in combination with one or more therapies other than SARM1 inhibitors. In certain embodiments, compositions containing additional therapeutic agents, the additional therapeutic agents, and the compounds provided may act synergistically. In certain embodiments, one or both therapies used in a combination regimen are administered at lower levels or less frequently than when used as monotherapy.

[0209] In certain embodiments, a compound, or a pharmaceutically acceptable salt thereof, an isotopically concentrated analog, a stereoisomer, a mixture of stereoisomers, or a prodrug, or a composition provided herein, is NAD + or NAD +It is administered in combination with a precursor (for example, nicotinamide riboside (NR), nicotinic acid (NA), nicotinic acid riboside (NaR), nicotinamide (NAM), nicotinamide mononucleotide (NMN), nicotinic acid mononucleotide (NaMN), tryptophan (TRP), nicotinic acid adenine dinucleotide (NAAD), or vitamin B3).

[0210] In certain embodiments, compounds such as those disclosed herein, or pharmaceutically acceptable salts thereof, isotopically enriched analogs, stereoisomers, mixtures of stereoisomers, or prodrugs are provided for use (e.g., in vitro or in vivo) in inhibiting the activity of sterile alpha and TIR motif-containing protein 1 (SARM1).

[0211] In certain embodiments, the present disclosure inhibits the activity of sterile alpha and TIR motif-containing protein 1 (SARM1) (e.g., in vitro or in vivo) and axonal NAD + This invention provides for the use of compounds such as those disclosed herein, or pharmaceutically acceptable salts thereof, isotopically concentrated analogs, stereoisomers, mixtures of stereoisomers, or prodrugs in the manufacture of pharmaceuticals to supplement levels.

[0212] Axonal degeneration is associated with various types of neurodegenerative diseases and is recognized as an important indicator of disease progression and an interesting target for the treatment of these diseases. Similarly, axonal degeneration is also observed in traumatic brain injury and peripheral neuropathy.

[0213] In certain embodiments, a method for treating a disease or condition mediated at least partially by SARM1, comprising administering a therapeutically effective amount of the compound disclosed herein, or a pharmaceutically acceptable salt thereof, an isotopically concentrated analog, a stereoisomer, a mixture of stereoisomers, or a prodrug, to NAD + or NAD +A method is provided which involves administering the substance in combination with a precursor (e.g., NR, NA, NaR, NAM, NMN, NaMN, TRP, NAAD, or vitamin B3) to a subject in need.

[0214] In certain embodiments, the Disclosure relates to the manufacture of a pharmaceutical product for treating or preventing neurodegenerative diseases in a subject that requires it, using a compound as disclosed herein, or a pharmaceutically acceptable salt thereof, an isotopically concentrated analog, a stereoisomer, a mixture of stereoisomers, or a prodrug, such as NAD. + or NAD + It is intended for use in combination with precursors (e.g., NR, NA, NaR, NAM, NMN, NaMN, TRP, NAAD, or vitamin B3).

[0215] In a particular embodiment, a method for treating any disease caused by SARM1 activity, comprising administering a therapeutically effective amount of the compound disclosed herein, or a pharmaceutically acceptable salt thereof, an isotopically concentrated analog, a stereoisomer, a mixture of stereoisomers, or a prodrug, to NAD + or NAD + A method is provided which involves administering the substance in combination with a precursor (e.g., NR, NA, NaR, NAM, NMN, NaMN, TRP, NAAD, or vitamin B3) to a subject in need.

[0216] In certain embodiments, the disease or condition may be a disease or condition of the central nervous system and / or may be caused by or related to a pathogen or traumatic injury. It will be understood that these general embodiments, defined according to the broad categories of diseases, disorders, and conditions, are not mutually exclusive.

[0217] In certain embodiments, a method for treating a neurodegenerative disease, comprising administering a therapeutically effective amount of the compound disclosed herein, or a pharmaceutically acceptable salt thereof, an isotopically concentrated analog, a stereoisomer, a mixture of stereoisomers, or a prodrug, to NAD + or NAD+ A method is provided which involves administering the substance in combination with a precursor (e.g., NR, NA, NaR, NAM, NMN, NaMN, TRP, NAAD, or vitamin B3) to a subject in need.

[0218] Other embodiments include the use of the compounds disclosed herein in the course of treatment.

[0219] 4. Kit Kits comprising the compounds of the Disclosure herein, or pharmaceutically acceptable salts thereof, isotopically enriched analogs, stereoisomers, mixtures of stereoisomers, or prodrugs, and appropriate packaging are also provided herein. In certain embodiments, the kit further includes instructions for use. In one embodiment, the kit includes the compounds of the Disclosure herein, or pharmaceutically acceptable salts thereof, isotopically enriched analogs, stereoisomers, mixtures of stereoisomers, or prodrugs, and labels and / or instructions for the use of the compounds in the treatment of symptoms including diseases or conditions described herein.

[0220] Products comprising the compounds described herein, or pharmaceutically acceptable salts thereof, isotopically concentrated analogs, stereoisomers, mixtures of stereoisomers, or prodrugs, in appropriate containers are also provided herein. The containers may be vials, jars, ampoules, pre-loaded syringes, or intravenous bags.

[0221] 5. Pharmaceutical composition and method of administration The compounds provided herein are typically administered in the form of pharmaceutical compositions. Therefore, pharmaceutical compositions containing one or more of the compounds described herein, or their pharmaceutically acceptable salts, stereoisomers, mixtures of stereoisomers, or prodrugs, as well as one or more pharmaceutically acceptable vehicles selected from carriers, adjuvants, and excipients, are also provided herein. Suitable pharmaceutically acceptable vehicles may include, for example, inert solid diluents and fillers, diluents containing sterile aqueous solutions and various organic solvents, permeation enhancers, solubilizers, and adjuvants. Such compositions are prepared by methods well known in the pharmaceutical field. See, for example, Remington's Pharmaceutical Sciences, Mace Publishing Co., Philadelphia, Pa. 17th Ed. (1985); and Modern Pharmaceutics, Marcel Dekker, Inc. 3rd Ed. (GSBanker & CTRhodes, Eds.).

[0222] The pharmaceutical composition may be administered as a single dose or in repeated doses. The pharmaceutical composition may be administered in various ways, including, for example, rectally, buccally, intranasally, and transdermally. In certain embodiments, the pharmaceutical composition may be administered by intra-arterial injection, intravenously, intraperitoneally, parenterally, intramuscularly, subcutaneously, orally, topically, or as an inhalant.

[0223] One mode of administration is parenteral, for example, by injection. Forms into which the pharmaceutical compositions described herein may be incorporated for administration by injection include, for example, aqueous or oily suspensions, or emulsions with sesame oil, corn oil, cottonseed oil, or peanut oil, as well as elixirs, mannitol, dextrose, or sterile aqueous solutions, and similar pharmaceutical vehicles.

[0224] Oral administration may be another route for administering the compounds described herein. Administration may be, for example, via capsules or enteric-coated tablets. When preparing a pharmaceutical composition comprising at least one of the compounds described herein, or a pharmaceutically acceptable salt thereof, an isotopically concentrated analog, a stereoisomer, a mixture of stereoisomers, or a prodrug, the active ingredient is usually diluted with an excipient and / or encapsulated in a carrier, which may be in the form of a capsule, sachet, paper, or other container. Where the excipient functions as a diluent, it may be in the form of a solid, semi-solid, or liquid substance acting as a vehicle, carrier, or medium for the active ingredient. Thus, the composition may be in the form of tablets, pills, powders, lozenges, sachets, cachets, elixirs, suspensions, emulsions, solutions, syrups, aerosols (as a solid or liquid medium), for example, ointments, soft and hard gelatin capsules, sterile injection solutions, and sterile packaging powders containing up to 10% by weight of the active compound.

[0225] Some examples of suitable excipients include, for example, lactose, dextrose, sucrose, sorbitol, mannitol, starch, acacia gum, calcium phosphate, alginate, tragacanth, gelatin, calcium silicate, microcrystalline cellulose, polyvinylpyrrolidone, cellulose, sterile water, syrup, and methylcellulose. The formulation may further contain lubricants such as talc, magnesium stearate, and mineral oil; wetting agents; emulsifiers and suspending agents; preservatives such as methyl benzoate and propyl hydroxybenzoate; sweeteners; and flavoring agents.

[0226] A composition comprising at least one of the compounds described herein, or a pharmaceutically acceptable salt thereof, an isotopically concentrated analog, a stereoisomer, a mixture of stereoisomers, or a prodrug, can be formulated to rapidly release, sustainedly release, or delayedly release the active ingredient after administration to a subject using procedures known in the art. Controlled-release drug delivery systems for oral administration include osmotic pump systems and dissolution systems containing polymer-coated reservoirs or drug-polymer matrix formulations. Another formulation for use in the manner disclosed herein uses a transdermal delivery device ("patch"). Such transdermal patches may be used to deliver continuous or discontinuous infusions of the compounds described herein in controlled amounts. The structure and use of transdermal patches for the delivery of pharmaceutical agents are well known in the art. Such patches may be constructed for continuous, pulsatile, or on-demand delivery of pharmaceutical agents.

[0227] To prepare solid compositions such as tablets, the main active ingredient may be mixed with pharmaceutically acceptable excipients to form a solid pre-formulation composition containing the compound described herein, or a pharmaceutically acceptable salt thereof, an isotopically concentrated analog, a stereoisomer, a mixture of stereoisomers, or a homogeneous mixture of a prodrug. When these pre-formulation compositions are referred to as homogeneous, the active ingredient may be uniformly dispersed throughout the composition so that the composition can be easily divided into equally effective unit dosage forms such as tablets, pills, and capsules.

[0228] Tablets or pills of the compounds described herein may be formulated to provide a dosage form that offers the benefit of long-term action, or to be coated to protect from the acidic conditions of the stomach, or otherwise. For example, a tablet or pill may contain an internally administered component and an externally administered component, the latter in the form of an envelope covering the former. The two components may be separated by an enteric layer that functions to withstand breakdown in the stomach, allowing the internal component to pass through unchanged into the duodenum or to delay its release. A variety of materials can be used for such enteric layers or coatings, and such materials include many polymer acids, as well as mixtures of polymer acids with materials such as shellac, cetyl alcohol, and cellulose acetate.

[0229] Compositions for inhalation or inhalation may include solutions and suspensions in pharmaceutically acceptable aqueous or organic solvents, or mixtures thereof, as well as powders. Liquid or solid compositions may contain suitable pharmaceutically acceptable excipients as described herein. In certain embodiments, compositions are administered by oral or nasal respiratory pathways for topical or systemic effects. In other embodiments, compositions in pharmaceutically acceptable solvents may be sprayed using an inert gas. The sprayed solution may be inhaled directly from a spraying device, or the spraying device may be attached to a facial mask tent or intermittent positive airway pressure (PAP) device. In one embodiment, the solution, suspension, or powder composition may be administered orally or nasally from a device that delivers the formulation in a suitable manner.

[0230] The amount of compound in a pharmaceutical composition or formulation can be varied within the range used by those skilled in the art. Typically, a formulation will contain, in weight percent (W%), about 0.01 to 99.99% by weight of the compound of this disclosure and one or more suitable pharmaceutically acceptable excipients, based on the total formulation. In one embodiment, the compound is present at a level of about 1 to 80% by weight. Typical pharmaceutical formulations are described below.

[0231] [Table 4]

[0232] [Table 5]

[0233] [Table 6]

[0234] [Table 7]

[0235] [Table 8]

[0236] 6. Administration The specific dose level of the compounds of this application for any particular subject will depend on a variety of factors, including the activity of the specific compound used, age, body weight, overall health, sex, diet, timing of administration, route of administration, and excretion rate, drug combinations, and the severity of the specific disease of the subject being treated. For example, the dosage may be expressed as milligrams (mg / kg) of the compound described herein per kilogram of body weight of the subject. Doses of about 0.1 to 150 mg / kg may be appropriate. In certain embodiments, about 0.1 to 100 mg / kg may be appropriate. In other embodiments, doses of 0.5 to 60 mg / kg may be appropriate. In certain embodiments, about 0.0001 to about 100 mg of the compound per kilogram of body weight per day, about 0.001 to about 50 mg of the compound per kilogram of body weight, or about 0.01 to about 10 mg of the compound per kilogram of body weight per day may be appropriate. Normalizing dosages according to the subject's body weight is particularly useful when adjusting dosages across a wide range of subject sizes, such as when using drugs in both children and adults, or when converting effective dosages for non-human subjects like dogs to dosages suitable for humans.

[0237] 7. Synthesis of Compounds The compounds may be prepared using the methods disclosed herein and their routine modifications, which will be apparent from the disclosure herein and from methods well known in the art. In addition to the teachings herein, conventional and well known synthetic methods may be used. The synthesis of typical compounds described herein may be carried out as described in the examples below. Where available, reagents and starting materials can be commercially purchased, for example, from Sigma Aldrich or other chemical manufacturers.

[0238] Typical or preferred process conditions (i.e., reaction temperature, time, reactant ratio, solvent, pressure, etc.) are provided, but other process conditions are also acceptable unless otherwise specified. Optimal reaction conditions may vary depending on the specific reactants or solvent used, but such conditions can be determined by those skilled in the art through optimization procedures.

[0239] In addition, conventional protecting groups ("PGs") may be necessary to prevent certain functional groups from undergoing undesirable reactions. Suitable protecting groups for various functional groups, as well as appropriate conditions for protecting and deprotecting specific functional groups, are well known in the art. For example, many protecting groups are described in Wuts, PGM, Greene, TW, & Greene, TW (2006). Greene's protective groups in organic synthesis. Hoboken, NJ, Wiley-Interscience, and the references cited therein. For example, silyl ethers (including trimethylsilyl (TMS), tert-butyldimethylsilyl (TBDMS), tri-isopropylsilyloxymethyl (TOM), and triisopropylsilyl (TIPS) ethers) are suitable protecting groups for alcohols such as hydroxyls, and can be removed by acids or fluoride ions such as NaF, TBAF (tetra-n-butylammonium fluoride), HF-Py, or HF-NEt3. Other protecting groups for alcohols include acetyl, which can be removed by an acid or base; benzoyl, which can be removed by an acid or base; benzyl, which can be removed by hydrogenation; methoxyethoxymethyl ether, which can be removed by an acid; dimethoxytrityl, which can be removed by an acid; methoxymethyl ether, which can be removed by an acid; tetrahydropyranyl or tetrahydrofuranyl, which can be removed by an acid; and trityl, which can be removed by an acid.Examples of amine protecting groups include carbobenzyloxy, which is removed by hydrolysis; p-methoxybenzylcarbonyl, which is removed by hydrolysis; tert-butyloxycarbonyl, which is removed by concentrated strong acids (such as HCl or CF3COOH) or by heating to over approximately 80°C; 9-fluorenylmethyloxycarbonyl, which is removed by bases such as piperidine; acetyl, which is removed by treatment with a base; benzoyl, which is removed by treatment with a base; benzyl, which is removed by hydrolysis; and amines removed by acid and gentle heating. Examples include carbamate groups, p-methoxybenzyl removed by hydrocracking, 3,4-dimethoxybenzyl removed by hydrocracking, p-methoxyphenyl removed by cerium(IV) ammonium nitrate, tosyl removed by concentrated acid (such as HBr or H2SO4) and a strong reducing agent (sodium or sodium naphthalenide in liquid ammonia), troc (trichloroethyl chloroformate) removed by Zn insertion in the presence of acetic acid, and sulfonamides (Nosyl & Nps) removed by samarium iodide or tributyltin hydride.

[0240] Furthermore, the compounds of this disclosure may contain one or more chiral centers. Therefore, if desired, such compounds can be prepared or isolated as pure stereoisomers, i.e., as individual enantiomers or diastereomers, or as a concentrated mixture of stereoisomers. All such stereoisomers (and concentrated mixtures) are included within the scope of this disclosure unless otherwise specified. Pure stereoisomers (or concentrated mixtures) can be prepared, for example, using optically active starting materials or stereoselective reagents well known in the art. Alternatively, racemic mixtures of such compounds can be separated, for example, using chiral column chromatography, chiral decomposition agents, etc.

[0241] The starting materials for the following reactions are either commonly known compounds or can be prepared by known procedures or obvious modifications thereof. For example, many of the starting materials are available from suppliers such as Aldrich Chemical Co. (Milwaukee, Wisconsin, USA), Bachem (Torrance, California, USA), and Emka-Chemce or Sigma (St. Louis, Missouri, USA). Others can be prepared by following the procedures or obvious modifications thereof described in standard reference books, such as Fieser and Fieser's Reagents for Organic Synthesis, Volumes 1-15 (John Wiley, and Sons, 1991), Rodd's Chemistry of Carbon Compounds, Volumes 1-5, and Supplementals (Elsevier Science Publishers, 1989), Organic Reactions, Volumes 1-40 (John Wiley, and Sons, 1991), March's Advanced Organic Chemistry, (John Wiley, and Sons, 5th Edition, 2001), and Larock's Comprehensive Organic Transformations (VCH Publishers Inc., 1989).

[0242] General synthesis Scheme I shows a general method that can be used for the synthesis of the compounds described herein (e.g., Formula I), where X 1 , X 2 , X 3 , X 4 , n, m, L, ring A, R 1 , R 2 , R 4 , and R 5 Each is independently as defined herein, and R X This is a functional group precursor of the -L-ring A (for example, -C(O)OR, where R is hydrogen, C 1-6(It is an alkyl group, etc.)

[0243] Scheme I [ka] In Scheme I, the compound of Formula I can be prepared by contacting compound I-1 with compound I-2 under appropriate carbamoylation conditions, for example, using a phosgene reagent such as triphosgene, followed by any functionalization or deprotection as needed. Alternatively, compound I-4 can be prepared by contacting compound I-1 with compound I-3 under appropriate carbamoylation conditions, for example, using a phosgene reagent such as triphosgene, followed by any functionalization or deprotection as needed. X The compound of formula I is obtained by functional group conversion from to -L-ring A (for example, under ring-forming reaction conditions). After each reaction is complete, the intermediate or final compound can be recovered and optionally purified by conventional techniques such as neutralization, extraction, precipitation, chromatography, and filtration.

[0244] Scheme II shows an alternative general method that can be used for the synthesis of the compounds described herein (e.g., Formula I), where X 1 , X 2 , X 3 , X 4 , n, m, L, ring A, R 1 , R 2 , R 4 , and R 5 Each is independently as defined herein, and LG is a leaving group (e.g., halo, alkoxy, -OCCl3, imidazolyl, 4-nitrobenzyloxy-O-, -SC 1-6 Alkyl, -Sn(C 1-6 Alkyl)3 etc., and each R 50 These are independently -OH, -O-alkyl, or together with the boron atom to which they are bonded, they form cyclic boronic acid esters, and R Y R X Alternatively, it is an L-ring A, where RX This is a functional group precursor of the -L-ring A (for example, -C(O)OR, where R is hydrogen, C 1-6 (It is an alkyl group, etc.)

[0245] Scheme II [ka] In Scheme II, the compound of Formula I is reacted by contacting compound II-1 with compound II-2 under appropriate coupling reaction conditions, such as in the presence of a palladium catalyst (e.g., Pd(dppf)Cl2) and a base, and then, if necessary, functionalization (e.g., under ring-forming reaction conditions, e.g., R) Y It can be prepared by functional group conversion (from -L-ring A) and / or deprotection. After each reaction is complete, the intermediate or final compound can be recovered and optionally purified by conventional techniques such as neutralization, extraction, precipitation, chromatography, and filtration.

[0246] Further derivatization of the compounds obtained by the steps outlined in Scheme I or Scheme II, or any intermediates, can yield additional compounds of Formula I. It should be understood that any of the compounds or intermediates shown in Scheme I or Scheme II can be prepared using conventional methods or purchased from commercial suppliers. In addition, any of the intermediates or products obtained by the processes outlined in Scheme I or Scheme II can be derivatized in any step to obtain various compounds of Formula I. In certain embodiments, the various substituents of the compounds or intermediates used in Scheme I or Scheme II are as defined with respect to Formula I.

[0247] For example, compounds I-1 and II-5 can be prepared according to the following Scheme III by a procedure similar to that described in Scheme II, where X 1 , X 2 , X 3 , X 4 , m, n, R 1 , R2 , R 4 , and R 5 Each is independently as defined herein, and X is a leaving group (e.g., halo, Sn(C) 1-6 Alkyl)3 etc., and each R 50 These are independently -OH, -O-alkyl, or together with the boron atom to which they are bonded, they form cyclic boronic acid esters, and R Y R X Alternatively, it is an L-ring A, where R X This is a functional group precursor of the -L-ring A (for example, -C(O)OR, where R is hydrogen, C 1-6 (It is an alkyl group, etc.)

[0248] Scheme III [ka] In Scheme III, compound III-2 can be prepared by contacting compound III-1 with compound II-2 under appropriate coupling reaction conditions, such as in the presence of a palladium catalyst (e.g., Pd(dppf)Cl2) and a base. Compound I-1 is obtained by reduction of compound III-2. Alternatively, compound I-1 can be obtained by contacting amine III-3 with compound II-2 under appropriate coupling reaction conditions, such as in the presence of a palladium catalyst (e.g., Pd(dppf)Cl2) and a base. Compound III-4 can be obtained by borylation of compound III-3. For example, urea II-1 is formed by carbamoylation of compound III-4 under appropriate reaction conditions using a phosgene reagent such as triphosgene. After each reaction is complete, the intermediate or final compound can be recovered and optionally purified by conventional techniques such as neutralization, extraction, precipitation, chromatography, and filtration.

[0249] It should be understood that any of the compounds or intermediates shown in Scheme III can be prepared using conventional methods or purchased from commercial suppliers. In addition, any of the intermediates or any products obtained by the processes outlined in Scheme III can be derivatized in any step to obtain various compounds of Formula I. In certain embodiments, the various substituents of the compounds or intermediates used in Scheme III are as defined with respect to Formula I.

[0250] In a particular embodiment, the process for obtaining a compound of formula I, 1) Compounds of formula I-1: [ka] The compound of formula I-2: [ka] The process is provided which includes contact under conditions sufficient to obtain the compound of formula I, where L, ring A, n, m, X 1 , X 2 , X 3 , X 4 , R, R 1 , R 4 , and R 5 These are each independently defined as herein. In certain embodiments, the conditions include a phosgene reagent, such as triphosgene. [Examples]

[0251] The following embodiments are included to demonstrate specific embodiments of the Disclosure. Those skilled in the art will understand that the techniques disclosed in the following embodiments are representative of techniques that function well when carrying out the Disclosure and that they may be considered to constitute a particular mode of implementation. However, those skilled in the art will understand that many modifications are made in the specific embodiments disclosed without departing from the spirit and scope of the Disclosure, but similar or comparable results can still be obtained.

[0252] General experimental methods All solvents used were commercially available and were used without further purification. Typically, the reaction was carried out using anhydrous solvents under an inert nitrogen atmosphere.

[0253] NMR spectroscopy: Bruker Avance III with a BBFO 300 MHz probe operating at 300 MHz, or one of the following instruments: Bruker Avance 400 instrument with probe DUAL 400 MHz S1, or probe 6 S1 400 MHz 5mm. 1 H- 13 Using a Bruker Avance 400 instrument equipped with a C ID, a Bruker Avance III 400 instrument with a NanoBay equipped with a Broadband BBFO 5 mm direct probe, and a Bruker Mercury Plus 400 NMR spectrometer equipped with a Bruker 400 BBO probe operating at 400 MHz, 1 Nuclear magnetic resonance (NMR) spectroscopy was performed. All deuterated solvents typically contained 0.03%–0.05% v / v tetramethylsilane, which was used as a reference signal. 1 H and 13 (Setting δ to 0.00 in both C and C). In some cases, using a Bruker Advance 400 instrument operating at 400 MHz, and using the solvents listed, at room temperature unless otherwise specified. 1 ¹H nuclear magnetic resonance (NMR) spectroscopy was performed. In all cases, the NMR data were consistent with the proposed structure. Characteristic chemical shifts (δ) are shown in parts per million using conventional abbreviations for major peaks: e.g., s (singlet), d (doublet), t (triplet), q (quartet), dd (doublet of doublets), dt (triplet of doublets), and br (broad).

[0254] Thin-layer chromatography: When thin-layer chromatography (TLC) is used, it refers to silica gel TLC using silica gel F254 (Merck) plates, where Rf is the distance the compound traveled on the TLC plate divided by the distance the solvent traveled. Column chromatography was performed on silica gel cartridges using an automated flash chromatography system, or on C18 cartridges in the case of reverse-phase chromatography. Alternatively, thin-layer chromatography (TLC) was performed using Alugram® (Silica gel 60 F254) from Mancherey-Nagel, typically with UV used to visualize the spots. In some cases, additional visualization methods were also used. In these cases, the TLC plates were treated with iodine (produced by adding approximately 1 g of I2 to 10 g of silica gel and mixing thoroughly), ninhydrin (commercially available from Aldrich), or Magic Stain (25 g of (NH4)6Mo7O 24 The compound was visualized by developing a color using 0.4H2O (produced by completely mixing 450 mL of water containing 5 g of (NH4)2Ce(IV)(NO3)6) with 50 mL of concentrated H2SO4).

[0255] Liquid chromatography-mass spectrometry and HPLC analysis: HPLC analysis was performed using a Shimadzu 20AB HPLC system equipped with a photodiode array detector and a Luna-C18(2) 2.0 × 50 mm, 5 μm column, at a flow rate of 1.2 mL / min, with gradient mobile phase A (MPA, H2O + 0.037% (v / v) TFA): mobile phase B (MPB, ACN + 0.018% (v / v) TFA) (0.01 min, 10% MPB; 4 min, 80% MPB; 4.9 min, 80% MPB; 4.92 min, 10% MPB; 5.5 min, 10% MPB). LC-MS was detected at 220 and 254 mm, or using evaporative light scattering (ELSD) detection and positive electrospray ionization (MS). Semi-preparative HPLC was performed under either acidic or neutral conditions. Acidic: Luna C18 100×30mm, 5μm; MPA: HCl / H2O=0.04%, or formic acid / H2O=0.2% (v / v); MPB: ACN. Neutral: Waters Xbridge 150×25mm, 5μm; MPA: H2O containing 10mM NH4HCO3; MPB: ACN. Gradient for both conditions: at a flow rate of 20 mL / min, 10% MPB to 80% MPB over 12 minutes, then 100% MPB over 2 minutes, 10% MPB over 2 minutes, UV detector. SFC analysis was performed using a Thar analytical SFC system equipped with a UV / Vis detector and a series of chiral columns including AD, AS-H, OJ, OD, AY, and IC, all 4.6 × 100 mm, 3 μm in diameter, at a flow rate of 4 mL / min, with gradient solvent mobile phase A (MPA, CO2): mobile phase B (MPB, MeOH + 0.05% (v / v) IPA) (0.01 min, 10% MPB; 3 min, 40% MPB; 3.5 min, 40% MPB; 3.56-5 min, 10% MPB).SFC preparative sampling was performed using a Thar 80 preparative SFC system equipped with a UV / Vis detector and a series of chiral preparative columns containing AD-H, AS-H, OJ-H, OD-H, AY-H, and IC-H, each measuring 30 × 250 mm, 5 μm, at a flow rate of 65 mL / min, with gradient solvent mobile phase A (MPA, CO2): mobile phase B (MPB, MeOH + 0.1% (v / v) NH3H2O) (0.01 min, 10% MPB; 5 min, 40% MPB; 6 min, 40% MPB; 6.1-10 min, 10% MPB). LC-MS data were also collected using a UPLC-MS Acquity® system coupled with a Waters single quadrupole mass spectrometer equipped with a PDA detector and operating alternately in positive and negative electrospray ionization modes. The column used was Cortecs UPLC C18, 1.6 μm, 2.1 × 50 mm. A linear gradient was applied for 2.0 minutes, starting with 95% A (A: 0.1% formic acid-containing water) and ending with 95% B (B: 0.1% formic acid-containing MeCN), for a total run time of 2.5 minutes. The column temperature was set to 40°C and the flow rate to 0.8 mL / min.

[0256] Intermediate 1 4-Methyl-3-(pyrimidine-2-yl)aniline [ka] To a solution of 2-bromopyrimidine (2 g, 12.58 mmol) and 4-methyl-3-(4,4,5,5-tetramethyl-1,3,2-dioxaborolan-2-yl)aniline (3.52 g, 15.10 mmol) in 1,4-dioxane (40 mL) and H2O (4 mL), K2CO3 (5.22 g, 37.74 mmol) and Pd(dppf)Cl2 (920 mg, 1.26 mmol) were added under N2 at 25°C. The mixture was heated to 100°C and stirred for 12 hours. The reaction mixture was diluted with H2O (60 mL) and extracted with siRNA (3 × 10 mL). The mixed organic layer was washed with brine (20 mL), dried over anhydrous Na2SO4, filtered, and concentrated under reduced pressure. The resulting residue was purified by silica gel column chromatography (PE:dimethyl = 10:1 to 1:1) to obtain the title compound. LCMS = 186.1 [M+H] + .

[0257] Intermediate 2 3-(5-fluoropyrimidine-2-yl)-4-methylaniline [ka] A mixture of 4-methyl-3-(4,4,5,5-tetramethyl-1,3,2-dioxaborolan-2-yl)aniline (1 g, 4.29 mmol) and 2-bromo-5-fluoropyrimidine (1.14 g, 6.43 mmol) in DMF (20 mL) and H2O (2 mL) was mixed with K2CO3 (1.78 g, 12.87 mmol) and Pd(PPh3)4 (496 mg, 0.43 mmol) under N2 at 25°C. The mixture was heated to 100°C and stirred for 12 hours. The reaction mixture was diluted with H2O (30 mL) and extracted with SiO2 (3 × 10 mL). The mixed organic layer was washed with brine (3 × 10 mL), dried over anhydrous Na2SO4, filtered, and concentrated under reduced pressure. The resulting residue was purified by silica gel column chromatography (PE:SiO = 10:1~2:1) to obtain the title compound. LCMS: m / z = 204.1 [M+H] + .

[0258] Intermediate 3 4-methyl-3-(1,2,4-triazine-3-yl)aniline [ka] (5-amino-2-methylphenyl)boronic acid: To a solution of 4-methyl-3-(4,4,5,5-tetramethyl-1,3,2-dioxaborolan-2-yl)aniline (8g, 34.32 mmol) in DCM (80 mL), BCl3 (172 mL, 1 M in toluene) was added under N2 at -40°C. The reaction mixture was heated to 20°C and stirred for 4 hours. Next, the reaction mixture was cooled to 0°C, quenched by adding MeOH (250 mL), and then concentrated under reduced pressure. The resulting residue was adjusted to pH 7-8 with saturated NaHCO3 aqueous solution and extracted with DCM (3 × 30 mL). The mixed organic layer was dried over anhydrous Na2SO4, filtered, and concentrated under reduced pressure to obtain the title compound.

[0259] To a solution of 3-(methylthio)-1,2,4-triazine (2 g, 15.73 mmol) and (5-amino-2-methylphenyl)boronic acid (4.75 g, 31.45 mmol) in 4-methyl-3-(1,2,4-triazine-3-yl)aniline:1,4-dioxane (40 mL), thiophene-2-carbonyloxy copper hydrate (7.22 g, 34.60 mmol) and Pd(PPh3)4 (1.82 g, 1.57 mmol) were added at 20°C. The reaction mixture was heated to 100°C and stirred for 12 hours. Next, the reaction product was concentrated under reduced pressure, and the resulting residue was purified by silica gel column chromatography (PE:HCl = 1:5 to 0:1). The crude product was adjusted to pH=3 with 1N HCl and extracted with HCl (3 × 15 mL). Next, the aqueous phase was adjusted to pH 7-8 using a saturated NaHCO3 aqueous solution, extracted with toluene (3 × 15 mL), dried over anhydrous Na2SO4, filtered, and concentrated under reduced pressure to obtain the title compound. LCMS: m / z = 187.3 [M+H] + .

[0260] Intermediate 4 3-(1,2,4-triazin-3-yl)-4-(trifluoromethyl)aniline [ka] 5-Bromo-2-(trifluoromethyl)benzothioamide: To a solution of 5-bromo-2-(trifluoromethyl)benzonitrile (10 g, 40 mmol) in DMF (150 mL), MgCl2 (3.81 g, 40 mmol) was added at 0°C. The reaction mixture was stirred for 5 minutes, then NaSH (6.73 g, 120 mmol) was added at 0°C. The reaction mixture was stirred at 0°C for 2 hours, diluted with H2O (1 L), and extracted with siRNA (3 × 300 mL). The mixed organic layer was washed with brine (3 × 50 mL), dried over anhydrous Na2SO4, filtered, and concentrated under reduced pressure. H2O (50 ml) was added to the crude product, the resulting solid was filtered, and the filter cake was dried under reduced pressure to obtain the title compound. LCMS: m / z = 284.0, 286.0 [M+H] + .

[0261] 5-Bromo-2-(trifluoromethyl)benzimide hydrazide: To a solution of 5-bromo-2-(trifluoromethyl)benzothioamide (6 g, 21.12 mmol) in EtOH (70 mL), hydrazine hydrate (10.57 g, 211.20 mmol) was added at 25°C. The reaction mixture was heated to 80°C and stirred for 12 hours. The reaction mixture was then concentrated under reduced pressure to obtain the title compound. LCMS: m / z = 282.0, 284.0 [M+H] + .

[0262] To a solution of 5-bromo-2-(trifluoromethyl)benzimide hydrazide (6 g, 21.27 mmol) in 3-(5-bromo-2-(trifluoromethyl)phenyl)-1,2,4-triazine:EtOH (100 mL), oxalaldehyde (15.43 g, 106.36 mmol, 40% purity in H2O) was added at 25°C. The mixture was heated to 80°C and stirred for 2 hours. Next, the reaction mixture was concentrated under reduced pressure, and the resulting residue was purified by silica gel column chromatography (PE:siRNA = 5:1~3:1) to obtain the title compound. LCMS: m / z = 304.0, 306.0 [M+H] + .

[0263] To a solution of 3-(5-bromo-2-(trifluoromethyl)phenyl)-1,2,4-triazine (2.5 g, 8.22 mmol) and diphenylmethanymine (1.64 g, 9.04 mmol) in N-(3-(1,2,4-triazine-3-yl)-4-(trifluoromethyl)phenyl)-1,1-diphenylmethanymine:1,4-dioxane (50 mL), Cs2CO3 (5.36 g, 16.44 mmol), Xantphos (951 mg, 1.64 mmol), and Pd2(dba)3 (753 mg, 0.82 mmol) were added under N2 at 25°C. The reaction mixture was heated to 100°C and stirred for 12 hours. The reaction mixture was concentrated under reduced pressure, and the resulting residue was purified by silica gel column chromatography (PE:siRNA = 3:1 to 1:1) to obtain the title compound. LCMS: m / z = 405.1 [M+H] + .

[0264] 3-(1,2,4-triazin-3-yl)-4-(trifluoromethyl)aniline: To a solution of N-(3-(1,2,4-triazin-3-yl)-4-(trifluoromethyl)phenyl)-1,1-diphenylmethaneimine (2 g, 4.95 mmol) in THF (15 mL), HCl (1 M, 15 mL) was added at 25 °C, and the mixture was stirred for 2 hours. The reaction mixture was diluted with H₂O (10 mL) and extracted with HCl (3 × 15 mL). The aqueous phase was adjusted to pH = 7-8 by adding saturated NaHCO₃ aqueous solution and extracted with HCl (3 × 15 mL). The mixed organic layers were dried over anhydrous Na₂SO₄, filtered, and concentrated under reduced pressure to obtain the title compound. LCMS: m / z = 241.1 [M + H] + .

[0265] Intermediate 5 2-Fluoro-4-methyl-5-(1,2,4-triazine-3-yl)aniline [ka] 5-Bromo-4-fluoro-2-methylbenzothioamide: A mixture of 5-bromo-4-fluoro-2-methylbenzamide (28 g, 120.66 mmol) in toluene (300 mL) was mixed with Lawson's reagent (29 g, 72.40 mmol) under N2 at 25°C. The reaction mixture was heated to 110°C and stirred for 2 hours. The reaction mixture was diluted with H2O (200 mL) and extracted with siRNA (3 × 200 mL). The mixed organic layer was washed with brine (2 × 100 mL), dried over anhydrous Na2SO4, filtered, and concentrated under reduced pressure. The resulting residue was purified by silica gel column chromatography (PE:siRNA = 3:1) to obtain the title compound. LCMS: m / z = 248.0, 250.0 [M+H] + .

[0266] 5-Bromo-4-fluoro-2-methylbenzimide hydrazide: To a mixture of 5-bromo-4-fluoro-2-methylbenzothioamide (11 g, 44.33 mmol) in EtOH (130 mL), N2H4·H2O (11 g, 221.67 mmol, 11 mL, 98% purity) was added under N2 conditions at 25°C. The mixture was heated to 50°C and stirred for 8 hours. The reaction mixture was then concentrated under reduced pressure to obtain the title compound. LCMS: m / z = 246.1, 248.1 [M+H] + .

[0267] A mixture of 5-bromo-4-fluoro-2-methylbenzimide hydrazide (10.9 g, 44.29 mmol) in 3-(5-bromo-4-fluoro-2-methylphenyl)-1,2,4-triazine:EtOH (140 mL) was mixed with oxalaldehyde (32 g, 221.47 mmol, 29 mL, 40% purity in H2O) at 25°C. The reaction mixture was heated to 80°C, stirred for 2 hours, and then concentrated under reduced pressure. The resulting residue was purified by silica gel column chromatography (PE:siRNA=3:1) to obtain the title compound. LCMS: m / z = 268.0, 270.0 [M+H] + .

[0268] To a mixture of 3-(5-bromo-4-fluoro-2-methylphenyl)-1,2,4-triazine (2 g, 7.46 mmol) and diphenylmethanymine (1.35 g, 7.46 mmol) in N-(2-fluoro-4-methyl-5-(1,2,4-triazine-3-yl)phenyl)-1,1-diphenylmethanymine:1,4-dioxane (50 mL), Pd2(dba)3 (683 mg, 0.75 mmol), Xantphos (863 mg, 1.49 mmol), and Cs2CO3 (4.86 g, 14.92 mmol) were added under N2 at 20°C. The reaction mixture was heated to 100°C and stirred for 5 hours. The reaction mixture was concentrated under reduced pressure, and the resulting residue was purified by silica gel column chromatography (PE:SiO=3:1~1:1) to obtain the title compound. LCMS: m / z = 369.2 [M+H]+ .

[0269] A mixture of N-(2-fluoro-4-methyl-5-(1,2,4-triazine-3-yl)aniline:THF (6 mL) and N-(2-fluoro-4-methyl-5-(1,2,4-triazine-3-yl)phenyl)-1,1-diphenylmethaneimine (400 mg, 1.09 mmol) was added to HCl (2 M, 3 mL) at 25 °C, and the reaction mixture was stirred for 12 hours. The reaction mixture was adjusted to pH=7 by adding saturated NaHCO3 aqueous solution and extracted with HCl (3 × 15 mL). The mixed organic phase was washed with brine (3 × 10 mL), dried over anhydrous Na2SO4, filtered, and concentrated under reduced pressure. The resulting residue was purified by silica gel column chromatography (PE:HCl = 1:1) to obtain the title compound. LCMS: m / z = 204.9 [M+H] + .

[0270] Intermediate 6 2-Fluoro-5-(5-fluoropyrimidine-2-yl)-4-methylaniline [ka] To a solution of 2-fluoro-4-methyl-5-(4,4,5,5-tetramethyl-1,3,2-dioxaborolan-2-yl)aniline (5 g, 15.93 mmol) and 2-bromo-5-fluoropyrimidine (2.35 g, 13.27 mmol) in 1,4-dioxane (80 mL) and H2O (8 mL), K2CO3 (4.6 g, 33.19 mmol) and Pd(dppf)Cl2 (970 mg, 1.33 mmol) were added under N2 at 25°C. The mixture was heated to 100°C and stirred for 12 hours. The reaction mixture was filtered through a Celite pad, and the filtrate was concentrated under reduced pressure. The resulting residue was purified by silica gel column chromatography (PE:siRNA = 10:1~3:1) to obtain the title compound. LCMS: m / z = 222.2 [M+H] + .

[0271] Intermediate 7 2-Fluoro-5-(pyridazin-3-yl)-4-(trifluoromethyl)aniline [ka] 3-(4,4,5,5-tetramethyl-1,3,2-dioxaborolan-2-yl)-4-(trifluoromethyl)aniline: To a solution of 3-bromo-4-(trifluoromethyl)aniline (20 g, 83.33 mmol) in DMSO (300 mL), 4,4,4',4',5,5,5',5'-octamethyl-2,2'-bi(1,3,2-dioxaborolan) (31.74 g, 124.99 mmol), Pd(dppf)Cl2 (6.10 g, 8.33 mmol), and KOAc (20.44 g, 208.32 mmol) were added at 25°C under N2. The reaction mixture was heated to 80°C and stirred for 16 hours. The reaction mixture was passed through a Celite pad and filtered. The filtrate was diluted with H2O (200 mL) and then extracted with siRNA (3 × 200 mL). The mixed organic layer was washed with brine (300 mL), dried over anhydrous Na2SO4, filtered, and concentrated under reduced pressure. The resulting residue was purified by silica gel column chromatography (PE:siRNA = 4:1~7:3) to obtain the title compound. LCMS: m / z = 288.1 [M+H] + .

[0272] To a solution of 3-(pyridazin-3-yl)-4-(trifluoromethyl)aniline (15 g, 52.25 mmol) in 1,4-dioxane (150 mL) and H2O (10 mL), 3-bromopyridazine (9.97 g, 62.70 mmol), K2CO3 (21.66 g, 156.75 mmol), and Pd(dppf)Cl2 (3.82 g, 5.22 mmol) were added under N2 at 25°C. The mixture was heated to 100°C and stirred for 12 hours. The reaction mixture was filtered through a Celite pad, and the filtrate was concentrated under reduced pressure. The resulting residue was purified by silica gel column chromatography (PE:HCl = 1:1 to 0:1) to obtain the title compound. LCMS: m / z = 240.1 [M+H] + .

[0273] 2-Fluoro-5-(pyridazin-3-yl)-4-(trifluoromethyl)aniline: Selectfluor (6.22 g, 17.56 mmol) was added to a solution of 3-(pyridazin-3-yl)-4-(trifluoromethyl)aniline (3.5 g, 14.63 mmol) in MeCN (40 mL) under N2 conditions at 25°C. The reaction mixture was heated to 50°C and stirred for 1.5 hours. The reaction mixture was diluted with H2O (20 mL) and extracted with RINKAN (3 × 20 mL). The mixed organic layer was washed with brine (30 mL), dried over anhydrous Na2SO4, filtered, and concentrated under reduced pressure. The resulting residue was purified by silica gel column chromatography (PE:RINKAN = 1:1 to 0:1) to obtain the title compound. LCMS: m / z = 258.1 [M+H] + .

[0274] Intermediate 8 2-Fluoro-5-(5-fluoropyrimidine-2-yl)-4-(trifluoromethyl)aniline [ka] 3-(5-fluoropyrimidine-2-yl)-4-(trifluoromethyl)aniline: To a solution of 3-(4,4,5,5-tetramethyl-1,3,2-dioxaborolan-2-yl)-4-(trifluoromethyl)aniline (3 g, 10.45 mmol) and 2-bromo-5-fluoropyrimidine (2.22 g, 12.54 mmol) in 1,4-dioxane (50 mL) and H2O (10 mL), K2CO3 (3.61 g, 26.12 mmol) and Pd(dppf)Cl2 (765 mg, 1.04 mmol) were added under N2 at 25°C. The mixture was heated to 100°C and stirred for 12 hours. The reaction mixture was diluted with H2O (50 mL) and extracted with ELISA (3 × 30 mL). The mixed organic layers were dried over anhydrous Na2SO4, filtered, and concentrated under reduced pressure. The resulting residue was purified by silica gel column chromatography (PE:MTBE = 10:1-5:1) to obtain the title compound. LCMS: m / z = 258.1 [M+H] + .

[0275] To a solution of 3-(5-fluoropyrimidin-2-yl)-4-(trifluoromethyl)aniline (7.49 g, 27.22 mmol) in 2-fluoro-5-(5-fluoropyrimidin-2-yl)-4-(trifluoromethyl)aniline (70 mL) in MeCN, Selectfluor (9.64 g, 27.22 mmol) was added under N2 at 0°C. The mixture was heated to 25°C and stirred for 2 hours. The reaction mixture was diluted with H2O (100 mL) and extracted with siRNA (3 × 50 mL). The mixed organic layers were dried over anhydrous Na2SO4, filtered, and concentrated under reduced pressure. The resulting residue was purified by preparative HPLC (Phenomenex luna C18 100 × 40 mm × 5 μm; mobile phase: A: 0.2% FA in water, B: MeCN; B% in A: 35%~60%, 8 minutes) to obtain the title compound. LCMS: m / z = 276.0 [M+H] + .

[0276] Intermediate 9 trans-6-((2-fluoro-4-methyl-5-(pyrimidine-2-yl)phenyl)carbamoyl)-3-methyl-6-azabicyclo[3.1.1]heptan-1-carboxylic acid [ka] To a solution of 5-bromo-2-fluoro-4-methylaniline (20 g, 98.02 mmol) in 2-fluoro-4-methyl-5-(4,4,5,5-tetramethyl-1,3,2-dioxaborolan-2-yl)aniline:1,4-dioxane (600 mL), 4,4,4',4',5,5,5',5'-octamethyl-2,2'-bi(1,3,2-dioxaborolan) (37.34 g, 147.03 mmol), KOAc (28.86 g, 294.06 mmol), and Pd(dppf)Cl2 (7.17 g, 9.80 mmol) were added under N2 at 25°C. The reaction mixture was heated to 100°C and stirred for 12 hours. The reaction mixture was filtered through a Celite pad, and the filtrate was concentrated under reduced pressure. The resulting residue was purified by silica gel column chromatography (PE:Â=15:1~10:1) to obtain the title compound. LCMS: m / z = 252.1 [M+H] + .

[0277] trans-6-((2-fluoro-4-methyl-5-(4,4,5,5-tetramethyl-1,3,2-dioxaborolan-2-yl)phenyl)carbamoyl)-3-methyl-6-azabicyclo[3.1.1]heptan-1-carboxylic acid: To a solution of triphosgene (1.18 g, 3.98 mmol) in THF (20 mL), 2-fluoro-4-methyl-5-(4,4,5,5-tetramethyl-1,3,2-dioxaborolan-2-yl)aniline (2 g, 2.14 mmol) and TEA (2.42 g, 23.89 mmol) in THF (30 mL) were added dropwise at 0°C under N2. The mixture was heated to 25°C and stirred for 1 hour. Next, trans-3-methyl-6-azabicyclo[3.1.1]heptane-1-carboxylic acid (8.25 g, 9.57 mmol, 18% purity) was added to the mixture, followed by TEA (2.42 g, 23.89 mmol). The reaction solution was then stirred at 25°C for 12 hours. The reaction mixture was diluted with H2O (1 mL) and concentrated under reduced pressure. The resulting residue was purified by preparative HPLC (Waters Xbridge BEH C18 250 × 70 mm × 10 μm; mobile phase: A: 10 mM NH4HCO3 in water, B: MeCN; B% in A: 20%~50%, 20 minutes) to obtain the title compound. LCMS: m / z = 433.2 [M+H] + .

[0278] trans-6-((2-fluoro-4-methyl-5-(pyrimidine-2-yl)phenyl)carbamoyl)-3-methyl-6-azabicyclo[3.1.1]heptan-1-carboxylic acid:1,4-dioxane (15 mL) and trans-6-((2-fluoro-4-methyl-5-(4,4,5,5-tetramethyl-1,3,2-dioxabolo in H2O (1.5 mL) To a solution of lan-2-yl)phenyl)carbamoyl)-3-methyl-6-azabicyclo[3.1.1]heptane-1-carboxylic acid (1.10 g, 2.45 mmol), 2-bromopyrimidine (485 mg, 3.05 mmol), K2CO3 (1.06 g, 7.63 mmol), and Pd(dppf)Cl2 (186 mg, 0.25 mmol) were added under N2 at 25°C. The mixture was heated at 100°C for 12 hours. The reaction mixture was filtered through a Celite pad, and the filtrate was concentrated under reduced pressure. The resulting residue was purified by preparative HPLC (Waters Xbridge BEH C18 250 × 70 mm × 10 μm; mobile phase: A: 10 mM NH4HCO3 in water, B: MeCN; B% in A: 10%~40%, 20 minutes) to obtain the title compound. LCMS: m / z = 385.0 [M+H] + .

[0279] Intermediate 10 (1R,3R)2-(3-methyl-6-picolinoyl-6-azabicyclo[3.1.1]heptan-1-yl)-2-oxoacetate methyl and (1S,3S)2-(3-methyl-6-picolinoyl-6-azabicyclo[3.1.1]heptan-1-yl)-2-oxoacetate methyl [ka] (5R,7R)-7-methyl-1,3-diazaspiro[4.5]decane-2,4-dione and (5S,7S)-7-methyl-1,3-diazaspiro[4.5]decane-2,4-dione: To a mixture of (R)-3-methylcyclohexane-1-one and (S)-3-methylcyclohexane-1-one (50 g, 445.76 mmol, 54.59 mL) in EtOH (250 mL) and H2O (250 mL), (NH4)2CO3 (128.49 g, 1.34 mol) and KCN (43.54 g, 669 mmol) were added under N2 at 20°C. The mixture was heated to 65°C and stirred for 3 hours. The reaction mixture was filtered, the filter cake was washed with H2O and dried under reduced pressure. The crude product was ground with EtOH at 20°C for 30 minutes, filtered, and the solid was dried under reduced pressure to obtain the title compound. LCMS: m / z = 183.2 [M+H] + .

[0280] (1R,3R)-1-amino-3-methylcyclohexane-1-carboxylic acid and (1S,3S)-1-amino-3-methylcyclohexane-1-carboxylic acid: To a solution of (5R,7R)-7-methyl-1,3-diazaspiro[4.5]decane-2,4-dione and (5S,7S)-7-methyl-1,3-diazaspiro[4.5]decane-2,4-dione (78.5 g, 430.80 mmol) in H2O (1000 mL), Ba(OH)2 (738 g, 4.31 mol) was added at 25 °C. The mixture was heated in a 5 L autoclave at 140 °C for 12 hours. The reaction mixture was cooled to 0 °C and the pH was adjusted to pH=3 using 3 M H2SO4. The mixture was filtered through a Celite pad, and the filtrate was concentrated under reduced pressure to obtain the title compound. LCMS: m / z = 158.2 [M+H] + .

[0281] (1R,3R)-1-amino-3-methylcyclohexane-1-carboxylic acid methyl hydrochloride and (1S,3S)-1-amino-3-methylcyclohexane-1-carboxylic acid methyl hydrochloride: To a mixture of (1R,3R)-1-amino-3-methylcyclohexane-1-carboxylic acid and (1S,3S)-1-amino-3-methylcyclohexane-1-carboxylic acid (60 g, 382 mmol) in MeOH (600 mL), SOCl2 (227 g, 1.91 mol, 138.43 mL) was added under N2 at 0°C. The mixture was heated at 75°C for 12 hours. The reaction mixture was concentrated under reduced pressure to obtain the title compound. LCMS: m / z = 172.2 [M+H] + .

[0282] (1R,3R)-3-methyl-1-(picolinamide)cyclohexane-1-carboxylate methyl and (1S,3S)-3-methyl-1-(picolinamide)cyclohexane-1-carboxylate methyl: To a solution of (1R,3R)-1-amino-3-methylcyclohexane-1-carboxylate methyl hydrochloride and (1S,3S)-1-amino-3-methylcyclohexane-1-carboxylate methyl hydrochloride (24 g, 140 mmol) and picolinic acid (25.88 g, 210 mmol) in DCM (300 mL), DIEA (54.34 g, 420 mmol, 73.24 mL), DMAP (1.71 g, 14 mmol), and EDCI (40.30 g, 210 mmol) were added under N2 at 0°C. The mixture was heated to 25°C and stirred for 16 hours. The reaction mixture was diluted with H2O (200 mL) and extracted with DCM (3 × 200 mL). The mixed organic layer was washed with brine (200 mL), dried over anhydrous Na2SO4, filtered, and concentrated under reduced pressure. The resulting residue was purified by silica gel column chromatography (PE:siRNA = 10:1 to 3:1) to obtain the title compound. LCMS: m / z = 277.2 [M + H] + .

[0283] (1R,3R)2-(3-methyl-6-picolinoyl-6-azabicyclo[3.1.1]heptan-1-yl)-2-oxoacetate methyl and (1S,3S)2-(3-methyl-6-picolinoyl-6-azabicyclo[3.1.1]heptan-1-yl)-2-oxoacetate methyl in (1R,3R)-3-methyl-1-(picolinamide)cyclohexane-1-carboxylate and (1S,3S)-3-methyl-1-(picolinamide) in (1R,3R)-3-methyl-1-(picolinamide) in (1S,3S To a solution of methyl amide)cyclohexane-1-carboxylate (19 g, 68.76 mmol), Na3PO4 (33.82 g, 206 mmol, 33.82 mL), 1,2,3,4,5-pentafluoro-6-iodobenzene (202.12 g, 688 mmol), AgOAc (34.43 g, 206 mmol, 10.56 mL), benzoquinone (3.72 g, 34 mmol, 7.74 mL), and Pd(OAc)2 (3.09 g, 13.75 mmol) were added under N2 at 25°C. The reaction mixture was heated to 145°C and stirred for 16 hours. The reaction mixture was then filtered through a Celite pad. The filtrate was concentrated under reduced pressure, and the resulting residue was purified by silica gel column chromatography (PE:siRNA = 10:1 to 3:1) to obtain the title compound. LCMS: m / z = 275.2 [M+H] + .

[0284] Intermediate 11 trans-3-methyl-6-azabicyclo[3.1.1]heptane-1-carboxylic acid [ka] To a mixture of 1-amino-3-methylcyclohexanecarbonile:TMSCN (61 g, 0.61 mol) and 3-methylcyclohexanone (53 g, 0.47 mol), zinc diiodide (15 g, 0.047 mol) was added under N2 at 0°C. The reaction mixture was heated to 20°C and stirred for 3 hours. Next, NH4 3(g)A solution of NH3 (7M, 500 mL) in MeOH at -78°C, formed by bubbling in MeOH at -78°C, was added to the reaction mixture and stirred at 20°C for 12 hours. The reaction mixture was concentrated under reduced pressure. The crude product was ground using DCM (500 mL) at 20°C for 20 minutes. Next, the mixture was filtered, and the filtrate was concentrated under reduced pressure to obtain the title compound.

[0285] A solution of 1-amino-3-methylcyclohexanecarboxylate hydrochloride (97 g, 0.70 mol) in HCl (10 M, 970 mL) was stirred at 100°C for 12 hours. The reaction mixture was filtered, and the filter cake was dried under reduced pressure to obtain the title compound. LCMS: m / z = 158.2 [M+H] + .

[0286] 1-amino-3-methylcyclohexanecarboxylate methyl hydrochloride: To a mixture of 1-amino-3-methylcyclohexanecarboxylate (94 g, 0.49 mol) in MeOH (940 mL), SOCl2 (106 mL, 1.46 mol) was added dropwise at 0°C under N2. The mixture was then heated to 75°C and stirred for 12 hours. The reaction mixture was concentrated under reduced pressure, and the crude product was ground using MTBE (1500 mL) at 20°C for 30 minutes. The solid was then filtered, and the filter cake was dried under reduced pressure to obtain the title compound. LCMS: m / z = 172.2 [M+H] + .

[0287] A mixture of 1-amino-3-methylcyclohexanecarboxylate methyl hydrochloride (79 g, 0.38 mol) and picolinic acid (61 g, 0.49 mol) in 3-methyl-1-(picolinamide)cyclohexanecarboxylate methyl:DCM (1500 mL) was mixed with DIEA (147 g, 1.14 mol), DMAP (4.7 g, 0.038 mol), and EDCI (109 g, 0.57 mol) under N2 at 0°C. The mixture was stirred at 20°C for 12 hours. The reaction mixture was diluted with H2O (700 mL) and extracted with DCM (2 × 400 mL). The mixed organic layer was washed with brine (2 × 300 mL), dried over anhydrous Na2SO4, filtered, and concentrated under reduced pressure. The residue was purified by silica column chromatography (PE:HCl = 1:0~3:1) to obtain the title compound. LCMS: m / z = 277.0 [M+H] + .

[0288] To a mixture of trans-3-methyl-6-picolinoyl-6-azabicyclo[3.1.1]heptane-1-carboxylate methyl:1,1,2,2-tetrachloroethane (900 mL) and methyl 3-methyl-1-(pyridine-2-carbonylamino)cyclohexanecarboxylate (30 g, 0.11 mol), Na3PO4 (53.40 g, 0.32 mol), 1,4-benzoquinone (5.87 g, 0.05 mol), AgOAc (54.36 g, 0.32 mol), 1,2,3,4,5-pentafluoro-6-iodobenzene (319 g, 1.09 mol), and Pd(OAc)2 (4.87 g, 0.02 mol) were added all at once under N2 at 20°C. The mixture was stirred at 140°C for 12 hours. The reaction mixture was filtered through a Celite pad, and the filtrate was concentrated under reduced pressure. The resulting residue was purified by silica gel column chromatography (PE:Â=1:0~1:1) to obtain the title compound. LCMS: m / z = 275.0 [M+H] + .

[0289] To a mixture of trans-3-methyl-6-azabicyclo[3.1.1]heptane-1-carboxylic acid (2 g, 0.007 mol) and trans-3-methyl-6-picolinoyl-6-azabicyclo[3.1.1]heptane-1-carboxylic acid (2 mL) in EtOH, NaOH (2.92 g, 0.072 mol) was added all at once under N2 at 20°C. The mixture was stirred at 90°C for 12 hours. The reaction mixture was concentrated under reduced pressure to remove the EtOH, and the crude product was then adjusted to a pH of approximately 3-4 by adding a diluted aqueous HCl solution. The solution was then lyophilized to obtain the title compound. LCMS: m / z = 156.2 [M+H] + .

[0290] Intermediate 12 cis-3-methyl-1-(pyrimidine-2-yl)-6-azabicyclo[3.1.1]heptanetrifluoroacetate [ka] To a solution of methyl 2-(cis-3-methyl-6-picolinoyl-6-azabicyclo[3.1.1]heptan-1-yl)-2-oxoacetate (3 g, 11 mmol) in 30 mL of EtOH, NaOH (4.37 g, 109 mmol) was added under N2 at 25°C. The reaction mixture was heated to 90°C and stirred for 12 hours. Next, the reaction mixture was concentrated under reduced pressure, adjusted to pH=5 with 12 M HCl at 0°C, and lyophilized to obtain the title compound. LCMS: m / z = 156.1 [M+H] + .

[0291] To a mixture of cis-3-methyl-6-azabicyclo[3.1.1]heptane-1-carboxylic acid (9 g, 11.31 mmol, purity 19%) in methyl cis-3-methyl-6-azabicyclo[3.1.1]heptane-1-carboxylic acid (MeOH) (100 mL), SOCl2 (2.69 g, 22.62 mmol, 1.64 mL) was added under N2 at 0°C. The mixture was heated to 20°C and stirred for 12 hours. The reaction mixture was concentrated under reduced pressure to obtain the title compound. LCMS: m / z = 170.2 [M+H] + .

[0292] To a mixture of 6-(tert-butyl)1-methylcis-3-methyl-6-azabicyclo[3.1.1]heptane-1,6-dicarboxylate:DCM (100 mL) and cis-3-methyl-6-azabicyclo[3.1.1]heptane-1-carboxylate methyl (9.74 g, 10.93 mmol, purity 19%) in MeOH (10 mL), DMAP (134 mg, 1.09 mmol), TEA (2.21 g, 21.86 mmol, 3.04 mL), and Boc2O (4.77 g, 21.86 mmol) were added under N2 at 0°C. The mixture was heated to 20°C and stirred for 12 hours. The reaction mixture was diluted with H2O (50 mL) and extracted with ELISA (3 × 30 mL). The mixed organic layer was dried over anhydrous Na2SO4, filtered, and concentrated under reduced pressure. The resulting residue was purified by silica gel column chromatography (PE:Â=5:1~3:1) to obtain the title compound. LCMS: m / z = 169.2 [M-Boc+H] + .

[0293] A mixture of tert-butyl cis-1-carbamoyl-3-methyl-6-azabicyclo[3.1.1]heptane-6-carboxylate (1.8 g, 6.68 mmol) and NH3·H2O (20 mL) was stirred at 20°C for 12 hours. The reaction mixture was diluted with H2O (20 mL), filtered, and dried under reduced pressure to obtain the title compound. LCMS: m / z = 199.2 [Mt-Bu+1] + .

[0294] To a solution of tert-butylcis-1-cyano-3-methyl-6-azabicyclo[3.1.1]heptane-6-carboxylic acid (1.6 g, 6.29 mmol) in THF (20 mL), Burgess reagent (4.50 g, 18.87 mmol) was added under N2 at 20°C. The mixture was heated to 65°C and stirred for 2 hours. The reaction mixture was diluted with H2O (10 mL) and extracted with ELISA (3 × 10 mL). The mixed organic layers were dried over anhydrous Na2SO4, filtered, and concentrated under reduced pressure. The resulting residue was purified by silica gel column chromatography (PE:ELISA = 5:1 to 3:1) to obtain the title compound.

[0295] To a mixture of tert-butylcis-1-(imino(methoxy)methyl)-3-methyl-6-azabicyclo[3.1.1]heptane-6-carboxylate (800 mg, 3.39 mmol) in MeOH (10 mL), NaOMe (610 mg, 3.39 mmol, 30% purity) was added under N2 at 0°C. The mixture was heated to 20°C and stirred for 12 hours. The reaction mixture was concentrated under reduced pressure to obtain the title compound. LCMS: m / z = 269.3 [M+H] + .

[0296] tert-butylcis-1-carbamimidoyl-3-methyl-6-azabicyclo[3.1.1]heptane-6-carboxylate (900 mg, 3.35 mmol) in MeOH (10 mL) was mixed with NH4Cl (215 mg, 4.02 mmol) under N2 at 20°C. The mixture was heated to 80°C and stirred for 3 hours. The reaction product was concentrated under reduced pressure to obtain the title compound. LCMS: m / z = 254.4 [M+H] + .

[0297] To a mixture of tert-butylcis-3-methyl-1-(pyrimidine-2-yl)-6-azabicyclo[3.1.1]heptane-6-carboxylate (900 mg, 3.55 mmol) and (Z)-3-(dimethylamino)-2-propenal (528 mg, 5.33 mmol) in EtOH (20 mL), K2CO3 (982 mg, 7.11 mmol) was added under N2 at 20°C. The mixture was heated to 90°C and stirred for 12 hours. The reaction mixture was diluted with H2O (10 mL) and extracted with ELISA (3 × 10 mL). The mixed organic layer was dried over anhydrous Na2SO4, filtered, and concentrated under reduced pressure. The resulting residue was purified by silica gel column chromatography (PE:SiO = 5:1~3:1) and then by preparative HPLC (Waters Xbridge BEH C18 100×30mm×10μm; mobile phase: A: 10mM NH4HCO3 in water, B: MeCN; B% in A: 30%~60%, 8 min) to obtain the title compound. LCMS: m / z = 290.3 [M+H] + .

[0298] To a mixture of tert-butylcis-3-methyl-1-(pyrimidine-2-yl)-6-azabicyclo[3.1.1]heptane-6-carboxylate (120 mg, 0.42 mmol) in DCM (3 mL), TFA (2.31 g, 20.26 mmol, 1.5 mL) was added under N2 at 20°C and the mixture was stirred for 1 hour. The reaction mixture was concentrated under reduced pressure to obtain the title compound. LCMS: m / z = 190.4 [M+H] + .

[0299] Intermediate 13 2-(cis-3-methyl-6-azabicyclo[3.1.1]heptan-1-yl)pyrimidine-5-carbonitrile [ka] To a mixture of tert-butylcis-1-(5-bromopyrimidine-2-yl)-3-methyl-6-azabicyclo[3.1.1]heptane-6-carboxylate (650 mg, 2.57 mmol) and (E)-2-bromo-3-(dimethylamino)-2-propenal (914 mg, 5.13 mmol) in EtOH (10 mL), K2CO3 (709 mg, 5.13 mmol) was added under N2. The mixture was heated to 90°C and stirred for 12 hours. The reaction mixture was concentrated under reduced pressure. The residue was purified by silica gel column chromatography (PE:siRNA = 5:1 to 1:1) to obtain the title compound. LCMS: m / z = 368.0, 370.1 [M+H] + .

[0300] To a mixture of tert-butylcis-1-(5-cyanopyrimidine-2-yl)-3-methyl-6-azabicyclo[3.1.1]heptane-6-carboxylate (350 mg, 0.95 mmol) in DMF (6 mL), Zn(CN)2 (223 mg, 1.90 mmol) and Pd(PPh3)4 (220 mg, 0.19 mmol) were added under N2. The mixture was heated to 130°C and stirred for 12 hours. The reaction mixture was cooled to 20°C, diluted with H2O (5 mL), and extracted with ELISA (3 × 5 mL). The mixed organic layer was dried over anhydrous Na2SO4, filtered, and concentrated under reduced pressure. The resulting residue was purified by silica gel column chromatography (PE:HCl = 3:1 to 1:1) to obtain the title compound. LCMS: m / z = 337.2 [M+Na] + .

[0301] To a mixture of tert-butylcis-1-(5-cyanopyrimidine-2-yl)-3-methyl-6-azabicyclo[3.1.1]heptan-1-yl)pyrimidine-5-carbonitrile:DCM (4 mL) and tert-butylcis-1-(5-cyanopyrimidine-2-yl)-3-methyl-6-azabicyclo[3.1.1]heptan-6-carboxylate (110 mg, 0.35 mmol), TFA (3 g, 26.92 mmol, 2 mL) was added. The reaction mixture was stirred at 20°C for 2 hours. The reaction mixture was concentrated under reduced pressure to obtain the title compound. LCMS: m / z = 215.1 [M+H] + .

[0302] Intermediate 14 cis-3-methyl-1-(1,3,5-triazin-2-yl)-6-azabicyclo[3.1.1]heptanetrifluoroacetate [ka] To a mixture of tert-butylcis-3-methyl-1-(1,3,5-triazine-2-yl)-6-azabicyclo[3.1.1]heptane-6-carboxylate (363 mg, 4.47 mmol) in EtOH (10 mL), AcOH (269 mg, 4.47 mmol) was added at 20°C. The reaction mixture was heated to 80°C and stirred for 12 hours. Next, the reaction mixture was adjusted to pH 7-8 by adding saturated NaHCO3 aqueous solution and extracted with ELISA (3 × 5 mL). The mixed organic layer was washed with brine (5 mL), dried over anhydrous Na2SO4, filtered, and concentrated under reduced pressure. The resulting residue was purified by silica gel column chromatography (PE:Â=3:1~0:1) to obtain the title compound. LCMS: m / z = 191.3 [M-Boc+H] + .

[0303] To a mixture of tert-butylcis-3-methyl-1-(1,3,5-triazine-2-yl)-6-azabicyclo[3.1.1]heptanetrifluoroacetate (170 mg, 0.29 mmol) in DCM (3 mL), TFA (1 mL) was added at 20°C, and the mixture was stirred for 1 hour. The reaction mixture was concentrated under reduced pressure to obtain the title compound.

[0304] Intermediate 15 cis-3-methyl-1-(1,2,4-triazin-3-yl)-6-azabicyclo[3.1.1]heptanetrifluoroacetate [ka] To a solution of tert-butylcis-1-(imino(methoxy)methyl)-3-methyl-6-azabicyclo[3.1.1]heptane-6-carboxylate (1.00 g, 0.78 mmol) in EtOH (15 mL), N2H4·H2O (291 mg, 5.70 mmol, 98% purity) was added under N2 conditions at 20°C. The reaction mixture was heated to 80°C and stirred for 2 hours. The reaction product was then concentrated under reduced pressure to obtain the title compound. LCMS: m / z = 269.3 [M+H] + .

[0305] To a solution of cis-1-(carbamohydrazonoyl)-3-methyl-6-azabicyclo[3.1.1]heptane-6-carboxylate (300 mg, 1.12 mmol) in tert-butylcis-3-methyl-1-(1,2,4-triazine-3-yl)-6-azabicyclo[3.1.1]heptane-6-carboxylic acid (10 mL) in EtOH, oxalaldehyde (811 mg, 5.59 mmol, 40% purity in H2O) was added at 20°C. The reaction mixture was heated to 80°C and stirred for 2 hours. The reaction mixture was diluted with H2O (15 mL) and extracted with  (3 × 5 mL). The mixed organic layer was washed with brine (2 × 5 mL), dried over anhydrous Na2SO4, filtered, and concentrated under reduced pressure. The resulting residue was purified by preparative TLC (PE: = 1:1) to obtain the title compound. LCMS: m / z = 291.2 [M+H] + .

[0306] cis-3-methyl-1-(1,2,4-triazin-3-yl)-6-azabicyclo[3.1.1]heptanetrifluoroacetate: To a solution of cis-3-methyl-1-(1,2,4-triazin-3-yl)-6-azabicyclo[3.1.1]heptane-6-carboxylate (20 mg, 0.69 mmol) in DCM (4 mL), TFA (2 mL) was added at 20°C, and the mixture was stirred for 1 hour. The reaction mixture was then concentrated under reduced pressure to obtain the title compound. LCMS: m / z = 191.2 [M+H] + .

[0307] Intermediate 16 cis-1-((1H-pyrazole-1-yl)methyl)-3-methyl-6-azabicyclo[3.1.1]heptanetrifluoroacetate [ka] To a mixture of tert-butyl cis-1-(hydroxymethyl)-3-methyl-6-azabicyclo[3.1.1]heptane-1,6-dicarboxylate (2.5 g, 9.28 mmol) in MeOH (50 mL), NaBH4 (2.11 g, 55.69 mmol) and CaCl2 (4.12 g, 37.13 mmol) were added under N2 at 0°C. The mixture was heated to 50°C and stirred for 2 hours. The reaction mixture was diluted with saturated NH4Cl aqueous solution (5 mL) and extracted with SiO2 (3 × 5 mL). The mixed organic layer was dried over anhydrous Na2SO4, filtered, and concentrated under reduced pressure to obtain the title compound. LCMS: m / z = 186.2 [Mt-Bu+H] + .

[0308] To a mixture of tert-butylcis-3-methyl-1-(((methylsulfonyl)oxy)methyl)-6-azabicyclo[3.1.1]heptane-6-carboxylate (500 mg, 2.07 mmol) and TEA (419.31 mg, 4.14 mmol) in DCM (10 mL), MsCl (356 mg, 3.11 mmol) and DMAP (25 mg, 0.21 mmol) were added at 0°C. The mixture was heated to 20°C and stirred for 2 hours. The reaction mixture was diluted with saturated NH4Cl aqueous solution (5 mL) and extracted with ELISA (3 × 5 mL). The mixed organic layer was dried over anhydrous Na2SO4, filtered, and concentrated under reduced pressure. The resulting residue was purified by silica gel column chromatography (PE:Â10:1~3:1) to obtain the title compound.

[0309] tert-butylcis-1-((1H-pyrazole-1-yl)methyl)-3-methyl-6-azabicyclo[3.1.1]heptane-6-carboxylate: To a mixture of tert-butylcis-3-methyl-1-(((methylsulfonyl)oxy)methyl)-6-azabicyclo[3.1.1]heptane-6-carboxylate (200 mg, 0.63 mmol) in DMSO (5 mL), 1H-pyrazole (64 mg, 0.94 mmol) and t-BuONa (121 mg, 1.25 mmol) were added under N2 at 20°C. The mixture was heated to 110°C and stirred for 12 hours. The reaction mixture was diluted with saturated NH4Cl aqueous solution (5 mL) and extracted with ELISA (3 × 5 mL). The mixed organic layer was dried over anhydrous Na2SO4, filtered, and concentrated under reduced pressure. The resulting residue was purified by silica gel column chromatography (PE:Â=5:1~2:1) to obtain the title compound. LCMS: m / z = 292.2 [M+H] + .

[0310] To a mixture of tert-butylcis-1-((1H-pyrazole-1-yl)methyl)-3-methyl-6-azabicyclo[3.1.1]heptane-6-carboxylate (100 mg, 0.34 mmol) in cis-1-((1H-pyrazole-1-yl)methyl)-3-methyl-6-azabicyclo[3.1.1]heptane-6-carboxylate (6 mL) in DCM (6 mL), TFA (4.62 g, 40.52 mmol, 3 mL) was added under N2 at 20°C, and the reaction mixture was stirred for 1 hour. The reaction mixture was concentrated under reduced pressure to obtain the title compound. LCMS: m / z = 192.4 [M+H] + .

[0311] Intermediate 17 cis-1-((4H-1,2,4-triazol-4-yl)methyl)-3-methyl-6-azabicyclo[3.1.1]heptanetrifluoroacetate [ka] To a mixture of tert-butylcis-1-((1,3-dioxoisoindolin-2-yl)methyl)-3-methyl-6-azabicyclo[3.1.1]heptane-6-carboxylate (1.80 g, 5.64 mmol) in DMF (30 mL), potassium (1,3-dioxoisoindolin-2-yl) (3.13 g, 16.91 mmol) was added under N2 at 20°C. The mixture was heated to 140°C and stirred for 12 hours. The reaction mixture was then diluted with H2O (10 mL) and extracted with SiO (3 × 10 mL). The mixed organic layer was washed with brine (10 mL), dried over anhydrous Na2SO4, filtered, and concentrated under reduced pressure. The resulting residue was purified by silica gel column chromatography (PE:Â1=5:1~2:1) to obtain the title compound.

[0312] To a solution of tert-butylcis-1-((1,3-dioxoisoindorin-2-yl)methyl)-3-methyl-6-azabicyclo[3.1.1]heptane-6-carboxylate (800 mg, 2.16 mmol) in EtOH (10 mL), N2H4·H2O (270 mg, 4.32 mmol) was added at 20°C, and the mixture was stirred for 12 hours. The reaction mixture was filtered through a Celite pad, and the filtrate was concentrated under reduced pressure to obtain the title compound. LCMS m / z = 241.2 [M+H] + .

[0313] tert-butylcis-1-((4H-1,2,4-triazole-4-yl)methyl)-3-methyl-6-azabicyclo[3.1.1]heptane-6-carboxylate: To a solution of tert-butylcis-1-(aminomethyl)-3-methyl-6-azabicyclo[3.1.1]heptane-6-carboxylate (430 mg, 1.79 mmol) in toluene (10 mL), p-TsOH (308 mg, 1.79 mmol) and N'-[(E)-dimethylaminomethyleneamino]-N,N-dimethyl-formamidine (254 mg, 1.79 mmol) were added at 20°C. The reaction mixture was heated to 100°C and stirred for 12 hours. The reaction mixture was diluted with H2O (10 mL) and extracted with SiO (3 × 10 mL). The mixed organic layers were washed with brine (10 mL), dried over anhydrous Na₂SO₄, filtered, and concentrated under reduced pressure. The resulting residue was purified by preparative HPLC (Phenomenex Gemini-NX C18 75 × 30 mm × 3 μm; mobile phase: A: 10 mM NH₄HCO₃ in water, B: MeCN; B% in A: 15%~45%, 9 min) to obtain the title compound. LCMS m / z = 293.2 [M+H] + .

[0314] To a mixture of tert-butylcis-1-((4H-1,2,4-triazole-4-yl)methyl)-3-methyl-6-azabicyclo[3.1.1]heptane-6-carboxylate (100 mg, 0.34 mmol) in cis-1-((4H-1,2,4-triazole-4-yl)methyl)-3-methyl-6-azabicyclo[3.1.1]heptane-6-carboxylate (3 mL) in cis-1-((4H-1,2,4-triazole-4-yl)methyl)-3-methyl-6-azabicyclo[3.1.1]heptane-6-carboxylate (100 mg, 0.34 mmol) in cis-1-((4H-1,2,4-triazole-4-yl)methyl)-3-methyl-6-azabicyclo[3.1.1]heptane-6-carboxylate (3 mL), TFA (1.92 g, 16.83 mmol, 1.25 mL) was added at 20°C, and the reaction mixture was stirred for 2 hours. The reaction mixture was then concentrated under reduced pressure to obtain the title compound. LCMS m / z = 193.3 [M+H] + .

[0315] Intermediate 18 cis-1-((1H-1,2,4-triazol-1-yl)methyl)-3-methyl-6-azabicyclo[3.1.1]heptanetrifluoroacetate [ka] tert-butylcis-1-((1H-1,2,4-triazole-1-yl)methyl)-3-methyl-6-azabicyclo[3.1.1]heptane-6-carboxylate: To a mixture of tert-butylcis-3-methyl-1-(methylsulfonyloxymethyl)-6-azabicyclo[3.1.1]heptane-6-carboxylate (350 mg, 1.10 mmol) in DMSO (5 mL), 1H-1,2,4-triazole (152 mg, 2.19 mmol) and t-BuONa (211 mg, 2.19 mmol) were added under N2 at 20°C. The reaction mixture was heated to 110°C and stirred for 12 hours. Next, the reaction mixture was diluted with saturated NH4Cl aqueous solution (5 mL) and extracted with SiO2 (3 × 10 mL). The mixed organic layer was dried over anhydrous Na2SO4, filtered, and concentrated under reduced pressure. The resulting residue was purified by silica gel column chromatography (PE:Â=5:1~2:1) to obtain the title compound. LCMS m / z = 293.2 [M+H] + .

[0316] To a mixture of tert-butylcis-1-((1H-1,2,4-triazole-1-yl)methyl)-3-methyl-6-azabicyclo[3.1.1]heptane-6-carboxylate (180 mg, 0.62 mmol) in cis-1-((1H-1,2,4-triazole-1-yl)methyl)-3-methyl-6-azabicyclo[3.1.1]heptane-6-carboxylate (4 mL) in cis-1-((1H-1,2,4-triazole-1-yl)methyl)-3-methyl-6-azabicyclo[3.1.1]heptane-6-carboxylate (4 mL), TFA (3 g, 26.92 mmol) was added at 20°C, and the reaction mixture was stirred for 2 hours. The reaction mixture was concentrated under reduced pressure to obtain the title compound.

[0317] Intermediates 19 and 20 tert-butylcis-1-((1H-1,2,3-triazole-1-yl)methyl)-3-methyl-6-azabicyclo[3.1.1]heptane-6-carboxylate and tert-butylcis-1-((2H-1,2,3-triazole-2-yl)methyl)-3-methyl-6-azabicyclo[3.1.1]heptane-6-carboxylate [ka] To a mixture of tert-butylcis-3-methyl-1-(((methylsulfonyl)oxy)methyl)-6-azabicyclo[3.1.1]heptane-6-carboxylate (1.1 g, 3.44 mmol) in DMSO (8 mL), triazole (475 mg, 6.89 mmol) and t-BuONa (660 mg, 6.89 mmol) were added under N2 at 20°C. The reaction mixture was heated to 110°C and stirred for 12 hours. The reaction mixture was diluted with H2O (10 mL) and extracted with SiO (3 × 20 mL). The mixed organic layer was washed with brine (2 × 10 mL), dried over anhydrous Na2SO4, filtered, and concentrated under reduced pressure. The resulting residue was purified by silica gel column chromatography (PE:SiO=3:1~1:1) to obtain tert-butylcis-1-((2H-1,2,3-triazole-2-yl)methyl)-3-methyl-6-azabicyclo[3.1.1]heptane-6-carboxylate (first to elute) and tert-butylcis-1-((1H-1,2,3-triazole-1-yl)methyl)-3-methyl-6-azabicyclo[3.1.1]heptane-6-carboxylate (second to elute). LCMS: m / z = 293.4 [M +H] + .

[0318] Intermediate 21 cis-1-((1H-1,2,3-triazol-1-yl)methyl)-3-methyl-6-azabicyclo[3.1.1]heptanetrifluoroacetate [ka] To a solution of tert-butylcis-1-((1H-1,2,3-triazole-1-yl)methyl)-3-methyl-6-azabicyclo[3.1.1]heptane-6-carboxylic acid (278 mg, 0.95 μmol) in DCM (6 mL), TFA (2 mL) was added at 25 °C, and the reaction mixture was stirred for 2 hours. The reaction mixture was then concentrated to obtain the title compound. LC-MS: m / z = 193.2 [M+H] + .

[0319] Intermediate 22 cis-1-((2H-1,2,3-triazol-2-yl)methyl)-3-methyl-6-azabicyclo[3.1.1]heptanetrifluoroacetate [ka] To a mixture of tert-butylcis-1-((2H-1,2,3-triazole-2-yl)methyl)-3-methyl-6-azabicyclo[3.1.1]heptan-6-carboxylate (290 mg, 0.99 mmol) in DCM (6 mL), TFA (2 mL) was added at 20 °C, and the reaction mixture was stirred for 1 hour. The reaction mixture was then concentrated under reduced pressure to obtain the title compound.

[0320] Intermediate 23 7-Azabicyclo[4.1.1]octane-1-carboxylic acid [ka] 1-aminocycloheptanecarboxylate methyl hydrochloride: To a solution of 1-aminocycloheptanecarboxylic acid (1 g, 6.36 mmol) in MeOH (15 mL), SOCl2 (3.78 g, 31.80 mmol) was added under N2 at 0°C. The mixture was heated to 65°C and stirred for 12 hours. The reaction mixture was cooled to room temperature and concentrated under reduced pressure to obtain the title compound. LCMS: m / z = 172.2 [M+H] + .

[0321] To a solution of methyl 1-aminocycloheptanecarboxylate hydrochloride (1.1 g, 5.30 mmol) in methyl 1-(pyridine-2-carbonylamino)cycloheptanecarboxylate: 978 mg, 7.94 mmol, DIEA (2.05 g, 15.89 mmol), DMAP (65 mg, 0.53 mmol), and EDCI (1.52 g, 7.94 mmol) were added under N2 at 25°C, and the reaction mixture was stirred for 12 hours. The reaction mixture was diluted with H2O (10 mL) and extracted with DCM (3 × 10 mL). The mixed organic layer was washed with brine (10 mL), dried over anhydrous Na2SO4, filtered, and concentrated under reduced pressure. The resulting residue was purified by silica gel column chromatography (PE:HCl = 3:1 to 1:1) to obtain the title compound. LCMS: m / z = 277.2 [M+H] + .

[0322] To a solution of methyl 1-(pyridine-2-carbonylamino)cycloheptanecarboxylate (1.26 g, 4.56 mmol) in methyl 7-(pyridine-2-carbonylamino)-7-azabicyclo[4.1.1]octane-1-carboxylate:1,1,2,2-tetrachloroethane (30 mL), Na3PO4 (2.24 g, 13.68 mmol), AgOAc (2.28 g, 13.68 mmol), p-benzoquinone (246 mg, 2.28 mmol), 1,2,3,4,5-pentafluoro-6-iodobenzene (13.4 g, 45.60 mmol), and Pd(OAc)2 (205 mg, 0.91 mmol) were added under N2 at 25°C. The mixture was heated to 145°C and stirred for 12 hours. The reaction mixture was filtered through a Celite pad, and the filtrate was concentrated under reduced pressure. The resulting residue was purified by silica gel column chromatography (PE:siRNA = 100:1 to 1:1) to obtain the title compound. LCMS: m / z = 275.1 [M+H] + .

[0323] 7-Azabicyclo[4.1.1]octane-1-carboxylic acid: To a solution of methyl 7-(pyridine-2-carbonyl)-7-azabicyclo[4.1.1]octane-1-carboxylic acid (910 mg, 3.32 mmol) in EtOH (10 mL), NaOH (1.33 g, 33.17 mmol) was added at 25 °C. The mixture was heated to 90 °C and stirred for 12 hours. The reaction mixture was concentrated under reduced pressure to remove EtOH, and the resulting residue was diluted with H2O (3 mL) and adjusted to pH = 4-5 by adding HCl (3 M). The resulting solution was lyophilized to obtain the title compound. LCMS: m / z = 156.1 [M+H] + .

[0324] Intermediates 24 and 25 (1R,3S,5S)-3-methyl-6-picolinoyl-6-azabicyclo[3.1.1]heptane-1-carboxylate methyl and (1S,3R,5R)-3-methyl-6-picolinoyl-6-azabicyclo[3.1.1]heptane-1-carboxylate methyl [ka] A mixture of enantiomers was separated by SFC (DAICEL CHIRALPAK 250mm×50mm, 10μm; mobile phase: A: CO2, B: i-PrOH MeOH 0.1% NH3H2O; B% in A: 20%~20%, 3 min; flow rate: 200 g / min; wavelength: 220 nm; column temperature: 35°C; system back pressure: 100 bar) to obtain cis-3-methyl-6-picolinoyl-6-azabicyclo[3.1.1]heptane-1-carboxylate methyl (peak 1 in SFC) intermediate 24 (LCMS: m / z = 275.2 [M+H]). + ), and cis-3-methyl-6-picolinoyl-6-azabicyclo[3.1.1]heptane-1-carboxylate methyl (peak 2 in SFC) intermediate 25 (LCMS: m / z = 275.2 [M+H] + ) was obtained.

[0325] Intermediate 26 cis-6-((2-fluoro-5-(5-fluoropyrimidine-2-yl)-4-(trifluoromethyl)phenyl)carbamoyl)-3-(trifluoromethyl)-6-azabicyclo[3.1.1]heptan-1-carboxylic acid [ka] To a mixture of 3-(trifluoromethyl)cyclohexanone (12 g, 72.23 mmol) in trans-7-(trifluoromethyl)-1,3-diazaspiro[4.5]decane-2,4-dione:EtOH (80 mL) and H2O (80 mL), (NH4)2CO3 (20.82 g, 216.68 mmol) and TMSCN (10.75 g, 108.34 mmol, 13.55 mL) were added under N2 at 20°C. The reaction mixture was heated to 65°C and stirred for 3 hours. The reaction mixture was filtered, the filter cake was washed three times with H2O, and then dried under reduced pressure to obtain the title compound. LCMS: m / z = 237.1 [M+H] + .

[0326] To a solution of trans-7-(trifluoromethyl)-1,3-diazaspiro[4.5]decane-2,4-dione (11 g, 46.57 mol) in trans-1-amino-3-(trifluoromethyl)cyclohexane-1-carboxylic acid:H2O (200 mL), Ba(OH)2 (79.80 g, 465.73 mmol) was added at 20°C. The mixture was heated to 140°C and stirred for 12 hours. The mixture was adjusted to pH=3 by adding 2 M H2SO4, filtered, and the filtrate was concentrated under reduced pressure to obtain the title compound.

[0327] To a solution of trans-1-amino-3-(trifluoromethyl)cyclohexane-1-carboxylic acid (9.8 g, 46.41 mmol) in methyl trans-1-amino-3-(trifluoromethyl)cyclohexane-1-carboxylic acid (MeOH) (200 mL), SOCl2 (27.60 g, 232.03 mmol, 16.85 mL) was added dropwise at 0°C. The mixture was heated to 75°C and stirred for 12 hours. The reaction mixture was concentrated under reduced pressure to obtain the title compound.

[0328] To a solution of trans-1-amino-3-(trifluoromethyl)cyclohexane-1-carboxylate methyl (7 g, 31.08 mmol) in DCM (200 mL), pyridine-2-carboxylic acid (4.97 g, 40.41 mmol), EDCI (8.94 g, 46.62 mmol), DMAP (380 mg, 3.11 mmol), and DIEA (12.05 g, 93.25 mmol, 16.24 mmol) were added at 0°C. The mixture was heated to 20°C and stirred for 12 hours. The reaction mixture was diluted with H2O (50 mL) and extracted with DCM (3 × 30 mL). The mixed organic layer was washed with brine (50 mL), dried over anhydrous Na2SO4, filtered, and concentrated under reduced pressure. The resulting residue was purified by silica gel column chromatography (PE:Â=1:1~0:1) to obtain the title compound. LCMS: m / z = 331.1 [M+H] + .

[0329] To a solution of trans-1-(picolinamide)-3-(trifluoromethyl)cyclohexane-1-carboxylate methyl (3.9 g, 11.81 mmol) in cis-6-picolinoyl-3-(trifluoromethyl)-6-azabicyclo[3.1.1]heptane-1-carboxylate methyl:1,1,2,2-tetrachloroethane (120 mL), AgOAc (5.91 g, 35.42 mmol), 1,2,3,4,5-pentafluoro-6-iodobenzene (34.71 g, 118.07 mmol), Pd(OAc)2 (266 mg, 1.18 mmol), benzoquinone (639 mg, 5.90 mmol), and Na3PO4 (5.81 g, 35.42 mmol) were added under N2 at 20°C. The reaction mixture was heated to 145°C and stirred for 12 hours. The reaction mixture was filtered, and the filtrate was concentrated under reduced pressure. The resulting residue was purified by silica gel column chromatography (PE:Â=3:1~1:1) to obtain the title compound. LCMS: m / z = 329.1 [M+H] + .

[0330] To a solution of methyl cis-6-picolinoyl-3-(trifluoromethyl)-6-azabicyclo[3.1.1]heptane-1-carboxylic acid (2 g, 6.09 mmol) in EtOH (30 mL), NaOH (2.44 g, 60.92 mmol) was added at 20°C. The mixture was heated to 90°C and stirred for 12 hours. The mixture was concentrated under reduced pressure, and the resulting residue was adjusted to pH=5 by adding 3 M HCl, and lyophilized to obtain the title compound.

[0331] Intermediate 27 cis-3-cyclopropyl-6-azabicyclo[3.1.1]heptane-1-carboxylic acid [ka] To a mixture of 3-cyclopropylcyclohexanone (3 g, 21.71 mmol) in trans-7-cyclopropyl-1,3-diazaspiro[4.5]decane-2,4-dione:EtOH (20 mL) and H2O (20 mL), (NH4)2CO3 (6.26 g, 65.12 mmol) and KCN (2.12 g, 32.56 mmol) were added under N2 at 20°C. The mixture was heated to 65°C and stirred for 3 hours. The reaction mixture was filtered, the filter cake was washed three times with H2O, and dried under reduced pressure to obtain the title compound. LCMS: m / z = 209.2 [M+H] + .

[0332] To a solution of trans-7-cyclopropyl-1,3-diazaspiro[4.5]decane-2,4-dione (3 g, 14.41 mmol) in trans-1-amino-3-cyclopropylcyclohexane-1-carboxylic acid:H2O (40 mL), Ba(OH)2 (24.68 g, 144.05 mmol) was added at 20 °C. The mixture was heated in an autoclave to 140 °C for 12 hours. The mixture was then adjusted to pH=3 by adding 2 M H2SO4, filtered, and the filtrate was concentrated under reduced pressure to obtain the title compound.

[0333] To a solution of trans-1-amino-3-cyclopropylcyclohexane-1-carboxylic acid (3 g, 16.37 mmol) in MeOH (50 mL), SOCl2 (9.74 g, 81.86 mmol, 5.95 mL) was added dropwise at 0°C. The mixture was heated to 75°C and stirred for 3 hours. The reaction mixture was concentrated under reduced pressure to obtain the title compound. LCMS: m / z = 198.2 [M+H] + .

[0334] To a solution of trans-1-amino-3-cyclopropylcyclohexane-1-carboxylate methyl hydrochloride (2.5 g, 10.70 mmol) and pyridine-2-carboxylic acid (1.71 g, 13.90 mmol) in trans-3-cyclopropyl-1-(picolinamide)cyclohexane-1-carboxylate methyl:DCM (30 mL), EDCI (3.08 g, 16.04 mmol), DMAP (130 mg, 1.07 mmol), and DIEA (4.15 g, 32.09 mmol, 5.59 mL) were added under N2 at 0°C. The mixture was heated to 20°C and stirred for 12 hours. The reaction mixture was diluted with H2O (50 mL) and extracted with DCM (3 × 30 mL). The mixed organic layer was washed with brine (50 mL), dried over anhydrous Na2SO4, filtered, and concentrated under reduced pressure. The resulting residue was purified by silica gel column chromatography (PE:Â=1:1~0:1) to obtain the title compound. LCMS: m / z = 303.2 [M+H] + .

[0335] To a solution of trans-3-cyclopropyl-1-(picolinamide)cyclohexane-1-carboxylate methyl (900 mg, 2.98 mmol) in cis-3-cyclopropyl-6-picolinoyl-6-azabicyclo[3.1.1]heptane-1-carboxylate methyl:1,1,2,2-tetrachloroethane (30 mL), AgOAc (1.49 g, 8.93 mmol), 1,2,3,4,5-pentafluoro-6-iodobenzene (8.75 g, 29.77 mmol), Pd(OAc)2 (66.83 mg, 0.30 mmol), benzoquinone (160.88 mg, 1.49 mmol), and Na3PO4 (1.46 g, 8.93 mmol) were added under N2 at 20°C. The mixture was heated to 145°C and stirred for 12 hours. The reaction mixture was filtered, and the filtrate was concentrated under reduced pressure. The resulting residue was purified by silica gel column chromatography (PE:Â=5:1~1:1) to obtain the title compound. LCMS: m / z = 301.1 [M+H] + .

[0336] To a solution of cis-3-cyclopropyl-6-azabicyclo[3.1.1]heptane-1-carboxylic acid (500 mg, 1.66 mmol) in EtOH (10 mL), NaOH (666 mg, 16.65 mmol) was added at 20°C. The mixture was heated in an autoclave to 140°C and stirred for 3 hours. The mixture was concentrated under reduced pressure, and the crude product was adjusted to pH=5 by adding 3 M HCl, then freeze-dried to obtain the title compound. LCMS: m / z = 182.2 [M+H] + .

[0337] Intermediate 28 cis-3-ethyl-6-azabicyclo[3.1.1]heptane-1-carboxylic acid [ka] trans-7-ethyl-1,3-diazaspiro[4.5]decane-2,4-dione: To a solution of 3-ethylcyclohexane-1-one (23 g, 182.26 mmol) in EtOH (120 mL) and H2O (120 mL), (NH4)2CO3 (52.54 g, 547 mmol) and KCN (17.8 g, 273.39 mmol) were added under N2 at 20°C. The reaction mixture was heated to 65°C and stirred for 4 hours. The reaction mixture was filtered, the filter cake was washed three times with H2O, and the filter cake was dried under reduced pressure to obtain the title compound. LCMS: m / z = 197.2 [M+H] + .

[0338] To a solution of trans-7-ethyl-1,3-diazaspiro[4.5]decane-2,4-dione in trans-1-amino-3-ethylcyclohexane-1-carboxylic acid:H2O (50 mL), Ba(OH)2 (26.19 g, 152.87 mmol) was added at 20°C. The mixture was heated to 140°C in an autoclave and stirred for 12 hours. The reaction mixture was adjusted to pH=3 by adding 3 M H2SO4, filtered, and the filtrate was concentrated under reduced pressure to obtain the title compound. LCMS: m / z = 172.2 [M+H] + .

[0339] To a solution of trans-1-amino-3-ethylcyclohexane-1-carboxylic acid (6 g, 35.04 mmol) in MeOH (60 mL), SOCl2 (20.84 g, 175.20 mmol) was added under N2 at 0°C. The reaction mixture was heated to 75°C and stirred for 6 hours. The reaction mixture was concentrated under reduced pressure to obtain the title compound. LCMS: m / z = 186.2 [M+H] + .

[0340] To a solution of trans-1-amino-3-ethylcyclohexane-1-carboxylate methyl hydrochloride (8 g, 36.08 mmol) in trans-3-ethyl-1-(picolinamide)cyclohexane-1-carboxylate methyl:DCM (100 mL), picolinic acid (6.66 g, 54.12 mmol), EDCI (10.38 g, 54.12 mmol), DMAP (440.79 mg, 3.61 mmol), and DIEA (13.99 g, 108.24 mmol) were added at 0°C. The mixture was heated to 20°C and stirred for 12 hours. The reaction mixture was diluted with H2O (200 mL) and extracted with DCM (3 × 50 mL). The mixed organic layer was washed with brine (200 mL), dried over anhydrous Na2SO4, filtered, and concentrated under reduced pressure. The resulting residue was purified by column chromatography (SiO2, PE:SiO2 = 4:1 to 1:1) to obtain the title compound. LCMS: m / z = 291.2 [M+H] + .

[0341] To a solution of trans-3-ethyl-1-(picolinamide)cyclohexane-1-carboxylate methyl cis-3-ethyl-6-picolinoyl-6-azabicyclo[3.1.1]heptane-1-carboxylate (4.6 g, 15.84 mmol) in 1,1,2,2-tetrachloroethane (135 mL), AgOAc (7.93 g, 47.53 mmol), benzoquinone (856 mg, 7.92 mmol), 1,2,3,4,5-pentafluoro-6-iodobenzene (46.57 g, 158.43 mmol), Na3PO4 (7.79 g, 47.53 mmol), and Pd(OAc)2 (711 mg, 3.17 mmol) were added under N2 at 20°C. The mixture was heated to 145°C and stirred for 12 hours. The reaction mixture was filtered through a Celite pad, and the filtrate was concentrated under reduced pressure. The resulting residue was purified by column chromatography (SiO2, PE:siRNA = 4:1 to 1:1) to obtain the title compound. LCMS: m / z = 289.1 [M+H] + .

[0342] To a solution of cis-3-ethyl-6-azabicyclo[3.1.1]heptane-1-carboxylic acid (800 mg, 2.77 mmol) in EtOH (15 mL), NaOH (1.11 g, 27.74 mmol) was added under N2 at 20°C. The reaction mixture was heated to 90°C and stirred for 12 hours. The mixture was diluted with H2O (10 mL), concentrated under reduced pressure, and EtOH was removed. The mixture was quenched by adding 6 M HCl to pH=4, and lyophilized to obtain the title compound. LCMS: m / z = 170.2 [M+H] + .

[0343] Intermediate 29 cis-1-(1-(4H-1,2,4-triazole-4-yl)ethyl)-3-methyl-6-azabicyclo[3.1.1]heptanetrifluoroacetate [ka] tert-butylcis-1-(1-aminoethyl)-3-methyl-6-azabicyclo[3.1.1]heptane-6-carboxylate: To a solution of tert-butylcis-1-cyano-3-methyl-6-azabicyclo[3.1.1]heptane-6-carboxylate (500 mg, 2.12 mmol) in toluene (10 mL), MeMgBr (3 M in Et2O, 1.1 mL) was added at 0°C. The mixture was heated to 20°C and stirred for 2 hours. The reaction mixture was cooled to 0°C, MeOH (2 mL) was added, and the mixture was stirred for 0.2 hours. NaBH4 (88 mg, 2.33 mmol) was added to the reaction mixture and stirred at 0°C for 1 hour. The mixture was quenched at 0°C by adding saturated NH4Cl aqueous solution (10 mL), and then concentrated under reduced pressure. The crude product was pulverized using DCM:MeOH (v:v=10:1, 30 mL), the solid was collected by filtration, and dried under reduced pressure to obtain the title compound. LCMS: m / z = 255.2 [M+H] + .

[0344] tert-butylcis-1-(1-(4H-1,2,4-triazole-4-yl)ethyl)-3-methyl-6-azabicyclo[3.1.1]heptane-6-carboxylate: To a solution of tert-butylcis-1-(1-aminoethyl)-3-methyl-6-azabicyclo[3.1.1]heptane-6-carboxylate (800 mg, 1.57 mmol) in toluene (2 mL), p-TsOH (812 mg, 4.72 mmol) and N'-((Z)-(dimethylamino)methylene)-N,N-dimethylformohydrazoneamide (671 mg, 4.72 mmol) were added under N2 at 20°C. The reaction mixture was heated to 100°C and stirred for 16 hours. The reaction mixture was diluted with H2O (10 mL) and extracted with SiO (3 × 10 mL). The mixed organic layers were washed with brine (10 mL), dried over anhydrous Na₂SO₄, filtered, and concentrated under reduced pressure. The resulting residue was purified by preparative TLC (SiO₂, DCM:MeOH = 10:1) and further purified by preparative HPLC (Phenomenex Gemini-NX 75 × 30 mm × 3 μm; A: 10 mM FA in water, B: MeCN; B% in A: 20%~50%, 9 min) to obtain the title compound. LCMS: m / z = 307.2 [M+H] + .

[0345] To a solution of tert-butylcis-1-(1-(4H-1,2,4-triazole-4-yl)ethyl)-3-methyl-6-azabicyclo[3.1.1]heptane-6-carboxylate (70 mg, 0.23 mmol) in cis-1-(1-(4H-1,2,4-triazole-4-yl)ethyl)-3-methyl-6-azabicyclo[3.1.1]heptane-6-carboxylate (2 mL) in cis-1-(1-(4H-1,2,4-triazole-4-yl)ethyl)-3-methyl-6-azabicyclo[3.1.1]heptane-6-carboxylate (2 mL), TFA (0.5 mL) was added at 20°C, the reaction mixture was stirred for 2 hours, and then concentrated under reduced pressure to obtain the title compound.

[0346] Intermediates 30 and 31 tert-butylcis-3-methyl-1-((4-(trifluoromethyl)-1H-1,2,3-triazole-1-yl)methyl)-6-azabicyclo[3.1.1]heptane-6-carboxylate and tert-butylcis-3-methyl-1-((4-(trifluoromethyl)-2H-1,2,3-triazole-2-yl)methyl)-6-azabicyclo[3.1.1]heptane-6-carboxylate [ka] To a solution of tert-butylcis-3-methyl-1-(((methylsulfonyl)oxy)methyl)-6-azabicyclo[3.1.1]heptane-6-carboxylate (200 mg, 0.63 mmol, a single unknown enantiomer prepared using intermediate 24 by the procedure described for intermediate 16) and 4-(trifluoromethyl)-1H-1,2,3-triazole (172 mg, 1.25 mmol), t-BuONa (120 mg, 1.25 mmol) was added at 25°C. The reaction mixture was heated to 140°C and stirred for 12 hours. The reaction mixture was diluted with H2O (15 mL) and extracted with SiO (3 × 5 mL). The mixed organic layers were dried over anhydrous Na2SO4, filtered, and concentrated under reduced pressure. The resulting residue was purified by preparative TLC (SiO2, PE:SiO=3:1) to obtain intermediate 30, which is tert-butylcis-3-methyl-1-((4-(trifluoromethyl)-1H-1,2,3-triazole-1-yl)methyl)-6-azabicyclo[3.1.1]heptane-6-carboxylate (LCMS: m / z = 361.0 [M+H]). + Intermediate 31, which is tert-butylcis-3-methyl-1-((4-(trifluoromethyl)-2H-1,2,3-triazole-2-yl)methyl)-6-azabicyclo[3.1.1]heptane-6-carboxylate, was obtained as a single unknown enantiomer (LCMS: m / z = 361.0 [M+H]). + ).

[0347] Intermediate 32 cis-3-methyl-1-((4-(trifluoromethyl)-1H-1,2,3-triazole-1-yl)methyl)-6-azabicyclo[3.1.1]heptanetrifluoroacetate [ka] To a solution of tert-butylcis-3-methyl-1-((4-(trifluoromethyl)-1H-1,2,3-triazole-1-yl)methyl)-6-azabicyclo[3.1.1]heptan-6-carboxylate (intermediate 30 mg, 0.08 mmol) in DCM (1 mL), TFA (0.3 mL) was added at 25°C. The reaction mixture was stirred for 1 hour, and then concentrated under reduced pressure to obtain the title compound as a single, unknown enantiomer. LCMS: m / z = 261.0 [M+H] + .

[0348] Intermediate 33 cis-3-methyl-1-((4-(trifluoromethyl)-2H-1,2,3-triazole-2-yl)methyl)-6-azabicyclo[3.1.1]heptanetrifluoroacetate [ka] To a solution of tert-butylcis-3-methyl-1-((4-(trifluoromethyl)-2H-1,2,3-triazole-2-yl)methyl)-6-azabicyclo[3.1.1]heptan-6-carboxylate (intermediate 31, 20 mg, 0.06 mmol) in DCM (1 mL), TFA (0.3 mL) was added at 25°C. The reaction mixture was stirred for 1 hour, and then concentrated under reduced pressure to obtain the title compound as a single, unknown enantiomer. LCMS: m / z = 261.0 [M+H] + .

[0349] Intermediate 34 4-Chloro-3-(1,2,4-triazine-3-yl)aniline [ka] 5-Bromo-2-chlorobenzothioamide: To a solution of 5-bromo-2-chlorobenzonitrile (5 g, 23.10 mmol) in DMF (80 mL), MgCl2 (2.20 g, 23.10 mmol) was added at 0°C, and the reaction mixture was stirred for 0.5 hours. NaSH (3.88 g, 69.30 mmol) was added to the reaction mixture at 0°C, and the mixture was stirred for 2 hours. The reaction mixture was diluted with H2O (500 mL), and the resulting solid was collected by filtration and dried under reduced pressure to obtain the title compound. LCMS: m / z = 249.9, 251.9 [M+H] + .

[0350] 5-Bromo-2-chlorobenzimide hydrazide: To a solution of 5-bromo-2-chlorobenzenecarbothioamide (2 g, 7.98 mmol) in EtOH (30 mL), N2H4·H2O (4.08 g, 79.83 mmol) was added at 25°C. The mixture was heated to 80°C and stirred for 5 hours. The reaction mixture was concentrated under reduced pressure to obtain the title compound. LCMS: m / z = 247.9, 249.9 [M+H] + .

[0351] To a solution of oxyaldehyde (12.84 g, 88.53 mmol, 40% purity) in 3-(5-bromo-2-chlorophenyl)1,2,4-triazine:EtOH (50 mL), 5-bromo-2-chlorobenzimidohydrazide (4.4 g, 17.71 mmol) was added dropwise at 25°C. The reaction mixture was heated to 80°C and stirred for 2 hours, after which the reaction mixture was concentrated under reduced pressure. The resulting residue was purified by column chromatography (SiO2, PE:siRNA = 3:1~1:1) to obtain the crude product, which was then ground using MTBE:PE (3:1, 30 mL) to obtain the title compound. LCMS: m / z = 269.9, 271.9 [M+H] + .

[0352] To a solution of 3-(5-bromo-2-chlorophenyl)-1,2,4-triazine (800 mg, 2.96 mmol) and diphenylmethanymine (804 mg, 4.44 mmol) in 4-chloro-3-(1,2,4-triazine-3-1,4-dioxane (15 mL), Cs2CO3 (1.93 g, 5.91 mmol), Xantphos (342 mg, 0.59 mmol), and Pd2(dba)3 (271 mg, 0.3 mmol) were added under N2 at 25°C. The mixture was heated to 110°C and stirred for 12 hours. The reaction mixture was filtered through a Celite® pad, and the filtrate was concentrated under reduced pressure. The crude substance was dissolved in THF (5 mL) at 25°C, 2 M HCl (5 mL) was added, and the mixture was stirred for 1 hour. The mixture was adjusted to pH 7-8 by adding saturated NaHCO3 aqueous solution. The aqueous phase was extracted with toluene (3 × 10 mL), dried over anhydrous Na2SO4, filtered, and concentrated under reduced pressure. The resulting residue was purified by silica gel column chromatography (PE:toluene = 3:1-1:1) to obtain the title compound. LCMS: m / z = 207.0 [M+H] + .

[0353] Intermediate 35 2-methyl-5-(cis-3-methyl-6-azabicyclo[3.1.1]heptan-1-yl)-1,3,4-oxadiazole [ka] To a solution of 6-(tert-butyl)1-methylcis-3-methyl-6-azabicyclo[3.1.1]heptane-1-carboxylic acid:MeOH (25 mL), a solution of 6-(tert-butyl)1-methylcis-3-methyl-6-azabicyclo[3.1.1]heptane-1,6-dicarboxylate (2 g, 7.43 mmol, prepared from intermediate 24 using the procedure described for intermediate 12) was added to a solution of NaOH (594 mg, 14.85 mmol) in H2O (5 mL) at 20°C. The reaction mixture was stirred at 20°C for 2 hours. The reaction mixture was adjusted to pH=4 by adding 4 M aqueous HCl. The resulting aqueous mixture was extracted with DCM:MeOH = 10:1 (3 × 20 mL). The mixed organic layer was washed with brine (15 mL), dried over anhydrous Na2SO4, filtered, and concentrated under reduced pressure to obtain the title compound. LCMS: m / z = 200.1 [M-tBu+H] + .

[0354] To a solution of cis-6-(tert-butoxycarbonyl)-3-methyl-6-azabicyclo[3.1.1]heptane-6-carboxylate (1.7 g, 6.67 mmol) in tert-butylcis-1-(2-acetylhydrazine-1-carbonyl)-3-methyl-6-azabicyclo[3.1.1]heptane-1-carboxylic acid (1.7 g, 6.67 mmol) in tert-butylcis-1-(20 mL) DMF, acetylhydrazine (987 mg, 13.33 mmol), HATU (4.8 g, 13.33 mmol), and DIEA (2.52 g, 19.98 mmol) were added under N2 conditions at 0°C. The reaction mixture was heated to 20°C and stirred for 12 hours. The reaction mixture was diluted with H2O (50 mL) and extracted with ELISA (3 × 30 mL). The mixed organic layers were washed with brine (20 mL), dried over anhydrous Na₂SO₄, filtered, and concentrated under reduced pressure to obtain the title compound. LCMS: m / z = 212.2 [M-Boc+H] + .

[0355] To a solution of cis-1-(2-acetylhydrazine-1-carbonyl)-3-methyl-6-azabicyclo[3.1.1]heptane-6-carboxylate (5.6 g, 5.30 mmol, 30% purity) in tert-butylcis-3-methyl-1-(5-methyl-1,3,4-oxadiazole-2-yl)-6-azabicyclo[3.1.1]heptane-6-carboxylate:Cs2CO3 (6.91 g, 21.20 mmol) and p-TsCl (1.52 g, 7.95 mmol) were added under N2 at 20°C. The reaction mixture was stirred at 20°C for 12 hours. The reaction mixture was diluted with H2O (20 mL) and extracted with siRNA (3 × 10 mL). The mixed organic layer was washed with brine (10 mL), dried over anhydrous Na2SO4, filtered, and concentrated under reduced pressure. The resulting residue was purified by silica gel column chromatography (PE:SiO = 1:1 to 0:1) to obtain the title compound. LCMS: m / z = 294.2 [M+H] + .

[0356] 2-methyl-5-(cis-3-methyl-6-azabicyclo[3.1.1]heptan-1-yl)-1,3,4-oxadiazole: To a solution of tert-butylcis-3-methyl-1-(5-methyl-1,3,4-oxadiazole-2-yl)-6-azabicyclo[3.1.1]heptan-6-carboxylate (300 mg, 1.02 mmol) and 2,6-lutidine (821 mg, 7.67 mmol) in DCM (10 mL), TMSOTf (681 mg, 3.07 mmol) in DCM (3 mL) was added under N2 at 0°C. The reaction mixture was heated to 25°C and stirred for 12 hours. The reaction mixture was quenched by adding MeOH (0.5 mL) and concentrated under reduced pressure to obtain the title compound. LCMS: m / z = 194.2 [M+H] + .

[0357] Examples 1 and 2 (1R,3R,5S)-N-(2-fluoro-4-methyl-5-(pyrimidine-2-yl)phenyl)-3-methyl-1-(3-methyl-1,2,4-oxadiazole-5-yl)-6-azabicyclo[3.1.1]heptan-6-carboxamide and (1S,3S,5R)-N-(2-fluoro-4-methyl-5-(pyrimidine-2-yl)phenyl)-3-methyl-1-(3-methyl-1,2,4-oxadiazole-5-yl)-6-azabicyclo[3.1.1]heptan-6-carboxamide [ka] To a solution of trans-6-((2-fluoro-4-methyl-5-(pyrimidine-2-yl)phenyl)-3-methyl-1-(3-methyl-1,2,4-oxadiazole-5-yl)-6-azabicyclo[3.1.1]heptane-6-carboxamide:DMF (3 mL), (Z)-N'-hydroxyacetimamide (57 mg, 0.78 mmol) and T3P (993 mg, 1.56 mmol, 50% purity in ethyl acetate) were added under N2 conditions at 25°C. The mixture was heated to 90°C and stirred for 12 hours. The reaction mixture was diluted with H2O (15 mL) and extracted with RINKAN (3 × 5 mL). The mixed organic layer was washed with brine (2 × 5 mL), dried over anhydrous Na2SO4, filtered, and concentrated under reduced pressure. The resulting residue was purified by preparative HPLC (Phenomenex C18 80 × 40 mm × 3 μm; mobile phase: A: 10 mM NH4HCO3 in water, B: MeCN; B% in A: 30%~70%, 8 minutes) to obtain the title compound as a mixture of enantiomers. LCMS: m / z = 423.0 [M+H] + .

[0358] (1R,3R,5S)-N-(2-fluoro-4-methyl-5-pyrimidine-2-ylphenyl)-3-methyl-1-(3-methyl-1,2,4-oxadiazole-5-yl)-6-azabicyclo[3.1.1]heptan-6-carboxamide and (1S,3S,5R)-N-(2-fluoro-4-methyl-5-pyrimidine-2-ylphenyl)-3-methyl-1-(3-methyl-1,2,4-oxadiazole-5-yl)-6-azabicyclo[3.1.1]heptan-6-carboxamide: A mixture of enantiomers, in SFC (DAICEL CHIRALPAK IG (250mm × 30 mm × 10 μm); mobile phase: A: CO2, B: EtOH) at 0.1% Purified by NH3H2O; B% in A: 45%~45%, 8 mins; flow rate: 70 g / min; wavelength: 220 nm; column temperature: 35°C; system back pressure: 100 bar) to trans-N-(2-fluoro-4-methyl-5-(pyrimidine-2-yl)phenyl)-3-methyl-1-(3-methyl-1,2,4-oxadiazole-5-yl)-6-azabicyclo[3.1.1]heptan-6-carboxamide (peak 1 in SFC) Example 1 (LCMS: m / z = 423.2 [M+H]) + ) and trans-N-(2-fluoro-4-methyl-5-(pyrimidine-2-yl)phenyl)-3-methyl-1-(3-methyl-1,2,4-oxadiazole-5-yl)-6-azabicyclo[3.1.1]heptan-6-carboxamide (peak 2 in SFC) Example 2 (LCMS: m / z = 423.2 [M+H] + ) was obtained.

[0359] Examples 3 and 4 (1S,3R,5R)-N-(2-fluoro-5-(5-fluoropyrimidine-2-yl)-4-methylphenyl)-3-methyl-1-(5-methyl-1,3,4-oxadiazole-2-yl)-6-azabicyclo[3.1.1]heptan-6-carboxamide and (1R,3S,5S)-N-(2-fluoro-5-(5-fluoropyrimidine-2-yl)-4-methylphenyl)-3-methyl-1-(5-methyl-1,3,4-oxadiazole-2-yl)-6-azabicyclo[3.1.1]heptan-6-carboxamide [ka] To a solution of triphosgene (335 mg, 1.13 mmol) in cis-6-((2-fluoro-5-(5-fluoropyrimidine-2-yl)-4-methylphenyl)carbamoyl)-3-methyl-6-azabicyclo[3.1.1]heptan-1-carboxylic acid: A mixture of TEA (457 mg, 4.52 mmol) and 2-fluoro-5-(5-fluoropyrimidine-2-yl)-4-methylaniline (500 mg, 2.26 mmol) in THF (7 mL) was added dropwise under N2 at 0°C. The mixture was stirred at 0°C for 1 hour. Next, cis-3-methyl-6-azabicyclo[3.1.1]heptane-1-carboxylate hydrochloride (2.09 g, 2.55 mmol, purity 23.4%) and TEA (344 mg, 3.40 mmol) were added to the mixture. The reaction mixture was then heated to 20°C and stirred for 12 hours. The reaction mixture was diluted with H2O (0.5 mL) and concentrated under reduced pressure. The resulting residue was purified by preparative HPLC (Welch Xtimate C18 250 × 70 mm × 10 μm; mobile phase: A: 10 mM NH4HCO3 in water, B: MeCN; B% in A: 5%~35%, 20 minutes) to obtain the title compound. LCMS: m / z = 403.2 [M+H] + .

[0360] To a solution of cis-6-((2-fluoro-5-(5-fluoropyrimidine-2-yl)-4-methylphenyl)-3-methyl-6-azabicyclo[3.1.1]heptane-6-carboxamide: 380 mg, 0.99 mmol) and acetylhydrazide (110 mg, 1.48 mmol) in cis-1-(2-acetylhydrazine-1-carbonyl)-N-(2-fluoro-5-(5-fluoropyrimidine-2-yl)-4-methylphenyl)carbamoyl)-3-methyl-6-azabicyclo[3.1.1]heptane-1-carboxylic acid ( DMF (8 mL), DIEA (255 mg, 1.98 mmol) and HATU (255 mg, 1.98 mmol) were added under N2 at 0°C. The mixture was heated to 25°C and stirred for 12 hours. The reaction mixture was diluted with H2O (15 mL) and extracted with toluene (3 × 5 mL). The mixed organic layer was washed with brine (2 × 5 mL), dried over anhydrous sodium toluene (Na2SO4), filtered, and concentrated under reduced pressure. The resulting residue was purified by silica gel column chromatography (PE:toluene = 3:1 to 1:1) to obtain the title compound. LCMS: m / z = 459.2 [M+H] + .

[0361] To a solution of cis-N-(2-fluoro-5-(5-fluoropyrimidine-2-yl)-4-methylphenyl)-3-methyl-1-(5-methyl-1,3,4-oxadiazole-2-yl)-6-azabicyclo[3.1.1]heptan-6-carboxamide (250 mg, 0.5 mmol) in MeCN (4 mL), p-TsCl (146 mg, 0.76 mmol) and Cs2CO3 (665 mg, 2.05 mmol) were added under N2 at 25°C. The mixture was stirred at 25°C for 12 hours. The reaction mixture was diluted with H2O (15 mL) and extracted with ethyl acetate (3 × 5 mL). The mixed organic layer was washed with brine (2 × 5 mL), dried over anhydrous sodium 2SO4, filtered, and concentrated under reduced pressure. The resulting residue was purified by preparative TLC (SiO2, PE:EE (ethyl acetate:EtOH = 3:1) = 1:1) to obtain the title compound. 1 H NMR (400 MHz, CDCl3): d 8.66 (s, 2H), 8.59 (d, J = 8.4 Hz, 1H), 8.02 (br s, 1H), 7.00 (d, J = 11.6 Hz, 1H), 4.33 (t, J = 6 Hz, 1H), 3.01-2.90 (m, 2H), 2.83-2.70 (m, 1H), 2.58 (s, 3H), 2.46 (s, 3H), 2.30-2.17 (m, 1H), 1.79-1.73 (m, 1H), 1.55 (d, J = 8.4 Hz, 1H), 1.41-1.35 (m, 1H), 1.10 (d, J = 6.8Hz, 3H). LCMS: m / z = 441.2 [M+H] + .

[0362] (1S,3R,5R)-N-(2-fluoro-5-(5-fluoropyrimidine-2-yl)-4-methylphenyl)-3-methyl-1-(5-methyl-1,3,4-oxadiazole-2-yl)-6-azabicyclo[3.1.1]heptan-6-carboxamide and (1R,3S,5S)-N-(2-fluoro-5-(5-fluoropyrimidine-2-yl)-4-methylphenyl)-3-methyl-1-(5-methyl-1,3,4-oxadiazole-2-yl)-6-azabicyclo[3.1.1]heptan-6-carboxamide: A mixture of enantiomers, in SFC (ChiralPak IH, 250mm × 30mm × 10μm; mobile phase: A: CO2, B: EtOH) at 0.1% Purified by NH3H2O; B% in A: 33%~33%, 10 min; flow rate: 70 g / min; wavelength: 220 nm; column temperature: 35 °C; system back pressure: 100 bar) to obtain cis-N-(2-fluoro-5-(5-fluoropyrimidine-2-yl)-4-methylphenyl)-3-methyl-1-(5-methyl-1,3,4-oxadiazole-2-yl)-6-azabicyclo[3.1.1]heptan-6-carboxamide (peak 1 in SFC) Example 3 (LCMS: m / z = 441.2 [M+H]) + ) and cis-N-(2-fluoro-5-(5-fluoropyrimidine-2-yl)-4-methylphenyl)-3-methyl-1-(5-methyl-1,3,4-oxadiazole-2-yl)-6-azabicyclo[3.1.1]heptan-6-carboxamide (peak 2 in SFC) Example 4 (LCMS: m / z = 441.2 [M+H] + ) was obtained.

[0363] Examples 5 and 6 (1S,3R,5R)-N-(3-(5-fluoropyrimidine-2-yl)-4-(trifluoromethyl)phenyl)-3-methyl-1-(5-methyl-1,3,4-oxadiazole-2-yl)-6-azabicyclo[3.1.1]heptan-6-carboxamide and (1R,3S,5S)-N-(3-(5-fluoropyrimidine-2-yl)-4-(trifluoromethyl)phenyl)-3-methyl-1-(5-methyl-1,3,4-oxadiazole-2-yl)-6-azabicyclo[3.1.1]heptan-6-carboxamide [ka] To a solution of triphosgene (288 mg, 0.97 mmol) in cis-6-((3-(5-fluoropyrimidine-2-yl)-4-(trifluoromethyl)phenyl)carbamoyl)-3-methyl-6-azabicyclo[3.1.1]heptan-1-carboxylic acid:3-(5-fluoropyrimidine-2-yl)-4-(trifluoromethyl)aniline (500 mg, 1.94 mmol) and TEA (590 mg, 5.83 Next, cis-3-methyl-6-azabicyclo[3.1.1]heptane-1-carboxylic acid (2.06 g, 2.65 mmol) and TEA (893 mg, 8.83 mmol) were added to the reaction mixture under N2 at 25°C, and the reaction was stirred for a further 1 hour. The mixture was then concentrated under reduced pressure. The resulting residue was purified by preparative HPLC (Agela DuraShell C18 250 × 70 mm × 10 μm; mobile phase: A: 10 mM NH4HCO3 in water, B: MeCN; B% in A: 22%~52%, 17.0 min) to obtain the title compound. LCMS: m / z = 439.1 [M+H] + .

[0364] To a solution of cis-6-[[3-(5-fluoropyrimidine-2-yl)-4-(trifluoromethyl)phenyl]carbamoyl]-3-methyl-6-azabicyclo[3.1.1]heptane-6-carboxamide:DMF (10 mL), 300 mg, 0.68 mmol of cis-6-[[3-(5-fluoropyrimidine-2-yl)-4-(trifluoromethyl)phenyl]carbamoyl]-3-methyl-6-azabicyclo[3.1.1]heptane-1-carboxylic acid (300 mg, 0.68 mmol) and acetylhydrazide (76 mg, 1.03 mmol) was added under N2 conditions at 0°C. The mixture was heated to 20°C and stirred for 2 hours. The reaction mixture was diluted with H2O (5 mL) and extracted with toluene (3 × 5 mL). The mixed organic layer was washed with brine (3 × 3 mL), dried over anhydrous sodium 2SO4, filtered, and concentrated under reduced pressure. The resulting residue was purified by silica gel column chromatography (PE:toluene = 3:1 to 1:1) to obtain the title compound. LCMS: m / z = 495.1 [M + H] + .

[0365] To a solution of cis-N-(3-(5-fluoropyrimidine-2-yl)-4-(trifluoromethyl)phenyl)-3-methyl-1-(5-methyl-1,3,4-oxadiazole-2-yl)-6-azabicyclo[3.1.1]heptan-6-carboxamide (200 mg, 0.40 mmol) in MeCN (12 mL), TsCl (116 mg, 0.60 mmol) and Cs2CO3 (527 mg, 1.62 mmol) were added under N2 at 25°C. The mixture was stirred at 25°C for 2 hours. The reaction mixture was concentrated under reduced pressure, and the resulting residue was purified by preparative TLC(siRNA) to obtain the title compound. LCMS: m / z = 477.3 [M+H] + .

[0366] (1S,3R,5R)-N-(3-(5-fluoropyrimidine-2-yl)-4-(trifluoromethyl)phenyl)-3-methyl-1-(5-methyl-1,3,4-oxadiazole-2-yl)-6-azabicyclo[3.1.1]heptan-6-carboxamide and (1R,3S,5S)-N-(3-(5-fluoropyrimidine-2-yl)-4-(trifluoromethyl)phenyl)-3-methyl-1-(5-methyl-1,3,4-oxadiazole-2-yl)-6-azabicyclo[3.1.1]heptan-6-carboxamide: A mixture of enantiomers, SFC (ChiralPak IH, 250mm × 30mm × 10μm; mobile phase: A: CO2, B: IPA, 0.1% Separation was performed by NH3H2O ​​(A: B%: 50%~50%, 10 min; flow rate: 70 g / min; wavelength: 220 nm; column temperature: 35 °C; system back pressure: 120 bar) to obtain the crude product of peak 1, which was further purified by preparative HPLC (Waters Xbridge BEH C18 100 × 30 mm × 5 μm; mobile phase: A: 10 mM NH4HCO3 in water, B: MeCN; A: B%: 27%~57%, 8 min) to obtain cis-N-[3-(5-fluoropyrimidine-2-yl)-4-(trifluoromethyl)phenyl]-3-methyl-1-(5-methyl-1,3,4-oxadiazole-2-yl)-6-azabicyclo[3.1.1]heptan-6-carboxamide (peak 1 in SFC) Example 5 (LCMS: m / z = 477.2 [M+H] + ) and cis-N-[3-(5-fluoropyrimidine-2-yl)-4-(trifluoromethyl)phenyl]-3-methyl-1-(5-methyl-1,3,4-oxadiazole-2-yl)-6-azabicyclo[3.1.1]heptan-6-carboxamide (peak 2 in SFC) Example 6 (LCMS: m / z = 477.2 [M+H] + ) was obtained.

[0367] Examples 7 and 8 (1S,3R,5R)-N-(2-fluoro-5-(5-fluoropyrimidine-2-yl)-4-(trifluoromethyl)phenyl)-3-methyl-1-(5-methyl-1,3,4-oxadiazole-2-yl)-6-azabicyclo[3.1.1]heptan-6-carboxamide and (1R,3S,5S)-N-(2-fluoro-5-(5-fluoropyrimidine-2-yl)-4-(trifluoromethyl)phenyl)-3-methyl-1-(5-methyl-1,3,4-oxadiazole-2-yl)-6-azabicyclo[3.1.1]heptan-6-carboxamide [ka] To a solution of triphosgene (135 mg, 0.45 mmol) in THF (5 mL), solutions of 2-fluoro-5-(5-fluoropyrimidine-2-yl)-4-(trifluoromethyl)phenyl)carbamoyl)-3-methyl-6-azabicyclo[3.1.1]heptan-1-carboxylic acid were added dropwise at 0°C under N2 conditions to a solution of triphosgene (135 mg, 0.45 mmol) in THF (5 mL). The mixture was stirred at 0°C for 1 hour. Next, cis-3-methyl-6-azabicyclo[3.1.1]heptane-1-carboxylic acid (966 mg, 1.25 mmol) and TEA (252 mg, 2.49 mmol) were added to the mixture at 25°C. The mixture was stirred at 25°C for 1 hour. The reaction mixture was concentrated under reduced pressure, and the resulting residue was purified by preparative HPLC (Agela DuraShell C18 250 × 70 mm × 10 μm; mobile phase: A: 10 mM NH4HCO3 in water, B: MeCN; B% in A: 15%~45%, 20 minutes) to obtain the title compound. LCMS: m / z = 457.1 [M+H] + .

[0368] To a solution of cis-6-((2-fluoro-5-(5-fluoropyrimidine-2-yl)-4-(trifluoromethyl)phenyl)-3-methyl-6-azabicyclo[3.1.1]heptane-6-carboxamide:DMF (2 mL), 180 mg, 0.39 mmol of cis-6-((2-fluoro-5-(5-fluoropyrimidine-2-yl)-4-(trifluoromethyl)phenyl)carbamoyl)-3-methyl-6-azabicyclo[3.1.1]heptane-1-carboxylic acid (180 mg, 0.39 mmol) and acetylhydrazide (44 mg, 0.59 mmol) were added under N2 conditions at 0°C. The mixture was heated to 25°C and stirred for 2 hours. The reaction mixture was diluted with H2O (15 mL) and extracted with HCl (3 × 5 mL). The mixed organic layer was washed with brine (3 × 3 mL), dried over anhydrous Na2SO4, filtered, and concentrated under reduced pressure. The resulting residue was purified by preparative TLC (SiO2, HCl) to obtain the title compound. LCMS: m / z = 513.4 [M + H] + .

[0369] To a solution of cis-N-(2-fluoro-5-(5-fluoropyrimidine-2-yl)-4-(trifluoromethyl)phenyl)-3-methyl-1-(5-methyl-1,3,4-oxadiazole-2-yl)-6-azabicyclo[3.1.1]heptan-6-carboxamide (100 mg, 0.2 mmol) in MeCN (5 mL), Cs2CO3 (254 mg, 0.78 mmol) and TsCl (56 mg, 0.29 mmol) were added at 25°C. The mixture was stirred at 25°C for 2 hours. The reaction mixture was diluted with H2O (10 mL) and extracted with Âxa (3 × 5 mL). The mixed organic layer was dried over anhydrous Na2SO4, filtered, and concentrated under reduced pressure. The resulting residue was purified by preparative TLC (SiO2, DCM:MeOH = 10:1) to obtain the title compound. LCMS: m / z = 495.3 [M + H] + .

[0370] (1S,3R,5R)-N-(2-fluoro-5-(5-fluoropyrimidine-2-yl)-4-(trifluoromethyl)phenyl)-3-methyl-1-(5-methyl-1,3,4-oxadiazole-2-yl)-6-azabicyclo[3.1.1]heptan-6-carboxamide and (1R,3S,5S)-N-(2-fluoro-5-(5-fluoropyrimidine-2-yl)-4-(trifluoromethyl)phenyl)-3-methyl-1-(5-methyl-1,3,4-oxadiazole-2-yl)-6-azabicyclo[3.1.1]heptan-6-carboxamide: A mixture of enantiomers, in SFC (DAICEL CHIRALPAK IG, 250mm × 30mm × 10μm; mobile phase: A: CO2, B: MeOH) at 0.1% Separation by NH3H2O; B% in A: 40%~40%, 8 min; flow rate: 70 g / min; wavelength: 220 nm; column temperature: 35 °C; system back pressure: 120 bar) yielded cis-N-(2-fluoro-5-(5-fluoropyrimidine-2-yl)-4-(trifluoromethyl)phenyl)-3-methyl-1-(5-methyl-1,3,4-oxadiazole-2-yl)-6-azabicyclo[3.1.1]heptan-6-carboxamide (peak 1 in SFC) Example 7 (LCMS: m / z = 495.2 [M+H]) + ) and cis-N-(2-fluoro-5-(5-fluoropyrimidine-2-yl)-4-(trifluoromethyl)phenyl)-3-methyl-1-(5-methyl-1,3,4-oxadiazole-2-yl)-6-azabicyclo[3.1.1]heptan-6-carboxamide (peak 2 in SFC) Example 8 (LCMS: m / z = 495.1 [M+H] + ) was obtained.

[0371] Examples 9 and 10 (1S,3R,5R)-N-(3-(5-fluoropyrimidine-2-yl)-4-methylphenyl)-3-methyl-1-(pyrimidine-2-yl)-6-azabicyclo[3.1.1]heptan-6-carboxamide and (1R,3S,5S)-N-(3-(5-fluoropyrimidine-2-yl)-4-methylphenyl)-3-methyl-1-(pyrimidine-2-yl)-6-azabicyclo[3.1.1]heptan-6-carboxamide [ka] To a mixture of triphosgene (110 mg, 0.40 mmol) in cis-N-(3-(5-fluoropyrimidine-2-yl)-4-methylphenyl)-3-methyl-1-(pyrimidine-2-yl)-6-azabicyclo[3.1.1]heptan-6-carboxamide:THF (3 mL), 3-(5-fluoropyrimidine-2-yl)-4-methylaniline (150 mg, 0.74 mmol) and TEA (299 mg, 2.95 mmol) were added under N2 conditions at 0°C. The reaction mixture was heated to 20°C and stirred for 1 hour. Next, a solution of cis-3-methyl-1-pyrimidine-2-yl-6-azabicyclo[3.1.1]heptanetrifluoroacetate (120 mg, 0.40 mmol) and TEA (141.27 mg, 1.40 mmol) in THF (2 mL) was added to the above mixture and stirred for 1 hour. The reaction mixture was diluted with H2O (5 mL) and extracted with SiO2 (3 × 5 mL). The mixed organic layer was dried over anhydrous Na2SO4, filtered, and concentrated under reduced pressure. The resulting residue was purified by preparative TLC (SiO2, PE:SiO2 = 1:1) to obtain the title compound. LCMS: m / z = 419.2 [M + H] + .

[0372] (1S,3R,5R)-N-(3-(5-fluoropyrimidine-2-yl)-4-methylphenyl)-3-methyl-1-(pyrimidine-2-yl)-6-azabicyclo[3.1.1]heptan-6-carboxamide and (1R,3S,5S)-N-(3-(5-fluoropyrimidine-2-yl)-4-methylphenyl)-3-methyl-1-(pyrimidine-2-yl)-6-azabicyclo[3.1.1]heptan-6-carboxamide: A mixture of enantiomers, in SFC (DAICEL CHIRALPAK OZ (250mm × 25mm × 10μm); mobile phase: A: CO2, B: EtOH) at 0.1% Separation by NH3H2O; B% in A: 50%~50%, 13 min; flow rate: 70 g / min; wavelength: 220 nm; column temperature: 35 °C; system back pressure: 120 bar) yielded cis-N-(3-(5-fluoropyrimidine-2-yl)-4-methylphenyl)-3-methyl-1-(pyrimidine-2-yl)-6-azabicyclo[3.1.1]heptan-6-carboxamide (peak 1 in SFC) Example 9 (LCMS: m / z = 419.2 [M+H]) + ) and cis-N-(3-(5-fluoropyrimidine-2-yl)-4-methylphenyl)-3-methyl-1-(pyrimidine-2-yl)-6-azabicyclo[3.1.1]heptan-6-carboxamide (peak 2 in SFC) Example 10 (LCMS: m / z = 419.2 [M+H] + ) was obtained.

[0373] Examples 11 and 12 (1S,3R,5R)-1-(5-cyanopyrimidine-2-yl)-N-(3-(5-fluoropyrimidine-2-yl)-4-methylphenyl)-3-methyl-6-azabicyclo[3.1.1]heptan-6-carboxamide and (1R,3S,5S)-1-(5-cyanopyrimidine-2-yl)-N-(3-(5-fluoropyrimidine-2-yl)-4-methylphenyl)-3-methyl-6-azabicyclo[3.1.1]heptan-6-carboxamide [ka] To a mixture of triphosgene (109.52 mg, 0.40 mmol) in cis-1-(5-cyanopyrimidine-2-yl)-N-(3-(5-fluoropyrimidine-2-yl)-4-methylphenyl)-3-methyl-6-azabicyclo[3.1.1]heptan-6-carboxamide:THF (3 mL), 3-(5-fluoropyrimidine-2-yl)-4-methyl-aniline (150 mg, 0.74 mmol) and TEA (298.77 mg, 2.95 mmol) were added under N2 conditions at 0°C. The reaction mixture was heated to 20°C and stirred for 1 hour. Next, a solution of 2-[cis-3-methyl-6-azabicyclo[3.1.1]heptan-1-yl]pyrimidine-5-carbonitrile (172 mg, 0.52 mmol) and TEA (177 mg, 1.75 mmol) in THF (2 mL) was added, and the reaction mixture was stirred for a further 1 hour. The reaction mixture was diluted with H2O (2 mL) and extracted with SiO2 (3 × 5 mL). The mixed organic layer was dried over anhydrous Na2SO4, filtered, and concentrated under reduced pressure. The resulting residue was purified by preparative TLC (SiO2, PE:SiO2 = 1:1) to obtain the title compound. LCMS: m / z = 444.1 [M + H] + .

[0374] A racemic mixture of (1S,3R,5R)-1-(5-cyanopyrimidine-2-yl)-N-(3-(5-fluoropyrimidine-2-yl)-4-methylphenyl)-3-methyl-6-azabicyclo[3.1.1]heptan-6-carboxamide and (1R,3S,5S)-1-(5-cyanopyrimidine-2-yl)-N-(3-(5-fluoropyrimidine-2-yl)-4-methylphenyl)-3-methyl-6-azabicyclo[3.1.1]heptan-6-carboxamide:cis-1-(5-cyanopyrimidine-2-yl)-N-(3-(5-fluoropyrimidine-2-yl)-4-methylphenyl)-3-methyl-6-azabicyclo[3.1.1]heptan-6-carboxamide, SFC (DAICEL Separation was performed by CHIRALCEL OD (250mm × 30mm × 10μm); mobile phase: A: CO2, B: 0.1% NH3H2O ​​in IPA; B% in A: 50%~50%, 13 minutes; flow rate: 70g / min; wavelength: 220nm; column temperature: 35℃; system back pressure: 120bar) to obtain cis-1-(5-cyanopyrimidine-2-yl)-N-(3-(5-fluoropyrimidine-2-yl)-4-methylphenyl)-3-methyl-6-azabicyclo[3.1.1]heptan-6-carboxamide (peak 1 in SFC) Example 11 (LCMS: m / z = 444.2 [M+H]) + ), and cis-1-(5-cyanopyrimidine-2-yl)-N-(3-(5-fluoropyrimidine-2-yl)-4-methylphenyl)-3-methyl-6-azabicyclo[3.1.1]heptan-6-carboxamide (peak 2 in SFC) Example 12 (LCMS: m / z = 444.2 [M+H] + ) was obtained.

[0375] Example 13 cis-1-(3-amino-1,2,4-oxadiazole-5-yl)-N-(2-fluoro-4-methyl-5-(1,2,4-triazine-3-yl)phenyl)-3-methyl-6-azabicyclo[3.1.1]heptan-6-carboxamide [ka] To a mixture of triphosgene (73 mg, 0.25 mmol) in THF (3 mL), a solution of 2-fluoro-4-methyl-5-(1,2,4-triazine-3-yl)aniline (100 mg, 0.49 mmol) and TEA (149 mg, 1.47 mmol) in THF (3 mL) was added dropwise under N2 at 0°C. The reaction mixture was stirred at 0°C for 1 hour, and then cis-3-methyl-6-azabicyclo[3.1.1]heptane-1-carboxylic acid (300 mg, crude, 50% purity) was added to the reaction mixture. The mixture was heated to 20°C and stirred for 12 hours. The reaction mixture was concentrated under reduced pressure, and the resulting residue was purified by preparative HPLC (column: Welch Xtimate C18 250×70mm×10μm; mobile phase: A: 10mM NH4HCO3 in water, B: MeCN; B% in A: 1%~30%, 20 min) to obtain the title compound. LCMS: m / z = 386.2 [M+H] + .

[0376] cis-N 1 -Cyano-N 6To a mixture of cis-6-((2-fluoro-4-methyl-5-(1,2,4-triazine-3-yl)phenyl)-3-methyl-6-azabicyclo[3.1.1]heptane-1,6-dicarboxamide:DMF (7 mL) and cis-6-((2-fluoro-4-methyl-5-(1,2,4-triazine-3-yl)phenyl)carbamoyl)-3-methyl-6-azabicyclo[3.1.1]heptane-1-carboxylic acid (250 mg, 0.65 mmol), sodium (cyanoamino) (207 mg, 3.25 mmol), DIEA (419 mg, 3.24 mmol), and HATU (740 mg, 1.95 mmol) were added under N2 at 0°C. The mixture was heated to 25°C and stirred for 24 hours. The reaction mixture was concentrated under reduced pressure, and the resulting residue was purified by p-HPLC (Waters Xbridge Prep OBD C18 150×40mm×10μm; mobile phase: A: 10mM NH4HCO3 in water, B: MeCN; B% in A: 20%~50%, 8 min) to obtain the title compound. LCMS: m / z = 410.2 [M+H] + .

[0377] cis-1-(3-amino-1,2,4-oxadiazole-5-yl)-N-(2-fluoro-4-methyl-5-(1,2,4-triazine-3-yl)phenyl)-3-methyl-6-azabicyclo[3.1.1]heptan-6-carboxamide:EtOH (5 mL) 1 -Cyano-N 6To a solution of -(2-fluoro-4-methyl-5-(1,2,4-triazine-3-yl)phenyl)-3-methyl-6-azabicyclo[3.1.1]heptan-1,6-dicarboxamide (110 mg, 0.27 mmol), NH2OH·HCl (93 mg, 1.34 mmol) and pyridine (128 mg, 1.61 mmol) were added at 25°C. The reaction mixture was heated to 35°C and stirred for 12 hours. The reaction mixture was diluted with H2O (10 mL) and extracted with DCM:i-PrOH (v:v=3:1) (3 × 15 mL). The mixed organic layer was dried over anhydrous Na2SO4, filtered, and concentrated under reduced pressure. The resulting residue was purified by preparative HPLC (Waters Xbridge BEH C18 100×30mm×10μm; mobile phase: A: 10mM NH4HCO3 in water, B: MeCN; B% in A: 25%~55%, 8 min) to obtain the title compound. LCMS: m / z = 425.2 [M+H] + .

[0378] Examples 14 and 15 (1S,6R)-N-(3-(5-fluoropyrimidine-2-yl)-4-(trifluoromethyl)phenyl)-1-(5-methyl-1,3,4-oxadiazole-2-yl)-7-azabicyclo[4.1.1]octane-7-carboxamide and (1R,6S)-N-(3-(5-fluoropyrimidine-2-yl)-4-(trifluoromethyl)phenyl)-1-(5-methyl-1,3,4-oxadiazole-2-yl)-7-azabicyclo[4.1.1]octane-7-carboxamide [ka] 7-[[3-(5-fluoropyrimidine-2-yl)-4-(trifluoromethyl)phenyl]carbamoyl]-7-azabicyclo[4.1.1]octane-1-carboxylic acid: To a solution of triphosgene (288 mg, 0.972 mmol) in THF (15 mL), TEA (590 mg, 5.83 mmol) and 3-(5-fluoropyrimidine-2-yl)-4-(trifluoromethyl)aniline (500 mg, 1.94 mmol) in THF (15 mL) were added dropwise under N2 at 0°C. The mixture was stirred at 0°C for 1 hour. The reaction mixture was heated to 25°C, and a solution of 7-azabicyclo[4.1.1]octane-1-carboxylic acid (548 mg, 3.53 mmol) in THF (30 mL), followed by TEA (357 mg, 3.53 mmol), was added. The reaction mixture was stirred for 12 hours. The reaction mixture was quenched by adding H2O (1 mL) and concentrated under reduced pressure. The resulting residue was purified by preparative HPLC (Welch Xtimate C18 180 × 70 mm × 10 μm; mobile phase: A: 10 mM NH4HCO3 in water, B: MeCN; B% in A: 10%~40%, 20 minutes) to obtain the title compound. LCMS: m / z = 439.2 [M+H] + .

[0379] To a solution of 7-[[3-(5-fluoropyrimidine-2-yl)-4-(trifluoromethyl)phenyl]-7-azabicyclo[4.1.1]octane-7-carboxamide:DMF (2 mL) containing 7-[[3-(5-fluoropyrimidine-2-yl)-4-(trifluoromethyl)phenyl]carbamoyl]-7-azabicyclo[4.1.1]octane-1-carboxylic acid (250 mg, 0.57 mmol), acetylhydrazine (63 mg, 0.855 mmol), HATU (434 mg, 1.14 mmol), and DIEA (221 mg, 1.71 mmol) were added under N2 conditions at 25°C. The reaction mixture was stirred at 25°C for 2 hours. The reaction mixture was diluted with H2O (5 mL) and extracted with ELISA (3 × 5 mL). The mixed organic layers were washed with brine (5 mL), dried over anhydrous Na₂SO₄, filtered, and concentrated under reduced pressure. The resulting residue was purified by silica gel column chromatography (SiO₂, PE:Â₂ = 3:1~0:1) to obtain the title compound. LCMS: m / z = 495.1 [M+H] + .

[0380] To a solution of 1-(acetamidecarbamoyl)-N-[3-(5-fluoropyrimidine-2-yl)-4-(trifluoromethyl)phenyl]-1-(5-methyl-1,3,4-oxadiazole-2-yl)-7-azabicyclo[4.1.1]octane-7-carboxamide (120 mg, 0.243 mmol) in MeCN (2 mL), Cs2CO3 (316 mg, 0.97 mmol) and TsCl (69 mg, 0.364 mmol) were added at 25°C. The reaction mixture was stirred at 25°C for 12 hours. The reaction mixture was diluted with H2O (5 mL) and extracted with ELISA (3 × 5 mL). The mixed organic layers were washed with brine (5 mL), dried over anhydrous Na₂SO₄, filtered, and concentrated under reduced pressure. The resulting residue was purified by preparative TLC (SiO₂, PE:EE(Â:EtOH=3:1)=1:1) to obtain the title compound. LCMS: m / z = 477.1 [M+H] + .

[0381] (1S,6R)-N-(3-(5-fluoropyrimidine-2-yl)-4-(trifluoromethyl)phenyl)-1-(5-methyl-1,3,4-oxadiazole-2-yl)-7-azabicyclo[4.1.1]octane-7-carboxamide and (1R,6S)-N-(3-(5-fluoropyrimidine-2-yl)-4-(trifluoromethyl)phenyl)-1-(5-methyl-1,3,4-oxadiazole-2-yl)-7-azabicyclo[4.1.1]octane-7-carboxamide: A mixture of enantiomers, SFC(REGIS(s,s)WHELK-O1, 250mm x 30mm, 5μm; mobile phase: A:CO2, B:EtOH, 0.1% Separation by NH3H2O; B% in A: 45%~45%, 10 minutes; flow rate: 70 g / min; wavelength: 220 nm; column temperature: 40°C; system back pressure: 100 bar) yielded N-(3-(5-fluoropyrimidine-2-yl)-4-(trifluoromethyl)phenyl)-1-(5-methyl-1,3,4-oxadiazole-2-yl)-7-azabicyclo[4.1.1]octane-7-carboxamide (peak 1 in SFC) Example 14 (LCMS: m / z = 477.0 [M+H]) + ) and N-(3-(5-fluoropyrimidine-2-yl)-4-(trifluoromethyl)phenyl)-1-(5-methyl-1,3,4-oxadiazole-2-yl)-7-azabicyclo[4.1.1]octane-7-carboxamide (peak 2 in SFC) Example 15 (LCMS: m / z = 477.0 [M+H] + ) was obtained.

[0382] Examples 16 and 17 (1S,3R,5R)-1-((2H-1,2,3-triazole-2-yl)methyl)-N-(3-(5-fluoropyrimidine-2-yl)-4-methylphenyl)-3-methyl-6-azabicyclo[3.1.1]heptan-6-carboxamide and (1R,3S,5S)-1-((2H-1,2,3-triazole-2-yl)methyl)-N-(3-(5-fluoropyrimidine-2-yl)-4-methylphenyl)-3-methyl-6-azabicyclo[3.1.1]heptan-6-carboxamide [ka] To a mixture of triphosgene (110 mg, 0.37 mmol) in cis-1-((2H-1,2,3-triazole-2-yl)methyl)-N-(3-(5-fluoropyrimidine-2-yl)-4-methylphenyl)-3-methyl-6-azabicyclo[3.1.1]heptan-6-carboxamide:THF (8 mL), TEA (149 mg, 1.48 mmol) and 3-(5-fluoropyrimidine-2-yl)-4-methylaniline (150 mg, 0.74 mmol) were added at 0°C. The reaction mixture was stirred at 0°C for 1 hour. Next, cis-1-((2H-1,2,3-triazole-2-yl)methyl)-3-methyl-6-azabicyclo[3.1.1]heptanetrifluoroacetate (301 mg, 0.98 mmol) and TEA (199 mg, 1.96 mmol) in THF (2 mL) were added to the reaction mixture. The reaction mixture was heated to 20°C and stirred for 1 hour. Three drops of water were added to the reaction mixture, and then the mixture was concentrated under reduced pressure. The resulting residue was purified by preparative HPLC (Waters Xbridge Prep OBD C18 150 × 40 mm × 10 μm; mobile phase: A: 10 mM NH4HCO3 in water, B: MeCN; B% in A: 35%~65%, 8.0 minutes) to obtain the title compound. LCMS: m / z = 422.3 [M+H] + .

[0383] (1S,3R,5R)-1-((2H-1,2,3-triazole-2-yl)methyl)-N-(3-(5-fluoropyrimidine-2-yl)-4-methylphenyl)-3-methyl-6-azabicyclo[3.1.1]heptan-6-carboxamide and (1R,3S,5S)-1-((2H-1,2,3-triazole-2-yl)methyl)-N-(3-(5-fluoropyrimidine-2-yl)-4-methylphenyl)-3-methyl-6-azabicyclo[3.1.1]heptan-6-carboxamide: A mixture of enantiomers was subjected to SFC (column: DAIEL CHIRALCEL OZ, 250×25mm ID 10μm; mobile phase: A: CO2, B: MeOH at 0.1%). Separation was performed by NH3H2O ​​(A: B%: 45%, flow rate: 70 g / min, wavelength: 220 nm, column temperature: 35°C, system back pressure: 120 bar) to obtain the first eluted isomer, which was further purified by preparative HPLC (Waters Xbridge BEH C18 100 × 30 mm × 10 μm; mobile phase: A: 10 mM NH4HCO3 in water, B: MeCN; gradient: 35% to 65% B over 8.0 minutes) to obtain cis-1-((2H-1,2,3-triazole-2-yl)methyl)-N-(3-(5-fluoropyrimidine-2-yl)-4-methylphenyl)-3-methyl-6-azabicyclo[3.1.1]heptan-6-carboxamide (peak 1 in SFC) Example 16 (LCMS: m / z = 422.1 [M+H]) + ) and cis-1-((2H-1,2,3-triazole-2-yl)methyl)-N-(3-(5-fluoropyrimidine-2-yl)-4-methylphenyl)-3-methyl-6-azabicyclo[3.1.1]heptan-6-carboxamide (peak 2 in SFC) Example 17 (LCMS: m / z = 422.1 [M+H] + ) was obtained.

[0384] Examples 18 and 19 (1S,3R,5R)-1-((1H-1,2,3-triazole-1-yl)methyl)-N-(3-(5-fluoropyrimidine-2-yl)-4-(trifluoromethyl)phenyl)-3-methyl-6-azabicyclo[3.1.1]heptan-6-carboxamide and (1R,3S,5S)-1-((1H-1,2,3-triazole-1-yl)methyl)-N-(3-(5-fluoropyrimidine-2-yl)-4-(trifluoromethyl)phenyl)-3-methyl-6-azabicyclo[3.1.1]heptan-6-carboxamide [ka] To a mixture of triphosgene (57.69 mg, 0.19 mmol) in cis-1-((1H-1,2,3-triazole-1-yl)methyl)-N-(3-(5-fluoropyrimidine-2-yl)-4-(trifluoromethyl)phenyl)-3-methyl-6-azabicyclo[3.1.1]heptan-6-carboxamide:THF (3 mL) and triphosgene (57.69 mg, 0.19 mmol), 3-(5-fluoropyrimidine-2-yl)-4-(trifluoromethyl)aniline (100 mg, 0.39 mmol) and TEA (118 mg, 1.17 mmol) in THF (2 mL) were added at 0°C. The reaction mixture was stirred at 0°C for 1 hour. Next, cis-1-((1H-1,2,3-triazol-1-yl)methyl)-3-methyl-6-azabicyclo[3.1.1]heptanetrifluoroacetate (81 mg, 0.26 mmol) and TEA (54 mg, 0.53 mmol) were added to the solution at 20°C and stirred for 1 hour. The reaction mixture was quenched by adding 3 drops of water and then concentrated under reduced pressure. The resulting residue was purified by preparative TLC (SiO2, DCM:MeOH = 10:1) to obtain the title compound. LCMS: m / z = 476.4 [M+H] + .

[0385] (1S,3R,5R)-1-((1H-1,2,3-triazole-1-yl)methyl)-N-(3-(5-fluoropyrimidine-2-yl)-4-(trifluoromethyl)phenyl)-3-methyl-6-azabicyclo[3.1.1]heptan-6-carboxamide and (1R,3S,5S)-1-((1H-1,2,3-triazole-1-yl)methyl)-N-(3-(5-fluoropyrimidine-2-yl)-4-(trifluoromethyl)phenyl)-3-methyl-6-azabicyclo[3.1.1]heptan-6-carboxamide: A mixture of enantiomers, in SFC (ChiralPak IH, 250mm x 30mm, 10μm; mobile phase: A: CO2, B: EtOH) at 0.1% Separation by NH3H2O; B% in A: 25%~25%, 4 mins; flow rate: 70 g / min; wavelength: 220 nm; column temperature: 35°C; system back pressure: 125 bar) yielded cis-1-((1H-1,2,3-triazole-1-yl)methyl)-N-(3-(5-fluoropyrimidine-2-yl)-4-(trifluoromethyl)phenyl)-3-methyl-6-azabicyclo[3.1.1]heptan-6-carboxamide (peak 1 in SFC) Example 18 (LCMS: m / z = 476.4 [M+H]) + ) and cis-1-((1H-1,2,3-triazole-1-yl)methyl)-N-(3-(5-fluoropyrimidine-2-yl)-4-(trifluoromethyl)phenyl)-3-methyl-6-azabicyclo[3.1.1]heptan-6-carboxamide (peak 2 in SFC) Example 19 (LCMS: m / z = 476.4 [M+H] + ) was obtained.

[0386] Examples 20 and 21 (1S,3R,5R)-N-(3-(1,2,4-triazin-3-yl)-4-(trifluoromethyl)phenyl)-1-((1H-1,2,3-triazol-1-yl)methyl)-3-methyl-6-azabicyclo[3.1.1]heptan-6-carboxamide and (1R,3S,5S)-N-(3-(1,2,4-triazin-3-yl)-4-(trifluoromethyl)phenyl)-1-((1H-1,2,3-triazol-1-yl)methyl)-3-methyl-6-azabicyclo[3.1.1]heptan-6-carboxamide [ka] To a mixture of triphosgene (74 mg, 0.25 mmol) in cis-N-(3-(1,2,4-triazin-3-yl)-4-(trifluoromethyl)phenyl)-1-((1H-1,2,3-triazole-1-yl)methyl)-3-methyl-6-azabicyclo[3.1.1]heptan-6-carboxamide:THF (3 ml), TEA (150 mg, 1.50 mmol) and (1,2,4-triazin-3-yl)-4-(trifluoromethyl)aniline (120 mg, 0.5 mmol) were added under N2 at 0°C, and the reaction mixture was stirred for 1 hour. Next, cis-1-((1H-1,2,3-triazol-1-yl)methyl)-3-methyl-6-azabicyclo[3.1.1]heptanetrifluoroacetate (180 mg, 0.94 mmol) was added to the solution at 25°C and stirred for 2 hours. The reaction mixture was quenched by adding 3 drops of water and then concentrated under reduced pressure. The resulting residue was purified by preparative TLC (SiO2, siRNA) to obtain the title compound. LCMS: m / z = 459.2 [M + H] + .

[0387] (1S,3R,5R)-N-(3-(1,2,4-triazin-3-yl)-4-(trifluoromethyl)phenyl)-1-((1H-1,2,3-triazol-1-yl)methyl)-3-methyl-6-azabicyclo[3.1.1]heptan-6-carboxamide and (1R,3S,5S)-N-(3-(1,2,4-triazin-3-yl)-4-(trifluoromethyl)phenyl)-1-((1H-1,2,3-triazol-1-yl)methyl)-3-methyl-6-azabicyclo[3.1.1]heptan-6-carboxamide: A mixture of enantiomers was subjected to SFC (column: REGIS(s,s)WHELK-O1, 250mm × 30mm, 10μm; mobile phase: A:CO2, B:MeOH at 0.1%). Separation was performed by NH3H2O; B% in A: 50%~50%, 10 mins; flow rate: 80 g / min; wavelength: 220 nm; column temperature: 40°C; system back pressure: 100 bar) to obtain cis-3-methyl-N-[3-(1,2,4-triazine-3-yl)-4-(trifluoromethyl)phenyl]-1-(triazole-1-ylmethyl)-6-azabicyclo[3.1.1]heptan-6-carboxamide (peak 1 in SFC) Example 20 and cis-3-methyl-N-[3-(1,2,4-triazine-3-yl)-4-(trifluoromethyl)phenyl]-1-(triazole-1-ylmethyl)-6-azabicyclo[3.1.1]heptan-6-carboxamide (peak 2 in SFC) Example 21 (LCMS: m / z = 459.2 [M+H] + ) was obtained.

[0388] Examples 22 and 23 (1S,3R,5R)-1-((4H-1,2,4-triazole-4-yl)methyl)-N-(3-(5-fluoropyrimidine-2-yl)-4-methylphenyl)-3-methyl-6-azabicyclo[3.1.1]heptan-6-carboxamide and (1R,3S,5S)-1-((4H-1,2,4-triazole-4-yl)methyl)-N-(3-(5-fluoropyrimidine-2-yl)-4-methylphenyl)-3-methyl-6-azabicyclo[3.1.1]heptan-6-carboxamide [ka] To a mixture of triphosgene (65 mg, 0.22 mmol) in cis-1-((4H-1,2,4-triazole-4-yl)methyl)-N-(3-(5-fluoropyrimidine-2-yl)-4-methylphenyl)-3-methyl-6-azabicyclo[3.1.1]heptan-6-carboxamide:THF (2 mL), 3-(5-fluoropyrimidine-2-yl)-4-methylaniline (100 mg, 0.49 mmol) and TEA (199 mg, 1.97 mmol) were added under N2 conditions at 0°C. The reaction mixture was heated to 20°C and stirred for 2 hours. Then, cis-1-((4H-1,2,4-triazole-4-yl)methyl)-3-methyl-6-azabicyclo[3.1.1]heptane (100 mg, 0.33 mmol) and TEA (141.27 mg, 1.40 mmol) were added to the reaction mixture, and the mixture was stirred for a further 1 hour. The reaction mixture was quenched by adding 2 drops of water, and then concentrated under reduced pressure. The resulting residue was purified by preparative TLC (SiO2, SiO2) to obtain the title compound. LCMS: m / z = 422.2 [M+H] + .

[0389] (1S,3R,5R)-1-((4H-1,2,4-triazole-4-yl)methyl)-N-(3-(5-fluoropyrimidine-2-yl)-4-methylphenyl)-3-methyl-6-azabicyclo[3.1.1]heptan-6-carboxamide and (1R,3S,5S)-1-((4H-1,2,4-triazole-4-yl)methyl)-N-(3-(5-fluoropyrimidine-2-yl)-4-methylphenyl)-3-methyl-6-azabicyclo[3.1.1]heptan-6-carboxamide: A mixture of enantiomers was subjected to SFC (column: REGIS(s,s)WHELK-O1, 250mm × 30mm, 5μm; mobile phase: A:CO2, B:MeOH at 0.1%). Separation by NH3H2O; B% in A: 50%~50%, 10 min; flow rate: 70 g / min; wavelength: 220 nm; column temperature: 40 °C; system back pressure: 100 bar) yielded cis-1-((4H-1,2,4-triazole-4-yl)methyl)-N-(3-(5-fluoropyrimidine-2-yl)-4-methylphenyl)-3-methyl-6-azabicyclo[3.1.1]heptan-6-carboxamide (peak 1 in SFC) Example 22 (LCMS: m / z = 422.2 [M+H]) + ) and cis-1-((4H-1,2,4-triazole-4-yl)methyl)-N-(3-(5-fluoropyrimidine-2-yl)-4-methylphenyl)-3-methyl-6-azabicyclo[3.1.1]heptan-6-carboxamide (peak 2 in SFC) Example 23 (LCMS m / z = 422.2 [M+H] + ) was obtained.

[0390] Examples 24 and 25 (1S,3S,5R)-N-(3-(5-fluoropyrimidine-2-yl)-4-(trifluoromethyl)phenyl)-3-methyl-1-(5-methyl-1,3,4-oxadiazole-2-yl)-6-azabicyclo[3.1.1]heptan-6-carboxamide and (1R,3R,5S)-N-(3-(5-fluoropyrimidine-2-yl)-4-(trifluoromethyl)phenyl)-3-methyl-1-(5-methyl-1,3,4-oxadiazole-2-yl)-6-azabicyclo[3.1.1]heptan-6-carboxamide [ka] A mixture of trans-6-((3-(5-fluoropyrimidine-2-yl)-4-(trifluoromethyl)phenyl)carbamoyl)-3-methyl-6-azabicyclo[3.1.1]heptan-1-carboxylic acid:THF (15 mL) and triphosgene (288 mg, 0.97 mmol) was added dropwise at 0°C to a mixture of THF (15 mL) containing 3-(5-fluoropyrimidine-2-yl)-4-(trifluoromethyl)aniline (500 mg, 1.94 mmol) and TEA (393 mg, 3.89 mmol). The reaction mixture was heated to 20°C and stirred for 1 hour. Next, trans-3-methyl-6-azabicyclo[3.1.1]heptane-1-carboxylic acid (400 mg, 1.41 mmol) and TEA (286 mg, 2.83 mmol) were added at 20°C, and the mixture was stirred for 1 hour. The reaction mixture was quenched by adding H2O (5 mL) and concentrated under reduced pressure. The resulting residue was purified by preparative HPLC (column: Welch Xtimate C18 250 × 70 mm × 10 μm; mobile phase: A: 0.05% NH3H2O ​​+ 10 mM NH4HCO3 in water, B: MeCN; B% in A: 20%~45%, 20.0 minutes) to obtain the title compound. LCMS: m / z = 439.2 [M+H] + .

[0391] To a mixture of trans-6-((3-(5-fluoropyrimidine-2-yl)-4-(trifluoromethyl)phenyl)-3-methyl-6-azabicyclo[3.1.1]heptane-6-carboxamide:DMF (5 mL), trans-6-((3-(5-fluoropyrimidine-2-yl)-4-(trifluoromethyl)phenyl)carbamoyl)-3-methyl-6-azabicyclo[3.1.1]heptane-1-carboxylic acid (210 mg, 0.48 mmol) and acetylhydrazine (53 mg, 0.72 mmol) was added at 0°C. The reaction mixture was heated to 20°C and stirred for 2 hours. Next, the reaction mixture was diluted with H2O (10 mL) and extracted with  (3 × 5 mL). The mixed organic layer was washed with brine (5 mL), dried over anhydrous Na2SO4, filtered, and concentrated under reduced pressure. The resulting residue was purified by preparative TLC (SiO2, DCM:MeOH = 20:1) to obtain the title compound. LCMS: m / z = 495.3 [M + H] + .

[0392] To a mixture of trans-N-(3-(5-fluoropyrimidine-2-yl)-4-(trifluoromethyl)phenyl)-3-methyl-1-(5-methyl-1,3,4-oxadiazole-2-yl)-6-azabicyclo[3.1.1]heptan-6-carboxamide (100 mg, 0.20 mmol) in MeCN (4 mL), Cs2CO3 (263.59 mg, 0.81 mmol) and TsCl (58 mg, 0.30 mmol) were added at 20°C. The mixture was heated to 20°C and stirred for 2 hours. The reaction mixture was diluted with H2O (3 mL) and extracted with DCM:MeOH (V:V=10:1) (3 × 5 mL). The mixed organic layer was dried over anhydrous Na2SO4, filtered, and concentrated under reduced pressure. The resulting residue was purified by preparative TLC (SiO2, DCM:MeOH=20:1) to obtain the title compound. LCMS: m / z = 477.0 [M+H] + .

[0393] (1S,3S,5R)-N-(3-(5-fluoropyrimidine-2-yl)-4-(trifluoromethyl)phenyl)-3-methyl-1-(5-methyl-1,3,4-oxadiazole-2-yl)-6-azabicyclo[3.1.1]heptan-6-carboxamide and (1R,3R,5S)-N-(3-(5-fluoropyrimidine-2-yl)-4-(trifluoromethyl)phenyl)-3-methyl-1-(5-methyl-1,3,4-oxadiazole-2-yl)-6-azabicyclo[3.1.1]heptan-6-carboxamide: A mixture of enantiomers, in SFC (Chiralpak IH-3, 50 × 4.6 mm ID, 3 μm; mobile phase: A: CO2, B: EtOH) at 0.1% Separation was performed using NH3H2O ​​(A = B%: 50%~50%, flow rate: 70 g / min, wavelength: 220 nm, column temperature: 35 °C, system back pressure: 120 bar) to obtain trans-N-(3-(5-fluoropyrimidine-2-yl)-4-(trifluoromethyl)phenyl)-3-methyl-1-(5-methyl-1,3,4-oxadiazole-2-yl)-6-azabicyclo[3.1.1]heptan-6-carboxamide (peak 1 in SFC) Example 24, and trans-N-(3-(5-fluoropyrimidine-2-yl)-4-(trifluoromethyl)phenyl)-3-methyl-1-(5-methyl-1,3,4-oxadiazole-2-yl)-6-azabicyclo[3.1.1]heptan-6-carboxamide (peak 2 in SFC) Example 25.

[0394] Examples 26 and 27 (1S,3R,5R)-N-(2-fluoro-5-(pyridazin-3-yl)-4-(trifluoromethyl)phenyl)-3-methyl-1-(5-methyl-1,3,4-oxadiazole-2-yl)-6-azabicyclo[3.1.1]heptan-6-carboxamide and (1R,3S,5S)-N-(2-fluoro-5-(pyridazin-3-yl)-4-(trifluoromethyl)phenyl)-3-methyl-1-(5-methyl-1,3,4-oxadiazole-2-yl)-6-azabicyclo[3.1.1]heptan-6-carboxamide [ka] cis-6-((2-fluoro-5-(pyridazin-3-yl)-4-(trifluoromethyl)phenyl)carbamoyl)-3-methyl-6-azabicyclo[3.1.1]heptane-1-carboxylic acid: To a solution of triphosgene (375 mg, 1.26 mmol) in THF (20 mL), a solution of TEA (767 mg, 7.58 mmol) and 2-fluoro-5-(pyridazin-3-yl)-4-(trifluoromethyl)aniline (650 mg, 2.53 mmol) in THF (20 mL) was added at 25°C. The mixture was stirred at 25°C for 1 hour. Next, cis-3-methyl-6-azabicyclo[3.1.1]heptane-1-carboxylic acid (2.35 g, 3.03 mmol) and TEA (767 mg, 7.58 mmol) were added to the above mixture at 25°C. The mixture was stirred at 25°C for 2 hours. The reaction mixture was quenched by adding H2O (0.5 mL) and concentrated under reduced pressure. The resulting residue was purified by preparative HPLC (column: Welch Xtimate C18 250 × 100 mm × 10 μm; mobile phase: A: 10 mM NH4HCO3 in water, B: MeCN; B% in A: 5%~40%, 20 min) to obtain the title compound. LCMS: m / z = 439.1 [M+H] + .

[0395] To a solution of cis-6-((2-fluoro-5-(pyridazin-3-yl)-4-(trifluoromethyl)phenyl)-3-methyl-6-azabicyclo[3.1.1]heptane-6-carboxamide: 780 mg, 1.78 mmol) of cis-6-((2-fluoro-5-(pyridazin-3-yl)-4-(trifluoromethyl)phenyl)carbamoyl)-3-methyl-6-azabicyclo[3.1.1]heptane-1-carboxylic acid (780 mg, 1.78 mmol) in DMF (6 mL), acetylhydrazine (198 mg, 2.67 mmol), DIEA (690 mg, 5.34 mmol), and HATU (1.35 g, 3.56 mmol) were added at 25°C, and the mixture was stirred for 12 hours. The reaction mixture was diluted with H2O (20 mL) and extracted with HCl (3 × 10 mL). The mixed organic layer was washed with brine (10 mL), dried over anhydrous Na2SO4, filtered, and concentrated under reduced pressure. The resulting residue was purified by silica gel column chromatography (HCl) to obtain the title compound. LCMS: m / z = 495.1 [M+H] + .

[0396] To a solution of cis-N-(2-fluoro-5-(pyridazin-3-yl)-4-(trifluoromethyl)phenyl)-3-methyl-1-(5-methyl-1,3,4-oxadiazole-2-yl)-6-azabicyclo[3.1.1]heptan-6-carboxamide (50 mg, 0.10 mmol) in MeCN (2 mL), p-TsCl (29 mg, 0.15 mmol) and Cs2CO3 (132 mg, 0.40 mmol) were added at 25°C, and the mixture was stirred for 12 hours. The reaction mixture was diluted with H2O (5 mL) and extracted with ₹ (3 × 5 mL). The mixed organic layer was washed with brine (5 mL), dried over anhydrous Na2SO4, filtered, and concentrated under reduced pressure. The resulting residue was purified by preparative TLC (SiO2, DCM:MeOH = 10:1) to obtain the title compound. LCMS: m / z = 477.1 [M + H] + .

[0397] (1S,3R,5R)-N-(2-fluoro-5-(pyridazin-3-yl)-4-(trifluoromethyl)phenyl)-3-methyl-1-(5-methyl-1,3,4-oxadiazole-2-yl)-6-azabicyclo[3.1.1]heptan-6-carboxamide and (1R,3S,5S)-N-(2-fluoro-5-(pyridazin-3-yl)-4-(trifluoromethyl)phenyl)-3-methyl-1-(5-methyl-1,3,4-oxadiazole-2-yl)-6-azabicyclo[3.1.1]heptan-6-carboxamide: A mixture of enantiomers, 0.1% in SFC (DAICEL CHIRALCEL OZ, 250mm × 25mm × 10μm; mobile phase: A: CO2, B: MeOH) Separation by NH3H2O; B% in A: 38%~38%, 12 mins; flow rate: 70 g / min; wavelength: 220 nm; column temperature: 40°C; system back pressure: 100 bar) yielded cis-N-(2-fluoro-5-(pyridazin-3-yl)-4-(trifluoromethyl)phenyl)-3-methyl-1-(5-methyl-1,3,4-oxadiazole-2-yl)-6-azabicyclo[3.1.1]heptan-6-carboxamide) (peak 1 in SFC) Example 26 (LCMS: m / z = 477.0 [M+H] + ) and cis-N-(2-fluoro-5-(pyridazin-3-yl)-4-(trifluoromethyl)phenyl)-3-methyl-1-(5-methyl-1,3,4-oxadiazole-2-yl)-6-azabicyclo[3.1.1]heptan-6-carboxamide (peak 2 in SFC) Example 27 (LCMS: m / z = 477.0 [M+H] + ) was obtained.

[0398] Examples 28 and 29 (1S,3R,5R)-N-(3-(5-chloropyridazine-3-yl)-4-methylphenyl)-3-methyl-1-(3-methyl-1,2,4-oxadiazole-5-yl)-6-azabicyclo[3.1.1]heptan-6-carboxamide (1R,3S,5S)-N-(3-(5-chloropyridazine-3-yl)-4-methylphenyl)-3-methyl-1-(3-methyl-1,2,4-oxadiazole-5-yl)-6-azabicyclo[3.1.1]heptan-6-carboxamide [ka] To a solution of triphosgene (637 mg, 2.14 mmol) in THF (10 mL), solutions of TEA (1.74 g, 17.16 mmol) and 4-methyl-3-(4,4,5,5-tetramethyl-1,3,2-dioxaborolan-2-yl)aniline (1 g, 4.29 mmol) in THF (10 mL) were added under N2 conditions at 0°C, and the reaction mixture was stirred at 0°C for 1 hour. Next, a solution of cis-3-methyl-6-azabicyclo[3.1.1]heptane-1-carboxylic acid (4.31 g, 5.14 mmol) in THF (5 mL) and TEA (867 mg, 8.57 mmol) was added to the reaction solution, and the mixture was heated to 25°C and stirred for 2 hours. The mixture was concentrated under reduced pressure, and the resulting residue was purified by preparative HPLC (Welch Xtimate C18 250 × 100 mm × 10 μm; mobile phase: A: 10 mM NH4HCO3 in water, B: MeCN; B% in A: 10%~45%, 22 min) to obtain the title compound. LCMS: m / z = 415.1 [M+H] + .

[0399] To a solution of 3-methyl-6-[[4-methyl-3-(4,4,5,5-tetramethyl-1,3,2-dioxaborolan-2-yl)phenyl]carbamoyl]-6-azabicyclo[3.1.1]heptane-1-carboxylic acid (370 mg, 0.89 mmol) and 3,5-dichloropyridazine (160 mg, 1.07 mmol) in 1,4-dioxane (15 mL) and H2O (1.5 mL), Pd(dppf)Cl2 (65 mg, 0.08 mmol) and K2CO3 (370 mg, 2.68 mmol) were added under N2 at 25°C. The reaction mixture was heated to 100°C and stirred for 3 hours. The reaction mixture was diluted with H2O (10 mL) and extracted with RINKAN (3 × 10 mL). The mixed organic layer was washed with brine (10 mL), dried over anhydrous Na2SO4, filtered, and concentrated under reduced pressure. The resulting residue was purified by preparative HPLC (Phenomenex luna C18 100 × 40 mm × 5 μm; mobile phase: A: FA in water, B: MeCN; B% in A: 20%~60%, 8 min) to obtain the title compound. LCMS: m / z = 401.1 [M+H] + .

[0400] To a solution of 6-[[3-(5-chloropyridazin-3-yl)-4-methylphenyl]carbamoyl]-3-methyl-6-azabicyclo[3.1.1]heptane-6-carboxamide:DMF (3 mL) containing 6-[[3-(5-chloropyridazin-3-yl)-4-methylphenyl]carbamoyl]-3-methyl-6-azabicyclo[3.1.1]heptane-1-carboxylic acid (140 mg, 0.35 mmol) and N'-hydroxyacetamidine (39 mg, 0.52 mmol), TEA (106 mg, 1.05 mmol) and T3P (667 mg, 1.05 mmol, 50% purity in ethyl acetate) were added under N2 conditions at 25°C. The reaction mixture was heated to 90°C and stirred for 12 hours. Next, the reaction mixture was diluted with H2O (5 mL) and extracted with ₹ (3 × 5 mL). The mixed organic layer was washed with brine (5 mL), dried over anhydrous Na2SO4, filtered, and concentrated under reduced pressure. The resulting residue was purified by preparative TLC (SiO2, ₹) to obtain the title compound. LCMS: m / z = 439.2 [M + H] + .

[0401] (1S,3R,5R)-N-(3-(5-chloropyridazin-3-yl)-4-methylphenyl)-3-methyl-1-(3-methyl-1,2,4-oxadiazole-5-yl)-6-azabicyclo[3.1.1]heptan-6-carboxamide and (1R,3S,5S)-N-(3-(5-chloropyridazin-3-yl)-4-methylphenyl)-3-methyl-1-(3-methyl-1,2,4-oxadiazole-5-yl)-6-azabicyclo[3.1.1]heptan-6-carboxamide: A mixture of enantiomers, in SFC (DAICEL CHIRALCEL OD, 250×30mm, 10μm; mobile phase: A:CO2, B:MeOH) at 0.1% Separation was performed by NH3H2O ​​(A, B%: 35%~35%, 10 min; flow rate: 70 g / min; wavelength: 220 nm; column temperature: 35°C; system back pressure: 120 bar) to obtain N-(3-(5-chloropyridazin-3-yl)-4-methylphenyl)-3-methyl-1-(3-methyl-1,2,4-oxadiazole-5-yl)-6-azabicyclo[3.1.1]heptan-6-carboxamide (peak 1 in SFC) Example 28 and N-(3-(5-chloropyridazin-3-yl)-4-methylphenyl)-3-methyl-1-(3-methyl-1,2,4-oxadiazole-5-yl)-6-azabicyclo[3.1.1]heptan-6-carboxamide (peak 2 in SFC) Example 29, and these were separated by preparative HPLC (Waters Xbridge). Further purification was performed using BEH, C18, 100×30mm×10μm; mobile phase: A: 10mM NH4HCO3 in water, B: MeCN; B% in A: 30%~60%; 8 mins). The following compounds were prepared as described above, or using similar procedures.

[0402] Examples 30 and 31 (1S,3R,5R)-N-(3-(5-fluoropyrimidine-2-yl)-4-methylphenyl)-3-methyl-1-(5-methyl-1,3,4-oxadiazole-2-yl)-6-azabicyclo[3.1.1]heptan-6-carboxamide and (1R,3S,5S)-N-(3-(5-fluoropyrimidine-2-yl)-4-methylphenyl)-3-methyl-1-(5-methyl-1,3,4-oxadiazole-2-yl)-6-azabicyclo[3.1.1]heptan-6-carboxamide [ka] A mixture of enantiomers was separated by SFC (ChiralPak IH, 250mm × 30mm, 10μm; mobile phase: A: CO2, B: 0.1% NH3H2O ​​in EtOH; B% in A: 27%~27%, 13 min; flow rate: 70 g / min; wavelength: 220 nm; column temperature: 35°C; system back pressure: 120 bar) to obtain cis-N-(3-(5-fluoropyrimidine-2-yl)-4-methylphenyl)-3-methyl-1-(5-methyl-1,3,4-oxadiazole-2-yl)-6-azabicyclo[3.1.1]heptan-6-carboxamide (peak 1 in SFC) Example 30 (LCMS: m / z = 423.1 [M+H]) + ) and cis-N-(3-(5-fluoropyrimidine-2-yl)-4-methylphenyl)-3-methyl-1-(5-methyl-1,3,4-oxadiazole-2-yl)-6-azabicyclo[3.1.1]heptan-6-carboxamide (peak 2 in SFC) Example 31 (LCMS: m / z = 423.1 [M+H] + ) was obtained.

[0403] Examples 32 and 33 (1S,3R,5R)-3-methyl-1-(3-methyl-1,2,4-oxadiazole-5-yl)-N-(4-methyl-3-(1,2,4-triazine-3-yl)phenyl)-6-azabicyclo[3.1.1]heptan-6-carboxamide and (1R,3S,5S)-3-methyl-1-(3-methyl-1,2,4-oxadiazole-5-yl)-N-(4-methyl-3-(1,2,4-triazine-3-yl)phenyl)-6-azabicyclo[3.1.1]heptan-6-carboxamide [ka] A mixture of enantiomers was separated by SFC (ChiralPak IH, 250mm × 30mm × 10μm; mobile phase: A: CO2, B: 0.1% NH3H2O ​​in MeOH; B% in A: 40%~40%, 11 min; flow rate: 70 g / min; wavelength: 220 nm; column temperature: 35°C; system back pressure: 120 bar) to obtain cis-3-methyl-1-(3-methyl-1,2,4-oxadiazole-5-yl)-N-(4-methyl-3-(1,2,4-triazine-3-yl)phenyl)-6-azabicyclo[3.1.1]heptan-6-carboxamide (peak 1 in SFC) Example 32 (LCMS: m / z = 406.1 [M+H]) + ) and cis-3-methyl-1-(3-methyl-1,2,4-oxadiazole-5-yl)-N-(4-methyl-3-(1,2,4-triazine-3-yl)phenyl)-6-azabicyclo[3.1.1]heptan-6-carboxamide (peak 2 in SFC) Example 33 (LCMS: m / z = 406.1 [M+H] + ) was obtained.

[0404] Examples 34 and 35 (1S,3R,5R)-1-((1H-1,2,4-triazole-1-yl)methyl)-N-(3-(5-fluoropyrimidine-2-yl)-4-methylphenyl)-3-methyl-6-azabicyclo[3.1.1]heptan-6-carboxamide and (1R,3S,5S)-1-((1H-1,2,4-triazole-1-yl)methyl)-N-(3-(5-fluoropyrimidine-2-yl)-4-methylphenyl)-3-methyl-6-azabicyclo[3.1.1]heptan-6-carboxamide [ka] A mixture of enantiomers was separated by SFC (REGIS(s,s) WHELK-O1), 250 mm × 30 mm × 5 μm; mobile phase: A: CO2, B: 0.1% NH3H2O ​​in IPA; B% in A: 45%~45%, 13 minutes; flow rate: 70 g / min; wavelength: 220 nm; column temperature: 35 °C; system back pressure: 120 bar) to obtain cis-1-((1H-1,2,4-triazole-1-yl)methyl)-N-(3-(5-fluoropyrimidine-2-yl)-4-methylphenyl)-3-methyl-6-azabicyclo[3.1.1]heptan-6-carboxamide (peak 1 in SFC) Example 34 (LCMS: m / z = 422.2 [M+H]) + ) and cis-1-((1H-1,2,4-triazole-1-yl)methyl)-N-(3-(5-fluoropyrimidine-2-yl)-4-methylphenyl)-3-methyl-6-azabicyclo[3.1.1]heptan-6-carboxamide (peak 2 in SFC) were obtained in Example 35. 1H NMR (400 MHz, CDCl3): δ 8.70 (s, 2H), 8.32 (s, 1H), 8.02 (s, 1H), 7.82 (d, J = 2.0 Hz, 1H), 7.48 (dd, J = 2.4, 8.4 Hz, 1H), 7.26-7.23 (m, 1H), 6.38-6.10 (m, 1H), 4.91-4.21 (m, 2H), 4.00 (t, J = 5.6 Hz, 1H), 2.55 (s, 3H), 2.59-2.42 (m, 2H), 2.24-2.12 (m, 2H), 1.44-1.32 (m, 2H), 1.16 (d, J = 8.4 Hz, 1H), 1.07 (d, J = 6.4 Hz, 3H). LCMS: m / z = 422.2 [M+H] + .

[0405] Examples 36 and 37 (1S,3R,5R)-1-((1H-1,2,3-triazole-1-yl)methyl)-N-(3-(5-fluoropyrimidine-2-yl)-4-methylphenyl)-3-methyl-6-azabicyclo[3.1.1]heptan-6-carboxamide and (1R,3S,5S)-1-((1H-1,2,3-triazole-1-yl)methyl)-N-(3-(5-fluoropyrimidine-2-yl)-4-methylphenyl)-3-methyl-6-azabicyclo[3.1.1]heptan-6-carboxamide [ka] A mixture of enantiomers was separated by SFC (REGIS(s,s)WHELK-O1, 250mm × 30mm, 5μm; mobile phase: A: CO2, B: 0.1% NH3H2O ​​in EtOH; B% in A: 50%~50%; flow rate: 70g / min; wavelength: 220nm; column temperature: 35℃; system back pressure: 120bar) to obtain cis-1-((1H-1,2,3-triazole-1-yl)methyl)-N-(3-(5-fluoropyrimidine-2-yl)-4-methylphenyl)-3-methyl-6-azabicyclo[3.1.1]heptan-6-carboxamide (peak 1 in SFC) Example 36 (LCMS: m / z = 422.2 [M+H]) + ) and cis-1-((1H-1,2,3-triazole-1-yl)methyl)-N-(3-(5-fluoropyrimidine-2-yl)-4-methylphenyl)-3-methyl-6-azabicyclo[3.1.1]heptan-6-carboxamide (peak 2 in SFC) were obtained in Example 37. 1 H NMR (400 MHz, MeOD): δ 8.83 (s, 2H), 7.90 (s, 1H), 7.87 (d, J = 2.0 Hz, 1H), 7.74 (s, 1H), 7.45 (dd, J = 2.0, 8.0 Hz, 1H), 7.24 (d, J = 8.0 Hz, 1H), 4.89-4.87 (m, 1H), 4.62 (d, J = 14.8 Hz, 1H), 4.17-4.12 (m, 1H), 2.59-2.47 (m, 2H), 2.44 (s, 3H), 2.12-1.99 (m, 2H), 1.50-1.31 (m, 2H), 1.16 (d, J = 8.8 Hz, 1H), 1.09 (d, J = 6.4 Hz, 3H). LCMS: m / z = 422.1 [M+H] + .

[0406] Examples 38 and 39 (1R,3S,5S)-1-(5-cyclopropyl-1,3,4-oxadiazole-2-yl)-N-(3-(5-fluoropyrimidine-2-yl)-4-methylphenyl)-3-methyl-6-azabicyclo[3.1.1]heptane-6-carboxamide and (1S,3R,5R)-1-(5-cyclopropyl-1,3,4-oxadiazole-2-yl)-N-(3-(5-fluoropyrimidine-2-yl)-4-methylphenyl)-3-methyl-6-azabicyclo[3.1.1]heptane-6-carboxamide [ka] A mixture of enantiomers was separated by SFC (ChiralPak IH, 250mm × 30mm, 10μm; mobile phase: A: CO2, B: 0.1% NH3H2O ​​in EtOH; B% in A: 25%~25%, 4 min; flow rate: 3.4 g / min; wavelength: 220 nm; column temperature: 35°C; system back pressure: 125 bar) to obtain cis-1-(5-cyclopropyl-1,3,4-oxadiazole-2-yl)-N-(3-(5-fluoropyrimidine-2-yl)-4-methylphenyl)-3-methyl-6-azabicyclo[3.1.1]heptan-6-carboxamide (peak 1 in SFC) Example 38 (LCMS: m / z = 449.4 [M+H]) + ) and cis-1-(5-cyclopropyl-1,3,4-oxadiazole-2-yl)-N-(3-(5-fluoropyrimidine-2-yl)-4-methylphenyl)-3-methyl-6-azabicyclo[3.1.1]heptan-6-carboxamide (peak 2 in SFC) Example 39 (LCMS: m / z = 449.4 [M+H] + ) was obtained.

[0407] Examples 40 and 41 (1R,3S,5S)-1-(5-ethyl-1,3,4-oxadiazole-2-yl)-N-(3-(5-fluoropyrimidine-2-yl)-4-methylphenyl)-3-methyl-6-azabicyclo[3.1.1]heptan-6-carboxamide and (1S,3R,5R)-1-(5-ethyl-1,3,4-oxadiazole-2-yl)-N-(3-(5-fluoropyrimidine-2-yl)-4-methylphenyl)-3-methyl-6-azabicyclo[3.1.1]heptan-6-carboxamide [ka] A mixture of enantiomers was separated by SFC (ChiralPak IH, 250mm × 30mm, 10μm; mobile phase: A: CO2, B: 0.1% NH3H2O ​​in IPA; B% in A: 50%~50%, 8 min; flow rate: 70 g / min; wavelength: 220 nm; column temperature: 35°C; system back pressure: 120 bar) to obtain cis-1-(5-ethyl-1,3,4-oxadiazole-2-yl)-N-(3-(5-fluoropyrimidine-2-yl)-4-methylphenyl)-3-methyl-6-azabicyclo[3.1.1]heptan-6-carboxamide (peak 1 in SFC) Example 40 (LCMS: m / z = 437.2 [M+H]) + ) and cis-1-(5-ethyl-1,3,4-oxadiazole-2-yl)-N-(3-(5-fluoropyrimidine-2-yl)-4-methylphenyl)-3-methyl-6-azabicyclo[3.1.1]heptan-6-carboxamide (peak 2 in SFC) Example 41 (LCMS: m / z = 437.2 [M+H] + ) was obtained.

[0408] Examples 42 and 43 (1S,3S,5R)-N-[3-(5-fluoropyrimidine-2-yl)-4-methylphenyl]-3-methyl-1-[5-(trifluoromethyl)-1,3,4-oxadiazole-2-yl]-6-azabicyclo[3.1.1]heptan-6-carboxamide and (1R,3R,5S)-N-[3-(5-fluoropyrimidine-2-yl)-4-methylphenyl]-3-methyl-1-[5-(trifluoromethyl)-1,3,4-oxadiazole-2-yl]-6-azabicyclo[3.1.1]heptan-6-carboxamide [ka] A mixture of enantiomers was separated by SFC (WHELK-O1, 250mm × 30mm × 5μm; mobile phase: A: CO2, B: 0.1% NH3H2O ​​in EtOH; B% in A: 45%~45%, 8 min; flow rate: 70 g / min; wavelength: 220 nm; column temperature: 35°C; system back pressure: 100 bar) to obtain trans-N-(3-(5-fluoropyrimidine-2-yl)-4-methylphenyl)-3-methyl-1-(5-(trifluoromethyl)-1,3,4-oxadiazole-2-yl)-6-azabicyclo[3.1.1]heptan-6-carboxamide (peak 1 in SFC) Example 42 (LCMS: m / z = 477.2 [M+H]) + ) and trans-N-(3-(5-fluoropyrimidine-2-yl)-4-methylphenyl)-3-methyl-1-(5-(trifluoromethyl)-1,3,4-oxadiazole-2-yl)-6-azabicyclo[3.1.1]heptan-6-carboxamide (peak 2 in SFC) Example 43 (LCMS: m / z = 477.2 [M+H] + ) was obtained.

[0409] Examples 44 and 45 (1R,3S,5S)-N-[2-fluoro-4-methyl-5-(1,2,4-triazine-3-yl)phenyl]-3-methyl-1-(3-methyl-1,2,4-oxadiazole-5-yl)-6-azabicyclo[3.1.1]heptan-6-carboxamide and (1S,3R,5R)-N-[2-fluoro-4-methyl-5-(1,2,4-triazine-3-yl)phenyl]-3-methyl-1-(3-methyl-1,2,4-oxadiazole-5-yl)-6-azabicyclo[3.1.1]heptan-6-carboxamide [ka] A mixture of enantiomers was separated by SFC (ChiralPak IH-3, 250mm × 30mm, 10μm; mobile phase: A: CO2, B: 0.1% NH3H2O ​​in MeOH; B% in A: 22%~22%, 15 min; flow rate: 70 g / min; wavelength: 220 nm; column temperature: 35°C; system back pressure: 120 bar) to obtain cis-N-(2-fluoro-4-methyl-5-(1,2,4-triazine-3-yl)phenyl)-3-methyl-1-(3-methyl-1,2,4-oxadiazole-5-yl)-6-azabicyclo[3.1.1]heptan-6-carboxamide (peak 1 in SFC) Example 44 (LCMS: m / z = 424.1 [M+H]) + ) and cis-N-(2-fluoro-4-methyl-5-(1,2,4-triazine-3-yl)phenyl)-3-methyl-1-(3-methyl-1,2,4-oxadiazole-5-yl)-6-azabicyclo[3.1.1]heptan-6-carboxamide (peak 2 in SFC) Example 45 (LCMS: m / z = 424.1 [M+H] + ) was obtained.

[0410] Examples 46 and 47 (1R,3S,5S)-N-[3-(5-fluoropyrimidine-2-yl)-4-methylphenyl]-3-methyl-1-(pyrazole-1-ylmethyl)-6-azabicyclo[3.1.1]heptan-6-carboxamide and (1S,3R,5R)-N-[3-(5-fluoropyrimidine-2-yl)-4-methylphenyl]-3-methyl-1-(pyrazole-1-ylmethyl)-6-azabicyclo[3.1.1]heptan-6-carboxamide [ka] A mixture of enantiomers was separated by SFC (DAICEL CHIRALCEL OZ, 250 mm × 30 mm, 10 μm; mobile phase: A: CO2, B: 0.1% NH3H2O ​​in EtOH; B% in A: 50%~50%, 13 min; flow rate: 70 g / min; wavelength: 220 nm; column temperature: 35 °C; system back pressure: 120 bar) to obtain cis-N-[3-(5-fluoropyrimidine-2-yl)-4-methylphenyl]-3-methyl-1-(pyrazole-1-ylmethyl)-6-azabicyclo[3.1.1]heptan-6-carboxamide (peak 1 in SFC) Example 46 (LCMS: m / z = 421.2 [M+H]) + ) and cis-N-[3-(5-fluoropyrimidine-2-yl)-4-methylphenyl]-3-methyl-1-(pyrazole-1-ylmethyl)-6-azabicyclo[3.1.1]heptan-6-carboxamide (peak 2 in SFC) Example 47 (LCMS: m / z = 421.2 [M+H] + ) was obtained.

[0411] Examples 48 and 49 (1R,3R,5S)-N-[2-fluoro-5-(5-fluoropyrimidine-2-yl)-4-methylphenyl]-3-methyl-1-(5-methyl-1,3,4-oxadiazole-2-yl)-6-azabicyclo[3.1.1]heptan-6-carboxamide and (1S,3S,5R)-N-[2-fluoro-5-(5-fluoropyrimidine-2-yl)-4-methylphenyl]-3-methyl-1-(5-methyl-1,3,4-oxadiazole-2-yl)-6-azabicyclo[3.1.1]heptan-6-carboxamide [ka] A mixture of enantiomers was separated by SFC (DAICEL CHIRALPAK AD, 250 mm × 30 mm, 10 μm; mobile phase: A: CO2, B: 0.1% NH3H2O ​​in IPA; B% in A: 43%~43%, 12 min; flow rate: 70 g / min; wavelength: 220 nm; column temperature: 35 °C; system back pressure: 120 bar) to obtain trans-N-(2-fluoro-5-(5-fluoropyrimidine-2-yl)-4-methylphenyl)-3-methyl-1-(5-methyl-1,3,4-oxadiazole-2-yl)-6-azabicyclo[3.1.1]heptan-6-carboxamide (peak 1 in SFC) Example 48 (LCMS: m / z = 441.2 [M+H]) + ) and trans-N-(2-fluoro-5-(5-fluoropyrimidine-2-yl)-4-methylphenyl)-3-methyl-1-(5-methyl-1,3,4-oxadiazole-2-yl)-6-azabicyclo[3.1.1]heptan-6-carboxamide (peak 2 in SFC) Example 49 (LCMS: m / z = 441.2 [M+H] + ) was obtained.

[0412] Examples 50 and 51 (1S,3R,5R)-N-(3-(5-fluoropyrimidine-2-yl)-4-methylphenyl)-3-methyl-1-(1,3,5-triazine-2-yl)-6-azabicyclo[3.1.1]heptan-6-carboxamide and (1R,3S,5S)-N-(3-(5-fluoropyrimidine-2-yl)-4-methylphenyl)-3-methyl-1-(1,3,5-triazine-2-yl)-6-azabicyclo[3.1.1]heptan-6-carboxamide [ka] A mixture of enantiomers was separated by SFC (column: ChiralPak IH, 250 mm × 30 mm, 10 μm; mobile phase: A: CO2, B: 0.1% NH3H2O ​​in EtOH; B% in A: 50%~50%; flow rate: 70 g / min; wavelength: 220 nm; column temperature: 35 °C; system back pressure: 120 bar) to obtain cis-N-(3-(5-fluoropyrimidine-2-yl)-4-methylphenyl)-3-methyl-1-(1,3,5-triazine-2-yl)-6-azabicyclo[3.1.1]heptan-6-carboxamide (peak 1 in SFC) Example 50 (LCMS: m / z = 420.2 [M+H]) + ) and cis-N-(3-(5-fluoropyrimidine-2-yl)-4-methylphenyl)-3-methyl-1-(1,3,5-triazine-2-yl)-6-azabicyclo[3.1.1]heptan-6-carboxamide (peak 2 in SFC) Example 51 (LCMS: m / z = 420.2 [M+H] + ) was obtained.

[0413] Examples 52 and 53 (1S,3R,5R)-N-(3-(5-fluoropyrimidine-2-yl)-4-methylphenyl)-3-methyl-1-(1,2,4-triazine-3-yl)-6-azabicyclo[3.1.1]heptan-6-carboxamide and (1R,3S,5S)-N-(3-(5-fluoropyrimidine-2-yl)-4-methylphenyl)-3-methyl-1-(1,2,4-triazine-3-yl)-6-azabicyclo[3.1.1]heptan-6-carboxamide [ka] A mixture of enantiomers was separated by SFC (DAICEL CHIRALCEL OD, 250 mm × 30 mm × 10 μm; mobile phase: A: CO2, B: 0.1% NH3H2O ​​in MeOH; B% in A: 40%~40%, 10 min; flow rate: 70 g / min; wavelength: 220 nm; column temperature: 35 °C; system back pressure: 120 bar) to obtain cis-N-(3-(5-fluoropyrimidine-2-yl)-4-methylphenyl)-3-methyl-1-(1,2,4-triazine-3-yl)-6-azabicyclo[3.1.1]heptan-6-carboxamide (peak 1 in SFC) Example 52 (LCMS: m / z = 420.1 [M+H]) + ) and cis-N-(3-(5-fluoropyrimidine-2-yl)-4-methylphenyl)-3-methyl-1-(1,2,4-triazine-3-yl)-6-azabicyclo[3.1.1]heptan-6-carboxamide (peak 2 in SFC) Example 53 (LCMS: m / z = 420.1 [M+H] + ) was obtained.

[0414] Examples 54 and 55 (1S,3R,5R)-N-(3-(1,2,4-triazine-3-yl)-4-(trifluoromethyl)phenyl)-1-(5-ethyl-1,3,4-oxadiazole-2-yl)-3-methyl-6-azabicyclo[3.1.1]heptan-6-carboxamide and (1R,3S,5S)-N-(3-(1,2,4-triazine-3-yl)-4-(trifluoromethyl)phenyl)-1-(5-ethyl-1,3,4-oxadiazole-2-yl)-3-methyl-6-azabicyclo[3.1.1]heptan-6-carboxamide [ka] A mixture of enantiomers was separated by SFC (ChiralPak IH, 250mm × 30mm, 10μm; mobile phase: A: CO2, B: 0.1% NH3H2O ​​in EtOH; B% in A: 50%~50%, 7 min; flow rate: 70 g / min; wavelength: 220 nm; column temperature: 35°C; system back pressure: 100 bar) to obtain cis-N-(3-(1,2,4-triazin-3-yl)-4-(trifluoromethyl)phenyl)-1-(5-ethyl-1,3,4-oxadiazole-2-yl)-3-methyl-6-azabicyclo[3.1.1]heptan-6-carboxamide (peak 1 in SFC) Example 54 (LCMS: m / z = 474.0 [M+H]) + ) and cis-N-(3-(1,2,4-triazin-3-yl)-4-(trifluoromethyl)phenyl)-1-(5-ethyl-1,3,4-oxadiazole-2-yl)-3-methyl-6-azabicyclo[3.1.1]heptan-6-carboxamide (peak 2 in SFC) Example 55 (LCMS: m / z = 474.0 [M+H] + ) was obtained.

[0415] Examples 56 and 57 (1S,3R,5R)-N-(2-fluoro-5-(5-fluoropyrimidine-2-yl)-4-(trifluoromethyl)phenyl)-1-(5-methyl-1,3,4-oxadiazole-2-yl)-3-(trifluoromethyl)-6-azabicyclo[3.1.1]heptan-6-carboxamide and (1R,3S,5S)-N-(2-fluoro-5-(5-fluoropyrimidine-2-yl)-4-(trifluoromethyl)phenyl)-1-(5-methyl-1,3,4-oxadiazole-2-yl)-3-(trifluoromethyl)-6-azabicyclo[3.1.1]heptan-6-carboxamide [ka] To a mixture of triphosgene (291 mg, 0.98 mmol) in cis-6-((2-fluoro-5-(5-fluoropyrimidine-2-yl)-4-(trifluoromethyl)phenyl)carbamoyl)-3-(trifluoromethyl)-6-azabicyclo[3.1.1]heptan-1-carboxylic acid:THF (15 mL), 2-fluoro-5-(5-fluoropyrimidine-2-yl)-4-(trifluoromethyl)aniline (600 mg, 2.18 mmol) and TEA (883 mg, 8.72 mmol) in THF (15 mL) were added under N2 conditions at 0°C. The mixture was heated to 20°C and stirred for 2 hours. cis-3-(trifluoromethyl)-6-azabicyclo[3.1.1]heptane-1-carboxylic acid (3.84 g, 2.19 mmol) and TEA (739 mg, 7.30 mmol) were added, and the mixture was stirred for a further 2 hours. The reaction mixture was quenched by adding H2O (1 mL) and concentrated under reduced pressure. The resulting residue was purified by preparative HPLC (Welch Xtimate C18 250 × 70 mm × 15 μm; mobile phase: A: 10 mM FA in water, B: MeCN; B% in A: 50%~80%, 20 minutes) to obtain the title compound. LCMS: m / z = 511.2 [M+H] + .

[0416] cis-6-((2-fluoro-5-(5-fluoropyrimidine-2-yl)-4-(trifluoromethyl)phenyl)carbamoyl)-3-(trifluoromethyl)-6-azabicyclo[3.1.1]heptane-1-carboxylic acid (250 mg, 0.49 mmol) and acetylhydrazine (54 mg, 0.74 mmol) in DMF (5 mL) were mixed with HATU (373 mg, 0.98 mmol) and DIEA (127 mg, 0.98 mmol) at 20 °C. The mixture was stirred for 2 hours, then diluted with H₂O (5 mL) and extracted with ELISA (3 × 5 mL). The mixed organic layers were washed with brine (5 mL), dried over anhydrous Na₂SO₄, filtered, and concentrated under reduced pressure. The resulting residue was purified by silica gel column chromatography (PE:Â=1:1~0:1) to obtain the title compound. LCMS: m / z = 567.2 [M+H] + .

[0417] To a solution of cis-6-((2-fluoro-5-(5-fluoropyrimidine-2-yl)-4-(trifluoromethyl)phenyl)-1-(5-methyl-1,3,4-oxadiazole-2-yl)-3-(trifluoromethyl)-6-azabicyclo[3.1.1]heptan-6-carboxamide:MeCN (3 mL), p-TsCl (76 mg, 0.40 mmol) and Cs2CO3 (345 mg, 1.06 mmol) were added at 20°C. The mixture was stirred for 2 hours, then diluted with H2O (5 mL) and extracted with ₹ (3 × 5 mL). The mixed organic layer was dried over anhydrous Na2SO4, filtered, and concentrated under reduced pressure. The resulting residue was purified by preparative TLC (SiO2, PE:₹=1:1) to obtain the title compound. LCMS: m / z = 549.1 [M+H] + .

[0418] (1S,3R,5R)-N-(2-fluoro-5-(5-fluoropyrimidine-2-yl)-4-(trifluoromethyl)phenyl)-1-(5-methyl-1,3,4-oxadiazole-2-yl)-3-(trifluoromethyl)-6-azabicyclo[3.1.1]heptan-6-carboxamide and (1R,3S,5S)-N-(2-fluoro-5-(5-fluoropyrimidine-2-yl)-4-(trifluoromethyl)phenyl)-1-(5-methyl-1,3,4-oxadiazole-2-yl)-3-(trifluoromethyl)-6-azabicyclo[3.1.1]heptan-6-carboxamide: A mixture of enantiomers, SFC (DAICEL CHIRALPAK Separation by IG, 250mm x 30mm, 10μm; mobile phase: A: CO2, B: 0.1% NH3H2O ​​in MeOH; B% in A: 50%~50%, 10 min; flow rate: 70 g / min; wavelength: 220 nm; column temperature: 40°C; system back pressure: 100 bar) yielded cis-N-(2-fluoro-5-(5-fluoropyrimidine-2-yl)-4-(trifluoromethyl)phenyl)-1-(5-methyl-1,3,4-oxadiazole-2-yl)-3-(trifluoromethyl)-6-azabicyclo[3.1.1]heptan-6-carboxamide (peak 1 in SFC) Example 56 (LCMS: m / z = 549.0 [M+H]) + ) and cis-N-(2-fluoro-5-(5-fluoropyrimidine-2-yl)-4-(trifluoromethyl)phenyl)-1-(5-methyl-1,3,4-oxadiazole-2-yl)-3-(trifluoromethyl)-6-azabicyclo[3.1.1]heptan-6-carboxamide (peak 2 in SFC) Example 57 (LCMS: m / z = 549.0 [M+H] + ) was obtained.

[0419] Examples 58 and 59 (1S,3R,5R)-3-cyclopropyl-N-(2-fluoro-5-(5-fluoropyrimidine-2-yl)-4-(trifluoromethyl)phenyl)-1-(5-methyl-1,3,4-oxadiazole-2-yl)-6-azabicyclo[3.1.1]heptane-6-carboxamide and (1R,3S,5S)-3-cyclopropyl-N-(2-fluoro-5-(5-fluoropyrimidine-2-yl)-4-(trifluoromethyl)phenyl)-1-(5-methyl-1,3,4-oxadiazole-2-yl)-6-azabicyclo[3.1.1]heptane-6-carboxamide [ka] Using intermediate 27, preparations were made as described in Examples 56 and 57. A mixture of enantiomers was separated by SFC (DAICEL CHIRALPAK IG, 250 mm × 30 mm, 10 μm; mobile phase: A: CO2, B: 0.1% NH3H2O ​​in MeOH; B% in A: 50%~50%, 10 min; flow rate: 70 g / min; wavelength: 220 nm; column temperature: 40 °C; system back pressure: 100 bar) to obtain cis-3-cyclopropyl-N-(2-fluoro-5-(5-fluoropyrimidine-2-yl)-4-(trifluoromethyl)phenyl)-1-(5-methyl-1,3,4-oxadiazole-2-yl)-6-azabicyclo[3.1.1]heptan-6-carboxamide (peak 1 in SFC) Example 58 (LCMS: m / z = 521.0 [M+H]) + ) and cis-3-cyclopropyl-N-(2-fluoro-5-(5-fluoropyrimidine-2-yl)-4-(trifluoromethyl)phenyl)-1-(5-methyl-1,3,4-oxadiazole-2-yl)-6-azabicyclo[3.1.1]heptan-6-carboxamide) (Peak 2 in SFC) Example 59 (LCMS: m / z = 521.0 [M+H] + ) was obtained.

[0420] Examples 60 and 61 (1S,3R,5R)-3-ethyl-N-(2-fluoro-5-(5-fluoropyrimidine-2-yl)-4-(trifluoromethyl)phenyl)-1-(5-methyl-1,3,4-oxadiazole-2-yl)-6-azabicyclo[3.1.1]heptan-6-carboxamide and (1R,3S,5S)-3-ethyl-N-(2-fluoro-5-(5-fluoropyrimidine-2-yl)-4-(trifluoromethyl)phenyl)-1-(5-methyl-1,3,4-oxadiazole-2-yl)-6-azabicyclo[3.1.1]heptan-6-carboxamide [ka] Using intermediate 28, preparations were made as described in Examples 56 and 57. A mixture of enantiomers was separated by SFC (column: DAIEL CHIRALPAK IG (250 mm × 30 mm, 10 μm); mobile phase: A: CO2, and B: IPA (0.1% NH3H2O); gradient: B% = 50%; homogeneous concentration elution mode; flow rate: 70 g / min; monitoring wavelengths: 220 and 254 nm; column temperature: 40 °C; system back pressure: 100 bar) to obtain cis-3-ethyl-N-(2-fluoro-5-(5-fluoropyrimidine-2-yl)-4-(trifluoromethyl)phenyl)-1-(5-methyl-1,3,4-oxadiazole-2-yl)-6-azabicyclo[3.1.1]heptan-6-carboxamide (peak 1 in SFC) Example 60 (LCMS: m / z = 509.1 [M+H]) + ) and cis-3-ethyl-N-(2-fluoro-5-(5-fluoropyrimidine-2-yl)-4-(trifluoromethyl)phenyl)-1-(5-methyl-1,3,4-oxadiazole-2-yl)-6-azabicyclo[3.1.1]heptan-6-carboxamide (peak 2 in SFC) Example 61 (LCMS: m / z = 509.2 [M+H] + ) was obtained.

[0421] Examples 62 and 63 (1S,3R,5R)-N-(4-chloro-3-(1,2,4-triazine-3-yl)phenyl)-3-methyl-1-(5-methyl-1,3,4-oxadiazole-2-yl)-6-azabicyclo[3.1.1]heptan-6-carboxamide and (1R,3S,5S)-N-(4-chloro-3-(1,2,4-triazine-3-yl)phenyl)-3-methyl-1-(5-methyl-1,3,4-oxadiazole-2-yl)-6-azabicyclo[3.1.1]heptan-6-carboxamide [ka] A mixture of enantiomers was separated by SFC (ChiralPak IH, 250mm × 30mm, 10μm; mobile phase: A: CO2, B: 0.1% NH3H2O ​​in EtOH; B% in A: 40%~40%, 10 min; flow rate: 70 g / min; wavelength: 220 nm; column temperature: 40°C; system back pressure: 100 bar) to obtain cis-N-(4-chloro-3-(1,2,4-triazine-3-yl)phenyl)-3-methyl-1-(5-methyl-1,3,4-oxadiazole-2-yl)-6-azabicyclo[3.1.1]heptan-6-carboxamide (peak 1 in SFC) Example 62 (LCMS: m / z = 426.0 [M+H]) + ) and cis-N-(4-chloro-3-(1,2,4-triazine-3-yl)phenyl)-3-methyl-1-(5-methyl-1,3,4-oxadiazole-2-yl)-6-azabicyclo[3.1.1]heptan-6-carboxamide (peak 2 in SFC) Example 63 (LCMS: m / z = 426.0 [M+H] + ) was obtained.

[0422] Examples 64 and 65 (1S,3R,5R)-1-((S)-1-(4H-1,2,4-triazole-4-yl)ethyl)-N-(2-fluoro-5-(5-fluoropyrimidine-2-yl)-4-(trifluoromethyl)phenyl)-3-methyl-6-azabicyclo[3.1.1]heptan-6-carboxamide and (1R,3S,5S)-1-((R)-1-(4H-1,2,4-triazole-4-yl)ethyl)-N-(2-fluoro-5-(5-fluoropyrimidine-2-yl)-4-(trifluoromethyl)phenyl)-3-methyl-6-azabicyclo[3.1.1]heptan-6-carboxamide [ka] To a mixture of triphosgene (97 mg, 0.33 mmol) in cis-1-(1-(4H-1,2,4-triazole-4-yl)ethyl)-N-(2-fluoro-5-(5-fluoropyrimidine-2-yl)-4-(trifluoromethyl)phenyl)-3-methyl-6-azabicyclo[3.1.1]heptan-6-carboxamide:THF (6 mL) and triphosgene (97 mg, 0.33 mmol), 2-fluoro-5-(5-fluoropyrimidine-2-yl)-4-(trifluoromethyl)aniline (200 mg, 0.77 mmol) and TEA (294 mg, 2.91 mmol) in THF (6 mL) were added under N2 at 0°C. The mixture was stirred at 0°C for 1 hour. The reaction mixture was used directly in the next step. Next, a mixture of TEA (34 mg, 0.33 mmol) and 3-methyl-1-[1-(1,2,4-triazole-4-yl)ethyl]-6-azabicyclo[3.1.1]heptanetrifluoroacetate (69 mg, 0.22 mmol) in THF (3 mL) was added to the above solution. The mixture was stirred at 20°C for 2 hours. The reaction mixture was diluted with H2O (5 mL) and extracted with  (3 × 5 mL). The mixed organic layer was washed with brine (10 mL), dried over anhydrous Na2SO4, filtered, and concentrated under reduced pressure. The residue was purified by preparative TLC (SiO2, DCM:MeOH = 10:1) to obtain the title compound. LCMS: m / z = 508.2 [M + H] + .

[0423] (1S,3R,5R)-1-((S)-1-(4H-1,2,4-triazole-4-yl)ethyl)-N-(2-fluoro-5-(5-fluoropyrimidine-2-yl)-4-(trifluoromethyl)phenyl)-3-methyl-6-azabicyclo[3.1.1]heptan-6-carboxamide and (1R,3S,5S)-1-((R)-1-(4H-1,2,4-triazole-4-yl)ethyl)-N-(2-fluoro-5-(5-fluoropyrimidine-2-yl)-4-(trifluoromethyl)phenyl)-3-methyl-6-azabicyclo[3.1.1]heptan-6-carboxamide: A mixture of enantiomers, SFC (DAICEL CHIRALPAK Separation by IG, 250mm x 30mm, 10μm; mobile phase: A: CO2, B: 0.1% NH3H2O ​​in EtOH; B% in A: 50%~50%, 10 min; flow rate: 70 g / min; wavelength: 220 nm; column temperature: 35°C; system back pressure: 120 bar) yielded 1-(1-(4H-1,2,4-triazole-4-yl)ethyl)-N-(2-fluoro-5-(5-fluoropyrimidine-2-yl)-4-(trifluoromethyl)phenyl)-3-methyl-6-azabicyclo[3.1.1]heptan-6-carboxamide (peak 1 in SFC) Example 64 (LCMS: m / z = 508.1 [M+H]) + ) and 1-(1-(4H-1,2,4-triazole-4-yl)ethyl)-N-(2-fluoro-5-(5-fluoropyrimidine-2-yl)-4-(trifluoromethyl)phenyl)-3-methyl-6-azabicyclo[3.1.1]heptan-6-carboxamide (peak 2 in SFC) Example 65 (LCMS: m / z = 508.1 [M+H] + ) was obtained.

[0424] Example 66 1-(-1-(4H-1,2,4-triazole-4-yl)ethyl)-N-(2-fluoro-5-(5-fluoropyrimidine-2-yl)-4-(trifluoromethyl)phenyl)-3-methyl-6-azabicyclo[3.1.1]heptan-6-carboxamide [ka] The title compound was isolated as a single unknown enantiomer from a mixture of diastereomers prepared using intermediate 24, using the procedure described for intermediates 12 and 29. Separation was performed by SFC (DAICEL CHIRALPAK IG 250mm × 30mm, 10μm; mobile phase: A: CO2, B: 0.1% NH3H2O ​​in EtOH; B% in A: 40%~40%, 10 min; flow rate: 70 g / min; wavelength: 220 nm; column temperature: 35°C; system back pressure: 120 bar) to obtain the title compound (peak 1 in SFC). LCMS: m / z = 508.2 [M+H] + .

[0425] Examples 67 and 68 (1S,3R,5R)-3-ethyl-N-(3-(5-fluoropyrimidine-2-yl)-4-(trifluoromethyl)phenyl)-1-(5-methyl-1,3,4-oxadiazole-2-yl)-6-azabicyclo[3.1.1]heptan-6-carboxamide and (1R,3S,5S)-3-ethyl-N-(3-(5-fluoropyrimidine-2-yl)-4-(trifluoromethyl)phenyl)-1-(5-methyl-1,3,4-oxadiazole-2-yl)-6-azabicyclo[3.1.1]heptan-6-carboxamide [ka] A mixture of enantiomers was separated by SFC (DAICEL CHIRALPAK IG, 250 mm × 30 mm, 10 μm; mobile phase: A: CO2, B: 0.1% NH3.H2O in EtOH; B% in A: 30%~30%; flow rate: 70 g / min; wavelength: 220 nm; column temperature: 35 °C; system back pressure: 120 bar) to obtain cis-3-ethyl-N-(3-(5-fluoropyrimidine-2-yl)-4-(trifluoromethyl)phenyl)-1-(5-methyl-1,3,4-oxadiazole-2-yl)-6-azabicyclo[3.1.1]heptan-6-carboxamide (peak 1 in SFC) Example 67 (LCMS: m / z = 491.1 [M+H]) +) and cis-3-ethyl-N-(3-(5-fluoropyrimidine-2-yl)-4-(trifluoromethyl)phenyl)-1-(5-methyl-1,3,4-oxadiazole-2-yl)-6-azabicyclo[3.1.1]heptan-6-carboxamide (peak 2 in SFC) Example 68 (LCMS: m / z = 491.1 [M+H] + ) was obtained.

[0426] Examples 69 and 70 (1S,3R,5R)-N-(2-fluoro-5-(5-fluoropyrimidine-2-yl)-4-(trifluoromethyl)phenyl)-3-methyl-1-(1,2,4-triazole-4-ylmethyl)-6-azabicyclo[3.1.1]heptan-6-carboxamide and (1R,3S,5S)-N-(2-fluoro-5-(5-fluoropyrimidine-2-yl)-4-(trifluoromethyl)phenyl)-3-methyl-1-(1,2,4-triazole-4-ylmethyl)-6-azabicyclo[3.1.1]heptan-6-carboxamide [ka] A mixture of enantiomers was separated by SFC (REGIS(s,s)WHELK-O1, 250mm × 30mm, 10μm; mobile phase: A: CO2, B: 0.1% NH3H2O ​​in i-PrOH; B% in A: 45%~45%; flow rate: 70g / min; wavelength: 220nm; column temperature: 35℃; system back pressure: 120bar) to obtain cis-1-((4H-1,2,4-triazole-4-yl)methyl)-N-(2-fluoro-5-(5-fluoropyrimidine-2-yl)-4-(trifluoromethyl)phenyl)-3-methyl-6-azabicyclo[3.1.1]heptan-6-carboxamide (peak 1 in SFC) Example 69 (LCMS: m / z = 494.1 [M+H]) +) and cis-1-((4H-1,2,4-triazole-4-yl)methyl)-N-(2-fluoro-5-(5-fluoropyrimidine-2-yl)-4-(trifluoromethyl)phenyl)-3-methyl-6-azabicyclo[3.1.1]heptan-6-carboxamide (peak 2 in SFC) were obtained in Example 70 (LCMS: m / z = 494.1 [M+H]+).

[0427] The following compounds were prepared, or are possible to prepare, by procedures similar to those described herein. [Table 9-1] [Table 9-2] [Table 9-3]

[0428] Example 81 N-(4-chloro-3-(5-methoxypyrimidine-2-yl)phenyl)-3-methyl-1-(5-methyl-1,3,4-oxadiazole-2-yl)-6-azabicyclo[3.1.1]heptan-6-carboxamide [ka] (5-amino-2-chlorophenyl)boronic acid: The following reaction was carried out by flow method: Solution 1: (2-chloro-5-nitrophenyl)boronic acid (10.8 g, 53.63 mmol) in MeOH (210 mL). A fixed bed (1 / 4'' SS, 5 mL volume) was completely packed with granular catalyst of 1% Pt / C (WXC1043). The H2 back pressure regulator was adjusted to 1.0 MPa and the H2 flow rate was set to 30 mL / min. Next, solution S1 was pumped to the fixed bed {FLR1, SS, fixed bed, 6.350 (1 / 4'') mm, 5 mL, 40°C} by pump 1 {S1, P1, 0.3 mL / min}. Solution S1 was passed through the reactor zone by flowing {FLR1, 3.3 min}, and then the reaction mixture was collected from the outlet of the reactor and concentrated under reduced pressure to obtain the title compound. LCMS: m / z = 172.0 [M+H] + .

[0429] To a solution of 2-chloro-5-methoxypyrimidine (506 mg, 3.50 mmol) and (5-amino-2-chlorophenyl)boronic acid (500 mg, 2.92 mmol) in 10 mL of 4-chloro-3-(5-methoxypyrimidine-2-yl)aniline:1,4-dioxane and H2O (1 mL), K2CO3 (1.01 g, 7.29 mmol) and Pd(dppf)Cl2 (213 mg, 0.29 mmol) were added under N2 at 25°C. The mixture was heated to 100°C and stirred for 12 hours. The reaction mixture was filtered through a Celite® pad, and the filtrate was concentrated under reduced pressure. The resulting residue was purified by silica gel column chromatography (PE:Â=3:1~1:1) to obtain the title compound. LCMS: m / z = 236.1 [M+H] + .

[0430] To a mixture of triphosgene (13 mg, 0.04 mmol) in N-(4-chloro-3-(5-methoxypyrimidine-2-yl)phenyl)-3-methyl-1-(5-methyl-1,3,4-oxadiazole-2-yl)-6-azabicyclo[3.1.1]heptan-6-carboxamide:THF (1 mL), TEA (32 mg, 0.32 mmol) and 4-chloro-3-(5-methoxypyrimidine-2-yl)aniline (25 mg, 0.11 mmol) were obtained under N2 conditions at 0°C. The reaction mixture was stirred at 0°C for 1 hour. Then, 2-methyl-5-(cis-3-methyl-6-azabicyclo[3.1.1]heptan-1-yl)-1,3,4-oxadiazole (intermediate 34, 117 mg, 0.11 mmol, a single unknown enantiomer prepared from intermediate 24) in THF (1 mL) was added to the reaction mixture. The mixture was heated to 25°C and stirred for 3 hours. The reaction mixture was diluted with H2O (3 mL) and extracted with SiO (3 × 5 mL). The mixed organic layer was washed with brine (3 mL), dried over anhydrous Na2SO4, filtered, and concentrated under reduced pressure. The resulting residue was purified by preparative HPLC (column: WePure Biotech XP C18 150×40mm×70μm; mobile phase: A: 10mM NH4HCO3 in water, B: MeCN; B% in A: 25%~55%, 8.0 minutes), and further purified by preparative TLC (SiO2, DCM:MeOH=10:1) to obtain the title compound as a single, unknown enantiomer. LCMS: m / z = 455.2 [M+H] + .

[0431] The following compounds were prepared by procedures similar to those described herein. [Table 10-1] [Table 10-2]

[0432] Biological Example 1 Biochemical assay of compounds Preparation of full-length SARM1 (FL-SARM1) lysates: HEK293T cells (ATCC:CRL-3216) were grown on a 150mm TC-treated dish in full DMEM (Thermo Fisher:11965175) supplemented with 10% HI-FBS (VWR:10802-772), 1×Pen / Strep (Thermo Fisher:15140122), 1×NEAA (Thermo Fisher:1140050), 1×Glutamax (Thermo Fisher:35050061), and 1 mM sodium pyruvate (Thermo Fisher:11360070) at 37°C and 5% CO2 to a culture density of 80-90%. One hour before transfection, the medium was supplemented with an additional 10 mM glucose (Alfa Aesar The DMEM (20 mL per 150 mm dish) was replaced with fresh, complete DMEM (20 mL per 150 mm dish) at 37°C, supplemented with AAJ60067EQE). 30 mg of FL-SARM1 (SEQ ID NO: 1; in-house cloning) plasmid was dissolved in 1 mL of DMEM at ambient temperature and mixed by inverting the tube 8-10 times. 90 μL of GenJet® in vitro DNA transfection reagent (Ver2) was dissolved in 1 mL of DMEM at ambient temperature and mixed by inverting the tube 8-10 times. The plasmid and transfection solution were combined and mixed by inverting the tube 8-10 times at ambient temperature, then incubated for 10 minutes. 2 mL of this transfection mixture was added to each dish containing the HEK293T cells prepared as described above, and then gently mixed by 4-5 horizontal turns. The dishes were then heated to 37°C and 5% The cells were incubated in CO2 for 24 hours. The dish was removed from the incubator, the culture medium was aspirated, and the cells were scraped off using a cell scraper in ice-cold 1×PBS (5 mL / dish, Thermo Fisher Scientific 10010023). The collected cells were centrifuged at 300 g for 5 minutes at 4°C. The supernatant was aspirated, and the pellet was frozen at -80°C until needed.Cell pellets from 30 dishes were dissolved at 4°C in 30 mL of 1×PBS supplemented with 4 tablets of Complete, Mini EDTA-free protease inhibitor cocktail. This mixture was sonicated on ice for 10 minutes at 50% amplitude with 1-second on / 1-second off intervals using a Model 120 sonicator (Thermo Fisher Scientific, FB120110). The lysates were centrifuged at 16000 g for 10 minutes at 4°C. Batches containing supernatant with NMN-dependent SARM1 activity were selected, pooled, and stored at -80°C until use in the FL-SARM1 cell lysate assay described later.

[0433] A 50 nL / well DMSO solution containing the test compound was added to a white 384-well Proxiplate (PerkinElmer, PE-6008280), followed by 7.5 mL / well of SARM1 cell lysate solution at a concentration of 0.067 mg / mL in reaction buffer (containing CHAPSO (0.1%) and fatty acid-free BSA (0.032%)). The plate was centrifuged at 1000 RPM for 1 minute, and then incubated in a 23°C incubator for 15 minutes. 40 mM NAD in reaction buffer was added to each well. + A 2.5 mL / well solution containing 4 mM nicotinamide mononucleotide (NMN) was added. The plate was centrifuged at 1000 RPM for 1 minute, sealed, and incubated in a 23°C incubator for 3.5 hours. Then, a 3.5 mL / well NAD / NADH-Glo® solution (prepared using the extended detection protocol as described by Promega) was added. The plate was centrifuged at 1000 RPM for 1 minute and then incubated at 23°C for 20 minutes. A 1 μL / well solution of 3.625 mM menadione in DMSO was added, and the plate was centrifuged at 1000 RPM for 1 minute. Relative luminescence (RLU) was recorded at a height of 6.5 mm using an Envision plate reader. The inhibition percentage was calculated as follows: % inhibition = (sample - low control) / (high control - low control) × 100.

[0434] I C 50The values ​​were calculated using 4-parameter logistic regression curve fitting from an 11-point curve using a 1 / 2 logarithmic dilution. The activity of the test compound is shown in Table 3 below: +++ = 0.0001 μM <IC 50 <1μM;++=IC 50 1~10μM; +=IC 50 >10μM. [Table 3-1] [Table 3-2]

[0435] FL-SARM1 plasmid sequence (SEQ ID NO: 1): tggaagggctaattcactcccaaagaagacaagatatccttgatctgtggatctaccacacacaaggcta cttccctgattagcagaactacacaccagggccaggggtcagatatccactgacctttggatggtgctac aagctagtaccagttgagccagataaggtagaagaggccaataaaggagagaacaccagcttgttacacc ctgtgagcctgcatgggatggatgacccggagagagaagtgttagagtggaggtttgacagccgcctagc atttcatcacgtggcccgagagctgcatccggagtacttcaagaactgctgatatcgagcttgctacaag ggactttccgctggggactttccagggaggcgtggcctgggcgggactggggagtggcgagccctcagat cctgcatataagcagctgctttttgcctgtactgggtctctctggttagaccagatctgagcctgggagc tctctggctaactaggggaacccactgcttaagcctcaataaagcttgccttgagtgcttcaagtagtgtg tgcccgtctgttgtgtgactctggtaactagagatccctcagacccttttagtcagtgtggaaaatctct agcagtggcgcccgaacagggacttgaaagcgaaagggaaaccagaggagctctctcgacgcaggactcg gcttgctgaagcgcgcacggcaagaggcgaggggcggcgactggtgagtacgccaaaaattttgactagc ggaggctagaaggagagatgggtgcgagagcgtcagtattaagcggggagaattagatcgcgatggg aaaaaattcggttaaggccagggggaaagaaaaaatataaattaaaaacatatagtatgggcaagcaggga gctagaacgattcgcagttaatcctggcctgttagaaacatcagaaggcttagacaaatactgggacag ctacaaccatcccttcagacaggatcagaagaacttagatcattatataatacagtagcaaccctctatt gtgtgcatcaaaggatagagataaaagacaccaaggaagctttagacaagatagaggaagagcaaaacaa aagtaagaccaccgcacagcaagcggcggccgctgatcttcagacctggaggaggagatatgaggcaca attggagaagtgaattatataaaatataaagtagtaaaattgaaccattaggagtagcacccaccaaggc aaagagaagagtggtgcagagagaaaaaagagcagtgggaataggagctttgttccttgggttcttggga gcagcaggaagcactatgggcgcagcgtcaatgacgctgacggtacaggccacaattattgtctggta tagtgcagcagcagaacaatttgctgagggctattgaggcgcacacatctgttgcaactcacagtctg gggcatcaagcagctccaggcagaatcctggctgtggaagatacctaaaggatcacagctcctgggg atttggggttgctctggaaaactcatttgcaccactgctgtgccttggaatgctagttggagtaataat ctctggaacagatttggaatcacacgacctggatggagtgggacagagaaatttacaattacacaagctt atacactccttaattgagaatcgcaaaaccagcagaaagaatgacaattattgattagat aaatggggcaagttgtggaattgtttaacaattggctgtgtataataaattattcataatga tagtaggaggcttgtaggttaagatagttttgctgtactttctatagtgaatagagttaggcaggg atattcaccattatcgtttcagacccaccctcccaccgagggaccgacaggcccgaaggaatagaa gagaaggtggagagagagacagacagatccattcgattagtgaacggatctcgacggtatcgccttt aaaaaaagggggggattggggggtacagtgcagggaagatagtagacatatagcacacacatac aaactaaaaaaaaaaaaaaattcaatttcggggtttacagggacagcagaga tccagtttatcgatgagtaattcatacaaaaggactcgcccctgccttggggaatcccagggaccgtcgt taaactcccactaacgtagaacccagagatcgctgcgttcccgccccctcacccgcccgctctcgtcatc actgaggtggagaagagcatgcgtgaggctccggtgcccgtcagtgggcagagcgcacatcgcccacagt ccccgagaagttggggggaggggtcggcaattgaaccggtgcctagagaaggtggcgcggggtaaactgg gaaagtgatgtcgtgtactggctccgcctttttcccgagggtgggggagaaccgtatataagtgcagtag tcgccgtgaacgttctttttcgcaacgggtttgccgccagaacacaggtaagtgccgtgtgtggttcccg cgggcctggcctctttacgggttatggcccttgcgtgccttgaattacttccacgcccctggctgcagta cgtgattcttgatcccgagcttcgggttggaagtgggtgggagagttcgaggccttgcgcttaaggagcc ccttcgcctcgtgcttgagttgaggcctggcttgggcgctggggccgccgcgtgcgaatctggtggcacc ttcgcgcctgtctcgctgctttcgataagtctctagccatttaaaatttttgatgacctgctgcgacgct ttttttctggcaagatagtcttgtaaatgcgggccaagatctgcacactggtatttcggtttttggggcc gcgggcggcgacggggcccgtgcgtcccagcgcacatgttcggcgaggcggggcctgcgagcgcggccac cgagaatcggacgggggtagtctcaagctggccggcctgctctggtgcctggcctcgcgccgccgtgtat cgccccgccctgggcggcaaggctggcccggtcggcaccagttgcgtgagcggaaagatggccgcttccc ggccctgctgcagggagctcaaaatggaggacgcggcgctcgggagagcgggcgggtgagtcacccacac aaaggaaaagggcctttccgtcctcagccgtcgcttcatgtgactccacggagtaccgggcgccgtccag gcacctcgattagttctcgagcttttggagtacgtcgtctttaggttggggggaggggttttatgcgatg gagtttccccacactgagtgggtggagactgaagttaggccagcttggcacttgatgtaattctccttgg aatttgccctttttgagtttggatcttggttcattctcaagcctcagacagtggttcaaagtttttttct tccatttcaggtgtcgtgaggatctatttccggtgaattcgccaccATGGTCCTGACGCTGCTTCTCTCC GCCTACAAGCTGTGTCGCTTCTTCGCCATGTCGGGCCCACGGCCGGGCGCCGAGCGGGATTACAAGGACG ACGATGACAAGCTGGCGGTGCCTGGGCCAGATGGGGGCGGTGGCACGGGCCCATGGTGGGCTGCGGGTGG CCGCGGGCCCCGCGAAGTGTCGCCGGGGGCAGGCACCGAGGTGCAGGACGCCCTGGAGCGCGCGCTGCCG GAGCTGCAGCAGGCCTTGTCCGCGCTGAAGCAGGCGGGCGGCGCGCGGGCCGTGGGCGCCGGCCTGGCCG AGGTCTTCCAACTGGTGGAGGAGGCCTGGCTGCTGCCGGCCGTGGGCCGCGAGGTAGCCCAGGGTCTGTG CGACGCCATCCGCTCGATGGCGGCCTCGACCTGCTGTTGCGGCTGCTGCAGGCGCCGGAGTTGGAGACG CGTGTGCAGGCCGCGCGCCTGCTGGAGCAGATCCTGGTGGCTGAGAACCGAGACCGCGTGGCCGCGCATTG GGCTGGGCGTGATCCTGAACCTGGCGAAGGAACGCGAACCCGTAGAGCTGGCGCGGAGCGTGGCAGGCAT CTTGGAGCACATGTTCAAGCATTCGGAGGAGACATGCCAGAGGCTGGTGGCGGCCGGCGGCCTGGACGCG GTGCTGTATTGGTGCCGCCGCACGGACCCCGCGCTGCTGCGCCACTGCGCGCTGGCGCTGGGCAACTGCG CGCTGCACGGGGGCCAGGCGGTGCAGCGACGCATGGTAGAGAAGCGCGCAGCCGAGTGGCTCTTCCCGCT CGCCTTCTCCAAGGAGGACGAGCTGCTTCGGCTGCACGCCTGCCTCGCAGTAGCGGTGTTGGCGACTAAC AAGGAGGTGGAGCGCGAGGTGGAGCGCTCGGGCACGCCTGGCGCTCGTGGAGCCGCTTGTGGCCTCGCTGG ACCCTGGCCGCTTCGCCCGCTGTCTGGTGGACGCCAGCGACACAAGCCAGGGCCGCGGGCCCGACGACCT GCAGCGCCTCGTGCCGTTGCTCGCACTCTAACCGCTTGGAGGCGCAGTGCATCGGGGCTTTCTACCTCTGC GCCGAGGCTGCCATCAAGAGCCTGCAAGGCAAGACCAAGGTGTTCAGCGACATCGGCGCCATCCAGAGCC TGAAACGCCTGGTTTCCTACTCTACCAATGGCACTAAGTCGGCGCTGGCCAAGCGCGCGCTGCGCCTGCT GGGCGAGGAGGTGCCACGGCCCATCCTGCCCTCCGTGCCCAGCTGGAAGGAGGCCGAGGTTCAGACGTGG CTGCAGCAGATCGGTTTCTCCAAGTACTGCGAGAGCTTCCGGGAGCAGCAGGTGGATGGCGACCTGCTTC TGCGGCTCACGGAGGAGGAACTCCAGACCGACCTGGGCATGAAATCGGGCATCACCCGCAAGAGGTTCTT TAGGGAGCTCACGGAGCTCAAGACCTTCGCCAACTATTCTACGTGCGACCGCAGCAACCTGGCGGACTGG CTGGGCAGCCTGGACCCGCGCTTCCGCCAGTACACCTACGGCCTGGTCAGCTGCGGCCTGGACCGCTCCC TGCTGCACCGCGTGTCTGAGCAGCAGCTGCTGGAAGACTGCGGCATCCACCTGGGCGTGCACCGCGCCCG CATCCTCACGGCGGCCAGAGAAATGCTACACTCCCCGCTGCCCTGTACTGGTGGCAAACCCAGTGGGGAC ACTCCAGATGTCTTCATCAGCTACCGCCGGAACTCAGGTTCCCAGCTGGCCAGTCTCCTGAAGGTGCACC TGCAGCTGCATGGCTTCAGTGTCTTCATTGATGTGGAGAAGCTGGAAGCAGGCAAGTTCGAGGACAAACT CATCCAGAGTGTCATGGGTGCCCGCAACTTTGTGTTGGTGCTATCACCTGGAGCACTGGACAAGTGCATG CAAGACCATGACTGCAAGGATTGGGTGCATAAGGAGATTGTGACTGCTTTAAGCTGCGGCAAGAACATTG TGCCCATCATTGATGGCTTCGAGTGGCCTGAGCCCCAGGTCCTGCCTGAGGACATGCAGGCTGTGCTTAC TTTCAACGGTATCAAGTGGTCCCACGAATACCAGGAGGCCACCATTGAGAAGATCATCCGCTTCCTGCAG GGCCGCTCCTCCCGGGACTCATCTGCAGGCTCTGACACCAGTTTGGAGGGTGCTGCACCCATGGGTCCAA CCtacccatacgatgttccagattacgctTAAggatcccgcccctctccctcccccccccctaacgttac tggccgaagccgcttggaataaggccggtgtgcgtttgtctatatgttattttccaccatattgccgtct tttggcaatgtgagggcccggaaacctggccctgtcttcttgacgagcattcctaggggtctttcccctc tcgccaaaggaatgcaaggtctgttgaatgtcgtgaaggaagcagttcctctggaagcttcttgaagaca aacaacgtctgtagcgaccctttgcaggcagcggaaccccccacctggcgacaggtgcctctgcggccaa aagccacgtgtataagatacacctgcaaaggcggcacaaccccagtgccacgttgtgagttggatagttg tggaaagagtcaaatggctctcctcaagcgtattcaacaaggggctgaaggatgcccagaaggtacccca ttgtatgggatctgatctggggcctcggtgcacatgctttacatgtgtttagtcgaggttaaaaaaacgt ctaggccccccgaaccacggggacgtggttttcctttgaaaaacacgatgataagcttgccacaacccac aaggacgaccttccatgaccgagtacaagcccacggtgcgcctcgccaccgcgacgacgtccccccgg gccgtacgcaccctcgccgccgcgttcgccgactacccgccacgcgccacaccgtcgacccggaccgcc acatcgagcgggtcaccgagctgcaagaactcttctccacgcgcgtcgggctcgacatcggcaaggtgtg ggtcgcggacgacggcgccgggggtggcggtctggaccacgccgggagagcgtcgaagcggggggcggtgttc gccgagatcggcccgcgcatggccgagttgagcggttcccggctggccgcgcagcaacagatggaaggcc tcctggcgccgcaccggcccaaggagcccgcgtggttcctggccaccgtcggcgtctcgcccgaccacca gggcaagggtctgggcagcgccgtcgtgctccccggagtggaggcggccgagcggccggggtgcccgcc ttcctggagacctccgcgccccgcaacctccccctttacgagcggctcggcttcaccgtcaccgccgacg tcgaggtgcccgaaggaccgcgcacctggtgcatgacccgcaagcccggtgcctagacgcgtctggaaca atcaacctctggattacaaaatttgtgaaagattgactggtattcttaactatgttgctccttttacgct atgtggatacgctgctttaatgcctttgtatcatgctattgcttccccgtatggctttcatttctctccc ttgtataaatcctggttgctgtctctttatgaggagttgtggcccgttgtcaggcaacgtggcgtggtgt gcactgtgtttgctgacgcaacccccactggttggggcattgccaccacctgtcagctcctttccgggac tttcgctttccccctccctattgccacggcggaactcatcgccgcctgccttgcccgctgctggacaggg gctcggctgttgggcactgacaattccgtggtgttgtcggggaagctgacgtcctttccatggctgctcg cctgtgttgccacctggattctgcgcgggacgtccttctgctacgtcccttcggccctcaatccagcgga ccttccttcccgcggcctgctgccggctctgcggcctcttccgcgtcttcgccttcgccctcagacgagt cggatctccctttgggccgcctccccgcctggaattaattctgcagtcgagacctagaaaaacatggagc aatcacaagtagcaatacagcagctaccaatgctgattgtgcctggctagaagcacaagaggaggaggag gtgggttttccagtcacacctcaggtacctttaagaccaatgacttacaaggcagctgtagatcttagcc actttttaaaagaaaagaggggactggaagggctaattcactcccaacgaagacaagatatccttgatct gtggatctaccacacacaaggctacttccctgattagcagaactacacaccagggccaggggtcagatat ccactgacctttggatggtgctacaagctagtaccagttgagccagataaggtagaagaggccaataaag gagagaacaccagcttgttacaccctgtgagcctgcatgggatggatgacccggagagagaagtgttaga gtggaggtttgacagccgcctagcatttcatcacgtggcccgagagctgcatccggagtacttcaagaac tgctgatatcgagcttgctacaagggactttccgctggggactttccagggaggcgtggcctgggcggga ctggggagtggcgagccctcagatcctgcatataagcagctgctttttgcctgtactgggtctctctggt tagaccagatctgagcctgggagctctctggctaactagggaacccactgcttaagcctcaataaagctt gccttgagtgcttcaagtagtgtgtgcccgtctgttgtgtgactctggtaactagagatccctcagaccc ttttagtcagtgtggaaaatctctagcagtagtagttcatgtcatcttattattcagtatttataacttg caaagaaatgaatatcagagagtgagaggccttgacattgctagcgtttaccgtcgacctctagctagag cttggcgtaatcatggtcatagctgtttcctgtgtgaaattgttatccgctcacaattccacacaacata cgagccggaagcataaagtgtaaagcctggggtgcctaatgagtgagctaactcacattaattgcgttgc gctcactgcccgctttccagtcgggaaacctgtcgtgccagctgcattaatgaatcggccaacgcgcggg gagaggcggtttgcgtattgggcgctcttccgcttcctcgctcactgactcgctgcgctcggtcgttcgg ctgcggcgagcggtatcagctcactcaaaggcggtaatacggttatccacagaatcaggggataacgcag gaaagaacatgtgagcaaaaggccagcaaaaaggccaggaaccgtaaaaaggccgcgttgctggcgttttt ccataggctccgcccccctgacgagcatcacaaaaatcgacgctcaagtcagaggtggcgaaacccgaca ggactataaagataccaggcgtttccccctggaagctccctcgtgcgctctcctgttccgaccctgccgc ttaccggatacctgtccgcctttctcccttcgggaagcgtggcgctttctcatagctcacgctgtaggta tctcagttcggtgtaggtcgttcgctccaagctgggctgtgtgcacgaacccc...

Claims

1. Compound of formula I: 【Chemistry 90】 or a pharmaceutically acceptable salt thereof, an isotopically concentrated analog, a stereoisomer, a tautomer, or a mixture of stereoisomers, wherein, X １ , X ２ , X ３ , and X ４ each independently is N or CR ６ , provided that X １ , X ２ , X ３ , and X ４ among them, no more than two are N; m is 0, 1, 2, 3, 4, 5, 6, or 7; n is 0, 1, or 2; Ring A is C ３－１０ A cycloalkyl, heterocyclyl, aryl, or heteroaryl, where each C ３－１０ Cycloalkyl, heterocyclyl, aryl, or heteroaryl molecules independently have 1 to 5 Z １ It is arbitrarily replaced by; L is bond, C １－４ Alkylene, C ２－４ Alkenylene, or C ２－４ It is alkynylene; R １ These are hydrogen, halo, cyano, and -NO. ２ , C １－６ Alkyl, C ２－６ Alkenil, C ２－６ Alkinyl, C ３－１０ Cycloalkyl, heterocyclyl, aryl, heteroaryl, -N(R) １１ ) ２ , -OR １１ , -SR １１ , -C(O)R １１ , -C(O)OR １１ , -S(O)R １１ , -S(O) ２ R １１ , -C(O)N(R １１ ) ２ , -NR １１ C(O)R １１ , -NR １１ S(O)R １１ , -NR １１ S(O) ２ R １１ , -S(O)N(R １１ ) ２ , -S(O) ２ N(R) １１ ) ２ , -NR １１ C(O)N(R) １１ ) ２ , -NR １１ S(O)N(R) １１ ) ２ , -NR １１ S(O) ２ N(R) １１ ) ２ , -OC(O)N(R １１ ) ２ , or -NR １１ C(O)OR １１ And here, each C １－６ Alkyl, C ２－６ Alkenil, C ２－６ Alkinyl, C ３－１０ Cycloalkyl, heterocyclyl, aryl, or heteroaryl molecules independently have 1 to 5 Z １ It is arbitrarily replaced by; Each R ２ is independently halo, cyano, -NO ２ , C １－６ alkyl, C ２－６ alkenyl, C ２－６ alkynyl, C ３－１０ cycloalkyl, heterocyclyl, aryl, heteroaryl, -N(R １１ ), -OR ２ , -SR １１ , -C(O)R １１ , -C(O)OR １１ , -S(O)R １１ , -S(O) １１ R ２ , -C(O)N(R １１ ), -NR １１ C(O)R ２ , -NRS(O)R １１ , -NR １１ S(O)R １１ , -NR １１ S(O) １１ R ２ , -S(O)N(R １１ ), -S(O) １１ N(R ２ ), -NR ２ C(O)N(R １１ ), -NR ２ S(O)N(R １１ ), -NR １１ S(O) ２ N(R １１ ), -OC(O)N(R １１ ), or -NR ２ C(O)OR １１ wherein C ２ alkyl, C １１ alkenyl, C ２ alkynyl, C １１ cycloalkyl, heterocyclyl, aryl, or heteroaryl is independently optionally substituted with 1 to 5 Z ２ ;​​​​​​​​​​​​​​ Alternatively, two R's ２ But together, C ３－１０ Forms a cycloalkyl or heterocycline, where C ３－１０ Cycloalkyl or heterocyclyl molecules independently contain 1 to 5 Z １ It is arbitrarily replaced by; R ４ These are hydrogen, halo, cyano, and C. １－６ Alkyl, C ２－６ Alkenil, C ２－６ Alkinyl, C ３－１０ Cycloalkyl, heterocyclyl, aryl, heteroaryl, -N(R) １１ ) ２ , -OR １１ , -SR １１ , -C(O)R １１ , -C(O)OR １１ , -S(O)R １１ , -S(O) ２ R １１ , -C(O)N(R １１ ) ２ , -NR １１ C(O)R １１ , -NR １１ S(O)R １１ , -NR １１ S(O) ２ R １１ , -S(O)N(R １１ ) ２ , -S(O) ２ N(R) １１ ) ２ , -NR １１ C(O)N(R) １１ ) ２ , -NR １１ S(O)N(R) １１ ) ２ , -NR １１ S(O) ２ N(R) １１ ) ２ , -OC(O)N(R １１ ) ２ , or -NR １１ C(O)OR １１ And here, C １－６ Alkyl, C ２－６ Alkenil, C ２－６ Alkinyl, C ３－１０ Cycloalkyl, heterocyclyl, aryl, or heteroaryl molecules independently have 1 to 5 Z １ It is arbitrarily replaced by; R ５ These are hydrogen, halo, cyano, and C. １－６ Alkyl, C ２－６ Alkenil, C ２－６ Alkinyl, C ３－１０ Cycloalkyl, heterocyclyl, aryl, heteroaryl, -N(R) １１ ) ２ , -OR １１ , -SR １１ , -C(O)R １１ , -C(O)OR １１ , -S(O)R １１ , -S(O) ２ R １１ , -C(O)N(R １１ ) ２ , -NR １１ C(O)R １１ , -NR １１ S(O)R １１ , -NR １１ S(O) ２ R １１ , -S(O)N(R １１ ) ２ , -S(O) ２ N(R) １１ ) ２ , -NR １１ C(O)N(R) １１ ) ２ , -NR １１ S(O)N(R) １１ ) ２ , -NR １１ S(O) ２ N(R) １１ ) ２ , -OC(O)N(R １１ ) ２ , or -NR １１ C(O)OR １１ And here, C １－６ Alkyl, C ２－６ Alkenil, C ２－６ Alkinyl, C ３－１０ Cycloalkyl, heterocyclyl, aryl, or heteroaryl molecules independently have 1 to 5 Z １ It is arbitrarily replaced by; Each R ６ These are independently hydrogen, halo, cyano, and -NO. ２ , C １－６ Alkyl, C ２－６ Alkenil, C ２－６ Alkinyl, C ３－１０ Cycloalkyl, heterocyclyl, aryl, heteroaryl, -N(R) １１ ) ２ , -OR １１ , -SR １１ , -C(O)R １１ , -C(O)OR １１ , -S(O)R １１ , -S(O) ２ R １１ , -C(O)N(R １１ ) ２ , -NR １１ C(O)R １１ , -NR １１ S(O)R １１ , -NR １１ S(O) ２ R １１ , -S(O)N(R １１ ) ２ , -S(O) ２ N(R) １１ ) ２ , -NR １１ C(O)N(R) １１ ) ２ , -NR １１ S(O)N(R) １１ ) ２ , -NR １１ S(O) ２ N(R) １１ ) ２ , -OC(O)N(R １１ ) ２ , or -NR １１ C(O)OR １１ And here, each C １－６ Alkyl, C ２－６ Alkenil, C ２－６ Alkinyl, C ３－１０ Cycloalkyl, heterocyclyl, aryl, or heteroaryl molecules independently have 1 to 5 Z １ It is arbitrarily replaced by; Each R １１ These are, independently, hydrogen and C １－６ Alkyl, C ２－６ Alkenil, C ２－６ Alkinyl, C ３－１０ A cycloalkyl, heterocyclyl, aryl, or heteroaryl, where each C １－６ Alkyl, C ２－６ Alkenil, C ２－６ Alkinyl, C ３－１０ Cycloalkyl, heterocyclyl, aryl, or heteroaryl molecules independently have 1 to 5 Z １ａ It is arbitrarily replaced by; Each Z １ These are independently: halo, cyano, -NO ２ , C １－６ Alkyl, C ２－６ Alkenil, C ２－６ Alkinyl, C １－６ Haloalkyl, C ３－１０ Cycloalkyl, heterocyclyl, aryl, heteroaryl, -N(R) １２ ) ２ , -OR １２ , -SR １２ , -C(O)R １２ , -C(O)OR １２ , -S(O)R １２ , -S(O) ２ R １２ , -C(O)N(R １２ ) ２ , -NR １２ C(O)R １２ , -NR １２ S(O)R １２ , -NR １２ S(O) ２ R １２ , -S(O)N(R １２ ) ２ , -S(O) ２ N(R) １２ ) ２ , -NR １２ C(O)N(R) １２ ) ２ , -NR １２ S(O)N(R) １２ ) ２ , -NR １２ S(O) ２ N(R) １２ ) ２ , -OC(O)N(R １２ ) ２ , or -NR １２ C(O)OR １２ And here, each C １－６ Alkyl, C ２－６ Alkenil, C ２－６ Alkinyl, C １－６ Haloalkyl, C ３－１０ Cycloalkyl, heterocyclyl, aryl, or heteroaryl molecules independently have 1 to 5 Z １ａ It is arbitrarily replaced by; Each R １２ These are, independently, hydrogen and C １－６ Alkyl, C ２－６ Alkenil, C ２－６ Alkinyl, C ３－１０ A cycloalkyl, heterocyclyl, aryl, or heteroaryl, where each C １－６ Alkyl, C ２－６ Alkenil, C ２－６ Alkinyl, C ３－１０ Cycloalkyl, heterocyclyl, aryl, or heteroaryl molecules independently have 1 to 5 Z １ｂ It is arbitrarily replaced by; Each Z １ａ These are independently: halo, cyano, -NO ２ , C １－６ Alkyl, C ２－６ Alkenil, C ２－６ Alkinyl, C ３－１０ Cycloalkyl, heterocyclyl, aryl, heteroaryl, -N(R) １３ ) ２ , -OR １３ , -SR １３ , -C(O)R １３ , -C(O)OR １３ , -S(O)R １３ , -S(O) ２ R １３ , -C(O)N(R １３ ) ２ , -NR １３ C(O)R １３ , -NR １３ S(O)R １３ , -NR １３ S(O) ２ R １３ , -S(O)N(R １３ ) ２ , -S(O) ２ N(R) １３ ) ２ , -NR １３ C(O)N(R) １３ ) ２ , -NR １３ S(O)N(R) １３ ) ２ , -NR １３ S(O) ２ N(R) １３ ) ２ , -OC(O)N(R １３ ) ２ , or -NR １３ C(O)OR １３ And here, each C １－６ Alkyl, C ２－６ Alkenil, C ２－６ Alkinyl, C ３－１０ Cycloalkyl, heterocyclyl, aryl, or heteroaryl molecules independently have 1 to 5 Z １ｂ It is arbitrarily replaced by; Each R １３ These are, independently, hydrogen and C １－６ Alkyl, C ２－６ Alkenil, C ２－６ Alkinyl, C ３－１０ A cycloalkyl, heterocyclyl, aryl, or heteroaryl, where each C １－６ Alkyl, C ２－６ Alkenil, C ２－６ Alkinyl, C ３－１０ Cycloalkyl, heterocyclyl, aryl, or heteroaryl molecules independently have 1 to 5 Z １ｂ It is arbitrarily replaced by; Each Z １ｂ These are independently: halo, cyano, -OH, -SH, -NH ２ , -NO ２ , C １－６ Alkyl, C １－６ Haloalkyl, C ２－６ Alkenil, C ２－６ Alkinyl, C ３－１０ Cycloalkyl, heterocyclyl, aryl, heteroaryl, -L １ -C １－６ Alkyl, -L １ -C ２－６ Alkenyl, -L １ -C ２－６ Alkinyl, -L １ -C １－６ Haloalkyl, -L １ -C ３－１０ Cycloalkyl, -L １ -heterocyclyl, -L １ -aryl, or -L １ - is heteroaryl; and Each L １ These are independently -O-, -NH-, -S-, -S(O)-, and -S(O) ２ -, -N(C １－６ Alkyl)-,-N(C ２－６ Alkenyl)-,-N(C) ２－６ Alkinyl)-,-N(C) １－６ Haloalkyl)-,-N(C) ３－１０ Cycloalkyl)-, -N(heterocyclyl)-, -N(aryl)-, -N(heteroaryl)-, -C(O)-, -C(O)O-, -C(O)NH-, -C(O)N(C １－６ Alkyl)-,-C(O)N(C ２－６ Alkenyl)-,-C(O)N(C ２－６ Alkinyl)-,-C(O)N(C １－６ Haloalkyl)-,-C(O)N(C ３－１０ Cycloalkyl)-, -C(O)N(heterocyclyl)-, -C(O)N(aryl)-, -C(O)N(heteroaryl)-, -NHC(O)-, -NHC(O)O-, -NHC(O)NH-, -NHS(O)-, or -S(O) ２ It is NH-; Here, Z １ｂ Each C １－６ Alkyl, C ２－６ Alkenil, C ２－６ Alkinyl, C １－６ Haloalkyl, C ３－１０ Cycloalkyl, heterocyclyl, aryl, and heteroaryl, and L １ Furthermore, independently, 1 to 5 halos, cyanos, -OH, -SH, -NH ２ , -NO ２ , -SF ５ , C １－６ Alkyl, C ２－６ Alkenil, C ２－６ Alkinyl, C １－６ Haloalkyl, C １－６ Alkoxy, C １－６ Haloalkoxy, C ３－１０ The compound, or a pharmaceutically acceptable salt thereof, an isotopically enriched analog, a stereoisomer, a tautomer, or a mixture of stereoisomers, optionally substituted with a cycloalkyl, heterocyclyl, aryl, or heteroaryl group.

2. X １ The compound according to claim 1, wherein is N.

3. X ２ , X ３ , and X ４ CR ６ The compound according to claim 1 or 2.

4. X ２ The compound according to claim 1, wherein is N.

5. X １ , X ３ , and X ４ CR ６ The compound according to claim 1 or 4.

6. X ３ The compound according to claim 1, wherein is N.

7. X １ , X ２ , and X ４ CR ６ The compound according to claim 1 or 6.

8. X １ N is X ２ and X ４ CR ６ The compound according to claim 1, 6, or 7.

9. X ４ The compound according to claim 1, wherein is N.

10. X １ , X ２ , and X ３ CR ６ The compound according to claim 1 or 9.

11. X １ N is X ２ and X ３ CR ６ The compound according to claim 1 or 9.

12. X ２ N is X １ and X ３ CR ６ The compound according to claim 1 or 9.

13. X ３ N is X １ and X ２ CR ６ The compound according to claim 1 or 9.

14. L is a bond or -CH ２ - The compound according to any of the prior claims.

15. portion 【Chemistry 91】 teeth, 【Chemistry 92】 The compound according to claim 1.

16. Each R ６ These are independently hydrogen, halo, cyano, hydroxy, or -O-C. １－６ A compound according to any of the prior claims, wherein it is an alkyl group.

17. portion 【Chemistry 93】 teeth, 【Chemical 94】 The compound according to claim 1.

18. Each R ２ Independently, C １－６ Alkyl or C ３－１０ It is a cycloalkyl, where each C １－６ Alkyl or C ３－１０ Cycloalkyl groups independently have 1 to 5 Z １ A compound according to any of the prior claims, which is optionally substituted with.

19. The compound according to any of the prior claims, wherein m is 0 or 1.

20. m is 0 or 1, and R ２ The compound is methyl, ethyl, cyclopropyl, or trifluoromethyl, as described in any of the prior claims.

21. m is 0 or 1, R ２ The compound according to any of the prior claims, wherein is methyl.

22. The compound according to any one of the prior claims, wherein n is 1 or 2.

23. Ring A consists of 1 to 5 Z １ The compound according to any of the prior claims, which is a heteroaryl optionally substituted with .

24. Ring A consists of 1 to 5 Z １ The compound according to any one of claims 1 to 22, which is a heterocyclyl optionally substituted with .

25. Each Z １ These are independently cyano, C １－６ Alkyl, C １－６ Haloalkyl, C ３－１０ Cycloalkyl, or -N(R １２ ) ２ The compound described in any of the prior claims.

26. Each R １２ The compound according to any of the prior claims, wherein is hydrogen.

27. R ４ The compound according to any of the prior claims, wherein is hydrogen.

28. R ５ The compound according to any of the prior claims, wherein is hydrogen or a halo.

30. The compound of formula I is formula II: 【Chemical 95】 The compound according to claim 1, represented by [the given expression].

31. The compound of formula I is formula III: 【Chemistry 96】 The compound according to claim 1, represented by [the given expression].

32. L is a combination or C １－４ A compound according to any of the prior claims, which is an alkylene.

33. R １ These are 1 to 5 Z １ C is arbitrarily substituted with １－６ A compound according to any of the prior claims, wherein it is an alkyl group.

34. Each Z １ The compound according to any of the prior claims, which is independently a halo.

35. R １ C １－６ Alkyl, or C １－６ A compound according to any of the prior claims, which is a haloalkyl compound.

36. A compound selected from Table 1, or a pharmaceutically acceptable salt thereof.

37. A compound selected from Table 2, or a pharmaceutically acceptable salt thereof.

38. A pharmaceutical composition comprising a compound described in any of the prior claims, a pharmaceutically acceptable salt thereof, an isotopically concentrated analog, a stereoisomer, a tautomer, or a mixture of stereoisomers, and a pharmaceutically acceptable carrier.

39. A method for inhibiting SARM1 activity, comprising contacting cells with an effective amount of a compound according to any one of claims 1 to 37, or a pharmaceutically acceptable salt thereof, an isotopically concentrated analog, a stereoisomer, a tautomer, or a mixture of stereoisomers, or the pharmaceutical composition according to claim 38.

40. The method according to claim 36, wherein the contact is performed in a living organism.

41. A method for treating a disease or condition mediated at least partially by SARM1, comprising administering an effective amount of any one of claims 1 to 37, or a pharmaceutically acceptable salt thereof, an isotopically concentrated analog, a stereoisomer, a tautomer, or a mixture of stereoisomers, or a pharmaceutical composition according to claim 38, to a subject in need thereof.

42. A method for inhibiting axonal degeneration, comprising administering to a subject requiring the use of an effective amount of a compound according to any one of claims 1 to 37, a pharmaceutically acceptable salt thereof, an isotopically concentrated analog, a stereoisomer, a tautomer, or a mixture of stereoisomers, or a pharmaceutical composition according to claim 38.

43. A method for treating neurodegeneration or neurological disease or neurological disorder, comprising administering an effective amount of any one of claims 1 to 37, or a pharmaceutically acceptable salt thereof, an isotopically concentrated analog, a stereoisomer, a tautomer, or a mixture of stereoisomers, or a pharmaceutical composition according to claim 38, to a subject in need thereof.

44. The method according to claim 40, wherein the neurodegeneration or neurological disease or neurological disorder is related to axonal degeneration, axonal injury, axonopathy, demyelinating disease, central pontine myelinlysis, nerve injury disease or disorder, metabolic disease, mitochondrial disease, metabolic axonal degeneration, axonal injury resulting from traumatic axonal injury (TAI), leukoencephalopathy, or leukoatrophy.

45. The aforementioned diseases or conditions include spinal cord injury, stroke, multiple sclerosis, and progressive multifocal white blood cell disease. Myelopathy, congenital myelin dysplasia, encephalomyelitis, acute disseminated encephalomyelitis, central pontine myelin breakdown, osmotic hyponatremia, hypoxic demyelination, ischemic demyelination, adrenoleukodystrophy, Alexander disease, Niemann-Pick disease, Pelizaeus-Merzbach disease, periventricular leukomalacia, globoid cell leukodystrophy (Krabbe disease), Waller's degeneration, optic neuritis, transverse myelitis, amyotrophic lateral sclerosis (ALS, Lou Gehrig's disease), Huntington's disease, Alzheimer's disease, Parkinson's disease, Tay-Sachs disease, Gaucher disease, Harler syndrome, traumatic brain injury (TBI), traumatic axonal injury (TAI), post-irradiation injury, neurological complications of chemotherapy (chemotherapeutic agent-induced peripheral neuropathy, CIPN), neuropathy, acute ischemic optic neuropathy, vitamin B １２ Deficiency, Isolation Vitamin E Deficiency Syndrome, Bassen-Kohnzweig Syndrome, Retinal Degeneration, Retinitis Pigmentosa, Glaucoma, Retinitis Pigmentosa, Traumatic Optic Nerve Injury, Leber Hereditary Optic Nerve Atrophy (Neurosis), Leber Congenital Amoenosis, Neuromyelitis Optica, Metachromatic Leukodystrophy, Acute Hemorrhagic Leukoencephalitis, Trigeminal Neuralgia, Bell's Palsy, Cerebral Ischemia, Multiple System Atrophy, Traumatic Glaucoma, Tropical Spastic Paraplegia, Human T-Lymphotropic Virus 1 (HTLV-1) Associated Myelopathy, West Nile Virus Brain Disease, Lacrosse Virus Encephalitis, Bunya Virus Encephalitis, The method according to claim 38, wherein the condition is childhood viral encephalitis, essential tremor, Charcot-Marie-Tooth disease, motor neuron disease, spinal muscular atrophy (SMA), conductive sensory and autonomic neuropathy (HSAN), adrenal spinal nerve disorder, progressive supranuclear palsy (PSP), Friedreich's ataxia, hereditary ataxia, noise-induced hearing loss, congenital hearing loss, Lewy body dementia, frontotemporal dementia, amyloidosis, diabetic neuropathy, HIV neuropathy, enteric neuropathy and axonal disease, Guillain-Barré syndrome, or severe acute motor axonal neuropathy (AMAN).

46. A method for treating chemotherapy-induced peripheral neuropathy (CIPN), comprising administering an effective amount of any one of claims 1 to 37, or a pharmaceutically acceptable salt thereof, an isotopically concentrated analog, a stereoisomer, a tautomer, or a mixture of stereoisomers, or the pharmaceutical composition described in claim 38, to a subject in need thereof.

47. Use of a compound according to any one of claims 1 to 37, or a pharmaceutically acceptable salt thereof, an isotopically concentrated analog, a stereoisomer, a tautomer, or a mixture of stereoisomers, or a pharmaceutical composition according to claim 38, for treating a disease or condition mediated at least partially by SARM1.

48. The aforementioned diseases or conditions include spinal cord injury, stroke, multiple sclerosis, and progressive multifocal white blood cell disease. Myelopathy, congenital myelin dysplasia, encephalomyelitis, acute disseminated encephalomyelitis, central pontine myelin breakdown, osmotic hyponatremia, hypoxic demyelination, ischemic demyelination, adrenoleukodystrophy, Alexander disease, Niemann-Pick disease, Pelizaeus-Merzbach disease, periventricular leukomalacia, globoid cell leukodystrophy (Krabbe disease), Waller's degeneration, optic neuritis, transverse myelitis, amyotrophic lateral sclerosis (ALS, Lou Gehrig's disease), Huntington's disease, Alzheimer's disease, Parkinson's disease, Tay-Sachs disease, Gaucher disease, Harler syndrome, traumatic brain injury (TBI), traumatic axonal injury (TAI), post-irradiation injury, neurological complications of chemotherapy (chemotherapeutic agent-induced peripheral neuropathy, CIPN), neuropathy, acute ischemic optic neuropathy, vitamin B １２ Deficiency, Isolation Vitamin E Deficiency Syndrome, Bassen-Kohnzweig Syndrome, Retinal Degeneration, Retinitis Pigmentosa, Glaucoma, Traumatic Optic Nerve Injury, Leber Hereditary Optic Nerve Atrophy (Neurosis), Leber Congenital Amaurosis, Neuromyelitis Optica, Metachromatic Leukodystrophy, Acute Hemorrhagic Leukoencephalitis, Trigeminal Neuralgia, Bell's Palsy, Cerebral Ischemia, Multiple System Atrophy, Traumatic Glaucoma, Tropical Spastic Paraplegia, Human T-Lymphotropic Virus 1 (HTLV-1) Associated Myelopathy, West Nile Virus Brain Disease, Lacrosse Virus Encephalitis, Bunya Virus Encephalitis, Childhood Virus The use according to claim 44, which is Luz's encephalitis, essential tremor, Charcot-Marie-Tooth disease, motor neuron disease, spinal muscular atrophy (SMA), conductive sensory and autonomic neuropathy (HSAN), adrenal spinal nerve disorder, progressive supranuclear palsy (PSP), Friedreich's ataxia, hereditary ataxia, noise-induced hearing loss, congenital hearing loss, Lewy body dementia, frontotemporal dementia, amyloidosis, diabetic neuropathy, HIV neuropathy, enteric neuropathy and axonal disease, Guillain-Barré syndrome, or severe acute motor axonal neuropathy (AMAN).

49. A compound according to any one of claims 1 to 37, or a pharmaceutically acceptable salt thereof, an isotopically concentrated analog, a stereoisomer, a tautomer, or a mixture of stereoisomers, or a pharmaceutical composition according to claim 38, for use in the treatment of medicine.

50. Spinal cord injury, stroke, multiple sclerosis, progressive multifocal white brain disease Myelopathy, congenital myelin dysplasia, encephalomyelitis, acute disseminated encephalomyelitis, central pontine myelin breakdown, osmotic hyponatremia, hypoxic demyelination, ischemic demyelination, adrenoleukodystrophy, Alexander disease, Niemann-Pick disease, Pelizaeus-Merzbach disease, periventricular leukomalacia, globoid cell leukodystrophy (Krabbe disease), Waller's degeneration, optic neuritis, transverse myelitis, amyotrophic lateral sclerosis (ALS, Lou Gehrig's disease), Huntington's disease, Alzheimer's disease, Parkinson's disease, Tay-Sachs disease, Gaucher disease, Harler syndrome, traumatic brain injury (TBI), traumatic axonal injury (TAI), post-irradiation injury, neurological complications of chemotherapy (chemotherapeutic agent-induced peripheral neuropathy, CIPN), neuropathy, acute ischemic optic neuropathy, vitamin B １２ Deficiency, Isolation Vitamin E Deficiency Syndrome, Bassen-Kohnzweig Syndrome, Retinal Degeneration, Retinitis Pigmentosa, Glaucoma, Traumatic Optic Nerve Injury, Leber Hereditary Optic Nerve Atrophy (Neurosis), Leber Congenital Amoenoma, Neuromyelitis Optica, Metachromatic Leukodystrophy, Acute Hemorrhagic Leukoencephalitis, Trigeminal Neuralgia, Bell's Palsy, Cerebral Ischemia, Multiple System Atrophy, Traumatic Glaucoma, Tropical Spastic Paraplegia, Human T-Lymphotropic Virus 1 (HTLV-1) Associated Myelopathy, West Nile Virus Brain Disease, Lacrosse Virus Encephalitis, Bunya Virus Encephalitis, Childhood Viral Encephalitis, Essential Tremor, Charcot-Marie-Tooth Disease, Motor Neuron Disease, Spinal Muscular Atrophy (SM) A) A compound according to any one of claims 1 to 37, or a pharmaceutically acceptable salt thereof, an isotopically concentrated analog, a stereoisomer, a tautomer, or a mixture of stereoisomers, or a pharmaceutical composition according to claim 38, for use in the treatment of transmissible sensory and autonomic neuropathy (HSAN), adrenal spinal neuropathy, progressive supranuclear palsy (PSP), Friedreich's ataxia, hereditary ataxia, noise-induced hearing loss, congenital hearing loss, Lewy body dementia, frontotemporal dementia, amyloidosis, diabetic neuropathy, HIV neuropathy, enteric neuropathy and axonopathy, Guillain-Barré syndrome, or severe acute motor axonal neuropathy (AMAN).

51. Spinal cord injury, stroke, multiple sclerosis, progressive multifocal white brain disease Myelopathy, congenital myelin dysplasia, encephalomyelitis, acute disseminated encephalomyelitis, central pontine myelin breakdown, osmotic hyponatremia, hypoxic demyelination, ischemic demyelination, adrenoleukodystrophy, Alexander disease, Niemann-Pick disease, Pelizaeus-Merzbach disease, periventricular leukomalacia, globoid cell leukodystrophy (Krabbe disease), Waller's degeneration, optic neuritis, transverse myelitis, amyotrophic lateral sclerosis (ALS, Lou Gehrig's disease), Huntington's disease, Alzheimer's disease, Parkinson's disease, Tay-Sachs disease, Gaucher disease, Harler syndrome, traumatic brain injury (TBI), traumatic axonal injury (TAI), post-irradiation injury, neurological complications of chemotherapy (chemotherapeutic agent-induced peripheral neuropathy, CIPN), neuropathy, acute ischemic optic neuropathy, vitamin B １２ Deficiency, Isolation Vitamin E Deficiency Syndrome, Bassen-Kohnzweig Syndrome, Retinal Degeneration, Retinitis Pigmentosa, Glaucoma, Traumatic Optic Nerve Injury, Leber Hereditary Optic Nerve Atrophy (Neurosis), Leber Congenital Amoenoma, Neuromyelitis Optica, Metachromatic Leukodystrophy, Acute Hemorrhagic Leukoencephalitis, Trigeminal Neuralgia, Bell's Palsy, Cerebral Ischemia, Multiple System Atrophy, Traumatic Glaucoma, Tropical Spastic Paraplegia, Human T-Lymphotropic Virus 1 (HTLV-1) Associated Myelopathy, West Nile Virus Brain Disease, Lacrosse Virus Encephalitis, Bunya Virus Encephalitis, Childhood Viral Encephalitis, Essential Tremor, Charcot-Marie-Tooth Disease, Motor Neuron Disease, Spinal Muscular Atrophy (SMA), Use of a compound according to any one of claims 1 to 37, or a pharmaceutically acceptable salt thereof, an isotope-enriched analog, a stereoisomer, a tautomer, or a mixture of stereoisomers, or a pharmaceutical composition according to claim 38, for the manufacture of a pharmaceutical for the treatment of sexual sensory and autonomic neuropathy (HSAN), adrenal spinal neuropathy, progressive supranuclear palsy (PSP), Friedreich's ataxia, hereditary ataxia, noise-induced hearing loss, congenital hearing loss, Lewy body dementia, frontotemporal dementia, amyloidosis, diabetic neuropathy, HIV neuropathy, enteric neuropathy and axonopathy, Guillain-Barré syndrome, or severe acute motor axonal neuropathy (AMAN).

52. A process for providing a compound of formula I, wherein the compound of formula I-1: 【Chemistry 97】 The compound of formula I-2: 【Chem.98】 The process involves contacting the compound of formula I, or a pharmaceutically acceptable salt thereof, an isotopically concentrated analog, a stereoisomer, a tautomer, or a mixture of stereoisomers, wherein, X １ , X ２ , X ３ , and X ４ Each of these independently determines N or CR ６ And, however, X １ , X ２ , X ３ , and X ４ Two or fewer of these are N; m is 0, 1, 2, 3, 4, 5, 6, or 7; n is 0, 1, or 2; Ring A is C ３－１０ A cycloalkyl, heterocyclyl, aryl, or heteroaryl, where each C ３－１０ Cycloalkyl, heterocyclyl, aryl, or heteroaryl molecules independently have 1 to 5 Z １ It is arbitrarily replaced by; L is bond, C １－４ Alkylene, C ２－４ Alkenylene, or C ２－４ It is alkynylene; R １ These are hydrogen, halo, cyano, and -NO. ２ , C １－６ Alkyl, C ２－６ Alkenil, C ２－６ Alkinyl, C ３－１０ Cycloalkyl, heterocyclyl, aryl, heteroaryl, -N(R) １１ ) ２ , -OR １１ , -SR １１ , -C(O)R １１ , -C(O)OR １１ , -S(O)R １１ , -S(O) ２ R １１ , -C(O)N(R １１ ) ２ , -NR １１ C(O)R １１ , -NR １１ S(O)R １１ , -NR １１ S(O) ２ R １１ , -S(O)N(R １１ ) ２ , -S(O) ２ N(R) １１ ) ２ , -NR １１ C(O)N(R) １１ ) ２ , -NR １１ S(O)N(R) １１ ) ２ , -NR １１ S(O) ２ N(R) １１ ) ２ , -OC(O)N(R １１ ) ２ , or -NR １１ C(O)OR １１ And here, each C １－６ Alkyl, C ２－６ Alkenil, C ２－６ Alkinyl, C ３－１０ Cycloalkyl, heterocyclyl, aryl, or heteroaryl molecules independently have 1 to 5 Z １ It is arbitrarily replaced by; Each R ２ These are independently: halo, cyano, -NO ２ , C １－６ Alkyl, C ２－６ Alkenil, C ２－６ Alkinyl, C ３－１０ Cycloalkyl, heterocyclyl, aryl, heteroaryl, -N(R) １１ ) ２ , -OR １１ , -SR １１ , -C(O)R １１ , -C(O)OR １１ , -S(O)R １１ , -S(O) ２ R １１ , -C(O)N(R １１ ) ２ , -NR １１ C(O)R １１ , -NR １１ S(O)R １１ , -NR １１ S(O) ２ R １１ , -S(O)N(R １１ ) ２ , -S(O) ２ N(R) １１ ) ２ , -NR １１ C(O)N(R) １１ ) ２ , -NR １１ S(O)N(R) １１ ) ２ , -NR １１ S(O) ２ N(R) １１ ) ２ , -OC(O)N(R １１ ) ２ , or -NR １１ C(O)OR １１ And here, C １－６ Alkyl, C ２－６ Alkenil, C ２－６ Alkinyl, C ３－１０ Cycloalkyl, heterocyclyl, aryl, or heteroaryl molecules independently have 1 to 5 Z １ It is arbitrarily replaced by; Alternatively, two R's ２ But together, C ３－１０ Forms a cycloalkyl or heterocycline, where C ３－１０ Cycloalkyl or heterocyclyl molecules independently contain 1 to 5 Z １ It is arbitrarily replaced by; R ４ These are hydrogen, halo, cyano, and C. １－６ Alkyl, C ２－６ Alkenil, C ２－６ Alkinyl, C ３－１０ Cycloalkyl, heterocyclyl, aryl, heteroaryl, -N(R) １１ ) ２ , -OR １１ , -SR １１ , -C(O)R １１ , -C(O)OR １１ , -S(O)R １１ , -S(O) ２ R １１ , -C(O)N(R １１ ) ２ , -NR １１ C(O)R １１ , -NR １１ S(O)R １１ , -NR １１ S(O) ２ R １１ , -S(O)N(R １１ ) ２ , -S(O) ２ N(R) １１ ) ２ , -NR １１ C(O)N(R) １１ ) ２ , -NR １１ S(O)N(R) １１ ) ２ , -NR １１ S(O) ２ N(R) １１ ) ２ , -OC(O)N(R １１ ) ２ , or -NR １１ C(O)OR １１ And here, C １－６ Alkyl, C ２－６ Alkenil, C ２－６ Alkinyl, C ３－１０ Cycloalkyl, heterocyclyl, aryl, or heteroaryl molecules independently have 1 to 5 Z １ It is arbitrarily replaced by; R ５ These are hydrogen, halo, cyano, and C. １－６ Alkyl, C ２－６ Alkenil, C ２－６ Alkinyl, C ３－１０ Cycloalkyl, heterocyclyl, aryl, heteroaryl, -N(R) １１ ) ２ , -OR １１ , -SR １１ , -C(O)R １１ , -C(O)OR １１ , -S(O)R １１ , -S(O) ２ R １１ , -C(O)N(R １１ ) ２ , -NR １１ C(O)R １１ , -NR １１ S(O)R １１ , -NR １１ S(O) ２ R １１ , -S(O)N(R １１ ) ２ , -S(O) ２ N(R) １１ ) ２ , -NR １１ C(O)N(R) １１ ) ２ , -NR １１ S(O)N(R) １１ ) ２ , -NR １１ S(O) ２ N(R) １１ ) ２ , -OC(O)N(R １１ ) ２ , or -NR １１ C(O)OR １１ And here, C １－６ Alkyl, C ２－６ Alkenil, C ２－６ Alkinyl, C ３－１０ Cycloalkyl, heterocyclyl, aryl, or heteroaryl molecules independently have 1 to 5 Z １ It is arbitrarily replaced by; Each R ６ These are independently hydrogen, halo, cyano, and -NO. ２ , C １－６ Alkyl, C ２－６ Alkenil, C ２－６ Alkinyl, C ３－１０ Cycloalkyl, heterocyclyl, aryl, heteroaryl, -N(R) １１ ) ２ , -OR １１ , -SR １１ , -C(O)R １１ , -C(O)OR １１ , -S(O)R １１ , -S(O) ２ R １１ , -C(O)N(R １１ ) ２ , -NR １１ C(O)R １１ , -NR １１ S(O)R １１ , -NR １１ S(O) ２ R １１ , -S(O)N(R １１ ) ２ , -S(O) ２ N(R) １１ ) ２ , -NR １１ C(O)N(R) １１ ) ２ , -NR １１ S(O)N(R) １１ ) ２ , -NR １１ S(O) ２ N(R) １１ ) ２ , -OC(O)N(R １１ ) ２ , or -NR １１ C(O)OR １１ And here, each C １－６ Alkyl, C ２－６ Alkenil, C ２－６ Alkinyl, C ３－１０ Cycloalkyl, heterocyclyl, aryl, or heteroaryl molecules independently have 1 to 5 Z １ It is arbitrarily replaced by; Each R １１ These are, independently, hydrogen and C １－６ Alkyl, C ２－６ Alkenil, C ２－６ Alkinyl, C ３－１０ A cycloalkyl, heterocyclyl, aryl, or heteroaryl, where each C １－６ Alkyl, C ２－６ Alkenil, C ２－６ Alkinyl, C ３－１０ Cycloalkyl, heterocyclyl, aryl, or heteroaryl molecules independently have 1 to 5 Z １ａ It is arbitrarily replaced by; Each Z １ These are independently: halo, cyano, -NO ２ , C １－６ Alkyl, C ２－６ Alkenil, C ２－６ Alkinyl, C １－６ Haloalkyl, C ３－１０ Cycloalkyl, heterocyclyl, aryl, heteroaryl, -N(R) １２ ) ２ , -OR １２ , -SR １２ , -C(O)R １２ , -C(O)OR １２ , -S(O)R １２ , -S(O) ２ R １２ , -C(O)N(R １２ ) ２ , -NR １２ C(O)R １２ , -NR １２ S(O)R １２ , -NR １２ S(O) ２ R １２ , -S(O)N(R １２ ) ２ , -S(O) ２ N(R) １２ ) ２ , -NR １２ C(O)N(R) １２ ) ２ , -NR １２ S(O)N(R) １２ ) ２ , -NR １２ S(O) ２ N(R) １２ ) ２ , -OC(O)N(R １２ ) ２ , or -NR １２ C(O)OR １２ And here, each C １－６ Alkyl, C ２－６ Alkenil, C ２－６ Alkinyl, C １－６ Haloalkyl, C ３－１０ Cycloalkyl, heterocyclyl, aryl, or heteroaryl molecules independently have 1 to 5 Z １ａ It is arbitrarily replaced by; Each R １２ These are, independently, hydrogen and C １－６ Alkyl, C ２－６ Alkenil, C ２－６ Alkinyl, C ３－１０ A cycloalkyl, heterocyclyl, aryl, or heteroaryl, where each C １－６ Alkyl, C ２－６ Alkenil, C ２－６ Alkinyl, C ３－１０ Cycloalkyl, heterocyclyl, aryl, or heteroaryl molecules independently have 1 to 5 Z １ｂ It is arbitrarily replaced by; Each Z １ａ These are independently: halo, cyano, -NO ２ , C １－６ Alkyl, C ２－６ Alkenil, C ２－６ Alkinyl, C ３－１０ Cycloalkyl, heterocyclyl, aryl, heteroaryl, -N(R) １３ ) ２ , -OR １３ , -SR １３ , -C(O)R １３ , -C(O)OR １３ , -S(O)R １３ , -S(O) ２ R １３ , -C(O)N(R １３ ) ２ , -NR １３ C(O)R １３ , -NR １３ S(O)R １３ , -NR １３ S(O) ２ R １３ , -S(O)N(R １３ ) ２ , -S(O) ２ N(R) １３ ) ２ , -NR １３ C(O)N(R) １３ ) ２ , -NR １３ S(O)N(R) １３ ) ２ , -NR １３ S(O) ２ N(R) １３ ) ２ , -OC(O)N(R １３ ) ２ , or -NR １３ C(O)OR １３ And here, each C １－６ Alkyl, C ２－６ Alkenil, C ２－６ Alkinyl, C ３－１０ Cycloalkyl, heterocyclyl, aryl, or heteroaryl molecules independently have 1 to 5 Z １ｂ It is arbitrarily replaced by; Each R １３ These are, independently, hydrogen and C １－６ Alkyl, C ２－６ Alkenil, C ２－６ Alkinyl, C ３－１０ A cycloalkyl, heterocyclyl, aryl, or heteroaryl, where each C １－６ Alkyl, C ２－６ Alkenil, C ２－６ Alkinyl, C ３－１０ Cycloalkyl, heterocyclyl, aryl, or heteroaryl molecules independently have 1 to 5 Z １ｂ It is arbitrarily replaced by; Each Z １ｂ is, independently, halo, cyano, -OH, -SH, -NH ２ , -NO ２ , C １－６ alkyl, C １－６ haloalkyl, C ２－６ alkenyl, C ２－６ alkynyl, C ３－１０ cycloalkyl, heterocyclyl, aryl, heteroaryl, -L １ -C １－６ alkyl, -L １ -C ２－６ alkenyl, -L １ -C ２－６ alkynyl, -L １ -C １－６ haloalkyl, -L １ -C ３－１０ cycloalkyl, -L １ -heterocyclyl, -L １ -aryl, or -L １ -heteroaryl; and Each L １ These are independently -O-, -NH-, -S-, -S(O)-, and -S(O) ２ -, -N(C １－６ Alkyl)-,-N(C ２－６ Alkenyl)-,-N(C) ２－６ Alkinyl)-,-N(C) １－６ Haloalkyl)-,-N(C) ３－１０ Cycloalkyl)-, -N(heterocyclyl)-, -N(aryl)-, -N(heteroaryl)-, -C(O)-, -C(O)O-, -C(O)NH-, -C(O)N(C １－６ Alkyl)-,-C(O)N(C ２－６ Alkenyl)-,-C(O)N(C ２－６ Alkinyl)-,-C(O)N(C １－６ Haloalkyl)-,-C(O)N(C ３－１０ Cycloalkyl)-, -C(O)N(heterocyclyl)-, -C(O)N(aryl)-, -C(O)N(heteroaryl)-, -NHC(O)-, -NHC(O)O-, -NHC(O)NH-, -NHS(O)-, or -S(O) ２ It is NH-; Here, Z １ｂ Each C １－６ Alkyl, C ２－６ Alkenil, C ２－６ Alkinyl, C １－６ Haloalkyl, C ３－１０ Cycloalkyl, heterocyclyl, aryl, and heteroaryl, and L １ Furthermore, independently, 1 to 5 halos, cyanos, -OH, -SH, -NH ２ , -NO ２ , -SF ５ , C １－６ Alkyl, C ２－６ Alkenil, C ２－６ Alkinyl, C １－６ Haloalkyl, C １－６ Alkoxy, C １－６ Haloalkoxy, C ３－１０ The process, optionally substituted with a cycloalkyl, heterocyclyl, aryl, or heteroaryl group.

53. The process according to claim 52, wherein the aforementioned conditions include triphosgene.

Images