Compositions and methods for treating STXBP1 disorder
Antisense oligonucleotides are used to regulate STXBP1 expression and splicing, addressing the symptoms of STXBP1 disorders by increasing protein levels and improving synaptic function in neuronal cells.
Patent Information
- Application Number
- JP2025562326
- Authority / Receiving Office
- JP · JP
- Patent Type
- Applications
- Current Assignee / Owner
- Priority Date
- 2023-04-24
- Filing Date
- 2024-04-23
- Publication Date
- 2026-05-21
AI Technical Summary
There is a need for effective treatments for STXBP1 disorders, including epilepsy, cognitive impairment, motor impairment, hypotonia, and autism, which are characterized by varying degrees of severity and often result from haploinsufficiency and mutations in the STXBP1 gene, affecting synaptic vesicle fusion and neurotransmitter release.
The use of antisense oligonucleotides (ASOs) that target STXBP1 mRNA or pre-mRNA to regulate its expression, splicing, or induce exon skipping, thereby increasing STXBP1 protein levels in cells, particularly neurons, to treat or delay the onset of STXBP1 disorders.
The ASOs effectively increase STXBP1 protein levels, potentially alleviating symptoms such as epilepsy, cognitive and motor impairments, and autism by enhancing synaptic function in neuronal cells.
Smart Images

Figure 2026516311000032 
Figure 2026516311000033 
Figure 2026516311000034
Abstract
Description
[Technical Field]
[0001] Related applications This application claims priority to U.S. Provisional Patent Application No. 63 / 497,836, filed on 24 April 2023. The contents of the aforementioned related application are incorporated herein by reference in their entirety.
[0002] This specification provides antisense oligonucleotides ("ASOs"), compositions comprising ASOs, and methods of using ASOs and compositions to treat, prevent, or delay the onset of STXBP1 disorders or diseases in which STXBP1 levels are reduced.
[0003] Embedding by reference All patents, patent applications, and publications referenced herein are incorporated herein in their entirety by reference. Any citation or specification of references in this application does not constitute an endorsement that such references are available as prior art to this application.
[0004] Sequence List This application includes a sequence listing submitted herein as an XML file named "0100STX01WO_SL.xml" with a size of 1,103,905 bytes, created on March 20, 2024, which is incorporated herein by reference in its entirety. [Background technology]
[0005] Syntaxin-binding protein 1 ("STXBP1") is encoded by the STXBP1 gene (also known as Munc18-1) and is involved in synaptic vesicle fusion with the nerve cell membrane via multiple interactions with the soluble N-ethylmaleimide-sensitive factor-attached protein receptor (SNARE) complex, and is therefore essential for neurotransmitter release (Rizo J et al. Annu. Rev. Biophys. 2015, 44, 339-67; Misura KM, et al Nature 2000, 404, 355-62; Dulbova I, et al PNAS 2007, 104, 2697-702; Shen J, et al Cell 2006, 128, 183-95).
[0006] The STXBP1 gene is located on chromosome 9q34.1. Its association with disease was discovered in 2008 in a study of patients with Ohtahara syndrome, a severe early-onset epilepsy. In these studies, five patients with Ohtahara syndrome, a severe, early-onset epilepsy characterized by EEG suppression-burst patterns and severe psychomotor delay, were explained by various mutations in the STXBP1 gene, including missense, frameshift, splice site, and nonsense mutations (Saitsu H, et al Nat Genet. 2008, 40(6), 782-8). Shortly thereafter, patients presenting with other early-onset epileptic encephalopathy, including West syndrome, Lennox-Gastaut syndrome, and Dravet syndrome, were identified with STXBP1 mutations (Otsuka M, et al Epilepsia 2010, 51, 2449-52; Carvill GL, et al Neurology 2014, 82, 1245-53; Allen AS, et al Nature 2013, 501, 217-21; Grone BP, et al PLoS ONE 2016, 11, e0151148, doi:10.1371 / journal.pone.0151148). Since then, various new mutations in the STXBP1 gene have been found in individuals, resulting in severe encephalopathy with diverse phenotypic sets (Deprez L, et al Neurology 2010, 75, 1159-65; Hamdan FF, et al Eur.J.Hum.Genet. 2011, 19, 607-9; Stamberger H, et al Neurology 2016, 86, 954-62; Xian J, et al Brain. 2021, awab327, https: / / doi.org / 10.1093 / brain / awab327). Most mutations in STXBP1 are spread across the STXBP1 gene, but there are several mutation hotspots. For example, p.Arg406His is the most common recurrent mutation.Missense mutations occur throughout the protein structure, often as small hotspots (Xian J, et al, supra; Abramov D, et al J. Neurochem. 2021, 157, 165-78), and most missense mutations studied to date cause protein destabilization, aggregation, and degradation (Abramov D, et al, see above). Multiple mutations result in the formation of immature stop codons, which have been found early in the protein sequence (L36X) and quite late (W522X) (Stamberger H, et al, see above). Mutations that cause disease associated with STXBP1 include missense, nonsense, frameshift, and splice site mutations, as well as intragenetic, whole-genetic, and polygenetic deletions.
[0007] Recent estimates of the incidence of STXBP1-related disorders suggest a ratio of approximately 1 in 30,000 births (Lopez-Rivera JA, et al Brain 2020, 143, 1099-1105), and STXBP1 is the fifth most involved gene in epileptic developmental disorders (Symonds JD et al Eur.J.Paediatr.Neurol. 2020, 24, 15-23), suggesting that these disorders are not as rare as previously thought.
[0008] Individuals with STXBP1 disorder present with varying degrees of severity of symptoms including epilepsy, generalized delay, cognitive impairment (mild to severe), motor impairment, hypotonia, and autism. STXBP1 alterations are typically novel within families, and a single copy of the damaged gene is sufficient to cause the disorder. Indeed, all STXBP1 patients exhibit developmental delay and intellectual disability, the majority of which can be classified as severe to profound. Approximately 85%–90% of patients experience some form of epilepsy, usually appearing within the first year. Over 30 types of seizures have been reported in individuals, the most common being focal seizures, generalized seizures, and epileptic convulsions (Xian J, et al, see above). Approximately 90% of patients have motor impairments such as dystonia, spasticity, ataxia, hypotonia, and tremor, while behavioral problems, including hyperactivity, anxiety, aggression, and autism, are common in some patients. The diverse clinical disease phenotypes in the STXBP1 patient population have been demonstrated in a recent analysis of 534 STXBP1 patients (Xian J, et al, see above). The number of human phenotype ontology (HPO) assigned terms used to describe its clinical features revealed 592 unique terms, with a median of 10 HPO terms used per patient (range 1–53). The most commonly assigned initial HPO terms were "general developmental delay," "speechlessness," and "infant seizures."
[0009] The primary mechanism of disorder formation is haploinsufficiency, with approximately 50%–60% of reported mutations being either deletions, nonsense mutations, frameshift mutations, or splice site variants (Stamberger H, et al, see above; Xian J, et al, see above). A subset of studied missense mutations promote aggregation and reduce wild-type protein levels, thus potentially producing dominant negative effects (Guiberson NGL, et al Nature Comm. 2018, 9, 3986-4009). In animal models, haploinsufficiency has been demonstrated to reproduce the phenotypes of several patients (Kovacevik J, et al Brain 2018, 141, 1350-1374; Chen W, et al eLife 2020, 9, e48705 DOI:10.7554 / eLife.48705). Establishing a relationship between genotype and phenotype is challenging. A recent analysis of 534 STXBP1 patients (Xian J, et al, see above) identified five genetic hotspots with recurrent variants in more than 10 patients, but while there were some nominal associations, none were linked to specific phenotypic features. Therefore, there is a need for treatment of STXBP1 disorders, including epilepsy, generalized cognitive delay, cognitive impairment (mild to severe), motor impairment, hypotonia, and autism. [Prior art documents] [Non-patent literature]
[0010] [Non-Patent Document 1] Rizo J et al.Annu.Rev.Biophys.2015,44,339-67 [Non-Patent Document 2] Misura KM,et al Nature 2000,404,355-62 [Non-Patent Document 3] Dulubova I,et al PNAS 2007,104,2697-702 [Non-Patent Document 4] Shen J,et al Cell 2006,128,183-95
Non-licensed Document 5
Non-licensed Document 6
Non-licensed Document 7
Non-licensed Document 8
Non-licensed literature 9
Non-licensed literature 10
Non-licensed Document 11
Non-licensed Document 12
Non-licensed Document 13
Non-licensed Document 14
Non-licensed Document 15
Non-licensed Document 16
Non-patent Document 17
Non-patent Document 18
Non-patent Document 19
Summary of the Invention
[0011] This specification provides antisense oligonucleotides (ASOs), compositions containing ASOs, and methods of using ASOs to treat or delay STXBP1 disorders. As shown in the examples, the ASOs provided herein are useful for regulating the expression of STXBP1. In one embodiment, the ASO is useful for increasing the expression of STXBP1 in cells such as neurons. In one embodiment, the ASO hybridizes to, binds to, or targets STXBP1 mRNA or pre-mRNA. In another embodiment, the ASO regulates the splicing of STXBP1 pre-mRNA. In another embodiment, the ASO induces exon skipping in STXBP1 pre-mRNA. In another embodiment, the ASO hybridizes to, binds to, or targets the 5'- or 3'-untranslated region (UTR) in STXBP1 mRNA or pre-mRNA. In one embodiment, the STXBP1 mRNA or pre-mRNA is wild-type STXBP1 mRNA or pre-mRNA. In another embodiment, the STXBP1 mRNA or pre-mRNA is mutant STXBP1 mRNA or pre-mRNA, such as mutant STXBP1 mRNA or pre-mRNA associated with STXBP1 disorders.
[0012] In one embodiment, the ASO provided herein is complementary to STXBP1 mRNA or premRNA. In another embodiment, the ASO provided herein is inversely complementary to STXBP1 mRNA or premRNA.
[0013] In another embodiment, a method is provided herein for treating or delaying the onset of an STXBP1 disorder by administering an ASO provided herein to a subject having an STXBP1 disorder. In one embodiment, the STXBP1 disorder is epilepsy, general delay, cognitive impairment (mild to severe), motor impairment, hypotonia, or autism. In one embodiment, the subject having an STXBP1 disorder is characterized by STXBP1 haploinsufficiency. [Brief explanation of the drawing]
[0014] [Figure 1A] Figures 1A–G show six dose-response curves generated using STXBP1 Het iNeuron treated by gymnosis with ASO provided herein. Figure 1A: Sequence ID No. 2. [Figure 1B] Figures 1A–G show six dose-response curves generated using STXBP1 Het iNeuron treated by gymnosis with ASO provided herein. Figure 1B: Sequence ID No. 17. [Figure 1C] Figures 1A–G show six dose-response curves generated using STXBP1 Het iNeuron treated by gymnosis with ASO provided herein. Figure 1C: Sequence ID No. 75. [Figure 1D] Figures 1A–G show six dose-response curves generated using STXBP1 Het iNeuron treated by gymnosis with ASO provided herein. Figure 1D: Sequence ID No. 168. [Figure 1E] Figures 1A–G show six dose-response curves generated using STXBP1 Het iNeuron treated by gymnosis with ASO provided herein. Figure 1E: Sequence ID No. 197. [Figure 1F] Figures 1A–G show six dose-response curves generated using STXBP1 Het iNeuron treated by gymnosis with ASO provided herein. Figure 1F: Sequence ID No. 188. [Figure 1G] Figures 1A–G show six dose-response curves generated using STXBP1 Het iNeuron treated by gymnosis with ASO provided herein. Figure 1G: Sequence ID No. 225. [Figure 2A] Figures 2A–G show the effect of 17 days of treatment at a 5 μM dose with the ASO and control provided herein on cell viability determined using the Cell-Titer Fluor assay. Figure 2A: Sequence ID No. 2. [Figure 2B] Figures 2A–G show the effect of 17 days of treatment at a 5 μM dose with the ASO and control provided herein on cell viability as determined using the Cell-Titer Fluor assay. Figure 2B: SEQ ID NO: 75. [Figure 2C] Figures 2A–G show the effect of 17 days of treatment at a 5 μM dose with the ASO and control provided herein on cell viability determined using the Cell-Titer Fluor assay. Figure 2C: SEQ ID NO: 17. [Figure 2D] Figures 2A–G show the effect of 17 days of treatment at a 5 μM dose with the ASO and control provided herein on cell viability as determined using the Cell-Titer Fluor assay. Figure 2D: SEQ ID NO: 168. [Figure 2E] Figures 2A–G show the effect of 17 days of treatment at a 5 μM dose with the ASO and control provided herein on cell viability as determined using the Cell-Titer Fluor assay. Figure 2E: SEQ ID NO: 188. [Figure 2F] Figures 2A–G show the effect of 17 days of treatment at a 5 μM dose with the ASO and control provided herein on cell viability determined using the Cell-Titer Fluor assay. Figure 2F: SEQ ID NO: 197. [Figure 2G] Figures 2A–G show the effect of 17 days of treatment at a 5 μM dose with the ASO and control provided herein on cell viability determined using the Cell-Titer Fluor assay. Figure 2G: SEQ ID NO: 225. [Figure 3] Figure 3 shows the immunostimulatory effect on cytokine production after treating PBMCs with 10 μM ASO and controls provided herein for 24 hours. [Figure 4A] Figures 4A–J show the NHP mismatch for each ASO, along with the results of orthogonal validation between the ASOs provided herein and controls using ELISA with STXBP1 Het iNeuron. [Figure 4B] Figures 4A–J show the NHP mismatch for each ASO, along with the results of orthogonal validation between the ASOs provided herein and controls using ELISA with STXBP1 Het iNeuron. [Figure 4C] Figures 4A–J show the NHP mismatch for each ASO, along with the results of orthogonal validation between the ASOs provided herein and controls using ELISA with STXBP1 Het iNeuron. [Figure 4D] Figures 4A–J show the NHP mismatch for each ASO, along with the results of orthogonal validation between the ASOs provided herein and controls using ELISA with STXBP1 Het iNeuron. [Figure 4E] Figures 4A–J show the NHP mismatch for each ASO, along with the results of orthogonal validation between the ASOs provided herein and controls using ELISA with STXBP1 Het iNeuron. [Figure 4F] Figures 4A–J show the NHP mismatch for each ASO, along with the results of orthogonal validation between the ASOs provided herein and controls using ELISA with STXBP1 Het iNeuron. [Figure 4G]Figures 4A–J show the NHP mismatch for each ASO, along with the results of orthogonal validation between the ASOs provided herein and controls using ELISA with STXBP1 Het iNeuron. [Figure 4H] Figures 4A–J show the NHP mismatch for each ASO, along with the results of orthogonal validation between the ASOs provided herein and controls using ELISA with STXBP1 Het iNeuron. [Figure 4I] Figures 4A–J show the NHP mismatch for each ASO, along with the results of orthogonal validation between the ASOs provided herein and controls using ELISA with STXBP1 Het iNeuron. [Figure 4J] Figures 4A–J show the NHP mismatch for each ASO, along with the results of orthogonal validation between the ASOs provided herein and controls using ELISA with STXBP1 Het iNeuron. [Figure 5] Figure 5 shows the results of ELISA screening at 5 μM using non-HiBiT tagged STXBP1 Het iNeuron for the ASOs and controls provided herein. [Figure 6] Figure 6 shows the levels of synaptic localized STXBP1 protein in glial-free STXBP1+ / -(HZ)Ngn2-induced neuronal cultures after treatment with ASO and controls provided herein. [Figure 7] Figure 7 shows the levels of synaptic localized STXBP1 protein in WT Ngn2-induced neuronal cultures after treatment with ASO and controls provided herein. [Figure 8] Figure 8 shows the levels of synaptic localization of STXBP1 protein in rat glial cultures of STXBP1+ / -(HZ)Ngn2-induced neurons after treatment with ASO and controls provided herein. [Figure 9] Figure 9 shows the levels of bulk STXBP1 protein in glial-free Ngn2-induced neuron cultures after treatment with ASO and controls provided herein. [Modes for carrying out the invention]
[0015] I. Definition To facilitate understanding of the disclosures described herein, several terms are defined below.
[0016] Unless otherwise defined, all technical and scientific terms used herein have the same meaning as those commonly understood by those skilled in the art. All patents, applications, published applications, and other publications are incorporated in their entirety by reference. If a term in this specification has multiple definitions, the definition in this section shall prevail unless otherwise noted.
[0017] The singular forms "a," "an," and "the" refer to multiple people unless the context explicitly indicates otherwise.
[0018] As used herein, "subject" refers to animals, including mammals, and humans such as patients.
[0019] As used herein, biological activity refers to the in vivo activity of an ASO, or the physiological response resulting from in vivo administration of an ASO, composition, or other mixture. Therefore, biological activity encompasses the therapeutic effects and pharmacokinetic behavior of such ASOs, compositions, and mixtures. Biological activity can be observed in an in vitro system designed to test such activity. For example, in one embodiment, the biological activity of an ASO refers to the regulation of gene expression. Methods for detecting and / or quantifying changes in gene expression are known in the Art and include, but are not limited to, those disclosed in the Examples.
[0020] Where the term “oligonucleotide” is used herein, unless otherwise suggested, it may be replaced with “antisense oligonucleotide” or vice versa.
[0021] As used herein, the term “complementary” encompasses both forward-complementary and reverse-complementary sequences, as will be apparent to those skilled in the art from the context. It is understood that if an oligonucleotide is complementary, it may also be reverse-complementary. Therefore, when an oligonucleotide is “complementary” to a target sequence, unless otherwise stated, it means that the oligonucleotide is reverse-complementary to the target sequence, and therefore the oligonucleotide is reverse-complementary to the target sequence. When an “antisense oligonucleotide is complementary” to a target sequence, unless otherwise stated, it means that the antisense oligonucleotide is reverse-complementary to the target sequence, and therefore the antisense oligonucleotide is complementary to the target sequence.
[0022] As used herein, the term “(reverse)complementarity” means a stretch of nucleic acid that can hybridize to another stretch of nucleic acid under physiological conditions. An antisense strand is generally said to be complementary to the sense strand it matches. In this context, an antisense oligonucleotide is complementary to its target. Hybridization conditions are defined herein. Therefore, it is not absolutely necessary that all bases in the complementary region can pair with bases on the opposing strand. For example, when designing an antisense oligonucleotide, one may want to incorporate residues that do not form base pairs with bases on the complementary strand. Mismatches may be to some extent if, under cellular conditions, the stretch of nucleotide can hybridize to the complementary region. In one embodiment, the ASO provided herein has one or two mismatches with a target sequence, such as a target sequence in STXBP1 mRNA or premRNA.
[0023] As used herein, unless otherwise noted, the term “binding” may be replaced with “complementary,” “hybridizes,” “overlaps,” and / or “targets” when used in relation to an antisense oligonucleotide that is complementary to a portion of the premRNAs identified herein. In this disclosure, such terms are synonymous. As used herein, “hybridizes” is used under intracellular physiological conditions. In one embodiment, the cell is a nerve cell unless otherwise indicated.
[0024] In one embodiment, the ASOs provided herein may have one or more substitutions or modifications compared to ASOs consisting of unmodified single-stranded DNA or RNA oligonucleotides. Generally, a substitution replaces one chemical group, which may be hydrogen, with another chemical group. Considering the carbon skeleton of organic molecules, RNA monomers are essentially 2'-substituted because they have a hydroxyl group at their 2'-position. Thus, DNA monomers are not 2'-substituted, and RNA monomers can be seen as 2'-substituted DNA monomers. If an RNA monomer is 2'-substituted, this substitution may replace either a 2'-OH or a 2'-H. If an RNA monomer is 2'-O-substituted, this substitution replaces the H of the 2'-OH moiety. As a non-restrictive example, 2'-O-methylRNA is a 2'-substituted monomer (-OMe substituted -H), a 2'-substituted RNA monomer (-OMe substituted -OH), and a 2'-O-substituted RNA monomer (-Me substituted -H), while 2'-F RNA is a 2'-substituted RNA monomer (-F substituted -OH or -H) but not a 2'-O-substituted RNA monomer (the 2'-O is either no longer present or unsubstituted). 2'-F RNA, in which F is substituted with 2'-OH, is both 2'-F-2'-deoxyRNA and 2'-F DNA.
[0025] As will be understood by those skilled in the art, throughout this application the terms “bicyclic nucleic acid,” “BNA,” “BNA scaffold,” “BNA nucleotide,” “BNA nucleoside,” “BNA modification,” or “BNA scaffold modification” may be replaced, as needed, with structurally restricted scaffold modifications, locked scaffold modifications, locked nucleotides, locked nucleosides, locked monomers, or Tm-enhanced scaffold modifications, or high-affinity modifications.
[0026] As used herein, “sequence identity” means the relationship between two or more nucleic acid (polynucleotide or nucleotide or oligonucleotide) sequences determined by comparing sequences. In one embodiment, sequence identity is calculated based on the total length or portion thereof of two given sequence numbers. A portion thereof means at least 50%, 60%, 70%, 80%, 90%, or 100% of both sequence numbers. As used herein, “identity” also means the degree of sequence relevance between nucleic acid sequences, which may be determined by matching strings of such sequences.
[0027] The method for determining identity is designed to produce the greatest match between the sequences being tested. Methods for determining identity and similarity are systematized in publicly available computer programs. Examples of computer programs for determining identity and similarity between two sequences include the GCG program package (Devereux, J., et al., Nucleic Acids Research 12(1):387(1984)), BestFit, BLASTN, and FASTA (Altschul, S. et al., J.Mol.Biol.215:403-410(1990)). The BLAST X program is publicly available from NCBI and other sources (BLAST Manual, Altschul, S., et al., NCBI NLM NIH Bethesda, MD 20894; Altschul, S., et al., J.Mol.Biol.215:403-410(1990)). Identity may be determined using the well-known Smith-Waterman algorithm.
[0028] The parameters for nucleic acid comparison include: Algorithm: Needleman and Wunsch, J.Mol.Biol.48:443-453(1970), Comparison matrix: Match = +10, Mismatch = 0, Gap penalty: 50, Gap length penalty: 3. Available as the Gap program from Genetics Computer Group in Madison, Wisconsin.
[0029] The hybridization conditions for nucleic acid molecules can have low, medium, or high stringency (Southern blotting procedure). Low, medium, or high stringency conditions refer to pre-hybridization and hybridization at 42°C with 5×SSPE, 0.3% SDS, and 200 pg / ml shear and denatured salmon sperm DNA, with either 25%, 35%, or 50% formamide, respectively, for low, medium, or high stringency. The hybridization reaction product is then washed three times for 30 minutes each time with 2×SSC and 0.2% SDS at either 55°C, 65°C, or 75°C, respectively, for low, medium, or high stringency.
[0030] As used herein, treatment means any method by which one or more of the symptoms of a disease or disorder are improved or otherwise changed in a beneficial manner. Treatment also encompasses any pharmaceutically acceptable use of the compositions herein, such as use to treat STXBP1 disorder.
[0031] As used herein, improvement of symptoms of a particular disorder by administration of a particular ASO or pharmaceutical composition means any reduction, whether permanent or temporary, sustained or transient, that may be caused by or related to the administration of the ASO or pharmaceutical composition.
[0032] The specific ASOs provided herein have asymmetric atoms (optical centers) or double bonds, and racemates, diastereomers, tautomers, geometric isomers, and individual isomers are included within the scope of this disclosure. The ASOs provided herein do not include any known in the art that are too unstable to be synthesized and / or isolated.
[0033] The ASOs provided herein may also contain, in one or more of the atoms constituting such ASO, an unnatural proportion of an atomic isotope. For example, the ASO may contain, for example, tritium. 3 H), Iodine-125 ( 125 I) or carbon-14 (14 They may be radiolabeled with radioactive isotopes such as C). All isotopic variations of ASO provided herein, whether radioactive or not, are included within the scope of this disclosure.
[0034] As used herein, the STXBP1 gene is well known in the art. In one embodiment, the coding strand of the human STXBP1 gene is approximately 80,423 bp long and is described in NCBI accession number NC_000009.12. Mutant STXBP1 genes are also well known in the art. The STXBP1 gene encodes two major splice variants: i) NM_003165 (isoform a), in which 19 consecutive exons are translated to produce a 68.7 kDa protein of 603 amino acids, and ii) NM_001032221 (isoform b), in which exon 19 is skipped and the stop codon at exon 20 terminates translation to produce a 67.6 kDa protein of 594 amino acids.
[0035] II. Antisense oligonucleotides for use in compositions and methods In one embodiment, an antisense oligonucleotide (ASO) is provided that targets or binds to STXBP1 mRNA or premRNA. In one embodiment, the ASO provided herein is a single-stranded oligonucleotide. In one embodiment, the ASO provided herein contains fewer than 50 nucleotides. In one embodiment, the ASO provided herein contains a nucleotide sequence complementary to the target sequence in STXBP1 mRNA or premRNA. In one embodiment, the ASO provided herein targets or binds to a portion of a complementary nucleic acid molecule, such as mRNA or premRNA, corresponding to the coding strand of the human STXBP1 gene described in NCBI accession number NC_000009.12. In another embodiment, the ASO provided herein targets or binds to a portion of a complementary nucleic acid molecule, such as mRNA or premRNA, corresponding to the human STXBP1 gene splice variant NM_003165 or NM_001032221.
[0036] In one embodiment, the ASO provided herein comprises a nucleotide sequence described in any one of SEQ ID NOs: 1 to 626. In one embodiment, the nucleotide sequence comprises a sequence described in any one of SEQ ID NOs: 1 to 626. In one embodiment, the ASO provided herein comprises a nucleotide sequence having at least 80%, 85%, 90%, or 95% sequence identity with any one of SEQ ID NOs: 1 to 626, and upon contact with cells, increases the expression of the STXBP1 protein. In one embodiment, the cells are nerve cells, optionally in vivo or in vitro, and the ASO provided herein increases the level of functional STXBP1 protein in the nerve cells compared to control cells not in contact with the ASO. In another embodiment, the ASO provided herein comprises at least 10, 11, 12, 13, 14, 15, or 16 consecutive bases of one of the following sequences: CAGAGGCCAGCTGACTGC (Sequence ID 1), TGTACTCACAGTCAGTG(Sequence ID 2), AGGAGGCAGCTTCCCTG (Sequence ID 3), ACTGACGCGCGGACTG (Sequence ID 4), CTGCGCGAGTCTCCCG (Sequence ID 5), TGCCAGCCAGGGCGTGCAGG (Sequence No. 6), CGAGAATGCAGCGGCAACAG (Sequence No. 7), AACAGTCCAGAAATTTCTCC (Sequence ID 8), CCAAGCAATGTGCACGTCAC (Sequence ID 9), CAAAGAGATGGAGGCTTCCA (Sequence ID 10), CAGAGGCCAGCTGACTG (Sequence ID 17) AGGAGGCAGCTTCCCT (Sequence ID 75), CACGAGAATGCAGCGGCA (Sequence ID 168) CCAGAAATTTCTCCTG (Sequence ID 188), CAAGCAATGTGCACGTCACC (Sequence ID 197), and TTCCAAAGAGATGGAGGCTT (Sequence No. 225).
[0037] While not bound by any theory, sequence numbers 1-3, 17, and 75 are thought to target the splice site and / or exon splicing enhancer (ESE) of mutant STXBP1 premRNA and / or induce exon skipping or inclusion in mutant STXBP1 premRNA. While not bound by any theory, sequence numbers 4 and 5 are thought to target the 5'-UTR of STXBP1 mRNA. While not bound by any theory, sequence numbers 6-10, 168, 188, 197, and 225 are thought to target the 3'-UTR of STXBP1 mRNA.
[0038] In all embodiments of this specification, the ASOs provided herein are complementary or inversely complementary to their intended mRNA or premRNA targets. The terms complementarity and inverse complementarity are used herein to refer to stretches of nucleic acids that can hybridize to another stretch of nucleic acid under intracellular physiological conditions. Such hybridization generally follows the well-known AT(U) / GC base pairing. Thus, references to T herein also include corresponding ASOs containing U instead of T. In one embodiment, the ASO provided herein is a T-containing ASO. In another embodiment, the ASO provided herein is a U-containing ASO. In yet another embodiment, the ASO provided herein contains a mixture of T and U bases. In one embodiment, the ASOs provided herein are fully complementary or inversely complementary to their targets. In yet another embodiment, the ASOs provided herein are less fully complementary or inversely complementary to their targets. In such embodiments, such “mismatches” are within the scope of this disclosure insofar as the resulting ASO hybridizes to its target under intracellular physiological conditions. In some embodiments, the degree of complementarity or inverse complementarity of the ASOs provided herein to their targets is at least 85%, 90%, 95%, 96%, 97%, 98%, 99%, or 100%. The ASOs specifically disclosed herein, represented by their sequence numbers, are 100% inversely complementary to their targets. Thus, unless otherwise indicated, the enumeration of specific sequence numbers herein that are 100% complementary or inversely complementary to their targets also includes ASOs containing mismatches that are at least 85%, 90%, 95%, 96%, 97%, 98%, or 99% complementary or inversely complementary to the same target. In one embodiment, the ASOs provided herein have one or two mismatches to their targets, such as STXBP1 mRNA or premRNA sequences.
[0039] In one embodiment, the ASO provided herein has a length of less than 50 nucleotides, or 8 to 40, 10 to 33, or 15 to 25 nucleotides. In another embodiment, the ASO provided herein has a length of 12 to 30 nucleotides. In another embodiment, the ASO provided herein has a length of 16 to 25 nucleotides. In another embodiment, the ASO provided herein has a length of 16 to 20 nucleotides. In another embodiment, the ASO provided herein has a length of 16, 17, 18, 19, or 20 nucleotides.
[0040] In one embodiment, the ASO provided herein has one or more modified bases, one or more modified sugars, and / or one or more modified internucleoside bonds. In another embodiment, the ASO provided herein has one or more modified bases. In another embodiment, the ASO provided herein has one or more modified sugars. In another embodiment, the ASO provided herein has one or more modified internucleoside bonds.
[0041] In another embodiment, the ASOs provided herein include hypoxanthine, pseudouracil, pseudocytosine, 1-methylpseudocuracil, orotic acid, agmatidine, lysidine, 2-thiouracil, 2-thiothymine, 5-halouracil, 5-halomethyluracil, 5-trifluoromethyluracil, 5-propynyluracil, 5-methylcytosine, 5-propynylcytosine, 5-aminomethyluracil, 5-hydroxymethyluracil, 5-aminomethylcytosine, 5-hydroxymethylcytosine, 7-deazaguanine, 7-deazaadenine, 7-aza-2,6-diaminopurine, 8-aza-7-deazaguanine, 8-aza-7-deazaadenine, 8-aza-7-deaza-2,6-diaminopurine, pseudoisocytosine, N 4 -Ethylcytosine, N 2 -Cyclopentylguanine (cPent-G), N 2 -Cyclopentyl-2-aminopurine (cPent-AP), or N2 It has one or more modified bases selected from propyl-2-aminopurine (Pr-AP).
[0042] In another embodiment, the ASO provided herein has one or more modified sugars selected from 2'-substituted RNA sugars, including threose nucleic acid sugars, 2'-F sugars, 2'-OMe and 2'-MOE(2'-O-(2-methoxyethyl)) sugars, and bicyclic (BNA) or tricyclic (TNA) nucleic acid sugars. In another embodiment, the ASOs provided herein include: stereostructure-restricted nucleotide (CRN) monomers, locked nucleic acid (LNA) monomers, xylo-LNA monomers, α-LNA monomers, α-L-LNA monomers, β-D-LNA monomers, 2'-amino-LNA monomers, 2'-(alkylamino)-LNA monomers, 2'-(acylamino)-LNA monomers, 2'-N-substituted-2'-amino-LNA monomers, 2'-thio-LNA monomers, (2'-O,4'-C)-restricted ethyl (cEt)BNA monomers, (2'-O,4'-C)-restricted methoxyethyl (cMOE)BNA monomers, 2',4'-BNANC(NH) monomers, 2',4'-BNANC(N-Me) monomers, 2',4'-BNANC(N-Bn) monomers, ethylene-bridged nucleic acid (ENA) monomers, carba-LNA (cLNA) monomers, and 3 The ASO has one or more BNAs and / or TNAs selected from 4-dihydro-2H-pyran nucleic acid (DpNA) monomers, 2'-C-bridged bicyclic nucleotide (CBBN) monomers, heterocyclic-bridged BNA monomers (such as triazolyl or tetrazolyl bonds), amide-bridged BNA monomers, urea-bridged BNA monomers, sulfonamide-bridged BNA monomers, bicyclic carbocyclic nucleotide monomers, TriNA monomers, α-L-TriNA monomers, bicycloDNA (bcDNA) monomers, F-bcDNA monomers, tricycloDNA (tcDNA) monomers, F-tcDNA monomers, oxetane nucleotide monomers, locked PMO monomers derived from 2'-amino-LNA, guanidine-bridged nucleic acid (GuNA) monomers, spirocyclopropylene-bridged nucleic acid (scpBNA) monomers, and their derivatives. In one embodiment, the ASO provided herein has two or more distinct modified sugars. In another embodiment, the ASO provided herein has a combination of a 2'-O-substituted RNA sugar and BNA.In another embodiment, the ASO provided herein has a combination of 2'-MOE sugars and LNA sugars. In yet another embodiment, the ASO provided herein has all 2'-MOE sugars. For example, Seth et al., J.Org.Chem. 2010, 75, 1569-1581; Osawa et al., J.Org.Chem., 2015, 80(21), pp10474-10481, International Publication No. 2014 / 145356, International Publication No. 2014 / 126229, Yamamoto et al. Org.Biomol.Chem. 2015, 13, 3757; Nishida et al. Chem.Commun. 2010, 46, 5283; WO2015 / 142910; Hanessian et al., J.Org.Chem., 2013, 78(18), pp 9064-9075; Bolli et al., Chem Biol. 1996 Mar; 3(3): 197-206, Murray See et al., Nucl. Acids Res., 2012, Vol.40, No.13 6135-6143; International Publication No. 2011 / 097641 and International Publication No. 2016 / 017422.
[0043] In another embodiment, the ASO provided herein has modified nucleoside bonds such as phosphorothioate or phosphoramidate. In another embodiment, the ASO provided herein has phosphorothioate nucleoside bonds. In another embodiment, the ASO provided herein has at least 50%, 60%, 70%, 80%, 90%, or all of the phosphorothioate nucleoside bonds.
[0044] In another embodiment, the ASOs provided herein are phosphorodiamidate morpholino oligomers (PMOs) or incorporated into conjugates such as peptide conjugate PMOs (PPMOs) or ASO antibody conjugates. See, for example, International Publication Nos. 2022 / 192749, 2020 / 028832, 2021 / 142307, 2022 / 020107, and 2022 / 140535.
[0045] In another embodiment, the ASO provided herein has a combination of 2'-MOE sugar and LNA sugar, as well as all phosphorothioate nucleoside bonds. In yet another embodiment, the ASO provided herein has all 2'-MOE sugar and all phosphorothioate nucleoside bonds.
[0046] In another embodiment, the ASO provided herein comprises at least 10, 11, 12, 13, 14, 15, or 16 consecutive bases CTGCGCGAGTCTCCCG (SEQ ID NO: 1) and optionally has all 2'-MOE sugars and all phosphorothioate nucleoside bonds. In another embodiment, the ASO provided herein is 16 to 25 nucleotides long and comprises at least 10, 11, 12, 13, 14, 15, or 16 consecutive bases CTGCGCGAGTCTCCCG (SEQ ID NO: 1) and optionally has all 2'-MOE sugars and all phosphorothioate nucleoside bonds. In another embodiment, the ASO provided herein is 16 to 20 nucleotides long and comprises at least 10, 11, 12, 13, 14, 15, or 16 consecutive bases CTGCGCGAGTCTCCCG (SEQ ID NO: 1) and optionally has all 2'-MOE sugars and all phosphorothioate nucleoside bonds. In another embodiment, the ASO provided herein comprises at least 10, 11, 12, 13, 14, 15, or 16 consecutive bases CTGCGCGAGTCTCCCG (SEQ ID NO: 1) and has all 2'-MOE sugars and all phosphorothioate nucleoside bonds. In another embodiment, the ASO provided herein is 16 to 25 nucleotides long and comprises at least 10, 11, 12, 13, 14, 15, or 16 consecutive bases CTGCGCGAGTCTCCCG (SEQ ID NO: 1) and has all 2'-MOE sugars and all phosphorothioate nucleoside bonds. In another embodiment, the ASO provided herein is 16 to 20 nucleotides long and comprises at least 10, 11, 12, 13, 14, 15, or 16 consecutive bases CTGCGCGAGTCTCCCG (SEQ ID NO: 1) and has all 2'-MOE sugars and all phosphorothioate nucleoside bonds.
[0047] In another embodiment, the ASO provided herein comprises TGTACTCACAGTCAGTG(SEQ ID NO: 2) of at least 10, 11, 12, 13, 14, 15, or 16 consecutive bases and optionally has all 2'-MOE sugars and all phosphorothioate nucleoside bonds. In another embodiment, the ASO provided herein is 16 to 25 nucleotides in length and comprises TGTACTCACAGTCAGTG(SEQ ID NO: 2) of at least 10, 11, 12, 13, 14, 15, or 16 consecutive bases and optionally has all 2'-MOE sugars and all phosphorothioate nucleoside bonds. In another embodiment, the ASO provided herein is 16 to 20 nucleotides long and comprises at least 10, 11, 12, 13, 14, 15, or 16 consecutive bases of TGTACTCACAGTCAGTG (SEQ ID NO: 2), and optionally has all 2'-MOE sugars and all phosphorothioate nucleoside bonds. In another embodiment, the ASO provided herein comprises at least 10, 11, 12, 13, 14, 15, or 16 consecutive bases of TGTACTCACAGTCAGTG (SEQ ID NO: 2), and comprises all 2'-MOE sugars and all phosphorothioate nucleoside bonds. In another embodiment, the ASO provided herein is 16 to 25 nucleotides long and comprises at least 10, 11, 12, 13, 14, 15, or 16 consecutive bases of TGTACTCACAGTCAGTG (SEQ ID NO: 2), and comprises all 2'-MOE sugars and all phosphorothioate nucleoside bonds. In another embodiment, the ASO provided herein is 16 to 20 nucleotides in length and comprises at least 10, 11, 12, 13, 14, 15 or 16 consecutive bases TGTACTCACAGTCAGTG (SEQ ID NO: 2), and has all 2'-MOE sugars and all phosphorothioate nucleoside bonds.
[0048] In another embodiment, the ASO provided herein comprises at least 10, 11, 12, 13, 14, 15, or 16 consecutive bases AGGAGGCAGCTTCCCTG (SEQ ID NO: 3) and optionally has all 2'-MOE sugars and all phosphorothioate nucleoside bonds. In another embodiment, the ASO provided herein is 16 to 25 nucleotides long and comprises at least 10, 11, 12, 13, 14, 15, or 16 consecutive bases AGGAGGCAGCTTCCCTG (SEQ ID NO: 3) and optionally has all 2'-MOE sugars and all phosphorothioate nucleoside bonds. In another embodiment, the ASO provided herein is 16 to 20 nucleotides long and comprises at least 10, 11, 12, 13, 14, 15, or 16 consecutive bases AGGAGGCAGCTTCCCTG (SEQ ID NO: 3), and optionally has all 2'-MOE sugars and all phosphorothioate nucleoside bonds. In another embodiment, the ASO provided herein comprises at least 10, 11, 12, 13, 14, 15, or 16 consecutive bases AGGAGGCAGCTTCCCTG (SEQ ID NO: 3), and comprises all 2'-MOE sugars and all phosphorothioate nucleoside bonds. In another embodiment, the ASO provided herein is 16 to 25 nucleotides long and comprises at least 10, 11, 12, 13, 14, 15, or 16 consecutive bases AGGAGGCAGCTTCCCTG (SEQ ID NO: 3), and comprises all 2'-MOE sugars and all phosphorothioate nucleoside bonds. In another embodiment, the ASO provided herein is 16 to 20 nucleotides in length and comprises at least 10, 11, 12, 13, 14, 15 or 16 consecutive bases AGGAGGCAGCTTCCCTG (SEQ ID NO: 3), and has all 2'-MOE sugars and all phosphorothioate nucleoside bonds.
[0049] In another embodiment, the ASO provided herein comprises at least 10, 11, 12, 13, 14, 15, or 16 consecutive bases of ACTGACGCGCGGACTG (SEQ ID NO: 4) and optionally has all 2'-MOE sugars and all phosphorothioate nucleoside bonds. In another embodiment, the ASO provided herein is 16 to 25 nucleotides long and comprises at least 10, 11, 12, 13, 14, 15, or 16 consecutive bases of ACTGACGCGCGGACTG (SEQ ID NO: 4) and optionally has all 2'-MOE sugars and all phosphorothioate nucleoside bonds. In another embodiment, the ASO provided herein is 16 to 20 nucleotides long and comprises at least 10, 11, 12, 13, 14, 15, or 16 consecutive bases of ACTGACGCGCGGACTG (SEQ ID NO: 4), and optionally has all 2'-MOE sugars and all phosphorothioate nucleoside bonds. In another embodiment, the ASO provided herein is 16 to 25 nucleotides long and comprises at least 10, 11, 12, 13, 14, 15, or 16 consecutive bases of ACTGACGCGCGGACTG (SEQ ID NO: 4), and optionally has all 2'-MOE sugars and all phosphorothioate nucleoside bonds. In another embodiment, the ASO provided herein is 16 to 20 nucleotides in length and comprises at least 10, 11, 12, 13, 14, 15, or 16 consecutive bases ACTGACGCGCGGACTG (SEQ ID NO: 4), and has all 2'-MOE sugars and all phosphorothioate nucleoside bonds.
[0050] In another embodiment, the ASO provided herein comprises at least 10, 11, 12, 13, 14, 15, or 16 consecutive bases CTGCGCGAGTCTCCCG (SEQ ID NO: 5) and optionally has all 2'-MOE sugars and all phosphorothioate nucleoside bonds. In another embodiment, the ASO provided herein is 16 to 25 nucleotides long and comprises at least 10, 11, 12, 13, 14, 15, or 16 consecutive bases CTGCGCGAGTCTCCCG (SEQ ID NO: 5) and optionally has all 2'-MOE sugars and all phosphorothioate nucleoside bonds. In another embodiment, the ASO provided herein is 16 to 20 nucleotides long and comprises at least 10, 11, 12, 13, 14, 15, or 16 consecutive bases CTGCGCGAGTCTCCCG (SEQ ID NO: 5) and optionally has all 2'-MOE sugars and all phosphorothioate nucleoside bonds. In another embodiment, the ASO provided herein comprises at least 10, 11, 12, 13, 14, 15, or 16 consecutive bases CTGCGCGAGTCTCCCG (SEQ ID NO: 5) and has all 2'-MOE sugars and all phosphorothioate nucleoside bonds. In another embodiment, the ASO provided herein is 16 to 25 nucleotides long and comprises at least 10, 11, 12, 13, 14, 15, or 16 consecutive bases CTGCGCGAGTCTCCCG (SEQ ID NO: 5) and has all 2'-MOE sugars and all phosphorothioate nucleoside bonds. In another embodiment, the ASO provided herein is 16 to 20 nucleotides long and comprises at least 10, 11, 12, 13, 14, 15, or 16 consecutive bases CTGCGCGAGTCTCCCG (SEQ ID NO: 5) and has all 2'-MOE sugars and all phosphorothioate nucleoside bonds.
[0051] In another embodiment, the ASO provided herein comprises at least 10, 11, 12, 13, 14, 15, or 16 consecutive bases TGCCAGCCAGGGCGTGCAGG (SEQ ID NO: 6) and optionally has all 2'-MOE sugars and all phosphorothioate nucleoside bonds. In another embodiment, the ASO provided herein is 16 to 25 nucleotides long and comprises at least 10, 11, 12, 13, 14, 15, or 16 consecutive bases TGCCAGCCAGGGCGTGCAGG (SEQ ID NO: 6) and optionally has all 2'-MOE sugars and all phosphorothioate nucleoside bonds. In another embodiment, the ASO provided herein is 16 to 20 nucleotides in length and comprises at least 10, 11, 12, 13, 14, 15, or 16 consecutive bases TGCCAGCCAGGGCGTGCAGG (SEQ ID NO: 6), and optionally has all 2'-MOE sugars and all phosphorothioate nucleoside bonds. In another embodiment, the ASO provided herein is 16 to 25 nucleotides in length and comprises at least 10, 11, 12, 13, 14, 15, or 16 consecutive bases TGCCAGCCAGGGCGTGCAGG (SEQ ID NO: 6), and optionally has all 2'-MOE sugars and all phosphorothioate nucleoside bonds. In another embodiment, the ASO provided herein is 16 to 20 nucleotides in length and comprises at least 10, 11, 12, 13, 14, 15 or 16 consecutive bases TGCCAGCCAGGGCGTGCAGG (SEQ ID NO: 6), and has all 2'-MOE sugars and all phosphorothioate nucleoside bonds.
[0052] In another embodiment, the ASO provided herein comprises at least 10, 11, 12, 13, 14, 15, or 16 consecutive bases CGAGAATGCAGCGGCAACAG (SEQ ID NO: 7) and optionally has all 2'-MOE sugars and all phosphorothioate nucleoside bonds. In another embodiment, the ASO provided herein is 16 to 25 nucleotides long and comprises at least 10, 11, 12, 13, 14, 15, or 16 consecutive bases CGAGAATGCAGCGGCAACAG (SEQ ID NO: 7) and optionally has all 2'-MOE sugars and all phosphorothioate nucleoside bonds. In another embodiment, the ASO provided herein is 16 to 20 nucleotides in length and comprises at least 10, 11, 12, 13, 14, 15, or 16 consecutive bases CGAGATGCAGCGGCAACAG (SEQ ID NO: 7), and optionally has all 2'-MOE sugars and all phosphorothioate nucleoside bonds. In another embodiment, the ASO provided herein is 16 to 25 nucleotides in length and comprises at least 10, 11, 12, 13, 14, 15, or 16 consecutive bases CGAGATGCAGCGGCAACAG (SEQ ID NO: 7), and optionally has all 2'-MOE sugars and all phosphorothioate nucleoside bonds. In another embodiment, the ASO provided herein is 16 to 20 nucleotides in length and comprises at least 10, 11, 12, 13, 14, 15 or 16 consecutive bases CGAGAATGCAGCGGCAACAG (SEQ ID NO: 7), and has all 2'-MOE sugars and all phosphorothioate nucleoside bonds.
[0053] In another embodiment, the ASO provided herein comprises at least 10, 11, 12, 13, 14, 15, or 16 consecutive bases AACAGTCCAGAAATTTCTCC (SEQ ID NO: 8) and optionally has all 2'-MOE sugars and all phosphorothioate nucleoside bonds. In another embodiment, the ASO provided herein is 16 to 25 nucleotides long and comprises at least 10, 11, 12, 13, 14, 15, or 16 consecutive bases AACAGTCCAGAAATTTCTCC (SEQ ID NO: 8) and optionally has all 2'-MOE sugars and all phosphorothioate nucleoside bonds. In another embodiment, the ASO provided herein is 16 to 20 nucleotides in length and comprises at least 10, 11, 12, 13, 14, 15, or 16 consecutive bases AACAGTCCAGAAATTTCTCC (SEQ ID NO: 8), and optionally has all 2'-MOE sugars and all phosphorothioate nucleoside bonds. In another embodiment, the ASO provided herein is 16 to 25 nucleotides in length and comprises at least 10, 11, 12, 13, 14, 15, or 16 consecutive bases AACAGTCCAGAAATTTCTCC (SEQ ID NO: 8), and optionally has all 2'-MOE sugars and all phosphorothioate nucleoside bonds. In another embodiment, the ASO provided herein is 16 to 20 nucleotides in length and comprises at least 10, 11, 12, 13, 14, 15 or 16 consecutive bases AACAGTCCAGAAATTTCTCC (SEQ ID NO: 8), and has all 2'-MOE sugars and all phosphorothioate nucleoside bonds.
[0054] In another embodiment, the ASO provided herein comprises at least 10, 11, 12, 13, 14, 15, or 16 consecutive bases CCAAGCAATGTGCACGTCAC (SEQ ID NO: 9) and optionally has all 2'-MOE sugars and all phosphorothioate nucleoside bonds. In another embodiment, the ASO provided herein is 16 to 25 nucleotides long and comprises at least 10, 11, 12, 13, 14, 15, or 16 consecutive bases CCAAGCAATGTGCACGTCAC (SEQ ID NO: 9) and optionally has all 2'-MOE sugars and all phosphorothioate nucleoside bonds. In another embodiment, the ASO provided herein is 16 to 20 nucleotides in length and comprises at least 10, 11, 12, 13, 14, 15, or 16 consecutive bases CCAAGCAATGTGCACGTCAC (SEQ ID NO: 9), and optionally has all 2'-MOE sugars and all phosphorothioate nucleoside bonds. In another embodiment, the ASO provided herein is 16 to 25 nucleotides in length and comprises at least 10, 11, 12, 13, 14, 15, or 16 consecutive bases CCAAGCAATGTGCACGTCAC (SEQ ID NO: 9), and optionally has all 2'-MOE sugars and all phosphorothioate nucleoside bonds. In another embodiment, the ASO provided herein is 16 to 20 nucleotides in length and comprises at least 10, 11, 12, 13, 14, 15 or 16 consecutive bases CCAAGCAATGTGCACGTCAC (SEQ ID NO: 9), and has all 2'-MOE sugars and all phosphorothioate nucleoside bonds.
[0055] In another embodiment, the ASO provided herein comprises CAAAGAGATGGAGGCTTCCA (SEQ ID NO: 10) of at least 10, 11, 12, 13, 14, 15, or 16 consecutive bases and optionally has all 2'-MOE sugars and all phosphorothioate nucleoside bonds. In another embodiment, the ASO provided herein is 16 to 25 nucleotides long and comprises CAAAGAGATGGAGGCTTCCA (SEQ ID NO: 10) of at least 10, 11, 12, 13, 14, 15, or 16 consecutive bases and optionally has all 2'-MOE sugars and all phosphorothioate nucleoside bonds. In another embodiment, the ASO provided herein is 16 to 20 nucleotides in length and comprises at least 10, 11, 12, 13, 14, 15, or 16 consecutive bases CAAAGAGATGGAGGCTTCCA (SEQ ID NO: 10), and optionally has all 2'-MOE sugars and all phosphorothioate nucleoside bonds. In another embodiment, the ASO provided herein is 16 to 25 nucleotides in length and comprises at least 10, 11, 12, 13, 14, 15, or 16 consecutive bases CAAAGAGATGGAGGCTTCCA (SEQ ID NO: 10), and optionally has all 2'-MOE sugars and all phosphorothioate nucleoside bonds. In another embodiment, the ASO provided herein is 16 to 20 nucleotides in length and comprises CAAAGAGATGGAGGCTTCCA (SEQ ID NO: 10) of at least 10, 11, 12, 13, 14, 15 or 16 consecutive bases and has all 2'-MOE sugars and all phosphorothioate nucleoside bonds.
[0056] In another embodiment, the ASO provided herein comprises CAGAGGCCAGCTGACTG (SEQ ID NO: 17) of at least 10, 11, 12, 13, 14, 15, or 16 consecutive bases and optionally has all 2'-MOE sugars and all phosphorothioate nucleoside bonds. In another embodiment, the ASO provided herein is 16 to 25 nucleotides long and comprises CAGAGGCCAGCTGACTG (SEQ ID NO: 17) of at least 10, 11, 12, 13, 14, 15, or 16 consecutive bases and optionally has all 2'-MOE sugars and all phosphorothioate nucleoside bonds. In another embodiment, the ASO provided herein is 16 to 20 nucleotides long and comprises at least 10, 11, 12, 13, 14, 15, or 16 consecutive bases CAGAGGCCAGCTGACTG (SEQ ID NO: 17), and optionally has all 2'-MOE sugars and all phosphorothioate nucleoside bonds. In another embodiment, the ASO provided herein is 16 to 25 nucleotides long and comprises at least 10, 11, 12, 13, 14, 15, or 16 consecutive bases CAGAGGCCAGCTGACTG (SEQ ID NO: 17), and optionally has all 2'-MOE sugars and all phosphorothioate nucleoside bonds. In another embodiment, the ASO provided herein is 16 to 20 nucleotides in length and comprises at least 10, 11, 12, 13, 14, 15 or 16 consecutive bases CAGAGGCCAGCTGACTG (SEQ ID NO: 17), and has all 2'-MOE sugars and all phosphorothioate nucleoside bonds.
[0057] In another embodiment, the ASO provided herein comprises AGGAGGCAGCTTCCCT (SEQ ID NO: 75) of at least 10, 11, 12, 13, 14, 15, or 16 consecutive bases and optionally has all 2'-MOE sugars and all phosphorothioate nucleoside bonds. In another embodiment, the ASO provided herein is 16 to 25 nucleotides long and comprises AGGAGGCAGCTTCCCT (SEQ ID NO: 75) of at least 10, 11, 12, 13, 14, 15, or 16 consecutive bases and optionally has all 2'-MOE sugars and all phosphorothioate nucleoside bonds. In another embodiment, the ASO provided herein is 16 to 20 nucleotides long and comprises at least 10, 11, 12, 13, 14, 15, or 16 consecutive bases AGGAGGCAGCTTCCCT (SEQ ID NO: 75), and optionally has all 2'-MOE sugars and all phosphorothioate nucleoside bonds. In another embodiment, the ASO provided herein comprises at least 10, 11, 12, 13, 14, 15, or 16 consecutive bases AGGAGGCAGCTTCCCT (SEQ ID NO: 75), and comprises all 2'-MOE sugars and all phosphorothioate nucleoside bonds. In another embodiment, the ASO provided herein is 16 to 25 nucleotides long and comprises at least 10, 11, 12, 13, 14, 15, or 16 consecutive bases AGGAGGCAGCTTCCCT (SEQ ID NO: 75), and comprises all 2'-MOE sugars and all phosphorothioate nucleoside bonds. In another embodiment, the ASO provided herein is 16 to 20 nucleotides in length and comprises at least 10, 11, 12, 13, 14, 15 or 16 consecutive bases AGGAGGCAGCTTCCCT (SEQ ID NO: 75), and has all 2'-MOE sugars and all phosphorothioate nucleoside bonds.
[0058] In another embodiment, the ASO provided herein comprises CACGAGAATGCAGCGGCA (SEQ ID NO: 168) of at least 10, 11, 12, 13, 14, 15, or 16 consecutive bases and optionally has all 2'-MOE sugars and all phosphorothioate nucleoside bonds. In another embodiment, the ASO provided herein is 16 to 25 nucleotides in length and comprises CACGAGAATGCAGCGGCA (SEQ ID NO: 168) of at least 10, 11, 12, 13, 14, 15, or 16 consecutive bases and optionally has all 2'-MOE sugars and all phosphorothioate nucleoside bonds. In another embodiment, the ASO provided herein is 16 to 20 nucleotides in length and comprises CACGAGAATGCAGCGGCA (SEQ ID NO: 168) of at least 10, 11, 12, 13, 14, 15, or 16 consecutive bases, and optionally has all 2'-MOE sugars and all phosphorothioate nucleoside bonds. In another embodiment, the ASO provided herein is 16 to 25 nucleotides long and comprises CACGAGAATGCAGCGGCA (SEQ ID NO: 168) of at least 10, 11, 12, 13, 14, 15, or 16 consecutive bases, and has all 2'-MOE sugars and all phosphorothioate nucleoside bonds. In another embodiment, the ASO provided herein is 16 to 20 nucleotides long and comprises CACGAGAATGCAGCGGCA (SEQ ID NO: 168) of at least 10, 11, 12, 13, 14, 15, or 16 consecutive bases, and has all 2'-MOE sugars and all phosphorothioate nucleoside bonds.
[0059] In another embodiment, the ASO provided herein comprises CCAGAAATTTCTCCTG (SEQ ID NO: 188) of at least 10, 11, 12, 13, 14, 15, or 16 consecutive bases and optionally has all 2'-MOE sugars and all phosphorothioate nucleoside bonds. In another embodiment, the ASO provided herein is 16 to 25 nucleotides in length and comprises CCAGAAATTTCTCCTG (SEQ ID NO: 188) of at least 10, 11, 12, 13, 14, 15, or 16 consecutive bases and optionally has all 2'-MOE sugars and all phosphorothioate nucleoside bonds. In another embodiment, the ASO provided herein is 16 to 20 nucleotides long and comprises at least 10, 11, 12, 13, 14, 15, or 16 consecutive bases CCAGAAATTTCTCCTG (SEQ ID NO: 188), optionally having all 2'-MOE sugars and all phosphorothioate nucleoside bonds. In another embodiment, the ASO provided herein is 16 to 25 nucleotides long and comprises at least 10, 11, 12, 13, 14, 15, or 16 consecutive bases CCAGAAATTTCTCCTG (SEQ ID NO: 188), optionally having all 2'-MOE sugars and all phosphorothioate nucleoside bonds. In another embodiment, the ASO provided herein is 16 to 20 nucleotides in length and comprises at least 10, 11, 12, 13, 14, 15 or 16 consecutive bases CCAGAAATTTCTCCTG (SEQ ID NO: 188), and has all 2'-MOE sugars and all phosphorothioate nucleoside bonds.
[0060] In another embodiment, the ASO provided herein comprises CAAGCAATGTGCACGTCACC (SEQ ID NO: 197) of at least 10, 11, 12, 13, 14, 15, or 16 consecutive bases and optionally has all 2'-MOE sugars and all phosphorothioate nucleoside bonds. In another embodiment, the ASO provided herein is 16 to 25 nucleotides in length and comprises CAAGCAATGTGCACGTCACC (SEQ ID NO: 197) of at least 10, 11, 12, 13, 14, 15, or 16 consecutive bases and optionally has all 2'-MOE sugars and all phosphorothioate nucleoside bonds. In another embodiment, the ASO provided herein is 16 to 20 nucleotides in length and comprises at least 10, 11, 12, 13, 14, 15, or 16 consecutive bases CAAGCAATGTGCACGTCACC (SEQ ID NO: 197), and optionally has all 2'-MOE sugars and all phosphorothioate nucleoside bonds. In another embodiment, the ASO provided herein is 16 to 25 nucleotides in length and comprises at least 10, 11, 12, 13, 14, 15 or 16 consecutive bases CAAGCAATGTGCACGTCACC (SEQ ID NO: 197), and has all 2'-MOE sugars and all phosphorothioate nucleoside bonds. In another embodiment, the ASO provided herein is 16 to 20 nucleotides in length and comprises at least 10, 11, 12, 13, 14, 15 or 16 consecutive bases CAAGCAATGTGCACGTCACC (SEQ ID NO: 197), and has all 2'-MOE sugars and all phosphorothioate nucleoside bonds.
[0061] In another embodiment, the ASO provided herein comprises TTCCAAAGAGATGGAGGCTT (SEQ ID NO: 225) of at least 10, 11, 12, 13, 14, 15, or 16 consecutive bases and optionally has all 2'-MOE sugars and all phosphorothioate nucleoside bonds. In another embodiment, the ASO provided herein is 16 to 25 nucleotides in length and comprises TTCCAAAGAGATGGAGGCTT (SEQ ID NO: 225) of at least 10, 11, 12, 13, 14, 15, or 16 consecutive bases and optionally has all 2'-MOE sugars and all phosphorothioate nucleoside bonds. In another embodiment, the ASO provided herein is 16 to 20 nucleotides in length and comprises TTCCAAAGAGATGGAGGCTT (SEQ ID NO: 225) of at least 10, 11, 12, 13, 14, 15, or 16 consecutive bases and optionally has all 2'-MOE sugars and all phosphorothioate nucleoside bonds. In another embodiment, the ASO provided herein is 16 to 25 nucleotides long and comprises TTCCAAAGAGATGGAGGCTT (SEQ ID NO: 225) of at least 10, 11, 12, 13, 14, 15, or 16 consecutive bases, and has all 2'-MOE sugars and all phosphorothioate nucleoside bonds. In another embodiment, the ASO provided herein is 16 to 20 nucleotides long and comprises TTCCAAAGAGATGGAGGCTT (SEQ ID NO: 225) of at least 10, 11, 12, 13, 14, 15, or 16 consecutive bases, and has all 2'-MOE sugars and all phosphorothioate nucleoside bonds.
[0062] In one embodiment, an ASO comprising a nucleotide sequence having at least 80%, 85%, 90%, 95%, or 100% sequence identity with any of the sequences listed in Tables 1 to 4 is provided herein. In another embodiment, an ASO comprising at least 8, 9, 10, 11, 12, 13, 14, 15, 16, 17, 18, 19, or 20 consecutive nucleotides of any of the sequences listed in Tables 1 to 4 is provided herein. In yet another embodiment, an ASO comprising 16 to 25 nucleotides and comprising at least 8, 9, 10, 11, 12, 13, 14, 15, 17, 17, 18, 19, or 20 consecutive nucleotides of any of the sequences listed in Sequence ID No. 1 to 626 is provided herein.
[0063] In one embodiment, an ASO comprising the nucleotide sequence listed in Table 1 or Table 2 is provided herein. In another embodiment, an ASO comprising a nucleotide sequence selected from SEQ ID NOs: 2, 17, 75, 168, 188, 197, and 225 is provided herein.
[0064] In one embodiment, the ASO provided herein comprises one or more modified bases, one or more modified sugars, and / or one or more modified internucleoside bonds. In another embodiment, the ASO provided herein comprises one or more 2'-MOE sugars and one or more phosphorothioate internucleoside bonds. In one embodiment, at least 50%, 75%, 90%, or all of the sugars in the ASO provided herein are 2'-MOE sugars, and independently, at least 50%, 75%, 90%, or all of the internucleoside bonds in the ASO provided herein are phosphorothioate internucleoside bonds.
[0065] In one embodiment, the ASO provided herein comprises a nucleotide sequence selected from Table 1, and optionally, the ASO has one or more modified bases, one or more modified sugars, and / or one or more modified internucleoside bonds. In another embodiment, the ASO provided herein has all 2'-MOE sugars and all phosphorothioate internucleoside bonds, and comprises a nucleotide sequence selected from Table 1. [Table 1-1] [Table 1-2] [Table 1-3] [Table 1-4] [Table 1-5]
[0066] In one embodiment, the ASO provided herein comprises a nucleotide sequence selected from Table 2, and optionally, the ASO has one or more modified bases, one or more modified sugars, and / or one or more modified internucleoside bonds. In another embodiment, the ASO provided herein has all 2'-MOE sugars and all phosphorothioate internucleoside bonds, and comprises a nucleotide sequence selected from Table 2. [Table 2]
[0067] In one embodiment, the ASO provided herein comprises a nucleotide sequence selected from Table 3, and optionally, the ASO has one or more modified bases, one or more modified sugars, and / or one or more modified internucleoside bonds. In another embodiment, the ASO provided herein has all 2'-MOE sugars and all phosphorothioate internucleoside bonds, and comprises a nucleotide sequence selected from Table 3. [Table 3-1] [Table 3-2] [Table 3-3] [Table 3-4] [Table 3-5] [Table 3-6] [Table 3-7] [Table 3-8]
[0068] In one embodiment, the ASO provided herein comprises a nucleotide sequence selected from SEQ ID NOs: 2, 17, 75, 168, 188, 197, and 225, and optionally, the ASO has one or more modified bases, one or more modified sugars, and / or one or more modified internucleoside bonds. In another embodiment, the ASO provided herein has all 2'-MOE sugars and all phosphorothioate internucleoside bonds and comprises a nucleotide sequence selected from SEQ ID NOs: 2, 17, 75, 168, 188, 197, and 225.
[0069] III. Synthesis of Antisense Alkyl The ASOs provided herein may be prepared according to standard methods well known in the art. See, for example, Beaucage, et al. Tetrahedron 1992, 48(12), 2223; Reese Org. & Biomol. Chem. 2005, 3(21), 3851-3868.
[0070] IV. Pharmaceutical Compositions The pharmaceutical compositions provided herein comprise a therapeutically effective amount of one or more of the ASOs provided herein, and a pharmaceutically acceptable carrier, diluent, or excipient.
[0071] ASOs can be formulated into appropriate pharmaceutical preparations such as solutions in sterile solutions or suspensions for ophthalmic or parenteral administration, as well as transdermal patch preparations. Typically, the aforementioned ASOs are formulated into pharmaceutical compositions using techniques and procedures well known in the art (see, for example, Ansel Introduction to Pharmaceutical Dosage Forms, Twelfth Edition 2021).
[0072] In the composition, one or more effective concentrations of ASO or pharmaceutically acceptable salts are mixed with a suitable pharmaceutical carrier or vehicle. In some embodiments, the concentration of ASO in the composition is effective in delivering an amount that, at the time of administration, treats, prevents, or improves one or more of the symptoms and / or progression of the diseases or disorders disclosed herein.
[0073] Typically, the compositions are formulated for single-dose administration. To formulate the compositions, weight fractions of ASO are dissolved, suspended, dispersed, or otherwise mixed in a selected vehicle at an effective concentration so as to alleviate or improve the treated symptoms. Suitable pharmaceutical carriers or vehicles for the administration of ASO provided herein include any such carrier known to those skilled in the art as suitable for a particular mode of administration.
[0074] Furthermore, ASO may be formulated as the sole pharmaceutically active ingredient in a composition, or in combination with other active ingredients. Liposome suspensions containing tissue-targeted liposomes may also be suitable as pharmaceutically acceptable carriers. These can be prepared according to methods known to those skilled in the art. For example, liposome formulations can be prepared as known in the art. Briefly, liposomes such as multilayer vesicles (MLVs) can be formed by drying egg phosphatidylcholine and brain phosphatidylserine (7:3 molar ratio) inside a flask. A solution of ASO provided herein in phosphate-buffered saline (PBS) without divalent cations (PBS) is added, and the flask is shaken until the lipid film is dispersed. The resulting vesicles are washed to remove any unencapsulated ASO, pelletized by centrifugation, and then resuspended in PBS.
[0075] The active ASO is contained in a pharmaceutically acceptable carrier in an amount sufficient to exert a therapeutically useful effect without undesirable side effects in the subject being treated. The therapeutically effective concentration can be determined empirically by testing the ASO in the in vitro and in vivo systems described herein and then extrapolating therefrom to the dose for humans. In some embodiments, the active ASO is administered in a manner that achieves a therapeutically effective concentration of the drug. In some embodiments, companion diagnostics (see, e.g., Olsen D and Jorgensen JT, Front. Oncol., 2014 May 16, 4:105, doi:10.3389 / fonC.2014.00105) are used to determine the therapeutic concentration and safety profile of the active ASO in a specific subject or population.
[0076] The concentration of active ASO in a pharmaceutical composition depends on the tissue distribution of active ASO, the inactivation and efflux rates, the physicochemical properties of ASO, the administration schedule, the amount administered, and other factors known to those skilled in the art. For example, the amount delivered is sufficient to improve one or more symptoms of the diseases or disorders disclosed herein.
[0077] In one embodiment, the therapeutically effective dose should produce a serum concentration of the active ingredient of about 0.1 ng / mL to about 50 to 100 μg / mL. In one embodiment, the pharmaceutical composition provides a dose of ASO of about 0.001 mg to about 2000 mg per kilogram of body weight per day. The pharmaceutical dosage unit form is prepared to provide about 1 mg to about 1000 mg, in one embodiment, about 10 to about 500 mg of the essential active ingredient or combination of essential ingredients per dosage unit form.
[0078] The active ingredient may be administered in a single dose or divided into several smaller doses to be administered at regular intervals. It is understood that the exact dosage and duration of treatment will vary depending on the disease being treated and may be determined empirically using known test protocols or by extrapolation from in vivo or in vitro test data. It should be noted that the concentration and dosage values may also vary depending on the severity of the condition being relieved. For any particular subject, a specific dosing regimen should be adjusted over time according to the individual needs and the professional judgment of the person administering or supervising the administration of the composition, and it should be further understood that the concentration ranges described herein are illustrative only and are not intended to limit the scope or implementation of the claimed composition.
[0079] Accordingly, one or more effective concentrations or amounts of ASO or its pharmaceutically acceptable salts described herein are mixed with a suitable pharmaceutical carrier or vehicle for systemic, topical, or topical administration to form a pharmaceutical composition. The ASO is included in an amount effective to improve one or more symptoms, or to treat, slow the progression of, or prevent one or more symptoms. The concentration of active ASO in the composition depends on the absorption, tissue distribution, inactivation, elimination rate of active ASO, the administration schedule, the amount administered, the specific formulation, and other factors known to those skilled in the art.
[0080] The composition is intended to be administered by a preferred route, including but not limited to parenteral, subcutaneous, intravenous, intramuscular, intraperitoneal, intrathecal, intraventricular, intraocular, mucosal, skin, percutaneous, oral, rectal, topical, or local. The composition is in liquid, semi-liquid, or solid form and is formulated in a manner suitable for each route of administration. The term "intraventricular" refers to the administration of the composition into the ventricular system of the brain, for example, by injection, infusion, or implantation (e.g., into the ventricles of the brain). The term "intraocular" refers to the administration of the composition into the ocular region, for example, by injection, infusion, or implantation (e.g., into the eyeball), or by topical / ophthalmic administration (e.g., using a cream, ointment, gel, or droplet). The term "intrathecal" refers to the administration of the composition into the lumbar region, for example, by injection, infusion, or implantation (e.g., into the subarachnoid space of the spinal cord).
[0081] Solutions or suspensions used for parenteral, intradermal, subcutaneous, or topical application may contain any of the following components: sterile diluents such as water for injection, physiological saline, fixative oil, polyethylene glycol, glycerin, propylene glycol, dimethylacetamide, or other synthetic solvents; antimicrobial agents such as benzyl alcohol and methylparaben; antioxidants such as ascorbic acid and sodium bisulfite; chelating agents such as ethylenediaminetetraacetic acid (EDTA); buffers such as acetates, citrates, and phosphates; and tonic modifiers such as sodium chloride and glucose. Parenteral preparations may be enclosed in ampoules, pens, disposable syringes, or single-dose or multi-dose vials made of glass, plastic, or other suitable materials.
[0082] If ASO exhibits insufficient solubility, methods for solubilizing ASO may be used. Such methods are known to those skilled in the art and include, but are not limited to, the use of a cosolvent such as dimethyl sulfoxide (DMSO), the use of a surfactant such as TWEEN®, or dissolution in an aqueous sodium bicarbonate solution.
[0083] When ASO is mixed or added, the resulting mixture may be a solution, suspension, emulsion, or the like. The form of the resulting mixture depends on several factors, including the intended mode of administration and the solubility of ASO in the selected carrier or vehicle. The effective concentration, which is sufficient to improve the symptoms of the disease, disorder, or condition being treated, can be determined empirically.
[0084] Pharmaceutical compositions are provided for administration to humans and animals in unit dosage forms such as powders, granules, sterile parenteral solutions or suspensions, and oil-water emulsions, containing suitable amounts of ASO or pharmaceutically acceptable salts thereof. pharmaceutically active ASO and its salts are formulated and administered in unit dosage forms or multiple dosage forms. As used herein, unit dosage forms refer to physically discrete units suitable for human and animal subjects, individually packaged as known in the art. Each unit dose contains a predetermined amount of therapeutically active ASO sufficient to produce the desired therapeutic effect, in conjunction with the necessary pharmaceutical carrier, vehicle, or diluent. Examples of dosage forms include ampoules and syringes, as well as individually packaged tablets or capsules. A unit dosage form may be administered in part or in multiples thereof. Multiple dosage forms involve multiple identical unit dosage forms packaged in a single container, administered in separate unit dosage forms. Examples of multiple dosage forms include vials, bottles of tablets or capsules, or pint or gallon bottles. Therefore, the multiple dosage forms are multiples of the unit dose that is not separated in the packaging.
[0085] Sustained-release preparations can also be prepared. Suitable examples of sustained-release preparations include semipermeable matrices of solid hydrophobic polymers containing ASOs provided herein, the matrices being in the form of molded articles, e.g., films, or microcapsules. Examples of sustained-release matrices include iontophoresis patches, polyesters, hydrogels (e.g., poly(2-hydroxyethyl methacrylate) or poly(vinyl alcohol)), polylactides, copolymers of L-glutamic acid and ethyl-L-glutamic acid, non-degradable ethylene-vinyl acetate, degradable lactate-glycolic acid copolymers such as LUPRON DEPOT® (injectable microspheres composed of lactate-glycolic acid copolymer and leuprolide acetate), and poly-D-(-)-3-hydroxybutyric acid. Polymers such as ethylene-vinyl acetate and lactate-glycolic acid allow for molecular release for more than 100 days, while certain hydrogels release proteins over shorter periods. If ASOs encapsulated in capsules remain in the body for extended periods, they may denature or aggregate as a result of exposure to water at 37°C, potentially leading to loss of biological activity and changes in their structure. Depending on the mechanism of action involved, reasonable strategies for stabilization can be devised. For example, if the aggregation mechanism is found to be intermolecular S-S bond formation via thio-disulfide exchange, stabilization can be achieved by modifying sulfidyl residues, freeze-drying from acidic solutions, controlling water content, using appropriate additives, and developing specific polymer matrix compositions.
[0086] Dosage forms or compositions containing an active ingredient in the range of 0.005% to 100%, with the remainder consisting of a non-toxic carrier, may be prepared. For oral administration, pharmaceutically acceptable non-toxic compositions are formed by incorporating one of the commonly used excipients, such as pharmaceutical-grade mannitol, lactose, starch, magnesium stearate, talc, cellulose derivatives, croscarmellose sodium, glucose, sucrose, magnesium carbonate, or saccharin sodium. Such compositions include implants and microencapsulated delivery systems, as well as solutions, suspensions, powders, and sustained-release formulations, including but not limited to biodegradable and biocompatible polymers such as collagen, ethylene vinyl acetate, polyanhydride, polyglycolic acid, polyorthoesters, and polylactic acid. Methods for preparing these compositions are known to those skilled in the art. The compositions intended may contain about 0.001% to 100% of the active ingredient, and in some embodiments, about 0.1% to 85% or about 75-95% of that.
[0087] Active ASO or pharmaceutically acceptable salts may be prepared using a carrier that protects the ASO from rapid removal from the body, such as a sustained-release formulation or coating.
[0088] The compositions may contain other active ASOs to obtain a desired combination of properties. The ASOs provided herein, or pharmaceutically acceptable salts thereof, may also be advantageously administered in combination with other pharmacological agents known in the general art for therapeutic or prophylactic purposes, as they are valuable in treating one or more of the diseases or medical conditions mentioned above, such as diseases associated with STXBP1 haploinsufficiency. It should be understood that such combination therapies constitute further embodiments of the compositions and therapeutic methods provided herein.
[0089] The anhydrous pharmaceutical compositions and dosage forms containing ASOs provided herein are further encompassed. For example, the addition of water (e.g., 5%) is widely accepted in the pharmaceutical art as a means of simulating long-term storage and determining properties such as shelf life or the stability of the formulation over time. See, for example, Jens T. Carstensen, Drug Stability: Principles & Practice, 2d. Ed., Marcel Dekker, NY, NY, 1995, pp. 379-80. In practice, water and heat accelerate the degradation of some ASOs. Therefore, the effect of water on a formulation can be very important, as moisture and / or humidity are commonly encountered during the manufacture, handling, packaging, storage, shipping, and use of the formulation.
[0090] The anhydrous pharmaceutical compositions and dosage forms provided herein can be prepared using anhydrous or low-moisture-containing components and low-moisture or low-humidity conditions. Pharmaceutical compositions and dosage forms comprising lactose and at least one active ingredient comprising a primary or secondary amine are anhydrous if they are expected to come into considerable contact with moisture and / or humidity during manufacture, packaging, and / or storage.
[0091] Anhydrous pharmaceutical compositions should be prepared and stored in such a way that their anhydrous properties are maintained. Therefore, anhydrous compositions may be packaged using materials known to prevent exposure to water, and as a result, may be included in appropriate formulation kits. Examples of appropriate packaging include, but are not limited to, sealed foil, plastic, unit dose containers (e.g., vials), blister packs, and strip packs.
[0092] A. Injectable preparations, solutions, and emulsions Parenteral administration, generally characterized by injection into the spinal cavity, ventricle, eye, subcutaneous, intramuscular, or venous cavity, is also contemplated herein. Injectable substances can be prepared in conventional forms, either as a liquid solution or suspension, as a solid suitable for the solution or suspension in the liquid before injection, or as an emulsion. In some embodiments, the suspension is a suspension of fine particles or nanoparticles. In some embodiments, the emulsion is an emulsion of fine particles or nanoparticles. Suitable excipients include, for example, water, saline, glucose, glycerol, or ethanol. Furthermore, if desired, the administered pharmaceutical composition may also contain small amounts of non-toxic adjuncts such as wetting or emulsifying agents, pH buffers, stabilizers, solubility enhancers, and other such agents, such as sodium acetate, sorbitan monolaurate, triethanolamine oleate, and cyclodextrin. For intrathecal or intraventricular delivery, one or more preservatives, stabilizers, or excipients may be used in the composition. In this regard, numerous known and routinely used preservatives, stabilizers, and excipients useful for formulations for intrathecal or intraventricular delivery are known in the art. More specifically, examples of such additives to formulations for use in intrathecal or intraventricular delivery are described in International Publication 2013 / 096899. The implantation of sustained-release or sustained-release systems to maintain a certain level of dose is also intended herein.In short, the ASOs provided herein are dispersed within a solid inner matrix such as, for example, polymethyl methacrylate, polybutyl methacrylate, plasticized or unplasticized polyvinyl chloride, plasticized nylon, plasticized polyethylene terephthalate, natural rubber, polyisoprene, polyisobutylene, polybutadiene, polyethylene, ethylene vinyl acetate copolymer, silicone rubber, polydimethylsiloxane, silicone carbonate copolymer, hydrogels of acrylic and methacrylic acid esters, collagen, crosslinked polyvinyl alcohol, and crosslinked partially hydrolyzed polyvinyl acetate, which are dispersed within a solid inner matrix such as, for example, polyethylene The ASO is surrounded by an outer polymer membrane that is insoluble in body fluids, such as polypropylene, ethylene / propylene copolymer, ethylene / ethyl acrylate copolymer, ethylene / vinyl acetate copolymer, silicone rubber, polydimethylsiloxane, neoprene rubber, chlorinated polyethylene, and vinyl chloride copolymer with polyvinyl chloride and vinyl acetate, vinylidene chloride, ethylene and propylene, ionomer polyethylene terephthalate, butyl rubber, epichlorohydrin rubber, ethylene / vinyl alcohol copolymer, ethylene / vinyl acetate / vinyl alcohol terepolymer, and ethylene / vinyl oxyethanol copolymer. The ASO diffuses through the outer polymer membrane in a release rate control step. The proportion of active ASO contained in these parenteral compositions depends largely on their specific properties, as well as the activity of the ASO and the needs of the target.
[0093] Parenteral administration of the composition includes intrathecal, intraventricular, intraocular, intravenous, subcutaneous, and intramuscular administration. Preparations for parenteral administration include sterile, dry, soluble products such as sterile solutions ready for injection and lyophilized powders ready to be mixed with a solvent immediately before use, as well as subcutaneous tablets, sterile suspensions ready for injection, sterile, dry, insoluble products ready to be mixed with a vehicle immediately before use, and sterile emulsions. The solutions may be aqueous or non-aqueous.
[0094] When administered intravenously, suitable carriers include physiological saline or phosphate-buffered saline (PBS), as well as solutions containing thickeners and solubilizers such as glucose, polyethylene glycol, and polypropylene glycol, and mixtures thereof.
[0095] Examples of pharmaceutically acceptable carriers used in parenteral preparations include aqueous vehicles, non-aqueous vehicles, antimicrobial agents, isotonic agents, buffers, antioxidants, local anesthetics, suspensions and dispersants, emulsifiers, metal ion sequestering agents or chelating agents, and other pharmaceutically acceptable substances.
[0096] Examples of aqueous vehicles include sodium chloride injection, Ringer's injection, isotonic glucose injection, sterile water injection, glucose, and lactated Ringer's injection. Examples of non-aqueous parenteral vehicles include plant-derived fixative oils, cottonseed oil, corn oil, sesame oil, and peanut oil. Antimicrobial agents at bacteriostatic or fungiostatic concentrations must be added to parenteral preparations packaged in multi-dose containers containing phenol or cresol, mercury, benzyl alcohol, chlorobutanol, methyl and propyl p-hydroxybenzoates, thimerosal, benzalkonium chloride, and benzethonium chloride. Isotonic agents include sodium chloride and glucose. Buffers include phosphates and citrates. An antioxidant is sodium bisulfate. A local anesthetic is procaine hydrochloride. Suspensions and dispersants include sodium carboxymethylcellulose, hydroxypropyl methylcellulose, and polyvinylpyrrolidone. Examples of emulsifiers include polysorbate 80 (TWEEN® 80). Metal ion sequestering agents or chelating agents include EDTA. The pharmaceutical carrier also includes ethyl alcohol, polyethylene glycol, and propylene glycol for water-miscible vehicles, as well as sodium hydroxide, hydrochloric acid, citric acid, or lactic acid for pH adjustment.
[0097] The concentration of pharmaceutically active ASO is adjusted so that the injection provides an effective amount to produce the desired pharmacological effect. The exact dose depends on the age, weight, and condition of the subject or animal, as is known in the art.
[0098] Parenteral preparations for a unit dose are packaged in ampoules, vials, or syringes with needles. All preparations for parenteral administration must be sterilized in a manner known and practiced in the art.
[0099] Exemplary, intravenous or intra-arterial infusion of a sterile aqueous solution containing active ASO is an effective mode of administration. Another embodiment is a sterile aqueous solution, oily solution, or suspension containing the active substance, which is injected as needed to produce the desired pharmacological effect.
[0100] The injectable formulations are designed for both local and systemic administration. Typically, therapeutically effective doses are formulated to contain concentrations of at least about 0.1% w / w to a maximum of about 90% w / w or higher, such as more than 1% w / w of active ASO in the treated tissue. The active ingredient may be administered in a single dose or divided into several smaller doses to be administered at regular intervals. It is understood that the exact dosage and duration of treatment will vary depending on the tissue being treated and may be determined empirically using known test protocols or by extrapolation from in vivo or in vitro test data. It should also be noted that concentrations and dosages may vary depending on the age of the individual being treated. For any particular subject, a specific dosing regimen should be adjusted over time according to individual needs and the professional judgment of the person administering or supervising the administration of the formulation, and it should be further understood that the concentration ranges described herein are illustrative only and are not intended to limit the scope or practice of the claimed formulation.
[0101] ASO may be suspended in granular form or other suitable form, or derivatized to produce a more soluble active product or a prodrug. The form of the resulting mixture depends on several factors, including the intended mode of administration and the solubility of ASO in the selected carrier or vehicle. The effective concentration, which is sufficient to improve the symptoms of the condition, can be determined empirically.
[0102] B. Freeze-dried powder This specification also notes lyophilized powders that can be reconstituted for administration as solutions, emulsions, and other mixtures. They may also be reconstituted and formulated as solids or gels.
[0103] Sterilized lyophilized powders are prepared by dissolving ASO or a pharmaceutically acceptable salt thereof, as provided herein, in a suitable solvent. The solvent may contain excipients that improve the stability of the powder or the reconstituted solution prepared from the powder, or other pharmacological components. Excipients that may be used include, but are not limited to, glucose, sorbitol, fructose, corn syrup, xylitol, glycerin, glucose, sucrose, or other suitable agents. The solvent may also contain a buffer such as citrate, sodium phosphate, or potassium phosphate, or, in one embodiment, another buffer known to those skilled in the art at a nearly neutral pH. The desired formulation is provided by subsequent sterile filtration of the solution and lyophilization under standard conditions known to those skilled in the art. Generally, the resulting solution is dispensed into vials for lyophilization. Each vial contains a single dose (containing, but not limited to, 10 to 1000 mg or 100 to 500 mg) or multiple doses of ASO. The lyophilized powder can be stored under suitable conditions, such as from about 4°C to room temperature.
[0104] Reconstituting this lyophilized powder with water for injection provides a formulation for parenteral administration. For reconstitution, approximately 1–50 mg, 5–35 mg, or 9–30 mg of the lyophilized powder is added per 1 mL of sterile water or other suitable carrier. The exact amount depends on the selected ASO. These amounts can be determined empirically.
[0105] C. Local administration Topical mixtures are prepared as described for topical and systemic administration. The resulting mixtures may be solutions, suspensions, emulsions, etc., and may be formulated as creams, gels, ointments, emulsions, solutions, elixirs, lotions, suspensions, tinctures, pastes, foams, aerosols, cleansers, sprays, suppositories, bandages, skin patches, or any other formulation suitable for topical administration.
[0106] ASOs or pharmaceutically acceptable salts thereof may be formulated as aerosols for topical application, such as by inhalation (see, for example, U.S. Patents 4,044,126, 4,414,209, and 4,364,923, which describe aerosols for the delivery of steroids useful in the treatment of inflammatory diseases, particularly asthma). These formulations for administration to the airways may be in the form of aerosols or solutions for nebulizers, or in the form of fine powders for inhalation, either alone or in combination with an inert carrier such as lactose. In such cases, the particles of the formulation have a diameter of less than 50 microns or less than 10 microns.
[0107] ASO may be formulated in the form of gels, creams, and lotions for ocular, cisternal, or intraspinal application, or for topical or local application, such as for topical application to the skin and mucous membranes such as the eyes. Topical administration is intended for transdermal delivery, as well as for administration to the eyes or mucous membranes, or for inhalation therapy. Active ASO may also be administered as a nasal solution alone or in combination with other pharmaceutically acceptable excipients.
[0108] These solutions, particularly those intended for ophthalmic use, may be formulated as 0.01% to 10% isotonic solutions with a pH of approximately 5 to 7, using appropriate salts.
[0109] D. Sustained-release compositions The active ingredients provided herein may be administered by controlled release means or by delivery devices well known to those skilled in the art. Examples include U.S. Patents No. 3,845,770, 3,916,899, 3,536,809, 3,598,123, and U.S. Patents No. 4,008,719, 5,674,533, 5,059,595, 5,591,767, 5,120,548, 5,073,543, 5,639,476, 5,354,556, 5,639,480, 5,733,566, 5,739,108, and 5,891,474, which are incorporated herein by reference. Nos. 5,922,356, 5,972,891, 5,980,945, 5,993,855, 6,045,830, 6,087,324, 6,113,943, 6,197,350, 6,248,363, 6,264,970, 6,267,981, 6,376,461, 6,419,961, 6,589,548, 6,613,358, 6,699,500, and 6,740,634 are examples, but are not limited to these. Using such dosage forms, for example, hydroxypropyl methylcellulose, other polymer matrices, gels, permeable membranes, osmotic systems, multilayer coatings, microparticles, liposomes, microspheres, or combinations thereof, it is possible to provide sustained-release or controlled release of one or more active ingredients and to provide desired release profiles in various proportions. Suitable controlled-release formulations known to those skilled in the art, including those described herein, can be readily selected for use with the active ingredients provided herein.
[0110] All controlled-release pharmaceuticals share the common objective of improving pharmacotherapy beyond what can be achieved by their uncontrolled-release counterparts. In one embodiment, the use of an optimally designed controlled-release preparation in a medical procedure is characterized by the smallest amount of active pharmaceutical ingredient used to cure or control a condition in the shortest possible time. In some embodiments, the advantages of controlled-release formulations include extended drug activity, reduced administration frequency, and increased target compliance. In addition, controlled-release formulations can be used to influence other characteristics such as the time of action onset or drug blood levels, and therefore can influence the occurrence of side effects (e.g., adverse events).
[0111] Most controlled-release formulations are designed to initially release a rapid amount of the drug (active ingredient) to produce the desired therapeutic effect, and then gradually and continuously release other amounts of the drug to maintain this level of therapeutic or preventive effect over a longer period. To maintain this constant level of drug in the body, the drug must be released from the dosage form at a rate that replaces the amount of drug metabolized and excreted from the body. The controlled release of the active ingredient can be stimulated by a variety of conditions, including but not limited to pH, temperature, enzymes, water, or other physiological conditions or ASOs.
[0112] In some embodiments, the drug may be administered by intravenous infusion, an implantable osmotic pump, a transdermal patch, liposomes, or other modes of administration. In one embodiment, a pump may be used (see Sefton, CRC Crit.Ref.Biomed.Eng.14:201(1987); Buchwald et al., Surgery 88:507(1980); Saudek et al., N.Engl.J.Med.321:574(1989)). In another embodiment, a polymer material may be used. In yet another embodiment, the controlled release system may be positioned near the therapeutic target, i.e., requiring only a portion of the systemic dose (see, for example, Goodson, Medical Applications of Controlled Release, vol.2, pp.115-138(1984)).
[0113] In some embodiments, controlled-release devices are introduced to targets near sites of inappropriate immune activation or tumors. Other controlled-release systems are discussed in a review by Langer (Science 249:1527-1533 (1990)). The active ingredient is dispersed in a solid inner matrix such as, for example, polymethyl methacrylate, polybutyl methacrylate, plasticized or unplasticized polyvinyl chloride, plasticized nylon, plasticized polyethylene terephthalate, natural rubber, polyisoprene, polyisobutylene, polybutadiene, polyethylene, ethylene vinyl acetate copolymer, silicone rubber, polydimethylsiloxane, silicone carbonate copolymer, hydrogels of acrylic and methacrylic acid esters, collagen, crosslinked polyvinyl alcohol, and crosslinked partially hydrolyzed polyvinyl acetate, for example, polyethylene, polypropylene, ethylene / propylene copolymer, ethylene / ethyl acrylate copolymer. The product is surrounded by an outer polymer membrane that is insoluble in bodily fluids, such as ethylene / vinyl acetate copolymer, silicone rubber, polydimethylsiloxane, neoprene rubber, chlorinated polyethylene, polyvinyl chloride, vinyl chloride copolymer with vinyl acetate, vinylidene chloride, ethylene and propylene, ionomer polyethylene terephthalate, butyl rubber, epichlorohydrin rubber, ethylene / vinyl alcohol copolymer, ethylene / vinyl acetate / vinyl alcohol terpolymer, and ethylene / vinyl oxyethanol copolymer. The active ingredient is then diffused through the outer polymer membrane in a release rate control step. The proportion of the active ingredient contained in these parenteral compositions depends largely on their specific properties and the needs of the target.
[0114] E. Targeted Therapies ASOs or pharmaceutically acceptable salts thereof provided herein may also be formulated to target specific tissues, receptors, or other areas of the body being treated, including liposomes, resealed red blood cells, and antibody-based delivery systems. Many of these targeting methods are well known to those skilled in the art. All such targeting methods are contemplated herein for use in the compositions of the present invention. For non-limiting examples of targeting methods, see, for example, U.S. Patents 6,316,652, 6,274,552, 6,271,359, 6,253,872, 6,139,865, 6,131,570, 6,120,751, 6,071,495, 6,060,082, 6,048,736, 6,039,975, 6,004,534, 5,985,307, 5,972,366, 5,900,252, 5,840,674, 5,759,542, and 5,709,874.
[0115] In one embodiment, the antibody-based delivery system is, for example, an antibody-drug conjugate ("ADC") as described in Hamilton GS, Biologicals, 2015 September, 43(5):318-32; Kim EG and Kim KM, Biomol. Ther. (Seoul), 2015 November, 23(6):493-509; and Peters C and Brown S, Biosci. Rep., 2015 Jun. 12, 35(4)pii:e00225, each of which is incorporated herein by reference.
[0116] In one embodiment, liposome suspensions containing tissue-targeting liposomes, such as tumor-targeting liposomes, may also be suitable as pharmaceutically acceptable carriers. These can be prepared according to methods known to those skilled in the art. For example, liposome formulations may be prepared as described in U.S. Patent No. 4,522,811. Briefly, liposomes such as multilayer vesicles (MLVs) can be formed by drying egg phosphatidylcholine and brain phosphatidylserine (7:3 molar ratio) inside a flask. A solution of ASO provided herein in phosphate-buffered saline (PBS) without divalent cations (PBS) is added, and the flask is shaken until the lipid film is dispersed. The resulting vesicles are washed to remove any unencapsulated ASO, pelletized by centrifugation, and then resuspended in PBS.
[0117] v. Administration The ASOs and pharmaceutical compositions provided herein may be administered in specific therapeutic or prophylactic doses, at specific time intervals, in specific dosage forms, and by specific administration methods as described below.
[0118] In one embodiment, a therapeutically effective or prophylactically effective dose of ASO is approximately 0.005 to approximately 1,000 mg / day, approximately 0.01 to approximately 500 mg / day, approximately 0.01 to approximately 250 mg / day, approximately 0.01 to approximately 100 mg / day, approximately 0.1 to approximately 100 mg / day, approximately 0.5 to approximately 100 mg / day, approximately 1 to approximately 100 mg / day, approximately 0.01 to approximately 50 mg / day, approximately 0.1 to approximately 50 mg / day, approximately 0.5 to approximately 50 mg / day, approximately 1 to approximately 50 mg / day, approximately 0.02 to approximately 25 mg / day, approximately 0.05 to approximately 10 mg / day, approximately 0.05 to approximately 5 mg / day, approximately 0.1 to approximately 5 mg / day, or approximately 0.5 to approximately 5 mg / day.
[0119] In one embodiment, the therapeutic or prophylactic effective dose is about 0.1, about 0.2, about 0.5, about 1, about 2, about 3, about 4, about 5, about 6, about 7, about 8, about 9, about 10, about 15, about 20, about 25, about 30, about 40, about 45, about 50, about 60, about 70, about 80, about 90, about 100, or about 150 mg / day.
[0120] In one embodiment, the recommended daily dose range of the ASO or its derivatives provided herein for the conditions described herein is in the range of about 0.5 mg to about 50 mg / day, given in one embodiment as a single dose once daily or as divided doses throughout the day. In some embodiments, the dose is in the range of about 1 mg to about 50 mg / day. In other embodiments, the dose is in the range of about 0.5 to about 5 mg / day. Specific daily doses include 0.1, 0.2, 0.5, 1, 2, 3, 4, 5, 6, 7, 8, 9, 10, 11, 12, 13, 14, 15, 16, 17, 18, 19, 20, 21, 22, 23, 24, 25, 26, 27, 28, 29, 30, 31, 32, 33, 34, 35, 36, 37, 38, 39, 40, 41, 42, 43, 44, 45, 46, 47, 48, 49, or 50 mg / day.
[0121] In certain embodiments, the recommended starting dose may be 0.5, 1, 2, 3, 4, 5, 10, 15, 20, 25, or 50 mg / day. In other embodiments, the recommended starting dose may be 0.5, 1, 2, 3, 4, or 5 mg / day. The dose may be gradually increased to 15, 20, 25, 30, 35, 40, 45, and 50 mg / day. In certain embodiments, ASO can be administered in amounts of about 25 mg / day. In certain embodiments, ASO can be administered in amounts of about 10 mg / day. In certain embodiments, ASO can be administered in amounts of about 5 mg / day. In certain embodiments, ASO can be administered in amounts of about 4 mg / day. In certain embodiments, ASO can be administered in amounts of about 3 mg / day.
[0122] In certain embodiments, a therapeutically effective amount or a prophylactically effective amount is from about 0.001 to about 100 mg / kg / day, from about 0.01 to about 50 mg / kg / day, from about 0.01 to about 25 mg / kg / day, from about 0.01 to about 10 mg / kg / day, from about 0.01 to about 9 mg / kg / day, from 0.01 to about 8 mg / kg / day, from about 0.01 to about 7 mg / kg / day, from about 0.01 to about 6 mg / kg / day, from about 0.01 to about 5 mg / kg / day, from about 0.01 to about 4 mg / kg / day, from about 0.01 to about 3 mg / kg / day, from about 0.01 to about 2 mg / kg / day, from about 0.01 to about 1 mg / kg / day, or from about 0.01 to about 0.05 mg / kg / day.
[0123] The administered dosage can also be expressed in units other than mg / kg / day. For example, a dosage for parenteral administration can be expressed as mg / m 2 / day. One of ordinary skill in the art will readily know how to convert a dosage from mg / kg / day to mg / m 2 / day given the height or weight, or both, of the subject (see www.fda.gov / cder / cancer / animalframe.htm). For example, a dosage of 1 mg / kg / day for a 65 kg human is approximately equal to 38 mg / m 2 / day.
[0124] In certain embodiments, the amount of ASO administered is sufficient to provide a plasma concentration of ASO in the range of from about 0.001 to about 500 μM, from about 0.002 to about 2 hundred μM, from about 0.005 to about 100 μM, from about 0.01 to about 50 μM, from about 1 to about 50 μM, from about 0.02 to about 25 μM, from about 0.05 to about 20 μM, from about 0.1 to about 20 μM, from about 0.5 to about 20 μM, or from about 1 to about 20 μM at steady state.
[0125] In other embodiments, the amount of ASO administered is sufficient to provide a plasma concentration of ASO at steady state and is in the range of from about 5 to about 100 nM, from about 5 to about 50 nM, from about 10 to about 100 nM, from about 10 to about 50 nM, or from about 50 to about 100 nM.
[0126] As used herein, the term “steady-state plasma concentration” refers to the concentration reached after a period of administration of the ASO or its derivatives provided herein. Upon reaching a steady state, there are slight peaks and troughs on the time-dependent curve of the plasma concentration of the ASO.
[0127] In one embodiment, the amount of ASO administered is sufficient to provide the maximum plasma concentration (peak concentration) of ASO, and is in the range of about 0.001 to about 50 μM, about 0.002 to about 200 μM, about 0.005 to about 100 μM, about 0.01 to about 50 μM, about 1 to about 50 μM, about 0.02 to about 25 μM, about 0.05 to about 20 μM, about 0.1 to about 20 μM, about 0.5 to about 20 μM, or about 1 to about 20 μM.
[0128] In one embodiment, the amount of ASO administered is sufficient to provide a minimum plasma concentration (trough concentration) of ASO, and is in the range of about 0.001 to about 500 μM, about 0.002 to about 200 μM, about 0.005 to about 100 μM, about 0.01 to about 50 μM, about 1 to about 50 μM, about 0.01 to about 25 μM, about 0.01 to about 20 μM, about 0.02 to about 20 μM, about 0.02 to about 20 μM, or about 0.01 to about 20 μM.
[0129] In one embodiment, the amount of ASO administered is sufficient to provide the area under the curve (AUC) of ASO, and is in the range of about 100 to about 100,000 ng*hr / mL, about 1,000 to about 50,000 ng*hr / mL, about 5,000 to about 25,000 ng*hr / mL, or about 5,000 to about 10,000 ng*hr / mL.
[0130] The methods provided herein encompass the treatment of patients regardless of their age, although some diseases or disorders are more common in specific age groups.
[0131] Depending on the disease being treated and the condition of the subject, the ASOs or derivatives provided herein may be administered orally, parenterally (e.g., intramuscular, intraperitoneal, intravenous, CIV, intracisional injection or infusion, subcutaneous injection, or implant), by inhalation, nasal, vaginal, rectal, sublingual, or topically (e.g., transdermal or topical). The ASOs or derivatives provided herein may be formulated alone or in appropriate dosage units with pharmaceutically acceptable excipients, carriers, adjuvants, and vehicles appropriate for each route of administration.
[0132] In one embodiment, the ASO or its derivatives provided herein are administered orally. In another embodiment, the ASO or its derivatives provided herein are administered parenterally. In yet another embodiment, the ASO or its derivatives provided herein are administered intravenously.
[0133] ASOs or derivatives provided herein can be delivered, for example, as a single bolus injection or as a single dose such as an oral tablet or pill, or over time, for example, by continuous infusion over time or by divided bolus administration over time. ASOs can be administered repeatedly as needed, for example, until the subject experiences stable disease or regression, or until the subject experiences disease progression or unacceptable toxicity. For example, stable disease in solid tumors generally means that the vertical diameter of the measurable lesion has not increased by 25% or more since the last measurement. Response Evaluation Criteria in Solid Tumors (RECIST) Guidelines, Journal of the National Cancer Institute 92(3):205 216(2000). Stable disease or absence thereof is determined by methods known in the art, such as evaluation of the patient's symptoms, physical examination, visualization of the tumor imaged using X-ray, CAT, PET, or MRI scans, and other generally accepted evaluation modalities.
[0134] ASOs or their derivatives provided herein may be divided into once-daily (QD) or multiple daily doses such as twice-daily (BID), three-daily (TID), and four-daily (QID). Furthermore, administration may be continuous (i.e., daily or daily for consecutive days), intermittent, or cyclical (i.e., including drug-free rest periods of several days, weeks, or months). As used herein, the term “daily” is intended to mean that a therapeutic ASO, such as an ASO or its derivatives provided herein, is administered, for example, once or twice daily for a certain period. The term “continuous” is intended to mean that a therapeutic ASO, such as an ASO or its derivatives provided herein, is administered daily for an uninterrupted period of at least 10 days to 52 weeks. As used herein, the terms “intermittent” or “intermittently” are intended to mean stopping and starting at regular or irregular intervals. For example, intermittent administration of ASOs or derivatives provided herein may be administration one to six days per week, administration in cycles (e.g., two to eight weeks of continuous daily administration followed by a rest period of up to one week without administration), or administration every other day. As used herein, the term “cycle” is intended to mean that a therapeutic ASO, such as an ASO or derivative provided herein, is administered daily or continuously, but with rest periods. In some such embodiments, administration is once daily for two to six days, followed by a rest period of five to seven days without administration.
[0135] In some embodiments, the administration frequency is in the range of approximately once a day to approximately once a month. In some embodiments, administration is once a day, twice a day, three times a day, four times a day, once every other day, twice a week, once a week, once every two weeks, once every three weeks, or once every four weeks. In one embodiment, the ASO or its derivatives provided herein are administered once a day. In another embodiment, the ASO or its derivatives provided herein are administered twice a day. In yet another embodiment, the ASO or its derivatives provided herein are administered three times a day. In yet another embodiment, the ASO or its derivatives provided herein are administered four times a day.
[0136] In one embodiment, the ASO or its derivatives provided herein are administered once daily for one to six months, one to three months, one to four weeks, one to three weeks, or one to two weeks. In another embodiment, the ASO or its derivatives provided herein are administered once daily for one week, two weeks, three weeks, or four weeks. In one embodiment, the ASO or its derivatives provided herein are administered once daily for four days. In another embodiment, the ASO or its derivatives provided herein are administered once daily for five days. In another embodiment, the ASO or its derivatives provided herein are administered once daily for six days. In another embodiment, the ASO or its derivatives provided herein are administered once daily for one week. In yet another embodiment, the ASO or its derivatives provided herein are administered once daily for two weeks. In yet another embodiment, the ASO or its derivatives provided herein are administered once daily for three weeks. In yet another embodiment, the ASO or its derivatives provided herein are administered once daily for four weeks.
[0137] VI. Treatment method In one embodiment, the ASO provided herein is useful for increasing the expression of STXBP1. In another embodiment, the ASO provided herein increases the expression of the STXBP1 protein when in contact with cells such as nerve cells. In yet another embodiment, the ASO provided herein increases the level of functional STXBP1 protein in nerve cells compared to control cells not in contact with the ASO. In yet another embodiment, the ASO provided herein increases the synaptic local expression of the STXBP1 protein in a composition containing nerve cells. In one embodiment, the composition containing nerve cells is present in vivo.
[0138] In one embodiment, the ASO provided herein modulates the expression of STXBP1. In another embodiment, the ASO provided herein increases the expression of STXBP1 in neurons. In yet another embodiment, neurons are haploinsufficient to STXBP1 and / or heterozygous for harmful mutations in STXBP1.
[0139] Methods are also provided herein for treating, preventing, or delaying the onset of STXBP1 disorders using the ASO provided herein. In one embodiment, the method provided herein results in an increase in intracellular STXBP1 levels and is therefore useful as a method for treating diseases associated with STXBP1 deficiency (i.e., reduced STXBP1 levels and / or loss-of-function mutations in the STXBP1 gene). In another embodiment, a method is provided for treating, preventing, or delaying the onset of diseases caused by a quantitative decrease in a given normal STXBP1 protein level. In some embodiments, the method provided herein may be carried out in vitro, ex vivo, or in vivo.
[0140] In one embodiment, STXBP1 disorder is associated with STXBP1 haploinsufficiency. In one embodiment, STXBP1 disorder is encephalopathy. In another embodiment, STXBP1 disorder is STXBP1 encephalopathy. In another embodiment, STXBP1 disorder is epilepsy. In another embodiment, STXBP1 disorder is epileptic encephalopathy.
[0141] In another embodiment, STXBP1 disorder is a severe early-onset epileptic encephalopathy or non-syndromic epilepsy selected from Ohtahara syndrome, West syndrome, Lennox-Gastaut syndrome, Dravet syndrome, early myoclonic encephalopathy, unclassified early-onset epileptic encephalopathy associated with STXBP1 haploinsufficiency, atypical Rett syndrome, and severe intellectual disability without epilepsy associated with STXBP1 haploinsufficiency. In one embodiment, STXBP1 disorder is epilepsy, generalized delay, cognitive impairment (mild to severe), motor impairment, hypotonia, or autism.
[0142] In another embodiment, STXBP1 disorder is DEE4, developmental and epileptic encephalopathy 4, developmental and epileptic encephalopathy type 4, early infant epileptic encephalopathy 4, EIEE4, STXBP1 encephalopathy with epilepsy, STXBP1 epileptic encephalopathy, STXBP1-associated developmental and epileptic encephalopathy, STXBP1-associated early-onset encephalopathy, or STXBP1-associated epileptic encephalopathy.
[0143] In another embodiment, methods are provided for treating, preventing, or delaying the onset of disorders caused by STXBP1 mutations using ASOs provided herein. Many of these mutations are missense mutations, and many of these mutations are publicly known (see, for example, www.stxbp1disorders.org / what-is-stxbp1).
[0144] In another embodiment, a method is provided for treating, preventing, or delaying the onset of a disease in which the disease reduces STXBP1 levels, using an ASO provided herein. In yet another embodiment, a method is provided for increasing STXBP1 levels in a subject having a disease in which the disease reduces STXBP1 levels, by administering an ASO provided herein to the subject. In yet another embodiment, the disease is amyotrophic lateral sclerosis (ALS). In these embodiments, the STXBP1 gene does not need to carry a mutation.
[0145] VII. Combination therapy using a second active agent The ASOs or derivatives provided herein may also be combined with or used in combination with other therapeutic agents useful for the treatment and / or prevention of STXBP1 disorders.
[0146] In one embodiment, a method for treating, preventing, or delaying STXBP1 disorder is provided herein, comprising administering an ASO or a derivative thereof, provided herein, in combination with one or more second activators.
[0147] As used herein, the term “combination” includes the use of two or more therapies (e.g., one or more prophylactic and / or therapeutic agents). However, the use of the term “combination” does not limit the order in which therapies (e.g., prophylactic and / or therapeutic agents) are administered to a subject with a disease or disorder. The first therapy (e.g., a prophylactic or therapeutic agent such as an ASO provided herein, an ASO provided herein, or a derivative thereof) may be administered before (e.g., 5 minutes, 15 minutes, 30 minutes, 45 minutes, 1 hour, 2 hours, 4 hours, 6 hours, 12 hours, 24 hours, 48 hours, 72 hours, 96 hours, 1 week, 2 weeks, 3 weeks, 4 weeks, 5 weeks, 6 weeks, 8 weeks, or 12 weeks before) or after the administration of the second therapy (e.g., a prophylactic or therapeutic agent) to the subject. Triple therapy is also intended herein.
[0148] The administration of ASOs or their derivatives provided herein, and one or more secondary active agents, to a target may occur simultaneously or sequentially via the same or different routes of administration. The suitability of a particular route of administration used for a particular active agent depends on the active agent itself (e.g., whether it can be administered orally without being broken down before entering the bloodstream) and the disease or disorder being treated.
[0149] The route of administration of ASO or its derivatives provided herein is independent of the route of administration of the second therapy. In another embodiment, the ASO or its derivatives provided herein are administered intrathecal, intraventricular, intraocular, or intravenously. Accordingly, according to these embodiments, the ASO or its derivatives provided herein are administered intrathecal, intraventricular, intraocular, or intravenously, and the second therapy may be administered orally, parenterally, intraperitoneally, intravenously, intra-arterially, transdermally, sublingually, intramuscularly, rectally, transbuccally, intranasally, intraliposomally, by inhalation, intravaginally, intraocularly, locally by catheter or stent, subcutaneously, intrafatally, intra-articularly, intrathecally, intraventricularly, or in sustained-release form. In one embodiment, the ASO or its derivatives provided herein and the second therapy are administered by the same mode of administration, for example, intrathecally, intraventricularly, intraocularly, or intravenously. In another embodiment, the ASO or its derivatives provided herein are administered by one mode of administration, for example, intrathecal, intraventricular, intraocular, or intravenous, while the second agent is administered by another mode of administration, for example, oral administration.
[0150] In one embodiment, the second activator is administered intravenously or subcutaneously once or twice daily in amounts of about 1 to about 1000 mg, about 5 to about 500 mg, about 10 to about 350 mg, or about 50 to about 200 mg. The specific amount of the second activator depends on the specific drug used, the type of disease being treated or managed, the severity and stage of the disease, the amount of ASO or its derivatives provided herein, and any additional activators administered concurrently to the subject.
[0151] One or more second active ingredients or agents may be used in conjunction with the ASO or its derivatives provided herein in the methods and compositions provided herein. The second activator may be a polymer (e.g., a protein) or a small molecule (e.g., a synthetic inorganic molecule, an organometallic molecule, or an organic molecule).
[0152] Examples of macromolecular surfactants include, but are not limited to, hematopoietic growth factors, cytokines, and monoclonal and polyclonal antibodies. Typical macromolecular surfactants are biomolecules such as native proteins, synthetic proteins, or recombinant proteins.
[0153] In one embodiment, the second activator is stiripentol, cannabidiol, levetiracetam, gene therapy drugs, 4-phenylbutyrate, adrenocorticotropic hormone (ACTH), topiramate, or prednisone. [Examples]
[0154] VIII. Examples The following examples are intended to illustrate specific embodiments provided herein and are not intended to limit the scope of this disclosure.
[0155] Example 1 ASOs of various lengths were designed for STXBP1 mRNA sequences, and then their restoration of STXBP1 protein levels was tested in STXBP1 heterozygous iPSC-derived neuronal cell line models.
[0156] AI-based ASO design
[0157] Using an artificial intelligence (AI)-based platform developed by Deep Genomics, Inc. (Toronto, Canada), we designed ASOs that target STXBP1 mRNA or premRNA and are predicted to restore or increase STXBP1 expression using a variety of different mechanisms. The set of 390 ASOs identified in Table 3 were then selected for in vitro primary screening using an STXBP1 haploinsufficient cell model with the HiBiT-Tag luciferase system described below.
[0158] STXBP1 cell model
[0159] iPSC-derived neurons (iNeurons) obtained under license from iPS Academia Japan (Kyoto, Japan) were used as a physiologically relevant model. Upon maturation in culture, iNeurons formed functional presynaptic and postsynaptic specializations, and within 3 weeks in vitro, they exhibited action potentials, voltage-gated Na+ and K+ currents, and induced excitatory postsynaptic currents (Zhang et al., Neuron 78, no.5 (June 2013):785-98; Meijer et al., Cell Reports 27, no.7 (May 2019):2199-2211.e6). Calcium imaging and multi-electrode array recordings also showed spontaneous and synapse-mediated action potentials blocked by the glutamate receptor antagonist CNQX.
[0160] The model used possesses a neurogenin-2 (NGN2) transgene under the control of an inductive promoter. iPSCs with this NGN2 induction system strongly express neurogenin-2, which rapidly and irreversibly induces their differentiation into excitatory iNeurons.
[0161] STXBP1 haploinsufficiency
[0162] The pathogenic mechanism of STXBP1 mutations is consistent with haploinsufficiency (Stamberger et al., see above). Therefore, this was modeled by introducing a frameshift mutation near the 5' end of the STXBP1 transcript.
[0163] CRISPR-Cas9 editing
[0164] Starting with the aforementioned NGN2-induced iPSCs, cells were edited using CRISPR-Cas9 with a guide RNA (5'-TGGTGGATCAGTTAAGCATG-3') (SEQ ID NO: 627) that specifically and efficiently cleaves at position chr9:127,653,738 (hg38). One successfully edited clone (1A2) showed two nucleotide deletions on a single allele, resulting in the disruption of the leading frame for constructing an STXBP1 Het-HiBiT iNeuron (i.e., an STXBP1 heterozygous clone).
[0165] Protein quantification of STXBP1 heterozygous clones
[0166] Disruption of the reading frame, leading to a decrease in STXBP1 protein, was confirmed in two independent batches of iNeuron. Protein solubilates were collected 7 days after neuronal induction, and STXBP1 protein levels were measured using the Jess WB system. STXBP1 signaling was normalized against the corresponding gamma-tubulin signaling as a loading control. Clone 1A2 showed approximately a 50% reduction in STXBP1 protein.
[0167] HiBiT-Tag Luciferase System
[0168] The HiBiT tag was introduced into the aa527 (loops 524-531) of the STXBP1 protein in clone 1A2. The resulting clone 1A2-E11 was tested for protein stability using the Jess WB system. STXBP1 heterozygous HiBiT-tagged iNeuron showed approximately half the amount of STXBP1 protein compared to untagged WT iNeuron, indicating that protein stability was not adversely affected by the HiBiT tag.
[0169] HiBiT-Tag Screening
[0170] STXBP1 Het-HiBiT iNeuron (clones 1A2-E11) were seeded at a density of 25,000 cells / well in pre-coated PDL 96-well plates. The day after seeding, the medium was removed and ASO was added at a final concentration of 5 μM. After 10 days, the number of viable cells was estimated using the Cell-Titer Fluor assay, and the HiBiT assay was performed.
[0171] HiBiT values were normalized to CTF values using linear regression. The magnification change was calculated relative to the mean of the untargeted control. Table 4 below provides data from the HiBiT-tag assay, showing the magnification change relative to the untargeted control. [Table 4-1] [Table 4-2] [Table 4-3] [Table 4-4] [Table 4-5] [Table 4-6] [Table 4-7] [Table 4-8] [Table 4-9] [Table 4-10] [Table 4-11] [Table 4-12]
[0172] A subset of ASOs from Table 4 was selected for further validation by ELISA (Example 2) based on reproducibility and magnification threshold.
[0173] Example 2 The ASO for STXBP1 selected from Example 1 was evaluated by ELISA as a separate validation of the increase in STXBP1 levels.
[0174] ASO was screened using 5 μM ELISA. Briefly, non-HiBiT-tagged STXBP1 Het iNeuron cells were seeded at a density of 50,000 cells / well in pre-coated PDL 96-well plates. The day after seeding, the medium was removed and ASO was added at a final concentration of 5 μM. After 17 days, the number of viable cells was estimated using a Cell-Titer Fluor assay, and the cells were lysed for ELISA. To avoid artifact normalization, the concentration values from the ELISA were not normalized to CTF values. Rather, both sets of values were considered separately when evaluating ASO. The ELISA fold change was calculated relative to the mean of the untargeted control in the plate. The results are shown in Figures 4A–J and 5.
[0175] Example 3 Dose response study
[0176] The ASOs provided herein were evaluated in a six-point, 1:2 dilution serial dose-response study. Briefly, STXBP1 Het iNeuron was treated by gymnosis with 0.3125 μM, 0.625 μM, 1.25 μM, 2.5 μM, 5 μM, and 10 μM ASOs. STXBP1 protein levels were measured using the Jess WB system. The STXBP1 signal was normalized to the corresponding gamma-tubulin signal as a loading control. The fold change values were calculated compared to an untargeted control at an equivalent dose and are shown in Figures 1A–G. Each point represents technical replication. The analysis was performed using median fitting to a four-parameter logistic curve. EC 50 and Y max If calculable, the values are shown in Table 5 below. [Table 5]
[0177] Example 4 Verification in iNeuron cell lines
[0178] To test the efficacy of the ASOs provided herein, STXBP1 heterozygous (Het) and wild-type (WT) iNeurons were treated in parallel with a 5 μM dose. Data were collected from two independent biological replicas, each performed on a different day, using different batches of neurons and treated with independently synthesized lots of the ASO compound. For STXBP1 Het only, data from the 5 μM treatment dose from the dose-response study (Example 3) was included as an additional third biological replica.
[0179] Similar to the dose-response study described in Example 3, STXBP1 protein levels were measured using the Jess WB system. The STXBP1 signal was normalized to the corresponding gamma-tubulin signal as a loading control. The fold change values were calculated for STXBP1 Het or WT iNeuron, respectively, treated with untargeted controls, and are shown in the table below.
[0180] To test for a significant increase in the magnification change, a one-sample, one-tailed t-test was used for each ASO against the null hypothesis 1, where a magnification change (FC) of 1 implies no change from the untargeted control μ ≤ (*p<0.05, **p<0.01, ***p<0.001). The data are provided in Table 6 below. [Table 6]
[0181] Example 5 Functional Verification
[0182] The effects of ASOs provided herein on synaptic function were evaluated using a MaxWell high-density multi-electrode array (hd-MEA) system. As neurons mature in vitro, synapse formation results in synchronized bursts of action potentials, the burst frequency of which is partially controlled by presynaptic function. Sun and Sudhof (2021) Journal of Neuroscience Methods 349, 109041 previously demonstrated that calcium imaging reduces the burst frequency of STXBP1 heterozygous neurons compared to WT neurons.
[0183] In short, STXBP1 Het iNeuron and WT iNeuron were co-cultured separately with human primary astrocytes in a 5:1 ratio (iNeuron:astrocyte). ASO was added on days 1 and 15 after grafting. Following this protocol, asynchronous action potential activity can typically be detected about two weeks after grafting. In vitro, by about 17-20 days, action potentials begin to synchronize, but burst frequency is inconsistent and tends to fluctuate by several minutes. To avoid capturing inaccurate burst frequency data during this period, after burst activity stabilized, burst frequency was measured in vitro at days 28 and 35 (DIV: d ays i n vMeasured using iTrial (ITRO). The burst frequencies at both time points are shown in the table below as a percentage of WT. Note that the burst frequency of STXBP1 Het iNeuron treated with the untargeted ASO control in DIV28 was 52.4% of WT, which is the estimated baseline when evaluating the ASOs provided herein for functional recovery. Two-sided t-tests assuming unequal variances were used to test for significant differences at each time point between the treatment condition and the control condition (STXBP1 Het iNeuron treated with the untargeted ASO control) (*p<0.05, **p<0.01, ***p<0.001). Data are provided in Table 7 below.
[0184] [Table 7]
[0185] Example 6 The effect of ASO on cell viability was evaluated.
[0186] Cell viability
[0187] Cell viability was assessed after treatment with a 5 μM dose for 17 days. Cell viability was determined using the Cell-Titer Fluor assay. For ease of comparison, the raw CTF values (relative fluorescence units) from four technical replicas for each ASO were replotted in Figures 2A–G along with the values for untargeted ASO controls collected from the same plate as the target ASOs. Cell viability was also calculated as a percentage of untargeted ASO controls and is shown in Table 8 below.
[0188] To test for significant differences in cell viability between the ASO provided herein and the untargeted ASO control, two-sided t-tests were used assuming unequal variances (*p<0.05, **p<0.01, ***p<0.001). [Table 8]
[0189] Example 7 PBMC Test
[0190] To test the potential immunostimulatory effects of the ASOs provided herein, a human peripheral blood mononuclear cell (PBMC) assay was performed. The selected ASOs shown in Table 9 below were purified by HPLC (>85% full length), their identity was confirmed by ESI-MS (±0.05%), and they were tested for endotoxin (<0.1 EU / mg). PBMCs were supplied from seven donors, of which five were selected for the assay. From each of the five donors, 100,000 PBMCs (96 wp) were seeded per well, and the ASOs were added in triplicates for gymnosis at concentrations of 0.08 μM, 0.4 μM, 2 μM, 10 μM, and 40 μM. After 24 hours, cytokine levels of IL-6, IL-1β, IL-12p70, IFNα2a, IFN-γ, and TNF-α were measured using the MSD U-Plex platform.
[0191] To assess donor suitability, internal quality control checks were performed for each of the five donors using PBS and culture medium-only controls. If any donor was found to consistently show elevated cytokine levels without any treatment, the results from that donor were deemed unsuitable for inclusion in these analyses. In this study, none of the five donors used in the PBMC assays were excluded from the analysis.
[0192] ASO-mediated IL-6 response has been shown to cause immunostimulatory problems in clinical trials. Figure 3 shows the IL-6 results after treatment with 10 μM. Error bars represent the standard error of the mean. Table 9 below summarizes the mean cytokine concentration values (pg / mL) at 0.4 μM. [Table 9]
[0193] Example 8 In vitro efficacy study of human induced pluripotent stem (iPS) cell-derived neurons and pathogenic STXBP1 cell lines
[0194] The ASOs provided herein were tested for STXBP1 RNA regulation, protein increase, synaptic localization, synaptic function, and in vitro network function in neuronal cultures. In addition to excitatory neurons lacking one copy of the gene functioning as a baseline, the ASOs provided herein were also tested in inhibitory neurons and isogenic cell lines engineered with pathogenic patient mutations.
[0195] These tests determine the biological efficacy of the ASO compounds provided herein from the perspective of human patient cell lines.
[0196] STXBP1+ / -(HZ)Ngn2-induced neuronal cultures grown without glia
[0197] STXBP1+ / -(engineered with CRISPR)Ngn2-induced neurons (BIONi010-C-13) grown without glia were treated with vehicle, 5 μM, or 10 μM ASO and compared to controls that were WT isogenic control cell lines + vehicle, HZ + lentivirus overexpressing STXBP1, or HZ + non-targeting control ASO.
[0198] Cells were seeded at a density of 30k, treated with ASO at 8 and 15 days in vitro, and fixed at 28 days in vitro for immunostaining analysis.
[0199] Neuronal cultures were immunostained for STXBP1 (Sigma: HPA023483) and synaptophysin 1 (Synaptic Systems: SYSY101004). STXBP1 staining co-localized with synaptophysin 1 was quantified as the primary readout in Figure 6. Each point represents a field of view, and fields of view were collected across two independent biological replicates. The horizontal line represents the median of the distribution.
[0200] The important result was that STXBP1+ / - neurons treated with the ASOs of SEQ ID NOs: 17, 168, and 225 showed a significant increase in synaptic STXBP1 expression compared to vehicle treatment.
[0201] Experimental parameters: Cell type: Ngn2-induced neurons without glia (DIV28), Gymnosis, Treatment: ASO at 5 μM or 10 μM, Immunostaining: 20 days after ASO treatment
[0202] *P≤0.05
[0203] **P≤0.01
[0204] ***P≤0.001
[0205] WT Ngn2-induced neuron culture
[0206] WT Ngn2-induced neurons (BIONi010-C-13) cultured without glia were treated with vehicle, 5 μM of ASO, and compared to controls that were WT isogenic control cell line + vehicle, WT + lentivirus overexpressing STXBP1, or WT + non-targeting control ASO.
[0207] Cells were seeded at a density of 30k, treated with ASO at 8 and 15 days in vitro, and fixed at 28 days in vitro for immunostaining analysis.
[0208] Neuronal cell cultures were immunostained for STXBP1 (Sigma: HPA023483) and synaptophysin 1 (Synaptic Systems: SYSY101004). STXBP l staining co-localized with synaptophysin 1 was quantified as the main readout in Figure 7. Each point represents a field of view, and the fields of view were collected over two independent biological replicates. The horizontal line represents the median of the distribution.
[0209] A key finding was that STXBP1 WT neurons treated with ASO of sequence number 17 showed a significant increase in synaptic STXBP1 expression compared to those treated with the vehicle.
[0210] Experimental parameters: Cell type: Glial-abstaining Ngn2-induced neurons (DIV28), gymnosis, Treatment: 5 μM ASO, Immunostaining: 20 days after ASO treatment
[0211] *P≦0.05
[0212] STXBP1+ / -(HZ)Ngn2-induced neuron cultures cultured in rat glia
[0213] STXBP1+ / - (CRISPR-engineered) Ngn2-induced neurons (BIONi010-C-13) cultured in rat glia were treated with a vehicle, 1 μM, 2.5 μM, 5 μM, or 10 μM ASO, and compared to a control that overexpressed HZ+STXBP1 with a lentivirus or an HZ+ untargeted control ASO.
[0214] Cells were seeded at a density of 30k, treated with ASO in vitro at 8 and 15 days, and fixed in vitro at 28 days for immunohistochemical analysis.
[0215] Neuronal cell cultures were immunostained for STXBP1 (Sigma: HPA023483) and synaptophysin 1 (Synaptic Systems: SYSY101004). STXBP1 staining co-localized with synaptophysin 1 was quantified as the primary reading in Figure 8.
[0216] The violin plot represents the distribution of data points (individual fields of view collected across two independent biological replicas). The horizontal line represents the median of the distribution.
[0217] The important result was that synapse STXBP1 expression was significantly increased in STXBP1+ / - neurons cultured in rat glia and treated with an ASO having SEQ ID NO: 17 or 197 as compared to treatment with vehicle.
[0218] Experimental parameters: cell type: Ngn2-induced neurons (DIV28) cultured in rat glia, gymnosis, treatment: ASO at 5 μM or 10 μM, immunostaining: 20 days after ASO treatment
[0219] *P≤0.05
[0220] ***P≤0.001
[0221] Ngn2-induced neuron culture
[0222] STXBP1+ / - (CRISPR-engineered) Ngn2-induced neurons (BIONi010-C-13) cultured without glia were treated with vehicle, 5 μM, or 10 μM ASO and compared to a control of WT isogenic control cell line + vehicle.
[0223] Cells were seeded at 30k density, treated with ASO after 8 days in vitro, and bulk cell lysates were collected after 15 days in vitro for ELISA analysis.
[0224] ELISA analysis of bulk STXBP1 protein was performed using a RayBiotech kit (ELH-STXBP1-A, 0621222675) with a calibration curve generated from recombinant human Munc18-1 protein (Abcam: ab267979, GR3337760-2).
[0225] Each point represents a cell culture well (technical replicate), and data were collected over three independent biological replicates. Horizontal lines represent the median of the distribution.
[0226] A key finding was that STXBP1+ / - neurons treated with ASO having sequence numbers 17 and 225 showed a significant increase in synaptic STXBP1 expression compared to those treated with the vehicle.
[0227] Experimental parameters: Cell type: Glial-abstaining Ngn2-induced neurons (DIV15), gymnosis, Treatment: ASO at 5 or 10 μM, ELISA: 7 days after ASO treatment
[0228] **P≦0.01
[0229] ***P≦0.001
[0230] Example 9 In vivo tolerability and in vivo distribution studies
[0231] The tolerability of the ASOs provided herein was tested by intrathecal injection into adult rats, with signs of acute biotoxicity monitored and postmortem brain pathology and in vivo distribution analyzed. Concurrently, intracerebroventricular injections were performed in mice to monitor long-term toxicity and neurodegeneration.
[0232] These tests will determine the toxicity and biodistribution of the ASO compounds provided herein in rodent models.
[0233] Example 10 In vivo tolerability and pharmacodynamic studies
[0234] Cynomolgus monkeys will be used to test the tolerability of the ASOs provided herein administered via intrathecal injection. For ASOs with complete homology between humans and monkeys, we further anticipate an increase in the STXBP1 protein in vivo. These tests will determine the tolerability and pharmacodynamics of ASOs in wild-type monkeys.
[0235] This disclosure should not be limited in scope by the embodiments disclosed in the examples intended as single illustrative examples of individual aspects, and any equivalents are within the scope of this disclosure. In addition to those shown and described herein, various modifications will be apparent to those skilled in the art from the foregoing description. Such modifications are intended to be included in the appended claims.
Claims
1. STXBP1 is an antisense oligonucleotide (ASO) containing a nucleotide sequence that is complementary or inversely complementary to a portion of mRNA or premRNA.
2. The ASO according to claim 1, wherein the STXBP1 premRNA is identical to the coding strand of NCBI accession number NC_000009.12, and all thymines are substituted with uracil.
3. The ASO according to claim 2, which increases the expression of the STXBP1 protein when administered to a target or when in contact with cells.
4. The ASO according to claim 3, wherein the cell is a nerve cell, and the ASO increases the level of functional STXBP1 protein in the nerve cell compared to a control nerve cell that has not been in contact with the ASO.
5. The ASO according to any one of claims 1 to 4, wherein the base sequence i) contains or consists of any one of sequence numbers 1 to 626, ii) has at least 80%, 85%, 90%, 95%, or 100% sequence identity with any one of sequence numbers 1 to 626, or iii) contains 10, 11, 12, 13, 14, 15, or 16 consecutive bases of any one of sequence numbers 1 to 626.
6. The ASO according to any one of claims 1 to 5, wherein the base sequence is at least 90%, 95%, 96%, 97%, 98%, 99%, or 100% complementary or reverse complementary to the STXBP1 mRNA or premRNA, or any mutant STXBP1 mRNA or premRNA.
7. The ASO according to any one of claims 1 to 6, wherein the base sequence has one or two mismatches with the STXBP1 mRNA or premRNA.
8. The ASO according to any one of claims 1 to 7, wherein the base sequence has fewer than 50 nucleotides and optionally has a length of 10 to 33 nucleotides.
9. The ASO according to any one of claims 1 to 8, comprising one or more modified bases, one or more modified sugars, and / or one or more modified internucleoside bonds.
10. The ASO according to any one of claims 1 to 9, comprising at least 50%, 75%, 80%, 85%, 90%, or all 2'-MOE sugars and independently at least 50%, 75%, 80%, 85%, 90%, or all phosphorothioate nucleoside interbondings.
11. The ASO according to any one of claims 1 to 10, comprising any one nucleotide sequence from sequence numbers 1 to 10 and 243 to 279, or 10, 11, 12, 13, 14, 15, or 16 consecutive nucleotides from any one of sequence numbers 1 to 10 and 243 to 279.
12. The ASO according to any one of claims 1 to 10, comprising any one base sequence from sequence numbers 1 to 10, or any one of sequence numbers 10, 11, 12, 13, 14, 15, or 16 consecutive bases.
13. An ASO according to any one of claims 1 to 10, comprising any one nucleotide sequence from sequence numbers 2, 17, 75, 168, 188, 197, and 225, or 10, 11, 12, 13, 14, 15, or 16 consecutive nucleotides from any one of sequence numbers 2, 17, 75, 168, 188, 197, and 225.
14. An ASO conjugate comprising the ASO described in any one of claims 1 to 13.
15. The ASO conjugate according to claim 14, wherein the conjugate includes a targeting portion.
16. The ASO conjugate according to claim 14 or claim 15, which is a peptide-ASO conjugate containing a PPMO conjugate, or an antibody-ASO conjugate.
17. A pharmaceutical composition comprising an ASO according to any one of claims 1 to 13 or an ASO conjugate according to any one of claims 14 to 16, and a pharmaceutically acceptable carrier.
18. A method for treating a subject having STXBP1 disorder, comprising administering to the subject an ASO according to any one of claims 1 to 13, or an ASO conjugate according to any one of claims 14 to 16, or a pharmaceutical composition according to claim 17.
19. The method according to claim 18, wherein the STXBP1 disorder is related to STXBP1 haploinsufficiency.
20. The aforementioned STXBP1 disorder is encephalopathy, STXBP I-encephalopathy, epilepsy, epileptic encephalopathy, severe early-onset epileptic encephalopathy, asymptomatic epilepsy, Ohtahara syndrome, West syndrome, Lennox-Gastaut syndrome, Dravet syndrome, early myoclonic encephalopathy, unclassified early-onset epileptic encephalopathy associated with STXBP1 haploinsufficiency, atypical Rett syndrome, severe intellectual disability without epilepsy associated with STXBP1 haploinsufficiency, generalized delay, cognitive impairment (mild to severe) The method according to claim 18 or 19, wherein the condition is motor impairment, hypotonia, autism, DEE4, developmental and epileptic encephalopathy 4, developmental and epileptic encephalopathy type 4, early infant epileptic encephalopathy 4, EIEE4, STXBP1 encephalopathy with epilepsy, STXBP1 epileptic encephalopathy, STXBP1-related developmental and epileptic encephalopathy, STXBP1-related early-onset encephalopathy, or STXBP1-related epileptic encephalopathy.
21. A method for treating, preventing, or delaying the onset of a disorder caused by an STXBP1 mutation in a subject, comprising administering to the subject an ASO according to any one of claims 1 to 13, an ASO conjugate according to any one of claims 14 to 16, or a pharmaceutical composition according to claim 17.
22. A method for increasing STXBP1 expression in cells, comprising contacting the cells with an ASO according to any one of claims 1 to 13, or an ASO conjugate according to any one of claims 14 to 16, or a pharmaceutical composition according to claim 17.
23. The method according to claim 22, wherein the cells are present in vitro.
24. The method according to claim 22, wherein the cells are present in vivo.
25. The method according to any one of claims 22 to 24, wherein the cell is a nerve cell.
26. The method according to any one of claims 22 to 24, wherein increasing STXBP1 expression in the cells increases the level of STXBP1 protein in the cells compared to control cells that have not been in contact with the ASO.
27. A method for increasing the synaptic local expression of STXBP1 protein in a composition containing nerve cells, comprising contacting the composition with an ASO according to any one of claims 1 to 13, or an ASO conjugate according to any one of claims 14 to 16, or a pharmaceutical composition according to claim 17.
28. The method according to claim 27, wherein the composition containing nerve cells is present in vivo.