Tomato plants that are resistant to tobamovirus at high temperatures.
Combining a ToBRFV resistance gene with a TSR gene in tomato plants addresses the susceptibility to ToBRFV under high temperatures by reducing hypersensitive response, ensuring resistance and maintaining plant health and yield.
Patent Information
- Authority / Receiving Office
- JP · JP
- Patent Type
- Applications
- Current Assignee / Owner
- ENZA ZADEN BEHEER BV
- Filing Date
- 2024-04-05
- Publication Date
- 2026-05-12
AI Technical Summary
Tomato plants are susceptible to ToBRFV infection under high-temperature conditions, leading to disease symptoms and crop damage, as the hypersensitive response (HR) mechanism is impaired by heat stress, compromising resistance.
Incorporating a ToBRFV resistance gene combined with at least one temperature sensitivity reduction (TSR) gene into tomato plants, enhancing resistance to ToBRFV at temperatures above 28°C by reducing HR at high temperatures.
The combination of ToBRFV and TSR genes provides significant improvement in disease resistance, maintaining plant health and yield under high-temperature conditions, with plants showing no disease or necrosis symptoms for extended periods.
Smart Images

Figure 2026514575000001_ABST
Abstract
Description
Technical Field
[0001] The present invention relates to a plant of the S. lycopersicum species that is resistant to Tobamovirus at high temperatures, contains a TBRFV resistance gene, and further contains at least one temperature sensitivity reduction (TSR) gene. The present invention further relates to a combination of a TBRFV resistance gene combined with at least one temperature sensitivity reduction (TSR) gene that provides resistance to Tobamovirus in S. lycopersicum plants at a temperature of at least 28°C, and a method for providing a tomato plant that is resistant to TBRFV at a temperature of at least 28°C.
Background Art
[0002] In 2014, the occurrence of a new viral disease infecting tomatoes occurred in Israel and Jordan and rapidly spread throughout the world. This new disease was identified as a novel Tobamovirus and is referred to as ToBRFV (also known as TBRFV). ToBRFV infection is accompanied by necrotic lesions on leaves, and tomato plants show mild leaf symptoms at the end of the season, but strong brown atrophy symptoms on fruits, making the fruits inedible. Tobamovirus is a genus of the Virgaviridae family of virus species that infect plants of the Solanaceae family, such as tobacco, potato, tomato, and eggplant, and is, in particular, one of the most serious threats to vegetable crops worldwide. Tobamovirus is particularly problematic in tomato crops grown in protected environments and is mechanically transmitted from plant to plant over long distances by external seed contamination and through common farming practices by workers' hands, clothing, and tools, and can preserve infectivity in seeds and contaminated soil.
[0003] In the fight against tobamovirus, resistance was introduced into tomatoes through gene transfer of resistance genes, resulting in complete resistance. However, as viruses adapt and evolve, resulting in viral breakthroughs, resistance is likely to be broken over time. Therefore, the ongoing battle remains to identify the resistance genes or gene combinations necessary to provide and maintain resistant crops, especially against new ToBRFVs. Furthermore, recent research in this field appears to indicate that ToBRFV can infect previously resistant tomato plants under high-temperature conditions, i.e., temperatures above 28°C, causing disease symptoms and leading to increased hypersensitivity and crop damage in the plants.
[0004] Hypersensitivity response (HR) is a defense mechanism in plants that is activated upon recognition of a pathogen or other stressor, such as tobermovirus infection. HR is characterized by rapid programmed cell death in diseased tissue, which limits the spread of the pathogen and prevents further damage to the plant. Tomato plants are known to exhibit HR when infected with tobermovirus, a virus genus that infects a wide range of plants, including tomatoes. In tomato plants, HR is triggered by the recognition of viral proteins by plant resistance proteins, which initiates a signaling cascade that leads to the activation of cell death. However, studies have shown that HR in tomato plants can be impaired at high temperatures of 28 degrees Celsius or above, particularly in the case of tobermovirus infection. This is likely because heat stress induced at high temperatures can interfere with the signaling pathway that triggers HR, allowing the virus to spread more easily and cause more damage to the plant. High temperatures are thought to inhibit the function of resistance proteins, preventing them from recognizing viral proteins and initiating the signaling cascade. In addition, heat stress can also induce the production of heat shock proteins that can interfere with HR activation.
[0005] In summary, HR is an important defense mechanism against tobamovirus infection in tomato plants, but its effectiveness can be impaired under high-temperature conditions. Understanding the molecular mechanisms involved in HR and the laws governing it under different environmental conditions may help in developing strategies to improve plant resistance to viral infections, particularly tobamovirus infection in tomato plants. [Prior art documents] [Non-patent literature]
[0006] [Non-Patent Document 1] Andrus CF, Reynard GB, Wade BL (1942) "Relative resistance of tomato varieties, selections, and crosses to defoliation by Alternaria and Stemphylium. US Department of Agriculture Circular 652 [Overview of the project] [Problems that the invention aims to solve]
[0007] Considering the above, there is a need in the field for tomato plants that are resistant to ToBRFV and at the same time maintain their agrochemical properties under high-temperature conditions, i.e., temperatures above 28°C. In addition, there is a need in the field for a method to provide tomato plants that are resistant to ToBRFV and at the same time maintain their agrochemical properties, including fruit size, fruit yield, and leaf health, under these high-temperature conditions.
[0008] Among other purposes, the objective of the present invention is to address the aforementioned needs in the art. The objective of the present invention is achieved, among other purposes, particularly by the present invention outlined in the appended claims. [Means for solving the problem]
[0009] Specifically, the above objectives are achieved, in particular, according to the first aspect, by a plant of the S. lycopersicum species that is resistant to tobamovirus, wherein the plant comprises a TRBFV resistance gene encoding a TRBFV resistance protein, the protein having at least 90%, preferably at least 95%, more preferably at least 98%, even more preferably at least 99%, and most preferably 100% amino acid sequence identity with SEQ ID NO: 2, and further comprises at least one temperature-reduced-TSR (TSR) gene encoding a TSR protein having at least 95%, more preferably at least 98%, even more preferably at least 99%, and most preferably 100% sequence identity with a TSR protein selected from the group consisting of SEQ ID NO: 4 (also referred herein as the TSR-1 protein), SEQ ID NO: 6 (also referred herein as the TSR-2 protein), and SEQ ID NO: 8 (also referred herein as the TSR-3 protein), preferably SEQ ID NO: 4.
[0010] The present invention relates to tomato plants whose genomes contain a combination of a ToBRFV gene and a temperature-reducing (TSR) gene for reducing the hypersensitive response (HR) of tomato plants at high temperatures above 28°C for at least 24 hours, preferably at least 48 hours, when in contact with tobamovirus, preferably TBRFV. This HR response is associated with undesirable effects such as leaf discoloration, dark spots on tomato fruits, reduced plant viability, and ultimately yield loss. Surprisingly, when the ToBRFV resistance gene was combined with the TSR gene, a significant improvement in disease resistance was obtained at high temperatures compared to plants without the TSR gene (but containing the ToBRFV gene). It was further shown that the homozygous presence of the TBRFV resistance gene itself has a favorable effect on reducing the HR response. Experiments have shown that when TBRFV resistance genes are combined with at least the listed TSR genes, viral disease resistance is improved, particularly under high-temperature conditions; that is, plants are resistant at temperatures of at least 28°C, preferably at least 30°C, more preferably at least 32°C, and most preferably at least 35°C, and that this temperature is the average temperature over a continuous period of at least one day, preferably at least two days, more preferably at least three days, even more preferably at least four days, and most preferably at least six days. The temperature may fluctuate within these continuous periods (i.e., higher temperatures during the day and lower temperatures at night), but the average is at least 28°C, and the fluctuation between the highest and lowest temperatures that yield the average is at most 1-7°C. Furthermore, the temperatures constituting the average temperature must not be lower than 27°C.
[0011] Disease symptoms and / or necrosis of TBRFV infection were not observed at all in plants composed of the combination of TBRFV and TSR resistance genes. Plants containing the TBRFV gene but lacking the TSR gene appear to be susceptible to TBRFV infection under such high-temperature conditions. The TBRFV and TSR genes appear to synergistically enhance the ability of plants to maintain complete resistance to TBRFV infection and not show necrosis under high-temperature conditions, i.e., temperatures above 28°C for at least 6 consecutive days. [Modes for carrying out the invention]
[0012] According to a preferred embodiment, the present invention relates to a plant in which the TBRFV resistance gene comprises a coding sequence having at least 90%, preferably at least 95%, more preferably at least 98%, even more preferably at least 99%, and most preferably 100% nucleotide sequence identity with SEQ ID NO: 1.
[0013] In another preferred embodiment, the present invention relates to a plant wherein a TBRFV resistance gene is present in the plant's genome in a heterozygous or homozygous manner. From experimental data, it can be concluded that the resistance is dominant and that the TBRFV resistance gene is present in the plant's genome at least in a heterozygous manner to provide resistance to TBRFV tobamovirus. Similar situations were observed in experiments with one or more TSR genes. When one or more TSR genes were present in a homozygous manner, the resistance of the plant to TBRFV virus under high-temperature conditions was significantly improved.
[0014] According to another preferred embodiment, the present invention relates to a plant wherein at least one TSR gene is present in the genome of the plant in a heterozygous or homozygous state, preferably homozygous. For example, the plant of the present invention comprises a TBRFV gene (homozygous or heterozygous), and / or a TSR-1 gene (homozygous or heterozygous), and / or a TSR-2 gene (homozygous or heterozygous), and / or a TSR-3 gene (homozygous or heterozygous), and / or a TSR-4 locus (homozygous or heterozygous).
[0015] According to another preferred embodiment, the present invention relates to a plant comprising TBRFV and TSR genes, each comprising the coding sequences of Sequence ID No. 2 (TBRFV coding sequence) and Sequence ID No. 4 (TSR-1 coding sequence), wherein both genes are present in a homozygous state.
[0016] In another preferred embodiment, the present invention relates to a plant comprising a TBRfV gene comprising the coding sequence of SEQ ID NO: 2 (TBRFV), a TSR gene comprising the coding sequence of SEQ ID NO: 4 (TSR-1), and a locus (referred to herein as the TSR4 locus) comprising another TSR gene (referred to herein as TSR4), wherein the TSR4 gene is linked to the marker sequences of SEQ ID NO: 10, SEQ ID NO: 11, and SEQ ID NO: 12, and preferably, all of the genes and loci are present in a homozygous state. Results have shown that when plants contain genes encoding the coding sequences of SEQ ID NO: 2 and SEQ ID NO: 4, and further contain a TSR4 locus linked to the marker sequences of SEQ ID NO: 10 (forward marker: TGTTAGGATGCGATATATGTAC), SEQ ID NO: 11 (reverse marker: CTGGATAGGAGTGGATTTAC), and SEQ ID NO: 12 (probe: GTTTATGTGTTAtGTTGCTATtAATGAGG), further improvements in disease resistance to TBRFV and reduction / absence of necrosis are observed at high temperatures. These improved disease and necrosis phenotypes have also been observed in plants containing the TBRVF gene (i.e., SEQ ID NO: 2) and the TSR4 gene, specifically the TSR-4 locus (linked to the marker sequences of SEQ ID NO: 10, SEQ ID NO: 11, and SEQ ID NO: 12), and further improvements exist in these plants in combination with SEQ ID NO: 4. Preferably, the improved plant contains the TBRVF, TSR-1, and TSR-4 genes and loci in a homozygous manner in its genome, and the homozygous plant is superior to the heterozygous plant in this respect.
[0017] According to a preferred embodiment, the present invention relates to a plant comprising the TSR-4 gene, wherein the TSR4 locus is linked to (cosegregated with) the marker sequences of SEQ ID NO: 10, SEQ ID NO: 11, and SEQ ID NO: 12. The TSR4 locus is preferably found to be located in the 8,500,000 bp to 10,500,000 bp (Heinz 2.40 reference genome). More preferably, the TSR-4 locus can be obtained from the Solanum pimpinellifolium plant PI 79532 (also described in Andrus CF, Reynard GB, Wade BL (1942) "Relative resistance of tomato varieties, selections, and crosses to defoliation by Alternaria and Stemphylium." US Department of Agriculture Circular 652).
[0018] According to a preferred embodiment, the present invention relates to a plant which is resistant to brown rugos fruit virus (TBRFV), tobamovirus strains Tm0, Tm1, and Tm2, preferably TBRFV.
[0019] In a preferred embodiment, the present invention relates to a plant in which the plant is resistant to a temperature of at least 28°C, preferably at least 30°C, more preferably at least 32°C, most preferably at least 35°C, the average temperature being present for at least one consecutive day, preferably at least two consecutive days, more preferably at least three consecutive days, even more preferably at least four consecutive days, most preferably at least six consecutive days, the plant is resistant to TBRFV, and does not exhibit tobamovirus disease and / or necrotic symptoms. As described above, the temperature may fluctuate within these consecutive days (i.e., higher temperatures during the day and lower temperatures at night), but the average is at least 28°C, and the fluctuation between the higher and lower temperatures that give rise to the average temperature is at most 1 to 7°C. Furthermore, the temperatures constituting the average temperature within the aforementioned consecutive days must not be lower than 27°C.
[0020] According to another preferred embodiment, the present invention relates to a plant, wherein the plant is an agrochemical plant that produces agrochemical fruits. The plant of the present invention maintains one or more agrochemical characteristics selected from the group consisting of fruit size, fruit yield, and leaf health under these high-temperature conditions.
[0021] In yet another preferred embodiment, the present invention relates to a plant in which the TBRFV resistance gene is found under accession number NCIMB 43279. NCIMB 43279, Solanum lycopersicum seeds, was deposited on November 16, 2018, with NCIMB Ltd, Ferguson Building, Craibstone Estate Bucksburn, AB21 9YA Aberdeen, United Kingdom.
[0022] The present invention, according to a second aspect, relates to plants, plant parts, tissues, cells, and / or seeds derived from the plants disclosed above.
[0023] According to a further aspect, the present invention relates to a TBRFV resistance gene in combination with at least one temperature sensitivity reduction (TSR) gene in a S. lycopersicum plant for providing resistance to tobamovirus, wherein the TBRFV gene comprises the coding sequence of SEQ ID NO: 1, and the TSR gene comprises a coding sequence selected from the group consisting of SEQ ID NO: 3 (also referred to as TSR-1), SEQ ID NO: 5 (also referred to as TSR-2), and SEQ ID NO: 7 (also referred to as TSR-3), preferably consisting of SEQ ID NO: 3, in combination with at least one temperature sensitivity reduction (TSR) gene. The at least one TSR gene may comprise a TSR4 locus comprising another TSR gene (referred to herein as TSR4), and the TSR4 gene is linked to the marker sequences of SEQ ID NO: 10, SEQ ID NO: 11, and SEQ ID NO: 12. Preferably, all of the genes and loci (TBRFV and TSR) are present in homozygosity in the plants of the present invention.
[0024] According to still another preferred embodiment, the present invention relates to a TBRFV resistance gene in combination with at least one temperature sensitivity reduction (TSR) gene, wherein the plant is resistant at a temperature of at least 28°C, preferably at least 30°C, more preferably at least 32°C, most preferably at least 35°C, and the temperature is an average temperature that is present continuously for at least 1 day, preferably continuously for at least 2 days, more preferably continuously for at least 3 days, even more preferably continuously for at least 4 days, most preferably continuously for at least 6 days, and the plant is resistant to TBRFV and does not exhibit tobamovirus disease and / or necrotic symptoms, in combination with at least one temperature sensitivity reduction (TSR) gene.
[0025] According to a further aspect, the present invention is a method for producing and / or selecting a plant of the S. lycopersicum species that is resistant to TBRFV, a) A step of selecting a first tomato plant, wherein said selection comprises constructing the presence of a TBRFV resistance gene encoding a TBRFV resistance protein in said first tomato plant, and the protein has at least 90% amino acid sequence identity with SEQ ID NO: 2, step b) A step of transferring a specified TBRFV resistance gene to a second tomato plant, for example by crossing, wherein said second tomato plant comprises at least one TSR gene encoding a TSR protein having at least 95% sequence identity with a TSR protein selected from the group consisting of SEQ ID NO: 4, SEQ ID NO: 6, and SEQ ID NO: 8, preferably SEQ ID NO: 4, step relates to a method comprising
[0026] According to a further aspect of the present invention, there is provided a method for selecting a plant of the S. lycopersicum species that is resistant to TBRFV disclosed herein, comprising selecting an S. lycopersicum plant, said selection comprising constructing the presence of a TBRFV resistance gene encoding a TBRFV resistance protein in said S. lycopersicum plant, the protein having at least 90% amino acid sequence identity with SEQ ID NO: 2, and constructing the presence of a TSR gene encoding a TSR protein having at least 95% sequence identity with a TSR protein selected from the group consisting of SEQ ID NO: 4, SEQ ID NO: 6, and SEQ ID NO: 8, preferably SEQ ID NO: 4, in said S. lycopersicum plant, relates to a method
[0027] The present invention, in a further embodiment, is a method for improving the yield of tomato production of tomato plants and / or reducing the loss of such production under conditions of TBRFV prevalence, wherein the plants are resistant to a temperature of at least 28°C, preferably at least 30°C, more preferably at least 32°C, most preferably at least 35°C, and the said temperature is the average temperature present for at least one consecutive day, preferably at least two consecutive days, more preferably at least three consecutive days, even more preferably at least four consecutive days, most preferably at least six consecutive days, and the plants are resistant to TBRFV and do not exhibit tobamovirus disease and / or necrotic symptoms, and the method comprises the step of providing plants of the S. lycopersicum species of the present invention.
[0028] In a further aspect, the present invention relates to a method for protecting tomato plant fields, tunnels, greenhouses, or glasshouses from the spread of TBRFV, and to a method for cultivating the plant species S. lycopersicum of the present invention.
[0029] The present invention, in a further embodiment, relates to the use of at least one temperature-reducing (TSR) gene in a tomato plant to reduce necrosis at a temperature of at least 28°C, preferably at least 30°C, more preferably at least 32°C, and most preferably at least 35°C, wherein the temperature is the average temperature present for at least one consecutive day, preferably at least two consecutive days, more preferably at least three consecutive days, even more preferably at least four consecutive days, and most preferably at least six consecutive days, the plant is resistant to TBRFV and does not exhibit tobamovirus disease and / or necrotic symptoms, and the at least one TSR gene comprises a sequence selected from the group consisting of SEQ ID NO: 3, SEQ ID NO: 5, and SEQ ID NO: 7, preferably a coding sequence having at least 95% sequence identity with SEQ ID NO: 3.
[0030] The present invention relates, in a further embodiment, to the use of at least one temperature-reducing (TSR) gene in a tomato plant for reducing the temperature sensitivity of the tomato plant and / or improving the vitality of the tomato plant at a temperature of at least 28°C, wherein the temperature is an average temperature present for at least one consecutive day, preferably at least two consecutive days, and the at least one TSR gene comprises a sequence selected from the group consisting of SEQ ID NO: 3, SEQ ID NO: 5, and SEQ ID NO: 7, preferably a coding sequence having at least 95% sequence identity with SEQ ID NO: 3. More preferably, the present invention relates to the use of the above-described temperature-reducing (TSR) gene in a tomato plant, wherein the tomato plant is resistant to tobamovirus, more preferably TBRFV.
[0031] According to a preferred embodiment, the present invention relates to the use in which at least one temperature-reducing (TSR) gene is combined with a TBRFV gene having a coding sequence having at least 90% nucleotide sequence identity with SEQ ID NO: 1 in a tomato plant.
[0032] In another preferred embodiment, the present invention relates to the use of a TBR FV resistance gene present in the genome of the plant in a heterozygous or homozygous, preferably homozygous, manner, and / or at least one TSR gene present in the genome of the tomato plant in a heterozygous or homozygous, preferably homozygous, manner.
[0033] The present invention will be further described in the following embodiments and drawings. [Brief explanation of the drawing]
[0034] [Figure 1]Tomato plants were treated with heat therapy at 35°C for at least 6 days, followed by a 4-5 day period at 22°C, after which the plants were scored for disease symptoms. Three hours before the start of heat therapy, the plants were inoculated with the TBRFV virus. In Figures 1A and 1B, the plants on the left are infected, while those on the right are not infected with TBRFV. Figure 1A shows a tomato plant composed of the TBRFV gene (SEQ ID NO: 1, heterozygous) and lacking the temperature-reducing-sensitivity-reducing (TSR) gene. Figure 1B shows a tomato plant composed of both the TBRFV (homozygous) and TSR genes (SEQ ID NO: 3, homozygous). The synergistic effect of the TSR gene combined with TBRFV after heat therapy is clearly visible, and healthy, vigorous plants are shown when both TBRFV and TSR are present. [Examples]
[0035] Inoculation of tomato plants with TBRFV A disease assay was performed using TBRFV isolate AE050 (originating from Saudi Arabia). Plant strain OT9, a plant strain susceptible to TBRFV, was used as the plant material for virus maintenance. Symptomatic leaves obtained from the original sample were used for mechanical foliar inoculation into strain OT9. The virus was maintained in tomato plants OT9 that were whole-infected by monthly mechanical foliar inoculation of new 3-week-old seedlings.
[0036] Tomato seeds to be infected were sown in vermiculite, and seedlings were transferred to rockwool blocks and inoculated four weeks after sowing. As starting material, symptomatic leaves derived from infected OT9 were collected and crushed in a mortar and pestle in cooled deionized water containing carborundum (1 gram / 100 mL). AE050 was mechanically inoculated into the oldest leaves of three-week-old seedlings of each test plant by gently rubbing the leaf once with one finger. The plants were phenotyped by visual scoring of the plants and leaves. The presence of yellow mosaic patterns on the leaves and leaf deformation (narrowing, spotting) was recorded; see below. Furthermore, qPCR testing was performed on the plants to determine viral infection.
[0037] Determination of TBRFV infection in tomatoes (S. lycopersicum) by qPCR qPCR was used to determine viral infection in tomato plants containing TBRFV resistance genes and / or TSR genes (both heterozygous and homozygous). Plants were infected with TBRFV and included the susceptible tomato line OT9 as a control (OT9). Three weeks after inoculation, one leaf punch (6 mm) from the top of each plant was collected in a 4 ml Micronic tube containing a 4 mm metal bullet. 2 ml of extraction buffer (buffer containing GH + 25 mM TCEP) was added, and the tube was shaken at high speed (1300 rpm) in a Seed Shaker Duo to finely grind the plant material. After centrifugation at 4,000 g for 20 minutes, RNA extraction was performed using a Hamilton Microlab Star instrument. One-step RT-qPCR (taqman) was performed using primer-probe combinations to amplify TBRFV; see Table 1 (SEQ ID NOs. 11-13).
[0038] [Table 1]
[0039] The higher the amount of viral RNA present in the sample, the lower the Ct value in qPCR. This is because fewer PCR cycles are required to amplify the cDNA (of the viral RNA) and pick up the signal. In this experiment, the control sample (OT9, uninfected) showed a Ct value of approximately 25 cycles or more. The infected control sample (OT9, infected) generally showed a Ct value of 5-15, and a Ct value of 8.9 was observed here. Therefore, plants showing a Ct value of more than 22 cycles are considered resistant, while plants showing a Ct value of less than 15 are considered susceptible. See Table 3.
[0040] Tomato plants containing the TBRFV resistance gene and / or TSR gene, whether homozygous (P) or heterozygous (H), all showed Ct values greater than 20 cycles and were considered resistant. When either gene was present in a homozygous state, improved resistance was observed, as indicated by the high Ct value. Plants without the TBRFV resistance gene and TSR gene (A) showed a Ct value of 8.9, indicating that the plants were completely susceptible to TBRFV infection.
[0041] Evaluation of disease resistance after heat treatment in tomato plants infected with TBRFV containing the TBRFV resistance gene and / or the TSR-1 gene. Plants with various genotypes, i.e., containing one or more of the resistance genes for TBRFV (SEQ ID NO: 1) and TSR (SEQ ID NO: 3), were treated with heat therapy at an average temperature of 35°C (daytime and average daytime and nighttime temperatures, temperature not lower than 27°C) for at least 6 consecutive days, followed by a period of 3-4 days at 22°C. After this, the plants were scored for disease symptoms and samples were collected for RT-qPCR. The plants were inoculated with TBRFV virus 3 hours before the start of the heat therapy.
[0042] For heat treatment, plants were placed on benches in a climate cell equipped with Son-T lights. The plants were grown in rockwool blocks and subjected to heat treatment at 4 weeks of age (three-leaf stage). While the temperature was set to a specific temperature, the temperature sometimes deviated by approximately 3°C above or below the set temperature due to the heat generated by the Son-T lights (220V, 400W) (this would reflect the more natural temperature profile inside the greenhouse). The lights were on for 12 hours per day (7:00-19:00).
[0043] The susceptible tomato variety OT9 was included as a control. Plants were classified as "resistant" if no such symptoms were observed in the leaves. Plants showing any symptoms in the leaves were classified as "susceptible." Leaf samples were collected from asymptomatic plants (i.e., resistant) and tested for the presence of the virus by qPCR (Ct value). Plants were phenotyped by visual scoring of the plants and leaves. The presence of yellow mosaic patterns in the leaves and leaf deformities (narrowing, spotting) was recorded. Necrosis was scored on a scale from 1 to 9, where 1 indicated severe necrosis and 9 indicated the absence of necrotic symptoms; see Table 2 below.
[0044] [Table 2]
[0045] The average of 12 plants was obtained to confirm the necrosis score for each group of plants tested. Tomato plants containing either homozygous or heterozygous TBRFV genes (SEQ ID NO: 1), TSR genes (SEQ ID NO: 3), or combinations thereof were included in the screening for disease resistance and necrosis after heat treatment of TBRFV-infected tomato plants. Furthermore, phenotypic results were confirmed by qPCR (Ct value, average of 6 plants) to relatively quantify the viral load in infected plants; please refer to Table 3.
[0046] [Table 3]
[0047] From the data, it can be concluded that when plants contain the TBRFV gene, the plant response is hypersensitive to TBRFV infection for at least 2-3 days at high temperatures (above 28°C). However, when plants also contain the TSR-1 gene, this hypersensitive response is strongly reduced or even absent if the TSR-1 gene is homozygous in the plant. The presence of a heterozygous TSR-1 gene combined with ToBRFV also shows reduced / absence of necrosis and improved disease response at high temperatures, suggesting that the TSR gene is semi-dominant. Plants composed of homozygous ToBRFV and homozygous TSR-1 genes showed no disease or necrotic symptoms after 10 days of heat treatment and ToBRFV inoculation, as described above. Furthermore, plants composed of the ToBRFV gene and the TSR-4 locus containing the TSR4 gene also showed improved necrosis and improved disease response (data not shown).
Claims
1. A plant of the S. lycopersicum species that is resistant to tobamovirus, wherein the plant comprises a TRBV resistance gene encoding a TRBV resistance protein, the protein having at least 90% amino acid sequence identity with SEQ ID NO: 2, and the plant further comprises at least one TSR gene encoding a TSR protein having at least 95% sequence identity with a temperature-reducing (TSR) protein selected from the group consisting of SEQ ID NO: 4, SEQ ID NO: 6, and SEQ ID NO: 8, preferably SEQ ID NO:
4.
2. The plant according to claim 1, wherein the TBRFV resistance gene comprises a coding sequence having at least 90% nucleotide sequence identity with SEQ ID NO:
1.
3. The plant according to claim 1 or 2, wherein the TBRFV resistance gene is present in the plant genome in a heterozygous or homozygous state, preferably homozygous.
4. The plant according to any one of claims 1 to 3, wherein the at least one TSR gene is present in the plant genome in a heterozygous or homozygous state, preferably homozygous.
5. The plant according to any one of claims 1 to 4, wherein the plant comprises the TBRFV and TSR genes, each containing the coding sequences of SEQ ID NO: 2 and SEQ ID NO: 4, and both genes are present in a homozygous state.
6. The plant according to any one of claims 1 to 5, wherein the plant is resistant to brown rugos fruit virus (TBRFV), tobamovirus strains Tm0, Tm1, and Tm2, preferably TBRFV.
7. The plant according to any one of claims 1 to 6, wherein the plant is resistant to a temperature of at least 28°C, preferably at least 30°C, more preferably at least 32°C, most preferably at least 35°C, and the temperature is the average temperature at which the plant exists for at least one consecutive day, preferably at least two consecutive days, more preferably at least three consecutive days, even more preferably at least four consecutive days, most preferably at least six consecutive days, and the plant is resistant to TBRFV and does not exhibit tobamovirus disease and / or necrotic symptoms.
8. The plant according to any one of claims 1 to 7, wherein the plant is an agricultural plant that produces agricultural fruits.
9. The plant according to any one of claims 1 to 8, wherein the TBRFV resistance gene is found in accession number NCIMB 43279.
10. A plant, plant part, tissue, plant cell, and / or seed derived from a plant according to any one of claims 1 to 9.
11. A TBRFV resistance gene in which at least one temperature-reducing (TSR) gene is combined with at least one temperature-reducing (TSR) gene to provide resistance to tobamovirus in the plant S. lycopersicum, wherein the TBRFV gene comprises the coding sequence of SEQ ID NO: 1, and the TSR gene comprises a coding sequence selected from the group consisting of SEQ ID NO: 3, SEQ ID NO: 5, and SEQ ID NO: 7, preferably SEQ ID NO:
3.
12. A TBRFV resistance gene combined with at least one temperature-reducing (TSR) gene according to claim 11, wherein the plant is resistant to a temperature of at least 28°C, preferably at least 30°C, more preferably at least 32°C, most preferably at least 35°C, the average temperature at which the plant is present for at least one consecutive day, preferably at least two consecutive days, more preferably at least three consecutive days, even more preferably at least four consecutive days, most preferably at least six consecutive days, and the plant is resistant to TBRFV and does not exhibit tobamovirus disease and / or necrotic symptoms.
13. A method for producing a plant of the S. lycopersicum species that is resistant to TBRFV according to any one of claims 1 to 9, a) A step of selecting a first tomato plant, wherein the selection includes establishing the presence of a TBR RIV resistance gene encoding a TBR RIV resistance protein in the first tomato plant, and the protein having at least 90% amino acid sequence identity with SEQ ID NO:
2. b) A step of transferring a identified TBRFV resistance gene to a second tomato plant, for example by crossbreeding, wherein the second tomato plant contains at least one TSR gene encoding a TSR protein having at least 95% sequence identity with a TSR protein selected from the group consisting of SEQ ID NO: 4, SEQ ID NO: 6, and SEQ ID NO: 8, preferably SEQ ID NO:
4. Methods that include...
14. A method for selecting a plant of the S. lycopersicum species that is resistant to TBRFV according to any one of claims 1 to 9, comprising the selection of a S. lycopersicum plant, wherein the selection involves constructing the presence of a TRBV resistance gene encoding a TRBV resistance protein in the S. lycopersicum plant, the protein having at least 90% amino acid sequence identity with SEQ ID NO: 2, and the presence of a TSR gene encoding a TSR protein having at least 95% sequence identity with a TSR protein selected from the group consisting of SEQ ID NO: 4, SEQ ID NO: 6, and SEQ ID NO: 8, preferably SEQ ID NO: 4, in the S. lycopersicum plant.
15. A method for reducing tomato production loss of tomato plants under conditions of TBRFV spread, wherein the tomato plants are resistant to a temperature of at least 28°C, the temperature being the average temperature present for at least one consecutive day, preferably at least two consecutive days, and the method comprises the step of providing a plant of the S. lycopersicum species as described in any one of claims 1 to 9.
16. The use of at least one temperature-reducing (TSR) gene in tomato plants to reduce necrotic symptoms at a temperature of at least 28°C, wherein the temperature is an average temperature present for at least one consecutive day, preferably at least two consecutive days, and the at least one TSR gene comprises a sequence selected from the group consisting of SEQ ID NO: 3, SEQ ID NO: 5, and SEQ ID NO: 7, preferably a coding sequence having at least 95% sequence identity with SEQ ID NO:
3.
17. The use according to claim 16, wherein the at least one temperature-reducing (TSR) gene is combined with a TBRFV gene having a coding sequence having at least 90% nucleotide sequence identity with SEQ ID NO: 1 in the tomato plant.
18. The use according to claim 16 or 17, wherein the TBR FV resistance gene is present in the genome of the plant in a heterozygous or homozygous state, preferably homozygous, and / or the at least one TSR gene is present in the genome of the tomato plant in a heterozygous or homozygous state, preferably homozygous.