Compositions and methods for the multiplexing of immune cells
Genetic modification and multiplexing of B-lineage cells at specific loci, combined with optimized culture conditions, address the challenge of immune response in cell therapies, achieving reduced immune reactions and improved therapeutic outcomes.
Patent Information
- Authority / Receiving Office
- JP · JP
- Patent Type
- Applications
- Current Assignee / Owner
- B BIOPHARMA INC
- Filing Date
- 2024-05-15
- Publication Date
- 2026-05-29
AI Technical Summary
Existing cell therapies using engineered immune cells face challenges in reducing immune responses in recipients, necessitating improved methods for culturing and administering B-lineage cells to enhance their therapeutic efficacy.
A method involving genetic modification and multiplexing of B-lineage cells through expression cassettes at specific loci, such as CCR5, JCHAIN, and IgH, to reduce immune response and enhance therapeutic properties, combined with culture techniques using IL-2, IL-6, IL-15, and IFN-alpha-2-beta, and serum-free conditions.
The method results in genetically modified B-lineage cells with reduced immune response, enabling effective treatment of conditions like hemophilia B, with enhanced engraftment and therapeutic efficacy.
Smart Images

Figure 2026517406000001_ABST
Abstract
Description
[Technical Field]
[0001] Cross-reference of related applications This application claims priority to U.S. Provisional Application No. 63 / 502,645, filed on 16 May 2023, which is incorporated herein by reference in its entirety. [Background technology]
[0002] Cell therapy is a novel form of treatment that involves administering human viable cells to a target in a manner that allows them to act as “living drugs.” In particular, certain cell therapies utilize immune cells that have been engineered to combat disease. Methods for culturing and administering these engineered adaptive immune cells are important in both clinical and preclinical settings for treatment in patient populations. [Overview of the Initiative]
[0003] This disclosure includes, in particular, compositions, methods, and administrations of modified immune cells (e.g., B-lineage cells). This disclosure also includes, in particular, culture methods and compositions for the multiple manipulation of immune cells. In particular, this disclosure provides the recognition that one or more modifications of B-lineage cells (e.g., through genetic engineering and / or alternative culture methods) may provide improved properties, such as a reduction in the immune response at or after administration to a subject. In some embodiments, this disclosure provides culture methods and compositions for manipulating B-lineage cells procured from a donor, wherein the manipulated B-lineage cells produce a reduction in the immune response in a non-donor subject (e.g., an untreated subject, a healthy subject, a subject treated with unmanipulated or alternatively manipulated B-lineage cells, etc.) compared to a reference substance.
[0004] In some embodiments, the present disclosure provides a method for genetically modifying a B-lineage cell population, the method comprising: (a) isolating primary B cells to obtain a primary B-lineage cell population; (b) activating the primary B-lineage cell population; and (c) multiplexing the primary B-lineage cell population during or after the activation step such that a first expression cassette containing a first transgene is incorporated into a first target locus, and (i) a second expression cassette containing a second transgene is incorporated into a second target locus, or (ii) endogenous gene expression at the second target locus is disrupted without the incorporation of a transgene, thereby generating a genetically modified B-lineage cell population. In some embodiments, the method further comprises the step of expanding the manipulated B-lineage cell population.
[0005] In particular, in one embodiment, the present disclosure provides a method for differentiating an engineered B-lineage cell population into a population of plasmablasts. In some embodiments, the differentiation step includes contacting the engineered B-lineage cell population with a culture medium containing (a) IL-2, (b) IL-6, (c) IL-10, and / or (d) IL-15.
[0006] In particular, in one embodiment, the present disclosure provides a method for differentiating an engineered B-lineage cell population into a population of plasma cells. In some embodiments, the differentiation step includes contacting the population of plasmablasts with a culture medium containing (a) IL-6, (b) IL-15, and / or (c) IFN-alpha-2-beta (IFNα-2β).
[0007] In some embodiments, the disclosure provides a method for manipulating a B-lineage cell population. In some embodiments, the method further includes the step of transplanting the manipulated B-lineage cell population into a cell culture medium free of human or bovine serum for about 24 hours. In some embodiments, the manipulation step further includes introducing an expression cassette containing a transgene into the primary B-cell population.
[0008] In some embodiments, multiplexing of a B-lineage cell population includes contacting a primary B-lineage cell population with both a first and a second expression cassette simultaneously. In some other embodiments, multiplexing of a B-lineage cell population includes sequentially contacting a primary B-lineage cell population with the first expression cassette before the second expression cassette. In some embodiments, sequential contact includes contacting a primary B-lineage cell population with the first expression cassette on day 3 of the culture process, followed by contacting the cell population with the second expression cassette on day 4 of the culture process, with the culture process having a start day of day 1. In some embodiments, multiplexing of a B-lineage cell population includes contacting a primary B-lineage cell population with both the first and second expression cassettes over a time range of about 24 to about 144 hours.
[0009] In some embodiments, the expression cassette includes (a) a 5' homology arm that is at least 95% identical to the 5' sequence with respect to the double-strand break site, and (b) a 3' homology arm that is at least 95% identical to the 3' sequence with respect to the double-strand break site. In some embodiments, the 5' homology arm includes, or is, (i) a size of about 450–850 base pairs in length, (ii) a PAM site or the absence of a PAM site, and / or (iii) a length symmetric or asymmetric with respect to the 3' homology arm. In some embodiments, the 3' homology arm includes, or is, (i) a size of about 450–850 base pairs in length, (ii) a PAM site or the absence of a PAM site, and / or (iii) a length symmetric or asymmetric with respect to the 5' homology arm.
[0010] In some embodiments, the procedure involves contacting a primary B cell population with a target nuclease capable of introducing double-strand breaks. In some embodiments, the target nuclease is or comprises a CRISPR-related (Cas) protein, a zinc finger nuclease (ZFN), a transcription activator-like effector-based nuclease (TALEN), or a meganuclease. In some embodiments, the Cas protein is or comprises Cas9, Cas12a, or Cas13a, or a variant thereof. In some embodiments, the Cas protein forms a complex with a guide RNA (gRNA). In some embodiments, the gRNA is a single guide RNA (sgRNA).
[0011] In some embodiments, the steps of the operation further include electroporation of a primary B cell population and / or transduction of the primary B cell population using an expression cassette. In some embodiments, electroporation is performed on a composition comprising (a) a Cas protein that forms a complex with gRNA, and (b) a primary B cell population.
[0012] In some embodiments, a population of B-lineage cells is brought into contact with a culture medium further comprising one or more of the following: XL413, M3814, nocodazole, and / or LAH4.
[0013] In some embodiments, the disclosure provides a population of genetically modified B-lineage cells comprising a transgene, wherein the transgene is expressed from the endogenous CCR5 locus. In some embodiments, the cells express the transgene and at least partially disrupt the expression of endogenous CCR5.
[0014] In some embodiments, the disclosure provides a population of genetically modified B-lineage cells comprising a transgene, wherein the transgene is expressed from the endogenous JCHAIN locus. In some embodiments, the cells express the transgene without disrupting the expression of endogenous JCHAIN.
[0015] In some embodiments, the disclosure provides a population of genetically modified B-lineage cells comprising a transgene, wherein the transgene is expressed from an endogenous IgH locus. In some embodiments, the cells express the transgene without disrupting the expression of endogenous IgH.
[0016] In some embodiments, the disclosure provides a population of genetically modified B-lineage cells comprising a transgene, wherein the transgene is expressed from the endogenous B2M locus. In some embodiments, the cells express the transgene and at least partially disrupt the expression of endogenous B2M.
[0017] In some embodiments, the disclosure provides a population of engineered B-lineage cells comprising a transgene sequence, wherein the transgene is incorporated into at least 10% of the cells. In some embodiments, the transgene is expressed from the endogenous CCR5 locus.
[0018] In some embodiments, the multiplex manipulation of the B-lineage cell population comprises contacting the primary B-lineage cell population with a first expression cassette and a second expression cassette simultaneously. In some embodiments, the multiplex manipulation of the B-lineage cell population comprises sequentially contacting the primary B-lineage cell population with a first expression cassette and then a second expression cassette. In some embodiments, the sequential contacting comprises contacting with the first expression cassette on the third day of the culture process and contacting with the second expression cassette on the fourth day of the culture process, wherein the culture process has a starting date on the first day. In some embodiments, the contact time range of the first expression cassette and the second expression cassette is within about 24 hours to about 144 hours.
[0019] In some embodiments, the present disclosure provides a pharmaceutical composition comprising one or more B-lineage cells selected from a population of genetically modified B-lineage cells. In some embodiments, the pharmaceutical composition comprises one or more B-lineage cells selected from a population of genetically modified B-lineage cells and further comprises one or more pharmaceutically acceptable excipients. In some embodiments, a method of administering a pharmaceutical composition, wherein the pharmaceutical composition comprises (a) one or more B-lineage cells selected from a population of genetically modified B-lineage cells of any aspect or embodiment described herein, and (b) one or more pharmaceutically acceptable excipients, and the pharmaceutical composition is administered to a subject.
[0020] In some embodiments, the present disclosure provides a method of treating a disease, disorder, or condition in a subject, the method comprising administering to the subject a therapeutically effective amount of a pharmaceutical composition, thereby treating the disease, disorder, or condition in the subject. In some embodiments, the pharmaceutical composition is administered intravenously. In some embodiments, the pharmaceutical composition is administered to an adult subject. In some embodiments, the pharmaceutical composition is administered to a pediatric subject. In some embodiments, the subject has hemophilia B.
[0021] In some embodiments, the present disclosure provides a method for characterizing a population of genetically modified B-lineage cells, the method comprising evaluating one or more of the following using an assay: (a) to (g): (a) the presence of the CD38 marker, (b) the presence of the CD138 marker, (c) the presence of the CD27 marker in at least 50% of living singlet cells, (d) secretion of at least 0.5 pg / cell / day of IgG, (e) secretion of at least 2.5 pg / cell / day of IgM, (f) secretion of at least 0.5 pg / cell / day of IgD, and (g) secretion of at least 0.1 pg / cell / day of FIX protein. In some embodiments, the assay comprises or includes one or more of the following: fluorescence-activated cell sorting (FAC sorting), Western blotting, flow cytometry, enzyme-linked immunosorbent spot assay (ELISpot), quantitative polymerase chain reaction (qPCR), reverse transcription PCR (RT-PCR), RT-qPCR, mesoscale discovery (MSD), and enzyme-linked immunosorbent assay (ELISA). In some embodiments, one or more B-lineage cells selected from a population of genetically modified B-lineage cells engraft in the bone marrow of the subject. In some embodiments, a method for monitoring the engraftment of genetically modified B-lineage cells in the subject comprises one or more of the following: bioluminescence, ELISpot, flow cytometry, qPCR, RT-PCR, RT-qPCR, and enzyme-linked immunosorbent assay.
[0022] In some embodiments, the multiplexing of a B-lineage cell population includes manipulation of a first target locus selected from CCR5, JCHAIN, and IGH. In some embodiments, the multiplexing of a B-lineage cell population includes manipulation of a second target locus selected from B2M, BCMA, CD19, and CD20. In some embodiments, the first target locus is CCR5, the second target locus is CD19, and endogenous gene expression at the second target locus is disrupted without the integration of a transgene. In some embodiments, the first target locus is CCR5, the second target locus is B2M, and endogenous gene expression at the second target locus is disrupted without the integration of a transgene. In some embodiments, the first target locus is JCHAIN, the second target locus is B2M, and endogenous gene expression at the second target locus is disrupted without the integration of a transgene. In some embodiments, the first target locus is IGH, the second target locus is B2M, and endogenous gene expression at the second target locus is disrupted without the integration of the transgene. In some embodiments, the first target locus is CCR5, the second target locus is B2M, and a second expression cassette containing the second transgene is integrated into the second target locus. In some embodiments, the first target locus is JCHAIN, the second target locus is B2M, and a second expression cassette containing the second transgene is integrated into the second target locus. In some embodiments, the first target locus is IGH, the second target locus is B2M, and a second expression cassette containing the second transgene is integrated into the second target locus. In some embodiments, the first transgene integrated into the first target locus is BiTE. In some embodiments, the first transgene integrated into the first target locus is selected from factor IX, SMPD1, and blinatumomab. In some embodiments, the second transgene integrated into the second target locus is selected from HLA-A, HLA-B, HLA-C, HLA-E, and HLA-G.
[0023] In some embodiments, the present disclosure provides a method for genetically modifying a B-lineage cell population, the method comprising: (a) isolating primary B cells to obtain a primary B-lineage cell population; (b) activating the primary B-lineage cell population; and (c) manipulating the primary B-lineage cell population during or after the activation step to reduce the expression of one or more endogenous target genes, thereby generating a genetically modified B-lineage cell population. In some embodiments, the one or more endogenous target genes are NLRC5, CD58, RFX5, TAP2, and / or TAPBP.
[0024] In some embodiments, the Disclosure provides methods for reducing the expression of one or more endogenous target genes, including knockout of one or more endogenous target genes. In some embodiments, the operational step includes incorporating one or more transgenes. In some embodiments, the incorporation of one or more transgenes reduces the expression of one or more endogenous target genes. In some embodiments, the methods and embodiments described herein include transgenes further comprising sequences encoding HLA-E, HLA-G, CD47, PDL1, FIX, SMPD1, and / or bispecific double scFv. In some embodiments, the operational step includes incorporating the transgene into endogenous NLRC5, RFX5, CD58, TAP2, TAPBP, CCR5, B2M, CD19, JCHAIN, AAVS1, TRAC, and / or GSH loci.
[0025] In some embodiments, the step of the procedure further includes introducing a donor construct containing the transgene into a primary B cell population. In some embodiments, the donor construct includes (a) a 5' homology arm that is at least 95% identical to the 5' sequence with respect to the double-strand break site, and (b) a 3' homology arm that is at least 95% identical to the 3' sequence with respect to the double-strand break site. In some embodiments, the donor construct includes one transgene sequence from sequence numbers 34-39. In some embodiments, the donor construct includes one homology arm sequence from sequence numbers 10-18.
[0026] In some embodiments, the disclosure provides a population of genetically modified B-lineage cells comprising a knockout modification at one or more endogenous gene loci. In some embodiments, the knockout modification is located at the endogenous NLRC5, B2M, CD58, RFX5, TAP2, and / or TAPBP gene loci. In some embodiments, the transgene comprises a sequence encoding an HLA-E or HLA-G protein. In some embodiments, the transgene further comprises a 2A peptide or IRES sequence at the 3' end of the HLA-E protein encoding sequence. In some embodiments, the transgene further comprises a sequence encoding a second protein at the 3' end of the 2A peptide or IRES sequence.
[0027] The drawings are for illustrative purposes only and are not intended to be limiting. [Brief explanation of the drawing]
[0028] [Figure 1A] A schematic diagram illustrating multiplexed genome editing at two separate gene loci is shown. [Figure 1B] As shown, this evaluates the editing efficiency of a specific guide RNA, either alone or in multiplexing, targeting either CCR5 or B2M. The guide RNAs were administered in a 1:1:1 ratio of (gRNA targeting CCR5):(gRNA targeting B2M):(Cas9). [Figure 1C] As shown, we evaluate the editing efficiency of a specific guide RNA, either alone or in multiplexing, targeting either CCR5 or B2M. The guide RNAs were administered in a ratio of 3.58:1:1 for (gRNA targeting CCR5):(gRNA targeting B2M):(Cas9).
[0029] [Figure 2] The evaluation of the manipulated B-lineage cells is shown. Cells were duplicated to induce disruptive expression of GFP from the CCR5 locus and disruptive expression of immunomodulatory factors (HLA-E) from the B2M locus.
[0030] [Figure 3A] The evaluation of the manipulated B-lineage cells is shown. Cells were duplicated to induce disruptive expression of GFP from the CCR5 locus and disruptive expression of immunomodulatory factors (HLA-E) from the B2M locus. [Figure 3B] The evaluation of the manipulated B-lineage cells is shown. Cells were duplicated to induce disruptive expression of GFP-BiTE (blinatumomab) from the IgH locus and disruptive expression of immunomodulatory factors (HLA-E) from the B2M locus. [Figure 3C] The evaluation of the manipulated B-lineage cells is shown. Cells were duplicated to induce disruptive expression of GFP-BiTE (blinatumomab) from the IgH locus and disruptive expression of immunomodulatory factors (HLA-E) from the B2M locus.
[0031] [Figure 4] The evaluation of the manipulated B-lineage cells is shown. Cells were multiply engineered for the destructive expression of either BiTE (blinatumomab) or factor IX (FIX) from the CCR5 locus, combined with the destructive expression of an immunomodulatory factor (HLA-E) from the B2M locus.
[0032] [Figure 5] The evaluation of the manipulated B-lineage cells is shown. Cells were multiply engineered for the destructive expression of either BiTE (blinatumomab) or factor IX (FIX) from the CCR5 locus, combined with the destructive expression of an immunomodulatory factor (HLA-E) from the B2M locus.
[0033] [Figure 6A]This study evaluates simultaneous and sequential (Seq) editing of B-lineage cell populations to produce multiplexed B-lineage cell populations. Cells were manipulated with guide RNA / Cas9 RNP via one of the following protocols: Seq1 protocol (Cas9 RNP complexing with a CCR5-targeting gRNA and AAV containing a GFP donor template on day 3 of the culture process, followed by Cas9 RNP complexing with a B2M-targeting gRNA and AAV HLA-E donor template on day 4 of the culture process), Seq2 protocol (Cas9 RNP complexing with a B2M-targeting gRNA and AAV containing an HLA-E donor template on day 3 of the culture process, followed by Cas9 RNP complexing with a CCR5-targeting gRNA and AAV GFP donor template on day 4 of the culture process), simultaneous day 3 (simultaneous administration of both RNP and AAV containing donor template on day 3 of the culture process), or simultaneous day 4 (simultaneous administration of both RNP and AAV containing donor template on day 4 of the culture process). [Figure 6B] This study demonstrates potential gene translocation events at the CCR5 and B2M loci, as well as the evaluation of such events in multiplexed and singlexed B-lineage cell populations. Culture timing is indicated as the start day 1.
[0034] [Figure 7] This study demonstrates multiplexing to express transgenes at multiple loci. An expression cassette containing the MND promoter and luciferase (LUC) transgene was inserted into the CCR5 locus, and an expression cassette containing the EF1a promoter and HLA-E transgene was inserted into the B2M locus (top panel). The percentage of HDR at the CCR5 locus was evaluated via ddPCR (left panel), and luminescence was measured using Steady-Glo (center panel). HLA-E incorporation was indicated by the percentage of manipulated B-lineage cells with the HLA-E+HLA-ABC-phenotype at day 13.
[0035] [Figure 8]This describes the administration of B-lineage cells engineered to express expression constructs indicated by the CCR5 and / or B2M loci. The engineered B-lineage cells were administered to hCD34-NSG-IL15 humanized mice and NOG-IL6 mice, and monitored for 6 weeks. Luminescence was measured via whole-body imaging of the treated mice at 6 weeks.
[0036] [Figure 9A] As shown, B-lineage cells are shown that were engineered to contain the MND promoter, bicistronic HLA-E transgene, and luciferase transgene ("Biscis HLA-E") at the CCR5 locus, and the EF1a promoter and GFP transgene at the B2M locus, compared to a control containing only the MND promoter and GFP transgene at the CCR5 locus. The percentage of GFP-positive cells (left panel) and the percentage of HLA-E-positive HLA-ABC-negative cells within GFP-positive cells (right panel) were evaluated. A comparison of the relative percentages with the control (engineered only at the CCR5 locus) and cells that were HLA-E-positive (HLA-E+) and / or HLA-ABC-positive (HLA-ABC+) is also shown (right panel). [Figure 9B] This paper compares activated B cells (B cells on day 2) with B-lineage cells engineered to knock out B2M expression (D13 B2M- / - engineered B-lineage cells) to evaluate primed T cell activation and naive T cell proliferation after co-culture with autologous or allogeneically engineered B-lineage cells. [Figure 9C] This report describes the evaluation of various B-lineage cell populations in co-culture with NK cells, including real-time killing and competitive survival rate assessments. Culture timing is described, with the culture start date being day 0.
[0037] [Figure 10A]As shown, the evaluation of B-lineage cells engineered to contain the MND promoter, bicistronic factor IX (FIX) transgene, and GFP transgene at the CCR5 locus (control), or to contain the MND promoter, bicistronic FIX transgene, and HLA-E transgene at the CCR5 locus, and the MND promoter and GFP transgene at the B2M locus (Bicis HLA-E) is presented. The integration percentage at CCR5 (left panel) and the percentage of GFP-positive cells in viable cells (center panel) were evaluated. The percentage of FIX-HLA-E-positive HLA-ABC-negative cells in GFP+ cells of Bicis HLA-E engineered B-lineage cells at day 13 was also evaluated (right panel). [Figure 10B] The panel shows the evaluation of Bicis HLA-E killing by control, B2M- / - manipulated B-lineage cells, or HLA mismatched NK cells (left panel), competitive survival of cells with different phenotypes when Bicis HLA-E manipulated B-lineage cells are co-cultured with or without HLA mismatched NK cells (center panel), and FIX activity by capture chromogenic assay (right panel).
[0038] [Figure 11A] This study demonstrates the evaluation of various conditions for editing and / or integration in CCR5 and TAP using CRISPR / Cas9, either alone or in combination with TAP knockout, or in combination with both B2M and CD58 knockout. Various ratios of CCR5 to TAP gRNA (1:1 and 3.58:1), as well as B2M and CD58 gRNA (1:1), were tested. Percentage reduction of HLA-ABC was evaluated in the indicated manipulated B-lineage cell populations. [Figure 11B] This study aims to demonstrate the evaluation of the conditions for CRISPR / Cas9-based multiplexed gene editing in CCR5 and TAP. [Figure 11C]This study demonstrates the evaluation of the conditions for CRISPR / Cas9 gene editing using CCR5 alone (with bicistronic LUC and GFP transgenes) or in combination with TAP2 and TAPBP. As shown, TAP2 and TAPB2 used gRNAs in a 1:1 ratio. Percentage reduction of HLA-ABC was evaluated in the manipulated B-lineage cell populations shown. [Figure 11D] This study aims to demonstrate the evaluation of the conditions for CRISPR / Cas9-based multiplexed gene editing at the CCR5, TAP, and TAPBP gene loci. [Figure 11E] This study demonstrates the evaluation of various conditions for editing and / or integration in CCR5 and NLRC5, using CRISPR / Cas9 to integrate bicistronic LUC and GFP transgenes in CCR5, either alone or in combination with NLRC5 knockout. Various ratios of CCR5 to NLRC5 gRNA were tested (1:1 and 3.58:1). [Figure 11F] This study aims to demonstrate the evaluation of the conditions for CRISPR / Cas9-based multiplexed gene editing in CCR5 and NLRC5. [Figure 11G] This study demonstrates the evaluation of various conditions for editing and / or integration in CCR5, B2M, and / or CD58, using CRISPR / Cas9 for the integration of bicistronic LUC and GFP transgenes in CCR5, either alone or in combination with B2M and CD58 knockouts. Various ratios of B2M to CD58 gRNA were tested (1:1). [Figure 11H] This study demonstrates the evaluation of B-lineage cells edited at the indicated gene locus.
[0039] [Figure 12A]As shown, we demonstrate the evaluation of B-lineage cells engineered to include the MND promoter and GFP transgene in CCR5, B2M knockout, and CD58 knockout (B2M / CD58 DKO), as well as a control with only CCR5 integration. We evaluated the percentage of GFP-positive cells from the control and B2M / CD58 DKO (left panel), as well as the editing efficiency of the B2M and CD58 loci in the B2M CD58 DKO (right panel). [Figure 12B] This study demonstrates the activation and proliferation of CD8 T cells after co-culturing with autologous or allogeneic D2 B cells, control D13 manipulated B-lineage cells, D13 B2M- / - manipulated B-lineage cells, and B2M / CD58 DKO cells, as well as the competitive survival of cells of different phenotypes when B2M / CD58 DKO manipulated B-lineage cells are co-culturified with autologous or allogeneic primed T cells. [Figure 12C] This shows real-time targeted killing of B-lineage cells by HLA-mismatched NK cells, and measurement of NK degranulation after 4 hours of exposure to allogeneically engineered B-lineage cells.
[0040] [Figure 13A] As shown, the evaluation of B-lineage cells engineered to contain either the FIX-GFP transgene (control) or the FIX-GFP transgene and CD58 knockout (CD58 KO) in CCR5 is presented. For the control and CD58 KO, the integration efficiency in CCR5, the percentage of GFP-positive cells, and the percentage of CD58-positive cells were evaluated. [Figure 13B] This report describes the activity of primed CD8 T cells after co-culturing with autologous or allogeneic D2 B cells, control D13 manipulated B-lineage cells, D13 B2M- / - manipulated B-lineage cells, and CD58 KO cells, as well as the evaluation of the manipulated B-lineage cell populations and FIX activity.
[0041] [Figure 14A]As shown, the evaluation of B-lineage cells engineered to contain the GFP transgene in CCR5 is presented, either alone (control) or in combination with TAP2 knockout (TAP2 KO), TAP2 and TAPBP knockout (TAP2 / TAPBP DKO), NLRC5 knockout (NLRC5 KO), RFX5 knockout (RFX5 KO), or B2M knockout (B2M KO). Unengineered activated B cells on day 2 were also evaluated. MHC-I expression, MHC-II expression, and HLA-E were measured for the engineered B-lineage cell populations shown. [Figure 14B] This shows the evaluation of primed T cell activation by autologous or allogeneically modified B-lineage cell populations. [Figure 14C] The images show real-time targeted B-lineage cell killing by allogeneic NK cells (left and upper right panels), NK degranulation 4 hours after exposure to allogeneic B-lineage cell targets (lower center panel), and the percentage of GFP-positive cells killed by allogeneic NK cells (lower right panel). Culture timing is indicated, with the culture start date being day 0.
[0042] [Figure 15A] As shown, the evaluation of B-lineage cells engineered to contain the FIX-GFP transgene in CCR5 (control), the FIX-GFP transgene and B2M knockout in CCR5 (B2M KO), the FIX-GFP transgene and NLRC5 knockout in CCR5 (NLRC5 KO), the FIX-GFP transgene and CD58 knockout in CCR5 (CD58 KO), the FIX-GFP transgene in CCR5, as well as knockouts of NLRC5 and CD58 (NLRC5 / CD58 DKO), the bicistronic FIX transgene and HLA-E transgene in CCR5, and the GFP transgene in B2M (Bicis HLA-E), or the FIX transgene in CCR5 (control) is presented. The integration efficiency in CCR5 and the percentage of GFP-positive cells were evaluated. [Figure 15B]The following shows the evaluation of B-lineage cells in terms of HLA-ABC levels and the percentage of CD58-positive cells. [Figure 15C] This shows an evaluation of the operational efficiency of the Bicis HLA-E. [Figure 15D] This shows an evaluation of the manipulated B-lineage cell population regarding NK cell resistance. [Figure 15E] This shows an evaluation of the manipulated B-lineage cell population regarding T cell resistance.
[0043] [Figure 16] As shown, the evaluation of B-lineage cells engineered to contain FIX transgene in CCR5 (control), FIX transgene in CCR5 and B2M knockout (B2M KO), FIX transgene in CCR5 and NLRC5 knockout (NLRC5 KO), or FIX transgene in CCR5 and B2M and CD58 knockout (B2M / CD58 DKO) is presented. The integration efficiency, FIX secretion, and FIX activity of the engineered B-lineage cell populations shown were evaluated.
[0044] [Figure 17] This report evaluates B-lineage cell populations modified to include a FIX transgene in CCR5 (control), or a bicistronic FIX transgene and HLA-E transgene in CCR5, and a GFP transgene (Bicis HLA-E) in B2M. The integration efficiency, FIX secretion, and FIX activity of the modified B-lineage cell populations were evaluated.
[0045] [Figure 18] This specification describes the evaluation of various gRNAs targeting the NLRC5 locus in B-lineage cells, using a CCR5 guide as a control in two donors.
[0046] [Figure 19A] This shows the cutting efficiency on the fifth day. [Figure 19B]This shows the evaluation of D13 B-lineage cell differentiation, determined by the percentage of plasma cells (PC) and plasmablasts (PB). [Figure 19C] The expression levels of HLA-ABC, HLA-DR / DP / DQ, and HLA-E in B-lineage cells on day 7 and day 13 are shown. [Figure 19D] On days 7 and 13 of cell culture, we will demonstrate the evaluation of the percentage of HDR and FIX secretion in B-lineage cell populations manipulated with the indicated gRNA.
[0047] [Figure 20A] This diagram illustrates various single-edit and multiple-edit strategies for incorporating HLA-E, blinatumomab (Blina), FIX, or combinations thereof. [Figure 20B] The evaluation of the manipulated B-lineage cell population is shown.
[0048] [Figure 21A] This document describes the evaluation of various manipulated B-lineage cell populations, including CCR5 with LUC transgene (control), CCR5 with LUC transgene and B2M knockout (B2M KO), CCR5 with bicistronic HLA-E transgene and LUC transgene (containing 2A peptide), and B2M knockout (Bicis HLA-E), CCR5 with LUC transgene and NLRC5 knockout, or CCR5 with LUC transgene and B2M and CD58 knockout (B2M / CD58 DKO). The B-lineage cell populations described herein were manipulated and cultured to contain the manipulated plasma cell preparations. The manipulated plasma cell preparations were administered to hCD34-NSG-IL15 and NOG-IL6 mice and evaluated 7 weeks after transplantation. [Figure 21B] This image shows whole-body luminescence imaging of treated mice. [Figure 21C] The overall engraftment assessment (AUC measurement) is shown. The persistence of engrafted B-lineage cells in the mouse models shown was evaluated for both the control and Bicis HLA-E modified B-lineage cell preparations.
[0049] [Figure 22A] This document describes the evaluation of various manipulated B-lineage cell populations, including CCR5 with LUC transgene (control), CCR5 with LUC transgene and B2M knockout (B2M KO), CCR5 with bicistronic HLA-E transgene and LUC transgene (including 2A peptide), and B2M knockout (Bicis HLA-E), CCR5 with LUC transgene and NLRC5 knockout, or CCR5 with LUC transgene and B2M and CD58 knockout (B2M / CD58 DKO). The B-lineage cell populations described herein were manipulated and cultured to contain the manipulated plasma cell preparations. The manipulated plasma cell preparations were administered to NOG-IL15 mice and evaluated 7 weeks after transplantation. [Figure 22B] This image shows whole-body luminescence imaging of treated mice.
[0050] [Figure 23] This shows the percentage of HLA-ABC-negative and "Don't Eat Me" signal (HLA-E or HLA-G)-positive B-lineage cell populations after multiplexing with either a promoter-enabled HLA-E construct (EF1α) or a promoter-unenabled HLA-E construct, compared to multiplexing with a bicistronic HLA-E construct or an ILT2 KO-enabled or promoter-unenabled HLA-E construct.
[0051] [Figure 24A] The percentage of living B-lineage cells that were either plasmablasts or plasma cells is shown after simultaneous or sequential multiplexing of both the B2M and CD58 loci and GFP knock-in into the CCR5 locus. These results were compared to a control group that only had GFP knock-in into CCR5. [Figure 24B] The percentage of GFP expression in B-lineage cells subjected to the aforementioned conditions is shown. [Figure 24C] This shows the percentage of CD58 expression within the same group of B-lineage cell populations. [Figure 24D]This shows the percentage of HLA-ABC expression within the same group of B-lineage cell populations.
[0052] [Figure 25A] The in vitro bioluminescence intensity (BLI) of various manipulated B-lineage cell populations is shown, including CCR5 with LUC transgene (control), CCR5 with bicistronic HLA-E transgene and LUC transgene (including 2A peptide), and B2M knockout (Bicis HLA-E), CCR5 with LUC transgene and NLRC5 knockout (NLRC5 KO), or CCR5 with LUC transgene and B2M and CD58 knockout (B2M / CD58 DKO). These B-lineage cells were administered to NOG-IL15 mice that were NK-transplanted or not NK-transplanted with K562 as a control. [Figure 25B] Bioluminescence images of mice 4 hours (Figure 25B) or 14 days (Figure 25C) after administration of manipulated B-series cells are shown. [Figure 25C] Bioluminescence images of mice 4 hours (Figure 25B) or 14 days (Figure 25C) after administration of manipulated B-series cells are shown. [Figure 25D] This shows the percentage of BLI in mice 14 days after administration of a B-lineage cell population or K562 under NK pressure, compared to mice without NK cells.
[0053] [Figure 26A] The images show bioluminescence images of NOG-IL6 mice 5 weeks after administration of B-lineage cell populations including CCR5 with LUC transgene (control), CCR5 with LUC transgene and B2M knockout (B2M KO), CCR5 with bicistronic HLA-E transgene and LUC transgene (including 2A peptide) and B2M knockout (Bicis HLA-E), CCR5 with LUC transgene and NLRC5 knockout (NLRC5 KO), or CCR5 with LUC transgene and B2M and CD58 knockout (B2M / CD58 DKO). [Figure 26B]This image shows the bioluminescence of huCD34-NSG-IL15 mice 36 days after administration of the same B-series cell population as in Figure 26A. [Figure 26C] The following shows the measurement of systemic BLI in NOG-IL6 mice (Figure 26C) and hCD34-NSG-IL15 mice (Figure 26D) at time points 1, 3, 7, 14, 21, 27, and 36 after administration of the indicated B-lineage cell population. [Figure 26D] The following shows the measurement of systemic BLI in NOG-IL6 mice (Figure 26C) and hCD34-NSG-IL15 mice (Figure 26D) at time points 1, 3, 7, 14, 21, 27, and 36 after administration of the indicated B-lineage cell population.
[0054] [Figure 27] The graph shows the integration percentage (homologous repair, HDR, top left), factor IX (FIX) secretion (top right), and FIX activity at D7 or D13 in the B cell culture process from two different donor B-lineage cell populations (LKP230152 and LKP230157), compared to an RNP-only control. This includes CCR5 with FIX transgenerator (control), CCR5 with FIX transgenerator and B2M knockout (B2M KO), CCR5 with FIX transgenerator and NLRC5 knockout (NLRC5 KO), CCR5 with FIX transgenerator and RFX5 knockout (RFX5 KO), or CCR5 with FIX transgenerator, as well as B2M and CD58 knockout (B2M / CD58 DKO). [Modes for carrying out the invention]
[0055] definition To facilitate understanding of the present invention, certain terms are first defined below. Further definitions of the following terms and other terms are provided throughout the specification. Publications and other reference materials referenced herein are incorporated herein by reference to provide context for the present invention and to provide further details on its practice.
[0056] The articles "a" and "an" are used herein to refer to one or more (i.e., at least one) grammatical objects of the article. For example, "an element" means one or more elements.
[0057] Approximately or about: As used herein, the terms “approximately” or “about” refer to a value similar to the stated baseline value when applied to one or more values of interest. In certain embodiments, unless otherwise stated or particularly evident from the context, the terms “approximately” or “about” refer to a range of values that fall within 25%, 20%, 19%, 18%, 17%, 16%, 15%, 14%, 13%, 12%, 11%, 10%, 9%, 8%, 7%, 6%, 5%, 4%, 3%, 2%, and 1% in either direction (above or below) the stated baseline value (unless such a number exceeds 100% of the possible values).
[0058] Activation: As used herein, the term “activation” refers to a state in which a cell, such as a B cell, is sufficiently stimulated to induce detectable cell proliferation or to exert its effector function. Activation can also be associated with the induction of cytokine production, cell signaling, differentiation, and / or antigen processing and presentation.
[0059] Administration: As used herein, the term “administration” usually means the administration of (e.g., a composition or treatment) to a subject or system (e.g., one or more cells, tissues, organisms, etc., or including them) to achieve, for example, the delivery of a drug contained in, or otherwise delivered or produced by, such composition or treatment. Those skilled in the art will know, in appropriate circumstances, the various routes that may be used for administration to a subject, e.g., a human. For example, in some embodiments, administration may be by eye drops, oral administration, parenteral administration, topical administration, etc. In some specific embodiments, administration may be bronchial administration (e.g., by bronchial infusion), oral administration, cutaneous administration (e.g., one or more of the following, or may include, local administration to the dermis, intradermal administration, interdermal administration, transdermal administration), enteral administration, intra-arterial administration, intradermal administration, intragastric administration, intrathecal administration, intramuscular administration, intranasal administration, intraperitoneal administration, subarachnoid administration, intravenous administration, intraventricular administration, administration within a specific organ (e.g., intrahepatic administration), mucosal administration, nasal administration, oral administration, rectal administration, subcutaneous administration, sublingual administration, local administration, tracheal administration (e.g., by intratracheal infusion), vaginal administration, intravitreal administration, etc. In some embodiments, administration may consist of only a single dose. In some embodiments, administration may include the application of a fixed number of doses. In some embodiments, administration may include intermittent administration (e.g., multiple doses spaced apart in time) and / or cyclic administration (individual doses separated by a common set of time). In some embodiments, administration may include continuous administration (e.g., perfusion) for at least a selected set of time.
[0060] Drugs: As used herein, the term “drug” (or “biological drug” or “therapeutic agent”) refers to molecules that can be expressed, released, secreted, or delivered to a target by the modified cells described herein. Drugs include, but are not limited to, nucleic acids, antibiotics, anti-inflammatory agents, antibodies or fragments thereof, antibody drugs or fragments thereof, growth factors, cytokines, enzymes, proteins (e.g., RNAse inhibitors), peptides, fusion proteins, synthetic molecules, organic molecules (e.g., small molecules), carbohydrates, lipids, hormones, microsomes, derivatives or variants thereof, and any combination thereof. Drugs can bind to any cellular portion present on the target or target cell, such as receptors, antigenic determinants, or other binding sites. Drugs may diffuse or be transported into the cell and act within the cell.
[0061] Allogeneic Antigen: As used herein, the term “allogeneic antigen” refers to an antigen associated with non-self-recognition and / or graft rejection (e.g., an antigen that induces a rejection immune response). Generally, an allogeneic antigen is a substance present in or on tissues from a particular individual of a specific species (e.g., a donor individual) but not in or on tissues from another individual of the same species (e.g., a recipient individual that is genetically different from the donor individual), i.e., transplantation of tissue from a donor individual into a recipient individual carries the risk of and / or results in a rejection immune response. Generally, an antigen can be or may include any chemical substance, e.g., small molecules, nucleic acids, polypeptides, carbohydrates, lipids, etc. In some embodiments, the allogeneic antigen is or includes a polypeptide. Various polypeptides are known in the art, whose amino acid sequences may differ between individuals of the same species and between individuals of the same species, so that they may act as allogeneic antigens.
[0062] Homogeneous: As used herein, the term “homogeneous” refers to any substance (e.g., a group of cells) derived from different animals of the same species.
[0063] Non-self recognition: As used herein, the term “non-self recognition” typically refers to an immune response initiated by the immune system of an individual receiving tissue transplantation from another individual of the same species (i.e., a donor genetically different from the recipient individual), where the immune response involves the recognition of an allogeneic antigen on the transplanted tissue. Typically, non-self recognition involves T cell recognition of an allogeneic antigen. In many embodiments, T cells recognize an allogeneic antigen peptide, for example, an allogeneic antigen peptide whose sequence is encoded by polymorphic genes that differ between the donor and recipient individuals.
[0064] Remission: As used herein, refers to the prevention, reduction, or mitigation of a condition, or improvement of a condition. Remission includes, but does not require, complete recovery from or complete prevention of a disease, disorder, or condition (e.g., radiation injury).
[0065] Antigen: As used herein, the terms “antigen” or “Ag” refer to a molecule capable of eliciting an immune response. This immune response may involve antibody production, activation of specific immune cells, or both. Those skilled in the art will understand that any macromolecule, including substantially all proteins or peptides, can function as an antigen. Furthermore, antigens may originate from recombinant DNA or genomic DNA. Those skilled in the art will understand that any DNA containing a nucleotide sequence or partial nucleotide sequence encoding a protein that elicits an immune response will code for the term “antigen” as used herein. Furthermore, those skilled in the art will understand that antigens do not have to be encoded solely by the full-length nucleotide sequence of a gene. It is readily apparent that the present invention may involve, but is not limited to, the use of partial nucleotide sequences of two or more genes, and that these nucleotide sequences may be arranged in various combinations to elicit a desired immune response. Furthermore, those skilled in the art will understand that antigens do not have to be encoded by a “gene” at all. It is readily apparent that antigens may be generated, synthesized, or derived from biological samples. Such biological samples may, but are not limited to, tissue samples, tumor samples, cells, or biological fluids.
[0066] Antibody Drugs: As used herein, the term “antibody drug” (hereinafter interchangeably referred to as “antibody”) refers to polypeptides that can be expressed, released, secreted, or delivered to a target by the modified cells described herein. The polypeptides contain canonical immunoglobulin sequence elements sufficient to confer specific binding to a particular target antigen. In some embodiments, the antibody drug consists of an antibody. As is known in the art, naturally produced antibodies are approximately 150 kD tetrameric agents comprising two identical heavy-chain polypeptides (each about 50 kD) and two identical light-chain polypeptides (each about 25 kD) that associate with each other to form a structure commonly referred to as a “Y-shaped” structure. Each heavy chain contains at least four domains (each about 110 amino acids long) of three constant domains: an amino-terminal variable (VH) domain (located at the tip of the Y structure), followed by CH1, CH2, and carboxy-terminal CH3 (located at the base of the trunk portion of the Y). A short region known as the "switch" links the heavy chain variable region and the heavy chain constant region. The "hinge" links the CH2 and CH3 domains to the remainder of the antibody. Two disulfide bonds in this hinge region link the two heavy chain polypeptides together in an intact antibody. Each light chain contains two domains, an amino-terminal variable (VL) domain followed by a carboxy-terminal constant (CL) domain, separated from each other by another "switch". An intact antibody drug tetramer contains two heavy-light chain dimers, each linked to the other by a single disulfide bond. Two other disulfide bonds link the heavy chain hinge regions together so that the dimers are linked to each other and a tetramer is formed. Antibody drugs typically have a glycosylated CH2 domain. Each domain in natural antibodies has a structure characterized by an "immunoglobulin fold" formed by two beta sheets (e.g., 3, 4, or 5-strand sheets) bundled together in a compressed antiparallel beta barrel. Each variable domain contains three hypervariable loops (CDR1, CDR2, and CDR3) and four somewhat invariant "framework" regions (FR1, FR2, FR3, and FR4) known as "complementarity-determining regions."When a native antibody folds, the FR region forms a beta sheet that provides a structural framework for the domain, and the CDR loop regions of both the heavy and light chains assemble in three-dimensional space to produce a single hypervariable antigen-binding site located at the tip of the Y structure. The Fc region of a naturally occurring antibody binds to components of the complement system, including, for example, effector cells that mediate cytotoxicity, and also to receptors on effector cells. The affinity and / or other binding properties of the Fc region to the Fc receptor can be modulated by glycosylation or other modifications. In some embodiments, antibodies produced and / or utilized (e.g., as components of a CAR) according to this disclosure include a glycosylated Fc domain, which contains an Fc domain whose glycosylation has been modified or manipulated. In some embodiments, any polypeptide or polypeptide complex containing sufficient immunoglobulin domain sequences found in a native antibody may be referred to as an “antibody drug” and / or used as an antibody, whether such polypeptide is naturally occurring (e.g., produced by an organism that reacts to an antigen) or produced by recombinant operations, chemosynthesis, or other artificial systems or methodologies. In some embodiments, the antibody drug is polyclonal. In some embodiments, the antibody drug is monoclonal. In some embodiments, the antibody drug has a constant region sequence characteristic of mouse, rabbit, primate, or human antibodies. In some embodiments, the sequence elements of the antibody drug are humanized, primated, chimeric, etc., as are well known in the art. Furthermore, as used herein, the term “antibody drug” may, in appropriate embodiments (unless otherwise specified or otherwise evident from the context), refer to any construct or format known or developed in the art for utilizing the structural and functional characteristics of an antibody in an alternative offering. In some embodiments, the antibody drug may lack covalent modifications (e.g., glycan linkages) that it has when naturally occurring.In some embodiments, the antibody drug may contain covalent modifications (e.g., the attachment of glycans, payloads [e.g., detectable portion, therapeutic portion, catalytic portion, etc.], or other pendant groups [e.g., polyethylene glycol, etc.]).
[0067] Self: As used herein, the term “self” refers to any material derived from the same individual that is later reintroduced into the individual.
[0068] Biologically active: As used herein, this refers to an observable biological effect or result achieved by the drug or entity of interest. For example, in some embodiments, specific binding interactions are biological activity. In some embodiments, modulation of a biological pathway or event (e.g., induction, enhancement, or inhibition) is biological activity. In some embodiments, the presence or degree of biological activity is assessed by detecting direct or indirect products generated by the biological pathway or event of interest.
[0069] Biomarker: The term “biomarker” is used herein to mean an entity, event, or feature whose presence, level, degree, type, and / or form correlates with a particular biological event or condition of interest, and as a result is considered a “marker” of that event or condition. To give only a few examples, in some embodiments a biomarker may be, or include, a marker of a particular pathological condition or a marker of the likelihood that a particular disease, disorder, or condition may develop, occur, or recur. In some embodiments a biomarker may be, or include, a marker of a particular disease or treatment outcome or the likelihood thereof. Thus, in some embodiments a biomarker predicts the relevant biological event or condition of interest, in some embodiments a biomarker predicts the prognosis of the relevant biological event or condition of interest, and in some embodiments a biomarker diagnoses the relevant biological event or condition of interest. A biomarker may be, or include, an entity of any chemical classification, or a combination of entities. For example, in some embodiments, the biomarker may be or include nucleic acids, polypeptides, lipids, carbohydrates, small molecules, inorganic agents (e.g., metals or ions), or combinations thereof. In some embodiments, the biomarker is a cell surface marker. In some embodiments, the biomarker is an intracellular biomarker. In some embodiments, the biomarker is detected extracellularly (e.g., secreted or otherwise produced extracellularly, or present extracellularly in body fluids, e.g., blood, urine, tears, saliva, cerebrospinal fluid, etc.). In some embodiments, the biomarker may be or include a gene signature or epigenetic signature. In some embodiments, the biomarker may be or include a gene expression signature.
[0070] Bispecific antibody: As used herein, this refers to a bispecific conjugate substance in which at least one, typically both, of the conjugates are antibody components or contain such components. Structures of various different bispecific antibodies are known in the art. In some embodiments, each conjugate in a bispecific antibody that is an antibody component or contains such components comprises a VH and / or VL region, and in some such embodiments, such VH and / or VL regions are found in a particular monoclonal antibody. In some embodiments in which a bispecific antibody contains conjugates that are two antibody components, each comprises a VH and / or VL region derived from a different monoclonal antibody. In some embodiments, a bispecific antibody comprises two antibody components, a binding moiety, where one of the two antibody components comprises an immunoglobulin molecule having a VH and / or VL region containing a CDR derived from a first monoclonal antibody, and the other of the two antibody components comprises an antibody fragment (e.g., Fab, F(ab'), F(ab')2, Fd, Fv, dAB, scFv, etc.) having a VH and / or VL region containing a CDR derived from a second monoclonal antibody. In some embodiments, the bispecific antibody may also include an Fc moiety, a tag (e.g., a His tag), or other elements that assist in circulation, purification, characterization, etc.
[0071] Conservative Sequence Modification: As used herein, the term “conservative sequence modification” refers to an amino acid modification that does not significantly affect or alter the binding properties of an antibody containing an amino acid sequence. Such conservative modifications include amino acid substitutions, additions, and deletions. Modifications can be introduced into antibodies suitable for various embodiments by standard techniques known in the art, such as site-directed mutagenesis and PCR-mediated mutagenesis. A conservative amino acid substitution is one in which an amino acid residue is replaced by an amino acid residue having a similar side chain. Families of amino acid residues having similar side chains are defined in the art. These families include amino acids with basic side chains (e.g., lysine, arginine, histidine), amino acids with acidic side chains (e.g., aspartic acid, glutamic acid), amino acids with non-charged side chains (e.g., glycine, asparagine, glutamine, serine, threonine, tyrosine, cysteine, tryptophan), amino acids with nonpolar side chains (e.g., alanine, valine, leucine, isoleucine, proline, phenylalanine, methionine), amino acids with beta-branched side chains (e.g., threonine, valine, isoleucine), and amino acids with aromatic side chains (e.g., tyrosine, phenylalanine, tryptophan, histidine). Therefore, one or more amino acid residues in the CDR region of an antibody can be replaced with other amino acid residues from the same side chain family, and the modified antibody can be tested for its ability to bind to an antigen using the functional assays described herein.
[0072] Code: As used herein, “code” refers to the inherent properties and resulting biological properties of a particular nucleotide sequence in a polynucleotide, such as a gene, cDNA, or mRNA, which has either a defined nucleotide (i.e., rRNA, tRNA, and mRNA) sequence or a defined amino acid sequence, and which acts as a template for the synthesis of other polymers and macromolecules in biological processes. Thus, a gene codes for a protein when the transcription and translation of the mRNA corresponding to that gene produce a protein in a cell or other biological system. Both the coding strand, which is identical to the mRNA sequence and is typically provided in a sequence listing, and the non-coding strand, which is used as a template for the transcription of a gene or cDNA, may be said to code for a protein or other product of that gene or cDNA.
[0073] Manipulated: Generally, the term “manipulated” refers to an aspect of being manipulated by human hands. For example, a polynucleotide can be considered “manipulated” if two or more sequences, which are not linked to each other in their natural order in nature, are manipulated by human hands so that they are directly linked to each other in the manipulated polynucleotide, and / or if certain residues in the polynucleotide are non-natural and / or, by human action, linked to entities or parts that are not linked in nature. For example, in some embodiments described and / or utilized herein, a manipulated polynucleotide includes a control sequence that is found to be operably linked to a first coding sequence but not to a second coding sequence in nature, and is operably linked by human hands so that the control sequence is operably linked to the second coding sequence. Similarly, a polypeptide can be considered “genetically engineered” if it is encoded or expressed by a manipulated polynucleotide and / or produced by means other than natural expression in a cell. Similarly, a cell or organism is considered “engineered” if it is subjected to an operation such that its genetic identity, epigenetic identity, and / or phenotypic identity is altered compared to a suitable reference cell, e.g., a otherwise identical cell that has not been similarly manipulated. In some embodiments, such an operation is or includes a genetic operation such that its genetic information is altered (e.g., novel genetic material that was not previously present is introduced, e.g., by transformation, mating, somatic hybridization, transfusion, transduction, or other mechanism, or previously present genetic material is altered or removed, e.g., by substitution or deletion mutation, or by a mating procedure). In some embodiments, an engineered cell is a cell that has been engineered to contain and / or express a particular active agent of interest (e.g., a protein, nucleic acid, and / or a particular form thereof) in an amount and / or timing of alteration compared to such a suitable reference cell.As is customary and as understood by those skilled in the art, a manipulated polynucleotide or cellular progeny is usually still referred to as “manipulated,” even if the actual manipulation was performed on a prior entity.
[0074] Endogenous: As used herein, “endogenous” means any substance that originates from or is produced within a particular organism, cell, tissue, or system.
[0075] Excipients: As used herein, these refer to non-therapeutic agents that may be included in a pharmaceutical composition to provide or contribute to a desired consistency or stabilizing effect. Suitable pharmaceutical excipients include starch, glucose, lactose, sucrose, gelatin, malt, rice, wheat flour, white powder, silica gel, sodium stearate, glycerol monostearate, talc, sodium chloride, skim milk powder, glycerol, propylene glycol, water, and ethanol.
[0076] Exogenous: As used herein, the term “exogenous” means any substance introduced from outside a particular organism, cell, tissue, or system, or produced outside of them.
[0077] Enlargement: As used herein, the term “enlargement” means an increase in number, such as in an increase in the number of cells, e.g., monocytes, macrophages, and / or dendritic cells. In one embodiment, monocytes, macrophages, or dendritic cells enlarged ex vivo are increased in number compared to the number initially present in the culture. In another embodiment, monocytes, macrophages, or dendritic cells enlarged ex vivo are increased in number compared to other cell types in the culture. In some embodiments, enlargement may occur in vivo. As used herein, the term “ex vivo” means cells taken from a living organism (e.g., human) and grown outside the organism (e.g., in a culture dish, test tube, or bioreactor).
[0078] Expression: As used herein, the term “expression” of a nucleic acid sequence refers to the generation of any gene product from a nucleic acid sequence. In some embodiments, the gene product may be a transcript. In some embodiments, the gene product may be a polypeptide. In some embodiments, the expression of a nucleic acid sequence includes one or more of the following: (1) generation of an RNA template from a DNA sequence (e.g., by transcription), (2) processing of the RNA transcript (e.g., by splicing, editing, 5' cap formation, and / or 3' end formation), (3) translation of the RNA into a polypeptide or protein, and / or (4) post-translational modification of the polypeptide or protein.
[0079] Expression vectors: As used herein, the term “expression vector” refers to a vector comprising recombinant polynucleotides containing an expression regulatory sequence operably ligated to the nucleotide sequence to be expressed. An expression vector contains sufficient cis-acting elements for expression, and other elements for expression may be supplied by a host cell or in an in vitro expression system. Expression vectors include all vectors known in the art, such as cosmids, plasmids (e.g., naked or contained in liposomes), and viruses (e.g., lentiviruses, retroviruses, adenoviruses, and adeno-associated viruses).
[0080] Fragment: As used herein, the terms “fragment” or “part” refer to a structure that includes a distinct part of the whole but lacks one or more parts found in the whole structure, where they are used interchangeably herein. In some embodiments, a fragment consists of such distinct parts. In some embodiments, a fragment consists of or includes characteristic structural elements or parts found in the whole. In some embodiments, the nucleotide fragment contains or consists of at least 3, 4, 5, 6, 7, 8, 9, 10, 11, 12, 13, 14, 15, 16, 17, 18, 19, 20, 25, 30, 35, 40, 45, 50, 55, 60, 65, 70, 75, 80, 85, 90, 95, 100, 110, 120, 130, 140, 150, 160, 170, 180, 190, 200, 210, 220, 230, 240, 250, 275, 300, 325, 350, 375, 400, 425, 450, 475, 500 or more monomeric units (e.g., nucleic acids) found throughout the nucleotide. In some embodiments, a nucleotide fragment contains or consists of at least about 5%, 10%, 15%, 20%, 25%, 30%, 25%, 40%, 45%, 50%, 55%, 60%, 65%, 70%, 75%, 80%, 85%, 90%, 95%, 96%, 97%, 98%, 99%, or more monomer units (e.g., residues) found throughout the nucleotide. The whole substance or entity may, in some embodiments, be referred to as the “parent” of the whole.
[0081] Functional: As used herein, a “functional” biomolecule is a biomolecule in a form that exhibits the properties and / or activity it is characterized by.
[0082] Gene product or expression product: As used herein, the terms “gene product” or “expression product” generally refer to RNA transcribed from a gene (before and / or after processing) or polypeptides encoded by RNA transcribed from a gene (before and / or after modification).
[0083] Homology: As used herein, the term “homology” refers to the overall relationship between polymer molecules, for example, between nucleic acid molecules (e.g., DNA molecules and / or RNA molecules) and / or between polypeptide molecules. In some embodiments, polymer molecules are considered “homology” to one another if their sequences are at least 25%, 30%, 35%, 40%, 45%, 50%, 55%, 60%, 65%, 70%, 75%, 80%, 85%, 90%, 95%, or 99% identical. In some embodiments, polymer molecules are considered “homology” to one another if their sequences are at least 25%, 30%, 35%, 40%, 45%, 50%, 55%, 60%, 65%, 70%, 75%, 80%, 85%, 90%, 95%, or 99% similar (e.g., containing residues with related chemical properties at corresponding positions). As will be understood by those skilled in the art, various algorithms are available that enable the comparison of sequences to determine the degree of homology, which include, for example, allowing gaps of a specified length in one sequence to another when considering which residues in different sequences "correspond" to each other. The calculation of the homology percentage between two nucleic acid sequences can be performed, for example, by aligning the two sequences for the purpose of best comparison (for example, gaps can be introduced in one or both of the first and second nucleic acid sequences for best alignment, and non-corresponding sequences can be ignored for the purpose of comparison). In a particular embodiment, the length of the aligned sequences for the purpose of comparison is at least 30%, at least 40%, at least 50%, at least 60%, at least 70%, at least 80%, at least 90%, at least 95%, or substantially 100% of the reference sequence. Nucleotides are then compared at the corresponding nucleotide positions. If the position in the first sequence is occupied by the same nucleotide as the corresponding position in the second sequence, the molecules are identical at that position; if the position in the first sequence is occupied by a nucleotide similar to the corresponding position in the second sequence, the molecules are similar at that position.The homology percentage between two sequences is a function of the number of identical and similar positions common to the sequences, taking into account the number of gaps that need to be introduced for optimal alignment of the two sequences and the length of each gap.
[0084] Identity: As used herein, the term “identity” refers to the subunit sequence identity between two polymer molecules, in particular between two amino acid molecules, for example between two polypeptide molecules. Two amino acid sequences are identical at the same position if, for example, the position in each of two polypeptide molecules is occupied by arginine. The identity or degree to which two amino acid sequences have the same residue at the same position in alignment is often expressed as a percentage. Identity between two amino acid sequences is a linear function of the number of matching or identical positions, for example, if half of the positions in the two sequences are identical (e.g., five positions in a polymer of 10 amino acids), the two sequences are 50% identical, and if 90% of the positions (e.g., nine out of ten) are matching or identical, the two amino acid sequences are 90% identical.
[0085] Immune cells: As used herein, the term “immune cells” refers to cells involved in an immune response, e.g., promoting an immune response. Examples of immune cells include, but are not limited to, macrophages, monocytes, dendritic cells, neutrophils, eosinophils, mast cells, platelets, large granular lymphocytes, Langerhans cells, natural killer (NK) cells, T lymphocytes, plasma cells, plasmablasts, or B lymphocytes. Sources of immune cells (e.g., macrophages, monocytes, or dendritic cells) can be obtained from the subject.
[0086] Immune response: As used herein, the term “immune response” refers to the cellular and / or systemic response to an antigen that occurs when lymphocytes recognize an antigen molecule as foreign, induce antibody formation, and / or activate lymphocytes to eliminate the antigen.
[0087] Immunoglobulins: As used herein, the terms “immunoglobulin” or “Ig” refer to a class of proteins that function as antibodies. Antibodies expressed by B cells are sometimes referred to as BCRs (B cell receptors) or antigen receptors. The five members of this class of proteins are IgA, IgG, IgM, IgD, and IgE. IgA is a primary antibody found in body secretions such as saliva, tears, breast milk, gastrointestinal secretions, and mucus secretions of the respiratory and urogenital tracts. IgG is the most common circulating antibody. IgM is the major immunoglobulin produced in the primary immune response to most targets. It is the most efficient immunoglobulin in agglutination, complement binding, and other antibody responses and is important for protection against bacteria and viruses. IgD is an immunoglobulin whose antibody function is unknown, but it may function as an antigen receptor. IgE is an immunoglobulin that mediates immediate-type hypersensitivity by triggering the release of mediators from mast cells and basophils upon exposure to allergens.
[0088] Isolation: As used herein, isolation means a substance and / or entity that (1) has been separated from at least some of the components that were associated when it was first produced (whether naturally and / or in an experimental setting) and / or otherwise previously associated, and / or (2) has been designed, produced, prepared and / or manufactured by human hands. In some embodiments, a substance may be considered “isolated” if it does not contain or has been separated from (or has been made not to contain or separated from) any other components (e.g., components to which it previously associated) in proportion to about 10%, about 20%, about 30%, about 40%, about 50%, about 60%, about 70%, about 80%, about 90%, about 91%, about 92%, about 93%, about 94%, about 95%, about 96%, about 97%, about 98%, about 99%, or more than about 99% of the other components (e.g., components to which it previously associated). In some embodiments, the isolated agent is approximately 80%, approximately 85%, approximately 90%, approximately 91%, approximately 92%, approximately 93%, approximately 94%, approximately 95%, approximately 96%, approximately 97%, approximately 98%, approximately 99%, or more than approximately 99% pure. As used herein, a substance is “pure” if it substantially contains no other components. In some embodiments, as will be understood by those skilled in the art, a substance may still be considered “isolated” or even “pure” after being combined with certain other components, such as one or more carriers or excipients (e.g., buffers, solvents, water, etc.). In such embodiments, the percentage isolation or purity of the substance is calculated without including such carriers or excipients. To give just one example, in some embodiments, a naturally occurring biomacromolecule such as polypeptides or polynucleotides is considered “isolated” if, by its origin or source of induction, it does not associate with some or all of the components that are naturally present in nature; b) it substantially does not contain other polypeptides or nucleic acids of the same species from which it is produced in nature; or c) it is expressed by cells or other expression systems that are not of the species that produces it in nature, or associates otherwise with components derived therefrom.Therefore, for example, in some embodiments, polypeptides that are chemically synthesized or synthesized by cellular mechanisms different from those that produce them in nature are considered “isolated” polypeptides. Alternatively or additionally, in some embodiments, polypeptides subjected to one or more purification techniques may be considered “isolated” polypeptides to the extent that a) it is associated in nature and / or (b) it is separated from other components that it was associated with when it was first produced.
[0089] Marker: As used herein, a marker refers to an entity or part whose presence or level is characteristic of a particular condition or event. In some embodiments, the presence or level of a particular marker may be characteristic of the presence or stage of a disease, disorder, or condition. For example, in some embodiments, the term refers to a gene expression product that is characteristic of a particular tumor, tumor subclass, tumor stage, etc. Alternatively or additionally, in some embodiments, the presence or level of a particular marker correlates, for example, with the activity (or level of activity) of a particular signaling pathway that may be characteristic of a particular class of tumor. The statistical significance of the presence or absence of a marker may vary depending on the particular marker. In some embodiments, the detection of a marker is highly specific in that it reflects a high probability that such a tumor belongs to a particular subclass. Such specificity may be obtained at the expense of sensitivity (i.e., a negative result may occur even if the tumor is one that is expected to express the marker). Conversely, a marker with high sensitivity may have lower specificity than one with lower sensitivity. Those skilled in the art will understand that in many embodiments, a useful marker does not need to be identified with 100% accuracy.
[0090] Modification: As used herein, the term “modification” refers to an altered state or structure of the molecules or cells of the present invention. Molecules can be modified in many ways, including chemically, structurally, and functionally. Cells can be modified by the introduction of nucleic acids.
[0091] Modulate: As used herein, the term “modulate” means mediating a detectable increase or decrease in the level of response and / or a change in the nature of the response in an object compared to the level and / or nature of the response in the object in the absence of the treatment or compound, and / or compared to the level and / or nature of the response in an otherwise identical but untreated object. The term encompasses, in an object, preferably a human, disrupting and / or influencing a natural signal or response, thereby mediating a beneficial therapeutic response.
[0092] Nucleic acid: As used herein, the term “nucleic acid” refers to a polymer of at least three nucleotides. In some embodiments, the nucleic acid includes DNA. In some embodiments, the nucleic acid includes RNA. In some embodiments, the nucleic acid is single-stranded. In some embodiments, the nucleic acid is double-stranded. In some embodiments, the nucleic acid includes both single-stranded and double-stranded portions. In some embodiments, the nucleic acid includes a backbone comprising one or more phosphodiester bonds. In some embodiments, the nucleic acid includes a backbone comprising both phosphodiester and non-phosphodiester bonds. For example, in some embodiments, the nucleic acid may include a backbone comprising one or more phosphorothioate bonds or 5'-N-phosphoramidite bonds and / or one or more peptide bonds, such as “peptide nucleic acid”. In some embodiments, the nucleic acid comprises one or more or all of the native residues (e.g., adenine, cytosine, deoxyadenosine, deoxycytidine, deoxyguanosine, deoxythymidine, guanine, thymine, uracil). In some embodiments, the nucleic acid comprises one or more or all of the non-native residues. In some embodiments, the non-natural residues include nucleoside analogs (e.g., 2-aminoadenosine, 2-thiothymidine, inosine, pyrrolo-pyrimidine, 3-methyladenosine, 5-methylcytidine, C-5 propynylcytidine, C-5 propynyluridine, 2-aminoadenosine, C5-bromouridine, C5-fluorouridine, C5-iodouridine, C5-propynyluridine, C5-propynylcytidine, C5-methylcytidine, 2-aminoadenosine, 7-deazaadenosine, 7-deazaguanosine, 8-oxoadenosine, 8-oxoguanosine, 0(6)-methylguanine, 2-thiocytidine, methylated bases, intercalated bases, and combinations thereof). In some embodiments, the non-natural residues include one or more modified sugars (e.g., 2'-fluororibose, ribose, 2'-deoxyribose, arabinose, and hexose) compared to those of the natural residues. In some embodiments, the nucleic acid has a nucleotide sequence encoding a functional gene product such as RNA or polypeptide.In some embodiments, the nucleic acid has a nucleotide sequence containing one or more introns. In some embodiments, the nucleic acid may be prepared by isolation from a natural source, enzymatic synthesis (e.g., polymerization based on a complementary template in vivo or in vitro), replication in recombinant cells or systems, or chemosynthesis. In some embodiments, the nucleic acid has at least 3, 4, 5, 6, 7, 8, 9, 10, 15, 20, 25, 30, 35, 40, 45, 50, 55, 60, 65, 70, 75, 8 The residue lengths are 0, 85, 90, 95, 100, 110, 120, 130, 140, 150, 160, 170, 180, 190, 20, 225, 250, 275, 300, 325, 350, 375, 400, 425, 450, 475, 500, 600, 700, 800, 900, 1000, 1500, 2000, 2500, 3000, 3500, 4000, 4500, and 5000 or more.
[0093] Operablely linked: As used herein, the term “operably linked” means a functional link between, for example, a regulatory sequence and a heterologous nucleic acid sequence, resulting in the expression of the latter. For example, if a first nucleic acid sequence is functionally related to a second nucleic acid sequence, the first nucleic acid sequence is operably linked to the second nucleic acid sequence. For example, a promoter is operably linked to a coding sequence if the promoter affects the transcription or expression of the coding sequence. Generally, operably linked DNA sequences are adjacent to each other in the same reading frame and, if necessary, are intended to link two protein-coding regions.
[0094] Payload: Generally as used herein, the term “payload” refers to a drug that can be delivered or transported by association with another entity. In some embodiments, such association may be or include covalent bonds. In some embodiments, such association may be or include non-covalent interactions. In some embodiments, the association may be direct. In some embodiments, the association may be indirect. The term “payload” is not limited to a specific chemical identity or chemical type. For example, in some embodiments, the payload may be or include entities of any chemical classification, including, for example, lipids, metals, nucleic acids (e.g., transgenes), polypeptides, sugars (e.g., polysaccharides), small molecules, or combinations or complexes thereof. In some embodiments, the payload may be or include biological modifiers, detectable drugs (e.g., dyes, fluorophores, radiolabels, etc.), detection reagents, nutrients, therapeutic agents, etc., or combinations thereof. In some embodiments, the payload may be or include cells or organisms, or fractions, extracts, or components thereof. In some embodiments, the payload may be or include a natural product in that it is found and / or obtained naturally. Alternatively or additionally, in some embodiments, the term may be used to refer to one or more entities that are artificial in that they are designed, manipulated and / or produced by the work of human hands and / or are not found in nature. In some embodiments, the payload may be or include a drug in an isolated or pure form. In some embodiments, such a drug may be in a crude form.
[0095] Pharmaceutical composition: As used herein, the term “pharmaceutical composition” refers to an active agent formulated with one or more pharmaceutically acceptable carriers. In some embodiments, the active agent exists in a unit dose suitable for administration in a therapeutic regimen that exhibits a statistically significant probability of achieving a predetermined therapeutic effect when administered to an appropriate population. In some embodiments, the pharmaceutical composition may be specifically formulated for administration in solid or liquid form, which includes those suitable for: oral administration, e.g., liquid drugs (aqueous solutions or non-aqueous solutions or suspensions), tablets, e.g., those targeting oral absorption, sublingual absorption, and systemic absorption, pills, powders, granules, and pastes for application to the tongue; parenteral administration, e.g., by subcutaneous, intramuscular, intravenous, or epidural injection, e.g., sterile solutions or suspensions or sustained-release formulations; topical application, e.g., creams, ointments, or sustained-release patches, or sprays applied to the skin, lungs, or mouth; vaginal or rectal use, e.g., pessaries, creams, or foams; sublingual use; ocular use; transdermal use; or transnasal, transpulmonary, and other mucosal applications.
[0096] Polynucleotides: As used herein, the term “polynucleotide” refers to a chain of nucleotides. Furthermore, nucleic acids are polymers of nucleotides. Thus, as used herein, nucleic acids and polynucleotides are interchangeable. Those skilled in the art have general knowledge that nucleic acids are polynucleotides and can be hydrolyzed to monomeric “nucleotides.” Monomeric nucleotides can be hydrolyzed to nucleosides. Polynucleotides as used herein include, but are not limited to, all nucleic acid sequences obtained by any means available in the art, including recombinant means, i.e., cloning of nucleic acid sequences from recombinant libraries or cell genomes, using conventional cloning techniques and PCR, etc., and synthetic means.
[0097] Polypeptide: As used herein, the term "polypeptide" refers to any polymer chain of residues (e.g., amino acids) linked by peptide bonds. In some embodiments, the polypeptide has a naturally occurring amino acid sequence. In some embodiments, the polypeptide has a non-natural amino acid sequence. In some embodiments, the polypeptide has a modified amino acid sequence in that it is artificially designed and / or manufactured. In some embodiments, the polypeptide may contain or consist of natural amino acids, non-natural amino acids, or both. In some embodiments, the polypeptide may contain or consist of only natural amino acids or only non-natural amino acids. In some embodiments, the polypeptide may contain D-amino acids, L-amino acids, or both. In some embodiments, the polypeptide may contain only D-amino acids. In some embodiments, the polypeptide may contain only L-amino acids. In some embodiments, the polypeptide may contain one or more pendant groups or other modifications, e.g., modifications or attachments to one or more amino acid side chains, at the N-terminus, the C-terminus, or any combination thereof. In some embodiments, such pendant groups or modifications may be selected from the group consisting of acetylation, amidation, lipidation, methylation, pegylation, etc. (including combinations thereof). In some embodiments, the polypeptide may be cyclic and / or contain a cyclic moiety. In some embodiments, the polypeptide is not cyclic and / or does not contain a cyclic moiety. In some embodiments, the polypeptide is linear. In some embodiments, the polypeptide may be or contain a staple polypeptide. In some embodiments, the term “polypeptide” may be suffixed to the name of a reference polypeptide, activity, or structure; in such cases, it is used herein to refer to polypeptides that share a relevant activity or structure and can therefore be considered members of the same class or family of polypeptides.For each such class, this specification provides exemplary polypeptides within the class whose amino acid sequence and / or function is known, and / or which will be recognized by those skilled in the art; in some embodiments, such exemplary polypeptides are reference polypeptides of the class or family of polypeptides. In some embodiments, members of the class or family of polypeptides exhibit significant sequence homology or identity with the reference polypeptide of the class; and in some embodiments, with all polypeptides within the class; they share common sequence motifs (e.g., characteristic sequence elements) and / or common activity (in some embodiments, at equivalent levels or within a specified range). For example, in some embodiments, the member polypeptide comprises at least about 30–40% and often exhibits an overall degree of sequence homology or identity with the reference polypeptide exceeding about 50%, 60%, 70%, 80%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99%, or more, and / or includes at least one region (for example, a conserved region that may be, or may contain, a characteristic sequence element) that often exhibits a very high degree of sequence identity exceeding 90%, or even more than 95%, 96%, 97%, 98%, or 99%. Such a conserved region typically comprises at least 3–4 amino acids, often up to 20 or more, and in some embodiments, the conserved region comprises at least one interval of at least 2, 3, 4, 5, 6, 7, 8, 9, 10, 11, 12, 13, 14, 15, or more consecutive amino acids. In some embodiments, the useful polypeptide may contain or consist of a fragment of the parent polypeptide.In some embodiments, the useful polypeptide may contain or consist of multiple fragments, each of which is found in the same parent polypeptide in a different spatial arrangement from that found in the polypeptide of interest (for example, a fragment directly linked to the parent may be spatially separated in the polypeptide of interest, or vice versa, and / or the fragments may be present in the polypeptide of interest in a different order than that of the parent), and thus the polypeptide of interest is a derivative of its parent polypeptide.
[0098] Protein: As used herein, the term “protein” means polypeptide (i.e., a string of at least two amino acids linked together by peptide bonds). Proteins may contain non-amino acid portions (e.g., glycoproteins, proteoglycans, etc.) and / or may be separately processed or modified. Those skilled in the art will understand that a “protein” may be a complete polypeptide chain (with or without a signal sequence) produced by a cell, or a characteristic portion thereof. Those skilled in the art will understand that a protein may include two or more polypeptide chains linked, for example, by one or more disulfide bonds, or otherwise associated. Polypeptides may contain L-amino acids, D-amino acids, or both, and may contain various amino acid modifications or analogs known in the art. Useful modifications include, for example, terminal acetylation, amidation, methylation, etc. In some embodiments, proteins may include native amino acids, non-native amino acids, synthetic amino acids, and combinations thereof. The term "peptide" is generally used to mean polypeptides having a length of less than approximately 100 amino acids, less than approximately 50 amino acids, less than 20 amino acids, or less than 10 amino acids. In some embodiments, proteins are antibodies, antibody fragments, their biologically active portions, and / or characteristic portions thereof.
[0099] Reference: When used herein, this refers to a standard substance or control on which the comparison is performed. For example, in some embodiments, a drug, animal, individual, population, sample, sequence, or value of interest is compared to a reference or control drug, animal, individual, population, sample, sequence, or value. In some embodiments, the reference or control is tested and / or measured substantially simultaneously with the test or measurement of interest. In some embodiments, the reference or control is optionally a historical reference or control recorded in a tangible medium of expression. As will be understood by those skilled in the art, the reference or control is usually measured or characterized under conditions or circumstances equivalent to those being evaluated. Those skilled in the art will understand the reliance on specific available references or controls, and / or the existence of sufficient similarity to justify comparison with them.
[0100] Response: As used herein, a response to a treatment may refer to a beneficial change in the condition of an object that results from or correlates with the treatment. In some embodiments, such changes may include, or are, stabilization of the condition (e.g., prevention of deterioration that would have occurred if no treatment had been performed), improvement of the symptoms of the condition, and / or improvement of the prospect of healing of the condition. In some embodiments, the term “response” may refer to the response of a particular system or its components (e.g., a particular cell, tissue, organism, or object). Those skilled in the art will know the techniques available for evaluating the response of an object of interest.
[0101] Sample: As used herein, the term “sample” typically refers to an aliquot of a substance obtained from or derived from a source of interest, as described herein. In some embodiments, the source of interest is a biological or environmental source. In some embodiments, the source of interest may be or may include cells or organisms, such as microorganisms, plants, or animals (e.g., humans). In some embodiments, the source of interest may be or may include biological tissues or biological fluids. In some embodiments, biological tissue or bodily fluid may be or include amniotic fluid, aqueous humor, ascites, bile, bone marrow, blood, breast milk, cerebrospinal fluid, earwax, chyle, porridge, ejaculated semen, endolymph, exudate, feces, gastric acid, gastric juice, lymph, mucus, pericardial fluid, perilymph, peritoneal fluid, pleural fluid, pus, mucosal secretions, saliva, sebum, semen, serum, smegma, sputum, synovial fluid, sweat, tears, urine, vaginal secretions, vitreous fluid, vomit, and / or combinations or components thereof. In some embodiments, bodily fluid may be or include intracellular fluid, extracellular fluid, intravascular fluid (plasma), interstitial fluid, lymph, and / or cell permeable fluid. In some embodiments, bodily fluid may be or include plant exudate. In some embodiments, biological tissue or biological specimens may be obtained, for example, by aspiration, biopsy (e.g., fine-needle biopsy or tissue biopsy), swab (e.g., oral swab, nasal swab, skin swab, or vaginal swab), scraping, surgery, washing or washing solution (e.g., bronchoalveolar lavage or washing solution, tubal lavage or washing solution, nasal lavage or washing solution, eye lavage or washing solution, oral lavage or washing solution, uterine lavage or washing solution, vaginal lavage or washing solution, or other washing or washing solution). In some embodiments, the biological specimen is or contains cells obtained from an individual. In some embodiments, the specimen is a “primary specimen” obtained directly from a source of interest by any suitable means. In some embodiments, as is evident from the context, the term “specimen” refers to a preparation obtained by processing a primary specimen (e.g., by removing one or more components of the primary specimen and / or by adding one or more agents).For example, filtration using a semipermeable membrane. Such “processed samples” may include nucleic acids or proteins extracted from the sample, or obtained by subjecting the primary sample to one or more techniques such as nucleic acid amplification or reverse transcription, isolation and / or purification of certain components. In some embodiments, the sample may be a “crude” sample in that it has been subjected to relatively light processing, and / or a complex in that it contains components of relatively different chemical classifications.
[0102] Signaling pathways: As used herein, the term “signaling pathways” refers to the biochemical relationships between various signaling molecules that play a role in the transmission of signals from one part of a cell to another. The term “cell surface receptors” includes molecules and complexes of molecules that can receive signals and transmit those signals across the cell’s plasma membrane.
[0103] Significant: As used herein, the term “significant” typically refers to a context in which a difference or relationship between two variables (e.g., sequence identity, protein production, spatiotemporal conditions, etc.) is certain and exists. Significance can be statistically measured by various formulas and models (e.g., statistically significant), as understood by those skilled in the art. These methods include, but are not limited to, Student's t-tests, two-tailed tests, and analysis of variance (ANOVA). Furthermore, significance can confer structural and chemical differences between two different entities. For example, a sample molecule may be compared to a reference molecule, and the sample molecule exhibits a structural difference from the reference molecule that is significant compared to the reference molecule, for example, in the presence or absence of one or more biological or chemical parts, or at that level.
[0104] Source: As used herein, the term “source” usually refers to a context in which the active substance of interest (which may be or include, for example, carbohydrates, lipids, nucleic acids, metals, polypeptides, small molecules, or combinations thereof) may be found in nature, or may exist, or be obtained (e.g., isolated). In some embodiments, the source may be or include a biological source (e.g., an organism, tissue, or cell, or a sample thereof). In some embodiments, the source may be an environmental source. In some embodiments, the source may be or include a primary sample of biological origin (e.g., it may be or include, a tissue or bodily fluid of such an organism, and / or it may be or include, a cell(s) of such an organism). In some embodiments, the organism may be or include a prokaryote (e.g., bacteria) or a eukaryote (e.g., fungi or yeast, insects, mammals, plants, reptiles, etc.). In some embodiments, infectious agents such as viruses or phages may be considered organisms for the purposes of this disclosure and in particular with respect to being a source. In some embodiments, the source may be or include an engineered source, such as a cell line or culture, an in vitro system, etc.
[0105] Subject: As used herein, the term “subject” means an organism, e.g., a mammal (e.g., human, non-human mammal, non-human primate, primate, laboratory animal, mouse, rat, hamster, gerbil, cat, or dog). In some embodiments, a human subject is an adult, adolescent, or child subject. In some embodiments, a subject suffers from a disease, disorder, or condition, e.g., a disease, disorder, or condition that can be treated as provided herein, e.g., cancer or tumor listed herein. In some embodiments, a subject is susceptible to a disease, disorder, or condition, and in some embodiments, a susceptible subject is predisposed to developing a disease, disorder, or condition and / or exhibits increased risk (compared to the mean risk observed in a reference subject or reference population). In some embodiments, a subject exhibits one or more symptoms of a disease, disorder, or condition. In some embodiments, a subject does not exhibit any specific symptoms (e.g., clinical symptoms of a disease) or features of a disease, disorder, or condition. In some embodiments, a subject does not exhibit any symptoms or characteristics of a disease, disorder, or condition. In some embodiments, the subject is a patient. In some embodiments, the subject is an individual to be diagnosed and / or treated.
[0106] Substantially Identical: As used herein, the term “substantially identical” refers to a comparison between amino acid sequences or nucleic acid sequences. As will be understood by those skilled in the art, two sequences are generally considered “substantially identical” if they contain identical residues at their corresponding positions. As is well known in the art, amino acid sequences or nucleic acid sequences can be compared using any of the various algorithms available, including those available in commercially available computer programs such as BLASTN for nucleotide sequences, BLASTP for amino acid sequences, Gap BLAST, and PSI-BLAST. In some embodiments, two sequences are considered substantially identical if at least 50%, 55%, 60%, 65%, 70%, 75%, 80%, 85%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99% or more of their corresponding residues are identical over the extension of the relevant residues. In some embodiments, the relevant section is the complete sequence. In some embodiments, the relevant extensions are at least 10, 15, 20, 25, 30, 35, 40, 45, 50, 55, 60, 65, 70, 75, 80, 85, 90, 95, 100, 125, 150, 175, 200, 225, 250, 275, 300, 325, 350, 375, 400, 425, 450, 475, 500, or more residues. In relation to a CDR, a reference to “substantial identity” usually refers to a CDR having an amino acid sequence that is at least 80%, preferably at least 85%, at least 90%, at least 95%, at least 98%, or at least 99% identical to the amino acid sequence of a reference CDR.
[0107] Substantial: As used herein, the term “substantial” refers to a qualitative state in which the characteristics or properties of the subject of interest are exhibited to a complete or near-complete degree. Those skilled in the art in the biological field will understand that biological and chemical phenomena are, if any, rarely complete and / or complete, and / or do not achieve or avoid absolute results. Accordingly, the term “substantial” is used herein to express the possibility of a lack of completeness inherent in many biological and chemical phenomena.
[0108] Substantially purified: As used herein, the term “substantially purified” refers, for example, to cells, which essentially contain no other cell types. Substantially purified cells also refer to cells isolated from other cell types that are normally associated in their naturally occurring state. In some cases, a population of substantially purified cells refers to a homogeneous population of cells. In other examples, the term simply refers to cells isolated from cells that naturally associate in their naturally occurring state. In some embodiments, cells are cultured in vitro. In other embodiments, cells are not cultured in vitro.
[0109] Target: As used herein, the term “target” means a cell, tissue, organ, or site in the body that is the subject of the method, system, and / or composition provided, for example, a cell, tissue, organ, or site in the body that is in need of treatment or preferentially bound to.
[0110] Target Locus: As used herein, the term “target locus” may refer to a specific site or location on a chromosome of interest. For example, a target locus may be a site that is “manipulated” or “modified” by human intervention. In some embodiments described and / or utilized herein, the manipulated polynucleotide includes homology to a target locus (e.g., CCR5 as a target locus, whose homologous sequence may be part of a guide RNA for causing the incorporation of edits by CRISPR / Cas-mediated gene editing) to enable further modification at a specific site. In some embodiments, a target locus may interchangeably refer to a target gene of interest to human manipulation. In some embodiments, such a target locus manipulation is or includes a genetic manipulation such that its genetic information is modified (e.g., novel genetic material that was not previously present is introduced, for example, by transformation, mating, somatic hybridization, translocation, transduction, or other mechanisms, or previously present genetic material is modified or removed, for example, by substitution or deletion mutation, or by a mating procedure).
[0111] Target site: As used herein, the term “target site” or “target sequence” refers to a genomic nucleic acid sequence that defines a portion of a nucleic acid to which a binding molecule can specifically bind under conditions sufficient for binding to occur.
[0112] Therapeutic agent: As used herein, the term “therapeutic agent” means an agent that, when administered to a subject, has a therapeutic effect and / or induces a desired biological and / or pharmacological effect. In some embodiments, a therapeutic agent is any substance that can be used to reduce, improve, alleviate, inhibit, delay the onset of, reduce the severity of, and / or reduce the incidence of one or more symptoms or characteristics of a disease, disorder, and / or condition.
[0113] Transfected: As used herein, the terms “transfected,” “transformed,” or “transduced” refer to the process by which an exogenous nucleic acid is transplanted or introduced into a host cell. A “transfected,” “transformed,” or “transduced” cell is a cell that has been transfected, transformed, or transduced with an exogenous nucleic acid. This includes primary target cells and their offspring.
[0114] To treat: As used herein, the terms “to treat,” “treatment,” or “to treat” mean the partial or complete relief, improvement, delay, inhibition, prevention, mitigation, and / or reduction of incidence and / or severity of one or more symptoms or characteristics of a disease, disorder, and / or condition. In some embodiments, treatment may be applied to subjects who do not exhibit any signs or characteristics of a disease, disorder, and / or condition (e.g., prophylactically). In some embodiments, treatment may be applied to subjects who exhibit only early or mild signs or characteristics of a disease, disorder, and / or condition, for example, to reduce the risk of developing a condition associated with the disease, disorder, and / or condition. In some embodiments, treatment may be applied to subjects who exhibit established, severe, and / or late signs of a disease, disorder, or condition.
[0115] Variant: As used herein, in the context of molecules, e.g., nucleic acids, proteins, or small molecules, the term “variant” refers to a molecule that exhibits significant structural identity with a reference molecule but is structurally different from the reference molecule, for example, in the presence or absence of one or more biological or chemical parts or at a certain level. In some embodiments, a variant is also functionally different from its reference molecule. In some embodiments, a variant is structurally different but performs the same or similar function as its reference molecule. Generally, whether a particular molecule is appropriately considered a “variant” of a reference molecule depends on the degree of structural identity with the reference molecule. As will be understood by those skilled in the art, any biological or chemical reference molecule has certain characteristic structural elements. A variant is, by definition, a distinct molecule that shares one or more such characteristic structural elements but is different from the reference molecule in at least one aspect. To give just a few examples, a polypeptide may have a characteristic sequence element consisting of multiple amino acids having designated positions in a linear or three-dimensional space and / or contributing to a specific structural motif and / or biological function, and a nucleic acid may have a characteristic sequence element consisting of multiple nucleotide residues having designated positions in a linear or three-dimensional space. In some embodiments, a variant polypeptide or nucleic acid may differ from a reference polypeptide or nucleic acid as a result of one or more differences in the amino acid or nucleotide sequence and / or one or more differences in the chemical moieties (e.g., carbohydrates, lipids, phosphate groups) that are covalently attached to the polypeptide or nucleic acid components (e.g., attached to the polypeptide or nucleic acid backbone). In some embodiments, a variant polypeptide or nucleic acid exhibits overall sequence identity with a reference polypeptide or nucleic acid of at least 85%, 86%, 87%, 88%, 89%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, or 99%. In some embodiments, the variant polypeptide or nucleic acid does not share at least one characteristic sequence element with the reference polypeptide or nucleic acid.In some embodiments, the reference polypeptide or nucleic acid has one or more biological activities. In some embodiments, the variant polypeptide or nucleic acid shares one or more of the biological activities of the reference polypeptide or nucleic acid. In some embodiments, the variant polypeptide or nucleic acid lacks one or more of the biological activities of the reference polypeptide or nucleic acid. In some embodiments, the variant polypeptide or nucleic acid exhibits one or more biological activities at a reduced level compared to the reference polypeptide or nucleic acid. In some embodiments, the variant polypeptide or nucleic acid is a cleaved form of the reference polypeptide or nucleic acid. In some embodiments, the variant polypeptide, being a cleaved form of the reference polypeptide, may exhibit one or more biological activities at an equivalent, identical, or higher level compared to the reference polypeptide or nucleic acid. In some embodiments, the polypeptide or nucleic acid of interest is considered a “variant” of the reference polypeptide or nucleic acid if it has an amino acid or nucleotide sequence identical to the reference sequence except for a few sequence changes at specific positions.
[0116] Vector: As used herein, the term “vector” refers to a composition of substances comprising isolated nucleic acids that can be used to introduce isolated nucleic acids into cells. Numerous vectors are known in the art, including but not limited to linear polynucleotides, polynucleotides associated with ionic or amphiphilic compounds, plasmids, and viruses. Thus, the term “vector” includes autonomously replicating plasmids or viruses. The term should also be interpreted to include non-plasmidal and non-viral compounds that facilitate the transplantation of nucleic acids into cells, such as polylysine compounds and liposomes. Examples of viral vectors include, but are not limited to, adenovirus vectors, adeno-associated virus vectors, retrovirus vectors, and lentiviral vectors.
[0117] Throughout this disclosure, various aspects of the present invention can be presented in range form. It should be understood that the range form is merely for convenience and conciseness and should not be interpreted as an inflexible limitation on the scope of the invention. Therefore, a range description should be considered to specifically disclose not only the individual numbers within that range, but also all possible subranges. For example, a range description such as 1 to 6 should be considered to have not only the individual numbers within that range, such as 1, 2, 2.7, 3, 4, 5, 5.3, and 6, but also specifically disclosed subranges such as 1 to 3, 1 to 4, 1 to 5, 2 to 4, 2 to 6, and 3 to 6. This applies regardless of the width of the range.
[0118] Detailed explanation This disclosure encompasses culturing and manipulation for producing highly viable and productive (e.g., multiple incorporation of one or more desired payloads) B-lineage cell populations for administration to a target population.
[0119] cell therapy Cell-based therapies (cell therapies) are a new class of medicines that utilize innate cellular mechanisms to combat disease. Unlike many conventional treatment methods, cell therapies leverage the localization, migration, and proliferation of cells within the body, which can lead to improved distribution and targeted delivery of therapeutic agents. Cell therapies also benefit from the ability of cells to sense and respond to a variety of exogenous signals within a target, including, for example, small molecules, other cells, physical forces, and / or marker proteins. In vivo cell persistence also allows cell therapies to survive, differentiate, and function within a target for extended periods. These innate characteristics can result in improved safety and efficacy of cell therapies compared to other biologics or pharmaceutical compounds, thereby providing long-lasting, specifically targeted, modulotable, and / or disease-responsive treatments.
[0120] Cell-based therapies have the potential to be applied to a wide range of diseases, including those that are known to be refractory or difficult to manage with conventional treatment options. Diseases targeted by cell-based treatments include, for example, various cancers, autoimmune diseases, central nervous system (CNS) diseases, neurodegenerative disorders, and cardiovascular diseases. Cell therapies offer an alternative to other treatment options for diseases where highly specific targeting (e.g., to specific tissue types, body regions, etc.) and / or longer-lasting treatment efficacy (e.g., enabling lower administration frequency, single treatment options, etc.) is highly desirable or required.
[0121] Cell therapy can utilize a number of different cell types that are typically modified (e.g., through transgene expression, reprogrammed cell targeting) to produce therapeutic effects. While many cell types have the ability to produce several types of therapeutic effects, adaptive immune cells, such as T lymphocytes and B lymphocytes (hereinafter interchangeably referred to as T cells and B cells, respectively), are highly desirable in recent therapies. For example, chimeric antigen receptor T (CAR-T) cells have been engineered to treat various cancers by recognizing one or more tumor cell markers that lead to cytotoxic destruction of tumor cells. CAR-T cells have also been applied to treat infectious diseases (e.g., HIV) by recognizing other target antigens. Recent engineering attempts have focused on enhancing CAR-T receptor function, reducing the innate immune response to CAR-T cells, and developing allogeneic therapies utilizing donor cells.
[0122] B-lineage cell therapy Cell-based therapies offer exciting new avenues for treating diseases, but numerous challenges exist, including achieving safe, specific, and long-lasting therapeutic changes within target cells or tissues while simultaneously reducing off-target effects. Furthermore, immune tolerance to these cell-based therapies is crucial for preventing any adverse side effects (see Jeske et al. 2021, which is incorporated herein by reference). To address these challenges, B-lineage cell manipulation has also been a development area for cell-based therapies, due to the innate role of B-lineage cells in producing antibodies in the body while minimizing inflammation. Antibody-based treatments are an established and well-studied form of treatment for numerous diseases, including cancer, autoimmune diseases, and infectious diseases. Monoclonal antibodies against target antigens can be produced in the body, which is useful for treating diseases in which such antibodies cannot be induced by natural processes (e.g., autoantigens in cancer and / or autoimmune diseases, antigens that cannot elicit a natural immune response through infection and / or vaccination). Current antibody therapies require frequent administration and are costly to produce. Researchers have attempted to address these problems through the use of gene therapy, which utilizes various techniques (e.g., viral vectors, CRISPR / Cas9 editing) to deliver antibody payloads to endogenous cells in the body, resulting in sustained antibody production within the target. However, these methods can lead to low levels of antibody expression and neutralization responses by the target's own immune system.
[0123] Furthermore, due to their minimal impact on the innate immune systems of those targets and their ability to continuously produce antibodies, B-lineage cells are highly desirable cell-based targets for secreting other payloads, including, but not limited to, enzymes, complement proteins, cytokines, cytokine receptors, chimeric antigen receptors (CARs), anti-fibrotic molecules, anti-thrombotic molecules, antigens, both wild-type and variant proteins, coagulation factors, glucose response factors, and antibody, antigen, and protein fragments. Recent reports have described, for example, the successful manipulation of B-lineage cells to produce human B-cell activator (hBAFF) in a mouse model. Interestingly, this study demonstrates not only the success of hBAFF production but also the engraftment of these manipulated B-lineage cells in the bone marrow and their viability for up to 60 days post-engraftment (see Cheng et al. 2022, which is incorporated herein by reference in its entirety). B-lineage cells are an attractive option for the development of cell-based therapies, potentially offering improved therapeutic effects (e.g., payload delivery, targeting, long-term payload expression, and reduced autoimmune responses) compared to conventional therapies (e.g., antibody-based drugs, other cell therapies).
[0124] In some embodiments, B-lineage cells are cells that express one or more B cell receptors (BCRs) on their cell membrane. In some embodiments, B-lineage cells are modified or variants of cells that express one or more B cell receptors (BCRs) on their cell membrane. In some embodiments, B-lineage cells are naive or memory B cells. In some embodiments, B-lineage cells are cells derived from naive B cells (e.g., activated B-lineage cells, plasmablasts, plasma cells) or variants thereof. In some embodiments, B-lineage cells are activated B-lineage cells. In some embodiments, B-lineage cells are plasmablasts. In some embodiments, B-lineage cells are plasma cells.
[0125] In some embodiments, the B-lineage cell population includes naive B cells. In some embodiments, the naive B cell population is used as a reference cell population. In some embodiments, the naive B cell population expresses CD19 (CD19 + In some embodiments, CD19 expression in a naive B cell population is used as a reference to aid in characterizing other B-lineage cell populations. In some embodiments, the naive B cell population expresses CD20 (CD20 + In some embodiments, CD20 expression in a naive B cell population is used as a reference to aid in characterizing other B-lineage cell populations. In some embodiments, the naive B cell population expresses small amounts of CD27 (CD27 lo In some embodiments, CD27 expression in a naive B cell population is used as a reference to aid in characterizing other B-lineage cell populations. In some embodiments, the naive B cell population expresses small amounts of CD38 (CD38 lo In some embodiments, CD38 expression in a naive B cell population is used as a reference to aid in characterizing other B-lineage cell populations. In some embodiments, the naive B cell population expresses small amounts of CD138 (CD138). lo In some embodiments, CD138 expression in naive B cell populations is used as a reference to aid in characterizing other B-lineage cell populations.
[0126] In some embodiments, the B-lineage cell population includes activated B-lineage cells. In some embodiments, the activated B-lineage cell population is used as a reference cell population. In some embodiments, the activated B-lineage cell population is compared to a reference cell population (e.g., a naive B-cell population). In some embodiments, the activated B-lineage cell population expresses less CD19 compared to the reference cell population (e.g., a naive B-cell population). lo)。In some embodiments, the activated B cell population expresses a different amount (e.g., a greater or lesser amount) of CD19 compared to a reference cell population (e.g., a differentiated B cell population, etc.). In some embodiments, the activated B cell population expresses a lesser amount of CD20 compared to a reference cell population (e.g., a naive B cell population) (CD20 lo )。In some embodiments, the activated B cell population expresses a different amount (e.g., a greater or lesser amount) of CD20 compared to a reference cell population (e.g., a differentiated B cell population, etc.). In some embodiments, the activated B cell population expresses a greater amount of CD27 compared to a reference cell population (e.g., a naive B cell population) (CD27 hi )。In some embodiments, the activated B cell population expresses a different amount (e.g., a greater or lesser amount) of CD27 compared to a reference cell population (e.g., a differentiated B cell population, etc.). In some embodiments, the activated B cell population expresses a lesser amount of CD38 compared to a reference cell population (e.g., a naive B cell population) (CD38 lo )。In some embodiments, the activated B cell population expresses a different amount (e.g., a greater or lesser amount) of CD38 compared to a reference cell population (e.g., a differentiated B cell population, etc.). In some embodiments, the activated B cell population expresses a lesser amount of CD138 compared to a reference cell population (e.g., a naive B cell population) (CD138 lo )。In some embodiments, the activated B cell population expresses a different amount (e.g., a greater or lesser amount) of CD138 compared to a reference cell population (e.g., a differentiated B cell population, etc.).
[0127] In some embodiments, the B cell population may include plasmablasts. In some embodiments, the plasmablast population is used as a reference cell population. In some embodiments, the plasmablast population is compared to a reference cell population (e.g., a naive B cell population). In some embodiments, the plasmablast population expresses a lesser amount of CD19 compared to a reference cell population (e.g., a naive B cell population) (CD19 loIn some embodiments, the plasmablast population expresses different amounts (e.g., more or less) of CD19 compared to a reference cell population (e.g., an activated cell population, a plasma cell population, etc.). In some embodiments, the plasmablast population expresses less CD20 compared to a reference cell population (e.g., a naive B cell population). lo In some embodiments, the plasmablast population expresses different amounts (e.g., more or less) of CD20 compared to a reference cell population (e.g., an activated cell population, a plasma cell population, etc.). In some embodiments, the plasmablast population expresses more CD27 compared to a reference cell population (e.g., a naive B cell population). hi In some embodiments, the plasmablast population expresses different amounts (e.g., more or less) of CD27 compared to a reference cell population (e.g., an activated cell population, a plasma cell population, etc.). In some embodiments, the plasmablast population expresses more CD38 compared to a reference cell population (e.g., a naive B cell population). hi In some embodiments, the plasmablast population expresses different amounts (e.g., more or less) of CD38 compared to a reference cell population (e.g., an activated cell population, a plasma cell population, etc.). In some embodiments, the plasmablast population expresses less CD138 compared to a reference cell population (e.g., a naive B cell population). lo In some embodiments, a population of plasmablasts expresses different amounts (e.g., more or less) of CD138 compared to a reference cell population (e.g., an activated cell population, a plasma cell population, etc.).
[0128] In some embodiments, the B-lineage cell population includes plasma cells. In some embodiments, a plasma cell population is used as a reference cell population. In some embodiments, the plasma cell population is compared to a reference cell population (e.g., a naive B cell population). In some embodiments, the plasma cell population expresses less CD19 compared to a reference cell population (e.g., a naive B cell population). loIn some embodiments, the plasma cell population expresses different amounts (e.g., more or less) of CD19 compared to a reference cell population (e.g., an activated cell population, a plasmablast cell population, etc.). In some embodiments, the plasma cell population expresses less CD20 compared to a reference cell population (e.g., a naive B cell population). lo In some embodiments, the plasma cell population expresses different amounts (e.g., more or less) of CD20 compared to a reference cell population (e.g., an activated cell population, a plasmablast cell population, etc.). In some embodiments, the plasma cell population expresses more CD27 compared to a reference cell population (e.g., a naive B cell population). hi In some embodiments, the plasma cell population expresses different amounts (e.g., more or less) of CD27 compared to a reference cell population (e.g., an activated cell population, a plasmablast cell population, etc.). In some embodiments, the plasma cell population expresses more CD38 compared to a reference cell population (e.g., a naive B cell population). hi In some embodiments, a plasma cell population expresses different amounts (e.g., more or less) of CD38 compared to a reference cell population (e.g., an activated cell population, a plasmablast cell population, etc.). In some embodiments, a plasma cell population expresses more CD138 compared to a reference cell population (e.g., a naive B cell population). hi In some embodiments, a population of plasma cells expresses different amounts (e.g., more or less) of CD138 compared to a reference cell population (e.g., an activated cell population, a plasmablast population, etc.).
[0129] Homogeneous and heterogeneous therapy Allogeneic therapy offers an attractive option for therapies involving the administration (e.g., transplantation, treatment, etc.) of one or more cells (e.g., cells, tissues, organs, etc.) from a single source (referred interchangeably herein as the donor) to recipients who are not genetically identical to the donor. Unlike autologous therapies that require a donor that is genetically identical (or substantially genetically identical) to the recipient (e.g., the donor and recipient are the same individual), allogeneic therapy is described in the art as a potentially "universal" therapy that can provide a treatment option (e.g., cell therapy, transplantation, etc.) from a single source to be administered to multiple patients. Allogeneic therapy is desirable, in particular, because it can reduce manufacturing costs and complications by treating donor cells (e.g., cells, tissues, organs, etc.) to prepare arapies suitable for administration to multiple patients. One challenge recognized by those skilled in the art is the preparation of allogeneic therapies that can be administered to multiple non-donor subjects without inducing an immune response in the recipient. Current therapies are often administered in combination with one or more alternative therapies, such as immunosuppressants, to reduce the risk of recipient immune response. This disclosure, among other things, provides the recognition that certain modifications (e.g., genetic modifications) to one or more donor cells (e.g., donor B-lineage cells, engineered B-lineage cells) can provide improved allogeneic properties (e.g., reduced immune response in the recipient) while providing one or more therapeutic benefits (e.g., expression and / or secretion of therapeutic transgenes). In some embodiments, improved allogeneic properties may include reduced immune response in the recipient by evading one or more recipient immune response pathways, such as T cell recognition (e.g., CD8+ T cells, CD4+ T cells) and natural killer (NK) cell recognition.
[0130] In some embodiments, the disclosure provides the recognition that B-lineage cells (e.g., plasma cells, plasmablasts) can be manipulated to produce improved allogeneic properties (hereinafter interchangeably referred to as allogeneic). In some embodiments, a B-lineage cell population is manipulated to reduce the levels of one or more endogenous proteins (e.g., MHC-I proteins, MHC-II proteins, proteins involved in immunological synapse formation, etc.) to provide improved allogeneic properties.
[0131] In particular, this disclosure provides the recognition that modification of one or more endogenous genes (e.g., through modification of corresponding mRNA and / or protein expression) can provide improvements in allogeneic properties. For example, it has been reported in the art that certain signals (e.g., CD58) are associated with the formation of immune synapses by natural killer (NK) cells and cytotoxic T cells, which are required to induce target cell killing. In some embodiments, modification of CD58 expression in B-lineage cells (e.g., disruption, knockout) can improve resistance to NK and T cells (e.g., reduce target cell killing or cell activation).
[0132] It has also been reported in the Art that certain signals (e.g., TAP1, TAP2, TAPBP, NLRC5) are associated with the formation of endogenous MHC-I complexes on the surface of B-lineage cells. In particular, this disclosure provides the insight that, in some embodiments, modification (e.g., disruption, knockout) of the expression of certain signals (e.g., TAP1, TAP2, TAPBP, NLRC5) can improve resistance to T cell responses. In some embodiments, modification (e.g., disruption, knockout) of the expression of certain signals (e.g., TAP1, TAP2, TAPBP, NLRC5) can improve resistance to T cell responses without increasing NK cell responses. In some embodiments, modification (e.g., disruption, knockout) of the expression of certain signals (e.g., TAP1, TAP2, TAPBP, NLRC5) can improve resistance to T cell responses while maintaining equivalent NK cell responses. In some embodiments, modification (e.g., disruption, knockout) of the expression of certain signals (e.g., TAP1, TAP2, TAPBP, NLRC5) can reduce the expression and / or formation of endogenous MHC-I. In some embodiments, modification (e.g., disruption, knockout) of the expression of certain signals (e.g., TAP1, TAP2, TAPBP, NLRC5) can reduce the expression and / or formation of endogenous MHC-I while maintaining equivalent levels of endogenous HLA-E. In some embodiments, modification (e.g., disruption, knockout) of the expression of certain signals (e.g., TAP1, TAP2, TAPBP, NLRC5) can reduce the expression and / or formation of endogenous MHC-I while reducing levels of endogenous HLA-E. In some embodiments, modification (e.g., disruption, knockout) of the expression of certain signals (e.g., TAP1, TAP2, TAPBP, NLRC5) can reduce the expression and / or formation of endogenous MHC-I while increasing the level of endogenous HLA-E. While we do not wish to be bound by any particular theory, this disclosure also provides insight into the association of certain signals (e.g., RFX5) with certain immune responses (e.g., T cell responses and NK cell responses) to certain cell therapies (e.g., B-lineage cell therapies). In some embodiments, modification (e.g., disruption, knockout) of the expression of a certain signal (e.g., RFX5) can reduce the expression and / or formation of endogenous MHC-I while maintaining equivalent levels of endogenous HLA-E. In some embodiments, modification (e.g., disruption, knockout) of the expression of a certain signal (e.g., RFX5) can reduce the expression and / or formation of endogenous MHC-I while increasing levels of endogenous HLA-E. In some embodiments, modification (e.g., disruption, knockout) of the expression of a certain signal (e.g., RFX5) can reduce the expression and / or formation of endogenous MHC-II. In some embodiments, modification (e.g., disruption, knockout) of the expression of a particular signal (e.g., RFX5) can reduce the expression and / or formation of endogenous MHC-I and MHC-II. In some embodiments, modification (e.g., disruption, knockout) of the expression of a particular signal (e.g., RFX5) can reduce the expression and / or formation of endogenous MHC-I and MHC-II while maintaining equivalent levels of endogenous HLA-E. In some embodiments, modification (e.g., disruption, knockout) of the expression of a particular signal (e.g., RFX5) can reduce the expression and / or formation of endogenous MHC-I and MHC-II while increasing levels of endogenous HLA-E.
[0133] cell manipulation For example, the production of engineered cells for various applications, including cell therapy, is an active area of development. Genomic and epigenomic modification, synthetic biology, and the application of biomaterials can be used to create engineered cells with desirable properties for therapeutic applications. The selection of a suitable method for creating engineered cells usually depends on the desired outcome and effect of the cell therapy and requires optimization for different cell types, introduced genes of interest, etc. It is understood in the art that an engineering method that is effective for one cell type may be less effective (or unfeasible) for another. Furthermore, the engineering method may differ depending on whether the treatment requires cell localization, expression of endogenous or exogenous proteins, removal of endogenous proteins, etc.
[0134] In some embodiments, the cell manipulation includes the use of one or more genome editing tools described herein.
[0135] Genome editing Genome editing tools can modify the cell genome to produce a desired therapeutic effect, such as the expression of a therapeutic protein. Targeted nucleases (e.g., Cas proteins, TALENs, ZFNs), viral vectors (e.g., AAV, adenoviruses, lentiviruses), recombinases (e.g., Cre recombinase, Flp recombinase, PhiC31 integrase), and other tools can be used to bring about gene modification. Gene editing efficiency can vary depending on, for example, cell type, desired function, and ease of delivery. Therefore, editing methods often require extensive optimization to obtain manipulated cells with the intended function for therapeutic application.
[0136] B lineage cell manipulation For example, various B-lineage cell manipulation techniques, including CRISPR / Cas9, AAV, lentivirus, and recombinase-based methods, have been described in the Art. These methods are generally used to introduce a payload (e.g., an expression cassette, a transgene, etc.) into naive B cells to express a protein of interest. The payload may be designed for episomal expression, integration into a specific target locus (e.g., an endogenous target gene locus), or integration into a non-specific locus (e.g., a random or non-target endogenous gene locus). The payload may be designed so that the endogenous target gene locus produces a functional protein and / or continues to perform its original function (non-destructive integration). The payload may also be designed to intentionally disrupt the endogenous target gene locus to produce low or undetectable levels of the functional protein and / or some amount of non-functional protein (also interchangeably referred to herein as destructive integration). This disclosure provides methods for the multiple integration of two or more payloads into one or more target loci.
[0137] A method for incorporating a payload (e.g., an expression cassette containing one or more transgenes) into an endogenous target locus may include site-directed cleavage by a target nuclease (e.g., a Cas protein including Cas9), followed by the incorporation of the transgene (e.g., SMPD1, factor IX, blinatumomab, etc.) via an endogenous repair pathway (e.g., homologous recombination, homologous-directed repair, etc.). In some embodiments, a method for incorporating an expression cassette containing a transgene includes site-directed cleavage at a target locus (e.g., CCR5) by a guide RNA / Cas9 complex, followed by the incorporation of the transgene at the target locus via homologous recombination.
[0138] In some embodiments, a method of B-lineage cell manipulation involves or includes the administration of ribonucleoproteins (RNPs) to a cell population. In some embodiments, a method of B-lineage cell manipulation involves or includes the administration of a composition comprising a Cas protein complexed with guide RNA (gRNA) to a cell population. In some embodiments, a method of B-lineage cell manipulation involves or includes the administration of a composition comprising a Cas9 / guide RNA complex cell population. In some embodiments, a method of B-lineage cell manipulation involves or includes the administration of a composition comprising a Cas9 / guide RNA complex cell population. In some embodiments, a method of B-lineage cell manipulation involves or includes the administration of a composition comprising a payload of interest (e.g., an expression cassette containing one or more transgenes) to a cell population. In some embodiments, a method of B-lineage cell manipulation involves or includes the administration of a composition comprising a payload (e.g., an expression cassette containing one or more transgenes) to a cell population via the use of a viral vector. In some embodiments, a method of B-lineage cell manipulation involves or includes the administration of a composition to a cell population that includes a payload (e.g., an expression cassette containing one or more transgenes) encapsulated within an AAV capsid (e.g., AAV2, AAV3, AAV5, AAV6, AAV8, etc.). In some embodiments, a method of B-lineage cell manipulation involves or includes the administration of a composition containing transgenes encapsulated within an AAV capsid (e.g., AAV2, AAV3, AAV5, AAV6, AAV8, etc.) in combination with or in addition to the administration of a composition containing a Cas9 / gRNA complex.
[0139] In some embodiments, a method for manipulating B-lineage cells includes an electroporation step to facilitate the uptake of one or more manipulative components. In some embodiments, a method for manipulating B-lineage cells includes an electroporation step to facilitate the uptake of a Cas9 / gRNA complex. In some embodiments, a method for manipulating B-lineage cells includes an electroporation step to facilitate the uptake of a Cas9 / gRNA complex and a payload. In some embodiments, a method for manipulating B-lineage cells may include an electroporation step to facilitate the uptake of a Cas9 / gRNA complex and a payload (e.g., an expression cassette containing one or more transgenes) encapsulated within an AAV capsid (e.g., AAV2, AAV3, AAV5, AAV6, AAV8). In some embodiments, a method for manipulating B-lineage cells includes an electroporation step to facilitate the uptake of a Cas9 / gRNA complex and a payload (e.g., an expression cassette containing one or more transgenes) encapsulated within an AAV6 capsid.
[0140] In some embodiments, the method for manipulating B-lineage cells includes a transfection step. In some embodiments, the method for manipulating B-lineage cells includes a nucleofection step.
[0141] In some embodiments, a B-lineage cell manipulation method includes a step of viral transduction to facilitate the cellular uptake of a payload (e.g., an expression cassette containing one or more transgenes). In some embodiments, a B-lineage cell manipulation method includes a step of viral transduction to facilitate the cellular uptake of a payload (e.g., a transgene) encapsulated within an AAV capsid (e.g., AAV2, AAV3, AAV5, AAV6, AAV8). In some embodiments, a B-lineage cell manipulation method includes a step of viral transduction to facilitate the cellular uptake of a payload (e.g., an expression cassette containing one or more transgenes) encapsulated within an AAV6 capsid. In some embodiments, a B-lineage cell manipulation method includes one or more of the following steps: (i) electroporation to facilitate the cellular uptake of a Cas9 / gRNA complex; and (ii) viral transduction to facilitate the cellular uptake of a payload encapsulated within an AAV capsid.
[0142] In some embodiments, the B-lineage cell manipulation method includes integration into multiple target loci. In some embodiments, the B-lineage cell manipulation method includes integration of a payload (e.g., a transgene, expression cassette, etc.) into a first target locus (e.g., a safe harbor locus, an endogenous gene locus, etc.) and disruption of a second target locus (e.g., a safe harbor locus, an endogenous gene locus, etc.) (e.g., knockout of endogenous protein expression, RNA production, etc.). In some embodiments, the B-lineage cell manipulation method includes integration of a payload (e.g., a transgene, expression cassette, etc.) into a CCR5 target locus and disruption of a B2M target locus (e.g., knockout of endogenous protein expression, RNA production, etc.).
[0143] In some embodiments, a method of B-lineage cell manipulation includes the integration of one or more payloads (e.g., transgenes, expression cassettes, etc.) into multiple target loci (e.g., safe harbor loci, endogenous loci, combinations thereof, etc.), also referred herein as multiple manipulation. In some embodiments, a method of B-lineage cell manipulation includes the integration of one or more payloads (e.g., transgenes, expression cassettes, etc.) into multiple distinct target loci (e.g., safe harbor loci, endogenous loci, combinations thereof, etc.). In some embodiments, a method of B-lineage cell manipulation includes the non-destructive integration of one or more payloads (e.g., transgenes, expression cassettes, etc.) into multiple distinct target loci (e.g., safe harbor loci, endogenous loci, combinations thereof, etc.). In some embodiments, a method of B-lineage cell manipulation includes the destructive integration of one or more payloads (e.g., transgenes, expression cassettes, etc.) into multiple distinct target loci (e.g., safe harbor loci, endogenous loci, combinations thereof, etc.). In some embodiments, the B-lineage cell manipulation method involves the simultaneous incorporation of one or more payloads (e.g., transgenes, expression cassettes, etc.) into multiple distinct target loci (e.g., safe harbor loci, endogenous loci, or combinations thereof).
[0144] In some embodiments, the B-lineage cell manipulation method includes sequentially incorporating a first payload (e.g., a transgene, an expression cassette, etc.) into a first target locus (e.g., a safe harbor locus, an endogenous gene locus, etc.), followed by incorporating a second payload (e.g., a transgene, an expression cassette, etc.) into a second target locus (e.g., a safe harbor locus, an endogenous gene locus, etc.). In some embodiments, the B-lineage cell manipulation method includes sequentially incorporating a first payload (e.g., a transgene, an expression cassette, etc.) into a first target locus (e.g., a safe harbor locus, an endogenous gene locus, etc.) at a first time point (e.g., day 2 or 3 of the culture process), followed by incorporating a second payload (e.g., a transgene, an expression cassette, etc.) into a second target locus (e.g., a safe harbor locus, an endogenous gene locus, etc.) at a second time point (e.g., day 3 or 4 of the culture process). In some embodiments, the first step of cell culture is described as day 1 of the culture process. In some embodiments, the first step of cell culture is described as day 1 of the culture process.
[0145] In some embodiments, a method for manipulating B-lineage cells includes incorporating one or more payloads (e.g., transgenes, expression cassettes, etc.) into multiple target loci (e.g., safe harbor loci, endogenous loci, or combinations thereof) to produce a multiplexed B-lineage cell population. In some embodiments, a method for manipulating B-lineage cells includes the simultaneous incorporation of one or more payloads (e.g., transgenes, expression cassettes, etc.) into multiple distinct target loci (e.g., safe harbor loci, endogenous loci, or combinations thereof) to produce a multiplexed B-lineage cell population simultaneously. In some embodiments, a method for manipulating B-lineage cells includes the sequential incorporation of a first payload (e.g., transgenes, expression cassettes, etc.) into a first target locus (e.g., safe harbor loci, endogenous loci, etc.), followed by the incorporation of a second payload (e.g., transgenes, expression cassettes, etc.) into a second target locus (e.g., safe harbor loci, endogenous loci, etc.) to produce a sequentially multiplexed B-lineage cell population.
[0146] In some embodiments, a method for multiplexing B-lineage cells may include site-directed cleavage by one or more target nucleases (e.g., Cas proteins including Cas9), followed by the integration of one or more transgenes (e.g., SMPD1, factor IX, blinatumomab, etc.) via an endogenous repair pathway (e.g., homologous recombination, homologous-directed repair, etc.). In some embodiments, a method for multiplexing B-lineage cells may include two or more expression cassettes, each containing one or more transgenes, and include site-directed cleavage at each target locus (e.g., CCR5, B2M) by one or more guide RNA / Cas9 complexes, followed by the integration of one or more transgenes at each target locus via homologous recombination. In some embodiments, a method for multiplexing B-lineage cells may include simultaneous introduction of two or more expression cassettes, each containing one or more transgenes, and include site-directed cleavage at each target locus (e.g., CCR5, B2M) by one or more guide RNA / Cas9 complexes, followed by the integration of one or more transgenes at each target locus via homologous recombination. In some embodiments, a method for multiplexing B-lineage cells may include the introduction of two or more expression cassettes, each containing one or more transgenes, and including site-specific cleavage at target loci (e.g., CCR5, B2M) by one or more guide RNA / Cas9 complexes, which is performed within a period of 24 hours or less. In some embodiments, a method for multiplexing B-lineage cells may include the sequential introduction of two or more expression cassettes, each containing one or more transgenes, and including site-specific cleavage at each target locus (e.g., CCR5, B2M) by one or more guide RNA / Cas9 complexes, followed by the integration of one or more transgenes at each target locus via homologous recombination. In some embodiments, there may be a period of time between the sequential introductions of expression cassettes. In some embodiments, the period between each sequential introduction of expression cassettes may be about 24 hours to about 144 hours.
[0147] In some embodiments, a method of B-lineage cell manipulation involves or includes the administration of one or more ribonucleoproteins (RNPs) to a cell population. In some embodiments, a method of multiplexed B-lineage cell manipulation involves or includes the administration of one or more compositions to a cell population, each comprising a Cas protein that forms a complex with a guide RNA (gRNA). In some embodiments, a method of multiplexed B-lineage cell manipulation involves or includes the administration of one or more compositions, each comprising a Cas9 / guide RNA complex cell population. In some embodiments, a method of multiplexed B-lineage cell manipulation involves or includes the administration of one or more compositions, each comprising a Cas9 / guide RNA complex cell population. In some embodiments, a method of multiplexed B-lineage cell manipulation involves or includes the administration of one or more compositions to a cell population, each comprising a payload of interest (e.g., an expression cassette containing one or more transgenes). In some embodiments, a method of multiplexed B-lineage cell manipulation involves or includes the administration of one or more compositions to a cell population, each comprising a payload (e.g., an expression cassette containing one or more transgenes) via the use of a viral vector. In some embodiments, a method of multiple B-lineage cell manipulation involves or includes the administration of one or more compositions to a cell population, each comprising a payload (e.g., an expression cassette containing one or more transgenes) encapsulated within an AAV capsid (e.g., AAV2, AAV3, AAV5, AAV6, AAV8, etc.). In some embodiments, a method of multiple B-lineage cell manipulation involves or includes the administration of one or more compositions, each comprising transgenes encapsulated within an AAV capsid (e.g., AAV2, AAV3, AAV5, AAV6, AAV8, etc.), in combination with or in addition to the administration of a composition comprising a Cas9 / gRNA complex.
[0148] In some embodiments, a multiplex B-series cell manipulation method includes an electroporation step to facilitate the uptake of one or more manipulation components. In some embodiments, a multiplex B-series cell manipulation method may include two or more electroporation steps to facilitate the uptake of one or more manipulation components. In some embodiments, a multiplex B-series cell manipulation method includes one or more electroporation steps to facilitate the uptake of one or more Cas9 / gRNA complexes. In some embodiments, a multiplex B-series cell manipulation method includes one or more electroporation steps to facilitate the uptake of one or more Cas9 / gRNA complexes and one or more payloads. In some embodiments, a multiplex B-series cell manipulation method may include one or more electroporation steps to facilitate the uptake of one or more Cas9 / gRNA complexes and one or more payloads (e.g., expression cassettes containing one or more transgenes) encapsulated within an AAV capsid (e.g., AAV2, AAV3, AAV5, AAV6, AAV8). In some embodiments, a method for manipulating multiple B-lineage cells includes one or more steps of electroporation to facilitate the uptake of one or more Cas9 / gRNA complexes and one or more payloads (e.g., expression cassettes containing one or more transgenes) each encapsulated within an AAV6 capsid.
[0149] In some embodiments, a multiplex B-lineage cell manipulation method includes one or more steps of viral transduction to facilitate the uptake of one or more payloads (e.g., expression cassettes containing one or more transgenes). In some embodiments, a multiplex B-lineage cell manipulation method includes one or more steps of viral transduction to facilitate the uptake of one or more payloads (e.g., transgenes) each encapsulated within an AAV capsid (e.g., AAV2, AAV3, AAV5, AAV6, AAV8). In some embodiments, a multiplex B-lineage cell manipulation method includes one or more steps of viral transduction to facilitate the uptake of one or more payloads (e.g., expression cassettes containing one or more transgenes) each encapsulated within an AAV6 capsid. In some embodiments, a multiplex B-lineage cell manipulation method includes (i) electroporation to facilitate the uptake of a Cas9 / gRNA complex, and (ii) one or more steps of viral transduction to facilitate the uptake of payloads encapsulated within an AAV capsid. In some other embodiments, the method of multiple B-lineage cell manipulation may include one or more additional repetitions of the following steps: (i) electroporation to facilitate cellular uptake of the Cas9 / gRNA complex, and (ii) viral transduction to facilitate cellular uptake of the payload encapsulated within the AAV capsid.
[0150] In some embodiments, the cell manipulation method is particularly effective for one type of cell (e.g., T cells) and less effective for another type of cell (e.g., B cells). In some embodiments, the B-lineage cell manipulation method provides improved genome editing efficiency in B-lineage cells compared to other cell types (e.g., T cells). In some embodiments, the B-cell manipulation method provides editing efficiencies of at least about 10%, 15%, 20%, 25%, 30%, 35%, 40%, 45%, 50%, 55%, 60%, 65%, 70%, 75%, 80%, 85%, 90%, 95%, or 99%. In some embodiments, a method of B-lineage cell manipulation provides at least about 1E6, 1.5E6, 2E6, 2.5E6, 3E6, 3.5E6, 4E6, 4.5E6, 5E6, 5.5E6, 6E6, 6.5E6, 7E6, 7.5E6, 8E6, 8.5E6, 9E6, 9.5E6, 1E7, 1.5E7, 2E7, 2.5E7, 3E7, 3.5E7, 4E7, 4.5E7, or 5E7 edited B-lineage cells.
[0151] In some embodiments, a method for manipulating B-lineage cells includes a step of editing activated B cells. In some embodiments, a method for manipulating B-lineage cells includes a step of editing B-lineage cells after an activation step of about 1, 2, 3, 4, or 5 days. In some embodiments, a method for manipulating B-lineage cells includes a step of editing B-lineage cells after an activation step of 2 days. In some embodiments, a method for manipulating B-lineage cells includes a step of editing B-lineage cells after an activation step of about 1, 2, 3, 4, or 5 days, and growing the edited B-lineage cells in an activation medium for a further period of about 1, 2, 3, 4, 5, 6, 7, or 8 days. In some embodiments, a method for manipulating B-lineage cells includes a step of editing B-lineage cells after an activation step of 2 days, and growing the edited B-lineage cells in an activation medium for an additional 6 days. In some embodiments, a method for manipulating B-lineage cells includes one or more steps of editing B-lineage cells after an activation step of about 1, 2, 3, 4, or 5 days (or more). In some embodiments, there is a period of time between each subsequent editing step. In some embodiments, this period is 24 to 144 hours.
[0152] payload Various methods described herein may be used to produce engineered cells (e.g., B-lineage cell populations) containing one or more payloads. In some embodiments, the engineered cells (e.g., B-lineage cell populations) contain polynucleotide sequences encoding one or more payloads. According to various aspects of this disclosure, any of the various payloads (e.g., for therapeutic or monitoring purposes) may be used alone or in combination. In some embodiments, the payload is or includes a polynucleotide sequence encoding a peptide or polypeptide. In some embodiments, the payload is or includes one or more transgenes. In some embodiments, the payload is or includes one or more homologous arm sequences. In some embodiments, the payload is or includes a transgene adjacent to one or more homologous sequences.
[0153] In some embodiments, the payload may include a sequence for polycistron expression (e.g., a 2A peptide, an intron sequence, or an internal ribosome entry site (IRES)). In some embodiments, the 2A peptide is a small peptide sequence (e.g., approximately 18–22 amino acids) that enables the co-expression of two or more distinct protein products within a single coding sequence. In some embodiments, the 2A peptide enables the co-expression of two or more distinct protein products regardless of the arrangement of the protein coding sequence. In some embodiments, the 2A peptide is or includes a viral sequence (e.g., foot-and-mouth disease virus (F2A), equine rhinitis virus type A, porcine tescovirus-1 (P2A), or Thosea asigna virus (T2A)). In some embodiments, the 2A polypeptide is P2A. In some embodiments, the 2A polypeptide is T2A. In some embodiments, the 2A peptide is furin-P2A.
[0154] In some embodiments, the payload may be one or more nucleic acid sequences encoding reporter genes (e.g., fluorescent reporters or luminescent reporters), or may include them.
[0155] In some embodiments, the payload may be or may include a polynucleotide sequence comprising an expression cassette. In some embodiments, the expression cassette comprises one or more polynucleotide sequence elements (e.g., a promoter, enhancer, transgene, termination element, homology arm, biomarker, signal peptide sequence, internal ribosome entry site element, self-cleaving peptide sequence, ubiquitas chromatin opening element, etc.). In some embodiments, the expression cassette comprises one or more polynucleotide sequence elements (e.g., a promoter, enhancer, transgene, termination element, homology arm, biomarker, signal peptide sequence, internal ribosome entry site element, self-cleaving peptide sequence, ubiquitas chromatin opening element, etc.) in a particular configuration and / or combination. In some embodiments, the expression cassette includes one or more polynucleotide sequence elements (e.g., promoter, enhancer, transgene, termination element, homology arm, biomarker, signal peptide sequence, internal ribosome entry site element, self-cleaving peptide sequence, ubiquitas chromatin opening element, etc.) in a specific configuration and / or combination to promote the expression of a transgene in a cell population.
[0156] In some embodiments, the expression cassette includes one or more polynucleotide sequences encoding one or more promoters (e.g., MND, CMV, SFFV, FEEK I, EF-1a, etc.). In some embodiments, the expression cassette includes one or more polynucleotide sequences encoding one or more exogenous promoters. In some embodiments, the expression cassette includes one or more polynucleotide sequences encoding one or more endogenous promoters. In some embodiments, the expression cassette does not include one or more promoters. In some embodiments, the expression cassette does not include one or more exogenous promoters. In some embodiments, the expression cassette does not include one or more endogenous promoters.
[0157] In some embodiments, the expression cassette includes one or more polynucleotide sequences encoding a translation initiation site (e.g., Kozak consensus sequence, ribosome binding site, etc.). In some embodiments, the expression cassette includes one or more exogenous polynucleotide sequences encoding a translation initiation site. In some embodiments, the expression cassette includes one or more endogenous polynucleotide sequences encoding a translation initiation site. In some embodiments, the expression cassette does not include one or more polynucleotide sequences encoding a translation initiation site. In some embodiments, the expression cassette does not include one or more exogenous polynucleotide sequences encoding a translation initiation site. In some embodiments, the expression cassette does not include one or more endogenous polynucleotide sequences encoding a translation initiation site.
[0158] In some embodiments, the expression cassette includes one or more polynucleotide sequences encoding one or more enhancers (e.g., WPRE, beta-globin, etc.). In some embodiments, the expression cassette includes one or more polynucleotide sequences encoding one or more exogenous enhancers. In some embodiments, the expression cassette includes one or more polynucleotide sequences encoding one or more endogenous enhancers. In some embodiments, the enhancers may be viral (e.g., WPRE, etc.) or nonviral. In some embodiments, the expression cassette does not include one or more enhancers. In some embodiments, the expression cassette does not include one or more exogenous enhancers. In some embodiments, the expression cassette does not include one or more endogenous enhancers.
[0159] In some embodiments, the expression cassette includes one or more polynucleotide sequences encoding one or more termination factors (e.g., BGH polyA, SV40 polyA, etc., e.g., polyA). In some embodiments, the expression cassette includes one or more polynucleotide sequences encoding one or more exogenous termination factors. In some embodiments, the expression cassette includes one or more polynucleotide sequences encoding one or more endogenous termination factors. In some embodiments, the expression cassette does not include one or more termination factors. In some embodiments, the expression cassette does not include one or more exogenous termination factors. In some embodiments, the expression cassette does not include one or more endogenous termination factors.
[0160] In some embodiments, the expression cassette includes a polynucleotide sequence encoding a transgene (e.g., SMPD1, factor IX, blinatumomab, etc.) or a variant thereof. In some embodiments, the expression cassette includes a polynucleotide sequence encoding a transgene (e.g., SMPD1, factor IX, blinatumomab, etc.) or a variant thereof for the expression of a peptide or polypeptide (e.g., acid sphingomyelinase, factor IX, blinatumomab, etc.) or a variant thereof.
[0161] Transgene In some embodiments, the transgene is a modified gene selected to improve one or more signs and / or symptoms of a disease, disorder, or condition. In some embodiments, the transgene is a functional version of a disease-related gene found in the subject (i.e., a gene isoform associated with the onset or exacerbation of a disease, disorder, or condition). In some embodiments, one or more transgenes are optimized versions of a disease-related gene found in the subject (e.g., codon-optimized or expression-optimized variants). In some embodiments, the transgene is a variant of a disease-related gene found in the subject (e.g., a functional gene fragment or a variant thereof). In some embodiments, the transgene is a gene that causes the expression of one or more peptides normally expressed in healthy tissue.
[0162] In some embodiments, the transgene is a gene that causes the expression of a modified protein having a gain-of-function or loss-of-function mutation. In some embodiments, the transgene is a gene that causes the expression of a fusion protein. In some embodiments, the transgene is a gene that causes the expression of an antibody drug. In some embodiments, the transgene is a gene that causes the expression of a multispecific antibody. In some embodiments, the transgene is an antibody, antigen, or protein fragment. In some embodiments, the transgene is a gene that causes the expression of an enzyme (e.g., for enzyme replacement therapy). In some embodiments, the transgene is a gene that causes the expression of a cytokine. In some embodiments, the transgene is a gene that causes the expression of a cytokine receptor. In some embodiments, the transgene is a gene that causes the expression of a chimeric antigen receptor (CAR). In some embodiments, the transgene is a gene that causes the expression of an antithrombotic molecule. In some embodiments, the transgene is a gene that causes the expression of a coagulation factor. In some embodiments, the transgene is a gene that causes the expression of a glucose response factor. In some embodiments, the transgene is a gene that causes the expression of a nanobody. In some embodiments, the transgene is a gene or variant thereof that causes the expression of sphingomyelin phosphodiesterase 1 (SMPD1), acid sphingomyelinase (ASM), factor IX, blinatumomab, HLA (e.g., HLA-A, HLA-B, HLA-C, HLA-E, HLA-G, etc.), B2M, and / or BCMA. In some embodiments, the transgene may comprise one or more antibody drugs (e.g., antibodies, BiTE, etc.). In some embodiments, the transgene may comprise one or more protein fusions. In some embodiments, the transgene may comprise a B2M fusion. In some embodiments, the transgene may comprise an HLA fusion. In some embodiments, the transgene may comprise a B2M / HLA-E single-strand fusion. In some embodiments, the transgene may comprise one or more linked proteins.
[0163] In some embodiments, the transgene is a gene encoding a functional nucleic acid, or includes such a gene. In some embodiments, the therapeutic agent is a drug having a therapeutic effect on host cells or a target (e.g., includes ribozymes, guide RNA (gRNA), antisense oligonucleotide (ASO), miRNA, siRNA, and / or shRNA), or includes such a drug. For example, in some embodiments, the therapeutic agent facilitates a biological process to treat a medical condition, e.g., a disease, disorder, or at least one symptom of a condition.
[0164] In some embodiments, the expression of the transgene in the subject is substantially attributable to integration at the target locus. In some embodiments, more than 75% (e.g., more than 80%, more than 85%, more than 90%, more than 95%, more than 99%, more than 99.5%) of the total transgene expression in the subject is due to transgene integration at the target locus. In some embodiments, less than 25% (e.g., less than 20%, less than 15%, less than 10%, less than 5%, less than 1%, less than 0.5%, less than 0.1%) of the total transgene expression in the subject is due to sources other than transgene integration at the target locus (e.g., episomal expression, integration at non-target loci).
[0165] In some embodiments, the transgene is a sequence having at least 80%, 85%, 90%, 95%, 99%, or 100% identity to a corresponding wild-type reference nucleotide sequence (e.g., wild-type gene sequence), or includes such a sequence. In some embodiments, the transgene is a sequence having at least 80%, 85%, 90%, 95%, 99%, or 100% identity to a portion of a corresponding wild-type reference nucleotide sequence (e.g., wild-type gene sequence), or includes such a sequence.
[0166] homology arm In some embodiments, the payload (e.g., an expression cassette) may contain one or more adjacent polynucleotide sequences having significant sequence homology to a target locus (e.g., a homology arm). In some embodiments, the homology arm is adjacent to the polynucleotide sequence encoding the payload (e.g., one homology arm is 5' to the payload (also referred herein as the 5' homology arm), and another homology arm is 3' to the payload (also referred herein as the 3' homology arm). In some embodiments, the homology arm directs site-specific incorporation of the payload.
[0167] In some embodiments, the homology arm is 50 to 1000 nt in length. In some embodiments, the homology arm is 100 to 500 nt in length. In some embodiments, the homology arm is 50 to 250 nt in length. In some embodiments, the homology arm is 50 to 850 nt in length. In some embodiments, the homology arm is 300 to 1000 nt in length. In some embodiments, the homology arm is 800 to 1500 nt in length. In some embodiments, the homology arm is at least 350 nt in length. In some embodiments, the homology arm is at least 500 nt in length. In some embodiments, the homology arm is less than 1500 nt in length. In some embodiments, the homology arm is 1000 nt in length. In some embodiments, the homology arm is at least 50 nt in length. In some embodiments, the homology arm is at least 600 nt in length. In some embodiments, the homology arms are of the same length. In some embodiments, the homology arms are not of the same length. In some embodiments, the homology arms have at least 70% sequence homology to the target locus. In some embodiments, the homology arms have at least 80% sequence homology to the target locus. In some embodiments, the homology arms have at least 90% sequence homology to the target locus. In some embodiments, the homology arms have at least 95% sequence homology to the target locus. In some embodiments, the homology arms have at least 99% sequence homology to the target locus. In some embodiments, the homology arms have 100% sequence homology to the target locus. In some embodiments, the homology arms have at least 70% sequence identity to the target locus. In some embodiments, the homology arms have at least 80% sequence identity to the target locus. In some embodiments, the homology arms have at least 90% sequence identity to the target locus. In some embodiments, the homology arm has at least 95% sequence identity with respect to the target locus.In some embodiments, the homology arm has at least 99% sequence identity with respect to the target locus. In some embodiments, the homology arm has 100% sequence identity with respect to the target locus.
[0168] In some embodiments, a structure including homology arms provides a target site integration rate of at least 5%. In some embodiments, a structure including homology arms provides target site integration rates of 1%, 2%, 5%, 10%, 15%, 20%, 25%, 30%, 35%, 40%, 45%, 50%, 55%, 60%, 65%, 70%, 75%, 80%, 85%, 90% or more. In some embodiments, a structure including homology arms provides a target site integration rate of 30% or more. In some embodiments, a structure including homology arms provides a target site integration rate of 35% or more.
[0169] Multiple embedding In some embodiments, the methods and compositions disclosed herein direct the integration of two or more payloads (e.g., transgenes) at one or more target loci (e.g., endogenous genes). In some embodiments, the compositions provided herein direct the integration of two or more payloads at one or more target loci of a particular cell type (e.g., naive B cells, B-lineage cell populations, etc.). In some embodiments, the methods provided herein direct the integration of two or more payloads (e.g., an expression cassette containing a transgene encoding SPMD1) at a target locus of a particular cell type (e.g., naive B cells, B-lineage cell populations, etc.). In some embodiments, the payloads are or include a transgene or a variant thereof.
[0170] In some embodiments, the methods and compositions disclosed herein instruct the integration of one or more payloads (e.g., transgenes) at one or more target loci. In some embodiments, the methods and compositions disclosed herein instruct the integration of one or more payloads (e.g., transgenes) at two or more target loci. In some embodiments, the methods and compositions disclosed herein instruct the integration of one or more payloads (e.g., transgenes) at two or more target loci. In some embodiments, the methods and compositions disclosed herein instruct the integration of one or more payloads (e.g., transgenes) at four or more target loci. In some embodiments, the methods and compositions disclosed herein instruct the integration of one or more payloads (e.g., transgenes) at five or more target loci. In some embodiments, the methods and compositions disclosed herein instruct the integration of one or more payloads (e.g., transgenes) at two target loci. In some embodiments, the methods and compositions disclosed herein instruct the integration of one or more payloads (e.g., transgenes) at three target loci. In some embodiments, the methods and compositions disclosed herein direct the integration of one or more payloads (e.g., transgenes) at four target loci. In some embodiments, the methods and compositions disclosed herein direct the integration of one or more payloads (e.g., transgenes) at five target loci.
[0171] In some embodiments, the methods and compositions disclosed herein optionally instruct the integration of one or more payloads (e.g., transgenes) at one or more target loci in combination with disruption (e.g., reduction of expression, knockout, etc.) at one or more target loci. In some embodiments, the methods and compositions disclosed herein optionally instruct the integration of one or more payloads (e.g., transgenes) at two or more target loci in combination with disruption (e.g., reduction of expression, knockout, etc.) at one or more target loci. In some embodiments, the methods and compositions disclosed herein optionally instruct the integration of one or more payloads (e.g., transgenes) at three or more target loci in combination with disruption (e.g., reduction of expression, knockout, etc.) at one or more target loci. In some embodiments, the methods and compositions disclosed herein optionally instruct the integration of one or more payloads (e.g., transgenes) at four or more target loci in combination with disruption (e.g., reduction of expression, knockout, etc.) at one or more target loci. In some embodiments, the methods and compositions disclosed herein optionally instruct the integration of one or more payloads (e.g., transgenes) at two or more target loci in combination with disruption (e.g., reduction of expression, knockout, etc.) at five or more target loci. In some embodiments, the methods and compositions disclosed herein optionally instruct the integration of one or more payloads (e.g., transgenes) at one or more target loci in combination with disruption (e.g., reduction of expression, knockout, etc.) at two or more target loci. In some embodiments, the methods and compositions disclosed herein optionally instruct the integration of one or more payloads (e.g., transgenes) at two or more target loci in combination with disruption (e.g., reduction of expression, knockout, etc.) at two or more target loci. In some embodiments, the methods and compositions disclosed herein optionally instruct the integration of one or more payloads (e.g., transgenes) at three or more target loci in combination with disruption (e.g., reduction of expression, knockout, etc.) at two or more target loci.In some embodiments, the methods and compositions disclosed herein optionally instruct the integration of one or more payloads (e.g., transgenes) at three or more target loci in combination with disruption (e.g., reduction of expression, knockout, etc.) at three or more target loci. In some embodiments, the methods and compositions disclosed herein optionally instruct the integration of one or more payloads (e.g., transgenes) at four or more target loci in combination with disruption (e.g., reduction of expression, knockout, etc.) at three or more target loci.
[0172] In some embodiments, the methods and compositions provided herein direct the integration of a payload at a target locus considered to be a safe harbor site (e.g., CCR5, AAVS1). In some embodiments, the methods and compositions provided herein direct the integration of a payload at a target locus considered to be a tissue biomarker and / or immunomodulator (e.g., B2M). In some embodiments, the methods and compositions provided herein direct the integration of one or more payloads at one or more target loci simultaneously (in less than 24 hours). In some embodiments, the methods and compositions provided herein direct the integration of one or more payloads at the same target locus. In some embodiments, the methods and compositions provided herein direct the integration of one or more payloads at two or more different target loci. In some embodiments, the methods and compositions provided herein direct the integration of two or more payloads at one or more target loci by the simultaneous introduction of two or more expression cassettes. In some embodiments, the method for multiple integration may include the simultaneous introduction of two or more expression cassettes, each containing one or more transgenes, and includes site-specific cleavage at each target locus (e.g., CCR5, B2M) by one or more guide RNA / Cas9 complexes, followed by the integration of one or more transgenes at each target locus via homologous recombination. In some embodiments, the introduction of two or more expression cassettes, each containing one or more transgenes, including site-specific cleavage at the target locus (e.g., CCR5, B2M) by one or more guide RNA / Cas9 complexes, is performed within a period of 24 hours or less. In some embodiments, the method for multiple integration may include the sequential introduction of one or more expression cassettes, each containing one or more transgenes, and includes site-specific cleavage at the target locus (e.g., CCR5, B2M) by one or more guide RNA / Cas9 complexes, followed by the integration of one or more transgenes at each target locus via homologous recombination, and then a period of time before the subsequent introduction of one or more additional expression cassettes.In some other embodiments, there may be a period of time between the sequential introduction of two or more expression cassettes. In some embodiments, the period between each sequential introduction of an expression cassette may be 24 to 144 hours. In some embodiments, the target locus is selected from any genomic site suitable for the use of the methods and compositions provided herein. In some embodiments, the target locus encodes a polypeptide. In some embodiments, the target locus encodes a polypeptide that is highly expressed in the subject (e.g., a subject not suffering from a disease, disorder, or condition, or a subject suffering from a disease, disorder, or condition). In some embodiments, the target locus is selected from one or more of CD19, CD20, IGH, B2M, CCR5, JCHAIN, PAX5, IRF4, IRF8, BACH2, EZH2, XBP1, CARD11, PRDM1, BAFF, TAP1, TAP2, TAPBP, NLRC5, RFX5, BCMA, and CD58.
[0173] In some embodiments, the methods and compositions disclosed herein instruct multiple incorporation at the safe harbor locus (e.g., CCR5) and the B2M locus. In some embodiments, the methods and compositions disclosed herein instruct multiple incorporation at the safe harbor locus (e.g., CCR5) and the CD58 locus. The methods and compositions disclosed herein instruct multiple incorporation at the safe harbor locus (e.g., CCR5), the B2M locus, and the CD58 locus. In some embodiments, the methods and compositions disclosed herein instruct incorporation at the safe harbor locus (e.g., CCR5) and disruption (e.g., knockout, reduction of expression, etc.) at the B2M locus. In some embodiments, the methods and compositions disclosed herein instruct multiple incorporation at the safe harbor locus (e.g., CCR5) and the CD58 locus. In some embodiments, the methods and compositions disclosed herein instruct incorporation at the safe harbor locus (e.g., CCR5) and disruption (e.g., knockout, reduction of expression, etc.) at the CD58 locus. In some embodiments, the methods and compositions disclosed herein instruct multiple incorporation at the safe harbor locus (e.g., CCR5), the B2M locus, and the CD58 locus. In some embodiments, the methods and compositions disclosed herein instruct incorporation at the safe harbor locus (e.g., CCR5), disruption at the B2M locus (e.g., knockout, reduction of expression, etc.), and disruption at the CD58 locus (e.g., knockout, reduction of expression, etc.).
[0174] In some embodiments, the methods and compositions disclosed herein instruct multiple incorporation at the CCR5 locus and the B2M locus. In some embodiments, the methods and compositions disclosed herein instruct multiple incorporation at the CCR5 locus and the CD58 locus. The methods and compositions disclosed herein instruct multiple incorporation at the CCR5 locus, the B2M locus and the CD58 locus. In some embodiments, the methods and compositions disclosed herein instruct incorporation at the CCR5 locus and disruption (e.g., knockout, reduction of expression) at the B2M locus. In some embodiments, the methods and compositions disclosed herein instruct multiple incorporation at the CCR5 locus and the CD58 locus. In some embodiments, the methods and compositions disclosed herein instruct incorporation at the CCR5 locus and disruption (e.g., knockout, reduction of expression) at the CD58 locus. In some embodiments, the methods and compositions disclosed herein instruct multiple incorporation at the CCR5 locus, the B2M locus and the CD58 locus. In some embodiments, the methods and compositions disclosed herein direct integration at the CCR5 locus, disruption at the B2M locus (e.g., knockout, reduction of expression, etc.), and disruption at the CD58 locus (e.g., knockout, reduction of expression, etc.).
[0175] In some embodiments, the methods and compositions disclosed herein instruct multiple incorporation at endogenous gene loci (e.g., JCHAIN) and the B2M locus. In some embodiments, the methods and compositions disclosed herein instruct multiple incorporation at endogenous gene loci (e.g., JCHAIN) and the CD58 locus. The methods and compositions disclosed herein instruct multiple incorporation at endogenous gene loci (e.g., JCHAIN), the B2M locus, and the CD58 locus. In some embodiments, the methods and compositions disclosed herein instruct incorporation at endogenous gene loci (e.g., JCHAIN) and disruption (e.g., knockout, reduction of expression, etc.) at the B2M locus. In some embodiments, the methods and compositions disclosed herein instruct multiple incorporation at endogenous gene loci (e.g., JCHAIN) and the CD58 locus. In some embodiments, the methods and compositions disclosed herein instruct integration at an endogenous gene locus (e.g., JCHAIN) and disruption at the CD58 locus (e.g., knockout, reduction of expression, etc.). In some embodiments, the methods and compositions disclosed herein instruct multiple integration at an endogenous gene locus (e.g., JCHAIN), the B2M locus, and the CD58 locus. In some embodiments, the methods and compositions disclosed herein instruct integration at an endogenous gene locus (e.g., JCHAIN), disruption at the B2M locus (e.g., knockout, reduction of expression, etc.), and disruption at the CD58 locus (e.g., knockout, reduction of expression, etc.).
[0176] In some embodiments, the methods and compositions disclosed herein instruct multiple incorporation at the safe harbor locus (e.g., CCR5) and the TAP2 locus. In some embodiments, the methods and compositions disclosed herein instruct multiple incorporation at the safe harbor locus (e.g., CCR5) and the TAPBP locus. In some embodiments, the methods and compositions disclosed herein instruct multiple incorporation at the safe harbor locus (e.g., CCR5), the TAP2 locus, and the TAPBP locus. In some embodiments, the methods and compositions disclosed herein instruct incorporation at the safe harbor locus (e.g., CCR5) and disruption (e.g., knockout, reduction of expression, etc.) at the TAP2 locus. In some embodiments, the methods and compositions disclosed herein instruct incorporation at the safe harbor locus (e.g., CCR5) and disruption (e.g., knockout, reduction of expression, etc.) at the TAPBP locus. In some embodiments, the methods and compositions disclosed herein direct integration at the safe harbor locus (e.g., CCR5), disruption at the TAP2 locus (e.g., knockout, reduction of expression, etc.), and disruption at the TAPBP locus (e.g., knockout, reduction of expression, etc.).
[0177] In some embodiments, the methods and compositions disclosed herein instruct multiple incorporation at the CCR5 locus and the TAP2 locus. In some embodiments, the methods and compositions disclosed herein instruct multiple incorporation at the CCR5 locus and the TAPBP locus. In some embodiments, the methods and compositions disclosed herein instruct multiple incorporation at the CCR5 locus, the TAP2 locus, and the TAPBP locus. In some embodiments, the methods and compositions disclosed herein instruct incorporation at the CCR5 locus and disruption (e.g., knockout, reduction of expression) at the TAP2 locus. In some embodiments, the methods and compositions disclosed herein instruct incorporation at the CCR5 locus and disruption (e.g., knockout, reduction of expression) at the TAPBP locus. In some embodiments, the methods and compositions disclosed herein instruct incorporation at the CCR5 locus, disruption (e.g., knockout, reduction of expression), and disruption (e.g., knockout, reduction of expression) at the TAPBP locus.
[0178] In some embodiments, the methods and compositions disclosed herein instruct multiple incorporation at endogenous gene loci (e.g., JCHAIN) and TAP2 loci. In some embodiments, the methods and compositions disclosed herein instruct multiple incorporation at endogenous gene loci (e.g., JCHAIN) and TAPBP loci. In some embodiments, the methods and compositions disclosed herein instruct multiple incorporation at endogenous gene loci (e.g., JCHAIN), TAP2, and TAPBP loci. In some embodiments, the methods and compositions disclosed herein instruct incorporation at endogenous gene loci (e.g., JCHAIN) and disruption (e.g., knockout, reduction of expression, etc.) at TAP2 loci. In some embodiments, the methods and compositions disclosed herein instruct incorporation at endogenous gene loci (e.g., JCHAIN) and disruption (e.g., knockout, reduction of expression, etc.) at TAPBP loci. In some embodiments, the methods and compositions disclosed herein direct integration at an endogenous gene locus (e.g., JCHAIN), disruption at the TAP2 locus (e.g., knockout, reduction of expression, etc.), and disruption at the TAPBP locus (e.g., knockout, reduction of expression, etc.).
[0179] In some embodiments, the methods and compositions disclosed herein direct multiple incorporation at the safe harbor locus (e.g., CCR5) and the NLRC5 locus. In some embodiments, the methods and compositions disclosed herein direct incorporation at the safe harbor locus (e.g., CCR5) and disruption at the NLRC5 locus (e.g., knockout, reduction of expression, etc.).
[0180] In some embodiments, the methods and compositions disclosed herein direct multiple incorporation at the CCR5 and NLRC5 loci. In some embodiments, the methods and compositions disclosed herein direct incorporation at the CCR5 locus and disruption (e.g., knockout, reduction of expression, etc.) at the NLRC5 locus.
[0181] In some embodiments, the methods and compositions disclosed herein direct multiple incorporation at endogenous gene loci (e.g., JCHAIN) and the NLRC5 locus. In some embodiments, the methods and compositions disclosed herein direct incorporation at endogenous gene loci (e.g., JCHAIN) and disruption at the NLRC5 locus (e.g., knockout, reduction of expression, etc.).
[0182] In some embodiments, the methods and compositions disclosed herein instruct multiple incorporation at the safe harbor locus (e.g., CCR5) and the RFX5 locus. In some embodiments, the methods and compositions disclosed herein instruct multiple incorporation at the safe harbor locus (e.g., CCR5), the RFX5 locus, and the CD58 locus. In some embodiments, the methods and compositions disclosed herein instruct incorporation at the safe harbor locus (e.g., CCR5) and disruption (e.g., knockout, reduction of expression, etc.) at the RFX5 locus. In some embodiments, the methods and compositions disclosed herein instruct incorporation at the safe harbor locus (e.g., CCR5), disruption (e.g., knockout, reduction of expression, etc.) at the RFX5 locus, and disruption (e.g., knockout, reduction of expression, etc.) at the CD58 locus. In some embodiments, the methods and compositions disclosed herein direct integration at a safe harbor locus (e.g., CCR5), integration at RFX5, and disruption at the CD58 locus (e.g., knockout, reduction of expression, etc.).
[0183] In some embodiments, the methods and compositions disclosed herein instruct multiple incorporation at the CCR5 locus and the RFX5 locus. In some embodiments, the methods and compositions disclosed herein instruct multiple incorporation at the CCR5 locus, the RFX5 locus and the CD58 locus. In some embodiments, the methods and compositions disclosed herein instruct incorporation at the CCR5 locus and disruption (e.g., knockout, reduction of expression) at the RFX5 locus. In some embodiments, the methods and compositions disclosed herein instruct incorporation at the CCR5 locus and disruption (e.g., knockout, reduction of expression) at the RFX5 locus and disruption (e.g., knockout, reduction of expression) at the CD58 locus. In some embodiments, the methods and compositions disclosed herein instruct incorporation at the CCR5 locus and incorporation at the RFX5 locus and disruption (e.g., knockout, reduction of expression) at the CD58 locus.
[0184] In some embodiments, the methods and compositions disclosed herein instruct multiple incorporation at an endogenous gene locus (e.g., JCHAIN) and the RFX5 locus. In some embodiments, the methods and compositions disclosed herein instruct multiple incorporation at an endogenous gene locus (e.g., JCHAIN), the RFX5 locus, and the CD58 locus. In some embodiments, the methods and compositions disclosed herein instruct incorporation at an endogenous gene locus (e.g., JCHAIN) and disruption (e.g., knockout, reduction of expression, etc.) at the RFX5 locus. In some embodiments, the methods and compositions disclosed herein instruct incorporation at an endogenous gene locus (e.g., JCHAIN) and disruption (e.g., knockout, reduction of expression, etc.) at the RFX5 locus and disruption (e.g., knockout, reduction of expression, etc.) at the CD58 locus. In some embodiments, the methods and compositions disclosed herein direct integration at an endogenous gene locus (e.g., JCHAIN), integration at RFX5, and disruption at the CD58 locus (e.g., knockout, reduction of expression, etc.).
[0185] In some embodiments, disruption of an endogenous target gene in a B-lineage cell population (e.g., knockout, reduction of expression, etc.) includes the use of a nuclease (e.g., Cas nuclease, ZFN, TALEN, etc.). In some embodiments, disruption of an endogenous target gene in a B-lineage cell population (e.g., knockout, reduction of expression, etc.) includes the use of one or more RNAi agents. In some embodiments, disruption of an endogenous target gene in a B-lineage cell population (e.g., knockout, reduction of expression, etc.) includes the use of siRNA. In some embodiments, disruption of an endogenous target gene in a B-lineage cell population (e.g., knockout, reduction of expression, etc.) includes the use of shRNA. In some embodiments, disruption of an endogenous target gene in a B-lineage cell population (e.g., knockout, reduction of expression, etc.) includes the use of miRNA.
[0186] In some embodiments, the methods and compositions disclosed herein direct the multiple incorporation of one or more payloads at one or more target loci at a higher rate compared to methods and compositions that do not include the methods described herein. In some embodiments, methods and compositions that result in increased multiple incorporation include, but are not limited to, serum leave. In some embodiments, methods and compositions that result in increased multiple incorporation may include the addition of small peptides, inhibitors (e.g., XL413, M3814, etc.), antimitotic agents (e.g., nocodazole), and / or AAV incorporation enhancers (e.g., LAH4). In some embodiments, the methods and compositions disclosed herein provide target site incorporation rates of 1%, 2%, 5%, 10%, 15%, 20%, 25%, 30%, 35%, 40%, 45%, 50%, 55%, 60%, 65%, 70%, 75%, 80%, 85%, 90% or higher.
[0187] In some embodiments, the methods and compositions disclosed herein dictate the multiple incorporation of the payload, which, when administered to a subject, provides a higher engraftment rate of the manipulated B-lineage cell population. In some embodiments, the subject is a clinical species (e.g., human). In some embodiments, the subject is a non-clinical species (e.g., mouse model).
[0188] In some embodiments, the methods disclosed herein include measuring and / or monitoring the engraftment of B-lineage cells manipulated with the methods and compositions disclosed herein. In some embodiments, the sample is collected from a subject to whom the manipulated B-lineage cells described herein are administered. In some embodiments, sample collection is by or includes venipuncture. In some embodiments, sample collection is by or includes tissue collection. In some embodiments, levels of proteins (e.g., factor IX, SMPD1, blinatumomab, etc.) are measured from the sample collection. In some embodiments, lipids are evaluated from the collected sample.
[0189] In some embodiments, the engraftment of one or more B-lineage cells from the genetically modified B-lineage cell population described herein is measured in a non-clinical species (e.g., hIL6- / NOG mice). In some embodiments, engraftment is measured using bioluminescence. In some embodiments, engraftment is measured using ELISpot. In some embodiments, plasma IgG levels are determined to measure engraftment. In some embodiments, plasma IgM levels are determined to measure engraftment. In some embodiments, levels of transgenes (e.g., SMPD1, factor IX, blinatumomab, etc.) are determined to measure engraftment. In some embodiments, the engraftment of one or more B-lineage cells from the genetically modified B-lineage cell population described herein occurs in a non-clinical species (e.g., hIL6- / NOG mice) with or without pre-conditioning of the non-clinical subject (e.g., chemotherapy, immunosuppressive therapy, etc.) (Cheng et al. 2022). In some embodiments, engraftment of one or more B-lineage cells from the genetically modified B-lineage cell population described herein occurs in a clinical species (e.g., a human subject) whether or not the clinical subject has been pre-conditioned (e.g., chemotherapy, immunosuppressive therapy, etc.).
[0190] B lineage cell culture method Various methods for in vitro culture and long-term maintenance of B-lineage cells have been described in the art (see Rawlings et al. 1995, Rawlings et al. 1997, and Fluckinger et al. 1998, each of which is incorporated herein by reference in its entirety). B-lineage cell culture conditions can significantly affect normal human B-lineage development and the generation of mature Ig-secreting B cells. While we do not wish to be bound by any theory, it is generally believed that ex vivo activation of B-lineage cells may be required for subsequent homologous repair (HDR)-based genome editing techniques (because the required DNA repair proteins are present during the G2 / S phase of the cell cycle) (see Rogers and Cannon 2021, which is incorporated herein by reference in its entirety).
[0191] Activation of B-lineage cells Various techniques for in vitro activation of B-lineage cells (also interchangeably referred to as "activated B-lineage cells") are described. Traditionally, in vitro B-lineage cell activation and proliferation have used CD40L-expressing feeder cell layer systems. Such feeder cell systems have been described as difficult to standardize and often unreliable in providing stable levels of B-lineage cell activation and proliferation. Recent advances have shifted to protocols for in vitro activation and proliferation of B-lineage cells in specific culture systems containing cytokines or other components in the absence of feeder cells (see Jourdan et al., 2009 and Hartweger et al., 2019 (each of which is incorporated herein by reference in whole)).
[0192] In some embodiments, a method for activating B-lineage cells includes contacting cells with a culture medium containing one or more components of the present disclosure. In some embodiments, a method for activating B-lineage cells includes contacting cells with a culture medium containing one or more cytokines and / or oligonucleotides (e.g., multimer human CD40L, IL-2, IL-10, IL-15, IL-21, and / or CpG). In some embodiments, a method for B cell activation involves contacting cells with a culture medium containing at least about 5 ng / mL, 10 ng / mL, 15 ng / mL, 20 ng / mL, 25 ng / mL, 30 ng / mL, 35 ng / mL, 40 ng / mL, 45 ng / mL, 50 ng / mL, 55 ng / mL, 60 ng / mL, 65 ng / mL, 70 ng / mL, 75 ng / mL, 80 ng / mL, 85 ng / mL, 90 ng / mL, 95 ng / mL, 100 ng / mL, 150 ng / mL, 200 ng / mL, or 500 ng / mL of one or more cytokines and / or oligonucleotides (e.g., multimerized human CD40L, IL-2, IL-10, IL-15, IL-21, and / or CpG). In some embodiments, a method for activating B-lineage cells involves contacting cells with a culture medium containing at least about 0.1 ug / mL, 0.2 ug / mL, 0.3 ug / mL, 0.4 ug / mL, 0.5 ug / mL, 0.6 ug / mL, 0.7 ug / mL, 0.8 ug / mL, 0.9 ug / mL, 1 ug / mL, 1.5 ug / mL, 2 ug / mL, 2.5 ug / mL, 3 ug / mL, 3.5 ug / mL, 4 ug / mL, 4.5 ug / mL, or 5 ug / mL of one or more cytokines and / or oligonucleotides (e.g., multimerized human CD40L, IL-2, IL-10, IL-15, IL-21, and / or CpG).
[0193] In some embodiments, a method for activating B-lineage cells includes the step of contacting cells with a culture medium containing one or more components of the present disclosure for at least about 1, 2, 3, 4, or 5 days. In some embodiments, a method for activating B-lineage cells includes the step of contacting cells with a culture medium containing one or more cytokines and / or oligonucleotides (e.g., CD40L, IL-2, IL-10, IL-15, IL-21, and / or CpG) for at least about 1, 2, 3, 4, or 5 days. In some embodiments, a method for activating B-lineage cells includes the step of contacting cells with a culture medium containing one or more cytokines and / or oligonucleotides (e.g., CD40L, IL-2, IL-10, IL-15, IL-21, and / or CpG) for at least 2 days. In some embodiments, a method for activating B-lineage cells includes the step of contacting cells with a culture medium containing one or more cytokines and / or oligonucleotides (e.g., CD40L, IL-2, IL-10, IL-15, IL-21, and / or CpG) for at least 2 days, followed by a gene editing step. In some embodiments, a method for activating B-lineage cells includes the step of contacting cells with a culture medium containing one or more cytokines and / or oligonucleotides (e.g., CD40L, IL-2, IL-10, IL-15, IL-21, and / or CpG) for at least two days, followed by a step of B-lineage cell proliferation. In some embodiments, a method for activating B-lineage cells includes the step of contacting cells with a culture medium containing one or more cytokines and / or oligonucleotides (e.g., CD40L, IL-2, IL-10, IL-15, IL-21, and / or CpG) for at least two days, followed by a step of B-lineage cell proliferation for at least about 1, 2, 3, 4, 5, 6, 7, or 8 days.
[0194] In some embodiments, the methods described herein produce an activated B-lineage cell population.
[0195] Culture methods (serum, plasma, and recombinant protein mutations) This application provides, in particular, methods for producing enhanced gene integration in B-lineage cell populations. The application of these methods can further result in increased engraftment of the engineered B-lineage cell population in a subject (e.g., a human subject). Increased engraftment of the engineered B-lineage cell population in a subject has broader branching for cell therapies, including, but not limited to, the treatment of disorders including hemophilia B and Niemann-Pick disease type B. Such methods for enhancing gene integration and increasing engraftment include, but are not limited to, the seromutation methods described herein.
[0196] In some embodiments, B-lineage cells are isolated and cultured for at least about 1, 2, 3, 4, or 5 days in a medium containing one or more cytokines and / or oligonucleotides (e.g., CD40L, IL-2, IL-10, IL-15, IL-21, and / or CpG). In some embodiments, a method for activating B-lineage cells includes the step of contacting cells with a medium containing one or more cytokines and / or oligonucleotides (e.g., CD40L, IL-2, IL-10, IL-15, IL-21, and / or CpG) for at least 2 days. In some embodiments, a method for activating B-lineage cells includes the step of contacting cells with a medium containing one or more cytokines and / or oligonucleotides (e.g., CD40L, IL-2, IL-10, IL-15, IL-21, and / or CpG) for at least 2 days, followed by a gene editing step.
[0197] In some embodiments, the B-lineage cell population is brought into contact with a cell culture medium that differs from the initial medium conditions during or after genetic engineering in terms of serum, plasma, and / or recombinant protein (e.g., lacking or substantially lacking serum, plasma, and / or recombinant protein). In some embodiments, the cell culture medium differs from (e.g., lacking or substantially lacking) one or more of human serum, bovine serum, horse serum, neonatal calf serum, goat serum, rabbit serum, pig serum, or chicken serum. In some embodiments, the B-lineage cell population is washed during or immediately after genetic engineering in a basal medium that differs from the initial medium conditions in terms of serum (e.g., human serum, bovine serum, horse serum, neonatal calf serum, goat serum, rabbit serum, pig serum, chicken serum, or a combination thereof) and lacks any additional cytokines and / or oligonucleotides. In some other embodiments, the B-lineage cell population is brought into contact with a cell culture medium that differs from the initial medium conditions in terms of plasma (e.g., lacking or substantially lacking plasma). In some such embodiments, the cell culture medium differs from (e.g., lacks or substantially does not contain) one or more of the following: human plasma, bovine plasma, horse plasma, neonatal calf plasma, goat plasma, rabbit plasma, porcine plasma, or chicken plasma. In some such embodiments, the B-lineage cell population is washed during or immediately after the genetic manipulation in a basal medium that differs from the initial medium conditions in terms of plasma (e.g., human plasma, bovine plasma, horse plasma, neonatal calf plasma, goat plasma, rabbit plasma, porcine plasma, chicken plasma, or a combination thereof) and lacks any additional cytokines and / or oligonucleotides. In some other embodiments, the B-lineage cell population is brought into contact with a cell culture medium that differs from the initial medium conditions in terms of plasma (e.g., lacks or substantially does not contain plasma) during or after the genetic manipulation. In some such embodiments, the cell culture medium differs from (e.g., lacks or substantially does not contain) one or more of the following: human recombinant protein, bovine recombinant protein, horse recombinant protein, newborn calf recombinant protein, goat recombinant protein, rabbit recombinant protein, pig recombinant protein, or chicken recombinant protein.In some such embodiments, the B-lineage cell population is washed during or immediately after genetic manipulation in a basal medium that differs from the initial medium conditions in that it contains recombinant proteins (e.g., human recombinant proteins, bovine recombinant proteins, horse recombinant proteins, neonatal calf recombinant proteins, goat recombinant proteins, rabbit recombinant proteins, pig recombinant proteins, chicken recombinant proteins, or combinations thereof) and lacks any additional cytokines and / or oligonucleotides.
[0198] In some embodiments, after the genetic manipulation described herein, the B-lineage cell population is brought into contact with a medium that differs from the initial medium conditions in terms of serum, plasma, and / or recombinant protein (e.g., lacking or substantially lacking serum, plasma, and / or recombinant protein), and then incubated for at least 1, 2, 3, 4, or 5 days. In some embodiments, the genetically engineered B-lineage cell population is brought into contact with a medium that differs from the initial medium conditions in terms of serum, plasma, and / or recombinant protein (e.g., lacking or substantially lacking serum, plasma, and / or recombinant protein), and then incubated for at least about 1 hour, 2 hours, 3 hours, 4 hours, 5 hours, 6 hours, 7 hours, 8 hours, 9 hours, 10 hours, or 12 hours. In some embodiments, the genetically engineered B-lineage cell population is brought into contact with a medium that differs from the initial medium conditions in terms of serum, plasma, and / or recombinant protein (e.g., lacking or substantially lacking serum, plasma, and / or recombinant protein), and then incubated for at least 12 hours. In some embodiments, the genetically engineered B-lineage cell population is brought into contact with a medium that differs from the initial medium conditions in terms of serum, plasma, and / or recombinant proteins (e.g., lacking or substantially lacking serum, plasma, and / or recombinant proteins), and then incubated for at least 24 hours. In some embodiments, the genetically engineered B-lineage cell population is brought into contact with a medium that differs from the initial medium conditions in terms of serum, plasma, and / or recombinant proteins (e.g., lacking or substantially lacking serum, plasma, and / or recombinant proteins), and then incubated for at least 48 hours. In some embodiments, the genetically engineered B-lineage cell population is brought into contact with a medium that differs from the initial medium conditions in terms of serum, plasma, and / or recombinant proteins (e.g., lacking or substantially lacking serum, plasma, and / or recombinant proteins), and then incubated for at least 72 hours. In some embodiments, the genetically engineered B-lineage cell population is brought into contact with a medium that differs from the initial medium conditions in terms of serum, plasma, and / or recombinant protein (e.g., lacking or substantially lacking serum, plasma, and / or recombinant protein), and then incubated for 72 hours or less.In some embodiments, the genetically engineered B-lineage cell population is brought into contact with a medium that differs from the initial medium conditions in terms of serum, plasma, and / or recombinant proteins (e.g., lacking or substantially lacking serum, plasma, and / or recombinant proteins), and then incubated for about 24 hours. In some embodiments, the genetically engineered B-lineage cell population is brought into contact with a medium that differs from the initial medium conditions in terms of serum, plasma, and / or recombinant proteins (e.g., lacking or substantially lacking serum, plasma, and / or recombinant proteins), and contains one or more cytokines and / or oligonucleotides (e.g., CD40L, IL-2, IL-10, IL-15, IL-21, and / or CpG).
[0199] In some embodiments, the B-lineage cell population is spun down after incubation, the supernatant is removed, and the cells are replated in a medium containing initial serum, plasma, and / or recombinant protein conditions (e.g., human serum, bovine serum, horse serum, neonatal calf serum, goat serum, rabbit serum, porcine serum, chicken serum, human plasma, bovine plasma, horse plasma, neonatal calf serum, goat serum, rabbit serum, porcine serum, chicken serum, human recombinant protein, bovine recombinant protein, horse recombinant protein, neonatal calf recombinant protein, goat recombinant protein, rabbit recombinant protein, porcine recombinant protein, chicken recombinant protein, or a combination thereof). In some embodiments, the B-lineage cells are replated in a medium containing one or more cytokines and / or oligonucleotides (e.g., CD40L, IL-2, IL-10, IL-15, IL-21, and / or CpG) and expanded for at least about 1, 2, 3, 4, or 5 days.
[0200] Differentiation of B cells into plasmablasts Plasmablasts are short-lived, rapidly produced effector cells, primarily present in early antibody responses and representing a potential product of terminal B cell differentiation. Plasmablasts can secrete antibodies, including IgM subtype antibodies, to initiate an immediate response to certain antigens in the body. In vitro differentiation of B cells into plasmablasts can be facilitated by the use of certain signaling molecules, including one or more cytokines (e.g., IL-2, IL-6, IL-10, and / or IL-15). Various methods for the differentiation of B cells into plasmablasts are known, but are not limited to those outlined in WO / 2018 / 170150 (which is incorporated herein in its entirety by reference). Plasmablasts produced by such methods are CD27 + / CD38 + / CD138 - It can be characterized as a cell.
[0201] In some embodiments, a method for differentiating B cells into plasmablasts includes contacting the cells with a culture medium containing one or more components. In some embodiments, a method for differentiating B cells into plasmablasts includes contacting activated B-series cells with a culture medium containing one or more cytokines (e.g., IL-2, IL-6, IL-10, and / or IL-15). In some embodiments, a method for B cell differentiation into plasmablasts involves contacting activated B-lineage cells with a culture medium containing at least about 0.5 ng / mL, 1 ng / mL, 1.5 ng / mL, 2 ng / mL, 2.5 ng / mL, 3 ng / mL, 3.5 ng / mL, 4 ng / mL, 4.5 ng / mL, 5 ng / mL, 10 ng / mL, 15 ng / mL, 20 ng / mL, 25 ng / mL, 30 ng / mL, 35 ng / mL, 40 ng / mL, 45 ng / mL, 50 ng / mL, 55 ng / mL, 60 ng / mL, 65 ng / mL, 70 ng / mL, 75 ng / mL, 80 ng / mL, 85 ng / mL, 90 ng / mL, 95 ng / mL, or ng / mL of one or more cytokines (e.g., IL-2, IL-6, IL-10, and / or IL-15).
[0202] In some embodiments, a method for differentiating B cells into plasmablasts includes the step of contacting cells with a culture medium containing one or more components of the present disclosure for at least 1, 2, 3, or 4 days. In some embodiments, a method for differentiating B cells into plasmablasts includes the step of contacting activated B-series cells with a culture medium containing one or more cytokines (e.g., IL-2, IL-6, IL-10, and / or IL-15) for at least 1, 2, 3, or 4 days. In some embodiments, a method for differentiating B cells into plasmablasts includes the step of contacting activated B-series cells with a culture medium containing one or more cytokines (e.g., IL-2, IL-6, IL-10, and / or IL-15) for at least 3 days. In some embodiments, a method for differentiating B cells into plasmablasts includes the step of contacting activated B-series cells with a culture medium containing one or more cytokines (e.g., IL-2, IL-6, IL-10, and / or IL-15) for at least 3 days, followed by a step of plasmablast proliferation.
[0203] Differentiation of plasmablasts into plasma cells Plasmablasts secrete more antibodies than naive B cells, but they are shorter-lived and secrete fewer antibodies than plasma cells (PCs). Long-lived plasma cells (LLPCs; used interchangeably with plasma cells throughout) are localized in the bone marrow of the body, can secrete high levels of antibodies, and can survive for decades without proliferation (see Hammerland et al., 2017 and Khodadadi et al., 2019 (both of which are incorporated in their entirety)). Differentiation of plasmablasts into long-lived plasma cells can be triggered by certain events in the body, including, for example, the activation of transcription factors Blimp-1 / PRDM1 and IRF4. Differentiation of plasmablasts into plasma cells in vitro can be facilitated by using certain signaling molecules, including one or more cytokines (e.g., IL-6, IL-15, and / or IFNα-2β). Various methods for differentiating plasmablasts into plasma cells are known, but are not limited to those outlined in Jourdan et al. 2019 and WO / 2018 / 170150 (each of which is incorporated herein by reference in its entirety). Plasma cells produced by such methods are CD27 + / CD38 + / CD138 + It can be characterized as a cell.
[0204] In some embodiments, a method for differentiating plasmablasts into plasma cells involves contacting the cells with a culture medium containing one or more cytokines (e.g., IL-6, IL-15, and / or IFNα-2β). In some embodiments, a method for differentiating plasmablasts into plasma cells involves contacting plasmablasts with a culture medium containing at least about 0.5 ng / mL, 1 ng / mL, 1.5 ng / mL, 2 ng / mL, 2.5 ng / mL, 3 ng / mL, 3.5 ng / mL, 4 ng / mL, 4.5 ng / mL, 5 ng / mL, 10 ng / mL, 15 ng / mL, 20 ng / mL, 25 ng / mL, 30 ng / mL, 35 ng / mL, 40 ng / mL, 45 ng / mL, 50 ng / mL, 55 ng / mL, 60 ng / mL, 65 ng / mL, 70 ng / mL, 75 ng / mL, 80 ng / mL, 85 ng / mL, 90 ng / mL, 95 ng / mL, or ng / mL of one or more cytokines (e.g., IL-6, IL-15, and / or IFNα-2β).
[0205] In some embodiments, a method for differentiating plasmablasts into plasma cells includes the step of contacting the cells with a culture medium containing one or more components of the present disclosure for at least 1, 2, 3, or 4 days. In some embodiments, a method for differentiating plasmablasts into plasma cells includes the step of contacting the plasmablasts with a culture medium containing one or more cytokines (e.g., IL-6, IL-15, and / or IFNα-2β) for at least 1, 2, 3, or 4 days. In some embodiments, a method for differentiating plasmablasts into plasma cells includes the step of contacting the plasmablasts with a culture medium containing one or more cytokines (e.g., IL-6, IL-15, and / or IFNα-2β) for at least 3 days. In some embodiments, a method for differentiating plasmablasts into plasma cells includes the step of contacting the plasmablasts with a culture medium containing one or more cytokines (e.g., IL-6, IL-15, and / or IFNα-2β) for at least 3 days, followed by a step of cell isolation. In some embodiments, a method for differentiating plasmablasts into plasma cells includes the steps of contacting plasmablasts with a culture medium containing one or more cytokines (e.g., IL-6, IL-15, and / or IFNα-2β) for at least three days, followed by the step of administration to a subject.
[0206] Manipulated cell preparations This disclosure describes engineered cell preparations comprising populations of cells modified to perform one or more desired functions. In some embodiments, the engineered cell preparation is a composition comprising a genetically modified immune cell population (e.g., B cells, T cells). In some embodiments, the engineered cell preparation is a composition comprising a genetically modified B-lineage cell population (e.g., B cells, plasmablasts, plasma cells). In some embodiments, the engineered cell preparation is a composition comprising a genetically modified plasmablast population. In some embodiments, the engineered cell preparation is a composition comprising a genetically modified plasma cell population.
[0207] In some embodiments, the engineered cell preparation is genetically modified to express one or more payloads of interest (e.g., transgenes). In some embodiments, the engineered cell preparation is genetically modified to express one or more transgenes from one or more expression cassettes (e.g., including additional polynucleotide sequence elements).
[0208] In some embodiments, the engineered cell preparation includes genetically modified cells expressing one or more transgenes of interest (e.g., therapeutic proteins, antibodies, etc.). In some embodiments, the engineered cell preparation includes genetically modified cells expressing one or more transgenes of interest (e.g., therapeutic proteins, antibodies, etc.) from one or more endogenous gene loci. In some embodiments, the engineered cell preparation includes genetically modified cells expressing one or more transgenes of interest (e.g., therapeutic proteins, antibodies, etc.) from one or more endogenous gene loci under the control of an endogenous promoter. In some embodiments, the engineered cell preparation includes genetically modified cells expressing one or more transgenes of interest (e.g., therapeutic proteins, antibodies, etc.) from one or more endogenous gene loci under the control of an exogenous promoter. In some embodiments, the engineered cell preparation includes genetically modified cells expressing one or more transgenes of interest (e.g., therapeutic proteins, antibodies, etc.) from one or more endogenous gene loci without disrupting the expression and / or function of endogenous genes. In some embodiments, the manipulated cell preparation includes genetically modified cells that express one or more transgenes of interest (e.g., therapeutic proteins, antibodies, etc.) from one or more endogenous gene loci, and partially or completely disrupt the expression and / or function of the endogenous genes.
[0209] In some embodiments, the engineered cell preparation is genetically modified to express one or more transgenes from one or more expression cassettes, each expression cassette further comprising one or more polynucleotide sequences encoding one or more promoters. In some embodiments, the engineered cell preparation is genetically modified to express one or more transgenes from one or more expression cassettes, each expression cassette further comprising one or more polynucleotide sequences encoding one or more enhancers. In some embodiments, the engineered cell preparation is genetically modified to express one or more transgenes from one or more expression cassettes, each expression cassette further comprising one or more polynucleotide sequences encoding one or more termination factors. In some embodiments, the engineered cell preparation is genetically modified to express one or more transgenes from one or more expression cassettes, each expression cassette further comprising one or more polynucleotide sequences encoding one or more homology arms. In some embodiments, the engineered cell preparation is genetically modified to express one or more transgenes from one or more expression cassettes, each expression cassette further comprising one or more polynucleotide sequences encoding one or more promoters, one or more enhancers, one or more termination factors, and / or one or more homology arms. In some embodiments, the engineered cell preparation is genetically modified to express one or more transgenes or variants thereof from one or more expression cassettes, each expression cassette further comprising one or more polynucleotide sequences encoding an MND promoter, a WPRE enhancer, a BGH polyA, a 5' homology arm, and a 3' homology arm. In some embodiments, the engineered cell preparation is genetically modified to express one or more transgenes or variants thereof from one or more expression cassettes, each expression cassette further comprising one or more polynucleotide sequences encoding an MND promoter, a BGH polyA, a 5' homology arm, and a 3' homology arm.In some embodiments, the engineered cell preparation is genetically modified to express one or more transgenes or variants thereof from one or more expression cassettes, each expression cassette further comprising one or more polynucleotide sequences encoding the MND promoter, WPRE enhancer, SV40 polyA, 5' homology arm, and 3' homology arm. In some embodiments, the engineered cell preparation is genetically modified to express one or more transgenes or variants thereof from one or more expression cassettes, each expression cassette further comprising one or more polynucleotide sequences encoding the MND promoter, SV40 polyA, 5' homology arm, and 3' homology arm. In some embodiments, the engineered cell preparation is genetically modified to express one or more transgenes or variants thereof from one or more expression cassettes, each expression cassette further comprising one or more polynucleotide sequences encoding the EF-1a promoter, WPRE enhancer, BGH polyA, 5' homology arm, and 3' homology arm. In some embodiments, the engineered cell preparation is genetically modified to express one or more transgenes or variants thereof from one or more expression cassettes, each expression cassette further comprising one or more polynucleotide sequences encoding the EF-1a promoter, BGH polyA, a 5' homology arm, and a 3' homology arm.
[0210] production This disclosure describes the production of certain genetically modified B-lineage cell preparations. As disclosed herein, in some embodiments, the B-lineage cell preparation comprises both modified and unmodified cells. In some embodiments, the modified B-lineage cell population comprises plasmablasts. In some embodiments, the modified B-lineage cell population comprises plasma cells. In some embodiments, the modified B-lineage cell population comprises long-lived plasma cells. In some embodiments, the modified B-lineage cell population comprises plasmablasts, plasma cells, and / or long-lived plasma cells as disclosed herein, and / or any mixture or combination thereof.
[0211] Plasma blast preparations In some embodiments, the engineered B-lineage cell preparation includes plasmablasts. As understood in the Art, plasmablasts are rapidly generated, short-lived effector cells in the early stages of an antibody response. Plasmablasts can be prepared from activated B-lineage cells using the methods described herein. In some embodiments, engineered plasmablasts can be prepared from engineered activated B-lineage cells.
[0212] In some embodiments, a population of plasmablasts may be contacted with a culture medium containing one or more components of the present disclosure (e.g., IL-6, IL-15, and / or IFNα-2β) to initiate differentiation into a population of plasma cells. In some embodiments, a method for differentiating a population of plasmablasts into a population of plasma cells includes contacting the population of plasmablasts with a culture medium containing one or more cytokines (e.g., IL-6, IL-15, and / or IFNα-2β). In some embodiments, a method for differentiating a population of plasmablasts into a population of plasma cells involves contacting the population of plasmablasts with a culture medium containing at least about 0.5 ng / mL, 1 ng / mL, 1.5 ng / mL, 2 ng / mL, 2.5 ng / mL, 3 ng / mL, 3.5 ng / mL, 4 ng / mL, 4.5 ng / mL, 5 ng / mL, 10 ng / mL, 15 ng / mL, 20 ng / mL, 25 ng / mL, 30 ng / mL, 35 ng / mL, 40 ng / mL, 45 ng / mL, 50 ng / mL, 55 ng / mL, 60 ng / mL, 65 ng / mL, 70 ng / mL, 75 ng / mL, 80 ng / mL, 85 ng / mL, 90 ng / mL, 95 ng / mL, or ng / mL of one or more cytokines (e.g., IL-6, IL-15, and / or IFNα-2β).
[0213] In some embodiments, a method for differentiating a population of plasmablasts into a population of plasma cells includes the step of contacting the cells with a medium containing one or more components of the present disclosure for at least 1, 2, 3, or 4 days. In some embodiments, a method for differentiating a population of plasmablasts into a population of plasma cells includes the step of contacting the population of plasmablasts with a medium containing one or more cytokines (e.g., IL-6, IL-15, and / or IFNα-2β) for at least 1, 2, 3, or 4 days. In some embodiments, a method for differentiating a population of plasmablasts into a population of plasma cells includes the step of contacting the population of plasmablasts with a medium containing one or more cytokines (e.g., IL-6, IL-15, and / or IFNα-2β) for at least 3 days. In some embodiments, a method for differentiating a population of plasmablasts into a population of plasma cells includes the step of contacting the population of plasmablasts with a medium containing one or more cytokines (e.g., IL-6, IL-15, and / or IFNα-2β) for at least 3 days, followed by a step of cell isolation. In some embodiments, a method for differentiating a population of plasmablasts into a population of plasma cells includes the steps of contacting the plasmablasts with a culture medium containing one or more cytokines (e.g., IL-6, IL-15, and / or IFNα-2β) for at least three days, followed by the step of administration to a subject.
[0214] Plasma cell preparations In some embodiments, the engineered B-lineage cell preparation includes a population of plasma cells. In some embodiments, the plasma cell population includes predetermined engineered plasma progenitor cells (e.g., plasmablasts) that further differentiate into a mature plasma cell population when administered to a subject. As understood in the Art, a mature plasma cell population includes non-dividing cells in a quiescent state of humoral immune response that can secrete large amounts of antibodies. In some embodiments, the mature plasma cell population may include short-lived plasma cells and / or long-lived plasma cells (LLPCs) and / or any combination thereof.
[0215] Characterization This disclosure provides various methods for characterizing an engineered cell population (e.g., a B-lineage cell population). In some embodiments, the methods disclosed herein are used to isolate and / or characterize a subpopulation of naive B cells within a B-lineage cell population. In some embodiments, the naive B cell subpopulation is characterized by one or more of the following: flow cytometry, fluorescence-activated cell sorting (FACS), magnetic-activated cell sorting (MACS), and / or affinity chromatography. In some embodiments, one or more methods for characterizing the naive B cell subpopulation are used during each step of the controlled cooling process. In some embodiments, the characterization methods are used to isolate and / or characterize an engineered naive B cell subpopulation. In some embodiments, the engineered naive B cell subpopulation is characterized by one or more of the following: flow cytometry, fluorescence-activated cell sorting (FACS), magnetic-activated cell sorting (MACS), and / or affinity chromatography. In some embodiments, one or more methods for characterizing the engineered naive B cell subpopulation are used between each step of the controlled cooling process.
[0216] In some embodiments, the methods disclosed herein are used to isolate and / or characterize activated B-series cell subpopulations within a B-series cell population. In some embodiments, the activated B-series cell subpopulations are characterized by one or more of the following: flow cytometry, fluorescence-activated cell sorting (FACS), magnetic-activated cell sorting (MACS), and / or affinity chromatography. In some embodiments, one or more methods for characterizing the activated B-series cell subpopulations are used between each step of the controlled cooling method. In some embodiments, the methods disclosed herein are used to isolate and / or characterize the manipulated activated B-series cell subpopulations. In some embodiments, the manipulated activated B-series cell subpopulations are characterized by one or more of the following: flow cytometry, fluorescence-activated cell sorting (FACS), magnetic-activated cell sorting (MACS), and / or affinity chromatography. In some embodiments, one or more methods for characterizing the manipulated activated B-series cell subpopulations are used between each step of the controlled cooling method.
[0217] In some embodiments, the methods disclosed herein are used to isolate and / or characterize a subpopulation of plasmablasts within a B-lineage cell population. In some embodiments, the plasmablast subpopulation is characterized by one or more of the following: flow cytometry, fluorescence-activated cell sorting (FACS), magnetic-activated cell sorting (MACS), and / or affinity chromatography. In some embodiments, one or more methods for characterizing the plasmablast subpopulation are used between each step of the controlled cooling process. In some embodiments, the methods disclosed herein are used to isolate and / or characterize the manipulated plasmablast subpopulation. In some embodiments, the manipulated plasmablast subpopulation is characterized by one or more of the following: flow cytometry, fluorescence-activated cell sorting (FACS), magnetic-activated cell sorting (MACS), and / or affinity chromatography. In some embodiments, one or more methods for characterizing the manipulated plasmablast subpopulation are used between each step of the controlled cooling process.
[0218] In some embodiments, the methods disclosed herein are used to isolate and / or characterize a subpopulation of plasma cell precursors within a B-lineage cell population. In some embodiments, the plasma progenitor cell subpopulation is characterized by one or more of the following: flow cytometry, fluorescence-activated cell sorting (FACS), magnetic-activated cell sorting (MACS), and / or affinity chromatography. In some embodiments, one or more methods for characterizing the plasma progenitor cell subpopulation are used between each step of the controlled cooling process. In some embodiments, the methods disclosed herein are used to isolate and / or characterize a subpopulation of plasma cell precursors. In some embodiments, the manipulated plasma progenitor cell subpopulation is characterized by one or more of the following: flow cytometry, fluorescence-activated cell sorting (FACS), magnetic-activated cell sorting (MACS), and / or affinity chromatography. In some embodiments, one or more methods for characterizing the manipulated plasma progenitor cell subpopulation are used between each step of the controlled cooling process.
[0219] In some embodiments, the methods disclosed herein are used to isolate and / or characterize a subpopulation of plasma cells within a B-lineage cell population. In some embodiments, the plasma cell subpopulation may be characterized by one or more of the following: flow cytometry, fluorescence-activated cell sorting (FACS), magnetically activated cell sorting (MACS), and / or affinity chromatography. In some embodiments, one or more methods for characterizing the plasma cell subpopulation are used between each step of the controlled cooling process. In some embodiments, the methods disclosed herein are used to isolate and / or characterize the manipulated plasma cell subpopulation. In some embodiments, the manipulated plasma cell subpopulation is characterized by one or more of the following: flow cytometry, fluorescence-activated cell sorting (FACS), magnetically activated cell sorting (MACS), and / or affinity chromatography. In some embodiments, one or more methods for characterizing the manipulated plasma cell subpopulation are used between each step of the controlled cooling process.
[0220] In some embodiments, the methods disclosed herein are used to isolate and / or characterize a population of short-lived plasma cells within a B-lineage cell population. In some embodiments, the short-lived plasma cell subpopulation is characterized by one or more of the following: flow cytometry, fluorescence-activated cell sorting (FACS), magnetic-activated cell sorting (MACS), and / or affinity chromatography. In some embodiments, one or more methods for characterizing the short-lived plasma cell subpopulation are used between each step of the controlled cooling method. In some embodiments, the methods disclosed herein are used to isolate and / or characterize the manipulated short-lived plasma cell subpopulation. In some embodiments, the manipulated short-lived plasma cell subpopulation is characterized by one or more of the following: flow cytometry, fluorescence-activated cell sorting (FACS), magnetic-activated cell sorting (MACS), and / or affinity chromatography. In some embodiments, one or more methods for characterizing the manipulated short-lived plasma cell subpopulation are used between each step of the controlled cooling method.
[0221] In some embodiments, the methods disclosed herein may be used to isolate and / or characterize a subpopulation of long-lived plasma cells, including a B-lineage cell population. In some embodiments, the long-lived plasma cell subpopulation is characterized by one or more of the following: flow cytometry, fluorescence-activated cell sorting (FACS), magnetic-activated cell sorting (MACS), and / or affinity chromatography. In some embodiments, one or more methods for characterizing the long-lived plasma cell subpopulation are used between each step of the controlled cooling method. In some embodiments, the methods disclosed herein are used to isolate and / or characterize the manipulated long-lived plasma cell subpopulation. In some embodiments, the manipulated long-lived plasma cell subpopulation is characterized by one or more of the following: flow cytometry, fluorescence-activated cell sorting (FACS), magnetic-activated cell sorting (MACS), and / or affinity chromatography. In some embodiments, one or more methods for characterizing the manipulated long-lived plasma cell subpopulation are used between each step of the controlled cooling method.
[0222] Treatment method This disclosure provides, in particular, a method for treating a disease, disorder, or condition in a subject (e.g., a disease, disorder, or condition described herein), comprising administering a pharmaceutical composition described herein. In some embodiments, a therapeutically effective amount of a pharmaceutical composition described herein is administered to a subject having the disease or disorder. The pharmaceutical compositions described herein may be for use in the manufacture of a pharmaceutical for treating a disease, disorder, or condition in a subject (e.g., a disease, disorder, or condition described herein).
[0223] The pharmaceutical compositions described herein may comprise one or more B-lineage cells selected from the genetically modified B-lineage cell population described herein. In some embodiments, the B-lineage cell population is manipulated to express or contain one or more payloads. In some embodiments, the payload is or comprises an expression cassette. In some embodiments, the expression cassette comprises a transgene (e.g., SMPD1, factor IX, blinatumomab, etc.).
[0224] The subjects treated by the methods described herein may be mammals, e.g., primates, e.g., humans (e.g., patients having or at risk of having any of the diseases, disorders, or conditions described herein). In some embodiments, the subjects may be adult subjects. In some embodiments, the manipulated B-lineage cells are administered to pediatric subjects.
[0225] The pharmaceutical compositions described herein can be administered in any convenient manner (e.g., by injection, ingestion, infusion, inhalation, implantation, or transplantation). In some embodiments, the pharmaceutical compositions described herein are administered by injection or infusion. The pharmaceutical compositions disclosed herein may be administered to a subject intravenously, intra-arterially, subcutaneously, intradermally, intratumorally, intranodally, intramedullarily, intramuscularly, or intraperitoneally. In some embodiments, the pharmaceutical compositions described herein are administered parenterally (e.g., intravenously, subcutaneously, intraperitoneally, or intramuscularly). In some embodiments, the pharmaceutical compositions described herein are administered by intravenous infusion or injection. In some embodiments, the pharmaceutical compositions described herein are administered by intramuscular or subcutaneous injection. In some embodiments, the pharmaceutical compositions described herein are administered directly to central nervous system (CNS) tissue.
[0226] In some embodiments, the pharmaceutical compositions described herein are administered in a pharmaceutically suitable dose to the subject. In some embodiments, the pharmaceutical compositions described herein are administered monthly. In some embodiments, the pharmaceutical compositions described herein are administered once every two months. In some embodiments, the pharmaceutical compositions described herein are administered once every three months. In some embodiments, the pharmaceutical compositions described herein are administered once every six months. In some embodiments, the pharmaceutical compositions described herein are administered once a year.
[0227] In some embodiments, the methods disclosed herein include measuring and / or monitoring treatment. In some embodiments, the sample is collected from a subject treated with the pharmaceutical composition described herein. In some embodiments, sample collection is or includes venipuncture. In some embodiments, sample collection is or includes tissue collection. In some embodiments, levels of proteins (e.g., SMPD1, factor IX, blinatumomab, etc.) are measured from the sample collection. In some embodiments, lipids are evaluated from the collected sample.
[0228] In some embodiments, the engraftment of one or more B-lineage cells from the genetically modified B-lineage cell population described herein is measured in a non-clinical species (e.g., hIL6- / NOG mice). In some embodiments, engraftment is measured using bioluminescence. In some embodiments, engraftment is measured using ELISpot. In some embodiments, plasma IgG levels are determined to measure engraftment. In some embodiments, plasma IgM levels are determined to measure engraftment. In some embodiments, levels of transgenes (e.g., SMPD1, factor IX, blinatumomab, etc.) are determined to measure engraftment. In some embodiments, the engraftment of one or more B-lineage cells from the genetically modified B-lineage cell population described herein occurs in a non-clinical species (e.g., hIL6- / NOG mice) with or without pre-conditioning of the non-clinical subject (e.g., chemotherapy, immunosuppressive therapy, etc.) (Cheng et al. 2022). In some embodiments, engraftment of one or more B-lineage cells from the genetically modified B-lineage cell population described herein occurs in a clinical species (e.g., a human subject) whether or not the human subject has been pre-conditioned (e.g., with chemotherapy, immunosuppressive therapy, etc.). [Examples]
[0229] The following examples are provided to those skilled in the art to illustrate how the methods and compositions described herein are prepared and used, and are not intended to limit the scope of this disclosure.
[0230] Example 1: Materials and Method This example demonstrates exemplary materials and methods that can be implemented for the preparation, generation, and analysis of certain cell populations, including, but not limited to, B cell populations. The cell population can include a B cell population or be a B cell population. The B cell population can include or be naive B cells. The B cell population can include or be activated B cells. The B cell population can include or be plasmablasts. The B cell population can include or be plasma cells.
[0231] CRISPR Inference of CRISPR Editing (ICE) Seventy-two hours after electroporation, cells were harvested from unmanipulated controls (reference templates) and conditions where only ribonucleoprotein (RNP) was manipulated. Genomic DNA was extracted using the Maxwell DNA extraction kit, quantified with a NanoDrop spectrophotometer, and then normalized to 16.5 ng / mL. Primers specific to the CRISPR sgRNA site were designed such that the target cleavage site was approximately 200 bp downstream of the sequencing primer and approximately 600 bp upstream of the amplicon end. PCR amplification was performed using Q5 HiFi Hot start 2x MasterMix and the recommended thermal cycler program. Non-template controls were included. The amplicon size was checked using the Lonza FlashGel system and shipped for Sanger Sequencing. Analysis of the Sanger sequence trace was performed using the Synthego ICE analysis method run on an internal server.
[0232] ICE Forward Primer for CCR5: GCAGCAAACCTTCCCTTCACTAC (SEQ ID NO: 1)
[0233] ICE Reverse Primer for CCR5: AGGATTCCCGAGTAGCAGATGAC (SEQ ID NO: 2)
[0234] ICE Sequencing Primer for CCR5: GGGTGGAACAAGATGGATTATC (SEQ ID NO: 3)
[0235] ICE forward primer for B2M: AGGACCTTCTCTGAGCTGTC
[0236] ICE reverse primer and sequencing primer for B2M: GCCCTAAACTTTGTCCCGAC
[0237] Droplet digital polymerase chain reaction (ddPCR) ddPCR enables quantification of the target integration efficiency as follows: copies / μL of HDR-edited allele (FAM-positive droplets) / copies / μL of reference allele (HEX-positive cells) * 100 = target integration %
[0238] For the integration site amplicon, one primer is outside the homology arm and the other primer is inside the transgene. Therefore, the amplicon is generated only when a genomic integration event occurs. The reference amplicon is ideally of a similar size and is generated from either a distal region on the same locus or a reference gene. The amplicon primers were designed using the IDT PrimerQuest tool, and the ddPCR probes were designed according to the following rules.
[0239] 1) A probe labeled with FAM was designed inside the integration site amplicon sequence and close to one of the two primers used for the integration site amplicon.
[0240] 2) A probe labeled with HEX was designed inside the reference amplicon sequence and close to one of the two primers used for the reference amplicon.
[0241] 5) Including two controls: non-template control (to exclude contamination), unedited cells (to confirm specificity)
[0242] The reaction mixture (including repeats) of the probe (without dUTP, BioRad) and the ddPCR Supermix were equilibrated to room temperature. Droplets were generated using an Automated Droplet Generator QX200 according to the manufacturer's instructions (BioRad). The reaction was then run using the C1000 Touch Thermal Cycler program recommended for the amplicon length. The samples were then read on the QX200 Droplet Reader (BioRad) and analyzed on a 2D amplitude plot (dot plot) to distinguish between negative, single-positive, and double-positive droplets. Thresholding was performed by calculating the threshold as follows: mean negative droplet intensity + 0.1 × (mean positive droplet intensity - mean negative droplet intensity) = threshold.
[0243] Next, based on the adjusted threshold and the FAM and HEX copies / uL, the target integration percentage was calculated using the equation above.
[0244] The following CCR5 target gene primers and probes were used:
[0245] CCR5 ddPCR forward primer: catcgcattgtctgagtagg (SEQ ID NO: 4)
[0246] CCR5 ddPCR reverse primer: CAGTGGATCGGGTGTAAAC (SEQ ID NO: 5)
[0247] CCR5_ddPCR probe (FAM): TCGGGAGCCTCTTGCTGGAAAATAGAA (Sequence ID 6)
[0248] The following CCRL2 reference gene primers and probes were used:
[0249] CCRL2_ddPCR forward primer: CCACATCAGAAGGAAGACTAC (SEQ ID NO: 7)
[0250] CCRL2_ddPCR reverse primer: GCTGTATGAATCCAGGTCC (SEQ ID NO: 8)
[0251] CCRL2_ddPCR probe (HEX): TGTTTCCTCCAGGATAAGGCAGCTGT (SEQ ID NO: 9)
[0252] Cell number and viability After thorough resuspension by gentle pipetting, cells were sampled for the CellacaMx counter. The cells were gently mixed with appropriate dilutions of AOPI dye, loaded into Nexcelom counting plates, and analyzed for number and viability based on acquired images and dilution ratios.
[0253] Flow cytometry analysis After resuspending the cell sample, 2 × 10 5Cells were set aside for flow cytometry analysis. The samples were washed and stained with antibody cocktails focused on immunocytopurity (markers: CD19, CD20, CD16, CD56, CD3, CD14, CD45), B-lineage cell phenotype (markers: CD19, CD20, CXCR4, CD27, CD38, CD138), HLA phenotype (HLA-A / B / C, HLA-E, HLA-G), or Ig profiling (markers: CD38, CD138, IgM, IgG, IgE, IgA). Cells were washed once with PBS and then stained with LIVE / DEAD Fixable Near-IR Dead Cell Stain (Life Technologies) at room temperature for 10 minutes. Cells were washed with Flow Cytometry Staining Buffer (eBioscience) and resuspended in Human TruStain FcX (BioLegend). After Fc blocking at 4°C for 5 minutes, the samples were resuspended in 100 μL of antibody cocktail master mix. The samples were incubated in the dark at 4°C for 20 minutes, then washed twice, and subsequently resuspended in 400 μL of staining buffer for capture in a flow cytometer. Monochromatic controls for voltage, gating, and compensation were also prepared. After compensation guided by prompts in NovoCyte software, over 10,000 cell events were acquired per sample. The files were saved and imported into FlowJo. Live cell singlets were further gated in this software, and then population percentages, total number of events, and geometric mean fluorescence intensity values were exported, formatted, and statistically analyzed.
[0254] For IgM / IgG profiling, intracellular staining was performed using cell fixation and permeabilization. After the last wash from viability staining, cells were suspended in fixation buffer (4% paraformaldehyde) and incubated for 20 minutes at room temperature. Cells were then washed three times with Permeabilization Buffer (eBioscience) and then resuspended in Ig profiling antibody master mix (dilutions used were as recommended by the manufacturer). Samples were protected from light and incubated for 20 minutes at room temperature and then washed twice with Permeabilization Buffer. Pellets were resuspended in staining buffer for fresh cell staining and analyzed by forward / side scatter gating adjusted for post-fixation cell shrinkage.
[0255] ELISA for Detecting Human FIX from Engineered B Cell Populations Supernatants from engineered B cell populations were collected from relevant experiments and frozen at -80 °C before testing. Samples were then tested for the concentration of human factor IX (hFIX) using a 96-well FIX ELISA (Abcam - ab108831). Briefly, all kit components, samples, and standards were thawed and equilibrated to room temperature. 50 μL of sample or standard was added to each well of a pre-coated plate and then incubated for 2 hours at room temperature. After incubation, the plate was washed 5 times with 200 μL of 1x wash buffer. Next, 50 μL of 1x biotinylated FIX detection antibody was added to each well and incubated for 1 hour at room temperature. The plate was then washed and 50 μL of 1x SP conjugate was added to each well. After addition of the 1x SP conjugate, the plate was then incubated for 30 minutes at room temperature. After one more plate wash, 50 μL of chromogenic substrate was added to each well and incubated for 10 minutes at room temperature. After the wells had developed color, 50 μL of stop solution was added to quench. The absorbance of the plate was read at 450 nm and 570 nm using a Cytation5 plate reader. Sample values were interpolated using standards of known hFIX concentration.
[0256] Example 2: Simultaneous multiplex editing at two gene loci in a B-lineage cell population expressing multiple proteins This embodiment demonstrates that a B-lineage cell population can be simultaneously manipulated at multiple distinct gene loci to express one or more proteins of interest.
[0257] As described in this disclosure and in whole incorporated herein by reference in WO2018 / 170150 or US2018 / 0282692, B-lineage cells were cultured and manipulated with CRISPR / Cas9. In the multiplexed editing reaction, two guides were combined with the Cas9 protein. By optimizing the relative amounts of a given pair of guides in the multiplexed reaction, it is possible to ensure that optimal editing is achieved at both loci. As shown in Figure 1B, when the CCR5 guide was combined with one of five different B2M guides in a 1:1 sgRNA:sgRNA ratio, the DNA editing efficiency at the CCR5 locus was reduced compared to the editing reaction using a single guide. In Figures 1B and 1C, gRNA1 is the CCR5 targeting guide RNA and gRNA2 is the B2M targeting guide RNA.
[0258] Certain data are presented in Figures 2, 3, 4, and 5, demonstrating that multiplexing of a B-lineage cell population can disrupt the expression and / or secretion of endogenous gene products (e.g., B2M, CCR5, etc.) while enabling the expression of one or more transgenes (e.g., one or more HLA proteins, including GFP, FIX, e.g., HLA-E, etc.). In some embodiments, a multiplexed B-lineage cell population can demonstrate equivalent IgH and / or IgA expression compared to a reference (e.g., an unmanipulated B-lineage cell population). In some embodiments, a multiplexed B-lineage cell population can demonstrate transgene integration at one or more loci that is equivalent to a reference (e.g., transgene integration observed at a single locus of a B-lineage cell without multiplexing editing) (Figure 3A). In some embodiments, the integration efficiency of a multiplexed B-lineage cell population can be altered through the optimization of one or more factors (e.g., guide RNA:Cas9 ratio, target locus, culture method, cell medium, etc.). In some embodiments, multiplexed B-lineage cells can preferentially expand within the manipulated B-lineage cell population.
[0259] Example 3: Sequential multiplex editing at two gene loci in a B-lineage cell population expressing one or more proteins This embodiment demonstrates that a B-lineage cell population can be sequentially manipulated at multiple distinct loci to express one or more proteins of interest, including one or more antibody drugs.
[0260] Figure 6 presents specific data comparing the integration efficiency of multiplexed B-lineage cell populations through simultaneous and sequential manipulation at multiple target loci. In some embodiments, sequentially multiplexed B-lineage cell populations can provide comparable integration efficiency to a reference population (e.g., an unmanipulated B-lineage cell population, a simultaneously multiplexed B-lineage cell population). In some embodiments, sequentially multiplexed lineage cell populations can provide a reduction in the number of gene translocation events compared to a reference population (e.g., a simultaneously multiplexed B-lineage cell population).
[0261] Example 4: Method for producing manipulated B-lineage cells with allogeneic characteristics This embodiment demonstrates that B-lineage cell populations can be manipulated to improve one or more allogeneic traits (e.g., reduced immune response). In some embodiments, B-lineage cell populations are manipulated simultaneously at multiple distinct loci to express one or more proteins of interest.
[0262] B-lineage cells were cultured and manipulated with CRISPR / Cas9 as described in this disclosure and WO2018 / 170150 or US2018 / 0282692, each of which is incorporated herein by reference in whole.
[0263] As outlined in Figure 7, B-lineage cells were edited at both the CCR5 and B2M loci to express the MND promoter and LUC transgene at the CCR5 locus, and the EF1a promoter and HLA-E at the B2M locus. The B-lineage cell populations were cultured and differentiated into plasma cell populations as described herein. Multiplexed plasma cell populations containing the MND promoter, LUC transgene, and BGH polyA at the CCR5 locus, and the EF1a promoter, HLA-E transgene, and SV40 polyA at the B2M locus were administered to mice (humanized and NOG-IL6 mice). A second manipulated plasma cell population ("control") containing the MND promoter, LUC transgene, and BGH polyA at the CCR5 locus was also administered to mice. Treated mice were monitored for 6 weeks post-administration to monitor engraftment and persistence of the administered manipulated B-lineage cell populations (Figure 8). At 6 weeks, mice treated with a multiply engineered plasma cell population demonstrated greater persistence in the spleen and bone marrow compared to control mice treated with a control engineered plasma cell population.
[0264] As outlined in Figure 9A, B-lineage cells were manipulated at multiple distinct loci, and the percentage of GFP-expressing cells and the percentage of cells expressing HLA-E and / or HLA-ABC cells within the GFP-expressing population were evaluated. B-lineage cells were manipulated to contain expression cassettes containing bicistronic HLA-E and LUC in CCR5 and GFP in B2M ("Bicis HLA-E"), expression cassettes containing bicistronic HLA-E and LUC only in CCR5 ("control"), or expression cassettes containing bicistronic HLA-E and LUC in CCR5 combined with B2M expression knockout ("Bicis-HLA-E"). As shown in Figure 9B, Bicis HLA-E manipulated B-lineage cells demonstrated reduced T cell activation and T cell proliferation. As shown in Figure 9C, Bicis HLA-E manipulated B-lineage cells also demonstrated increased resistance to NK cell targeting compared to B2M KO BCMs.
[0265] As outlined in Figure 10A, B-lineage cells were manipulated at multiple distinct loci, and integration efficiency at CCR5, the percentage of GFP-expressing cells, and the percentage of cells expressing FIX within the GFP-expressing population were evaluated. B-lineage cells were manipulated to include expression cassettes containing bicistronic HLA-E and FIX at CCR5 and a GFP transgene at B2M ("Bicis HLA-E"), or an expression cassette containing only FIX-GFP ("control"), an expression cassette containing FIX-GFP combined with B2M knockout ("B2M- / -BCM"), or an expression cassette containing FIX at CCR5 ("control'"). As outlined in Figure 10B, the manipulated B-lineage cells were evaluated for real-time killing and competitive survival when co-cultured with NK cells. FIX activity was also evaluated for control' and Bicis HLA-E gene-manipulated B-lineage cells. Bicis HLA-E modified B-lineage cells were able to produce functional FIX and demonstrated some degree of resistance to NK cell killing.
[0266] As outlined in Figures 11A, 11B, 11C, 11D, 11E, 11F, 11G, and 11H, various conditions for CRISPR / Cas9 gene editing can result in efficient editing at multiple loci in B-lineage cells. In some embodiments, B-lineage cells can be edited at two or more sites (e.g., CCR5, TAP, TAP2, TAPBP, etc.). In some embodiments, B-lineage cells can be edited at three or more sites (e.g., CCR5, TAP, TAP2, TAPBP, etc.).
[0267] As outlined in Figure 12A, engineered B-lineage cells were evaluated for the efficiency of integration and / or knockout at one or more loci. The percentage of GFP-positive cells and knockout efficiency were assessed for B-lineage cells engineered to contain a GFP transgene in CCR5 (control), and for cells engineered to contain a GFP transgene in CCR5, B2M knockout, and CD58 knockout (B2M / CD58 DKO). As outlined in Figure 12B, B2M / CD58 DKO engineered B-lineage cells demonstrated improved T cell resistance compared to other methods. As outlined in Figure 12C, the B2M / CD58 DKO engineered B-lineage cell population demonstrated some degree of improved NK cell resistance compared to other engineered B-lineage cell populations.
[0268] As outlined in Figure 13A, engineered B-lineage cells were evaluated for integration efficiency in CCR5, GFP-positive cell percentage, and CD58-positive cell percentage. As outlined in Figure 13B, engineered B-lineage cells were evaluated for T cell resistance. Measurements were performed on B-lineage cells engineered to contain FIX-GFP transgene (control), FIX-GFP transgene and CD58 knockout (CD58 KO), or FIX-GFP transgene and B2M knockout (D13 B2M- / -BCM) in CCR5, as shown. As outlined in Figure 13B, CD25 MFI was evaluated between CD8+ cell populations for the engineered B-lineage cell populations and unengineered primary B cells on day 2. FIX activity was also evaluated for the control and CD58 KO engineered B-lineage cell populations. Culture timing is described with the culture start day as day 0.
[0269] As outlined in Figure 14A, engineered B-lineage cells were evaluated for MHC-I, MHC-II, and HLA-E expression. As shown, B-lineage cells were engineered to contain the GFP transgene in CCR5, either alone (control) or in combination with one of the following: TAP2 knockout (TAP2 KO), TAP2 and TAPBP knockout (TAP2 / TAPBP KO), NLRC5 knockout (NLRC5 KO), RFX5 knockout (RFX5 KO), or B2M knockout (B2M KO). Unengineered primary B cells on day 3 were also evaluated. As outlined in Figure 14B, the engineered B-lineage cell populations were evaluated for T cell resistance. As outlined in Figure 14C, the engineered B-lineage cell populations were evaluated for NK cell resistance.
[0270] As outlined in Figure 15A, the integration efficiency of the engineered B-lineage cells was evaluated. As shown, B-lineage cells were engineered to include CCR5 with FIX-GFP transgene (control), CCR5 with FIX-GFP transgene and B2M knockout (B2M KO), CCR5 with FIX-GFP transgene and NLRC5 knockout (NLRC5 KO), CCR5 with FIX-GFP transgene and CD58 knockout (CD58 KO), CCR5 with FIX-GFP transgene and NLRC5 and CD58 knockout (NLRC5 / CD58 DKO), CCR5 with bicistronic FIX transgene and HLA-E transgene, and B2M with GFP transgene (Bicis HLA-E), or CCR5 with FIX transgene (control'). As outlined in Figures 15B and 15C, protein expression and engineering efficiency were evaluated for various engineered B-cell populations. As shown in Figures 15D and 15E, NK cell resistance and T cell resistance were also evaluated for the manipulated B-lineage cell populations. Certain manipulated B-lineage cell populations exhibited relatively moderate to high NK cell resistance. Certain manipulated B-lineage cell populations exhibited moderate to high T cell resistance.
[0271] As outlined in Figure 16, engineered B-lineage cells were evaluated for integration efficiency, secretion levels, and FIX activity. As shown, B-lineage cells were engineered to contain FIX transgene in CCR5 (control), FIX transgene in CCR5 and B2M knockout (B2M KO), FIX transgene in CCR5 and NLRC5 knockout (NLRC5 KO), or FIX transgene in CCR5, along with B2M and CD58 knockout (B2M / CD58 DKO).
[0272] As outlined in Figure 17, engineered B-lineage cells were evaluated for integration efficiency, secretion levels, and FIX activity. B-lineage cells were engineered to contain either a FIX transgene in CCR5 (control), or a bicistronic FIX transgene and HLA-E transgene in CCR5, and a GFP transgene (Bicis HLA-E) in B2M.
[0273] As outlined in Figures 20A and 20B, various manipulated B-lineage cells were prepared through single and multiple editing, and their editing efficiency and transgene expression were evaluated.
[0274] In some embodiments, this embodiment demonstrates that B-lineage cells manipulated at multiple distinct loci can engraft in vivo and exhibit sustained expression in vivo (e.g., for more than 6 weeks). In some embodiments, B-lineage cells manipulated at multiple different loci (e.g., CCR5 and B2M) can demonstrate improved engraftment compared to B-lineage cells manipulated at a single locus (e.g., CCR5).
[0275] In some embodiments, B-lineage cell populations engineered to reduce or knock out B2M expression can demonstrate improved allogeneic properties (e.g., reduced immune response, increased in vivo persistence) compared to a reference B-lineage cell population (e.g., an unengineered B-lineage cell population, a B-lineage cell population with reduced B2M expression). In some embodiments, B-lineage cells engineered to express one or more transgenes (e.g., HLA-E) can demonstrate improved allogeneic properties (e.g., reduced immune response, increased in vivo persistence) compared to a reference B-lineage cell population (e.g., an unengineered B-lineage cell population). In some embodiments, B-lineage cells engineered to express one or more transgenes (e.g., HLA-E) and to reduce or knock out B2M expression can demonstrate improved allogeneic properties (e.g., reduced immune response, increased in vivo persistence) compared to a reference B-lineage cell population (e.g., an unengineered B-lineage cell population).
[0276] Example 5: Multiplexed allogeneic delivery including cultured and manipulated B-lineage cell populations results in reduced immunogenicity, increased persistence, and / or improved transgene secretion. This embodiment demonstrates that a B-lineage cell population cultured and (e.g., multiple) engineered in the manner described herein can produce an engineered B-lineage cell population that induces a reduced and increased duration of immunogenic response in a target different from the donor (e.g., allogeneic delivery). In some other embodiments, the cultured B-lineage cell population may or may not be further engineered using the method and expression cassette described herein to produce an engineered B-lineage cell population. In some such embodiments, the engineered B-lineage cell population can further induce a reduced and increased duration of immunogenic response in a target different from the donor (e.g., allogeneic delivery).
[0277] Furthermore, B-lineage cell populations were manipulated using the methods described herein to have either simultaneous or sequential knockout of the B2M and CD58 loci in addition to GFP knock-in in CCR5. On day 13, the percentages of plasmablasts and plasma cells were evaluated compared to a cultured B-lineage cell population (control) in which GFP was knocked in CCR5 alone (Figure 24A). In addition, flow cytometry was used to measure the percentage of live B-lineage cells expressing GFP (Figure 26B), the percentage expressing CD58 (Figure 24C), and the percentage expressing HLA-ABC (Figure 24D).
[0278] Next, B-lineage cell populations were manipulated to include CCR5 with a LUC transgene (control), CCR5 with a bicistronic HLA-E transgene and a LUC transgene (containing 2A peptide) and B2M knockout (Bicis HLA-E), CCR5 with a LUC transgene and NLRC5 knockout (NLRC5 KO), or CCR5 with a LUC transgene and B2M and CD58 knockout (B2M / CD58 DKO). Bioluminescence was measured in vitro for these B-lineage cell populations (Figure 25A). Next, the manipulated B-lineage cell populations were administered to immunodeficient mouse models, with or without pre-engrafted NK cells. Bioluminescence was then measured in these mouse models (Figures 25B, 25C, and 25D).
[0279] Additional in vivo administration experiments were performed, including the administration of the B-lineage cell population (control, B2M KO, Bicis HLA-E, NLRC5 KO, and B2M / CD58 DKO) to either the hCD34-NSG-IL15 mouse model or the NOG-IL6 mouse model, and bioluminescence over time was evaluated as outlined in Figures 26A and 26B.
[0280] Furthermore, the effects of multiple manipulation of two different donor B-lineage cell populations on factor IX (FIX) integration and secretion were evaluated using the following conditions: RNP alone, CCR5 with FIX transgene (control), CCR5 with FIX transgene and B2M knockout (B2M KO), CCR5 with FIX transgene and NLRC5 knockout (NLRC5 KO), CCR5 with FIX transgene and RFX5 knockout (RFX5 KO), or CCR5 with FIX transgene, and B2M and CD58 knockout (B2M / CD58 DKO). FIX secretion and activity were measured and evaluated using the ELISA and capture chromogenic assays described in Example 1 (Figure 27).
[0281] In particular, this disclosure demonstrates that multiplexed B-lineage cell populations can provide equivalent or improved integration efficiency compared to a reference (e.g., an unmanipulated B-lineage cell population, an alternatively manipulated B-lineage cell population). In some embodiments, multiplexed lineage cell populations can provide a reduction in the number of gene translocation events compared to a reference (e.g., an alternatively manipulated B-lineage cell population). In some embodiments, multiplexed B-lineage cell populations can provide equivalent or not significantly reduced engraftment and / or transgene expression (e.g., SMPD1, FIX, luciferase) after administration to a subject compared to a reference condition. In some embodiments, the multiplexed B-lineage cell populations described herein can provide improved engraftment and / or transgene expression compared to a reference condition. In some embodiments, the multiplexed B-lineage cell populations described herein can engraft and / or express transgenes for a long period (e.g., 36 days). In some embodiments, the multiplexed B-lineage cells may further include plasmablasts and plasma cells, and may have sustained viability. In some embodiments, a multiplexed B-lineage cell population may have a reduced immunogenic response compared to a reference condition (e.g., an unmanipulated B-lineage cell population or an alternatively manipulated B-lineage cell population). Example sequence [Table 1-1] [Table 1-2] [Table 1-3] [Table 1-4] [Table 2-1] [Table 2-2] Table 2-3 Table 2-4 Table 2-5 Table 2-6 Table 2-7 Table 2-8 Table 2-9 Table 2-10 Table 2-11 Table 2-12 Table 2-13 Table 2-14 Table 2-15 Table 2-16 Table 2-17 Table 2-18 Table 2-19 Table 2-20 Table 2-21 Table 2-22 Table 2-23 Table 2-24 Table 2-25 Table 2-26 Table 2-27 Table 2-28 Table 2-29 Table 2-30 Table 2-31 Table 3 Table 4-1 Table 4-2 Table 4-3 Table 4-4 Table 4-5 Table 4-6 Table 4-7 Table 4-8 Table 4-9 Table 4-10 Table 5 Table 6 References Hung et.Al., Molecular Therapy, 2018,: https: / / doi.org / 10.1016 / j.ymthe.2017.11.012. Maruo et.Al.,Trends in Molecular Medicine,2014,10.1016 / j.molmed.2014.09.003. NIH, Niemann Pick Disease, Accessed: 2023, https: / / www.ninds.nih.gov / health-information / disorders / niemann-pick-disease. Qui et.Al.,Journal of Biological Chemistry,2003,10.1074 / jbc.M303022200. Schuchman, EH, and Desnick, RJ, 2001. Niemann-Pick disease types A and B: acid sphingomyelinase deficiencies. In The Metabolic and Molecular Bases of Inherited Disease, 8 th edn. (Scriver, CR, Beaudet, AL, Sly, WS, and Valle, D., eds; Childs, B., Kinzler, KW, and Vogelstein, B., assoc. eds.), pp. 3589. McGraw-Hill, New York. Schuchman, EH,. FEBS Letters, 2009: https: / / doi.org / 10.1016 / j.febslet.2009.11.083.
[0282] Equal parts Those skilled in the art will understand that various modifications, alterations, and improvements to the present disclosure will be readily conceivable. Such modifications, alterations, and improvements are intended to be part of the present disclosure and to fall within the spirit and scope of the invention. Accordingly, the foregoing description and drawings are merely examples and constitute any invention described in the present disclosure as described in more detail by the following claims.
[0283] Those skilled in the art will understand typical criteria for deviations or errors resulting from values obtained in assays or other processes described herein. Publications, websites, and other reference materials referenced herein to explain the background of the invention and to provide additional details relating to its practice are incorporated herein by reference in their entirety.
Claims
1. A method for genetically modifying a B-lineage cell population, wherein the method is (a) A step of isolating primary B cells so that a primary B cell population can be obtained, (b) The step of activating the primary B cell population, (c) The first expression cassette containing the first transgene is incorporated into the first target gene locus, (i) A second expression cassette containing the second transgene is incorporated into the second target locus, or (ii) The primary B cell population is duplicated during or after the activation step such that endogenous gene expression at the second target locus is disrupted without the incorporation of the transgene. The method comprising the step of generating a population of genetically modified B-lineage cells.
2. The method according to claim 1, further comprising the step of expanding the genetically modified B-lineage cell population.
3. The method according to claim 1 or 2, further comprising the step of differentiating the genetically modified B-lineage cell population into a population of plasmablasts.
4. The differentiation step involves the genetically modified B-lineage cell population, (a) IL-2, (b) IL-6, (c) IL-10, and / or (d) The method according to claim 3, comprising contacting with a culture medium containing IL-15.
5. The method according to claim 3 or 4, further comprising the step of differentiating the population of plasmablasts into a population of plasma cells.
6. The differentiation step involves the population of plasmablasts, (a) IL-6, (b) IL-15, and / or (c) The method according to claim 5, comprising contacting with a culture medium containing IFN-alpha-2-beta (IFNα-2β).
7. The method according to any one of the prior claims, wherein the first expression cassette and the second expression cassette are brought into contact simultaneously with a primary B-lineage cell population.
8. The method according to any one of the prior claims, wherein the first expression cassette and the second expression cassette are sequentially brought into contact with the primary B-series cell population.
9. The method according to claim 8, wherein the first expression cassette is brought into contact with the primary B-series cell population on the third day of the culture process, the second expression cassette is brought into contact with the primary B-series cell population on the fourth day of the culture process, and the culture process has a start day of day 1.
10. The method according to claim 9, wherein the contact time range of the first expression cassette and the second expression cassette is approximately 24 hours to approximately 144 hours.
11. The expression cassette, (a) A 5' homology arm that is at least 95% identical to the 5' side sequence with respect to the double-strand break site, (b) The method according to claim 7, further comprising: (b) a 3' homology arm which is at least 95% identical to the 3' side arrangement with respect to the double-strand break site.
12. The aforementioned 5' homology arm, (i) Size of approximately 350 to 850 base pairs in length, (ii) PAM site or absence of PAM site, and / or (iii) The method according to claim 11, comprising or having lengths symmetrical or asymmetrical with respect to the 3' homology arm.
13. The 3' homology arm is (i) Size of approximately 350 to 850 base pairs in length, (ii) PAM site or absence of PAM site, and / or (iii) The method according to claim 11 or 12, comprising, or being, lengths symmetrical or asymmetrical with respect to the 5' homology arm.
14. The method according to any one of claims 7 to 13, further comprising an adeno-associated virus (AAV) vector.
15. The method according to any one of the prior claims, wherein the step of the operation comprises contacting the primary B cell population with a target nuclease capable of introducing double-strand breaks.
16. The method according to claim 15, wherein the target nuclease is a CRISPR-related (Cas) protein, a zinc finger nuclease (ZFN), a transcription activator-like effector-based nuclease (TALEN), or a meganuclease, or comprises the same.
17. The method according to claim 15, wherein the Cas protein is Cas9, Cas12a, or Cas13a, or a variant thereof, or comprises the same.
18. The method according to claim 15, wherein the Cas protein forms a complex with guide RNA (gRNA).
19. The method according to claim 18, wherein the gRNA is a single guide RNA (sgRNA).
20. The steps of the above operation are (a) Electroporation of the primary B cell population, and / or (b) The method according to any one of the prior claims, comprising transduction of the primary B cell population using one or more expression cassettes.
21. The electroporation described above, (a) The Cas protein that forms a complex with the gRNA, and (b) The method according to claim 20, which is performed on a composition comprising the primary B cell population.
22. In the steps of the above operation, or afterward, the primary B cell population (a) Electroporation of the primary B cell population, and / or (b) The method according to claim 20 or 21, which may undergo an additional operational step comprising transduction of the primary B cell population using one or more expression cassettes.
23. The method according to any one of the prior claims, wherein the B-series cell population is brought into contact with a culture medium further comprising one or more of the following: XL413, M3814, nocodazole, and / or LAH4.
24. A population of genetically modified B-series cells containing an introduced gene, wherein the introduced gene is expressed from the endogenous CCR5 locus.
25. The population of genetically modified B-lineage cells according to claim 24, wherein the cells express an introduced gene and at least partially disrupt the expression of endogenous CCR5.
26. A population of genetically modified B-series cells containing an introduced gene, wherein the introduced gene is expressed from the endogenous JCHAIN locus.
27. The population of genetically modified B-lineage cells according to claim 26, wherein the cells express the transgene without disrupting the expression of endogenous JCHAIN.
28. A population of genetically modified B-series cells containing an introduced gene, wherein the introduced gene is expressed from the endogenous IgH gene locus.
29. The population of genetically modified B-lineage cells according to claim 28, wherein the cells express the transgene without disrupting the expression of endogenous IgH.
30. A population of genetically modified B-series cells containing an introduced gene, wherein the introduced gene is expressed from the endogenous B2M locus.
31. The population of genetically modified B-lineage cells according to claim 30, wherein the cells express an introduced gene and at least partially disrupt the expression of endogenous B2M.
32. The population of genetically modified B-series cells is a population of genetically modified plasma cells, or a population including such a population, according to any one of claims 26 to 31.
33. The population according to any one of claims 26 to 31, wherein the population of genetically modified B-series cells is a population of plasmablasts, or includes such a population.
34. The population according to claim 33, wherein the population of genetically modified B-series cells is a population of plasma cell precursors, or includes such a population.
35. Using the assay, (a) to (c): (a) Percentage of homology-oriented restorations, (b) Percentage of indels, and / or (c) The method according to any one of the prior claims, further comprising the step of evaluating the amount of one or more reporter proteins.
36. The method according to claim 35, wherein the reporter protein is green fluorescent protein (GFP), blue fluorescent protein (BFP), red fluorescent protein (RFP), and / or luciferase, or comprises the same.
37. The method according to claim 35, wherein the assay comprises or is one or more of the following: fluorescence-activated cell sorting (FAC sorting), Western blotting, flow cytometry, enzyme-linked immunosorbent spot assay (ELISApot), enzyme-linked immunosorbent assay (ELISA), droplet digital PCR (ddPCR), and CRISPR editing inference (ICE).
38. A population of manipulated B-series cells comprising an introduced gene sequence, wherein the introduced gene is incorporated into at least 10% of the cells.
39. The population according to claim 38, wherein the introduced gene is expressed from the endogenous CCR5 locus.
40. A pharmaceutical composition comprising one or more B-lineage cells selected from a population of genetically modified B-lineage cells described in any one of the prior claims, and one or more pharmaceutically acceptable excipients.
41. A method for administering a pharmaceutical composition, wherein the method is (a) A population of B-lineage cells selected from the population of genetically modified B-lineage cells described in any one of the prior claims, (b) a step of administering the pharmaceutical composition comprising one or more pharmaceutically acceptable excipients, The method comprising administering the pharmaceutical composition to a subject.
42. The method according to claim 41, further comprising step (a) selecting a population of B-lineage cells having a high incorporation percentage.
43. The method according to claim 41, wherein the population of B-series cells is characterized by the incorporation of at least 10% of the introduced genes.
44. A method for treating a disease, disorder, or condition in a subject, the method comprising administering a therapeutically effective amount of the pharmaceutical composition according to claim 41 to the subject, thereby treating the disease, disorder, or condition in the subject.
45. The method according to claim 44, wherein the pharmaceutical composition is administered intravenously.
46. The method according to any one of claims 44 to 45, wherein the pharmaceutical composition is administered to an adult.
47. The method according to any one of claims 44 to 45, wherein the pharmaceutical composition is administered to a child.
48. Using the assay, (a) to (f): (a) Presence of CD38 marker, (b) Presence of CD138 marker, (c) Presence of the CD27 marker in at least 50% of living singlet cells, (d) Secretion of at least 0.5 pg / cell / day of IgG, (e) Secretion of at least 2.5 pg / cell / day of IgM, and A method for characterizing a population of manipulated B-lineage cells according to any one of the prior claims, comprising evaluating one or more of the following: (f) secretion of at least 0.5 pg / cell / day of IgD.
49. The method according to claim 48, wherein the assay comprises one or more of the following: fluorescence-activated cell sorting (FAC sorting), Western blotting, flow cytometry, enzyme-linked immunosorbent spot assay (ELISApot), quantitative polymerase chain reaction (qPCR), reverse transcription PCR (RT-PCR), RT-qPCR, mesoscale discovery (MSD), and enzyme-linked immunosorbent assay (ELISA).
50. The method according to claim 48 or 49, wherein one or more B-lineage cells selected from a population of manipulated B-lineage cells capable of engraftment engraft in the bone marrow of the subject.
51. A method for monitoring the engraftment of engraftable engineered B-lineage cells within a target, comprising one or more of the following: bioluminescence, ELISpot, flow cytometry, qPCR, RT-PCR, RT-qPCR, and enzyme-linked immunosorbent assay.
52. The method according to claim 1, wherein the first target gene locus is selected from CCR5, JCHAIN, and IGH.
53. The method according to claim 1 or 52, wherein the second target gene locus is selected from B2M, BCMA, CD19, and CD20.
54. The method according to claim 1, wherein the first target gene locus is CCR5, the second target gene locus is CD19, and the endogenous gene expression at the second target gene locus is disrupted without the incorporation of the transgene.
55. The method according to claim 54, wherein the first introduced gene is BiTE.
56. The method according to claim 1, wherein the first target gene locus is CCR5, the second target gene locus is B2M, and the endogenous gene expression at the second target gene locus is disrupted without the incorporation of the transgene.
57. The method according to claim 1, wherein the first target gene locus is JCHAIN, the second target gene locus is B2M, and the endogenous gene expression at the second target gene locus is disrupted without the incorporation of the transgene.
58. The method according to claim 1, wherein the first target gene locus is IGH, the second target gene locus is B2M, and the endogenous gene expression at the second target gene locus is disrupted without the incorporation of the transgene.
59. The method according to claim 1, wherein the first target gene locus is CCR5, the second target gene locus is B2M, and the second expression cassette containing the second transgene is incorporated into the second target gene locus.
60. The method according to claim 1, wherein the first target gene locus is JCHAIN, the second target gene locus is B2M, and the second expression cassette containing the second transgene is incorporated into the second target gene locus.
61. The method according to claim 1, wherein the first target gene locus is IGH, the second target gene locus is B2M, and the second expression cassette containing the second transgene is incorporated into the second target gene locus.
62. The method according to any one of claims 54 to 61, wherein the first transgene incorporated into the first target gene locus is BiTE.
63. The method according to any one of claims 54 to 61, wherein the first transgene incorporated into the first target gene locus is selected from factor IX, SMPD1, and blinatumomab.
64. The method according to any one of claims 59 to 63, wherein the second transgene incorporated into the second target gene locus is selected from HLA-A, HLA-B, HLA-C, HLA-E, and HLA-G.
65. A method for genetically modifying a B-lineage cell population, wherein the method is (a) A step of isolating primary B cells so that a primary B cell population can be obtained, (b) The step of activating the primary B cell population, (c) During or after the activation step, the primary B cell population is manipulated to reduce the expression of one or more endogenous target genes. The method comprising the step of generating a population of genetically modified B-lineage cells.
66. The method according to claim 65, wherein the endogenous target gene is NLRC5.
67. The method according to claim 65, wherein the endogenous target gene is CD58.
68. The method according to claim 65, wherein the endogenous target gene is RFX5.
69. The method according to claim 65, wherein the endogenous target gene is TAP2.
70. The method according to claim 65, wherein the endogenous target gene is TAPBP.
71. The method according to claim 65, wherein the endogenous target genes are B2M and CD58.
72. The method according to claim 65, wherein the endogenous target genes are NLRC5 and CD58.
73. The method according to claim 65, wherein the endogenous target genes are RFX5 and CD58.
74. The method according to any one of the prior claims, wherein the method for reducing expression comprises knockout of one or more endogenous target genes.
75. The method according to any one of the prior claims, wherein the operation step includes incorporating one or more transgenes at one or more target gene loci.
76. The method according to claim 75, wherein the incorporation of the one or more introduced genes reduces the expression of the one or more endogenous target genes.
77. The method according to claim 75 or 76, wherein the introduced gene includes a sequence encoding HLA-E.
78. The method according to claim 75 or 76, wherein the introduced gene includes a sequence encoding HLA-G.
79. The method according to claim 75 or 76, wherein the introduced gene includes a sequence encoding CD47.
80. The method according to claim 75 or 76, wherein the introduced gene includes a sequence encoding PDL1.
81. The method according to claim 75, wherein the introduced gene includes factor IX (FIX).
82. The method according to claim 75, wherein the introduced gene comprises sphingomyelin phosphodiesterase 1 (SMPD1).
83. The method according to claim 75, wherein the introduced gene includes a bispecific double scFv.
84. The method according to any one of claims 75 to 83, wherein the operation step includes incorporating the introduced gene into the endogenous CCR5 locus.
85. The method according to any one of claims 75 to 83, wherein the operation step includes incorporating the introduced gene into the endogenous B2M gene locus.
86. The method according to any one of claims 75 to 83, wherein the operation step includes incorporating the introduced gene into the endogenous CD19 locus.
87. The method according to any one of claims 75 to 83, wherein the operation step includes incorporating the introduced gene into the endogenous JCHAIN locus.
88. The method according to any one of claims 75 to 83, wherein the operation step includes incorporating the introduced gene into the endogenous AAVS1 locus.
89. The method according to any one of claims 75 to 83, wherein the operation step includes incorporating the introduced gene into the endogenous TRAC gene locus.
90. The method according to any one of claims 75 to 83, wherein the operation step includes incorporating the introduced gene into the endogenous GSH gene locus.
91. The method according to any one of the prior claims, further comprising the step of transplanting the genetically modified B-series cell population into a cell culture medium that does not contain human serum or bovine serum for about 24 hours.
92. The method according to any one of the prior claims, wherein the step of the operation further comprises introducing a donor construct containing the transgene into the primary B cell population.
93. The aforementioned donor structure, (a) A 5' homology arm that is at least 95% identical to the 5' side sequence with respect to the double-strand break site, (b) The method according to claim 92, comprising a 3' homology arm which is at least 95% identical to the 3' side arrangement with respect to the double-strand break site.
94. The method according to claim 95, wherein the donor construct comprises one of the transgene sequences from sequence numbers 34 to 39.
95. The method according to claim 93 or 94, wherein the donor structure includes one homology arm sequence from sequence numbers 10 to 18.
96. A population of genetically modified B-lineage cells containing knockout modifications to one or more endogenous gene loci.
97. The population according to claim 96, wherein the knockout modification is located at the endogenous NLRC5 gene locus.
98. The population according to claim 96, wherein the knockout modification is located at the endogenous B2M gene locus.
99. The population according to claim 96, wherein the knockout modification is located at the endogenous CD58 gene locus.
100. The population according to claim 96, wherein the knockout modification is located at the endogenous RFX5 gene locus.
101. The population according to claim 96, wherein the knockout modification is located at the endogenous TAP2 gene locus.
102. The population according to claim 96, wherein the knockout modification is located at the endogenous TAPBP gene locus.
103. The population according to claim 96, wherein the knockout modifications are located at the endogenous B2M gene locus and the endogenous CD58 gene locus.
104. The population according to claim 96, wherein the knockout modifications are located at the endogenous NLRC5 gene locus and the endogenous CD58 gene locus.
105. The population according to claim 96, wherein the knockout modifications are located at the endogenous RFX5 gene locus and the endogenous CD58 gene locus.
106. The population according to any one of the prior claims, further comprising a transgene sequence expressed from one or more target gene loci.
107. The population according to claim 106, wherein the population includes a knockout modification of the endogenous B2M gene locus and an introduced gene expressed from the CCR5 gene locus.
108. The population according to claim 107, wherein the introduced gene comprises a sequence encoding an HLA-E or HLA-G protein.
109. The population according to claim 108, wherein the introduced gene further comprises a 2A peptide or an IRES sequence at the 3' end of the sequence encoding the HLA-E protein.
110. The population according to claim 109, wherein the introduced gene further comprises a sequence encoding a second protein at the 3' end of the 2A peptide or the IRES sequence.