Method for producing yeast products using high-lactic acid industrial by-products
A fermentation method using high-lactic acid industrial by-products produces high-protein yeast products, addressing resource utilization and environmental issues while reducing costs and molasses dependency.
Patent Information
- Authority / Receiving Office
- JP · JP
- Patent Type
- Applications
- Current Assignee / Owner
- ANGEL YEAST CO LTD
- Filing Date
- 2023-12-22
- Publication Date
- 2026-05-15
AI Technical Summary
The challenge lies in effectively utilizing high-lactic acid industrial by-products such as corn steep liquor, soluble distillers dried grains with solubles, baijiu yellow water, and kimchi water, which are rich in nutrients but difficult to treat, leading to environmental pollution and resource wastage, while also addressing the scarcity of molasses as a raw material for yeast production.
A method involving the fermentation of yeast using high-lactic acid industrial by-products, including steps of inoculating activated yeast strains into primary and secondary seed media, utilizing a fermentation medium containing these by-products, and producing yeast products through separation or drying, with the addition of nutrients like trace elements and vitamins to enhance growth and efficiency.
This method enables the production of high-protein yeast products that can serve as nitrogen sources for antibiotic fermentation, reduces production costs, and effectively utilizes these by-products, alleviating environmental concerns and molasses shortages.
Smart Images

Figure 2026515319000001_ABST
Abstract
Description
Technical Field
[0001] (Cross - reference to Related Applications) This application claims the priority of a prior application, Chinese Patent Application No. 202310540113.X, filed with the China National Intellectual Property Administration on May 13, 2023, and incorporates all of its contents herein.
[0002] (Technical Field) The present invention relates to the technical field of yeast fermentation, and specifically to a method for producing yeast products using high - lactic - acid industrial by - products.
Background Art
[0003] Corn steep liquor is a by - product of corn starch production, a water - soluble substance obtained during the process of soaking corn. Corn steep liquor is rich in soluble proteins, growth factors and some precursors, and contains approximately 40 - 50% dry matter. Corn soaking water is high - concentration organic wastewater and cannot be directly discharged into the sewage treatment plant. In corn deep - processing enterprises, corn soaking water is generally concentrated into corn steep liquor and sprayed onto corn fiber or corn germ meal to produce spray - dried fiber or spray - dried germ meal. During the evaporation and drying process, the energy consumption is high, the added value is low, and the remaining corn steep liquor is used as an organic nitrogen source medium for the fermentation industry. In recent years, the processing volume in corn deep - processing enterprises has been growing rapidly, and corn steep liquor is in a serious oversupply situation. Since enterprises need to add freight to process corn steep liquor, the growth of corn deep - processing enterprises is greatly restricted.
[0004] Soluble distillers dried grains with solubles (DDGS) is the production waste liquid remaining after distilling alcohol from the alcohol fermentation residue of corn, mainly composed of protein and also containing fat, sugars, vitamins, etc. The distillers' solubles liquor is rich in nutrients, but the difficulty of treating soluble distillers dried grains with solubles waste liquid is very high and the related costs are high.
[0005] Yellow water (Huangshui) is a small amount of water that flows to the bottom of the liquor (distillation raw materials) during the baijiu brewing process due to gravity. This water, along with the alcohol, aldehydes, acids, esters, minerals, reducing sugars, and amino acids dissolved in it, eventually settles at the bottom of the cellar and turns into a brown liquid over time. Disposing of it as is would not only waste resources but also risk polluting the environment.
[0006] Kimchi water is industrial wastewater rich in lactic acid left over from the production of kimchi. Discharging it as is would cause environmental pollution, but it is difficult to treat. On the other hand, during the fermentation process of kimchi, some nutrients, such as lactic acid, vitamins, calcium, and phosphorus, are released into the kimchi water. Discharging it as is would not only cause environmental pollution, but some of these nutrients would also be wasted.
[0007] Industrial by-products such as corn steep liquor, soluble corn distillate residue, baijiu yellow water, or kimchi water are rich in soluble proteins, trace elements, lactic acid, and vitamins. Of these, all contain over 3% lactic acid, making them high-lactic-acid industrial by-products. How to utilize these resources and reduce pollution problems for businesses has become a pressing need for those involved.
[0008] Yeast products are obtained by fermenting and cultivating yeast in specific systems and are widely used in the food, brewing, pharmaceutical, and animal feed industries. This process requires the supply of nutrients and their conversion into cells and metabolites. Molasses is a necessary raw material for yeast production; it not only provides the carbon source required by yeast, but the many trace elements and minerals it contains are also essential for yeast growth. In recent years, with the active development of the yeast industry, competition for molasses raw materials has intensified. Finding inexpensive and effective new culture medium ingredients to secure sufficient production materials and reduce the cost of yeast production has become one of the directions for the development of the yeast industry.
[0009] Chinese Patent Application Publication No. 113455584 discloses a method for producing feed yeast granules using corn steep liquor, which includes activating the yeast species, preparing a seed solution, and obtaining a fermented liquid by production in a fermenter, and then obtaining a feed yeast granule product by multiple-effect evaporation concentration and spray granulation onto a fluidized bed, wherein one or two yeast species are selected from Saccharomyces cerevisiae, Torula yeast (Candida utilis), or baker's yeast, and corn steep liquor is used as the fermentation medium. The feed yeast product produced by this method has a crude protein content of 50% or more and a total of 18 amino acids of 46% or more, thus meeting the requirements for feed yeast. However, the product contains a large amount of unconverted corn steep liquor as an impurity, and therefore can only be used as feed and cannot be used as a nitrogen source for microbial fermentation or in the production of high-value yeast extracts. [Overview of the project] [Problems that the invention aims to solve]
[0010] The technical problems that this invention aims to solve are as follows: This invention provides a method for producing yeast using a high-lactic acid industrial by-product, which allows for the production of high-protein yeast protein that can be used as a nitrogen source for antibiotic fermentation, or further, the production of yeast extract to provide an organic nitrogen source for a wider range of microbial fermentations, while also enabling the rational utilization of resources. [Means for solving the problem]
[0011] To achieve the above objectives, the present invention provides the following technical solutions. This application is, (1) A step of inoculating the activated yeast strain into a primary seed medium and fermenting it to obtain a primary seed liquid, wherein the yeast strain is selected from one or more species from Cluyberomyces marcyanas, Cluyberomyces lactis, Pichia cudriabzebi and Candida tropicalis, (2) The step of obtaining a secondary seed solution by inoculating the primary seed solution into a secondary seed medium and fermenting it, (3) A step of inoculating a secondary seed liquid into a fermentation medium and fermenting it, wherein the fermentation medium contains a by-product of the high-lactic acid industry and / or a modified product of the high-lactic acid industry. (4) A method for producing a yeast product using a high-lactic acid industrial by-product is provided, comprising the steps of (4) separating the fermentation liquid from step (3) to obtain a yeast product, or drying the fermentation liquid from step (3) to obtain a yeast product.
[0012] In some embodiments of the present application, the high lactic acid industrial by-product described in step (3) of the above method comprises one or more of corn steep liquor, soluble corn distillate residue, baijiu yellow water, or kimchi water, and is preferably corn steep liquor.
[0013] In some embodiments of the present application, the fermentation medium further contains nutrients, wherein the nutrients include trace elements and vitamins.
[0014] In some embodiments of the present application, the trace element is selected from copper, calcium, iron, zinc, magnesium, and potassium, one or more of which are preferably copper and / or calcium, and the vitamin is selected from vitamin B1, vitamin B2, vitamin B3, vitamin B6, pantothenic acid, and vitamin B7, one or more of which are preferably vitamin B1, pantothenic acid, and vitamin B7.
[0015] In some embodiments of the present application, the nutrients, on a basis of total weight of the fermentation medium, include one or more of the following: 2-5 ppm copper, 400-1000 ppm calcium, 10-30 ppm vitamin B1, 15-30 ppm pantothenic acid, and 0.5-1.5 ppm vitamin B7.
[0016] In some embodiments of the present application, the above method includes the step of preparing the modified product of the high-lactic acid industrial by-product by cellulase enzymatic degradation, protease enzymatic degradation, and enzymatic inactivation of the high-lactic acid industrial by-product.
[0017] In some embodiments of the present application, in the above method, based on the dry weight of the high-lactic acid industrial by-product, the addition amount of the cellulase is 3 to 6 wt‰, preferably 4 to 6 wt‰. Preferably, the temperature of cellulase enzymatic hydrolysis is 55 to 65 °C, and preferably, the enzymatic hydrolysis time is 3 to 6 hours.
[0018] In some embodiments of the present application, in the above method, based on the dry weight of the high-lactic acid industrial by-product, the addition amount of the protease is 2 to 4 wt‰, preferably 2 to 3 wt‰. Preferably, the temperature of protease enzymatic hydrolysis is 55 to 65 °C, and preferably, the enzymatic hydrolysis time is 3 to 6 hours.
[0019] In some embodiments of the present application, in the above method, the enzyme inactivation includes heating to 70 to 90 °C and holding for 20 to 40 minutes.
[0020] In some embodiments of the present application, in the above method, in the fermentation culture described in step (3), a stirring fermentation tank is used, provided that the stirring rotation speed is 400 to 600 rpm, preferably, the aeration ratio is 1:1 to 2, or In the fermentation culture described in step (3), an air-lift type fermentation tank is used, provided that the aeration ratio is 1:10 to 70. Preferably, the fermentation culture temperature is 25 to 35 °C, and preferably, the culture time is 12 to 48 hours.
[0021] In some embodiments of the present application, in the above method, the separation described in step (4) includes one or more of centrifugal separation, suction filtration, pressure filtration, or plate and frame filter press, preferably centrifugal separation. More preferably, the rotation speed of the centrifugal separation is 3000 to 10000 rpm, and preferably, the centrifugal separation time is 5 to 20 minutes.
[0022] In some embodiments of the present application, in the above method, the method further includes washing and / or drying the yeast product obtained by the separation described in step (4).
[0023] In some embodiments of the present application, in the above method, in step (1), the primary seed medium is a YPD liquid medium. Preferably, the temperature of the fermentation culture in step (1) is 25 to 35 °C. Preferably, the fermentation culture time is 12 to 30 hours. More preferably, the rotation speed is 150 to 220 rpm.
[0024] In some embodiments of the present application, in the above method, based on the mass-volume percentage, in step (2), the secondary seed medium contains 5 to 8% glucose, 0.3 to 0.6% yeast extract, 1 to 2% ammonium sulfate, 0.2 to 0.4% zinc sulfate, 0.4 to 0.6% potassium dihydrogen phosphate, and 0.4 to 0.6% magnesium sulfate. Preferably, the temperature of the fermentation culture in step (2) is 25 to 35 °C. Preferably, the culture time is 12 to 36 hours. More preferably, the pH of the fermentation culture is 4.5 to 5.5. Preferably, the ventilation rate is 2 to 4 L / min.
[0025] The present application also provides a yeast product produced by the above method. Based on the weight percentage, the yeast product contains 30 to 68%, preferably 50 to 68% protein. Preferably, the yeast product contains 1.5 to 9.0% trehalose. More preferably, the yeast product contains 2.0 to 4.0% diphosphorus pentoxide.
[0026] In some embodiments of the present application, the form of the yeast product is powdery, paste-like or liquid.
[0027] The present application also provides the use of the above yeast product in feed protein, food seasoning or nitrogen source for fermentation industry.
Advantages of the Invention
[0028] The beneficial effects of the present invention are as follows. When yeast products are produced using the method of the present invention, the fermentation process is stable, production efficiency is high, and products of consistent quality are produced. Compared to conventional methods that use molasses to produce yeast, the method of the present invention is equivalent to conventional methods in terms of production efficiency and quality, while the cost is far lower. Therefore, the method of the present invention enables the industrial application of yeast production using high-lactic acid industrial by-products, increases the supply routes for yeast-derived sugar resources, expands the range of use for high-lactic acid industrial by-products, and alleviates the problem of molasses resource shortages in the yeast industry.
[0029] (Strain deposit information) The fungal species Kluyveromyces marxianus AMCC 30634 used in this application was deposited with the China Center for Typical Cultures Depository on February 27, 2023, with deposit number CCTCC NO:M 2023217, the depositary institution is Wuhan University, Wuhan, China, postal code 430072, and telephone number (027)-68754052.
[0030] Kluyveromyces Marxianus AMCC 31342, obtained by mutagenesis in this application, was deposited with the China Center for Typical Cultures Depository (CCTCC) on December 30, 2022, with depositary number CCTCC NO:M 20222110, depositary institution Wuhan University, Wuhan, China, postal code 430072, and telephone number (027)-68754052.
[0031] The Saccharomyces cerevisiae FX-2 used in this application was deposited with the China Center for Typical Cultures Depository (CCTCC) on August 1, 2016, with deposit number CCTCC NO:M 2016418, the depositary institution is Wuhan University, Wuhan, China, with postal code 430072 and telephone number (027)-68754052 (the said Saccharomyces cerevisiae FX-2 is described in the patent application Chinese Patent Application No. 201710532216.6 (Chinese Patent Application Publication No. 109207384)).
[0032] The Pichia kudriavzeii C4.12 used in this application was deposited with the China Center for Typical Cultures Depository (CCTCC) on January 21, 2021, with deposit number CCTCC NO:M 2021124, depositary institution Wuhan University, Wuhan, China, postal code 430072, and telephone number (027)-68754052 (this Pichia kudriavzeii C4.12 strain is described in the Chinese Patent Application No. 202111509846.4 (Chinese Patent Application Publication No. 114107077)).
[0033] The Kluyveromyces lactis AMCC 31347 used in this application was deposited with the China Center for Typical Cultures Depositary (CCTCC) on February 27, 2023, with deposit number CCTCC NO:M 2023218, deposited by Wuhan University in Wuhan, China, with postal code 430072 and telephone number (027)-68754052. [Brief explanation of the drawing]
[0034] [Figure 1] Figure 1 shows the morphology of a colony of Cluyveromyces marsianus AMCC 30634. [Figure 2] Figure 2 shows the morphology of Kluiveromyces marcyanas AMCC 30634 under a microscope. [Figure 3]Figure 3 shows the wet weight change curve for the culture of Streptomyces abermitilis using yeast as the nitrogen source in Experimental Example 1. [Figure 4] Figure 4 shows the growth curve of the culture of E. coli using yeast extract as a nitrogen source in Experimental Example 2. [Modes for carrying out the invention]
[0035] To make the object, technical solution, and technical effect of the embodiments of the present invention clearer, the technical solution of the embodiments of the present invention will be described clearly and completely. The embodiments described below are not all embodiments of the present invention, but only a few. All other embodiments obtained by those skilled in the art based on the embodiments of the present invention without performing inventive work are within the scope of the protection of the present invention.
[0036] The mass-volume percentage described in this application refers to the mass content of a substance in 100 mL of solution, i.e., 1% = 1 g / 100 mL.
[0037] The ppm values used in this application represent weight percentages.
[0038] This application provides Kluyveromyces marxianus AMCC31342, whose deposit number is CCTCC NO:M 20222110. This Kluyveromyces marxianus has excellent resistance to organic acids and can grow using lactic acid as a carbon source.
[0039] In this application, the above-mentioned *Cluyveromyces marcyanas*, with deposit number CCTCC NO:M 20222110, was obtained by mutagenesis using strain AMCC 30634, with deposit number CCTCC NO:M 2023217, as the starting strain. The starting strain refers to the original strain used for breeding.
[0040] The strain described in this application, with deposit number CCTCC NO:M 2023217, is a strain isolated from a fermented dairy product sample from the Tibet Autonomous Region. This strain has excellent resistance to organic acids, can grow using lactic acid as a carbon source, and is also tolerant to low pH.
[0041] In this application, the ITS sequence of the above-mentioned strain with deposit number CCTCC NO:M 2023217 is shown in Sequence ID No. 3 and is as follows. CCAACGGGGATTGCCTTAGTACGGCGAGTGAAGCGGCAAAAGCTCAAATTTGAAATCTGGCGTCTTCGACGTCCGAGTTGTAATTTGAAGAAGGCGACTTTGTAGCTGGTCCTTGTCTATGTTCCTTGGAACAGGACGTC ATAGAGGGTGAGAATCCCGTGTGGCGAGGATCCCAGTTATTTGTAAAGTGCTTTCGACGAGTCGAGTTGTTTGGGAATGCAGCTCTAAGTGGGTGGTAAATTCCATCTAAAGCTAAATATTGGCGAGAGACCGATAGCGAA CAAGTACAGTGATGAAAGATGAAAAGAACTTTGAAAAGAGAGTGAAAAAGTACGTGAAATTGTTGAAAGGGAAGGGCATTTGATCAGACATGGCGTTTGCTTCGGCTTTCGCTGGGCCAGCATCAGTTTTAGCGGTTGG ATAAATCCTCGGGAATGTGGCTCTGCTTCGGTAGAGTGTTATAGCCCGTGGGAATACAGCCAGCTGGGACTGAGGATTGCGACTTTTGTCAAGGATGCTGGCGTAATGGTTAAATGCCGCCCGTCTTGAACCCACGGACCA
[0042] This application also provides Kluiveromyces lactis AMCC 31347, the deposit number of which Kluiveromyces lactis is CCTCC NO:M 2023218. This Kluiveromyces lactis has excellent resistance to organic acids and can be grown using lactic acid as a carbon source.
[0043] The bacterial strain with deposit number CCTCC NO:M 2023218 described in this application is a strain isolated from a fermented dairy product sample from Inner Mongolia.
[0044] In this application, the ITS sequence of the above-mentioned strain with deposit number CCTCC NO:M 2023218 is shown in Sequence ID No. 4 and is as follows. TCCGGGGAATCTACCTGATTTGAGGTCAACTTTGAGAGTTTTGATTAAGCCGTATGCCTCAAGGAGACAAACACCAGCGAGTCTTTATAACACCTATAAGCTCATTGACCCTAGCTTACCACGAATTGGCGCAAACCTAAGACGTAGATGTGCAAGAGTCGAGTCCATAGACTTGACAC GCAGCCCTGCTCACGCAGAAGGCAACGGCTAGCCACTTTCAAGTTAACCCGAAAAACGAGTATCACTCACTACCAAACCCAAAGGTTTGAGAGAGAAATGACGCTCAAACAGGCATGCCCCCTGGAATACCAGAGGGCGCAATGTGCGTTCAAAGATTTGATGATTCACGAAAATCTGC AATTCACAATACATATCGCAATTCGCTGCGTTCTTCATCGATGCGAGAACCAAGAGATCCGTTGTTGAAAGTTTTGAATATTAAATTTCTTGATAAATAGTTTTTCATAATGCAAAATGTTGTTTGTGTTTATGTCCACTGGAGAGACGAGCTCTCCAGGGAAGTAGTTCATAGAGAAA AAACTCCATTGTGTTTAGGATGAGAGAAAGAAAACTGATAGCAGAAAATCAAGAATTAGCCGCGCAATTAAGCGCAGGCCATATTCAGCGATTCCCCAGTAATCTACTCATTCATAATCTTTAATGATCCTTCCGCAGGTTCACCTACGGAAACCTTGTTACGATTTTTTACCTCCAA
[0045] In this invention, the ITS sequence is located in the rDNA gene, and the 5.8S rDNA and 28S rDNA gene spacer sequences are called ITS. Because their length and sequence vary significantly, different biotypes, strains, species, and genera of fungi can be classified and identified by RFLP or sequence analysis of their amplification products. It may also be used to distinguish between very closely related species.
[0046] This invention primarily involves obtaining pure cultured yeast cells by fermenting a specific yeast species using a high-lactic acid industrial by-product as a substrate.
[0047] In the first aspect, in a specific embodiment of the present application, the present invention is: (1) A step of inoculating the activated yeast strain into a primary seed medium and fermenting it to obtain a primary seed liquid, wherein the yeast strain is selected from one or more species from Cluyberomyces marcyanas, Cluyberomyces lactis, Pichia cudriabzebi and Candida tropicalis, (2) The step of obtaining a secondary seed solution by inoculating the primary seed solution into a secondary seed medium and fermenting it, (3) A step of inoculating a secondary seed liquid into a fermentation medium and fermenting it, wherein the fermentation medium contains a by-product of the high-lactic acid industry and / or a modified product of the high-lactic acid industry. (4) A method for producing a yeast product using a high-lactic acid industrial by-product is provided, comprising the steps of (4) separating the fermentation liquid from step (3) to obtain a yeast product, or drying the fermentation liquid from step (3) to obtain a yeast product.
[0048] In this invention, the biphase separated in step (4) is a yeast product.
[0049] In some embodiments of the present invention, the temperature of the fermentation culture described in step (3) is 25 to 35°C, and preferably the culture time is 12 to 48 hours.
[0050] For example, the fermentation culture temperature may be 25°C, 28°C, 33°C, 35°C, etc., and the fermentation time may be 12 hours, 24 hours, 36 hours, 48 hours, etc., or a value within a numerical range configured with any two of the above specific numerical values as endpoints.
[0051] The fermenter used in the fermentation culture described in step (3) is not particularly limited and may be a stirred fermenter or an air-lift fermenter. When using a stirred fermenter, the stirring speed is 400 to 600 rpm, and preferably the aeration ratio is 1:1 to 2. If the rotation speed and aeration ratio fall below this range, the dissolved oxygen in the fermentation liquid will be insufficient, affecting yeast growth and ultimately resulting in a low wet weight. However, if the rotation speed and aeration ratio exceed this range, energy and compressed air will be wasted, and foaming and leakage are more likely to occur during the fermentation process, increasing the risk of microbial contamination. When using an air-lift fermenter, the aeration ratio is 1:10 to 70.
[0052] In this invention, "high lactic acid industrial by-products" refers to industrial by-products and their processed products having a mass percentage lactic acid content of 3% or more, and includes, but is not limited to, corn steep liquor, a by-product of corn starch production; soluble corn distillate, a by-product of alcohol production; and baijiu yellow water or kimchi water, a by-product of baijiu brewing.
[0053] In some embodiments of the present application, the yeast strain is selected from one or more species from Kluyveromyces marxianus, deposit number CCTCC NO:M 20222110; Kluyveromyces lactis, deposit number CCTCC NO:M 2023218; Pichia kudriavzeii C4.12, deposit number CCTCC NO:M 2021124; and Candida tropicalis CGMCC 2.0588.
[0054] In some embodiments of the present application, the steps include preparing a modified product of a high-lactic acid industrial by-product by modifying the high-lactic acid industrial by-product in order to improve the content of sugars and amino acids in the fermentation liquid and allow the yeast to absorb and convert them better, thereby improving fermentation efficiency and the quality of the yeast product, and the step of preparing a modified product of a high-lactic acid industrial by-product is a. Dissolve the high-lactic acid industrial byproduct in water at a concentration of 10-20% (w / v), then add 3-6‰ of cellulase based on the dry weight of the high-lactic acid industrial byproduct, and incubate at 55-65°C for 3-6 hours. b. Next, add 2-4‰ of protease (based on the dry weight of the high-lactic acid industrial by-product) and incubate at 55-65°C for 3-6 hours. c. The process includes the step of raising the temperature to 70-90°C and performing enzyme inactivation for 20-40 minutes.
[0055] For example, based on the dry weight of the high-lactic acid industrial by-product, the amount of cellulase added may be 3‰, 4‰, 5‰, 6‰, or a value within a numerical range configured with any two of the aforementioned specific values as endpoints, and the time for cellulase enzymatic degradation may be 3 hours, 4 hours, 5 hours, 6 hours, or a value within a numerical range configured with any two of the aforementioned specific values as endpoints.
[0056] For example, based on the dry weight of the high-lactic acid industrial by-product, the amount of protease added may be 2‰, 2.5‰, 3‰, 3.5‰, 4‰, or a value within a numerical range constructed with any two of the aforementioned specific values as endpoints, and the time for protease enzymatic degradation may be 3 hours, 4 hours, 5 hours, 6 hours, or a value within a numerical range constructed with any two of the aforementioned specific values as endpoints.
[0057] The inventors have diligently studied the characteristics of high-lactic acid industrial by-products and have found that by adding nutrients to high-lactic acid industrial by-products and designing a formulation, it is possible to promote yeast growth and improve fermentation efficiency and the quality of yeast products. In one embodiment of the present invention, the fermentation medium further contains nutrients, wherein the nutrients include trace elements and vitamins, and the trace elements are selected from copper, calcium, iron, zinc, magnesium, and potassium, one or more of which are preferably copper and / or calcium, more preferably copper and calcium, and the vitamins are selected from vitamin B1, vitamin B2, vitamin B3, vitamin B6, pantothenic acid, and vitamin B7, one or more of which are preferably vitamin B1, pantothenic acid, and vitamin B7, more preferably vitamin B1, pantothenic acid, and vitamin B7.
[0058] In some embodiments of the present application, the nutrients, on a basis of total weight of the fermentation medium, include one or more of the following: 2-5 ppm copper, 400-1000 ppm calcium, 10-30 ppm vitamin B1, 15-30 ppm pantothenic acid, and 0.5-1.5 ppm vitamin B7, preferably including 2-5 ppm copper, 400-1000 ppm calcium, 10-30 ppm vitamin B1, 15-30 ppm pantothenic acid, and 0.5-1.5 ppm vitamin B7.
[0059] For example, based on the total weight of the fermentation medium, the mass content of copper may be 2 ppm, 3 ppm, 4 ppm, 5 ppm, etc., or a value within a numerical range constructed with any two of the above specific values as endpoints; the mass content of calcium may be 400 ppm, 500 ppm, 600 ppm, 700 ppm, 800 ppm, 900 ppm, 1000 ppm, etc., or a value within a numerical range constructed with any two of the above specific values as endpoints; and the mass content of vitamin B1 may be 10 ppm, 15 ppm, 20 ppm, 2 The mass content of pantothenic acid may be 15 ppm, 20 ppm, 25 ppm, 30 ppm, or any value within a numerical range configured with any two of the aforementioned specific values as endpoints. The mass content of vitamin B7 may be 0.5 ppm, 0.7 ppm, 1.0 ppm, 1.2 ppm, 1.5 ppm, or any value within a numerical range configured with any two of the aforementioned specific values as endpoints.
[0060] In some embodiments of the present application, the step of further purifying the yeast product is to wash and / or dry the biphase obtained by centrifugation in step (4) with pure water.
[0061] In this invention, the activation medium for the bacterial species, the primary seed medium, the secondary seed medium, and the culture conditions are not particularly limited, and any medium and culture conditions that are suitable for the growth of yeast species and are well known in this field are acceptable.
[0062] In some embodiments of the present application, in step (1), the primary seed medium is YPD liquid medium, preferably the fermentation culture temperature is 25-35°C, preferably the fermentation culture time is 12-30 hours, and more preferably the stirring speed is 150-220 rpm.
[0063] In some embodiments of the present application, the secondary seed medium in step (2) comprises, on a mass-volume percentage basis, 5-8% glucose, 0.3-0.6% yeast extract, 1-2% ammonium sulfate, 0.2-0.4% zinc sulfate, 0.4-0.6% potassium dihydrogen phosphate, and 0.4-0.6% magnesium sulfate, preferably the fermentation culture temperature is 25-35°C, preferably the culture time is 12-36 hours, more preferably the pH of the fermentation culture is 4.5-5.5, and preferably the aeration rate is 2-4 L / min.
[0064] In a second aspect, the present application also provides a yeast produced using the above method, which contains 30-68%, preferably 50-68%, of protein, preferably the yeast product contains 1.5-9.0% trehalose, and more preferably the yeast product contains 2.0-4.0% phosphorus pentoxide.
[0065] The form of the yeast product of the present invention is not particularly limited, and may be, for example, liquid, powder, or paste.
[0066] In a third aspect, the present application also provides the use of the above-mentioned yeast products in feed proteins, food flavorings, or nitrogen sources for industrial fermentation. The industrial fermentation nitrogen sources include, but are not limited to, yeast extracts.
[0067] Specifically, the above yeast products may be used as a nitrogen source for industrial fermentation as is, or they may be further processed into yeast extracts. It should be understood that yeast extracts refer to powdered, paste-like, or liquid products obtained by using fresh yeast as a raw material, inducing many of the yeast's own enzyme systems by utilizing modern biotechnology or by changing the culture environment, adding (or not adding) some foreign enzymes, decomposing intracellular proteins and nucleic acid substances under appropriate conditions, and then undergoing several purification steps.
[0068] The above yeast products can also be used as feed protein sources to improve the daily feed intake, daily weight gain, and feed-to-body weight ratio of animals.
[0069] The above yeast products may be further processed into yeast extract and used in the food seasoning field to enhance the umami flavor of food.
[0070] The beneficial effects of the method for producing yeast products using high-lactic acid industrial by-products described in this application will be further explained with specific examples below.
[0071] For information on the raw materials and apparatus used in the examples and comparative examples of this application, please refer to Table 1. Table 1: Raw materials used in the examples and comparative examples of the present invention [Table 1]
[0072] (Example 1) (Screening, identification methods, and identification results for *Cluiveromyces marcianas*) Fermented dairy product samples collected in Tibet were dissolved in sterile water and mixed uniformly. The bacterial suspension was then aspirated and subjected to a 10-fold series dilution. -5 , 10 -6A bacterial suspension was prepared, spread onto YPD medium, and incubated at 30°C for 24-48 hours. Slides were prepared and the yeast morphology was observed under a microscope, the results of which are shown in Figure 1. The characteristics of a single colony on the plate were also observed, the results of which are shown in Figure 2. As can be seen from Figures 1 and 2, the yeast strain colonies had a cheese-like texture, were milky white in color, had a smooth surface, had orderly edges, and exhibited oval microscopic morphology and budding reproduction. These were streaked, purified twice, inoculated onto YPD slant medium, and stored at 4°C. The yeast strain genome was extracted, and the yeast ITS sequence was amplified using ITS1 (5'-TCCGTAGGTGAACCTGCGG-3', SEQ ID NO: 1) and ITS4 (5'-TCCTCCGCTTATTGATATGC-3', SEQ ID NO: 2) as primers. After detection by 1% gel electrophoresis and sequencing, a Blast comparative analysis was performed with the GenBank sequence. Sequences with a similarity of more than 99% were identified as the same species. Morphological analysis and molecular identification revealed that the strain was Kluyveromyces marxianus, strain number AMCC 30634, where AMCC is an abbreviation for Angel Microbiological Culture Collection Center. Its ITS sequence is shown in SEQ ID NO: 3. This strain was deposited with the China Typical Culture Depository Center on February 27, 2023, with deposit number CCTCC NO:M It is 2023217.
[0073] (Mutation in Cluiveromyces marcianas) The strain AMCC 30634 obtained above was inoculated at a 2% dose into a test tube containing 5 mL of YPD liquid, incubated at 30°C and 180 rpm for 20 hours, centrifuged to collect the cells, washed with ddH2O, and the number of viable cells was approximately 5 × 10⁶. 7The mixture was resuspended to a CFU / mL concentration, 10 μL was aspirated and added dropwise to an iron plate, then uniformly spread. Mutagenesis was induced under the following conditions: treatment distance of 2 mm, treatment power of 120 W, gas flow rate of 10 SLM, spotting volume of 10 μL, and irradiation times of 0, 5, 10, 15, 20, 25, and 30 seconds, respectively. Next, it was uniformly mixed in 1 mL of physiological saline, and after gradient dilution, 0.1 mL was aspirated and spread onto YPD solid medium. It was incubated at 30°C for 48 hours, and the mortality rate was measured using the standard method in this field. From plates with a mortality rate exceeding 98%, 98 strains with colony size superior to that of the starting strain were selected, and single colonies were inoculated into YPD medium for activation. All 98 strains were mutagenesis strains, and further screening yielded one strain, which was then selected for AMCC. The strain was named 31342 and deposited with the China Center for Typical Cultures Depository on December 30, 2022, with deposit number CCTCC NO:M 20222110.
[0074] The yeast production method using corn steep liquor in this embodiment includes the following steps. (1) Activate the bacterial strain. Strain AMCC 31342 (Cluyveromyces marcyanas, deposit number CCTCC NO: M 20222110) was inoculated into YPD solid medium and activated at an activation temperature of 30°C for 60 hours to obtain a purified strain. Here, the YPD solid medium contained 10 g of yeast extract, 20 g of peptone, 20 g of glucose, and 20 g of agar, and was diluted to a final volume of 1000 mL with distilled water, and autoclaved at 121°C for 15 minutes.
[0075] (2) Prepare the primary seed solution. Prepare 50 mL of YPD liquid medium, sterilize it in preparation for use, pick cluiveromyces marcyanas colonies from the plate and inoculate them into the YPD liquid medium at a dose of 1% (v / v), and incubate with shaking in a shaker for 24 hours at a shaker speed of 180 rpm and a temperature of 28°C. Here, the YPD liquid medium contained 1 wt% paste-like yeast extract, 2 wt% yeast peptone, and 2 wt% glucose, with the remainder being deionized water.
[0076] (3) Prepare the secondary seed solution. Prepare 1.5 L of seed medium with the following composition, on a mass-volume percentage basis: 5% glucose, 0.3% yeast extract, 1% ammonium sulfate, 0.2% zinc sulfate, 0.4% potassium dihydrogen phosphate, 0.4% magnesium sulfate, and the remainder deionized water. Add the prepared seed medium to a 3 L fermenter, sterilize, and inoculate the 3 L fermenter with a dose of 3% (v / v), a stirring speed of 400 rpm, an aeration rate of 2 L / min, a pH of 4.5, and a temperature of 28°C for 24 hours.
[0077] (4) Ferment the corn steep liquor. A 25 L corn steep liquor solution was prepared using corn steep liquor and water in a 2:1 volume ratio. This solution was added to a 50 L fermenter, and after sterilization, the secondary seed solution was inoculated into the fermenter at a dose of 6% (v / v), with a stirring speed of 400 rpm, an aeration rate of 30 L / min, and a temperature of 28°C. The mixture was cultured for 36 hours using a method that allowed the pH to rise naturally. At this point, the lactic acid content in the corn steep liquor was 12.3 wt%, and the protein content was 22.7 wt%.
[0078] (5) After the fermentation in step (4) is complete, a portion of the fermentation liquid is centrifuged at 5000 rpm for 10 minutes to collect the biphase yeast cells, then the yeast cells are washed with pure water and centrifuged repeatedly to obtain a yeast product, which is designated as Example 1-1. A yeast product is obtained by continuous spray drying of the remaining fermentation liquid after the fermentation in step (4), which is designated as Example 1-2.
[0079] The effects of yeast fermentation and the characteristics of the yeast were measured using the method described below, and the results are shown in Table 3.
[0080] 1) Measurement of wet weight Place 10 mL of the fermented liquid after fermentation into a weighed 10 mL centrifuge tube, centrifuge at 5000 rpm for 10 minutes, discard the supernatant, gently shake off the remaining supernatant, weigh it, and the weight is m1, which is calculated using the following formula. M = (m1 - m0) × 100 Here, M is the wet weight (g / L) of the yeast. m1 is the weight (g) obtained after centrifugation and discarding the supernatant. m0 is the weight (g) of the centrifuge tube.
[0081] 2) Protein measurement The Kjeldahl method described in section 6.4 of the Chinese national standard GB / T 23530-2009 was used. For a sample (equivalent to 30-440 mg of total nitrogen), 5 g of mixed catalyst a (a mixture of potassium sulfate and copper sulfate pentahydrate in a ratio of 97:3) and 2.5 g of catalyst b (a mixture of selenium powder and potassium sulfate in a ratio of 0.1:100) were added, boiled in 20 mL of concentrated sulfuric acid, digested, and then distilled. The product ammonia was absorbed with boric acid, and the sample was titrated with 0.1 mol / L hydrochloric acid. The data was read, and the total nitrogen content was calculated. Protein content = Total nitrogen × 6.25
[0082] 3) Measurement of phosphorus pentoxide content 3.1 Principle After digestion, phosphorus in yeast produces water-soluble inorganic phosphorus, which reacts with ammonium molybdate to produce ammonium phosphate-molybdate. Under acidic conditions, a reducing agent is used to produce molybdenum blue, the intensity of which is proportional to the P2O5 content. Following the Lambert-Beer law, the absorbance at 700 nm was measured using a spectrophotometer.
[0083] 3.2 Main equipment A spectrophotometer, a 5 mL graduated pipette, and a 100 mL volumetric flask.
[0084] 3.3 Reagents and Solutions This is a 6% ammonium molybdate solution. 6g of ammonium molybdate [(NH4)6Mo7O 24Weighed [4H2O], dissolved it in water, diluted it to 100 mL, and mixed it uniformly. Note that ammonium molybdate will gradually decompose when left standing to produce water-insoluble MoO3, and a small amount of precipitate will not affect its use, but it is recommended not to prepare large quantities at once and to use it within one month. This is a 0.2% metol solution. 0.2 g of metol was weighed out, dissolved in water, diluted to 100 mL, and mixed uniformly. This is a 1% sodium sulfite solution. 1 g of sodium sulfite was weighed, dissolved in water, diluted to 100 mL, and mixed uniformly. This is a 30% disodium disulfate solution. 30 g of disodium disulfate was weighed out, dissolved in water, diluted to 100 mL, and mixed uniformly. This is a reducing agent solution. The above-mentioned 0.2% metol solution, 1% sodium sulfite solution, and 30% disodium disulfate solution were uniformly mixed in a 1:1:1 ratio and stored in a brown reagent bottle. This is a standard phosphorus solution. 0.191 g is accurately weighed and dried at 105°C until a constant weight is obtained. The potassium dihydrogen phosphate standard is then dissolved in water, placed in a 500 mL volumetric flask, water is added up to the graduation mark, and the mixture is shaken by hand to make it homogeneous. 1 mL corresponds to 0.2 mg of P2O5.
[0085] 3.4 Operation Steps Number three 100 mL volumetric flasks as blank, standard, and sample, respectively, and transfer the reagents into the three volumetric flasks in the order shown in Table 2 below. Table 2: Reagent Transfer Steps [Table 2] Each sample was shaken by hand to ensure uniformity, then left to stand in the dark for 1 hour. Using the blank as a control, the absorbance at 700 nm was measured using a spectrophotometer.
[0086] 3.5 Calculation of Results Calculate using the following formula. X7=((E1 / E2)×3×0.2) / (W×Ds×(5 / 100)×1000)×100% Here, X7 is the percentage content of P2O5 in the sample, and the unit is %. E1 is the absorbance of the sample. E2 is the absorbance of the P2O5 standard. 3 is the volume of P2O5 standard solution to be drawn out, and the unit is mL. 0.2 represents the concentration of the P2O5 standard solution, in units of g / L. W is the mass of the sample, in grams. Ds represents the percentage content of the exact dry substance in the sample, in units of %. 5 / 100 is the dilution factor for digestive fluids. The calculation result is rounded down to two decimal places.
[0087] 4) Measurement of trehalose content 4.1 Principle When anthrone and trehalose react, the solution turns light green, and the two colors are proportional. The absorbance at 630 nm was measured using a spectrophotometer, and this was used to calculate the trehalose content.
[0088] 4.2 Main equipment a. Analytical balance with a readability of 0.1 mg, b. Spectrophotometer, c. Centrifuge, d. Shaker, e. 10 mL graduated test tube, f. 5 mL graduated pipette, g. 1 mL graduated pipette, h. 50 mL volumetric flask, i. 50 mL small beaker.
[0089] 4.3 Reagents and Solutions a. Trichloroacetic acid. It is an analytical grade with a concentration of 0.5 mol / L (CCl3COOH). 40.8 g of trichloroacetic acid was weighed, dissolved in water, diluted to 500 mL, and mixed uniformly.
[0090] b. Sulfuric acid. It was analytical grade, dilute sulfuric acid. 150 mL of water was added to a 1000 mL beaker, and then 485 mL of sulfuric acid was measured out using a 500 mL graduated cylinder and slowly poured into the beaker while stirring slowly to cool.
[0091] c. Anthrone. Analytical grade anthrone was weighed out at 0.04 g, dissolved in 25 mL of dilute sulfuric acid (4.10.3.2), and mixed uniformly.
[0092] 4.4 Operation Steps a. After thoroughly mixing and homogenizing the yeast milk, accurately weigh 0.15 g (precision 0.0002 g) and place it in a centrifuge tube. Add 4.0 mL of 0.5 mol / L trichloroacetic acid solution and shake in a shaker until homogeneous. Then, place the tube in ice water containing ice cubes and shake once every 15 minutes for 1 hour.
[0093] b. The sample was centrifuged at 3000 rpm for 5 minutes using a centrifuge.
[0094] c. Pour the supernatant into a 50 mL volumetric flask, wash the centrifuge tube and precipitate with ice water, shake to mix uniformly, then centrifuge at 3000 rpm for 5 minutes using a centrifuge, pour the supernatant into a 50 mL volumetric flask, then dilute with ice water to the marked level, and shake by hand to make uniform.
[0095] d. This is a blank. Add 4.0 mL of 0.5 mol / L trichloroacetic acid solution to a 50 mL volumetric flask, dilute with ice water to the marked level, and shake by hand to make homogeneous.
[0096] e. Accurately aspirate 1.00 mL of the blank and sample, add them to two clean, dry test tubes, and then accurately add 5 mL of liquid anthron reagent to each. Shake by hand to homogenize, react in a boiling water bath for 10 minutes, remove and immediately cool to room temperature, shake by hand to homogenize, and measure the absorbance at 630 nm using a spectrophotometer with a 1 cm cuvette, using the blank as the control.
[0097] 4.5 Calculation of Results The trehalose content in the sample is calculated using the following formula. X8=(E×6.29×100) / (W×Ds×1000) Here, X8 is the percentage content of trehalose in the sample, and the unit is %. E is the absorbance of the sample. 6.29 is the mass of trehalose contained in 1 mL of solution when E=1, and the unit is mg. W is the mass of the sample, in grams. Ds represents the percentage content of the exact dry substance in the sample, in units of %. The calculation result is rounded down to two decimal places.
[0098] (Example 2) (Screening, identification methods, and identification results for *Cluiveromyces lactis*) Fermented dairy product samples collected in Inner Mongolia were dissolved in sterile water and mixed uniformly. The bacterial suspension was then aspirated and subjected to a 10-fold series dilution. -5 , 10 -6A bacterial suspension was prepared, spread onto YPD medium, and incubated at 30°C for 24-48 hours. Slides were prepared and the morphology of the yeast was observed under a microscope. The characteristics of the single colonies on the plates were also observed. The yeast strain colonies had a cheese-like texture, were milky white in color, had a smooth surface, regular edges, and were oval in microscopic shape, exhibiting budding reproduction. These were streaked, purified twice, inoculated onto YPD slant medium, and stored at 4°C. The yeast strain genome was extracted, and the yeast ITS sequence was amplified using ITS1 (5'-TCCGTAGGTGAACCTGCGG-3', SEQ ID NO. 1) and ITS4 (5'-TCCTCCGCTTATTGATATGC-3', SEQ ID NO. 2) as primers. After detection by 1% gel electrophoresis and sequencing, a Blast comparative analysis was performed with the GenBank sequence. Sequences with a similarity of more than 99% were identified as the same species. Morphological analysis and molecular identification revealed that the strain was Kluyveromyces lactis, strain number AMCC 31347, where AMCC is an abbreviation for Angel Microbiological Culture Collection Center. Its ITS sequence is shown in SEQ ID NO. 4, and the strain was deposited with the China Typical Culture Depository Center on February 27, 2023, with deposit number CCTCC NO:M 2023218.
[0099] The yeast production method using baijiu yellow water in this example includes the following steps. (1) Activate the bacterial strain. The strain AMCC 31347 was inoculated into YPD solid medium and activated at an activation temperature of 30°C for 60 hours to obtain a purified strain. Here, the YPD solid medium was prepared according to Example 1.
[0100] (2) Prepare the primary seed solution. Prepare 100 mL of YPD liquid medium, sterilize it in preparation for use, pick a single colony of Cluiveromyces lactis from the plate and inoculate it into the YPD liquid medium at a dose of 2% (v / v), and incubate it with shaking in a shaker for 30 hours at a shaker speed of 220 rpm and a temperature of 33°C. The YPD liquid medium was prepared using the formulation ratio of Example 1.
[0101] (3) Prepare the secondary seed solution. Prepare 2 L of seed medium with the following composition, on a mass-volume percentage basis: 8% glucose, 0.6% yeast extract, 2% ammonium sulfate, 0.4% zinc sulfate, 0.6% potassium dihydrogen phosphate, 0.6% magnesium sulfate, and the remainder deionized water. Add the prepared seed medium to a 3 L fermenter, sterilize, and inoculate the fermenter with a dose of 2% (v / v), a stirring speed of 600 rpm, aeration rate of 4 L / min, pH of 5.5, and temperature of 33°C for 36 hours.
[0102] (4) Fermenting the baijiu yellow water. Using baijiu yellow water and water, 35 L of baijiu yellow water solution was prepared in a 1:1 volume ratio and added to a 50 L fermentation tank. An additional 35 g of (NH4)2HPO3 was added, and after sterilization, the secondary seed solution was inoculated into the fermentation tank. The inoculation amount was 5% (v / v), the stirring speed was 600 rpm, the aeration rate was 50 L / min, and the temperature was 33°C. The mixture was cultured for 48 hours using a method that allowed the pH to rise naturally. At this point, the lactic acid content in the baijiu yellow water was 11.5 wt%.
[0103] (5) After the fermentation in step (4) was completed, the fermentation liquid was centrifuged at 5000 rpm for 10 minutes to collect the biphase yeast cells. Then, the yeast cells were washed with pure water and centrifuged repeatedly to obtain the yeast.
[0104] The effect of yeast fermentation and the characteristics of the yeast were measured using the method of Example 1, and the results are shown in Table 3.
[0105] (Example 3) The yeast production method using corn steep liquor in this embodiment includes the following steps. (1) Activate the bacterial strain. Pichia kudriavzeii C4.12 was inoculated into YPD solid medium and activated at an activation temperature of 30°C for 60 hours to obtain a purified strain. Here, the YPD solid medium contained 10 g of yeast extract, 20 g of peptone, 20 g of glucose, and 20 g of agar, and was diluted to a final volume of 1000 mL with distilled water, and autoclaved at 121°C for 15 minutes.
[0106] (2) Prepare the primary seed solution. Prepare 50 mL of YPD liquid medium, sterilize it in preparation for use, pick Pichia cudriabzebi colonies from the plate and inoculate them into the YPD liquid medium at a dose of 1% (v / v), and incubate with shaking in a shaker for 24 hours at a shaker speed of 180 rpm and a temperature of 28°C. Here, the YPD liquid medium contained 1 wt% paste-like yeast extract, 2 wt% yeast peptone, and 2 wt% glucose, with the remainder being deionized water.
[0107] (3) Prepare the secondary seed solution. Prepare 1.5 L of seed medium with the following composition, on a mass-volume percentage basis: 5% glucose, 0.3% yeast extract, 1% ammonium sulfate, 0.2% zinc sulfate, 0.4% potassium dihydrogen phosphate, 0.4% magnesium sulfate, and the remainder deionized water. Add the prepared seed medium to a 3 L fermenter, sterilize, and inoculate the 3 L fermenter with a dose of 3% (v / v), a stirring speed of 400 rpm, an aeration rate of 2 L / min, a pH of 4.5, and a temperature of 28°C for 24 hours.
[0108] (4) Ferment the corn steep liquor. A 25 L corn steep liquor solution was prepared using corn steep liquor and water in a 2:1 volume ratio. This solution was added to a 50 L fermenter, and after sterilization, the secondary seed solution was inoculated into the fermenter at a dose of 6% (v / v), with a stirring speed of 400 rpm, an aeration rate of 30 L / min, and a temperature of 28°C. The mixture was cultured for 36 hours using a method that allowed the pH to rise naturally. At this point, the lactic acid content in the corn steep liquor was 12.3 wt%, and the protein content was 22.7 wt%.
[0109] (5) After the fermentation in step (4) was completed, the fermentation liquid was centrifuged at 5000 rpm for 10 minutes to collect the biphase yeast cells. Then, the yeast cells were washed with pure water and centrifuged repeatedly to obtain the yeast.
[0110] The effect of yeast fermentation and the characteristics of the yeast were measured using the method of Example 1, and the results are shown in Table 3.
[0111] (Example 4) The yeast production method using soluble corn distillate in this embodiment includes the following steps. (1) Activate the bacterial strain. Candida tropicalis CGMCC 2.0588 was inoculated into YPD solid medium and activated at an activation temperature of 30°C for 60 hours to obtain a purified strain. Here, the YPD solid medium contained 10 g of yeast extract, 20 g of peptone, 20 g of glucose, and 20 g of agar, and was diluted to a final volume of 1000 mL with distilled water, and autoclaved at 121°C for 15 minutes.
[0112] (2) Prepare the primary seed solution. Prepare 50 mL of YPD liquid medium, sterilize it in preparation for use, pick Candida tropicalis colonies from the plate and inoculate them into the YPD liquid medium at a dose of 1% (v / v), and incubate with shaking in a shaker for 24 hours at a shaker speed of 180 rpm and a temperature of 28°C. Here, the YPD liquid medium contained 1 wt% paste-like yeast extract, 2 wt% yeast peptone, and 2 wt% glucose, with the remainder being deionized water.
[0113] (3) Prepare the secondary seed solution. Prepare 1.5 L of seed medium with the following composition, on a mass-volume percentage basis: 5% glucose, 0.3% yeast extract, 1% ammonium sulfate, 0.2% zinc sulfate, 0.4% potassium dihydrogen phosphate, 0.4% magnesium sulfate, and the remainder deionized water. Add the prepared seed medium to a 3 L fermenter, sterilize, and inoculate the 3 L fermenter with a dose of 3% (v / v), a stirring speed of 400 rpm, an aeration rate of 2 L / min, a pH of 4.5, and a temperature of 28°C for 24 hours.
[0114] (4) Fermenting the soluble corn distillate. A 35 L corn distillate solution was prepared using soluble corn distillate and water in a mass-to-volume ratio of 1:10. This solution was added to a 50 L air-lift fermenter, and after sterilization, the secondary seed solution was inoculated into the fermenter at a dose of 5% (v / v), with an aeration rate of 350 L / min, a temperature of 33°C, and cultured for 48 hours using a method that allowed the pH to rise naturally. The lactic acid content in the soluble corn distillate was 10.3 wt%.
[0115] (5) After the fermentation in step (4) was completed, the fermentation liquid was centrifuged at 5000 rpm for 10 minutes to collect the biphase yeast cells. Then, the yeast cells were washed with pure water and centrifuged repeatedly to obtain the yeast.
[0116] The effect of yeast fermentation and the characteristics of the yeast were measured using the method of Example 1, and the results are shown in Table 3.
[0117] (Example 5) The yeast production method using corn steep liquor in this embodiment includes the following steps. (1) Activate the bacterial strain. The strain AMCC 31342 (Cluyveromyces marcyanas, deposit number CCTCC NO:M 20222110) from Example 1 was inoculated into YPD solid medium and activated at an activation temperature of 30°C for 60 hours to obtain a purified strain. Here, the YPD solid medium contained 10 g of yeast extract, 20 g of peptone, 20 g of glucose, and 20 g of agar, and was diluted to a final volume of 1000 mL by adding distilled water. It was then autoclaved at 121°C for 15 minutes.
[0118] (2) Prepare the primary seed solution. Prepare 50 mL of YPD liquid medium, sterilize it in preparation for use, pick cluiveromyces marcyanas colonies from the plate and inoculate them into the YPD liquid medium at a dose of 1% (v / v), and incubate with shaking in a shaker for 24 hours at a shaker speed of 180 rpm and a temperature of 28°C. Here, the YPD liquid medium contained 1 wt% paste-like yeast extract, 2 wt% yeast peptone, and 2 wt% glucose, with the remainder being deionized water.
[0119] (3) Prepare the secondary seed solution. Prepare 1.5 L of seed medium with the following composition, on a mass-volume percentage basis: 5% glucose, 0.3% yeast extract, 1% ammonium sulfate, 0.2% zinc sulfate, 0.4% potassium dihydrogen phosphate, 0.4% magnesium sulfate, and the remainder deionized water. Add the prepared seed medium to a 3 L fermenter, sterilize, and inoculate the 3 L fermenter with a dose of 3% (v / v), a stirring speed of 400 rpm, an aeration rate of 2 L / min, a pH of 4.5, and a temperature of 28°C for 24 hours.
[0120] (4) Ferment the corn steep liquor. Prepare a 25 L corn steep liquor solution using corn steep liquor and water in a 2:1 volume ratio, add it to a 50 L fermenter, sterilize the fermenter medium, and inoculate the secondary seed solution into the fermenter at a dose of 6% (v / v). Add copper sulfate, calcium carbonate, vitamin B1, pantothenic acid, and vitamin B7 to the fermenter. Based on the total weight of the fermenter medium, the mass content of copper was 5 ppm, the mass content of calcium was 400 ppm, the mass content of vitamin B1 was 10 ppm, the mass content of pantothenic acid was 15 ppm, and the mass content of vitamin B7 was 0.5 ppm. The mixture was cultured for 36 hours under the conditions that the stirring speed was 400 rpm, the aeration rate was 30 L / min, and the temperature was 28°C, allowing the pH to rise naturally. In this study, the lactic acid content in the corn steep liquor was 12.3 wt%, and the protein content was 22.7 wt%.
[0121] (5) After the fermentation in step (4) was completed, the fermentation liquid was centrifuged at 5000 rpm for 10 minutes to collect the biphase yeast cells. Then, the yeast cells were washed with pure water and centrifuged repeatedly to obtain the yeast.
[0122] The effect of yeast fermentation and the characteristics of the yeast were measured using the method of Example 1, and the results are shown in Table 3.
[0123] (Example 6) The yeast production method using baijiu yellow water in this example includes the following steps. (1) Activate the bacterial strain. The strain AMCC 31347 (Cluyveromyces lactis, deposit number CCTCC NO:M 2023218) from Example 2 was inoculated into YPD solid medium and activated. The activation temperature was 30°C and the activation time was 60 hours to obtain a purified strain. Here, the YPD solid medium was prepared according to Example 1.
[0124] (2) Prepare the primary seed solution. Prepare 100 mL of YPD liquid medium, sterilize it in preparation for use, pick a single colony of Cluiveromyces lactis from the plate and inoculate it into the YPD liquid medium at a dose of 2% (v / v), and incubate it with shaking in a shaker for 30 hours at a shaker speed of 220 rpm and a temperature of 33°C. The YPD liquid medium was prepared using the formulation ratio of Example 1.
[0125] (3) Prepare the secondary seed solution. Prepare 2 L of seed medium with the following composition, on a mass-volume percentage basis: 8% glucose, 0.6% yeast extract, 2% ammonium sulfate, 0.4% zinc sulfate, 0.6% potassium dihydrogen phosphate, 0.6% magnesium sulfate, and the remainder deionized water. Add the prepared seed medium to a 3 L fermenter, sterilize, and inoculate the fermenter with a dose of 2% (v / v), a stirring speed of 600 rpm, aeration rate of 4 L / min, pH of 5.5, and temperature of 33°C for 36 hours.
[0126] (4) Fermenting the baijiu yellow water. Using baijiu yellow water and water in a 1:1 volume ratio, 35 L of baijiu yellow water solution was prepared and added to a 50 L fermentation tank. Further, 35 g of (NH4)2HPO3 was added, and after sterilizing the above fermentation medium, the secondary seed solution was inoculated into the fermentation tank at a dose of 5% (v / v). Copper sulfate, calcium carbonate, vitamin B1, pantothenic acid, and vitamin B7 were added to the fermentation tank. Based on the total weight of the fermentation tank medium, the mass content of copper was 2 ppm, the mass content of calcium was 600 ppm, the mass content of vitamin B1 was 30 ppm, the mass content of pantothenic acid was 20 ppm, and the mass content of vitamin B7 was 1 ppm. The mixture was cultured for 48 hours under the conditions of a stirring speed of 600 rpm, an aeration rate of 50 L / min, and a temperature of 33°C, allowing the pH to rise naturally. The lactic acid content in the baijiu yellow water was 11.5 wt%.
[0127] (5) After the fermentation in step (4) was completed, the fermentation liquid was centrifuged at 5000 rpm for 10 minutes to collect the biphase yeast cells. Then, the yeast cells were washed with pure water and centrifuged repeatedly to obtain the yeast.
[0128] The effect of yeast fermentation and the characteristics of the yeast were measured using the method of Example 1, and the results are shown in Table 3.
[0129] (Example 7) The yeast production method using corn steep liquor in this embodiment includes the following steps. (1) Activate the bacterial strain. Pichia kudriavzeii C4.12 was inoculated into YPD solid medium and activated at an activation temperature of 30°C for 60 hours to obtain a purified strain. Here, the YPD solid medium contained 10 g of yeast extract, 20 g of peptone, 20 g of glucose, and 20 g of agar, and was diluted to a final volume of 1000 mL with distilled water, and autoclaved at 121°C for 15 minutes.
[0130] (2) Prepare the primary seed solution. Prepare 50 mL of YPD liquid medium, sterilize it in preparation for use, pick Pichia cudriabzebi colonies from the plate and inoculate them into the YPD liquid medium at a dose of 1% (v / v), and incubate with shaking in a shaker for 24 hours at a shaker speed of 180 rpm and a temperature of 28°C. Here, the YPD liquid medium contained 1 wt% paste-like yeast extract, 2 wt% yeast peptone, and 2 wt% glucose, with the remainder being deionized water.
[0131] (3) Prepare the secondary seed solution. Prepare 1.5 L of seed medium with the following composition, on a mass-volume percentage basis: 5% glucose, 0.3% yeast extract, 1% ammonium sulfate, 0.2% zinc sulfate, 0.4% potassium dihydrogen phosphate, 0.4% magnesium sulfate, and the remainder deionized water. Add the prepared seed medium to a 3 L fermenter, sterilize, and inoculate the 3 L fermenter with a dose of 3% (v / v), a stirring speed of 400 rpm, an aeration rate of 2 L / min, a pH of 4.5, and a temperature of 28°C for 24 hours.
[0132] (4) Ferment the corn steep liquor. A 25 L corn steep liquor solution was prepared using corn steep liquor and water in a 2:1 volume ratio and added to a 50 L fermenter. After sterilization, the secondary seed solution was inoculated into the fermenter at an inoculation rate of 6% (v / v). Copper sulfate, calcium carbonate, vitamin B1, pantothenic acid, and vitamin B7 were added to the fermenter. Based on the total weight of the fermenter medium, the mass content of copper was 3 ppm, the mass content of calcium was 1000 ppm, the mass content of vitamin B1 was 20 ppm, the mass content of pantothenic acid was 30 ppm, and the mass content of vitamin B7 was 1.5 ppm. The mixture was cultured for 36 hours under the conditions of a stirring speed of 400 rpm, an aeration rate of 30 L / min, and a temperature of 28°C, allowing the pH to rise naturally. The lactic acid content in the corn steep liquor was 12.3 wt%, and the protein content was 22.7 wt%.
[0133] (5) After the fermentation in step (4) was completed, the fermentation liquid was centrifuged at 5000 rpm for 10 minutes to collect the biphase yeast cells. Then, the yeast cells were washed with pure water and centrifuged repeatedly to obtain the yeast.
[0134] The effect of yeast fermentation and the characteristics of the yeast were measured using the method of Example 1, and the results are shown in Table 3.
[0135] (Example 8) The yeast production method using soluble corn distillate in this embodiment includes the following steps. (1) Activate the bacterial strain. Candida tropicalis CGMCC 2.0588 was inoculated into YPD solid medium and activated at an activation temperature of 30°C for 60 hours to obtain a purified strain. Here, the YPD solid medium contained 10 g of yeast extract, 20 g of peptone, 20 g of glucose, and 20 g of agar, and was diluted to a final volume of 1000 mL with distilled water, and autoclaved at 121°C for 15 minutes.
[0136] (2) Prepare the primary seed solution. Prepare 50 mL of YPD liquid medium, sterilize it in preparation for use, pick Candida tropicalis colonies from the plate and inoculate them into the YPD liquid medium at a dose of 1% (v / v), and incubate with shaking in a shaker for 24 hours at a shaker speed of 180 rpm and a temperature of 28°C. Here, the YPD liquid medium contained 1 wt% paste-like yeast extract, 2 wt% yeast peptone, and 2 wt% glucose, with the remainder being deionized water.
[0137] (3) Prepare the secondary seed solution. Prepare 1.5 L of seed medium with the following composition, on a mass-volume percentage basis: 5% glucose, 0.3% yeast extract, 1% ammonium sulfate, 0.2% zinc sulfate, 0.4% potassium dihydrogen phosphate, 0.4% magnesium sulfate, and the remainder deionized water. Add the prepared seed medium to a 3 L fermenter, sterilize, and inoculate the 3 L fermenter with a dose of 3% (v / v), a stirring speed of 400 rpm, an aeration rate of 2 L / min, a pH of 4.5, and a temperature of 28°C for 24 hours.
[0138] (4) Fermenting soluble corn meal. A 35 L corn meal solution was prepared using soluble corn meal and water in a mass-to-volume ratio of 1:10 and added to a 50 L air-lift fermenter. After sterilization, a secondary seed solution was inoculated into the fermenter at an inoculation rate of 5% (v / v). Copper sulfate, calcium carbonate, vitamin B1, pantothenic acid, and vitamin B7 were added to the fermenter. Based on the total weight of the fermenter medium, the mass content of copper was 3 ppm, the mass content of calcium was 600 ppm, the mass content of vitamin B1 was 15 ppm, the mass content of pantothenic acid was 20 ppm, and the mass content of vitamin B7 was 0.75 ppm. The aeration rate was 350 L / min, the temperature was 33°C, and the culture was carried out for 48 hours using a method that allowed the pH to rise naturally. The lactic acid content in the soluble corn meal was 10.3 wt%.
[0139] (5) After the fermentation in step (4) was completed, the fermentation liquid was centrifuged at 5000 rpm for 10 minutes to collect the biphase yeast cells. Then, the yeast cells were washed with pure water and centrifuged repeatedly to obtain the yeast.
[0140] The effect of yeast fermentation and the characteristics of the yeast were measured using the method of Example 1, and the results are shown in Table 3.
[0141] (Example 9) The yeast production method using soluble corn distillate in this embodiment includes the following steps. (1) Activate the bacterial strain. The strain AMCC 31347 (Cluyveromyces lactis, deposit number CCTCC NO:M 2023218) from Example 2 was inoculated into YPD solid medium and activated. The activation temperature was 30°C and the activation time was 60 hours to obtain a purified strain. Here, the YPD solid medium was prepared according to Example 1.
[0142] (2) Prepare the primary seed solution. Prepare 100 mL of YPD liquid medium, sterilize it in preparation for use, pick a single colony of Cluiveromyces lactis from the plate and inoculate it into the YPD liquid medium at a dose of 1% (v / v), and incubate it with shaking in a shaker for 30 hours at a shaker speed of 220 rpm and a temperature of 33°C. The YPD liquid medium was prepared using the formulation ratio of Example 1.
[0143] (3) Prepare the secondary seed solution. Prepare 2 L of seed medium with the following composition, on a mass-volume percentage basis: glucose 6%, yeast extract 0.6%, ammonium sulfate 2%, zinc sulfate 0.4%, potassium dihydrogen phosphate 0.6%, magnesium sulfate 0.6%, and the remainder being deionized water. Add the prepared seed medium to a 3 L fermenter, sterilize, and inoculate the primary seed solution into the fermenter. The inoculation amount is 3% (v / v), the stirring speed is 600 rpm, the aeration rate is 4 L / min, the pH is 5.8, and the temperature is 33°C, and the mixture is incubated for 36 hours.
[0144] (4) Fermenting soluble corn meal. A 35 L corn meal solution was prepared using soluble corn meal and water in a mass-volume ratio of 1:10, added to a 50 L fermenter, and after sterilization, a secondary seed solution was inoculated into the fermenter at an inoculation rate of 5% (v / v). A fermentation medium was prepared by adding copper sulfate, calcium carbonate, vitamin B1, pantothenic acid, and vitamin B7 to the fermenter. Based on the total weight of the fermenter medium, the mass content of copper was 3 ppm, the mass content of calcium was 600 ppm, the mass content of vitamin B1 was 15 ppm, the mass content of pantothenic acid was 20 ppm, and the mass content of vitamin B7 was 0.75 ppm. The mixture was cultured for 48 hours under the conditions of a stirring speed of 600 rpm, an aeration rate of 50 L / min, and a temperature of 33°C, allowing the pH to rise naturally.
[0145] (5) After the fermentation in step (4) was completed, the fermentation liquid was centrifuged at 5000 rpm for 10 minutes to collect the biphase yeast cells. Then, the yeast cells were washed with pure water and centrifuged repeatedly to obtain the yeast.
[0146] The effect of yeast fermentation and the characteristics of the yeast were measured using the method of Example 1, and the results are shown in Table 3.
[0147] (Example 10) The yeast production method using soluble corn distillate in this embodiment includes the following steps. (1) Activate the bacterial strain. The strain AMCC 31347 (Cluyveromyces lactis, deposit number CCTCC NO:M 2023218) from Example 2 was inoculated into YPD solid medium and activated. The activation temperature was 30°C and the activation time was 60 hours to obtain a purified strain. Here, the YPD solid medium was prepared according to Example 1.
[0148] (2) Prepare the primary seed solution. Prepare 100 mL of YPD liquid medium, sterilize it in preparation for use, pick a single colony of Cluiveromyces lactis from the plate and inoculate it into the YPD liquid medium at a dose of 1% (v / v), and incubate it with shaking in a shaker for 30 hours at a shaker speed of 220 rpm and a temperature of 33°C. The YPD liquid medium was prepared using the formulation ratio of Example 1.
[0149] (3) Prepare the secondary seed solution. Prepare 2 L of seed medium with the following composition, on a mass-volume percentage basis: 6% glucose, 0.6% yeast extract, 2% ammonium sulfate, 0.4% zinc sulfate, 0.6% potassium dihydrogen phosphate, 0.6% magnesium sulfate, and the remainder deionized water. Add the prepared seed medium to a 3 L fermenter, sterilize, and inoculate the primary seed solution into the fermenter. The inoculation amount is 3% (v / v), the stirring speed is 600 rpm, the aeration rate is 4 L / min, the pH is 5.8, and the temperature is 33°C, and the culture is incubated for 36 hours.
[0150] (4) Modifying soluble corn distillate. A 40 L corn distillate solution was prepared using soluble corn distillate and water in a mass-volume ratio of 1:10. The solution was heated to 60°C, and 4.0 wt‰ of cellulase (based on the dry weight of the corn distillate solution) was added. Enzymatic digestion was carried out for 5 hours. Next, 3 wt‰ of protease (based on the dry weight of the corn distillate solution) was added, and enzymatic digestion was carried out for 4 hours. The solution was then heated to 75°C and enzymatic inactivation was carried out for 30 minutes to obtain modified corn distillate. The lactic acid content in the corn distillate was 10.3 wt%.
[0151] (5) 35 L of the above-mentioned modified corn distillate was added to a 50 L fermenter, and after sterilization, the secondary seed liquid was inoculated into the fermenter at a dose of 5% (v / v). Copper sulfate, calcium carbonate, vitamin B1, pantothenic acid, and vitamin B7 were added to the fermenter. Based on the total weight of the fermenter culture medium, the mass content of copper was 3 ppm, the mass content of calcium was 600 ppm, the mass content of vitamin B1 was 15 ppm, the mass content of pantothenic acid was 20 ppm, and the mass content of vitamin B7 was 0.75 ppm. The mixture was cultured for 48 hours under the conditions that the stirring speed was 600 rpm, the aeration rate was 50 L / min, and the temperature was 33°C, allowing the pH to rise naturally.
[0152] (6) After fermentation in step (4) was completed, the fermentation liquid was centrifuged at 5000 rpm for 10 minutes to collect the biphase yeast cells. Then, the yeast cells were washed with pure water and centrifuged repeatedly to obtain the yeast.
[0153] The effect of yeast fermentation and the characteristics of the yeast were measured using the method of Example 1, and the results are shown in Table 3.
[0154] (Example 11) Following the method of Example 5, the strain AMCC 31342 (Cluyveromyces marcyanas, deposit number CCTCC NO:M 20222110) from Example 1 was activated, primary seed cultured, and secondary seed cultured to obtain a secondary seed culture solution, which was then prepared for use.
[0155] Corn steep liquor was modified. A 30 L corn steep liquor solution was prepared using corn steep liquor and water in a 2:1 mass-volume ratio. The solution was heated to 55°C, and 6 wt‰ of cellulase (based on the dry weight of the corn steep liquor solution) was added. Enzymatic digestion was carried out for 6 hours. Next, 2 wt‰ of protease (based on the dry weight of the corn steep liquor solution) was added, and enzymatic digestion was carried out for 3 hours. The solution was then heated to 70°C and enzymatic inactivation was performed for 40 minutes to obtain modified corn steep liquor. The lactic acid content in the corn steep liquor was 12.3 wt%, and the protein content was 22.7 wt%.
[0156] The modified corn steep liquor was fermented. 25 L of the above corn steep liquor solution was added to a 50 L fermenter, and after sterilizing the fermentation medium, the secondary seed culture solution prepared above was inoculated into the fermenter at an inoculation rate of 6% (v / v). Copper sulfate, calcium carbonate, vitamin B1, pantothenic acid, and vitamin B7 were added to the fermenter. Based on the total weight of the fermenter medium, the mass content of copper was 5 ppm, the mass content of calcium was 400 ppm, the mass content of vitamin B1 was 10 ppm, the mass content of pantothenic acid was 15 ppm, and the mass content of vitamin B7 was 0.5 ppm. The mixture was cultured for 36 hours under the conditions of a stirring speed of 400 rpm, an aeration rate of 30 L / min, and a temperature of 28°C, allowing the pH to rise naturally.
[0157] The fermentation liquid after the above fermentation was completed was centrifuged at 5000 rpm for 10 minutes to collect the biphase yeast cells. Then, the yeast cells were washed with pure water and centrifuged repeatedly to obtain the yeast.
[0158] The effect of yeast fermentation and the characteristics of the yeast were measured using the method of Example 1, and the results are shown in Table 3.
[0159] (Example 12) Following the method of Example 6, the strain AMCC 31347 (Cluyveromyces lactis, deposit number CCTCC NO:M 2023218) from Example 2 was activated, primary seed cultured, and secondary seed cultured to obtain a secondary seed culture solution, which was then prepared for use.
[0160] The baijiu huang water was modified. A 40 L baijiu huang aqueous solution was prepared using baijiu huang water and water in a 1:1 mass-volume ratio. The solution was heated to 65°C, 3 wt‰ of cellulase (based on the dry weight of the baijiu huang aqueous solution) was added, and the solution was enzymatically digested for 3 hours. Next, 4 wt‰ of protease (based on the dry weight of the baijiu huang aqueous solution) was added, and the solution was enzymatically digested for 6 hours. Finally, the solution was heated to 90°C and the enzymes were inactivated for 20 minutes to obtain modified baijiu huang water. The lactic acid content in the baijiu huang water was 11.5 wt%.
[0161] The modified baijiu yellow water was fermented. 35 L of modified baijiu yellow water was added to a 50 L fermenter, and then 35 g of (NH4)2HPO3 was added. After sterilizing the fermentation medium, the secondary seed culture solution prepared above was inoculated into the fermenter at a concentration of 5% (v / v). Copper sulfate, calcium carbonate, vitamin B1, pantothenic acid, and vitamin B7 were added to the fermenter. Based on the total weight of the fermenter medium, the mass content of copper was 2 ppm, the mass content of calcium was 600 ppm, the mass content of vitamin B1 was 30 ppm, the mass content of pantothenic acid was 20 ppm, and the mass content of vitamin B7 was 1 ppm. The mixture was cultured for 48 hours under the conditions of a stirring speed of 600 rpm, an aeration rate of 50 L / min, and a temperature of 33°C, allowing the pH to rise naturally.
[0162] The fermentation liquid after the above fermentation was completed was centrifuged at 5000 rpm for 10 minutes to collect the biphase yeast cells. Then, the yeast cells were washed with pure water and centrifuged repeatedly to obtain the yeast.
[0163] The effect of yeast fermentation and the characteristics of the yeast were measured using the method of Example 1, and the results are shown in Table 3.
[0164] (Example 13) Example 5 differs from this example in that the stirring speed in step (4) is 300 rpm and the aeration rate is 12.5 L / min.
[0165] The effect of yeast fermentation and the characteristics of the yeast were measured using the method of Example 1, and the results are shown in Table 3.
[0166] (Example 14) Example 6 differs from this example in that the stirring speed in step (4) is 700 rpm and the aeration rate is 75 L / min.
[0167] The effect of yeast fermentation and the characteristics of the yeast were measured using the method of Example 1, and the results are shown in Table 3.
[0168] (Example 15) This method differs from Example 5 in that vitamin B1, pantothenic acid, and vitamin B7 are not added during the fermentation of the corn steep liquor in step (4).
[0169] (Example 16) This method differs from Example 5 in that copper sulfate and calcium carbonate are not added during the fermentation of the corn steep liquor in step (4).
[0170] (Comparative Example 1) Comparative Example 1 was the same as Example 1, except that it used Saccharomyces cerevisiae FX-2 as the fermentation strain.
[0171] However, in step (5), a portion of the fermentation liquid after the completion of fermentation in step (4) is centrifuged at 5000 rpm for 10 minutes to collect the biphase yeast cells, then the yeast cells are washed with pure water and centrifuged repeatedly to obtain a yeast product, which is designated as Comparative Example 1-1. A yeast product is also obtained by continuous spray drying of the remaining fermentation liquid after the completion of fermentation in step (4), which is designated as Comparative Example 1-2.
[0172] The effect of yeast fermentation and the characteristics of the yeast were measured using the method of Example 1, and the results are shown in Table 3.
[0173] (Comparative Example 2) This method differs from Example 1 in that fermentation is carried out using molasses in step (4), and the specific method is as follows. (1) Activate the bacterial strain. The strain AMCC 31342 (Cluyveromyces marcyanas, deposit number CCTCC NO:M 20222110) from Example 1 was inoculated into YPD solid medium and activated at an activation temperature of 30°C for 60 hours to obtain a purified strain. Here, the YPD solid medium contained 10 g of yeast extract, 20 g of peptone, 20 g of glucose, and 20 g of agar, and was diluted to a final volume of 1000 mL by adding distilled water. It was then autoclaved at 121°C for 15 minutes.
[0174] (2) Prepare the primary seed solution. Prepare 50 mL of YPD liquid medium, sterilize it in preparation for use, pick cluiveromyces marcyanas colonies from the plate and inoculate them into the YPD liquid medium at a dose of 1% (v / v), and incubate with shaking in a shaker for 24 hours at a shaker speed of 180 rpm and a temperature of 28°C. Here, the YPD liquid medium contained 1 wt% paste-like yeast extract, 2 wt% yeast peptone, and 2 wt% glucose, with the remainder being deionized water.
[0175] (3) Prepare the secondary seed solution. Prepare 1.5 L of seed medium with the following composition, on a mass-volume percentage basis: 5% glucose, 0.3% yeast extract, 1% ammonium sulfate, 0.2% zinc sulfate, 0.4% potassium dihydrogen phosphate, 0.4% magnesium sulfate, and the remainder deionized water. Add the prepared seed medium to a 3 L fermenter, sterilize, and inoculate the 3 L fermenter with a dose of 3% (v / v), a stirring speed of 400 rpm, an aeration rate of 2 L / min, a pH of 4.5, and a temperature of 28°C for 24 hours.
[0176] (4) Ferment the molasses. Prepare a 25 L corn steep liquor solution using molasses and water in a 2:1 volume ratio, add it to a 50 L fermenter, add 350 g ammonium sulfate and 200 g potassium dihydrogen phosphate, sterilize, inoculate the secondary seed solution into the fermenter at a dose of 6% (v / v), with a stirring speed of 400 rpm, an aeration rate of 30 L / min, and a temperature of 28°C, and culture for 36 hours using a method that allows the pH to rise naturally.
[0177] (5) After the fermentation in step (4) was completed, the fermentation liquid was centrifuged at 5000 rpm for 10 minutes to collect the biphase yeast cells. Then, the yeast cells were washed with pure water and centrifuged repeatedly to obtain the yeast.
[0178] The effect of yeast fermentation and the characteristics of the yeast were measured using the method of Example 1, and the results are shown in Table 3.
[0179] (Comparative Example 3) Comparative Example 2 was identical to Example 2, except that it used Saccharomyces cerevisiae FX-2 as the fermentation strain.
[0180] The effect of yeast fermentation and the characteristics of the yeast were measured using the method of Example 1, and the results are shown in Table 3. Table 3: Measurement results [Table 3]
[0181] As can be seen from Table 3, the wet weight discharged from yeast production using Examples 1 to 16 of the present invention was 155 to 242 g / L. After separation, the protein content in the yeast product was 53.15 to 67.33%, the phosphorus pentoxide content was 2.11 to 3.51%, and the trehalose content was 1.81 to 8.42%. This indicates that when yeast is produced using the method of the present invention, the fermentation process is stable, the production efficiency is high, and the product quality is stable.
[0182] Compared to Example 1, Comparative Example 1, which used Saccharomyces cerevisiae for fermentation, had a discharged wet weight of only 102 g / L, indicating a clear decrease in fermentation efficiency. After separation, the protein content in the yeast product was 43.14%, significantly lower than in Example 1. The difference in protein content between the yeast products obtained by direct spray drying (Examples 1-2 and Comparative Examples 1-2) was not significant, mainly due to the presence of unconverted proteins in the fermentation substrate, corn steep liquor. Compared to Example 2, Comparative Example 3, which used Saccharomyces cerevisiae for fermentation, had a discharged wet weight of only 69 g / L, indicating a clear decrease in fermentation efficiency. After separation, the protein content in the yeast product was 42.17%, significantly lower than in Example 2. It was found that when fermenting high-lactic acid industrial byproducts using the specific yeast species of the present invention, high fermentation efficiency is achieved, and the resulting yeast product has a higher yeast protein content.
[0183] In Comparative Example 2, molasses was used as the fermentation carbon source compared to Example 5, and the discharged wet weight was 228 g / L. The fermentation efficiency of Example 5 and Comparative Example 2 was equivalent, but high-lactic acid industrial by-products such as corn steep liquor are industrial waste, and their cost was much lower than that of molasses.
[0184] Compared to Examples 1-4, Examples 5-8 had added nutrients, resulting in increased wet weight by 22.4%, 45.5%, 26.2%, and 27.9%, respectively. This indicates that nutrients can significantly promote yeast growth in high-lactic acid industrial by-product fermentation substrates. Compared to Example 5, Example 15 only had copper and calcium added, resulting in a wet weight of 183 g / L. Example 16 only had vitamin B1, pantothenic acid, and vitamins added, resulting in a wet weight of 181 g / L. Example 1 had neither copper and calcium nor vitamin B1, pantothenic acid, and vitamins added, resulting in a wet weight of 183 g / L. This shows that there is a synergistic effect when trace elements and vitamins are added simultaneously during the process of producing yeast using high-lactic acid industrial by-products.
[0185] Compared to Example 9, in Example 10, the discharged wet weight increased by 30% by first enzymatic hydrolysis of the soluble corn distillate and then fermentation. Compared to Example 5, in Example 11, the discharged wet weight increased by 8% by first enzymatic hydrolysis of the soluble corn distillate and then fermentation. Compared to Example 6, in Example 12, the discharged wet weight increased by 5.8% by first enzymatic hydrolysis of the soluble corn distillate and then fermentation. This indicates that by modifying high-lactic acid industrial by-products with enzymatic hydrolysis before fermentation, the sugar and amino acid content in the high-lactic acid industrial by-products is improved, allowing yeast to absorb and convert them more effectively and improving fermentation efficiency.
[0186] Compared to Example 5, Example 13 has lower turnover speed and aeration ratio during the fermentation and culture stage, resulting in insufficient dissolved oxygen in the fermentation liquid, which affects yeast growth and ultimately leads to a lower wet weight. Compared to Example 5, Example 14 has higher turnover speed and aeration ratio during the fermentation and culture stage, and although the discharged wet weight does not increase significantly, foaming and leakage are more likely to occur during the fermentation process, increasing the difficulty of production control.
[0187] (Experimental Example 1) The yeast produced in Examples 1-16 and Comparative Examples 1-3 (however, in both Examples 1 and Comparative Example 1, the yeast product produced after isolation was used) was used as the nitrogen source to culture Streptomyces abermitilis ACCC 40168 (antibiotic fermenting strain), and the specific method is as follows. 1. Prepare 100 mL of culture medium with 40 g / L glucose, 5 g / L potassium dihydrogen phosphate, and 10 g / L yeast (Examples 1-6, Comparative Examples 1-2, on a dry basis), place it in a 500 mL Erlenmeyer flask, and sterilize it for use.
[0188] 2. Streptomyces abermitilis spores were prepared as a spore suspension using sterile water, 5 mL was aspirated and inoculated into the culture medium from step 1, and incubated with shaking at 25°C and 180 rpm for 96 hours. Samples were taken every 12 hours during the incubation period and their wet weight was measured.
[0189] 3. The measurement results are shown in Figure 3.
[0190] As can be seen from Figure 3, when the yeast product produced by the present invention and the yeast product produced by molasses fermentation were used as a fermentation nitrogen source, the fermentation effect was equivalent, and moreover, as the fermentation time increased, the fermentation effect of the yeast product produced by the present invention was clearly superior to that of the yeast products produced in Comparative Examples 1 and 3.
[0191] (Experimental Example 2) Yeast extracts were prepared using the yeast produced in Examples 1-16 and Comparative Examples 1-3 (however, in both Examples 1 and Comparative Example 1, the yeast product produced after isolation was used). Next, E. coli CICC 23933 was cultured using the yeast extract as a nitrogen source. The specific method for preparing the yeast extract is as follows. 1. Water was added to the yeast to prepare 14% (w / w) yeast milk. 2. The pH of the yeast milk obtained in Step 1 was adjusted to 5.5-5.8, and it was kept warm at 55°C for 20 hours. Then the temperature was raised to 70°C and kept warm for 30 minutes to inactivate the enzymes. 3. The mixture was centrifuged at 5000 rpm for 10 minutes, and the supernatant was collected. 4. The supernatant was concentrated using a rotary evaporator, and then spray-dried to obtain a powdered yeast extract.
[0192] Using the methods described above, yeast extracts were obtained from Examples 1-16 and Comparative Examples 1-3, respectively. Then, E. coli culture tests were conducted using the yeast extracts from Examples 1-16 and Comparative Examples 1-3 as nitrogen sources, respectively, in the following manner. 1. Prepare 100 mL of culture medium with 30 g / L glucose, 5 g / L sodium chloride, and 15 g / L of any yeast extract prepared in Examples 1-16 and Comparative Examples 1-3. Place this medium in a 500 mL Erlenmeyer flask and sterilize it for use.
[0193] 2. Pick a single E. coli colony from the slope and inoculate it into the medium from Step 1. Culture at 37°C and 200 rpm with shaking for 24 hours, taking a sample every 4 hours during the period and measuring the OD with a spectrophotometer. 600 (That is, the absorbance of the solution at 600 nm) was measured, and the results are shown in Figure 4.
[0194] As can be seen from Figure 4, when yeast extracts produced from the yeast products of Examples 1 to 16 of the present invention are used as an organic nitrogen source, the quality of the product is equivalent to that of yeast produced by conventional technology using molasses (Comparative Example 2). Therefore, the yeast produced by the method of the present invention can meet market needs, realize the industrial application of yeast production using high-lactic acid industrial by-products, increase the supply routes for yeast-derived sugar resources, expand the range of use for high-lactic acid industrial by-products, and alleviate the problem of molasses resource shortage in the yeast industry.
[0195] OD of Comparative Example 1 and Comparative Example 3 600 Since this is clearly smaller than that of Examples 1 and 2, it can be seen that the density of yeast in the fermentation liquid is low, meaning that when a yeast extract produced from a yeast product produced using a specific bacterial species in the present invention is used as an organic nitrogen source, the fermentation effect is better.
[0196] (Experimental Example 3) A sensory evaluation was conducted on the yeast extracts produced in Experimental Example 2 (Example 11, Comparative Example 2) to examine the differences in texture between the yeast extracts produced using the two methods. Based on the texture, scores from 0 to 10 were assigned, with 0 indicating a very poor texture and 10 indicating a very good texture. The specific procedure was as follows. (Sensory evaluation of a 2% aqueous solution) The two yeast extracts described above were prepared as 2% (w / v) warm aqueous solutions (60°C). Ten sensory evaluators blindly evaluated the two samples, then scored them based on texture. The results are shown in Table 4. Table 4: Sensory evaluation results of yeast extracts prepared in Example 11 and Comparative Example 2 [Table 4]
[0197] As can be seen from Table 4, the texture score of the yeast extract produced in Example 11 was superior to that of the yeast extract produced in Comparative Example 2. This indicates that when yeast is fermented using a high-lactic acid industrial by-product (e.g., corn steep liquor), the yeast cells can produce more flavor substances, resulting in a richer texture in the final product, which is more advantageous in the field of seasoning.
[0198] The above preferred embodiments illustrate the technical solutions of the present invention and do not limit them. While the above preferred embodiments describe the present invention in detail, those skilled in the art should understand that various changes may be made to the form and details without departing from the scope limited by the claims of the present invention. Table 5 Sequence List [Table 5]
[0199] (Note) (Note 1) (1) A step of inoculating the activated yeast strain into a primary seed medium and fermenting it to obtain a primary seed liquid, wherein the yeast strain is selected from one or more species from Cluyberomyces marcyanas, Cluyberomyces lactis, Pichia cudriabzebi and Candida tropicalis, (2) The step of obtaining a secondary seed solution by inoculating the primary seed solution into a secondary seed medium and fermenting it, (3) A step of inoculating a secondary seed liquid into a fermentation medium and fermenting it, wherein the fermentation medium contains a by-product of the high-lactic acid industry and / or a modified product of the high-lactic acid industry. (4) A method for producing a yeast product using a high-lactic acid industrial by-product, characterized by comprising the steps of (4) separating the fermentation liquid from step (3) to obtain a yeast product, or drying the fermentation liquid from step (3) to obtain a yeast product.
[0200] (Note 2) The method according to Appendix 1, characterized in that the high lactic acid industrial by-product described in step (3) comprises one or more of corn steep liquor, soluble corn distillate residue, baijiu yellow water, or kimchi water, and is preferably corn steep liquor.
[0201] (Note 3) The method according to Appendix 1 or 2, wherein the fermentation medium further contains nutrients, wherein the nutrients include trace elements and vitamins.
[0202] (Note 4) The aforementioned trace elements are selected from one or more of copper, calcium, iron, zinc, magnesium, and potassium, preferably copper and / or calcium. Preferably, the vitamin is selected from one or more of vitamin B1, vitamin B2, vitamin B3, vitamin B6, pantothenic acid, and vitamin B7, and preferably, one or more of vitamin B1, pantothenic acid, and vitamin B7, as described in Appendix 3.
[0203] (Note 5) The method according to Appendix 3 or 4, characterized in that, on a total weight basis of the fermentation medium, the nutrients include one or more of the following: 2-5 ppm copper, 400-1000 ppm calcium, 10-30 ppm vitamin B1, 15-30 ppm pantothenic acid, and 0.5-1.5 ppm vitamin B7.
[0204] (Note 6) The method according to any one of Appendix 1 to 5, characterized in that the preparation step of the modified product of the high-lactic acid industrial by-product includes the step of preparing the product by cellulase enzymatic degradation, protease enzymatic degradation, and enzymatic inactivation of the high-lactic acid industrial by-product.
[0205] (Note 7) The method according to Appendix 6, characterized in that, on a dry weight basis of the high lactic acid industrial by-product, the amount of cellulase added is 3 to 6 wt‰, preferably 4 to 6 wt‰, the temperature of cellulase enzymatic decomposition is preferably 55 to 65°C, and the time of enzymatic decomposition is preferably 3 to 6 hours.
[0206] (Note 8) The method according to Appendix 6 or 7, characterized in that, on a dry weight basis of the high lactic acid industrial by-product, the amount of protease added is 2 to 4 wt‰, preferably 2 to 3 wt‰, the temperature of protease enzymatic decomposition is preferably 55 to 65°C, and the time of enzymatic decomposition is preferably 3 to 6 hours.
[0207] (Note 9) The method according to any one of the appendices 6 to 8, characterized in that the enzyme inactivation includes raising the temperature to 70 to 90°C and maintaining the temperature for 20 to 40 minutes.
[0208] (Note 10) In the fermentation culture described in step (3), a stirred fermenter is used, provided that the stirring speed is 100 to 600 rpm, preferably the aeration ratio is 1:1 to 2, or In the fermentation culture described in step (3), an air-lift type fermenter is used, however, the aeration ratio is 1:10 to 70. Preferably, the fermentation culture temperature described in step (3) is 25 to 35°C, and preferably, the culture time is 12 to 48 hours, as described in any one of the appendices 1 to 9.
[0209] (Note 11) The separation described in step (4) comprises one or more of centrifugation, suction filtration, pressure filtration, or plate and frame filter press, preferably centrifugation, more preferably the rotation speed of the centrifugation is 3000 to 10000 rpm, and even more preferably the centrifugation time is 5 to 20 minutes, as described in any one of appendices 1 to 10.
[0210] (Note 12) The method according to any one of the appendices 1 to 11, further comprising the step of washing and / or drying the yeast product obtained by separation as described in step (4).
[0211] (Note 13) The method according to any one of the appendices 1 to 12, characterized in that the primary seed medium described in step (1) is YPD liquid medium, preferably the fermentation culture temperature in step (1) is 25 to 35°C, preferably the fermentation culture time is 12 to 30 hours, and more preferably the rotation speed is 150 to 220 rpm.
[0212] (Note 14) The method according to any one of the appendices 1 to 13, characterized in that, on a mass-volume percentage basis, the secondary seed medium described in step (2) contains 5-8% glucose, 0.3-0.6% yeast extract, 1-2% ammonium sulfate, 0.2-0.4% zinc sulfate, 0.4-0.6% potassium dihydrogen phosphate, and 0.4-0.6% magnesium sulfate, preferably the temperature of the fermentation culture in step (2) is 25-35°C, preferably the culture time is 12-36 hours, more preferably the pH of the fermentation culture is 4.5-5.5, and preferably the aeration rate is 2-4 L / min.
[0213] (Note 15) A yeast product produced by any one of the methods described in Appendix 1 to 14, characterized by containing 30-68%, preferably 50-68%, of protein by weight percentage, preferably 1.5-9.0% of trehalose, and more preferably 2.0-4.0% of phosphorus pentoxide.
[0214] (Note 16) The yeast product according to Appendix 15, characterized in that the form of the yeast product is powder, paste, or liquid.
[0215] (Note 17) Use of yeast products as described in Appendix 15 or 16 in feed proteins, food flavorings, or nitrogen sources for the fermentation industry.
Claims
1. (1) A step of inoculating the activated yeast strain into a primary seed medium and fermenting it to obtain a primary seed liquid, wherein the yeast strain is selected from one or more species from Cluyberomyces marcyanas, Cluyberomyces lactis, Pichia cudriabzebi and Candida tropicalis, (2) The step of obtaining a secondary seed solution by inoculating the primary seed solution into a secondary seed medium and fermenting it, (3) A step of inoculating a secondary seed liquid into a fermentation medium and fermenting it, wherein the fermentation medium contains a by-product of the high-lactic acid industry and / or a modified product of the high-lactic acid industry. A method for producing a yeast product using a high-lactic acid industrial by-product, characterized by comprising the steps of (4) separating the fermentation liquid from step (3) to obtain a yeast product, or drying the fermentation liquid from step (3) to obtain a yeast product.
2. The method according to claim 1, characterized in that the high lactic acid industrial by-product described in step (3) comprises one or more of corn steep liquor, soluble corn distillate residue, baijiu yellow water, or kimchi water, and is preferably corn steep liquor.
3. The method according to 1 or 2, wherein the fermentation medium further contains nutrients, wherein the nutrients include trace elements and vitamins.
4. The aforementioned trace elements are selected from one or more of copper, calcium, iron, zinc, magnesium, and potassium, preferably copper and / or calcium. Preferably, the vitamin is selected from one or more of vitamin B1, vitamin B2, vitamin B3, vitamin B6, pantothenic acid, and vitamin B7, and preferably, one or more of vitamin B1, pantothenic acid, and vitamin B7, as described in the method of 3.
5. The method according to 3 or 4, characterized in that, on a total weight basis of the fermentation medium, the nutrients include one or more of the following: 2 to 5 ppm of copper, 400 to 1000 ppm of calcium, 10 to 30 ppm of vitamin B1, 15 to 30 ppm of pantothenic acid, and 0.5 to 1.5 ppm of vitamin B7.
6. The method according to any one of claims 1 to 5, characterized in that the step of preparing the modified product of the high-lactic acid industrial by-product includes a step of preparing the product by cellulase enzymatic degradation, protease enzymatic degradation and enzymatic inactivation of the high-lactic acid industrial by-product.
7. The method according to 6, characterized in that, on a dry weight basis of the high lactic acid industrial by-product, the amount of cellulase added is 3 to 6 wt‰, preferably 4 to 6 wt‰, the temperature of cellulase enzymatic decomposition is preferably 55 to 65°C, and the time of enzymatic decomposition is preferably 3 to 6 hours.
8. The method according to 6 or 7, characterized in that, on a dry weight basis of the high lactic acid industrial by-product, the amount of protease added is 2 to 4 wt‰, preferably 2 to 3 wt‰, the temperature of protease enzymatic decomposition is preferably 55 to 65°C, and the time of enzymatic decomposition is preferably 3 to 6 hours.
9. The method according to any one of claims 6 to 8, characterized in that the enzyme inactivation includes raising the temperature to 70 to 90°C and maintaining the temperature for 20 to 40 minutes.
10. In the fermentation culture described in step (3), a stirred fermenter is used, provided that the stirring speed is 100 to 600 rpm, and preferably the aeration ratio is 1:1 to 2, or In the fermentation culture described in step (3), an air-lift type fermenter is used, however, the aeration ratio is 1:10 to 70. Preferably, the temperature of the fermentation culture described in step (3) is 25 to 35°C, and preferably, the culture time is 12 to 48 hours, as described in any one of claims 1 to 9.
11. The separation described in step (4) comprises one or more of centrifugation, suction filtration, pressure filtration, or plate and frame filter press, preferably centrifugation, more preferably the rotation speed of the centrifugation is 3,000 to 10,000 rpm, and even more preferably the centrifugation time is 5 to 20 minutes, as described in any one of claims 1 to 10.
12. The method according to any one of claims 1 to 11, further comprising the step of washing and / or drying the yeast product obtained by separation as described in step (4).
13. The method according to any one of claims 1 to 12, characterized in that the primary seed medium described in step (1) is YPD liquid medium, preferably the temperature of the fermentation culture in step (1) is 25 to 35°C, preferably the fermentation culture time is 12 to 30 hours, and more preferably the rotation speed is 150 to 220 rpm.
14. The method according to any one of claims 1 to 13, characterized in that, on a mass-volume percentage basis, the secondary seed medium described in step (2) contains 5 to 8% glucose, 0.3 to 0.6% yeast extract, 1 to 2% ammonium sulfate, 0.2 to 0.4% zinc sulfate, 0.4 to 0.6% potassium dihydrogen phosphate, and 0.4 to 0.6% magnesium sulfate, preferably the temperature of the fermentation culture in step (2) is 25 to 35°C, preferably the culture time is 12 to 36 hours, more preferably the pH of the fermentation culture is 4.5 to 5.5, and preferably the aeration rate is 2 to 4 L / min.
15. A yeast product produced by the method of any one of claims 1 to 14, characterized in that it contains 30 to 68%, preferably 50 to 68%, of protein by weight percentage, preferably 1.5 to 9.0% of trehalose, and more preferably 2.0 to 4.0% of phosphorus pentoxide.
16. The yeast product according to claim 15, characterized in that the form of the yeast product is in the form of a powder, paste, or liquid.
17. Use of the yeast product according to claim 15 or 16 in feed protein, food flavoring, or nitrogen source for the fermentation industry.