Eye organoids

By producing conjunctival and limbal organoids through stem cell expansion and differentiation, the method addresses the lack of effective in vitro models, enabling accurate tissue modeling and drug screening for conjunctival and limbal diseases.

JP2026514562APending Publication Date: 2026-05-12KONINK NEDERLANDSE AKADE VAN WETENSCHAPPEN
View PDF 0 Cites 0 Cited by

Patent Information

Application Number
JP2025555464
Authority / Receiving Office
JP · JP
Patent Type
Applications
Current Assignee / Owner
Priority Date
2023-03-21
Filing Date
2024-03-21
Publication Date
2026-05-12

AI Technical Summary

Technical Problem

There is a lack of reliable and efficient in vitro models for studying conjunctival and limbal epithelium, hindering understanding of their homeostasis and dysfunction, and limiting the development of therapeutic drugs for associated diseases.

Method used

A method for producing conjunctival and limbal organoids by expanding and differentiating conjunctival or limbal stem cells from biopsies, using a specific culture medium that allows long-term culture and reproduction of essential structural and physiological features, enabling the creation of reliable tissue models for drug screening and therapeutic applications.

Benefits of technology

The method enables the production of sufficient quantities of organoids that closely resemble conjunctival and limbal tissues, providing accurate models for studying pathological conditions and screening drug candidates for treating related diseases.

✦ Generated by Eureka AI based on patent content.

Smart Images

  • Figure 2026514562000001
    Figure 2026514562000001
  • Figure 2026514562000002
    Figure 2026514562000002
  • Figure 2026514562000003
    Figure 2026514562000003
Patent Text Reader

Abstract

The present invention relates to an in vitro method for producing conjunctival or limbal organoids. It also encompasses the use of novel conjunctival or limbal organoids as implants in regenerative medicine, and as conjunctival or limbal tissue and / or corneal tissue models for the study of these tissues. Furthermore, specific cell culture media particularly suitable for the production of conjunctival or limbal organoids are disclosed.
Need to check novelty before this filing date? Find Prior Art

Description

[Technical Field]

[0001] This invention generally relates to the field of organoids and methods for producing them. It also relates to specific applications of organoids in the fields of therapeutics and compound screening. [Background technology]

[0002] The background information contains information useful for understanding the present invention. It is not acknowledged that any information provided herein constitutes prior art, or is related to the claimed invention, or that any publication specifically or implicitly referenced constitutes prior art.

[0003] The conjunctiva covers the inner surface of the eyelids and also the sclera (white of the eye). The conjunctiva contains a stroma called the stromal propria, which includes fibroblasts, blood vessels, and immune cells, and is covered by non-keratinized stratified epithelium.

[0004] Two differentiated cell types have been identified in the epithelium: goblet cells, which produce mucus, and keratinocytes. Since goblet cells, along with the lacrimal glands, produce the mucin layer of the tear film covering the ocular surface, most research on the conjunctiva focuses on goblet cells. This mucin layer is essential for tear homeostasis, as it allows the aqueous layer of tears to adhere to the ocular surface, protecting against evaporative dry eye. However, the role of conjunctival keratinocytes beyond forming the epithelial barrier, and the nature of conjunctival stem cells, remain unclear.

[0005] Research on the ocular surface has primarily focused on the cornea, a tissue essential for vision. However, the conjunctiva is equally crucial for vision. Conjunctival dysfunction can ultimately affect corneal homeostasis and lead to blindness. Firstly, the avascular cornea is an immune-privileged tissue, protected from a wide range of immune responses. The conjunctiva is responsible for immune defense on the ocular surface. Secondly, damage to the conjunctiva due to physical or viral injury destabilizes the tear film, leading to dry eye, discomfort, and ultimately, blindness.

[0006] The limbus is the boundary between the cornea and the conjunctiva (sclera, i.e., the white of the eye) and contains limbal stem cells. The cornea is the transparent layer of the anterior segment of the eye. This layer is organized perpendicular to the trajectory of light and consists of keratinocytes that secrete extracellular matrix, covered by non-keratinized stratified epithelium. This epithelium is renewed by stem cells located around the cornea, in a region called the limbus. During homeostasis maintenance or after injury to the central part of the cornea, these stem cells divide, differentiate, and migrate towards the center to replenish the tissue. If the limbus is injured, it leads to a deficiency of limbal stem cells. In such cases, the limbal stem cells, and consequently the central part of the cornea, are replaced by non-transparent conjunctival tissue, leading to blindness.

[0007] For this reason, both the cornea and the limbus have been extensively studied. Several culture models exist for studying the cornea. Most of these models are limbus stem cells enlarged on mouse embryonic fibroblasts (2D structure) or organoids (3D structure) derived from induced pluripotent stem cells (iPSCs).

[0008] The most standard surgical method for repairing conjunctival defects is autologous conjunctival grafting. Simply put, this involves taking a piece of healthy conjunctival tissue (average 1 cm) from the patient's eyeball that is the size of the damaged area. 2 This means directly harvesting the sclera (the tissue from which healthy conjunctiva was harvested) and covering the damage. However, this also means that the sclera from which the healthy conjunctiva was harvested is exposed, making it more susceptible to infection. Furthermore, this option is no longer viable if the damage is too extensive or if additional healthy conjunctival tissue is required. To date, there are no extracellular cell therapies for the conjunctiva available to patients. Therefore, there is clearly an unaddressed clinical need at present.

[0009] Simple limbal epithelial transplantation (SLET) is used to treat unilateral corneal epithelial stem cell deficiency (LSCD). This involves harvesting healthy limbal stem cells from a healthy eye and autotransplanting them into the affected eye to restore corneal transparency and prevent conjunctivalization.

[0010] A major obstacle to understanding conjunctival homeostasis and dysfunction, and / or limbal homeostasis and dysfunction, is the lack of representative in vitro models. Indeed, models of conjunctival epithelium established over many years have several limitations. They are either short-lived excisions cultured under poorly defined conditions (i.e., on feeder cells or amniotic membrane) or derived from induced pluripotent stem cells that generally do not accurately reproduce the cellular diversity and maturity of conjunctival epithelium. Thus, the lack of representative in vitro models of mammalian conjunctival epithelium has hindered our understanding of conjunctival epithelial biology and the development of therapeutic drugs for conjunctival diseases. The same is true for limbal homeostasis and dysfunction.

[0011] An example of an in vitro model of the conjunctiva is disclosed in Nomi et al., “Generation of functional conjunctival epithelium, including goblet cells, from human iPSCs”, Cell Reports 34, 108715. Nomi et al. generated conjunctival epithelial cells from human iPSCs that had been enlarged to form two-dimensional eyeball-like organoids. EGF and KGF work in conjunction to promote the development and maturation of iPSC-derived conjunctival epithelium, including mucin-producing goblet cells, respectively. The model proposed by Nomi et al. does not reproduce the natural phenomena that occur within the eyeball when the conjunctiva is formed. Furthermore, this model requires a pre-stage to form ectoderm-autonomous multizone (SEAM), and the procedure for obtaining conjunctival epithelium is complex.

[0012] Viral conjunctivitis is typically studied using cancer cell lines derived from the lungs or other organs. However, there is no protocol for growing primary conjunctival tissue under specific conditions over a long period of time.

[0013] An example of an in vitro model of human limbal (or corneal) epithelial cells using human amniotic membrane (hAM) as a culture medium is described by Mariappan et al. (Nat Protoc 2010 5(8):1470-9. doi: 10.1038 / nprot.2010.115). Kauppila et al. discuss further attempts to provide an in vitro model of the limbal cornea (Advanced Healthcare Material 2023 Volume12, Issue29; doi.org / 10.1002 / adhm.202301396).

[0014] Adult stem cell-based organoids were first established from intestinal tissue in 2009. Organoids are three-dimensional structures that replicate the essential structure and function of their originating tissue and have been repeatedly proposed in regenerative medicine, primarily for digestive organs such as the intestines and liver. However, obtaining organoids that replicate the key characteristics of the tissue is not easy. Furthermore, it is difficult to produce a sufficient quantity of organoids to regenerate organs, especially large organs. Therefore, clinical trials testing the repair capabilities of organoids are currently rare.

[0015] For these reasons, new products, compositions, methods, and applications are highly desirable but not yet readily available. In particular, there is a clear demand in the art for reliable, efficient, and reproducible products, compositions, methods, and applications that can be used to obtain cell cultures, such as organoids, that reproduce the essential structural and physiological features of actual conjunctival epithelium or corneal epithelium and / or limbal epithelium, and can be used, for example, as transplants in the treatment of cancer. Accordingly, the underlying technical problem of the present invention can be found in providing such products, compositions, methods, and applications to satisfy any of the aforementioned needs, or at least to provide a useful option to the public. This technical problem is solved by the claims and the embodiments characterized herein below. [Overview of the project]

[0016] As embodied and extensively described herein, the present invention is directed toward the remarkable discovery that organoids of conjunctival epithelium, corneal epithelium and / or limbal epithelium that reproduce the essential structural and physiological features of actual conjunctival epithelium or corneal epithelium and / or limbal epithelium can be obtained, for example, by means of directly expanding and differentiating conjunctival stem cells (in the case of corneal epithelium) isolated from a conjunctival biopsy (consisting of such conjunctival stem cells), or, for example, by directly expanding and differentiating limbal stem cells (corneal epithelium and / or limbal epithelium, preferably in the case of corneal epithelium or limbal epithelium) isolated from a limbal biopsy or corneal biopsy (containing such limbal stem cells).

[0017] Preferably, conjunctival stem cells and / or limbal stem cells are obtained from primary tissue, for example, (human) conjunctival biopsy specimens, or from (human) limbal biopsy specimens or (human) corneal biopsy specimens.

[0018] A reliable and simple in vitro method is provided for the preparation of conjunctival organoids (using conjunctival stem cells) and limbal organoids (using limbal stem cells) (also referred to herein as limbal organoids), which avoid deviation from iPSCs and the associated drawbacks. Conjunctival organoids (or conjunctival organoids) can reproduce the essential structural and physiological features of actual conjunctival epithelium. Limbal organoids can reproduce the essential structural and physiological features of actual corneal epithelium and / or limbal epithelium.

[0019] The novel method disclosed herein makes it possible to obtain a sufficient quantity of conjunctival organoids or limbal organoids in a reasonable and practical period of time, and is therefore particularly useful in regenerative medicine among the other applications disclosed.

[0020] In this method, a simple cell culture medium that enables appropriate expansion and / or differentiation of conjunctival stem cells or limbal stem cells is used. Surprisingly, for conjunctival stem cells and limbal stem cells, the same culture method as disclosed herein can be advantageously employed, for example, it has been found that long-term culture (e.g., 10 passages or more, 20 passages or more, 30 passages or more) of organoids is enabled, for example, in ALI culture, it provides tissue structures that closely resemble conjunctival tissue, particularly conjunctival epithelium, or limbal tissue and / or corneal tissue, particularly limbal epithelium and / or corneal epithelium.

[0021] Furthermore, the organoids have an appropriate lifespan, and thus are useful as a conjunctival tissue model, or limbal tissue and / or corneal tissue (particularly limbal epithelium and / or corneal epithelium). These models enable testing of compounds that can regulate conjunctival epithelium or limbal epithelium and / or corneal epithelium. This model can reliably reproduce the pathological conditions of the conjunctiva, or limbus and / or cornea (particularly limbal epithelium and / or corneal epithelium), and is also useful as a screening model for drug candidates for the prevention and / or treatment of conjunctival diseases, or the prevention and / or treatment of limbal and / or corneal diseases.

[0022] Finally, ready-to-use cell culture tools, reagents, and devices for easily and reliably implementing the in vitro method of the present invention are also provided.

[0023] Thus, in a first aspect, the present invention relates to an in vitro method for producing a conjunctival organoid or a limbal organoid, the method comprising: (a) providing conjunctival stem cells or limbal stem cells; and (b) culturing the conjunctival stem cells or limbal stem cells in a culture medium under conditions suitable for forming a conjunctival organoid or a limbal organoid.

[0024] As will be understood by those skilled in the art, according to another aspect of the present invention, conjunctival stem cells and limbal stem cells are preferably obtained from biopsy samples of tissues containing such stem cells, but can be provided together in the same in vitro method for producing organoids. Thus, the culture methods including ALI culture, the media used, the use of the organoids or ALI cultures thus obtained, and the information disclosed herein related to the organoids thus obtained are, in all embodiments, similarly applicable to this aspect of the present invention, and it will also be understood by those skilled in the art that conjunctival stem cells and limbal stem cells can be introduced together in the culture method. For example, according to such an aspect, it is contemplated that organoids having the characteristics of the conjunctival organoids described herein and the characteristics of the limbal organoids described herein can be obtained. Those skilled in the art will understand this without the need to repeat the description verbally.

[0025] As described in the following examples, these conjunctival organoids are composed of basal cells and keratinocytes commonly found in the actual conjunctival epithelium. Furthermore, these cells are spatially organized similar to the in vivo structure of the actual conjunctival epithelium. That is, the cells are arranged in a layered manner with basal cells arranged in the lower layer in relation to a support, an extracellular matrix, or something like the substantia propria in conjunctival tissue, and the differentiated keratinocytes are arranged in the upper layer of the layered structure, above the layer of basal cells. Furthermore, the physiological characteristics of the organoids also mimic those of the actual conjunctival epithelium. As described in the examples below, limbal organoids contain various cells commonly found in the actual limbal tissue and / or corneal tissue (including corneal epithelium and / or limbal epithelium), as demonstrated by the expression of various cell markers, and can exhibit a spatial organization similar to that found in in vivo limbal tissue and / or corneal tissue (including corneal epithelium and / or limbal epithelium).

[0026] The method of the present invention allows for the production of a sufficient amount of organoid in a relatively short time. Furthermore, this sufficient amount is sufficient to cover a surface area that is adequate to replace or fill damaged or affected conjunctiva, or damaged or affected corneal tissue and / or limbal tissue, in, for example, a human subject.

[0027] Another aspect of the present invention is an isolated conjunctival organoid, particularly mammalian, and more particularly human, that comprises cells expressing keratin-19 (KRT19) and one or more of the transcription factors p63 (TP63), mucin short variant S1 (MUC1), and aquaporin-5 (AQP5).

[0028] Another aspect is an isolated limbal organoid, particularly mammalian, and more particularly human, limbal organoid, comprising cells expressing keratin 24 (KRT24), transcription factor p63 (TP63), and ocular surface transcription factor PAX6. Another aspect of the present invention is an organoid obtained by simultaneously culturing conjunctival stem cells and limbal stem cells, as described above.

[0029] Methods for propagating conjunctival stem cells or limbal stem cells can confer specific structural and functional characteristics to the cells. Thus, organoids can also be defined by the method of their acquisition. For example, in the case of limbal stem cells, organoids (or ALI cultures) obtained by the method of the present invention may more closely resemble corneal tissue or more closely resemble limbal tissue, depending, for example, the duration of culture and / or the differentiation state of the cells contained. For example, in ALI culture, it is expected that if culture is started based on limbal organoids that have already differentiated in the corneal direction, a culture more similar to the cornea will be obtained, while if less differentiated limbal organoids are used in ALI culture, an ALI culture with tissue more similar to limbal tissue may be obtained. Those skilled in the art will understand, in view of the disclosure herein, how to achieve this.

[0030] Therefore, another aspect of the present invention is an isolated mammalian conjunctival organoid that can be obtained or obtained by the method defined in the first aspect. Therefore, another aspect of the present invention is an isolated mammalian limbal organoid that can be obtained or obtained by the method defined in the first aspect.

[0031] Therefore, the present invention can be obtained, or in particular, by the method defined in the embodiments described above. (a) Provide conjunctival stem cells or limbal stem cells, (b) Culture conjunctival stem cells or limbal stem cells in a culture medium under conditions suitable for forming conjunctival organoids or limbal organoids. This relates to isolated mammalian conjunctival organoids or isolated mammalian limbal organoids that can be obtained or are obtained by means of.

[0032] Derivative products and devices comprising the conjunctival epithelial organoid and / or limbal organoid of the present invention are also provided, which are useful tools for their analysis and testing of compounds.

[0033] In another aspect, the present invention provides a gas-liquid interface culture of conjunctival cells, preferably conjunctival organoid cells. The gas-liquid interface culture is I. A container comprising a first chamber and a second chamber, wherein the first chamber and the second chamber are separated by a porous membrane, II. A multilayer of conjunctival cells, particularly those derived from dissociated conjunctival organoids, arranged on at least one surface of the porous membrane, Equipped with, The multilayer comprises at least one cell layer located proximal to the porous membrane and containing basal keratinocytes expressing KRT-19 and TP63, and at least one cell layer located distal to the support and containing apical keratinocytes and goblet cells expressing KRT-19, MUC1 and AQP5, and the gas-liquid interface culture optionally contains cell culture medium in at least one of the first and second chambers.

[0034] Gas-liquid interface cultures of conjunctival cells, preferably conjunctival organoid cells, are reliable and accurate models of the conjunctiva, particularly the conjunctival epithelium.

[0035] In fact, as will be explained below, the pathological conditions of the conjunctiva can be reproduced in this model, making it useful for studying these conditions and for discovering treatment approaches.

[0036] In another aspect, the present invention provides a gas-liquid interface culture of corneal epithelium and / or limbal epithelium, preferably limbal organoid cells. The gas-liquid interface culture is III. A container comprising a first chamber and a second chamber, wherein the first chamber and the second chamber are separated by a porous membrane, IV. A multilayer comprising cells derived from corneal epithelium and / or limbal epithelium, particularly dissociated limbal organoids, arranged on at least one surface of the porous membrane, Equipped with, The multilayer comprises cells expressing at least keratin 24 (KRT24), transcription factor p63 (TP63), and ocular surface transcription factor PAX6, and the gas-liquid interface culture optionally contains cell culture medium in at least one of the first and second chambers.

[0037] Gas-liquid interface cultures of corneal epithelial and / or limbal epithelial cells, preferably limbal organoid cells, are reliable and accurate models of limbal tissue and / or corneal tissue (including corneal epithelium and / or limbal epithelium).

[0038] In fact, pathological conditions of the limbal tissue and / or corneal tissue (including the corneal epithelium and / or limbal epithelium) can be reproduced using this model, making it useful for studying these conditions and discovering therapeutic approaches.

[0039] A further aspect of the present invention is a conjunctival implant, which comprises or consists of a conjunctival organoid obtained by the method defined in the preceding aspects or in the first aspect. Alternatively, the conjunctival implant comprises or consists of cells dissociated from the conjunctival organoid. The conjunctival implant is also referred to here as a cell implant, cell transplant, or cell graft (a transplant of living cells or tissue).

[0040] The direct use of this implant, when properly implanted in an animal or subject, is as a pharmaceutical.

[0041] Therefore, another aspect of the present invention is a conjunctival organoid obtained in vitro, or a conjunctival implant obtained in vitro, for use as a pharmaceutical. Herein, the conjunctival implant is as defined in the preceding aspect, and / or the conjunctival organoid obtained in vitro can be obtained by the method defined in the first aspect, and / or the conjunctival organoid obtained in vitro is as defined in the preceding aspect.

[0042] A further aspect of the present invention is a corneal epithelium and / or limbal epithelial implant. The implant comprises or consists of a limbal organoid, which is defined in the preceding aspects or obtained by the method specified herein. Alternatively, the implant comprises or consists of cells dissociated from the limbal organoid. The corneal epithelium and / or limbal epithelial implant may also be referred to as a cell implant, cell transplant, or cell graft (a transplant of living cells or tissue).

[0043] The direct use of this implant, when properly implanted in an animal or subject, is as a pharmaceutical.

[0044] Accordingly, another aspect of the present invention is an in vitro limbal organoid or an in vitro implant of corneal epithelium and / or limbal epithelium for use as a pharmaceutical. The implant is as defined in the preceding aspects, and / or the in vitro limbal organoid is obtained by the method defined herein, and / or the in vitro limbal organoid is also as defined in the preceding aspects. The present invention relates to all uses of organoids or gas-liquid interface cultures as defined in the preceding aspects as in vitro models of mammalian conjunctival epithelium or mammalian limbal tissue and / or corneal tissue (including corneal epithelium and / or limbal epithelium), or in drug discovery screening, or in toxicity assays. A reliable model of mammalian conjunctival epithelium, or limbal tissue and / or corneal tissue (including corneal epithelium and / or limbal epithelium), enables screening of drug candidates and analysis of parameters that can modulate the physiology of conjunctival limbal tissue and / or corneal tissue (including corneal epithelium and / or limbal epithelium). Furthermore, this model avoids the drawbacks associated with the short-term use of excised tissue, or the drawbacks associated with cancer cell line-derived models, and, in a preferred embodiment, the drawbacks associated with induced pluripotent stem cell-derived models.

[0045] Therefore, in a further embodiment, a method for screening candidate agents for modulating the conjunctiva and / or for preventing and / or treating diseases or disorders of the conjunctiva, particularly human conjunctiva, is also provided. The method is (a) Providing a conjunctival organoid as defined in the above-described embodiment, or a gas-liquid interface culture as defined in the above-described embodiment, (b) optionally, a step of providing conditions or a drug that simulates a disease or disorder, (c) A step of providing candidate drugs, (d) Optionally, before, after, or simultaneously with step (b), the candidate drug is brought into contact with the conjunctival organoid or gas-liquid interface culture under conditions that allow interaction between the conjunctival organoid or gas-liquid interface culture and the candidate drug. (e) A step of determining whether contact with the candidate drug modulates the conjunctiva (conjunctival organoid or gas-liquid interface culture) and / or prevents or reverses a simulated disorder or disease, It is equipped with.

[0046] To carry out the method of the present invention for producing conjunctival organoids, particularly mammalian conjunctival organoids, the inventors have developed a novel cell culture medium.

[0047] Therefore, in a further embodiment, a method is also provided for screening candidate agents for modulating the corneal epithelium and / or limbal epithelium, and / or for preventing and / or treating diseases or disorders of limbal tissue and / or corneal tissue (including corneal epithelium and / or limbal epithelium), particularly human tissue. The method is (a) Providing a limbal organoid as defined in the above-described embodiment, or a gas-liquid interface culture as defined in the above-described embodiment, (b) optionally, a step of providing conditions or a drug that simulates a disease or disorder, (c) A step of providing candidate drugs, (d) Optionally, before, after, or simultaneously with step (b), a step of bringing the candidate drug into contact with the limbal organoid or gas-liquid interface culture under conditions that allow interaction between the candidate drug and the limbal organoid or gas-liquid interface culture, (e) A step of determining whether contact with the candidate drug modulates the limbal organoid or gas-liquid interface culture and / or prevents or reverses the simulated disorder or disease, It is equipped with.

[0048] A novel cell culture medium was developed by the inventors to carry out the method of the present invention for producing conjunctival organoids or limbal organoids, particularly mammalian conjunctival organoids or mammalian limbal organoids.

[0049] Therefore, another aspect of the present invention is a cell culture medium, preferably a cell expansion culture medium, comprising a basal medium for mammalian cells, supplemented with an inhibitor of the transforming growth factor β (TGF-β) signaling pathway, an inhibitor of bone morphogenetic protein (BMP), and an agonist of the Wnt pathway, and optionally one or more B27 supplements; N-acetylcysteine ​​(NAC); fibroblast growth factor (FGF), particularly those selected from FGF10, FGF1, FGF2, and FGF7 and combinations thereof; epidermal growth factor (EGF); and antimicrobial and / or antifungal compounds.

[0050] In some preferred embodiments, the culture medium further comprises forskolin or FGF-10 or WNT surrogate, or forskolin and FGF-10, or preferably forskolin, FGF-10 and WNT surrogate.

[0051] In some more preferred embodiments, the culture medium further comprises IGF1 or FGF7, or in preferred embodiments, IGF1 and FGF7 (for example, forskolin or FGF-10 or WNT surrogate, or forskolin and FGF-10, or preferably forskolin, FGF-10 and WNT surrogate). In even further embodiments, the culture medium further comprises IL-6, for example, in combination with IGF1 and FGF7, or in combination with forskolin, FGF-10 and WNT surrogate (or Wnt agonist).

[0052] Another embodiment is a cell culture medium, preferably a cell differentiation culture medium comprising a mammalian cell basal medium supplemented with an inhibitor of the transforming growth factor β (TGF-β) signaling pathway, an inhibitor of bone morphogenetic protein (BMP), and an agonist of the Wnt pathway. This medium is substantially free of epidermal growth factor (EGF), substantially free of any fibroblast growth factor (FGF), and substantially free of B27 supplements.

[0053] Embodiments of the present invention will be further described below with reference to the attached drawings: [Brief explanation of the drawing]

[0054] [Figure 1-1] Figure 1(A) is a schematic diagram of mouse conjunctival organoid establishment. Figure 1(B) is a bright-field image of organoid elongation and organoid morphology after 34 passages. Scale bars: 500 μm (4x magnification) and 100 μm (20x magnification). Figure 1(C) Immunohistochemical analysis of the labeling marker of mouse conjunctival organoids compared with mouse conjunctival tissue. Scale bar: 50 μm. Scale bar for inserted portion: 20 μm. [Figure 1-2] Figure 1(D) is a schematic diagram of the establishment of a Pax6 knockout (Pax6KO). Figure 1(E) shows the sequencing traces of three Pax6KO clones. A fragment of exon 4 of the Pax6 Mus musculus, TGCCGGACTCCACCCGGCAGATCGTAGAGCTA (SEQ ID NO: 17), is shown. Figure 1(F) is a bright-field image of representative WT and Pax6KO clones at p32 and p25 at 13 days after cleavage, respectively. Scale bar, 500 μm. Figure 1(H) shows the staining of PAX6, TP63, and PAS in WT and Pax6KO clone 5. Scale bar, 50 μm, inset, 20 μm. [Figure 1-3] Figure 1(G) is a volcano plot of differentially expressed genes between organoids of WT (n=2 strains) and Pax6KO (n=3 strains). Genes with fc>2 and p-adj<0,01 are shown in light gray. [Figure 2-1]This figure shows the establishment and characterization of human conjunctival organoids and gas-liquid interface cultures. Figure 2(A) is a schematic diagram of human conjunctival organoid establishment. Figure 2(B) is a bright-field image of organoid growth and morphology. Scale bars are 500 μm (4x magnification) and 100 μm (20x magnification). Figure 2(C) shows immunohistochemical analysis of markers shown by human conjunctival organoids compared to tissue. Scale bar is 50 μm. [Figure 2-2] Figure 2(D) is a schematic diagram of human conjunctival organoid differentiation. Figure 2(E) shows immunohistochemical analysis of human conjunctival organoids cultured in expansion medium and differentiation medium against the indicated markers. Scale bar: large 200 μm, inset 50 μm. [Figure 3] This figure shows that organoid-derived gas-liquid interface cultures promote the differentiation of goblet cells. Figure 3(A) is a schematic diagram of a human conjunctival gas-liquid interface culture. Figure 3(B) is a bright-field image of the gas-liquid interface 17 days after being lifted to ALI. Scale bar, 50 μm. Figure 3(C) shows immunohistochemical analysis of markers shown in human conjunctival ALI cultures 4 and 17 days after lifting to ALI. Scale bar, 50 μm. Figure 3(D) is a transmission electron micrograph of goblet cells from ALI culture (left) and primary tissue (right) at 17 days old. Scale bar, 5 μm. [Figure 4] This figure shows the characterization of conjunctival epithelial cell types compared to a culture model. Figure 4(A) shows a schematic of the various samples subjected to single-cell RNA sequencing. Figures 4(B) and 4(C) show immunohistochemical staining of LCN2(B) and WFDC2(C) in conjunctival tissue and 17-day-old ALI cultures. Scale bar is 50 μm. Figure 4(D) is an electron micrograph of a 17-day-old ALI culture. The arrows point to vesicles present on the apical surface of the ALI culture. The left scale bar is 1 μm, and the right is 200 nm. Figure 4(E) shows the results of LCN2 secretion assays performed 1, 4, 10, 17, and 22 days after lifting to ALI. The supernatant secreted over 24 hours was collected, loaded onto a protein gel (Western blot), and stained for LCN2. [Figure 5]This figure shows that NGFR+ cells are amphipotretinal stem cells. Figure 5(A) shows NGFR expression in a single-cell dataset. Figure 5(B) shows bright-field images (left) and quantification (right) of organoid growth from NGFR- and NGFR+ cells. Scale bar, 500 μm. Each dot represents an independent experiment. Figure 5(C) shows staining of goblet cell marker MUC5AC and keratinocyte marker MUC1 in single-cell derived organoids. Arrows indicate cells positive for either marker. Scale bar, 100 μm. [Figure 6-1] This figure shows that the conjunctival gas-liquid interface maintains HSV1, hAdV8, and SARS-CoV-2 infection. Figure 6(A) shows an overview of the HSV1 infection protocol. One of the HSV1 capsid proteins is tagged with tdTomato. Figure 6(B) shows the HSV1 titers in conjunctival ALI culture medium detected by qPCR with and without 10 μM acyclovir treatment. Supernatants were collected every 24 hours and the HSV1 genome copy number was evaluated. n=3 independent experiments. Figure 6(C) shows an overview of the SARS-CoV-2 infection protocol. Figure 6(D) shows the titers of SARS-CoV-2 variants 614G and delta in conjunctival ALI culture medium detected by qPCR. Supernatants were collected every 24 hours to evaluate the SARS-CoV-2 RNA copy number. n=3 independent infection ALI cultures. Figure 6(E) shows an overview of the hAdV8 infection protocol. Figure 6(G) shows the hAdV8 titers in conjunctival ALI cultures detected by qPCR with and without treatment with 10 μM acyclovir, 60 μM cidofovir, or 20 μM nelfinavir. Supernatants were collected every 24 hours, and the number of hAdV8 genome copies was assessed. n=3 independent experiments. [Figure 6-2] Figure 6(F) shows bright-field images of ALI cultures 48 hours (top) and 96 hours (bottom) after hAdV8 infection, with or without the addition of 10 μM acyclovir, 60 μM cidofovir, or 20 μM nelfinavir. Scale bar, 100 μm. [Figure 7-1]This figure shows that human conjunctival organoids can engraft and be manipulated for human transplantation. Figure 7(A) shows an overview of organoid transplantation in NSG mice. Figure 7(B) shows staining of human KRT19 (hKRT19), KI67, TP63, and MUC1 in the transplanted eye 2 days after surgery. Scale bars: large panel 500 μm, small panel 50 μm. Representative of n=2 mice. [Figure 7-2] Figure 7(C) shows the staining of hKRT19, human nucleolus, MUC5AC, MUC1, and TP63 three weeks after transplantation. The dashed line indicates the transplantation site based on human staining of serial sections immediately after transplantation. Scale bars: 100 μm in the left panel, 50 μm in the right panel. Figure 7(D) shows the quantification of successful engraftment three weeks later. [Figure 8] This figure shows the preparation of a transplantable conjunctival cell sheet on a fibrin matrix. Figure 8(A) shows an overview of the preparation of a transplantable human organoid-based cell sheet. Figure 8(B) shows the staining of human KRT19 (hKRT19), TP63, and MUC1 7 days after seeding. Scale bars: large panel 1 mm, small panel 50 μm. [Figure 9] This figure shows the growth of organoids on a collagen I matrix. Scale bar: overall view: 500 μm, zoom in: 100 μm, however, the inset in the upper right is 500 μm. [Figure 10] This photograph shows the defect area indicated by the white dashed line (5 mm in diameter). The sutures marking the boundary of the graft are clearly visible, which indicates the degree to which the defect has healed. [Figure 11] This diagram shows that human (i.e., organoid) cells are present in the defect area, and that many goblet cells are present. [Figure 12-1] Figure 12(A) shows a limbal organoid obtained by the method according to the present invention. [Figure 12-2] Figure 12(B) shows the passage numbers of human limbal organoids in expanded medium (hCJ), X2 medium, and X3 medium. Culturing and passage are still ongoing. Similar results were obtained with other limbal organoid strains. [Figure 13-1]This figure shows a two-dimensional ALI culture of limbal organoids. [Figure 13-2] This figure shows a two-dimensional ALI culture of limbal organoids. [Modes for carrying out the invention]

[0055] definition This disclosure contains copyrighted material (including, but not limited to, figures, apparatus photographs, or other aspects of this post that are or may be copyrighted in any jurisdiction). The copyright holders have no objection to facsimile copies of the patent documents or patent disclosures listed in the patent files or patent records of the Japan Patent Office, but all other copyrights are reserved.

[0056] Various terms relating to the methods, compositions, uses, and other embodiments of the present invention are used throughout the specification and claims. Such terms have their common meanings in the art to which the invention pertains, unless otherwise specified. Other specifically defined terms are to be interpreted in accordance with the definitions provided herein. Similar or equivalent methods and materials may be used in the test implementation of the present invention, but preferred materials and methods are described herein.

[0057] For the purposes of this invention, the following terms are defined below.

[0058] In this specification, the singular forms "a," "an," and "the" include multiple references unless the context clearly indicates otherwise. The indefinite articles "a" and "an" are synonymous with "at least one" or "one or more."

[0059] In this specification, the term "quantity" is used interchangeably with the term "dose."

[0060] In this specification, the term "and / or" indicates that one or more of the described cases may occur individually, in combination with at least one of the described cases, or in combination with all of the described cases.

[0061] In this specification, the term “at least” a particular value means that particular value or greater. For example, “at least 2” is understood to be the same as “2 or more,” i.e., 2, 3, 4, 5, 6, 7, 8, 9, 10, 11, 12, 13, 14, 15, ..., etc.

[0062] In this specification, “comprise” or “to comprise” is to be interpreted as inclusive, open-ended, and non-exclusive. Specifically, this term and its variations mean that the specified feature, step, or component is included. These terms are not to be interpreted as excluding the existence of other features, steps, or components. They also encompass the more restrictive “consist of.”

[0063] In this specification, “prior art” or “methods known to those skilled in the art” means that the methods used in the methods disclosed herein would be obvious to those skilled in the art. Practices of the prior art in molecular biology, biochemistry, cell culture, genomics, sequencing, medicine, pharmacology, immunology, and related fields are well known to those skilled in the art and are discussed in various handbooks and references.

[0064] In this specification, the term “subject” refers to any vertebrate, but typically relates to mammals, e.g., humans, domesticated animals (such as dogs or cats), livestock animals (such as horses, cattle, or sheep), or laboratory animals (such as rats, mice, non-human primates or guinea pigs, or rabbits). In preferred examples, the subject is human and includes males, females, adults, elderly, children, or infants who have a need for treatment, particularly a need for treatment involving the transplantation of (part of) the conjunctiva.

[0065] In this specification, the terms “therapeutably effective amount” or “effective amount” mean an amount of organoids, organoid-containing grafts, organoid-constituting cells, or organoid-containing grafts, or any other product disclosed herein, that is effective in producing an effective and desired (therapeutic) effect in a subject, within the scope of the therapeutics of the present invention, at an applicable and reasonable benefit / risk ratio.

[0066] As used herein, the terms “treatment” and “to treat” mean therapeutic procedures. The goal of treatment is at least to slow the progression of the disease. Those who require treatment include those who are already in a diseased state.

[0067] An “organoid” is a structured cell line obtained in vitro that reproduces and mimics a miniaturized and simplified version of an actual organ in terms of its major functional, structural, and biological complexity. Organoids can generally be obtained by culturing stem cells embedded in a three-dimensional cell culture medium, which is a hydrogel containing extracellular matrix components. Thus, a “conjunctival organoid” is an organoid that mimics the actual, particularly mammalian, conjunctiva. The conjunctival organoids of this invention are more particularly conjunctival epithelial organoids, meaning they mimic the conjunctival epithelium. Organoids are obtained from conjunctival stem cells, which are basal cells present in the sublayers of multilayer epithelium or in pockets of simple epithelium. Thus, a “limbal organoid” is an organoid that mimics the actual, particularly mammalian, limbal tissue and / or corneal tissue (including corneal epithelium and / or limbal epithelium). Organoids are obtained from limbal stem cells, which are cells found in the limbus and / or corneal tissue. Accordingly, it will be understood by those skilled in the art that, in the present invention, terms such as limbal tissue and corneal tissue (including corneal epithelium and / or limbal epithelium) are related in that they are obtained by the methods disclosed herein based on the use of limbal stem cells and / or limbal organoids.

[0068] "Conjunctival stem cells," also known as adult conjunctival stem cells or "basal cells," are understood as somewhat undifferentiated cells that, under appropriate stimulation and conditions, can differentiate into more specialized cells found in the conjunctival epithelium, such as keratinocytes and goblet cells. In this specification, "basal cells" are also identified as cells within organoids expressing the transcription factor TP63. While "basal cells" in epithelial structures are generally recognized as epithelial stem cells, they may also refer to any cells located on the epithelial basement membrane (i.e., basally located). In this specification, basal cells are the cells on the outer surface of organoids in contact with basement membrane extracts or fibrin in the cell cultures disclosed herein. These cells mimic cells located in the lower layers (i.e., basally located) of multilayer epithelium and in the pockets of simple epithelium, constituting the so-called basal layer. "Limbal stem cells," also called adult limbal stem cells or corneal epithelial stem cells, are understood as somewhat undifferentiated cells that, under appropriate stimulation or conditions, can differentiate into more specialized cells such as corneal epithelium and / or limbal epithelium, for example, those found in the cornea and / or limbus.

[0069] Keratinocytes are the main differentiated cells found in the conjunctival epithelium. Keratinocytes differentiate from subepithelial stem cells (i.e., basal stem cells) and migrate toward the surface. Keratinocytes express different markers depending on the stage of differentiation, but mainly keratin and mucin. In the organoids disclosed herein, keratinocytes are referred to as differentiated conjunctival epidermal cells that preferably do not express TP63 and / or express at least mucin 1 (MUC1) and aquaporin 5 (AQP5). These are located in the apical and intermediate zones of organoids, as well as in the apical or intermediate layer of cell cultures on a plate. In organoids derived from conjunctival stem cells that have been expanded and / or proliferated and / or differentiated in a hydrogel matrix that mimics the extracellular matrix (i.e., basement membrane extract or fibrin), the apical zone is located in a region within the organoid that is not in contact with this matrix (i.e., not in contact with fibrin or basement membrane extract). In multilayer cell cultures on plates obtained from the expansion and / or proliferation and / or differentiation of conjunctival stem cells (i.e., ALI cultures), the apical zone is the region defined by a layer of cells that are not in contact with the support or matrix (i.e., not in contact with basement membrane extracts or fibrin). Therefore, the apical or intermediate zone of organoids, or multilayer in vitro cell cultures of the conjunctiva, is a region that is far from or not in contact with the support or matrix that mimics the extracellular matrix, and corresponds to the region where conjunctival stem cells were first seeded and expanded and / or proliferated and / or differentiated, or the region above it.

[0070] "Goblet cells" are also specialized (i.e., differentiated) cells scattered among the conjunctival epithelium. Morphologically, goblet cells are columnar and secrete mucin. In this specification, they are specifically identified as cells that express mucin 5AC (MUC5AC) and are positioned apical relative to the support or matrix in which organoids are formed.

[0071] In the present invention, when the expressions “isolation from conjunctiva,” “isolation from cornea,” and “isolation from limbus” are used, it means that it includes minimal manipulation of the biopsy, such as simply bringing the biopsy into contact with an extracellular matrix mimic (e.g., BME) and adding (enlarged) cell culture medium, or homogenization of the biopsy to obtain a mixture of single cells or cell aggregates. It also includes more complex operations, such as selectively separating different cells from the conjunctiva, cornea, and limbus, and isolating fractions containing or consisting of conjunctival stem cells (present in conjunctival tissue) or limbal stem cells (present in limbal tissue and / or corneal tissue), respectively, and culturing them as directed.

[0072] In this specification, the expression “substantially absent” is understood to include not only the absence of the compound or composition in the culture medium, but also trace amounts that do not interfere with the growth and lifespan of organoids, or interfere with the intended effect in a particular culture medium or environment defined as substantially absent from the compound or composition.

[0073] As used herein, "expanding medium" refers to a cell culture medium that promotes organoid proliferation by increasing the number of organoid cells while expanding the surface area of ​​the organoids, in addition to being a basal cell culture medium containing nutrients for maintaining cell lifespan.

[0074] The expansion media used in the methods disclosed herein remarkably enable the long-term culture of conjunctival organoids and / or limbal organoids, respectively, without loss of cleavage (or passage) ability. In other words, the expansion media according to the present invention remarkably maintain the stem cell capacity of the culture without the cells losing their cleavage ability over long-term culture (or cell passage). For example, in some embodiments, organoids according to the present invention can be passaged (or cleaved) at least 10 times or more without the cell culture losing its ability to continue expanding. This allows organoids to be cultured for a long period, for example, at least 50 days, or 100 days or more, starting from stem cells obtained from a biopsy.

[0075] In this specification, “differentiation medium” is understood to be a medium that facilitates the transformation of stem cells from less specialized types or stages to more specialized forms and functions. In specific cases of the present invention, it is a medium comprising one or more compounds that promote cell proliferation and subsequently enable the acquisition of capabilities (i.e., to initiate differentiation into keratinocytes, goblet cells, and tuft cells in the case of conjunctiva).

[0076] Those skilled in the art are familiar with these differentiation media from the prior art. This specification provides particularly useful examples for promoting the differentiation of conjunctival organoids, which are also useful for the differentiation of limbal organoids. As used herein, “candidate drug” or “drug” refers to a molecule that can be screened or identified as modulating the development, post-injury regeneration, or permeability to the drug or other substance of the conjunctival epithelium, or the corneal epithelium and / or limbal epithelium. Such drugs may, for example, be inhibitors or enhancers (i.e., promoters) of conjunctival functionality or limbal tissue and / or corneal tissue (including corneal epithelium and / or limbal epithelium) functionality, and may find a variety of applications, including therapeutic ones.

[0077] The screening method is typically an assay that provides a qualitative / quantitative measurement of activity in the presence of a specific candidate drug (i.e., regulation of conjunctival development, permeability, and regeneration, or regulation of the development, permeability, regeneration, and regulation of limbal tissue and / or corneal tissue (including corneal epithelium and / or limbal epithelium)). In embodiments of the present invention, the screening uses conjunctival organoids. In embodiments of the present invention, the screening uses limbal organoids. In embodiments of the present invention, the screening uses ALI-cultured conjunctiva (e.g., obtained from conjunctival organoids) as disclosed herein. In embodiments of the present invention, the screening uses ALI-cultured limbal tissue and / or corneal tissue (including corneal epithelium and / or limbal epithelium) as disclosed herein (e.g., obtained from limbal organoids as disclosed herein).

[0078] Candidate drugs can be obtained from a wide variety of sources, including libraries of synthetic or natural compounds. For example, numerous means are available for the random and directed synthesis of a wide variety of organic compounds and biomolecules, including the expression of randomized oligonucleotides and oligopeptides. Alternatively, libraries of natural compounds in the form of bacterial, fungal, plant, and animal extracts or purified compounds are available or can be produced. Furthermore, libraries and compounds produced naturally or synthetically can be prepared using conventional chemical, physical, and biochemical means and used to produce combinatorial libraries. Known pharmacological drugs can undergo directed or random chemical modifications, such as acylation, alkylation, esterification, and amidation, to produce structural analogs or derivatives. Candidate drugs may also be biomolecules, including peptides, saccharides, fatty acids, steroids, purines, pyrimidines, derivatives, structural analogs, or combinations thereof.

[0079] (Detailed explanation) The present invention is defined herein, and in particular in the appended claims. Subject matter not included in the claims does not form part of the present invention.

[0080] Any method, use, product, or composition described herein is intended to be applicable in relation to any other method, use, product, or composition described herein. Embodiments discussed relating to the methods, uses, products, and / or compositions of the present invention may be adopted in relation to any other method, use, product, or composition described herein. Therefore, an embodiment relating to one method, use, product, or composition may also be applicable to other methods, uses, products, and compositions of the present invention.

[0081] All references herein to therapeutic methods refer to the compounds, pharmaceutical compositions, and pharmaceuticals of the present invention for use in therapeutic methods of treating the human (or animal) body.

[0082] As embodied and extensively described herein, the present invention is directed toward the remarkable discovery that long-term proliferative organoids of conjunctival epithelium or primary conjunctival tissue can be obtained from conjunctival stem cells under reliable and reproducible conditions. These organoids reproduce the essential structural and physiological features of actual conjunctival epithelium. These organoids can be obtained in quantities or with sufficient surface area for use in replacing or refilling actual conjunctiva in mammals, particularly humans.

[0083] Similarly, as embodied and extensively described herein, the present invention is directed toward the remarkable discovery that long-term proliferation of limbal organoids, or corneal epithelium and / or limbal epithelium, or primary limbal tissue and / or corneal tissue, can be obtained from limbal stem cells under reliable and reproducible conditions. The organoids reproduce the essential structural and physiological features of actual limbal tissue and / or corneal tissue (including corneal epithelium and / or limbal epithelium). They can be obtained in quantities or with sufficient surface area for use in replacement or refilling of limbal tissue and / or corneal tissue (including corneal epithelium and / or limbal epithelium), particularly in humans.

[0084] Considering the practical applications of organoids, namely as study models for the physiology and structure of organs and tissues, and their applicability as substitutes for tissues or organs, it is relevant that organoids have a long lifespan for their manipulation and for engraftment into the body that receives them.

[0085] This discovery is unexpected, as most previous attempts to obtain conjunctival epithelium have involved short-lived excisions, which present inherent challenges in securing sufficient tissue volume and maintaining stable viability for transplantation. When conjunctival organoids are obtained from iPSC expansion, the resulting conjunctival epithelium does not reproduce the maturity of actual conjunctival epithelium, making it insufficient as a conjunctival model or raising questions about its suitability for transplantation. Similarly, attempts to obtain limbal organoids have only been partially successful and suffer from the same types of problems.

[0086] Accordingly, the inventions disclosed herein are also intended to provide a versatile platform for studying conjunctival (pathophysiology) and a solution to an unaddressed need in the art that has lacked in vitro-produced conjunctival tissue that replicates all the important features of the conjunctival epithelium. Similarly, the inventions disclosed herein are also intended to provide a versatile platform for studying limbal and corneal (pathophysiology) that replicates all the important features of the corneal epithelium, and a solution to an unaddressed need in the art that provides in vitro-produced limbal tissue, e.g., limbal tissue and / or corneal tissue, preferably corneal epithelium and / or limbal epithelial tissue.

[0087] In vitro method for producing conjunctival organoids or limbal organoids: As previously stated, the present invention is an in vitro method for producing conjunctival organoids, particularly mammalian conjunctival organoids. The method is (a) A step of providing conjunctival stem cells, particularly conjunctival stem cells from an isolated conjunctival sample, (b) The step of culturing conjunctival stem cells in a culture medium under conditions suitable for the formation of conjunctival organoids.

[0088] As previously stated, the present invention first relates to an in vitro method for producing limbal organoids, particularly mammalian limbal organoids. The method is as follows: (a) Providing limbal stem cells from a particularly isolated limbal or corneal sample, (b) The procedure comprises the step of culturing limbal stem cells in a culture medium under conditions suitable for the formation of limbal organoids.

[0089] In certain embodiments of the in vitro method disclosed above, the organoid is a conjunctival epithelial organoid. In certain embodiments of the in vitro method disclosed above, the organoid is a limbal (or corneal epithelial) organoid.

[0090] In certain embodiments of the in vitro methods disclosed above, the step of culturing conjunctival stem cells or limbal stem cells in a culture medium includes the step of culturing them in a cell expansion culture medium, preferably the cell expansion culture medium comprising an inhibitor of the transforming growth factor β (TGF-β) signaling pathway, an inhibitor of bone morphogenetic protein (BMP), and / or an agonist of the Wnt pathway.

[0091] In certain embodiments of the in vitro methods disclosed above, the step of culturing conjunctival stem cells or limbal stem cells in a culture medium includes the step of culturing them in a cell expansion culture medium, preferably the cell expansion culture medium comprising an inhibitor of the transforming growth factor β (TGF-β) signaling pathway, an inhibitor of bone morphogenetic protein (BMP), and / or an agonist of the Wnt pathway, a cyclic AMP activator, and / or an activator of fibroblast growth factor (FGF) signaling.

[0092] In certain embodiments of the in vitro methods disclosed above, the step of culturing conjunctival stem cells or limbal stem cells in a culture medium includes the step of culturing them in a cell expansion culture medium, which preferably comprises an inhibitor of the transforming growth factor β (TGF-β) signaling pathway, an inhibitor of bone morphogenetic protein (BMP), an agonist of the Wnt pathway, a cyclic AMP activator, and an activator of fibroblast growth factor (FGF) signaling, in particular one or more fibroblast growth factors (FGF), in particular FGF-1 and / or FGF-10, preferably FGF1 and FGF10.

[0093] In another particular embodiment of the cell culture medium, preferably a cell expansion culture medium, the cell culture medium further comprises one or more interleukins, particularly interleukin-4 (IL-4) and interleukin-13 (IL-13), more preferably interleukin-6 (IL-6).

[0094] Cell culture media containing interleukins, preferably cell expansion media, can be used to study the conjunctiva under conditions that mimic inflammatory states.

[0095] Furthermore, the presence of one or more interleukins, preferably IL-4 and IL-13, in the cell culture medium, preferably cell expansion culture medium, also promotes the expansion of goblet cells and tuft cells in conjunctival organoids.

[0096] In another specific embodiment of the cell culture medium, preferably a cell expansion culture medium, further comprises insulin-like growth factor, particularly insulin-like growth factor 1 (IGF-1) (or its derivatives such as Long R3 recombinant).

[0097] In another specific embodiment of the cell culture medium, preferably the cell expansion culture medium, the cell culture medium further comprises a keratinocyte growth factor also known as FGF-7.

[0098] In preferred embodiments, the culture medium, particularly the expansion medium, contains IGF-1 and FGF-7. Therefore, in particularly preferred embodiments, the culture medium, particularly the expansion medium, contains Wnt pathway agonists, cyclic AMP activators, fibroblast growth factor (FGF) signaling activators (particularly one or more fibroblast growth factors (FGF), particularly FGF-1 and / or FGF-10), preferably FGF1 and FGF10, IGF-1 and FGF-7.

[0099] In another specific embodiment, the in vitro method comprises the step of culturing in culture medium for a period of time sufficient to allow the formation of conjunctival organoids, preferably the formed conjunctival organoids comprising cells expressing one or more of the transcription factor tumor protein p63 (TP63), keratin-19 (KRT19), mucin short variant S1 (MUC1), and aquaporin-5 (AQP5).

[0100] More specifically, the formed conjunctival organoids contain cells expressing KRT19 and one or more of TP63, MUC1, and AQP5.

[0101] More specifically, the formed conjunctival organoids include basal cells expressing KRT19 and TP63, as well as differentiated apical keratinocytes expressing KRT19 and one or more of MUC1 and AQP5, and in particular, both MUC1 and AQP5.

[0102] Thus, the spatial distribution of these cells, that is, their attributes as basal or apical, mimics that of actual conjunctival epithelium. The basal location corresponds to the outer surface of organoids in contact with fibrin or basement membrane extract matrix, or collagen, which mimic the extracellular matrix, and is used for culturing cells in or on it. Basal cells are actually conjunctival stem cells. The apical location, mainly occupied by keratinocytes, corresponds to the region within organoids that is not in contact with fibrin or basement membrane extract.

[0103] In another specific embodiment, the in vitro method includes the step of culturing in culture medium for a period sufficient to allow the formation of limbal organoids, preferably the formed limbal organoids comprising cells expressing one or more of the transcription factor tumor proteins p63 (TP63), keratin-24 (KRT24), and PAX6 (Paired box protein Pax-6, also known as anilidia type II protein (AN2) or oculorhombin). In a preferred embodiment, the formed limbal organoids comprising cells expressing KRT12. In some embodiments, the cells do not express MUC-1 (mucin-1), or substantially do not express it.

[0104] In another specific embodiment of an in vitro method for producing conjunctival organoids and / or limbal organoids, the incubation period in the culture medium is at least 3 days. More specifically, the incubation period is selected from 3 days to 10 weeks, 3 days to 8 weeks, 3 days to 7 weeks, 3 days to 6 weeks, 3 days to 5 weeks, 3 days to 4 weeks, 3 days to 3 weeks, 3 days to 2 weeks, and 3 days to 1 week. In another, more specific embodiment, the period is selected from 3, 4, 5, 6, 7, 8, 9, 10, 11, 12, 13, 14, 15, 16, 17, 18, 19, 20, 21, 22, 23, 24, 25, 26, 27, 28, 29, 30, 31, 32, 33, 34, 35, 36, 37, 38, 39, 40, 41, 42, 43, 44, 45, 46, 47, 48, 49, 50, 51, 52, 53, 54, 55, and 56 days. Those skilled in the art will understand that during cultivation, for example in a broad-stage medium, the culture medium may be replaced with fresh culture medium. It was remarkable that the expanded culture medium disclosed herein made it possible to culture conjunctival organoids and / or limbal organoids for extended periods, such as at least 60, 70, 80, 90, 100, 200 days or more.

[0105] Therefore, in the culture method according to the present invention, organoids can be subcultured (divided) over a long period of time using the expanded culture medium of the present invention. For example, it has been surprisingly found that at least 10, 20, 30, 40, 50 or more subcultures can be achieved for conjunctival organoids, and at least 10, 20, 30, 40, 50 or more subcultures can be achieved for limbal organoids.

[0106] In another specific embodiment of an in vitro method for producing conjunctival organoids or limbal organoids, the culture in a culture medium is carried out on or in a composition containing an extracellular matrix compound or a composition that mimics the extracellular matrix. These are well known to those skilled in the art. In particular, hydrogels suitable for culturing cells according to the present invention are used.

[0107] Examples of compositions that mimic the extracellular matrix include hydrogels containing fibrin, basement membrane extract matrix, collagen, or laminin. Those skilled in the art will know of commercially available compounds or compositions that mimic the extracellular matrix and have been used in the prior art for culturing cells, including, for example, basement membrane extract (BME) and Matrigel. In one embodiment, as shown in the examples, conjunctival stem cells and / or limbal stem cells are mixed with an unsolidified hydrogel (e.g., basement membrane extract), the hydrogel is then gelled, and the cells are grown within the solidified hydrogel. Thus, in some embodiments, conjunctival stem cells and / or limbal stem cells are present in a hydrogel, e.g., BME. In other embodiments, conjunctival stem cells and / or limbal stem cells are placed on or on a hydrogel, e.g., BME.

[0108] In a particularly preferred embodiment, conjunctival organoids or ALI cultures, and / or limbal organoids and / or ALI cultures, can be cultured on a collagen matrix for, for example, at least one passage, two passages, or more, for example, two passages. This remarkable effect addresses situations where it is undesirable to grow organoids in an animal-derived matrix, such as when conjunctival organoids or ALI cultures, and / or limbal organoids and / or ALI cultures, are used for transplantation.

[0109] In another specific embodiment of the in vitro method for producing conjunctival organoids, the conjunctiva is mammalian, rodent, or human conjunctiva, preferably human conjunctiva. In another specific embodiment of the in vitro method for producing limbal organoids, the cells are mammalian, rodent, or human cells, preferably human cells.

[0110] In another specific embodiment of the in vitro method for producing conjunctival organoids, the conjunctival stem cells are actually known as adult conjunctival stem cells, particularly mammalian adult conjunctival stem cells. More specifically, the conjunctival stem cells are human adult conjunctival stem cells. In another specific embodiment of the in vitro method for producing limbal system organoids, the limbal system stem cells are actually known as adult limbal system stem cells, particularly mammalian adult limbal system stem cells. More specifically, the limbal system stem cells are human adult limbal stem cells.

[0111] Those skilled in the art know of various sources for conjunctival stem cells and / or limbal stem cells, particularly adult conjunctival stem cells and / or adult limbal stem cells. Particularly preferred sources are primary tissues or samples (biops) containing these cells.

[0112] A particularly preferred source of conjunctival stem cells is the conjunctiva, especially mammalian conjunctiva, and more specifically, human conjunctiva. Isolation and provision of adult conjunctival stem cells are particularly important when organoids are used in autologous cell therapy. Such conjunctival-derived organoids rarely activate the target immune system against grafts composed of or containing organoids.

[0113] Furthermore, in a more specific embodiment of the in vitro method of the present invention, the conjunctiva is selected from one or more of the palpebral conjunctiva and the bulbar conjunctiva.

[0114] Particularly preferred sources of limbal stem cells are limbal tissue and / or corneal tissue, especially mammalian limbal tissue and / or corneal tissue, and even more specifically human limbal tissue and / or corneal tissue, where limbal adult stem cells can be found in the same way as they arise in other tissues of the body. Isolating or providing adult stem cells from the limbus or corneal sampling (i.e., biopsy) is of particular interest when organoids are used as autologous cell therapy. Such autologous tissue-derived organoids rarely activate the target immune system against, for example, grafts composed of or containing organoids.

[0115] Conveniently, as shown in the following examples, organoids that reproduce the structure and physiology of actual conjunctival epithelial tissue have been obtained from palpebral or bulbar conjunctiva. Advantageously, as demonstrated in tests conducted by the inventors, organoids that reproduce the structure and physiology of actual limbal tissue and / or corneal tissue (including corneal epithelium and / or limbal epithelium) can be obtained from limbal stem cells, including adult limbal stem cells, obtained from limbal tissue and / or corneal tissue.

[0116] Another embodiment of the in vitro method according to the present invention relates to a method in which the conjunctival stem cells or limbal stem cells, particularly adult stem cells, are human conjunctival stem cells or limbal stem cells, preferably the culture medium / cell expansion culture medium is substantially free of epidermal growth factor (EGF), and optionally includes cyclic AMP activator, particularly forskolin, and / or one or more fibroblast growth factors (FGF), particularly one or more fibroblast growth factors (FGF) selected from FGF1 and FGF10, and combinations thereof.

[0117] The inventors have observed that the lifespan of human conjunctival epithelial organoids or human limbal organoids is reduced when EGF is present in the cell culture medium. Thus, although EGF is not harmful as it allows for organoid elongation and expansion in several passages, it makes the method of producing the organoids impractical. Therefore, when the expression "substantially absent" in this specification refers to the presence and amount of EGF, it is understood to include not only the absence of the compound in the culture medium, but also amounts (trace amounts) that do not impede the growth and lifespan of the organoids.

[0118] The inventors have surprisingly discovered that certain stem cells of the conjunctiva, particularly mammalian conjunctiva, can proliferate and differentiate under conditions that enable the production of organoids including basal cells expressing KRT19 and preferably TP63, apical keratinocytes expressing KRT19 and one or more MUC1 and AQP5, and goblet cells expressing MUC5AC in particular. These amphipotent stem cells are conjunctival stem cells that express at least nerve growth factor receptor (NGFR) in that they can differentiate into both keratinocytes and goblet cells. Therefore, they are NGFR-positive cells.

[0119] Therefore, in another specific embodiment of the in vitro method according to the first aspect of the present invention, the conjunctival stem cells, preferably human conjunctival stem cells, are either expressing NGFR or are nerve growth factor receptor-positive conjunctival stem cells (NGFR+). Corneal limbal stem cells may also express NGFR.

[0120] In another specific embodiment, an in vitro method for producing conjunctival organoids or limbal organoids comprises the step of culturing conjunctival stem cells or organoids, or limbal stem cells or organoids, in a culture medium which is a cell differentiation culture medium, preferably the cell differentiation culture medium comprising a TGF-β signaling pathway inhibitor, a BMP inhibitor, and / or a Wnt pathway agonist, and more preferably the cell differentiation culture medium further substantially omits EGF, fibroblast growth factor, and / or B27 supplements.

[0121] In a preferred embodiment of the cell differentiation medium, the medium further comprises insulin-like growth factor, particularly insulin-like growth factor 1 (IGF-1) (or its derivatives such as Long R3 recombinant). In another specific embodiment of the cell culture differentiation medium, it further comprises keratinocyte growth factor, also known as FGF-7. In a preferred embodiment, the cell culture differentiation medium comprises IGF-1 and FGF-7. In some embodiments, the cell culture differentiation medium comprises IL-6 in addition to IGF-1, FGF-7, or both.

[0122] Therefore, in particularly preferred embodiments, the cell culture differentiation medium comprises an inhibitor of the transforming growth factor β (TGF-β) signaling pathway, an inhibitor of bone morphogenetic protein (BMP), a Wnt pathway agonist, a cyclic AMP activator, IGF-1, and FGF-7. Preferably, the cell culture differentiation medium does not contain FGF-1, FGF-10, or both. Preferably, in some embodiments, the cell culture differentiation medium does not contain a B27 supplement, but in other embodiments, it may contain a B27 supplement. Preferably, the cell culture differentiation medium does not contain a WNT surrogate. Preferably, the cell culture differentiation medium does not contain EGF.

[0123] The in vitro method of the present invention is carried out in a cell culture medium that promotes the proliferation and differentiation of conjunctival stem cells and / or limbal stem cells.

[0124] In certain embodiments of the in vitro method, the step of culturing conjunctival stem cells or limbal stem cells in a culture medium includes the step of culturing them in cell expansion culture medium followed by culturing them in cell differentiation culture medium.

[0125] In another specific embodiment of the in vitro method according to the present invention, the culture in a culture medium, particularly a cell differentiation culture medium, is for a period of time sufficient to allow the formation of conjunctival organoids, and preferably the formed conjunctival organoids include keratinocytes expressing one or more of KRT-19, TP63, MUC1, and AQP5, and further include goblet cells.

[0126] More specifically, the formed conjunctival organoids contain cells expressing KRT19 and one or more of TP63, MUC1, and AQP5.

[0127] More specifically, the formed conjunctival organoids include basal cells expressing KRT19 and TP63, as well as differentiated apical keratinocytes expressing KRT19 and one or more of MUC1 and AQP5.

[0128] In another specific embodiment of the in vitro method according to the present invention, the culture in a culture medium, particularly a cell differentiation culture medium, is for a period sufficient to allow the formation of limbal organoids, and preferably the formed limbal organoids include cells expressing one or more of the transcription factor tumor proteins p63 (TP63), keratin-24 (KRT24), and PAX6 (Paired box protein Pax-6, also known as anilidia type II protein (AN2) or ocularhombin). In a preferred embodiment, the formed limbal organoids include cells expressing KRT12. In some embodiments, the cells do not express MUC-1 (mucin-1), or substantially do not express it.

[0129] In another specific embodiment of the in vitro method according to the present invention, the culture in culture medium, particularly cell differentiation medium, is for at least 3 days, more particularly for a period selected from 3 to 6 weeks, 3 to 5 weeks, 3 to 4 weeks, 3 to 2 weeks, and 3 to 1 week. In yet another specific embodiment, the culture is for a period selected from 3, 4, 5, 6, 7, 8, 9, 10, 11, 12, 13, 14, 15, 16, 17, 18, 19, 20, 21, 22, 23, 24, 25, 26, 27, 28, 29, 30, 31, 32, 33, 34, 35, 36, 37, 38, 39, 40, 41, and 42 days. In a specific embodiment available for a shorter time, the culture in medium, particularly cell differentiation medium, is for 3 to 4 days.

[0130] In a more specific embodiment of the in vitro method, the step of culturing conjunctival stem cells and / or limbal stem cells in culture medium is to culture them in cell expansion culture medium for at least 3 days, more particularly at least 10 days, or for the aforementioned periods in expansion culture medium, more particularly 3, 4, 5, 6, 7, 8, 9, 10, 11, 12, 13, 14, 15, 16, 17, 18, 19, 20, 21, 22, 23, 24, 25, 26, 27, 28, 29, 30, 31, 32, 33, 34, 35, 36, 37, 38, 39, 40, 41, 42, 43, 44, 45, 46, 47, 48 The step includes culturing for 49, 50, 51, 52, 53, 54, 55, 56 days, or a period selected from at least such periods, and then culturing for at least 3 days in a cell differentiation medium, more particularly for the differentiation medium, for the periods mentioned above, more particularly for 3, 4, 5, 6, 7, 8, 9, 10, 11, 12, 13, 14, 15, 16, 17, 18, 19, 20, 21, 22, 23, 24, 25, 26, 27, 28, 29, 30, 31, 32, 33, 34, 35, 36, 37, 38, 39, 40, 41, 42 days, or a period selected from at least such periods. This particular order and timing of expansion and differentiation culture medium is especially suitable for obtaining conjunctival organoids or limbal organoids as described herein, containing both differentiated keratinocytes and tuft cells, as well as goblet cells, at an apical position relative to the support or extracellular matrix (e.g., fibrin or basement membrane extract).

[0131] The conditions for conjunctival stem cells and / or limbal stem cells, particularly adult human conjunctival stem cells and / or adult human limbal stem cells, to form conjunctival organoids or limbal organoids, respectively, include culturing them in either cell culture expansion medium or differentiation medium in a medium containing a TGF-β signaling pathway inhibitor, a BMP inhibitor, and a Wnt pathway agonist.

[0132] In a particular embodiment of the in vitro method of the present invention, the inhibitor of the TGF-β signaling pathway is a compound selected from the group consisting of A83-01 (CAS No.: 909910-43-6), SB-431542 (CAS No.: 301836-41-9), SB-505124 (CAS No.: CAS694433-59-5), SB-525334 (CAS No.: 356559-20-1), LY364947 (CAS No.: 396129-53-6), SD-208 (CAS No.: 627536-09-8), SJN2511 (CAS No.: 2319939-07-4), and combinations thereof, particularly A83-01 (CAS No.: 909910-43-6). Other suitable compounds are known to those skilled in the art.

[0133] In another specific embodiment of the in vitro method of the first aspect, the BMP inhibitor is a compound selected from the group consisting of Noggin (human protein Uniprot Nr. P97466), Chordin, follistatin, gremlin, twisted gastrulation (TSG), short gastrulation (SOG), dolsomorphine, LDN193189 (CAS number: 1062368-24-4), and combinations thereof. Other suitable compounds are known to those skilled in the art.

[0134] In another specific embodiment of the in vitro method of the first aspect, the Wnt pathway agonist is selected from the group consisting of R-spondin; Wnt protein; Wnt surrogate; ROCK inhibitor; and combinations thereof. Other suitable compounds are known to those skilled in the art.

[0135] In more specific embodiments, the R-spongin is selected from R-spongin 1, R-spongin 2, R-spongin 3, and R-spongin 4, or combinations thereof. Other suitable compounds are known to those skilled in the art.

[0136] In more specific embodiments, the Wnt protein is selected from compound CHIR99021 (CAS number: 252917-06-9) or compound iCRT3(2-[[[2-(4-ethylphenyl)-5-methyl-4-oxazolyl]methyl]thio]-N-(2-phenylethyl)acetamide). Other suitable compounds are known to those skilled in the art.

[0137] Wnt surrogates are known to those skilled in the art, and examples include the WNT surrogate-Fc fusion protein provided by IPA therapeutics and described by Miao et al. (Cell Stem-cell (2020) Volume 27, Issue 5, Pages 840-851.e6. doi: 10.1016 / j.stem.2020.07.020). Other suitable compounds are known to those skilled in the art.

[0138] In certain embodiments, the ROCK inhibitor is compound Y-27632 (CAS number: 146986-50-7). Other suitable compounds are known to those skilled in the art.

[0139] In a particular embodiment of the in vitro method according to the present invention, once conjunctival organoids and / or limbal organoids have been formed, the method further comprises dissociating the cells contained in the organoids and then culturing one or more of the dissociated cells at a gas-liquid interface.

[0140] In a more specific embodiment, the in vitro method is (a) Providing a container comprising a first chamber and a second chamber, wherein the first chamber and the second chamber are separated by a porous membrane, (b) A step of seeding cells dissociated from conjunctival organoids and / or limbal organoids onto one side of a porous membrane, preferably on one side of the porous membrane in a first chamber, wherein the porous membrane is first coated with an extracellular matrix (ECM) composition, preferably containing one or more of collagen, laminin, and basement membrane extracts, and the cells are seeded onto this ECM, (c) The step of supplying culture medium to the first and / or second chambers so that the cells seeded on the porous membrane are immersed in the culture medium, (d) The step of expanding the seeded cells on a porous membrane for a period of time sufficient to obtain a substantially confluent cell layer, (e) Removing the culture medium from the chamber containing the layer of confluent cells, preferably the first chamber, and exposing the cells to air for a period of time sufficient to obtain a conjunctival cell culture containing multiple layers of cells, or a limbal cell culture containing multiple layers of cells, respectively. Equipped with, In a conjunctival cell culture, the cell layer proximal to the porous membrane comprises basal keratinocytes expressing KRT-19 and TP63, and the cell layer distal to the porous membrane comprises apical keratinocytes expressing MUC1 and goblet cells expressing MUC5AC. The limbal cell culture comprises cells expressing one or more of the transcription factor tumor proteins p63 (TP63), keratin 24 (KRT24), and PAX6 (Paired box protein Pax-6, also known as anilidia type II protein (AN2) or ochlorhonbin). In a preferred embodiment, the formed limbal organoid comprises cells expressing KRT12, and preferably the culture medium is a cell expansion culture medium or a cell differentiation culture medium, more preferably a cell expansion culture medium as disclosed herein. In some embodiments, the cells do not express MUC-1 (mucin-1) or express it substantially, and preferably the culture medium is a cell expansion culture medium or a cell differentiation culture medium, more preferably a cell expansion culture medium as disclosed herein.

[0141] In another specific embodiment of the in vitro method, the method is (a) Providing a container comprising a first chamber and a second chamber, wherein the first chamber and the second chamber are separated by a porous membrane, (b) A step of seeding conjunctival stem cells, particularly conjunctival stem cells derived from isolated mammalian conjunctiva, or limbal stem cells, particularly limbal stem cells derived from isolated mammalian limbal tissue and / or corneal tissue, on one side of a porous membrane, preferably on one side of a porous membrane in a first chamber, wherein the porous membrane is first coated with an extracellular matrix (ECM) composition, preferably comprising one or more of collagen, laminin, and basement membrane extracts, and the cells are seeded on this ECM, (c) The step of supplying culture medium to the first and / or second chambers so that the cells seeded on the porous membrane are immersed in the culture medium, (d) The step of expanding the seeded cells on a porous membrane for a period of time sufficient to obtain a substantially confluent cell layer, (e) Removing the culture medium from the chamber containing the layer of confluent cells, preferably the first chamber, and exposing the cells to air for a period of time sufficient to obtain a conjunctival cell culture containing multiple layers of cells, or a limbal cell culture containing multiple layers of cells, respectively. Equipped with, In the conjunctival cell culture, the cell layer proximal to the porous membrane contains basal keratinocytes expressing KRT-19 and TP63, and the cell layer distal to the porous membrane contains apical keratinocytes expressing MUC1 and goblet cells expressing MUC5AC. The limbal cell culture contains cells expressing one or more of the transcription factor tumor proteins p63 (TP63), keratin-24 (KRT24), and PAX6 (Paired box protein Pax-6, anilidia type II protein (AN2), or ochlorhonbin). Preferably, the culture medium is a cell expansion culture medium or a cell differentiation culture medium, more preferably a cell expansion culture medium as disclosed herein. In preferred embodiments, the formed limbal organoid contains cells expressing KRT12. In some embodiments, the cells do not express MUC-1 (mucin-1), or substantially do not express it. In a preferred embodiment, the formed conjunctival organoid contains tuft cells.

[0142] In a more specific embodiment of the in vitro method when performed at the gas-liquid interface, the conjunctival cell culture and / or limbal cell culture, which comprises multiple layers of cells, comprises at least two layers, and more particularly two to ten layers of cells.

[0143] If this method includes a step of gas-liquid interface culture from cells dissociated from conjunctival organoids, or from conjunctival stem cells, particularly conjunctival stem cells isolated from mammalian conjunctiva, then the resulting conjunctival cell culture, which contains multiple layers of the cells defined above, will contain goblet cells.

[0144] A conjunctival cell culture or a limbal cell culture containing multiple layers of cells can be detached from a chamber, preferably a first chamber, and used directly as an implant (i.e., graft or transplant) of, for example, conjunctiva, or limbal tissue and / or corneal tissue (including corneal epithelium and / or limbal epithelium) to an entity requiring it.

[0145] Isolated conjunctival organoids: As previously described, another aspect of the present invention is an isolated conjunctival organoid, particularly a human conjunctival organoid, comprising keratinocytes expressing KRT19 and one or more of TP63, MUC1, and AQP5. In particular, the isolated conjunctival organoid comprises basal cells expressing KRT19 and TP63, as well as differentiated apical keratinocytes expressing KRT19 and one or more of MUC1 and AQP5.

[0146] In a more specific and different embodiment of the isolated conjunctival organoid of the present invention, the isolated organoid, in particular the human conjunctival organoid, further comprises goblet cells, preferably goblet cells expressing MUC5AC. In a more preferred embodiment, the conjunctiva further comprises tuft cells.

[0147] Isolated limbal organoids: As previously described, another aspect of the present invention is an isolated limbal organoid, particularly a human limbal organoid, comprising cells expressing at least one of the transcription factor tumor protein p63 (TP63), keratin-24 (KRT24), and PAX6 (Paired box protein Pax-6, also known as anilidia type II protein (AN2) or oclorhonbin). In a preferred embodiment, the formed limbal organoid comprises cells expressing KRT12. In some embodiments, the cells do not express MUC-1 (mucin-1), or substantially do not express it.

[0148] Gas-liquid interface cultures of conjunctival organoids: As a result of the selection of gas-liquid interface cultures, gas-liquid interface cultures of conjunctival cells, preferably conjunctival organoid cells, are provided. The gas-liquid interface culture is i. A container comprising a first chamber and a second chamber, wherein the first chamber and the second chamber are separated by a porous membrane, ii. A multilayer of conjunctival cells arranged on at least one surface of a porous membrane, Equipped with, The multilayer comprises at least one cell layer located proximal to the porous membrane and containing basal keratinocytes expressing KRT-19 and TP63, and at least one cell layer located distal to the support and containing apical keratinocytes and goblet cells expressing KRT-19, MUC1 and AQP5. The gas-liquid interface culture optionally contains cell culture medium in at least one of the first and second chambers.

[0149] Gas-liquid interface cultures of limbal organoids: As a result of the selection of gas-liquid interface cultures, gas-liquid interface cultures of corneal epithelial cells and / or limbal epithelial cells, preferably limbal organoid cells, are provided. The gas-liquid interface culture is i. A container comprising a first chamber and a second chamber, wherein the first chamber and the second chamber are separated by a porous membrane, ii. A multilayer of limbal cells arranged on at least one surface of the porous membrane, Equipped with, The multilayer comprises cells expressing at least one of the transcription factor tumor protein p63 (TP63), keratin-24 (KRT24), and PAX6 (Paired box protein Pax-6, also known as anilidia type II protein (AN2) or ochlorhonbin), and the gas-liquid interface culture optionally contains cell culture medium in at least one of the first and second chambers. In preferred embodiments, the ALU cultured cells include cells expressing KRT12. In some embodiments, the cells do not express MUC-1 (mucin-1) or substantially do not express it.

[0150] Transplantation, graft, or graft of the conjunctiva or limbus: Another aspect of the present invention is a conjunctival implant, or an implant of limbal tissue and / or corneal tissue (including corneal epithelium and / or limbal epithelium). The conjunctival implant includes, or consists of, the conjunctival organoids as defined above, or obtained by the method defined above, particularly by the method including a gas-liquid interface culture, or includes, or consists of, cells dissociated from the conjunctival organoids. The limbal tissue and / or corneal tissue implant includes, or consists of, the limbal organoids as defined above, or obtained by the method defined above, particularly by the method including a gas-liquid interface culture, or includes, or consists of, cells dissociated from the limbal organoids.

[0151] In certain embodiments, a conjunctival implant, or an implant of limbal tissue and / or corneal tissue, each comprises a conjunctival organoid or limbal organoid as defined above, or a conjunctival organoid or limbal organoid obtained by the method defined above, particularly by a method including a gas-liquid interface culture, or cells dissociated from the conjunctival organoid or limbal organoid, and a physiologically acceptable material, preferably an adhesive material.

[0152] Physiologically acceptable adhesives are understood as compounds or compositions that are biocompatible, meaning they are non-toxic to cells and do not cause adverse effects such as immune responses when in contact with living tissue. Examples of these adhesives, also called bioadhesives or biocompatible adhesives, are, in certain embodiments, selected from compositions containing one or more of fibrin, laminin, albumin, and collagen, preferably fibrin. In preferred embodiments, these adhesives are or are derived from the autologous material of the object on which the implant is designed. Examples of useful commercially available adhesives include Baxter Tisseel Fibrin (Baxter), Human Collagen CC050 (Merck), and Laminin 1 (Human LAMA1 / Laminin Alpha 1 Recombinant (His) Protein LS-G12401-100) (LS Bio).

[0153] In fact, this physiologically acceptable adhesive material mimics or functions as an extracellular matrix that confines cells in a specific location. In more specific embodiments, the conjunctival implant is a layered conjunctival implant comprising a layer of physiologically acceptable adhesive material and a conjunctival cell culture comprising one or more layers of cells from conjunctival organoids or dissociated organoids, or a multilayer of cells from a gas-liquid interface culture, placed on the layer of physiologically acceptable adhesive material. In more specific embodiments, the limbal tissue and / or corneal tissue (including corneal epithelium and / or limbal epithelium) implant is a layered implant comprising a layer of physiologically acceptable adhesive material and a limbal tissue and / or corneal tissue (including corneal epithelium and / or limbal epithelium) cell culture comprising one or more layers of cells from limbal organoids or dissociated organoids, or a multilayer of cells from a gas-liquid interface culture, placed on the layer of physiologically acceptable adhesive material as disclosed herein.

[0154] These implants, possessing physiologically acceptable adhesive materials, are useful for precisely positioning layers of cells obtained from organoids or their dissociation, or from gas-liquid interface cultures, in desired locations within the body without the risk of loss within the eyeball.

[0155] Conjunctival organoids as pharmaceuticals As previously stated, another aspect of the present invention is an in vitro conjunctival organoid or an in vitro conjunctival implant for use as a pharmaceutical, wherein the conjunctival implant is as defined above, the in vitro conjunctival organoid can be obtained by the method defined in the first aspect or any one of its embodiments, and / or the in vitro conjunctival organoid is as defined above.

[0156] In certain embodiments of in vitro conjunctival organoids, or in vitro conjunctival implants for use as pharmaceuticals, their use is in the prevention and / or treatment of diseases or disorders of the conjunctiva, particularly the human conjunctiva, or in regenerative medicine.

[0157] In certain embodiments, conjunctival organoids or conjunctival implants obtained in vitro are used in autologous cell therapy.

[0158] In other specific embodiments of in vitro-obtained conjunctival organoids or in vitro-obtained conjunctival implants for use as pharmaceuticals, they are intended for use in the prevention and / or treatment of one or more ocular cancers selected from intraocular melanoma, squamous cell carcinoma, conjunctival hemorrhagic conjunctivitis, alaclima, allergic conjunctivitis, chemical eye injury, chemosis, conjunctival calculi, conjunctival hyperemia, conjunctivitis, conjunctival laxity, dry eye syndrome, keratoconjunctivitis, woody conjunctivitis, mucus fishing syndrome, neonatal conjunctivitis, ocular melanosis, pinguecula, pseudopterygium, pterygium (eye), erythrorhizon, subconjunctival hemorrhage, limbal keratoconjunctivitis, eyelid adhesion, vernal keratoconjunctivitis, and ocular cancers, particularly intraocular melanoma, squamous cell carcinoma, conjunctival intraepithelial neoplasm, lymphoma, and retinoblastoma (childhood cancer).

[0159] Some of these conditions result from infection of the conjunctiva by pathogens. Therefore, in a specific embodiment of in vitro-obtained conjunctival organoids or in vitro-obtained conjunctival implants for use as pharmaceuticals, they are used for the prevention and / or treatment of conjunctival diseases caused by pathogens.

[0160] In more specific embodiments, the pathogen is selected from viruses, bacteria, and fungi.

[0161] This aspect and its embodiments may also be prescribed as the use of the in vitro conjunctival organoid or in vitro conjunctival implant defined above for the preparation of pharmaceuticals, in particular for the prevention and / or treatment of diseases or disorders of the conjunctiva, in particular the human conjunctiva.

[0162] The present invention also relates to a method for treating a disease or disorder of the conjunctiva, particularly the human conjunctiva, comprising administering a therapeutically effective amount of the above-described in vitro conjunctival organoid or in vitro conjunctival implant to a subject in need thereof.

[0163] For use as a pharmaceutical product, an in vitro conjunctival organoid or in vitro conjunctival implant may be one integer of a pharmaceutical composition comprising a therapeutically effective amount of the organoid or implant together with one or more pharmaceutically acceptable carriers or excipients.

[0164] Those skilled in the art know how to determine the therapeutically effective amount and possible pharmaceutically acceptable carriers or excipients.

[0165] Corneal limbal organoids as pharmaceuticals As previously stated, another aspect of the present invention is an in vitro limbal organoid or in vitro limbal tissue and / or corneal tissue (including corneal epithelium and / or limbal epithelium) for use as a pharmaceutical. Implants of limbal tissue and / or corneal tissue (including corneal epithelium and / or limbal epithelium) are as defined above, and in vitro limbal organoids can be obtained by the method defined herein, and / or in vitro limbal organoids are as defined above. Certain embodiments of in vitro limbal organoids or in vitro implants of limbal tissue and / or corneal tissue (including corneal epithelium and / or limbal epithelium) for use as pharmaceuticals include use in the prevention and / or treatment of diseases or disorders of limbal tissue and / or corneal tissue (including corneal epithelium and / or limbal epithelium), particularly human limbal tissue and / or corneal tissue (including corneal epithelium and / or limbal epithelium), or use in regenerative medicine.

[0166] In certain embodiments, corneal organoids or implants obtained in vitro are intended for use in autologous cell therapy.

[0167] In other specific embodiments of in vitro limbal organoids or in vitro limbal / corneal epithelial implants for use as pharmaceuticals, they are intended for use in the prevention and / or treatment of one or more of the following conditions: limbal stem cell deficiency, impaired corneal epithelial wound healing, chronic surface inflammation of the eye, corneal neovascularization, corneal opacity, recurrent corneal epithelial erosion, corneal ulcer, corneal perforation, corneal epithelial neoplasm, and dry eye syndrome, as well as for use in transplantation therapy of cultured corneal epithelium and / or limbal epithelium, treatment of eye cancer, treatment of aniridia, and treatment of glaucoma.

[0168] Mammalian conjunctival epithelium or mammalian corneal epithelium, limbus, or organoids of the conjunctiva or limbus as in vitro models of the cornea, and their use: Another aspect of the present invention involves using the conjunctival organoids or gas-liquid interface cultures defined above as in vitro models of mammalian conjunctival epithelium, or in drug screening or toxicity assays.

[0169] Another aspect of the present invention is the use of the limbal organoids or gas-liquid interface cultures defined above as in vitro models of mammalian limbal tissue and / or corneal tissue (including corneal epithelium and / or limbal epithelium), or in drug screening, or in toxicity assays.

[0170] Another aspect is a method for screening candidate drugs for modulating the conjunctiva and / or for preventing and / or treating diseases or disorders of the conjunctiva, particularly the human conjunctiva. The method is (a) Providing a conjunctival organoid as defined above, or a conjunctival gas-liquid interface culture as defined above, (b) optionally, a step of providing conditions or a drug that simulates a disease or disorder, (c) A step of providing candidate drugs, (d) Optionally, before, after, or simultaneously with step (b), a step of bringing the candidate drug into contact with the organoid or gas-liquid interface culture under conditions that allow interaction between the candidate drug and the organoid or gas-liquid interface culture, (e) The step of determining whether contact with a candidate drug modulates the conjunctiva, conjunctival organoids, or conjunctival gas-liquid interface cultures, and / or prevents or reverses a simulated disorder or disease.

[0171] Another aspect is a method for screening candidate drugs for modulating limbal tissue and / or corneal tissue (including corneal epithelium and / or limbal epithelium), and / or for preventing and / or treating diseases or disorders of limbal tissue and / or corneal tissue (preferably corneal epithelium and / or limbal epithelium). The method is particularly applicable when the tissue is human. (a) Providing a limbal organoid as defined above, or a gas-liquid interface culture of limbal tissue and / or corneal tissue as defined above, (b) optionally, a step of providing conditions or a drug that simulates a disease or disorder, (c) A step of providing candidate drugs, (d) Optionally, before, after, or simultaneously with step (b), a step of contacting the candidate drug with the organoid or limbal tissue and / or corneal tissue gas-liquid interface culture under conditions that allow interaction between the candidate drug and the organoid or limbal tissue and / or corneal tissue gas-liquid interface culture, (e) The step of determining whether contact with a candidate drug modulates a limbal organoid or limbal tissue and / or a gas-liquid interface culture of corneal tissue, and / or prevents or reverses a simulated disorder or disease.

[0172] In certain embodiments of the screening method, the conditions or agents used to simulate a disease or disorder are microorganisms, particularly bacteria or viruses.

[0173] The inventors have confirmed that viral infection can be reproduced in models of conjunctival organoids or limbal organoids. This is considered an important contribution, as, for example, some cases of viral conjunctivitis have previously required studying cancer cell lines derived from other tissues (e.g., lungs) that cannot clearly reproduce the same structure as conjunctival tissue.

[0174] In another specific embodiment of the screening method, the conditions or agents that simulate a disease or disorder are, in particular, to simulate dry eye, to expose organoids or gas-liquid interface cultures to drying stress. Drying stress on cell cultures can be applied according to the prior art known to those skilled in the art.

[0175] In another specific embodiment of a screening method for candidate drugs that modulate the conjunctiva, drugs are tested to determine whether they can penetrate the conjunctival epithelium or modulate conjunctival permeability. This specific screening method is preferably performed with a gas-liquid interface culture as defined above and allows for the screening of candidates that can reach the ocular tissues of the posterior or anterior chamber of the eye, such candidates are either candidates or drugs that themselves treat conditions involving other ocular tissues, or compounds that help other compounds reach these other tissues by being administered through the conjunctiva. For example, a glaucoma drug that is to lower intraocular pressure must be applied to the surface of the eye and pass through the conjunctival epithelium. The screening method of the present invention, performed using organoids or gas-liquid interface cultures disclosed herein, not only allows for the selection of candidates that are useful for lowering intraocular pressure and can pass through the conjunctiva, but also allows for the selection of known glaucoma drugs that can pass through the conjunctiva to reach the corresponding ocular tissues. Similarly, a screening method is provided for testing whether a drug can penetrate or pass through the corneal epithelium and / or limbal epithelium, or modulate such tissues. This particular screening method can preferably screen for candidates that can reach the interior of the tissue or the region beneath the tissue by performing corneal epithelial gas-liquid interface culture as defined above.

[0176] Cell culture medium for obtaining conjunctival organoids: Another aspect of the present invention is a cell culture medium, preferably a cell expansion culture medium. The cell culture medium comprises a basal medium for mammalian cells supplemented with an inhibitor of the transforming growth factor β (TGF-β) signaling pathway, an inhibitor of bone morphogenetic protein (BMP), and an agonist of the Wnt pathway, and optionally one or more B27 supplements; N-acetylcysteine ​​(NAC); fibroblast growth factor (FGF), particularly FGF selected from FGF10, FGF1, FGF7, FGF2 and combinations thereof; epidermal growth factor (EGF); and antibacterial and / or antifungal compounds. In some preferred embodiments, the culture medium further comprises forskolin or FGF-10 or WNT surrogate, or forskolin and FGF-10, or preferably forskolin, FGF-10 and WNT surrogate.

[0177] In some more preferred embodiments, the culture medium further comprises IGF1 or FGF7, or in a preferred embodiment, IGF1 and FGF7 (for example, after forskolin or FGF-10 or WNT surrogate, or after forskolin and FGF-10, or preferably after forskolin, FGF-10 and WNT surrogate). In yet another embodiment, the culture medium further comprises IL-6, for example, in combination with IGF1 and FGF7, or in combination with forskolin, FGF-10 and WNT surrogate (or Wnt agonist). In a preferred embodiment, the culture medium does not contain or substantially contains EGF. In a preferred embodiment, the culture medium does not contain or substantially contains B27 supplement.

[0178] A cell culture medium according to the above-described embodiment, preferably a cell expansion culture medium, contains fibroblast growth factor (FGF), particularly FGF10, FGF1, and a combination thereof, and substantially does not contain EGF.

[0179] In another specific embodiment of the cell culture medium, preferably the cell expansion culture medium according to the embodiments and models described above, the medium further comprises one or more interleukins, particularly interleukin-4 (IL-4) and interleukin-13 (IL-13). In another embodiment, the culture medium comprises IL-6.

[0180] As previously shown, cell culture media containing interleukins, preferably cell expansion media, can be used to study the conjunctiva under conditions that mimic an inflammatory state.

[0181] Furthermore, the presence of one or more interleukins, preferably IL4 and IL13, in the cell culture medium, preferably cell expansion medium, also promotes the expansion of goblet cells and / or tuft cells.

[0182] Another aspect of the present invention is a cell culture medium, preferably a cell differentiation culture medium. The medium comprises a basal medium for mammalian cells supplemented with an inhibitor of the transforming growth factor β (TGF-β) signaling pathway, an inhibitor of bone morphogenetic protein (BMP), and an agonist of the Wnt pathway, and is substantially EGF-free, substantially free of any fibroblast growth factor, and substantially free of B27 supplement.

[0183] With respect to conjunctival stem cells, the present invention can be summarized in the following sections: 1. (a) A step of providing conjunctival stem cells, (b) A step of culturing conjunctival stem cells in a culture medium under conditions suitable for the formation of conjunctival organoids, An in vitro method for producing conjunctival organoids, comprising the following features. 2. The in vitro method according to paragraph 1, wherein the step of culturing conjunctival stem cells in a culture medium comprises the step of culturing in a cell expansion culture medium, and preferably the cell expansion culture medium comprises an inhibitor of the transforming growth factor β (TGF-β) signaling pathway, an inhibitor of bone morphogenetic protein (BMP), and / or an agonist of the Wnt pathway. 3. The in vitro method according to any one of the above items, wherein the culture in the culture medium is for a period sufficient for the formation of conjunctival organoids, and preferably the formed conjunctival organoids include keratinocytes expressing one or more of the transcription factor tumor protein p63 (TP63), keratin-19 (KRT19), mucin short variant S1 (MUC1), and aquaporin-5 (AQP5). 4. The in vitro method described in any one of the above items, wherein the culture in the culture medium is performed for at least 3 days. 5. The in vitro method according to any one of the above items, wherein the conjunctiva is the conjunctiva of a mammal, rodent, or human, preferably human conjunctiva. 6. The in vitro method according to any one of the above items, wherein the conjunctival stem cells are human conjunctival stem cells, preferably the culture medium / cell expansion culture medium is substantially free of epidermal growth factor (EGF), and optionally comprises cyclic AMP activator, particularly forskolin, and / or one or more fibroblast growth factors (FGF), particularly one or more fibroblast growth factors (FGF) selected from FGF1 and FGF10, and combinations thereof. 7. The in vitro method according to any one of the above items, wherein the conjunctival stem cells, preferably human conjunctival stem cells, express nerve growth factor receptor (NGFR) or are nerve growth factor receptor-positive conjunctival stem cells. 8. The in vitro method according to any one of the above items, wherein the step of culturing conjunctival stem cells in a culture medium comprises the step of culturing in a cell differentiation culture medium, and preferably the cell differentiation culture medium comprises transforming growth factor β (TGF-β), a signaling pathway inhibitor, a bone morphogenetic protein (BMP) inhibitor, and / or a Wnt pathway agonist, and more preferably the cell differentiation culture medium further substantially contains EGF, fibroblast growth factor, and / or B27 supplement. 9. The in vitro method according to any one of the above items, wherein the step of culturing conjunctival stem cells in a culture medium includes the step of culturing them in a cell expansion culture medium and then culturing them in a cell differentiation culture medium. 10. The in vitro method according to any one of the above items, preferably any one of items 8 to 9, wherein the culture in the culture medium, particularly in the cell differentiation culture medium, is for a period of time sufficient to enable the formation of conjunctival organoids, and preferably the formed conjunctival organoids include keratinocytes expressing one or more of KRT-19, TP63, MUC1, and AQP5, and further includes goblet cells. 11. The in vitro method according to any one of the above items, wherein the inhibitor of the transforming growth factor β (TGF-β) signaling pathway is a compound selected from the group consisting of A83-01 (CAS number: 909910-43-6), SB-431542 (CAS number: 301836-41-9), SB-505124 (CAS number: CAS694433-59-5), SB-525334 (CAS number: 356559-20-1), LY364947 (CAS number: 396129-53-6), SD-208 (CAS number: 627536-09-8), SJN2511 (CAS number: 2319939-07-4), and combinations thereof, and in particular A83-01 (CAS number: 909910-43-6). 12. An in vitro method according to any one of the above items, wherein the inhibitor of bone morphogenetic protein (BMP) is a compound selected from the group consisting of Noggin (human protein Uniprot Nr. P97466), Chordin, follistatin, gremlin, twisted gastrulation (tsg), short gastrulation (sog), dolsomorphine, LDN193189 (CAS number: 1062368-24-4), and combinations thereof. 13. An in vitro method according to any one of the above items, wherein the agonist of the Wnt pathway is selected from the group consisting of R-spondin 1, Wnt protein, Wnt surrogate, ROCK inhibitor, and combinations thereof. 14. An in vitro method according to any one of the above items, further comprising the step of dissociating cells contained in a conjunctival organoid, and then culturing one or more of the dissociated cells in a gas-liquid interface culture. 15. (a) Providing a container comprising a first chamber and a second chamber, wherein the first chamber and the second chamber are separated by a porous membrane, (b) The step of seeding the cells detached from the conjunctival organoid onto one side of the porous membrane, preferably on one side of the porous membrane in the first chamber, (c) The step of supplying culture medium to the first chamber and / or the second chamber so that the cells seeded on the porous membrane are immersed in the culture medium, (d) The step of expanding the seeded cells on a porous membrane for a period of time sufficient to obtain a substantially confluent cell layer, (e) Removing the culture medium from the chamber containing the layer of confluent cells, preferably the first chamber, and exposing the cells to air for a period of time sufficient to obtain a conjunctival cell culture containing multiple layers of cells, Equipped with, The cell layer proximal to the porous membrane contains basal keratinocytes expressing KRT-19 and TP63, and the cell layer distal to the porous membrane contains apical keratinocytes expressing MUC1 and goblet cells that particularly express MUC5AC. Preferably, the culture medium is a cell expansion culture medium or a cell differentiation culture medium, and more preferably a cell expansion culture medium, in the in vitro method according to item 14. 16. Isolated conjunctival organoids, particularly human conjunctival organoids, containing keratinocytes expressing KRT19 and one or more of TP63, MUC1, and AQP5. 17. Isolated conjunctival organoids as described in paragraph 16, more particularly human conjunctival organoids, further comprising goblet cells, preferably goblet cells expressing MUC5AC. 18. Isolated mammalian conjunctival organoids obtained by any of the methods described in Sections 1 to 15. 19. A gas-liquid interface culture of conjunctival cells, preferably conjunctival organoid cells, I. A container comprising a first chamber and a second chamber, wherein the first chamber and the second chamber are separated by a porous membrane, II. A multilayer of conjunctival cells arranged on at least one surface of a porous membrane, Equipped with, The multilayer comprises at least one cell layer located proximal to the porous membrane and containing basal keratinocytes expressing KRT-19 and TP63, and at least one cell layer located distal to the support and containing apical keratinocytes and goblet cells expressing KRT-19, MUC1 and AQP5. A gas-liquid interface culture is optionally a gas-liquid interface culture containing cell culture medium in at least one of the first and second chambers. 20. A conjunctival organoid as described in any one of paragraphs 16 to 18, or a conjunctival organoid obtained by the method described in any one of paragraphs 1 to 15, or comprising the said conjunctival organoid, or comprising cells dissociated from the said conjunctival organoid, or comprising the said cells. 21. An in vitro conjunctival organoid or in vitro conjunctival implant for use as a pharmaceutical, wherein the conjunctival implant is as described in paragraph 20, and the in vitro conjunctival organoid is obtained by the method described in any one of paragraphs 1 to 15, and / or the in vitro conjunctival organoid is as described in any one of paragraphs 16 to 18. 22. In vitro conjunctival organoids or in vitro conjunctival implants for use as pharmaceuticals as described in paragraph 21, the use of which is for the prevention and / or treatment of diseases or disorders of the conjunctiva, particularly human conjunctiva, or for use in regenerative medicine. 23. Use of any organoid described in Sections 16 to 18, or a gas-liquid interface culture described in Section 19, as an in vitro model of mammalian conjunctival epithelium, or in drug screening, or in toxicity assays. 24. A method for screening candidate drugs for modulating and / or preventing and / or treating diseases or disorders of the conjunctiva, particularly the human conjunctiva, (a) Providing an organoid as described in any of paragraphs 16 to 18, or a gas-liquid interface culture as described in paragraph 19, (b) optionally, a step of providing conditions or a drug that simulates a disease or disorder, (c) A step of providing candidate drugs, (d) Optionally, before, after, or simultaneously with step (b), a step of bringing the candidate drug into contact with the organoid or gas-liquid interface culture under conditions that allow interaction between the candidate drug and the organoid or gas-liquid interface culture, (e) A step of determining whether contact with the candidate drug modulates the conjunctiva and / or prevents or reverses a simulated disorder or disease, A screening method for candidate drugs that includes the following features. 25. The screening method described in paragraph 24, wherein the condition or agent used to simulate a disease or disorder is a microorganism, particularly bacteria or a virus. 26. A cell culture medium, preferably a cell expansion medium, comprising a basal medium for mammalian cells, supplemented with an inhibitor of the transforming growth factor β (TGF-β) signaling pathway, an inhibitor of bone morphogenetic protein (BMP), and an agonist of the Wnt pathway, and optionally one or more B27 supplements; N-acetylcysteine ​​(NAC); fibroblast growth factor (FGF) particularly selected from FGF10, FGF1 and combinations thereof; epidermal growth factor (EGF); and antibacterial and / or antifungal compounds. 27. A cell culture medium according to item 26, preferably a cell expansion culture medium, comprising fibroblast growth factor (FGF) particularly selected from FGF10, FGF1 and combinations thereof, and substantially free of EGF. 28. A cell culture medium, preferably a cell differentiation culture medium, comprising a basal medium for mammalian cells supplemented with an inhibitor of the transforming growth factor β (TGF-β) signaling pathway, an inhibitor of bone morphogenetic protein (BMP), and an agonist of the Wnt pathway, substantially free of EGF, substantially free of any fibroblast growth factor, and substantially free of B27 supplement.

[0184] The present invention can also be summarized in the following section with respect to limbal stem cells: 1. (a) A step of providing limbal stem cells, (b) A step of culturing limbal stem cells in a culture medium under conditions suitable for the formation of limbal organoids, An in vitro method for producing limbal organoids of the cornea, comprising the components described above. 2. The in vitro method according to paragraph 1, wherein the step of culturing limbal stem cells in a culture medium comprises the step of culturing in a cell expansion culture medium, and preferably the cell expansion culture medium comprises an inhibitor of the transforming growth factor β (TGF-β) signaling pathway, an inhibitor of bone morphogenetic protein (BMP), and / or an agonist of the Wnt pathway. 3. The in vitro method according to any one of the above items, wherein the culture in the culture medium is for a period of time sufficient to allow the formation of limbal organoids, and preferably the formed limbal organoids include cells expressing one or more, preferably all, of the transcription factor tumor protein p63 (TP63), keratin-24 (KRT24), and PAX6 (Paired box protein Pax-6, also known as anilidia type II protein (AN2) or oculorhombin), and preferably the formed limbal organoids also include cells expressing KRT12. 4. The in vitro method described in any one of the above items, wherein the culture in the culture medium is performed for at least 3 days. 5. The in vitro method according to any one of the above items, wherein the limbal cells are mammalian, rodent, or human cells, preferably human cells. 6. The in vitro method according to any one of the above items, wherein the limbal stem cells are human limbal stem cells, and preferably the culture medium / cell expansion culture medium is substantially free of epidermal growth factor (EGF), and optionally comprises cyclic AMP activator, particularly forskolin, and / or one or more fibroblast growth factors (FGF), particularly one or more fibroblast growth factors (FGF) selected from FGF1 and FGF10, and combinations thereof. 7. The in vitro method described in any one of the above items, wherein the limbal stem cells are human limbal stem cells. 8. The in vitro method according to any one of the above items, wherein the step of culturing limbal stem cells in a culture medium comprises the step of culturing in a cell differentiation culture medium, preferably the cell differentiation culture medium comprises an inhibitor of the transforming growth factor β (TGF-β) signaling pathway, an inhibitor of bone morphogenetic protein (BMP), and / or an agonist of the Wnt pathway, and more preferably the cell differentiation culture medium further substantially contains EGF, fibroblast growth factor, and / or B27 supplement. 9. The in vitro method according to any one of the above items, wherein the step of culturing limbal stem cells in a culture medium includes the step of culturing them in a cell expansion culture medium and then culturing them in a cell differentiation culture medium. 10. The in vitro method according to any one of the above items, preferably any one of items 8 to 9, wherein the culture in the culture medium, particularly in the cell differentiation culture medium, is for a period of time sufficient to enable the formation of limbal organoids, and preferably the formed limbal organoids include cells expressing one or more of the transcription factor tumor protein p63 (TP63), keratin-24 (KRT24), and PAX6 (Paired box protein Pax-6, also known as anilidia type II protein (AN2) or oculorhombin), preferably all of the transcription factors, and preferably the formed limbal organoids also include cells expressing KRT12. 11. The in vitro method according to any one of the above items, wherein the inhibitor of the transforming growth factor β (TGF-β) signaling pathway is a compound selected from the group consisting of A83-01 (CAS number: 909910-43-6), SB-431542 (CAS number: 301836-41-9), SB-505124 (CAS number: CAS694433-59-5), SB-525334 (CAS number: 356559-20-1), LY364947 (CAS number: 396129-53-6), SD-208 (CAS number: 627536-09-8), SJN2511 (CAS number: 2319939-07-4), and combinations thereof, and in particular A83-01 (CAS number: 909910-43-6). 12. An in vitro method according to any one of the above items, wherein the inhibitor of bone morphogenetic protein (BMP) is a compound selected from the group consisting of Noggin (human protein Uniprot Nr. P97466), Chordin, follistatin, gremlin, twisted gastrulation (tsg), short gastrulation (sog), dolsomorphine, LDN193189 (CAS number: 1062368-24-4), and combinations thereof. 13. An in vitro method according to any one of the above items, wherein the agonist of the Wnt pathway is selected from the group including R-spondin 1, Wnt protein, Wnt surrogate, ROCK inhibitor, and combinations thereof. 14. An in vitro method according to any one of the above items, further comprising dissociating cells constituting limbal organoids, and then culturing one or more of the dissociated cells at a gas-liquid interface. 15. (a) Providing a container comprising a first chamber and a second chamber, wherein the first chamber and the second chamber are separated by a porous membrane, (b) The step of seeding cells dissociated from the limbal organoids onto one side of a porous membrane, preferably on one side of the porous membrane in the first chamber, (c) The step of supplying culture medium to the first chamber and / or the second chamber so that the cells seeded on the porous membrane are immersed in the culture medium, (d) The step of expanding the seeded cells on a porous membrane for a period of time sufficient to obtain a substantially confluent cell layer, (e) Removing the culture medium from the chamber containing the layer of confluent cells, preferably the first chamber, and exposing the cells to air for a period sufficient to obtain a limbal cell culture containing multiple layers of cells, Equipped with, The multilayered cells express keratin 24 (KRT24) and at least one of PAX6 (Paired box protein Pax-6, also known as anilidia type II protein (AN2) or oculorhombin), and preferably, the limbal organoids also include cells expressing KRT12. Preferably, the culture medium is a cell expansion culture medium or a cell differentiation culture medium, and more preferably a cell expansion culture medium, in the in vitro method according to item 14. 16. Isolated limbal organoids, particularly human limbal organoids, comprising cells expressing at least one, preferably all, of the transcription factor tumor proteins p63 (TP63), keratin-24 (KRT24), and PAX6 (Paired box protein Pax-6, also known as anilidia type II protein (AN2) or oculorhombin), and preferably also comprising cells expressing KRT12. 17. A limbal organoid as described in paragraph 16, wherein the limbal organoid is a human limbal organoid. 18. Isolated mammalian limbal organoids obtained by any of the methods described in paragraphs 1 to 15. 19. A gas-liquid interface culture of limbal tissue and / or corneal tissue, preferably corneal epithelium and / or limbal epithelium, preferably limbal organoid cells, I. A container comprising a first chamber and a second chamber, wherein the first chamber and the second chamber are separated by a porous membrane, II. A porous membrane comprising a multilayer of limbal tissue and / or corneal tissue cells arranged on at least one surface of the porous membrane, The multilayer comprises cells expressing at least one, preferably all, of the transcription factor tumor protein p63 (TP63), keratin-24 (KRT24), and PAX6 (Paired box protein Pax-6, also known as anilidia type II protein (AN2) or oculorhombin), preferably the limbal organoid also comprises cells expressing KRT12, and the gas-liquid interface culture optionally comprises cell culture medium in at least one of the first and second chambers. 20. A limbal organoid as described in any one of paragraphs 16 to 18, or a limbal organoid obtained by the method described in any one of paragraphs 1 to 15, or comprising the said limbal organoid, or comprising cells dissociated from the said limbal organoid, or comprising the said cells, limbal tissue and / or corneal tissue, preferably corneal epithelium and / or limbal epithelium implant. 21. An in vitro limbal organoid, or an in vitro limbal tissue and / or corneal tissue, preferably corneal epithelium and / or limbal epithelium implant, for use as a pharmaceutical, wherein the limbal tissue and / or corneal tissue, preferably corneal epithelium and / or limbal epithelium implant is as described in item 20, and the in vitro limbal organoid is obtained by the method described in any one of items 1 to 15, and / or the in vitro limbal organoid is as described in any one of items 16 to 18, wherein the in vitro limbal organoid, or an in vitro limbal tissue and / or corneal tissue, preferably corneal epithelium and / or limbal epithelium implant, is as described in item 16 to 18. 22. In vitro limbal organoids, or in vitro implants of limbal tissue and / or corneal tissue, preferably corneal epithelium and / or limbal epithelium, for use as a pharmaceutical product as described in paragraph 21, wherein the use is for the prevention and / or treatment of diseases or disorders of human limbal tissue and / or corneal tissue, preferably human corneal epithelium and / or limbal epithelium, or for use in regenerative medicine. 23. Use of limbal organoids as described in any of paragraphs 16 to 18, or gas-liquid interface cultures of limbal tissue and / or corneal tissue as described in paragraph 19, as an in vitro model of mammalian limbal tissue and / or corneal tissue (including corneal epithelium and / or limbal epithelium), or in drug discovery screening, or in toxicity assays. 24. A screening method for candidate drugs that modulate the limbal tissue and / or corneal tissue (including the corneal epithelium and / or limbal epithelium) and / or prevent and / or treat disease or impairment of the limbal tissue and / or corneal tissue (including the corneal epithelium and / or limbal epithelium), (a) Providing a limbal organoid according to any of paragraphs 16 to 18, or a gas-liquid interface culture of limbal tissue and / or corneal tissue according to paragraph 19, (b) optionally, a step of providing conditions or a drug that simulates a disease or disorder, (c) A step of providing candidate drugs, (d) Optionally, before, after, or simultaneously with step (b), a step of bringing the candidate drug into contact with the organoid or gas-liquid interface culture under conditions that allow interaction between the candidate drug and the organoid or gas-liquid interface culture, (e) A step of determining whether contact with the candidate drug modulates limbal organoids and / or limbal tissue and / or corneal tissue, and / or prevents or reverses a simulated disorder or disease, A screening method for candidate drugs that includes the following features. 25. The screening method described in paragraph 24, wherein the conditions or agents used to simulate a disease or disorder are microorganisms, particularly bacteria or viruses.

[0185] The foregoing description of specific embodiments is intended to fully illustrate the general nature of the invention, and others can readily modify and / or adapt such specific embodiments for various uses without departing from the general concept of the invention or without excessive experimentation, by applying the knowledge of those skilled in the art (including the contents of the documents cited herein). Therefore, such adaptations and modifications are intended to be within the meaning and scope of equivalents of the disclosed embodiments, based on the teachings and guidance presented herein.

[0186] All references cited herein (including journal articles or abstracts, published or corresponding patent applications, patents, or any other references) are fully incorporated herein by reference, including all data, tables, figures, and text presented in the cited references. Furthermore, the entire content of any references cited within any reference cited herein is also fully incorporated by reference.

[0187] It should be understood that the terms and usage in this specification are for illustrative purposes only and not intended to be restrictive, so that a person skilled in the art should interpret them in conjunction with the teachings and guidance presented herein.

[0188] All details, embodiments, and options described in relation to one embodiment of the present invention are equally applicable to other embodiments or models of the present invention, and it is understood that it is not necessary to individually detail all such details, embodiments, and options for all embodiments.

[0189] While the present invention has been described in general terms, the same will be more readily apparent by referring to the following examples. The examples are provided for illustrative purposes only and are not intended to limit the present invention. Further aspects and embodiments will be apparent to those skilled in the art. [Examples]

[0190] All materials and methods applicable to the following embodiments are disclosed at the end of this section for the sake of simplification.

[0191] Example 1. Preparation of mouse conjunctival organoids Wild-type mouse conjunctiva was dissected from the eyelids and sclera, incubated in 0.25% trypsin / EDTA for 5 minutes, disrupted by pipetting, and plated in basement membrane extract (BME). The culture medium was supplemented with B27, N-acetylcysteine, epidermal growth factor (EGF), fibroblast growth factor-1 (FGF1), Noggin, R-spondin 1, tumor growth factor-β (TGFβ) inhibitor, and Rho-kinase inhibitor (Figure 1A). After 3-4 days, high-density organoids appeared (Figure 1B). The organoids were divided using trypsin / EDTA every 7 days on average and could be maintained for at least 34 passages (Figure 1B). The organoids expressed the conjunctival marker Krt19 but not the corneal marker Krt12 (Figure 1C). In addition, they retained expression of the master transcription factor PAX6 for oculogenesis (Figure 1C). Cells expressing the tumor protein p63 (TP63+ cells) were found to be located basally in both mouse tissue and organoids, while keratinocytes expressing mucin 1 (MUC1+ keratinocytes) were located more apically (Figure 1C). These enlarged mouse conjunctival organoids did not contain goblet cells expressing mucin 5AC (MUC5AC+ goblet cells) (Figure 1C), but they are equally useful for conjunctival studies.

[0192] Pax6 is essential for conjunctival differentiation: Pax6 is a master regulator of eye development and maintains its expression even in adulthood. In certain conjunctival lesions such as pterygium and pinguecula, decreased expression of Pax6 has been reported. To evaluate the effect of loss of function of Pax6 in conjunctival organoids, Pax6 was mutated using CRISPR / Cas9 (Pax6 KO , Figures 1D - 1E). Pax6 KO organoids showed no obvious morphological differences compared to wild - type (WT) organoids (Figure 1F). Using bulk RNA sequencing, 709 genes were found to be downregulated and 454 genes were upregulated in Pax6 WT organoids compared to Pax6 KO (fc > 2 and p - adj < 0.01, Figure 1G). Pax6 mRNA was downregulated in Pax6 KO organoids and the genotype was confirmed (Figures 1G - 1H). Foxc2, another transcription factor important for eye development, was also downregulated, suggesting that it acts downstream of Pax6 (Figure 1G). Among the genes downregulated in Pax6 KO organoids, several genes encoding secreted gene products were found, such as the antimicrobial peptides Ltf, Ctsz, Slpi, Pigr, Lcn2, Htra4, Serpina3n and Serpina9, the surfactant protein Sftpd, Fcgbp involved in maintaining gel structure, complement factors C3 and Cfh. It was also found that Toll - like receptors 2 and 4 (Tlr2 and Tlr4) were downregulated (Figure 1G). These results indicate that Pax6 KO caused a decrease in defense response genes. Conversely, genes whose expression was upregulated in Pax6 KO organoids included the Wnt target Axin2 and stem - cell - related genes such as the basal cell markers Trp63, Trp73, Krt5 and Krt14 (Figure 1G). Immunohistochemically, Pax6 KOIncreased TP63 expression and decreased PAS mucus / goblet cell staining were observed in organoids (Figure 1H). In conclusion, Pax6 deficiency resulted in an undifferentiated basal-like phenotype, similar to that seen in pterygium.

[0193] Example 2. Preparation of human conjunctival organoids Next, we began establishing human-derived conjunctival organoids. To this end, we obtained conjunctival biopsies from deceased donors and patients who had undergone ophthalmic surgery. Biopsies were taken from the palpebral conjunctiva (eyelids) and bulbar conjunctiva (eyeball) and digested with 0.25% trypsin / EDTA for 5 minutes. Subsequently, single cells were plated onto BME in mouse conjunctival medium supplemented with WNT surrogate, FGF10, and the cyclic AMP activator forskolin (FSK). Furthermore, EGF was removed from the medium as it was thought to shorten the lifespan of the organoids (Figure 2A). As a result, high-density organoids were obtained from both bulbar and palpebral conjunctiva, and they could be enzymatically divided every 9–14 days and used for up to 17 passages (Figure 2B). All human conjunctival organoids expressed the conjunctival marker KRT19 (Figure 2C). Furthermore, like the original tissue, it contained a basal layer of TP63+ cells (Figure 2C). Notably, the outer surface of all adult tissue-derived organoids was in contact with the BME and consistently represented the basal side of the corresponding epithelium. Under these magnification conditions, the organoids did not contain MUC5AC+ goblet cells, but they did contain differentiated PAS+, MUC1+, and AQP5+ keratinocytes, which were morphologically very similar to the keratinocytes in the tissue (Figure 2C). Notably, the expression of AQP5 suggested that the keratinocytes could secrete water and therefore may be involved in lubrication of the ocular surface in coordination with the lacrimal gland.

[0194] Human conjunctival organoids did not contain goblet cells under magnification conditions, so the culture conditions were changed. To do this, WNT surrogates, FGF1, FGF10, and B27 were removed from the culture medium to create a "differentiation medium" (Figure 2D). After 9 days of exposure to the differentiation medium, the organoids became cystic, and the expression of the goblet cell transcription factor SPDEF and the secretory mucin gene MUC5AC increased (data not shown). After 7 days of exposure to the differentiation medium, histological examination confirmed a decrease in the number of TP63+ basal cells and proliferating cells, and an increase in the number of MUC5AC+ cells (Figure 2E). KRT19 remained expressed in all cells in the differentiation medium, and MUC1 remained apical (Figure 2E). Notably, MUC5AC staining was also detected in the lumen of some organoids, suggesting that this mucin was secreted (Figure 2E). Therefore, when human conjunctival organoids were differentiated, the expression of markers in the differentiated cells, particularly goblet cells, increased, while the number of basal cells decreased.

[0195] Example 3. Gas-liquid interface culture of human conjunctival organoids Epithelial air-liquid interface (ALI) culture, which is normally exposed to air, can promote near-native differentiation of cultured cells, as demonstrated in the upper respiratory tract. Therefore, 100,000 conjunctival organoid cells were seeded in human expansion medium in collagen-coated Transwell plates (24 wells). When the cells reached confluence (usually within 3-4 days), the liquid in the upper chamber of the Transwell was removed to create an ALI (Figure 3A). The ALI culture was followed for up to 22 days, during which time it remained confluent (Figure 3B). On day 4 after transitioning to ALI, the culture was 2-3 cell layers thick, with TP63+ cells at the base and MUC1+ keratinocytes at the apex, but no MUC5AC+ goblet cells were observed (Figure 3C). On day 17 after transitioning to ALI, the culture was 5-10 cell layers thick (Figure 3C). TP63+ cells constituted the bottom 2-3 layers and were small, densely packed cells (Figure 3C). Initial ALI-cultured cells contained many KI67+ cells, but the number of proliferating cells decreased over time, reaching a number similar to that observed in primary tissue 17 days after ALI (data not shown). No substantial apoptosis was detected (data not shown). MUC1 was expressed in all cells and gradually increased toward the apical surface (Figure 3C).

[0196] Notably, 17-day-old ALI cultured cells contained MUC5AC+ cells (Figure 3C). These MUC5AC+ cells resembled tissue goblet cells, were located on or within the epithelium, and were hypertrophied PAS+ vacuoles containing MUC5AC+ vesicles. Furthermore, the ultrastructure of these cells, as shown by transmission electron microscopy, was identical to that of tissue goblet cells (Figure 3D). In addition, differentiated ALI cultures showed higher expression levels of the goblet cell transcription factor SPDEF and MUC5AC compared to their counterpart 3D organoids, while the expression levels of the keratinocyte marker MUC16 and the antimicrobial product WFDC2 were similar (data not shown). ALI cultures derived from conjunctival organoids reproduced the structure, cell type composition, and functionality of human conjunctival tissue.

[0197] Example 4. Single-cell characterization of human conjunctival tissue and cultures To directly compare the newly established culture system with conjunctival tissue, single-cell mRNA sequencing was applied to (1) tissue biopsies (n=2), (2) organoids cultured in expansion or differentiation medium, and (3) ALI cultures 0, 3, and 17 days after transfer to ALI (Figure 4A). As expected, non-epithelial cells appeared only in tissue biopsies (cluster 8). These included hematopoietic cells expressing PTPRC, CD3E, and CD4, melanocytes expressing MLANA, MITF, and TYRBP1, and endothelial cells expressing PECAM1, VWF, and TIE1 (data not shown). Next, five clusters of basal cells (clusters 0, 3, 4, 5, and 7) were identified based on the expression of TP63, KRT5, and KRT14, one of which clusters consisted mainly of MKI67+ proliferative basal cells derived from early ALI cultures and tissue biopsies (cluster 7) (not shown). Finally, based on the expression of MUC1 and MUC20, we identified three clusters of differentiated keratinocytes (data not shown). This dataset contained very few goblet cells for two reasons: the fragile and large goblet cells appear to be highly susceptible to damage during cell sorting, and they were relatively rare in both ocular biopsies and sequenced cultures. Six goblet cells with high expression of MUC5AC, TFF1, TFF3, and SPDEF were identified from tissue (n=3) and organoids (n=3) (data not shown).

[0198] Example 5. Characteristics of tissue conjunctival stem cells and keratinocytes, and similarities between tissue and organoid-based culture systems. Functionality of conjunctival epithelium in vitro. Because the conjunctival epithelium is not extensively characterized at the single-cell level, we first focused on primary tissue cells. Using differential gene expression analysis (>2x change, p-adjusted<0.01), we identified genes abundant in basal tissue cells (derived from clusters 0 and 7) and keratinocytes differentiated from tissue (derived from cluster 1). Of the 23 genes abundant in basal cells, several stem cell markers (TP63, KRT5, KRT14), the proliferation marker MYC, COL17A1 (previously identified in gastric and skin stem cells), and the basement membrane proteins LAMB1 and DST were identified. In addition, basal cells were the major cells expressing plasminogen activator PLAT, which is essential for the coagulation cascade, and growth factors IGFBP6 and IGFBP7. Differentiated keratinocytes derived from tissue expressed genes involved in secretion, defense responses, and activation of immune cells. Of these genes, keratinocytes expressed complement factors C3, CFB, and CFD, antimicrobial proteins SERPINA1, CST3, WFDC2, SERPINB1, S100A8, S100A9, SLPI, and LCN2, glycosylation proteins CEACAM5, CEACAM6, and CEACAM7, and membrane-bound mucins MUC1, MUC4, MUC7, MUC15, MUC16, and MUC20. Furthermore, conjunctival keratinocytes appeared to be involved in retinol metabolism in the eye through the expression of ALDH1A3 and ADH1C, which are essential for maintaining the conjunctiva and corneal epithelium in a non-keratinized state. We also found that conjunctival keratinocytes express the chemokines CXCL17 and IL18 as components of the mucosal barrier. CXCL17 is a chemokine known to be produced in other mucosal tissues such as the intestines and lungs, and is important in the recruitment of antigen-presenting cells such as monocyte-macrophages and dendritic cells. Furthermore, CXCL17 expression is increased in the tears of patients with Sjögren's syndrome, a condition characterized by autoimmune dry eye. Other mucosal chemokines involved in the recruitment of commensal immune cells, such as CCL25, CCL28, and CXCL14, were not expressed in conjunctival keratinocytes. While maps of immune populations present in the mouse conjunctiva have recently been created, little is known about the role of the conjunctival epithelium in vascular recruitment during infections and allergies, for example.The inventors found that conjunctival epithelial cells (both stem cells and keratinocytes) express VEGFA and VEGFB, and low levels of VEGFC, under homeostatic conditions. Angiopoietins ANGPT1 and ANGPT2, as well as VEGF signaling inhibitors THBS1 and THBS2, were not expressed in conjunctival epithelial tissue cells, as previously reported. Taken together, these data indicate that conjunctival keratinocytes play a crucial role in protecting the ocular surface by producing antimicrobial peptides and interacting with the immune system through cytokine release.

[0199] Similarities between tissue culture systems and organoid culture systems This single-cell RNA sequencing dataset was used to analyze the comparison between cultured conjunctival cells and primary tissue cells. Thus, the expression of key markers between culture conditions was compared with that of tissue biopsies. As expected, the conjunctival lineage markers KRT19 and PAX6 were expressed under all conditions (data not shown). Furthermore, the expression of stem cell markers KRT5, KRT14, TP63, and NGFR was widely shared between organoid-derived cells and tissue biopsies (data not shown). Stem cell markers were most highly expressed in early ALI cultures and decreased during differentiation, while differentiation markers (such as MUC1 and LCN2) were upregulated (data not shown). Among the markers whose expression increased during in vitro differentiation (organoids on day 17 of DM and ALI), we identified genes encoding membrane-bound mucins (MUC1, MUC4, MUC15, MUC16, MUC20), antimicrobial peptides (LCN2, WFDC2, PIGR, SLPI), retinol-metabolizing enzymes (ADH7, RDH10, ALDH1A1, ALDH1A3, ALDH3A1), complement factors (C3, CFB), and coagulation factor F3 (data not shown). Furthermore, organoid-based cells retained VEGFA and VEGFB expression similar to that of tissue (data not shown). The expression levels of all the above genes were very similar between the differentiated organoid-based culture system and tissue biopsy, suggesting that major tissue characteristics were reproduced in vitro.

[0200] Functionality of the conjunctival epithelium: Based on single-cell RNA sequencing data, one function of conjunctival epithelium is likely to be the production of antimicrobial peptides. Antibody staining showed that the expression patterns of LCN2 and WFDC2 in 17-day-old ALI cultures were identical to those in tissue samples (Figures 4B-C). Furthermore, transmission electron microscopy revealed the presence of medium-sized secretory vesicles in some, but not all, conjunctival keratinocytes in 17-day-old organoid-derived ALI cultures (Figure 4D). LCN2 secretion into the supernatant increased as the ALI cultures grew and differentiated (Figure 4E). Therefore, this data demonstrates that organoid-derived conjunctival epithelium can secrete antimicrobial peptides in vitro.

[0201] Example 6. Conjunctival organoid from a single cell Next, we aimed to validate some of the findings obtained from single-cell RNA sequencing experiments. Since NGFR was confirmed to be specifically expressed in basal cells, we evaluated whether it is a stem cell marker for conjunctival epithelium, as has been shown in other epithelial cells. We examined the organoid-forming ability of selected NGFR+ and NGFR- cells. Only NGFR+ cells were able to form organoids. One question in this area is whether conjunctival stem cells can generate both goblet cells and keratinocytes. We identified both MUC1+ keratinocytes and MUC5AC+ goblet cells in organoids derived from a single NGFR+ cell. In summary, this experiment provides conclusive evidence that NGFR+ cells are pluripotent stem cells of the conjunctiva (Figure 5A, B, C).

[0202] Example 7. Practical Application. Conjunctival ALI culture as a conjunctival virus infection model. Induction of gene expression. Due to the lack of long-term in vitro models, studying conjunctival disorders in the laboratory has been difficult. Therefore, we modeled viral conjunctivitis using a newly established conjunctival organoid technology. Several viruses infect the conjunctiva and cornea, causing vision-threatening symptoms known as viral keratoconjunctivitis. Here, we focused on three viruses that can cause conjunctivitis: herpes simplex virus 1 (HSV1), SARS-CoV-2, and human adenovirus 8 (hAdV8). HSV1 accounts for 5% of all conjunctivitis cases. Adenoviruses account for 90% of all conjunctivitis cases, with hAdV8 being the most common strain globally. Conjunctivitis is observed in 1% of SARS-CoV-2 infected individuals. First, we checked whether the human organoid model expressed identified or potentially identified viral entry receptors. HSV1 entry receptors (NECTIN1, NECTIN2, HSPG2), SARS-CoV-2 entry factors (ACE2, TMPRSS2), and hAdV8 entry receptors (ITGAV, ITGA3, ITGB1) were expressed in all conjunctival culture models, particularly in 17-day-old ALI cultures, and their expression was most similar to that of tissue (data not shown).

[0203] To model HSV1 infection, the apical surface of fully differentiated 17-day-old ALI cultures was exposed for 3 hours to an HSV1 strain tagged with tdTomato on the capsid protein VP26 (hereinafter referred to as HSV1-tdTomato, Figure 6A). HSV1 titers increased by 5 log over 96 hours after the initial incubation with HSV1, suggesting that the conjunctival ALI cultures were productively infected with HSV1 (Figure 6B). Furthermore, imaging using an Auto-EVOS microscope (Thermo Fisher Scientific) revealed an increase in tdTomato signaling over time in HSV1-infected ALI cultures (data not shown). Interestingly, tdTomato+ lesions were observed within the cells, suggesting that the virus was likely accumulating at the nuclear membrane (data not shown). The tdTomato+ cells also exhibited cytopathic effects (CPE), including cell rounding and exclusion from the epithelial layer, resulting in large gaps in the ALI cultures (data not shown). Acyclovir, an inhibitor of HSV1 DNA polymerase, is commonly administered to patients with HSV1-induced conjunctivitis. Indeed, treatment of ALI cultures with 10 μM acyclovir inhibited infection (Figure 6A-B). Thus, organoid-derived ALI cultures support HSV1 infection and serve as a human ocular surface model for HSV1 infection.

[0204] SARS-CoV-2 is a respiratory virus that can cause conjunctivitis. Recent studies have applied conjunctival excisions to research SARS-CoV-2 infection. However, since productive infection did not occur, it was concluded that conjunctival epithelial cells are resistant to productive SARS-CoV-2 infection. To investigate whether SARS-CoV-2 directly infects the conjunctiva, SARS-CoV-2 variants 614G and δ were incubated with differentiated ALI cultures for 3 hours (Figure 6C). Based on the concentration of RNA copies in the apical lavage, both SARS-CoV-2 variants replicated in conjunctival ALI cultures (Figure 6D). Furthermore, the produced virus recovered in the ALI supernatant exhibited secondary infectivity when added to Calu-3 cells (data not shown). In addition, SARS-CoV-2 nucleocapsid-positive cells were identified 72 hours after infection (data not shown). Thus, SARS-CoV-2 infection of the conjunctival epithelium can be studied using human organoids.

[0205] Adenoviruses are a major cause of viral conjunctivitis. However, there is currently no therapeutic drug, partly because there is no model system for this type of eye infection. The hAdV8 strain isolated from patients was provided by Dr. Nobuyo Yawata (Kyushu University, Japan) and Dr. Makoto Yawata (NUS, Singapore) (see Yawata, N., and Yawata, M. 2022. Assessing the Response of Human NK Cell Subsets to Infection by Clinically Isolated Virus Strains. Methods Mol Biol 2463, 205-220. https: / / doi.org / 10.1007 / 978-1-0716-2160-8_15). hAdV8 was added to 17-day-old conjunctival ALI culture medium (Figure 6E). The conjunctival ALI culture medium readily infected with hAdV8, and this was confirmed by viral titer measured by qPCR (not shown). CPE was observed from 48 hours after infection, meaning that infected cells darkened and were pushed out of the epithelium. Next, the inhibitory effects of several antiviral drugs (acyclovir, cidofovir, nelfinavir) experimentally applied to adenoviral conjunctivitis were tested. As a result, only cidofovir was able to reverse adenovirus infection, as indicated by a decrease in viral titer and disappearance of CPE up to 96 hours later (Figure 6F-G).

[0206] The cellular convection of hAdV8 in the conjunctiva is currently unknown. To evaluate this, we investigated which cell types in conjunctival ALI cultures are infected with hAdV8. As a result, we found that both MUC5AC+ goblet cells and MUC5AC- keratinocytes contain the hAdV8 capsid protein (data not shown), indicating that hAdV8 infects both conjunctival goblet cells and keratinocytes. Taken together, these data demonstrate that conjunctival organoid-based ALI cultures can replicate viral infection.

[0207] Example 8. Practical Application. Conjunctival Organoids for Autologous Cell Therapy Currently, there is no human conjunctival replacement using autologous cell therapy. Currently, to repair conjunctival damage, a healthy conjunctival graft is harvested from another part of the patient's eyeball and used to cover the wound. The sclera beneath the donor site is left exposed, resulting in conjunctival scarring. As a result, no reserve tissue for repeated treatments is obtained. Conjunctival organoid technology is 1 mm 3 Because it requires tissue less than a certain size as a starting material, it offers a unique possibility for restoring damaged conjunctiva.

[0208] To investigate the engraftment ability of human conjunctival organoids, these organoids were transplanted into the conjunctiva and fornix of mechanically injured immunodeficient NSG mice early in the passaged stage (Figure 7A). Two days after transplantation, human cells were found to have engrafted within the mouse eyeballs, as seen in human KRT19 staining (Figure 7B). Although only a small number of cells had engrafted and properly integrated into the epithelium, human cells located at the basal and apical ends could already be identified (Figure 7B). The cells located at the basal end retained expression of the stem cell marker TP63, and some were KI67 positive (Figure 7B). On the other hand, the cells located at the apical end expressed the keratinocyte marker MUC1 (Figure 7B). Three weeks later, analysis of the organoid engraftment status revealed human cells in 2 out of 8 mice (Figures 7C-D). Importantly, in both engrafted mice, the cells adhered to the basement membrane and generated three major cell conjunctival cell types: TP63+ basal cells, MUC1+ keratinocytes, and MUC5AC+ goblet cells (Figure 7C). While this surgical procedure is difficult to perform in the mouse eyeball and requires improvement, this pilot experiment demonstrates that organoids receive the appropriate signals in vivo to trigger a proper differentiation cascade.

[0209] More precisely, organoids were further fabricated as transplantable cell sheets to improve surgical procedures. Example 9 below illustrates this procedure.

[0210] Example 9. Practical Application. Cell sheet of conjunctival organoid for autologous cell therapy on a fibrin matrix. The conjunctiva is a flattened polar epithelium, meaning that stem cells are located adjacent to the basement membrane and differentiate on the opposite side. Previously, we demonstrated that organoid-derived stem cells can proliferate on a coated two-dimensional surface and differentiate into nearly original tissue structures. Therefore, to create a cell sheet that is easy to transplant into humans, human organoid cells were seeded onto a fibrin matrix (Figure 8A). Within 7 days, a fully confluent cell sheet was created on a fibrin adhesive covering a 4 cm² surface (Figure 8B). Importantly, the cells that proliferated on the fibrin matrix could be easily lifted from the culture dish using forceps. After 7 days, stratification began, and both basal TP63+ cells and MUC1+ keratinocytes were identified (Figure 8B). No goblet cells were found in this setup, likely because the expanding medium was continuously supplied to the apex, leaving no time window for final differentiation. However, after 7 days, not all cells located at the basal level expressed TP63 (Figure 8B). In limbal stem cell transplantation, the number of TP63+ cells in the final product is key to determining the transplantation outcome. Therefore, we examined the amounts of basal and proliferating cells in a previous culture seeded on fibrin. Immunofluorescence analysis revealed that when the cells had just reached confluence, the conjunctival cell sheet consisted almost entirely of TP63+ cells, with some KI67+ cells (data not shown). Thus, we were able to create a cell sheet of average size necessary to cover typical conjunctival damage, making it easy to transplant into patients.

[0211] Example 10. Organoid growth on collagen I as an extracellular matrix. As in Example 2, human organoids were obtained from single cells derived from biopsy. These cells were expanded in the culture expansion medium described in Example 2. The cells were plated in collagen I (1.5 mg / ml). The comparative example was performed using BME. Collagen was able to maintain organoid growth (Figure 9).

[0212] Materials and methods relating to the examples Mouse organoidsThe conjunctiva of surplus WT C57 / Bl6 female mice was dissected and cut using a scalpel. Microdissection to remove the fibroblast layer was not performed. The tissue suspension was incubated with 0.5% trypsin-EDTA (Gibco), diluted 1:1 with Advanced DMEM / F12 (Gibco, final concentration 0.25%), in a 37°C water bath for 10-15 minutes. The tissue suspension was vigorously pipetted up and down every 5 minutes using a P1000 pipette. 10 mL of Advanced DMEM / F12 (Gibco) was added, and digestion was stopped when small epithelial fragments and single cells were obtained. The cells were then pelleted at 500 g for 5 minutes, washed a second time with 10 mL of Advanced DMEM / F12 (Gibco), and pelleted again. This pellet was resuspended in approximately 100 μL of Cultrex Pathclear Reduced Growth Factor Basement Membrane Extract (BME, 3533-001, Amsbio) per eye. After coagulating the BME at 37°C for 25-30 minutes, expansion medium was added.The mouse culture medium consisted of Advanced DMEM / F12 (Gibco), 10 mmol / L HEPES (11560496, Gibco), GlutaMAX (11574466, Gibco), 100 U / mL Penicillin-Streptomycin (11548876, Gibco) (hereinafter referred to as AdDMEM+++), B27 Supplement (1X, 11530536, Gibco), 1.25 mM N-acetylcysteine ​​(A9165, Sigma-Aldrich), 0.25% Noggin-modified medium (U-Protein Express), and 5% R-spongin 1-modified medium (Pleguezuelos-Manzano, C., Puschhof, J., van den Brink, S., Geurts, V., Beumer, J., and Clevers, H. (2020). Establishment and Culture of Human intestinal organoids (prepared as described in *Human Intestinal Organoids Derived from Adult Stem Cells. Curr Protoc Immunol 130, e106. 10.1002 / cpim.106.*) consisted of 50 ng / ml EGF (AF-100-15, Peprotech), 100 ng / ml FGF1 (Peprotech), 3 μM A83-01 (2939, Tocris), 10 μM ROCK inhibitor Y-27632 (M1817, Abmole), and 100 mg / ml Primocin (ant-pm-1, Invivogen). The organoids were maintained in a humidified 37°C incubator containing 5% CO2. Every 7-10 days, organoids were dissociated into single cells using 0.5% trypsin-EDTA (Gibco) diluted 1:1 with AdDMEM+++, similar to organoid establishment, and plated in a 1:6-1:8 ratio. If necessary, the mouse expansion medium was replaced with mouse differentiation medium 10 days after cleavage.The mouse differentiation medium consisted of AdDMEM+++, 1.25 mM N-acetylcysteine ​​(A9165, Sigma-Aldrich), 0.25% Noggin-modified medium (U-Protein Express), 5% R-spongin 1-modified medium (prepared as described in Pleguezuelos-Manzano, C., Puschhof, J., van den Brink, S., Geurts, V., Beumer, J., and Clevers, H. (2020). Establishment and Culture of Human Intestinal Organoids Derived from Adult Stem Cells. Curr Protoc Immunol 130, e106. 10.1002 / cpim.106.), 3 μM A83-01 (2939, Tocris), 10 μM ROCK inhibitor Y-27632 (M1817, Abbmole), and 100 mg / mL. The mouse conjunctival organoids were composed of primocin (ant-pm-1, in vivogen). They were maintained in differentiation medium for up to 9 days.

[0213] Human organoids Human conjunctival samples were from patients who underwent eyelid surgery at University Medical Center Utrecht (UMCU) in the Netherlands, patients who underwent pterygium excision at Maastricht University Medical Center (MUMC+) in the Netherlands, or from donors at the ETB-BISLIFE corneal bank (Beverwijk, Netherlands). This study was approved by the UMCU Medical Ethics Committee (TCBio) as protocol 18-740, by the MUMC+ Medical Ethics Committee as protocol METC2021-2732, and by the ETB-BISLIFE donor bank, and was conducted in accordance with the Declaration of Helsinki and Dutch law. Approximately 1 mm 3The conjunctival samples were kept refrigerated in AdDMEM+++ supplemented with 100 mg / mL Primocin (ant-pm-1, Invivogen) until further processing (less than 4 hours). In the laboratory, human conjunctival samples were digested in exactly the same way as mouse samples. If necessary, portions of the samples were fixed for histological analysis (described later). The cell pellet was resuspended in BME, and human expansion medium was added when the BME solidified. The human expansion medium consisted of mouse expansion medium supplemented with 0.15 nM Wnt Surrogate (U-Protein Express), 100 ng / mL FGF10 (100-26, Peprotech), and 1 μM Forskolin (1099, Tocris). EGF was removed from the medium because it shortened the lifespan (passage number) of the organoids. For organoids cultured in EGF-containing medium, only single-cell mRNA sequencing of organoids during expansion and differentiation was performed. Human conjunctival organoids were divided every 10 days, similar to mouse organoids, and plated in a 1:4 ratio. If necessary, the expansion medium was replaced with differentiation medium on day 10 after division. The human differentiation medium consisted of AdDMEM+++, 1.25 mM N-acetylcysteine ​​(A9165, Sigma-Aldrich), 0.25% Noggin-modified medium (U-Protein Express), 5% R-spongin-1-modified medium, 3 μM A83-01 (2939, Tocris), and 10 μM ROCK inhibitor Y-27632 (M1817, Abmole). Human conjunctival organoids were maintained in differentiation medium for up to 11 days.

[0214] Air-liquid interface culture Human organoids (5-7 days after cleavage) were harvested, trypsinized with 0.25% trypsin / EDTA (Thermo Fisher Scientific) for 5 minutes, and 100,000 cells were seeded into 100 μL of human expansion medium on a 6.5 mm wide transwell (Corning or Greiner). The human expansion medium was added to the lower compartment. After 3-4 days, when the cells reached confluence, the medium was removed from the upper compartment and the culture was lifted to the gas-liquid interface (ALI). The ALI culture was maintained for 22 days. The medium in the lower compartment was replaced every 3-4 days.

[0215] RT-qPCR analysis of gene expression RNA was extracted from organoids, ALI cultures, or primary tissues contained in 100 μL of BME using the RNeasy Mini Kit (QIAGEN) and suspended in 25 μL of nucleus-free water (QIAGEN). Reverse transcription of at least 500 ng of RNA was performed for each condition using GoScript Reverse Transcriptase (A5003, Promega) and Random primers (C1181, Promega) according to the manufacturer's instructions. Quantitative PCR was performed using SYBR green (1725270, Bio-Rad) on a CFX384 Touch Real-Time PCR detection system (Bio-Rad). The primers used are as follows: MUC5AC_F2:TCTGGAACGTGAGCATACCC (SEQ ID NO: 1), MUC5AC_R2:CGGCTCAAGACCTTGCTCA (SEQ ID NO: 2), MUC16_F1:gctaccacaggttccagtcc (SEQ ID NO: 3), Muc16_R1:cgacggttataactgctggtg (SEQ ID NO: 4), Spdef_F1:ccagtggccaacctgagtg (SEQ ID NO: 5), spdef_r1:tggcggctgtctgttag (SEQ ID NO: 6), wfdc2_f1:caagagtgcgtctcggacag (SEQ ID NO: 7), wfdc2_r1:ttcatctggccaggacactg (SEQ ID NO: 8).

[0216] histologyThe tissues were fixed in formalin for at least 2 hours. The organoids were dissociated from the BME by washing with 10 mL of ice-cold AdDMEM+++ per 100 μL of BME, followed by pelleting at 300 × g for 5 minutes. Subsequently, the culture medium for the organoids and ALI was also fixed in formalin for at least 2 hours. At this stage, the Transwell membrane containing the cells was excised from the Transwell insert and processed further. The tissues, organoids, and Transwells were finally embedded in paraffin by continuous incubation in EtOH 70%, EtOH 96%, EtOH 100%, xylene, and liquid paraffin. 4 μm sections were prepared, hydrated, and stained with hematoxylin and eosin (H&E) and PAS staining, or immunohistochemistry, according to methods widely known to those skilled in the art. In the case of immunohistochemistry, antigen recovery was performed according to the instructions of the respective antibody manufacturers. Subsequently, the sections were blocked with 1% Bovine Serum Albumin (BSA, MP Biomedicals, 160069) in PBS. The following antibodies were used for staining: TP63 (ab735, Abcam), PAX6 (Biolegend, 901301), KRT5 (clone AF138, Covance, 905501), KI67 (eBiosciences, 14-5698-82), MUC5AC (Thermo Fisher Scientific, MA5-12175), MUC1 (Abcam, ab15481), AQP5 (Origene, TA307525), LTF (Millipore 07-685), LCN2 (R&D systems, AF1757), WFDC2 (LSBio, LS-C175346), mouse KRT19 (Cell Signalling Technology, 13092S), human KRT19 (Cell Signalling Technology, 4558S), TFF3 (Atlas Antibodies, HPA035464). After staining with the primary antibody overnight at 4°C, the sections were washed three times with PBS. If necessary, the sections were incubated with the secondary antibody rabbit anti-goat (Southern Biotech, 6160-01) for 1 hour and washed three times with PBS.Finally, the sections were incubated with BrightVision poly-HRT anti-rabbit (Agilent, K400311-2) or BrightVision poly-HRT anti-mouse (Agilent, K400111-2) for 1 hour and with 3,3'-diaminobenzidine (DAB) for 10 minutes. Finally, the sections were dehydrated and mounted using Pertex (registered trademark). The sections were imaged using a DM4000 optical microscope (Leica). The images were processed using ImageJ software (FIJI).

[0217] Immunofluorescence First, the organoids were recovered from the BME as described above. The organoids and ALI were fixed with formalin for 2 - 24 hours, permeabilized with 0.2% Triton-X for 20 minutes, and blocked with 1% BSA and 0.2% Triton-X. They were stained overnight at 4°C using the indicated antibodies in 1% BSA and 0.2% Triton-X. Then, the organoids and ALI were washed three times with PBS and stained for 1 hour at room temperature in the dark while rotating with the appropriate secondary antibodies: Alexa Fluor 488 donkey anti-rabbit (Thermo Fisher Scientific, A21206), Alexa Fluor 568 donkey anti-mouse (Thermo Fisher Scientific, A10037), Alexa Fluor 568 donkey anti-rabbit (Thermo Fisher Scientific, A10042) or Alexa Fluor 568 donkey anti-goat (Thermo Fisher Scientific, A11057). In some cases, Phalloidin-Atto 647N (Sigma-Aldrich, 65906) and DAPI (Sigma) were added to the mixture. After washing three times with PBS and once with MilliQ, the organoids and ALI on the Transwell membrane were mounted on slides using Prolong Gold antifade reagent with DAPI (P36935, Thermo Fisher Scientific). The slides were imaged using an SP8 or SP8X confocal microscope (both from Leica). The images were processed using ImageJ (FIJI).

[0218] Knockout via CRISPR / Cas9 Approximately 5 days after cell division (when the organoids are in the proliferation phase), the cells were dissociated to a state close to single cells, similar to subculture. Half a plate was taken for each gene to be knocked out (~600 μL BME). The cell suspension was washed and pelletized at 500 g for 5 minutes. Next, the organoids were resuspended in 80 μL BTXpress solution (45-0805, BTX) supplemented with 100 μM ROCK inhibitor Y-27632 (M1817, Abmole). 10 μg of pSpCas9(BB)-2A-GFP containing Pax6 gRNA (Pax6_gRNA_F:CACCgCTCTACGATCTTCTGCCGGG (SEQ ID NO: 9) and Pax6_gRNA_R:AAACCCCGGCAGAAGATCGTAGAGc (SEQ ID NO: 10)) was cloned, and 7.2 μg of hygromycin-resistant transposon and 2.8 μg of transposase were added to the cell suspension. This suspension was transferred to an electroporation cuvette immediately before electroporation. Electroporation was performed using NEPA21. Immediately thereafter, 400 μL of BTXpress supplemented with Y-27632 was added to the electroporated cells, and the cells were allowed to recover at room temperature for 30 minutes before plating. Importantly, a control without hygromycin transposon and transposase was also electroporated. This served as a later selection control. After harvesting, Pax6 gRNA and control cells were plated at similar densities and expanded medium was added. When the organoids recovered from electroporation and began to proliferate (approximately 3-5 days after electroporation), selection with hygromycin (1:1000, Invivogen) was initiated. When all control cells had died (within 5 days), surviving clones were extracted, dissociated, and expanded.To investigate Pax6 deletions, DNA was extracted from clones using 50 μL of QuickExtract® DNA Extraction Solution 1.0 (QE09050, Lucigen). Genotyping of the clones was performed by PCR using the following primers: Pax6_gen_F TCCAGTGGGCAGGTTCAAAT (SEQ ID NO: 11) and Pax6_gen_R AGGACGCTTAGAGTGGAGGGCC (SEQ ID NO: 12). Clones with out-of-frame deletions were retained for further analysis.

[0219] Bulk mRNA sequencing Similar to qPCR analysis, RNA was isolated from organoids. Bulk mRNA sequencing was performed at Single Cell Discoveries (Utrecht, Netherlands). Briefly, poly(A)-enriched RNA was reverse transcribed, sequenced using Illumina NextSeq500, and paired-end reads were mapped to the mouse genome (mm10) or human genome (hg19) using the publicly available pipeline MapAndGo (https: / / github.com / vertesy / TheCorvinas / blob / 102b598cc8e3717c155c5c5ea974488fe7992d96 / Python / MapAndGo / Readme_MapAndGo.md) and the default settings of BWA-MEM. Bulk RNA-seq samples were analyzed using R. DESeq2 (version 1.26.0) (Love et al., 2014) was used to perform differential expression analysis between infected and naive samples. clusterProfiler (version 3.14.0) (Yu et al., 2012) and ChIPpeakAnno (version 3.20.0) were used to perform gene function annotation of differentially expressed genes. When comparing gene expression levels, all samples were downsampled to the minimum depth (3.155M transcript per sample).

[0220] Single-cell mRNA sequencing For single-cell mRNA sequencing of organoids, human conjunctival organoids were cultured for 17 days in expansion medium containing EGF (AF-100-15, Peprotech), or for 10 days in expansion medium containing EGF (AF-100-15, Peprotech) followed by 7 days in differentiation medium. These were then dissociated into single cells in the same manner as in cell division. Subsequently, the cell suspension was washed twice with 10 mL of AdDMEM+++, and DAPI-negative cells were sorted using FACS Fusion (BD Biosciences) in a 384-well plate containing ERCC spike-ins (Agilent), RT primers, and dNTPs (Promega).

[0221] For single-cell mRNA sequencing of the tissue, human conjunctival biopsy samples were dissociated into single cells in the same manner as organoid establishment and washed twice with AdDMEM+++. The cells were counted, and 10 6Cells were stained with 5 μL of the following antibodies at 4°C in the dark for 30 minutes: Alexa Fluor 488 anti-human EPCAM (clone 9C4, 324210, Biolegend) and APC / Cy7 anti-human CD45 (clone HI30, 304014, Biolegend). Cells were washed immediately before sorting and stained with DAPI. Living DAPI-negative epithelial cells (EPCAM-positive and CD45-negative) or ungated DAPI-negative cells were sorted into 384-well plates containing ERCC spike-ins (Agilent), RT primers, and dNTPs (Promega) using FACS Melody (BD Biosciences). The plates were then processed according to the SORT-seq protocol based on the Cel-Seq2 protocol. PolyA-rich libraries were subjected to paired-end sequencing on the Illumina NextSeq500 platform. For analysis, fastq files were mapped to the human genome (hg19). Transcription counts from different conditions were merged and input into the Seurat package v4.0. A total of 1917 cells were sequenced. Cells with fewer than 1500 transcripts (n_features), more than 7500 transcripts (i.e., doublets), or less than 30% mitochondrial genes were filtered, and batch effects were reduced using SCtransform. Then, 960 cells representing all seven conditions were clustered. The following parameters were used for clustering the dataset: dims=1:11, resolution=0.3. Cluster identity was determined based on the expression of marker genes. GOterm enrichment analysis was performed using the goseq package.

[0222] Proliferation of single-celled organoids Human conjunctival organoids cultured in expanded medium for 7-11 days were dissociated into single cells as described above. The cells were counted, and 10 6Cells were stained with 5 μL of PE anti-human NGFR (345106, Biolegend) per cell at 4°C in the dark for 30 minutes. The cells were then washed, resuspended in human expansion medium, and filtered (35 μm). DAPI was added immediately before sorting. 1000 viable cells (DAPI-negative), NGFR-positive, and NGFR-negative were sorted into human expansion medium, pelletized, and plated in 20 μL of BME to track organoid growth. Photographs were taken using a bright-field Leica microscope and AutoEvos (Thermo Fisher Scientific). After 6 days, the number of organoids that had grown under each condition was manually counted using ImageJ (FIJI). Single-cell clones were further enlarged and subjected to histological analysis.

[0223] Western blot Twenty-four hours prior to collection, the upper compartment ALI culture was washed with 100 μL of PBS to remove any previously secreted material. Then, 50 μL of PBS was added to the apical surface of the ALI, and after 24 hours, the ALI secreted the product. The supernatant was collected and frozen until further processing. The same process was repeated for the same ALI culture at the indicated time.

[0224] The recovered supernatant was mixed with Laemmli buffer containing 100 mM DTT (Sigma-Ace) and boiled for 5 minutes. After rotation, the supernatant was loaded onto a 4-15% gradient gel (BioRad) and electrophoresed at 100V for 1 hour (LCN2 staining). The proteins were transferred to a nitrocellulose membrane using an ice block at 100V for 1 hour. The membrane was blocked with 1% BSA and stained overnight with LCN2 antibody (R&D Systems, AF1757) in 1% BSA. The next day, the membrane was washed three times with TBS (TBST, Sigma) containing 0.1% Tween. The LCN2-stained membrane was incubated with rabbit anti-goat HRP secondary antibody (Dako, P0449, 1:5000) in blocking buffer for 1 hour. After washing three times with TBST, the membrane was incubated with ECL detection reagent (Thermo Fisher Scientific, 12393969) according to the manufacturer's instructions. The membrane was imaged using BioRad gel doc XR+.

[0225] Herpes simplex virus 1 infection Herpes simplex virus 1 containing the VP16 capsid protein endogenously tagged with tdTomato (HSV1-tdTomato) was used. For HSV1 infection of 17-day-old ALI cultures, HSV1-tdTomato virus was apicalally added to ALI (in a transwell) in 50 μL of PBS at a MOI of 0.1 for 3 hours. After 3 hours, the supernatant was removed and the transwell was washed twice with 150 μL of PBS. Subsequently, secreted virus was collected in 100 μL of PBS every 24 hours (including 0 hours post-infection). Briefly, PBS was added to the transwell, pipetted three times, and collected after 15 minutes. The collected supernatant was stored at -20°C until further processing. If instructed, 10 μM acyclovir (PHR1254, Sigma-Aldrich) was added to the lower compartment after incubation with the virus. Furthermore, ALI cultures were imaged daily using an Auto-EVOS microscope (Thermo Fisher Scientific) to monitor viral progression. Quantitative analysis of viral titers was performed as described below.

[0226] hAdV8 infection hAdV8 strains isolated from patients were used. Similar to HSV1 infection, hAdV8 with an MOI of 10 was added to ALI cultures in 50 μL of PBS for 3 hours, followed by washing. Every 24 hours, the excreted virus was collected in 100 μL of PBS and stored until further processing. Where instructed, 10 μM acyclovir (PHR1254, Sigma-Aldrich), 60 μM cidofovir (C5874, Sigma-Aldrich), or 20 μM nelfinavir (PZ0013, Sigma-Aldrich) was added to the lower compartment after incubation with the virus. ALI cultures infected with hAdV8 were stored for up to 4 days and fixed as needed.

[0227] Measurement of viral titer by qPCR DNA was extracted using the Zymogen Quick-DNA Microprep kit (ZY-D3020, Zymogen) when processing the supernatant of organoid pellets and ALI cultures. The DNA was systematically resuspended in 15 μL of nuclease-free water (QIAGEN). Subsequently, viral DNA was quantified by qPCR as follows: 5 μL of DNA extract was mixed with 5 μL of SYBR green containing HSV1 detection primers (HSV1-F:ATCAACTTCGACTGGCCCTT (SEQ ID NO: 13) and HSV1-R:CCGTACATGTCGATGTTCAC (SEQ ID NO: 14)) or hAdV8 detection primers (hAdV8-F:TTCCCCATGGCNCACAAYAC (SEQ ID NO: 15) and hAdV8-R:TGCCKRCTCATRGGCTGRAAGTT (SEQ ID NO: 16)). SYBR green was mixed with 10 μM of the primer mix in a 10:1 ratio. Technical replicates were evaluated by qPCR. A 40-cycle program consisting of 2 minutes at 95°C, followed by 15 seconds at 98°C, 15 seconds at 60°C, and 15 seconds at 72°C was used for viral DNA amplification. To quantify the viral DNA content in the ALI supernatant, the HSV1-tdTomato genome was amplified to 179 bp using HSV1-F and HSV1-R, and the hAdV8 genome was amplified to 1004 bp using hAdV8-F and hAdV8-R. Both were cloned into pJet vectors (Thermo Fisher Scientific) and used to create a standard curve for the viral genome range of 2,104–2,109 copies, according to the Addgene instructions (https: / / www.addgene.org / protocols / aav-titration-qpcr-using-sybr-green-technology / ). This standard curve was used to estimate the number of viral genome copies excreted into the supernatant. Infection experiments were always performed in technical triplicate and repeated with different organoid strains.

[0228] SARS-CoV-2 production Calu-3 cells were maintained at 37°C in a humidified CO2 incubator in Opti-MEM I (1X) + GlutaMAX (Gibco) supplemented with 10% fetal bovine serum, penicillin (100 IU / mL), and streptomycin (100 IU / mL). Ancestral SARS-CoV-2 (614G, isolate BavPat1 / 2020 EVAg Ref-SKU: 026V-03883) and a delta variant (GenBank accession number: OM287123) were grown on Calu-3 cells in AdDMEM+++ and sequenced as described above (GeurtsvanKessel et al., 2022). Viral titration was performed by plaque assay. All work involving infectious SARS-CoV-2 was performed in a Class II biosafety cabinet under BSL-3 conditions at Erasmus Medical Center.

[0229] SARS-CoV-2 infection For SARS-CoV-2 infection of 17-30 day old ALI cultures, the expansion medium was refreshed, the culture medium was washed twice with 200 μL of AdDMEM+++, and then inoculated apical to 0.1 MOI with 200 μL of AdDMEM+++ per well. Next, the cells were incubated at 37°C and 5% CO2 for 2 hours, and then the apical end was washed three times with 200 μL of AdDMEM+++. At the indicated time, 200 μL of AdDMEM+++ was added apical, and the cells were incubated at 37°C and 5% CO2 for 10 minutes. The virus was recovered from the cells by storing the supernatant at -80°C. Before measuring viral titer, the samples were centrifuged at 500 × g for 5 minutes. Infectious viral titer was measured by qRT-PCR and plaque assay using Calu-3 cells.

[0230] Fixed immunofluorescence microscopy of two-dimensional cultures infected with SARS-CoV-2. Cells were fixed in formalin, permeabilized with 70% ethanol, and blocked for 60 minutes in PBS with 10% normal goat serum (blocking buffer). Cells were incubated overnight at 4°C with primary antibody (Rabbit-anti-SARS-CoV NP, Sino Biological; 1:1000) in blocking buffer, washed with PBS, incubated with Alexa488-conjugated secondary antibody (1:1000; Invitrogen) in blocking buffer at room temperature for 2 hours, washed with PBS, incubated with Hoechst for 20 minutes, incubated with CruzFluor647-labeled phalloidin (Santa Cruz) for 20 minutes, washed with PBS, and mounted with Prolong Antifade (Invitrogen) mounting medium. Samples were imaged using ZEN software (Zeiss) with an LSM700 confocal microscope.

[0231] Transmission electron microscope Fresh tissue and ALI samples were fixed in fixation buffer (2% paraformaldehyde, 2.5% glutaraldehyde, 0.1M phosphate buffer, pH 7.4) at 4°C for 24 hours. The samples were then maintained in washing buffer (0.1M cacodylate) until further treatment. The samples were further fixed in washing buffer with 1% osmium tetroxide and 1.5% potassium ferricyanide in the dark at 4°C for 1 hour. The samples were then dehydrated with 100% EtOH and immersed in Epon resin for 2 days. The samples were then embedded in Epon resin and polymerized at 60°C for 2 days. Ultrathin sections were cut using an ultramicrotome (Leica Ultracut UCT) and mounted on Formvar-coated copper grids. The sections were stained with 2% uranyl acetate and lead citrate in water. The sections were imaged using a Tecnai T12 electron microscope and an Eagle 4k*4k CCD camera (Thermo Fisher Scientific).

[0232] Mouse orthotopic transplantation Human conjunctival organoids were enlarged as described in the previous section and divided 4-5 days before transplantation. On the day of transplantation, the organoids were released from BME using dispase. Organoids in the proliferative phase were suspended in fibrin component 2 (TISSEEL, Baxter) and kept on ice until transplantation into mice. Immunodeficient NSG mice were sedated by intraperitoneal injection of midazolam (10 μL / g body weight). Under a surgical microscope, the conjunctiva of the right eye was excised using surgical scissors. Next, 5 μL (~100,000 cells) of the organoid suspension in fibrin component 2 was placed on the wound. Immediately, approximately 5 μL of fibrin component 1 was added to induce fibrin polymerization. After fibrin polymerization, one drop of Fusitalumi ointment was instilled to prevent bacterial infection. The eyelids were sutured to avoid transplantation failure due to blinking. To prevent pain, 0.1 mg / kg of buprenorphine was injected on the day of surgery, and 0.06 mg / mL of carprofen was administered orally for two days. To evaluate the initial engraftment of organoids, mice were sacrificed by CO2 inhalation two days after surgery. The entire eyeball was dissected, fixed, and embedded in paraffin. Engraftment of KRT19+ human cells was histologically screened. If human cells were detected, serial sections were stained with conjunctival markers such as TP63, MUC1, and KI67, as described in the previous chapter. All mouse experiments were conducted under a project license granted by the Central Committee Animal Experimentation (CCD) of the Dutch government and approved by the KNAW-Hubrecht Institute Animal Welfare Body.

[0233] Data analysis and availability The number of repetitions and the statistical analysis performed are shown in the figure or legend.

[0234] Organoids grown on fibrin First, fibrin gels were prepared in suspension plates immediately before seeding the cells. Human conjunctival organoids 5 days after the previous passage were dissociated into single cells using 0.25% trypsin / EDTA. After filtering the cell suspension through a 40-μm filter (Greiner), 1.2 x 10 6 cells per well of a 12-well plate were seeded into human expansion medium. Up to 7 days later, the cells grown on fibrin were fixed with formalin and subjected to histological and immunofluorescence examinations.

[0235] Organoid Induction in Collagen First, rat tail collagen I (Thermo Fisher Scientific) was prepared according to the manufacturer's instructions to make gels. Next, human conjunctival tissues were dissociated as described above. The same amount of dissociated cells was seeded side by side in BME and 1.5 collagen I to compare the growth of organoids. The passage of organoids grown on collagen I was performed using 0.25% trypsin / EDTA.

[0236] Example 11. Transplantation of Human Conjunctival Organoids in a Rabbit Model The conjunctiva (the cells covering the sclera and the inner side of the eyelid) is essential for eye lubrication and antibacterial defense. In addition to mechanical and chemical injuries, damage can also occur through the treatment of premalignant pterygium or ocular surface squamous neoplasia, a group of diseases including premalignant lesions and malignant epithelial lesions (conjunctival intraepithelial neoplasia, squamous cell carcinoma, and the rare variant mucoepidermoid carcinoma). This defect can be repaired by autologous transplantation, but the tissue source is limited, leading to scar formation at the donor site or being unavailable. In this experiment, preclinical evidence was obtained showing that human conjunctival cells / grafts obtained by the method disclosed herein can be used as grafts and are thus suitable for use in the treatment of conjunctival epithelial damage.

[0237] The preparation and evaluation of the grafts were basically carried out as follows: A small conjunctival biopsy (<1 mm²) was taken from the donor and processed according to the method disclosed herein to proliferate stem cells present in the conjunctival epithelium and efficiently form organoids. The organoids were grown under 3D conditions in basement membrane extract and passaged every 10 days on average by dissociating and re-platering the cells in basement membrane extract.

[0238] To prepare grafts for transplantation, cells are seeded onto fibrin gel approximately 3-7 days after passage (while still in the proliferative phase). Currently, approximately 2.5 million cells are seeded in a 30mm dish containing medical fibrin gel. Approximately 4 days after seeding, the cells become confluent, and grafts can be prepared. Using a 6mm punch, approximately 6-8 grafts can be prepared from a single plate, which are then transplanted in vivo into the conjunctiva of rabbits. Our preliminary tests indicated that the seeding density needs to be optimized.

[0239] Human conjunctival grafts were prepared on fibrin as described above, and the resulting grafts were transplanted into 20 rabbits in the 7-day follow-up group and an additional 14 rabbits in the 21-day follow-up group. Figure 10 shows the defect area (the area where the implant was introduced) with a white dashed line (5 mm in diameter). The sutures marking the boundary of the graft are clearly visible, indicating the degree of healing of the defect. Representative images of the histological findings at week 1 and week 3 show that the graft is occupied by multiple layers of human epithelial cells. At week 1, approximately 100% of the graft is covered with cells, compared to approximately 75% at week 3. The arrows in Figure 11 indicate goblet cells (Alcian blue), which are (as expected) more abundant in the fornix (18 cells / mm) than in the conjunctiva (9 cells / mm). Multiple layers of human cells are observed, which is related to the regenerated ocular surface.

[0240] Example 12. Preparation of human limbal organoids. In this example, we initiated the establishment of human-derived limbal organoids. The cornea is a transparent layer of the anterior segment of the eye. This layer consists of extracellular matrix secretory keratinocytes organized perpendicular to the light path, covered by non-keratinized stratified epithelium. This epithelium is renewed by stem cells located in a region around the cornea called the limbus. During homeostasis maintenance and after injury to the central part of the cornea, these stem cells divide, differentiate, and migrate towards the center to replenish the tissue. If the limbus is injured, it leads to a deficiency of limbal stem cells. In such cases, limbal stem cells, and consequently the central part of the cornea, are replaced by conjunctival tissue, leading to blindness.

[0241] For this reason, both the cornea and the limbus have been extensively studied. Several culture models exist for studying the cornea. These models are either limbus stem cells (2D structure) or organoids (3D structure) derived from induced pluripotent stem cells (iPSCs) grown on mouse embryonic fibroblasts. Here, we establish organoids directly from limbus stem cells and clarify their characteristics.

[0242] For this purpose, we used human limbal / corneal samples (n=7) from donor residues at the ETB-BISLIFE Corneal Bank (Beverwijk, Netherlands). This study was conducted in accordance with the Declaration of Helsinki and Dutch law. Patient samples were anonymized, so sex, age, race, and other information were not recorded, and organoid strains derived downstream from some of these samples are also unavailable.

[0243] The limbal region of the cornea was excised, the sample was chopped, and placed in a 37°C water bath in 0.05% trypsin / EDTA (Thermo Fisher Scientific) for 30 minutes, shaking the tube periodically. After the corneal fragments had settled, the supernatant was collected and placed in a tube containing 10 mL of Advanced DMEM / F12 (Thermo Fisher Scientific) supplemented with Pen / Strep (Thermo Fisher Scientific), GlutaMAX (Thermo Fisher Scientific), and HEPES (Thermo Fisher Scientific) (hereinafter referred to as Ad+++). If the cells were still adhered to the corneal matrix, the above steps were repeated twice, and the dissociated cells were collected and pooled with the previous cells.

[0244] The cells were pelleted at 300xg for 5 minutes and then resuspended in basement membrane extract (BME, Cultrex). The BME droplets containing corneal cells were then plated onto a suspension plate (Greiner). Once the BME had solidified, expansion medium was added. The human expansion medium consists of B27 supplement (1X, 11530536, ThermoFisher Scientific), 1.25 mM N-acetylcysteine ​​(A9165, Sigma-Aldrich), 0.25% Noggin-conditioned medium (U-ProteinExpress), 5% R-spongin-conditioned medium (Pleguezuelos-Manzano, C., Puschhof, J., van den Brink, S., Geurts, V., Beumer, J., and Clevers, H. (2020). Establishment and Culture of Human Intestinal Organoids Derived from Adult Stem Cells. Curr Protoc Immunol 130, e106. 10.1002 / cpim.106, manufactured as described), 100 ng / mL FGF1 (Peprotech), and 3 μM The culture medium consisted of Ad+++ supplemented with A83-01 (2939, Tocris), 10 μM ROCK inhibitor Y-27632 (M1817, Abbmole), 0.15 nM Wnt Surrogate (U-Protein Express), 100 ng / mL FGF10 (100-26, Peprotech), and 1 μM forskolin (1099, Tocris). EGF was removed from the medium because it shortens the lifespan (passage number) of the organoids.

[0245] Furthermore, the organoids were grown in the (human) expansion medium specified above, supplemented with either 100 ng / mL of FGF-7 (Peprotech) and 100 ng / mL of IGF-1 (X2 medium), or 100 ng / mL of FGF-7 (Peprotech), 100 ng / mL of IGF-1 (Peprotech), and IL-6 (Peprotech) (X3 medium).

[0246] The corneal organoids were divided in exactly the same way as human conjunctival organoids.

[0247] In two-dimensional culture on the Transwell, corneal organoids were seeded in exactly the same way as human conjunctival organoids and maintained in two dimensions. If instructed, PBS was added to the upper chamber of the Transwell when the cells reached confluence.

[0248] Histological analysis and immunofluorescence analysis were performed in exactly the same manner as in the case of human conjunctiva.

[0249] result After detaching the entire cornea or limbus, cells were dissociated using 0.05% trypsin / EDTA and plated in a medium containing B27, N-acetylcysteine, WNT surrogate, R-spongin 1 modified medium, Noggin modified medium, TGFβ inhibitor A83-01, forskolin (FSK), FGF1, and FGF10. The dense organoids proliferated within 7 days and were subsequently divided every 7–14 days on average and cultured for at least 3 months for more than 10 passages (X2 medium; at least 14 passages), demonstrating that the method according to the present invention provides long-term (e.g., more than 10 passages) culture of limbal (or conjunctival: conjunctival) stem cells and / or organoids (see Figure 12A and B). The established limbal organoids basally expressed the stem cell marker TP63 in addition to PAX6 and expressed the limbal stem cell marker KRT24. Finally, the organoids were similarly grown for the first 10 passages in the (human) expansion medium specified above, or in X2 or X3 medium. Expansion media further containing IGF1 and / or FGF7 resulted in the longest overall growth periods, allowing for at least 14 passages or more.

[0250] Next, human limbal organoids were histologically characterized in comparison to limbal and central corneal tissue. Organoids according to the present invention expressed the ocular surface transcription factor PAX6. Most cells expressed TP63, which was most similar to the limbal region of the tissue. KRT24, a marker for the so-called "limbal surface epithelium," was most expressed at the apical end of the organoids, but its expression was spread throughout the limbus and corneal epithelial tissue. Finally, MUC1 was not expressed in either the organoids or the tissue. Overall, the human organoids were histologically similar to their corresponding tissues.

[0251] To replicate the structure of limbal corneal tissue (corneal epithelial tissue), organoids were cultured two-dimensionally on a transwell (2D culture). Both chambers of the transwell were filled with expansion medium until confluence. Once the cells reached confluence, the upper chamber of the transwell was filled with PBS or all the fluid was removed. After approximately 7 days, the cells were found to be layered and possessed a basal layer of cells expressing the stem cell marker TP63, as well as KRT24 and PAX6 (Figure 13). This structure is very similar to that of central corneal tissue.

[0252] Although the present invention has been fully described, it will be understood by those skilled in the art that the same can be carried out within a wide range of equivalent parameters, concentrations, and conditions without departing from the spirit and scope of the invention and without excessive experimentation.

[0253] References to known methods, prior art, known methods, or prior art do not in any way constitute an endorsement that any aspect, description, or embodiment of the present invention is disclosed, taught, or suggested in the relevant art.

Claims

1. (a) the step of providing conjunctival stem cells and / or limbal stem cells, (b) an in vitro method for producing a conjunctival organoid or limbal organoid, comprising the step of culturing the conjunctival stem cells and / or the limbal stem cells in a culture medium under conditions suitable for forming a conjunctival organoid or limbal organoid.

2. The in vitro method according to claim 1, wherein the step of culturing the conjunctival stem cells or limbal stem cells in the culture medium comprises the step of culturing them in a cell expansion culture medium, and preferably the cell expansion culture medium comprises an inhibitor of the transforming growth factor β (TGF-β) signaling pathway, an inhibitor of bone morphogenetic protein (BMP), and / or an agonist of the Wnt pathway.

3. The in vitro method according to any one of claims 1 to 2, wherein the culture in the culture medium is for a period of time sufficient to enable the formation of the conjunctival organoid or for a period of time sufficient to enable the formation of the limbal organoid, and preferably the formed conjunctival organoid comprises keratinocytes expressing one or more of the transcription factor tumor protein p63 (TP63), keratin-19 (KRT19), mucin short variant S1 (MUC1), and aquaporin-5 (AQP5).

4. The in vitro method according to any one of claims 1 to 3, wherein the culture in the culture medium is performed for at least 3 days.

5. The in vitro method according to any one of claims 1 to 4, wherein the conjunctival organoid and / or limbal organoid is a conjunctiva of a mammal, rodent or human, preferably a human conjunctiva or limbal organoid.

6. The in vitro method according to any one of claims 1 to 5, wherein the conjunctival stem cells or limbal stem cells are human conjunctival stem cells or human limbal stem cells, and preferably the culture medium / cell expansion culture medium is substantially free of epidermal growth factor (EGF), and optionally comprises cyclic AMP activator, particularly forskolin, and / or one or more fibroblast growth factors (FGF), particularly one or more fibroblast growth factors (FGF) selected from FGF1 and FGF10, and combinations thereof.

7. The in vitro method according to any one of claims 1 to 6, wherein the conjunctival stem cells, preferably human conjunctival stem cells, express nerve growth factor receptor (NGFR) or are nerve growth factor receptor-positive conjunctival stem cells.

8. The in vitro method according to any one of claims 1 to 7, wherein the step of culturing the conjunctival stem cells and / or limbal stem cells in the culture medium comprises the step of culturing them in a cell differentiation culture medium, preferably the cell differentiation culture medium comprises an inhibitor of the transforming growth factor β (TGF-β) signaling pathway, an inhibitor of bone morphogenetic protein (BMP), and / or an agonist of the Wnt pathway, and more preferably the cell differentiation culture medium further substantially comprises EGF, fibroblast growth factor, and / or B27 supplement.

9. The in vitro method according to any one of claims 1 to 8, wherein the step of culturing the conjunctival stem cells and / or limbal stem cells in the culture medium comprises the step of culturing them in a cell expansion culture medium and then culturing them in a cell differentiation culture medium.

10. The in vitro method according to any one of claims 1 to 9, preferably any one of claims 8 to 9, wherein the culture in the culture medium, particularly in the cell differentiation culture medium, is for a period of time sufficient to enable the formation of the conjunctival organoid and / or the limbal organoid, and preferably the formed conjunctival organoid comprises keratinocytes expressing one or more of KRT-19, TP63, MUC1, and AQP5, and further comprises goblet cells.

11. The inhibitors of the transforming growth factor β (TGF-β) signaling pathway are A83-01 (CAS number: 909910-43-6), SB-431542 (CAS number: 301836-41-9), SB-505124 (CAS number: CAS694433-59-5), SB-525334 (CAS number: 356559-20-1), and LY36. The in vitro method according to any one of claims 1 to 10, wherein the compound is selected from the group consisting of 4947 (CAS number: 396129-53-6), SD-208 (CAS number: 627536-09-8), SJN2511 (CAS number: 2319939-07-4), and combinations thereof, and is particularly A83-01 (CAS number: 909910-43-6).

12. The in vitro method according to any one of claims 1 to 11, wherein the inhibitor of bone morphogenetic protein (BMP) is a compound selected from the group consisting of Noggin (human protein Uniprot Nr. P97466), Chordin, follistatin, gremlin, twisted gastration (TSG), short gastration (SOG), dolsomorphine, LDN193189 (CAS number: 1062368-24-4), and combinations thereof.

13. The in vitro method according to any one of claims 1 to 12, wherein the agonist of the Wnt pathway is selected from the group consisting of R-spondin, Wnt protein, Wnt surrogate, ROCK inhibitor, and combinations thereof.

14. The in vitro method according to any one of claims 1 to 13, further comprising the step of dissociating cells contained in the conjunctival organoid and / or the limbal organoid, and then culturing one or more of the dissociated cells at a gas-liquid interface.

15. (a) Providing a container comprising a first chamber and a second chamber, wherein the first chamber and the second chamber are separated by a porous membrane, (b) The step of seeding the cells dissociated from the conjunctival organoid onto one side of the porous membrane, preferably on one side of the porous membrane in the first chamber, (c) A step of supplying culture medium to the first chamber and / or the second chamber such that the cells seeded on the porous membrane are immersed in the culture medium, (d) The step of expanding the seeded cells on the porous membrane for a period of time sufficient to obtain a substantially confluent cell layer, (e) Removing the culture medium from the chamber containing the confluent cell layer, preferably the first chamber, and exposing the cells to air for a period of time sufficient to obtain a conjunctival cell culture containing multiple layers of cells; Equipped with The cell layer proximal to the porous membrane comprises basal keratinocytes expressing KRT-19 and TP63, and the cell layer distal to the porous membrane comprises apical keratinocytes expressing MUC1 and goblet cells, particularly goblet cells expressing MUC5AC. Preferably, the culture medium is a cell expansion culture medium or a cell differentiation culture medium, and more preferably a cell expansion culture medium, according to claim 14.

16. Isolated conjunctival organoids, particularly human conjunctival organoids, containing keratinocytes expressing KRT19 and one or more of TP63, MUC1, and AQP5.

17. The isolated organoid according to claim 16, more particularly a human conjunctival organoid, further comprising goblet cells, preferably goblet cells expressing MUC5AC.

18. Isolated mammalian conjunctival organoid or mammalian limbal organoid obtained by the method described in any one of claims 1 to 15.

19. A gas-liquid interface culture of conjunctival cells, preferably conjunctival organoid cells, I. A container comprising a first chamber and a second chamber, wherein the first chamber and the second chamber are separated by a porous membrane, II. A multilayer of conjunctival cells arranged on at least one surface of the porous membrane, Equipped with, The multilayer comprises at least one cell layer located proximal to the porous membrane and containing basal keratinocytes expressing KRT-19 and TP63, and at least one cell layer located distal to the support and containing apical keratinocytes and goblet cells expressing KRT-19, MUC1 and AQP5. The gas-liquid interface culture optionally includes a cell culture medium in at least one of the first chamber and the second chamber.

20. A conjunctival organoid according to any one of claims 16 to 18, or a conjunctival organoid obtained by the method according to any one of claims 1 to 15, or comprising the conjunctival organoid, or comprising cells dissociated from the conjunctival organoid, or comprising the cells.

21. An in vitro conjunctival organoid or in vitro conjunctival implant for use as a pharmaceutical, wherein the conjunctival implant is as described in claim 20, and the in vitro conjunctival organoid is obtained by the method described in any one of claims 1 to 15, and / or the in vitro conjunctival organoid is as described in any one of claims 16 to 18.

22. An in vitro conjunctival organoid or in vitro conjunctival implant for use as a pharmaceutical according to claim 21, wherein the use is for the prevention and / or treatment of diseases or disorders of the conjunctiva, particularly human conjunctiva, or for use in regenerative medicine.

23. Use of the organoid according to any one of claims 16 to 18, or the gas-liquid interface culture according to claim 19, as an in vitro model of mammalian conjunctival epithelium, or in drug screening, or in toxicity assays.

24. A method for screening candidate drugs for modulating and / or preventing and / or treating diseases or disorders of the conjunctiva, particularly the human conjunctiva, (a) Providing an organoid according to any one of claims 16 to 18, or a gas-liquid interface culture according to claim 19, (b) optionally, providing conditions or a drug that simulates a disease or disorder, (c) A step of providing candidate drugs, (d) Optionally, before, after, or simultaneously with step (b), a step of bringing the candidate drug into contact with the organoid or the gas-liquid interface culture under conditions that enable interaction between the candidate drug and the organoid or the gas-liquid interface culture, (e) A step of determining whether contact with the candidate drug modulates the conjunctiva and / or prevents or reverses a simulated disorder or disease, A screening method for candidate drugs, comprising the following features.

25. The screening method according to claim 24, wherein the conditions or agent that simulate the disease or disorder are microorganisms, particularly bacteria or viruses.

26. A cell culture medium, preferably a cell expansion medium, comprising a basal medium for mammalian cells, further supplemented with an inhibitor of the transforming growth factor β (TGF-β) signaling pathway, an inhibitor of bone morphogenetic protein (BMP), and an agonist of the Wnt pathway, and optionally one or more of the following: B27 supplement; N-acetylcysteine ​​(NAC); fibroblast growth factor (FGF) particularly selected from FGF10, FGF1 and combinations thereof; epidermal growth factor (EGF); and antibacterial and / or antifungal compounds.

27. A cell culture medium according to claim 26, preferably a cell expansion culture medium, comprising a fibroblast growth factor (FGF) particularly selected from FGF10, FGF1 and combinations thereof, and substantially free of EGF.

28. A cell culture medium, preferably a cell differentiation culture medium, comprising a basal medium for mammalian cells supplemented with an inhibitor of the transforming growth factor β (TGF-β) signaling pathway, an inhibitor of bone morphogenetic protein (BMP), and an agonist of the Wnt pathway, substantially free of EGF, substantially free of any fibroblast growth factor, and substantially free of B27 supplement.