Compounds for treating hereditary spastic paraplegia

Compounds targeting intracellular ATG9A transport in AP-4-HSP models provide a novel approach to treat hereditary spastic paraplegia by correcting abnormal protein transport, addressing the limited therapeutic options for AP-4-HSP-related neurological disorders.

JP2026519013APending Publication Date: 2026-06-11CHILDRENS MEDICAL CENT CORP
View PDF 0 Cites 0 Cited by

Patent Information

Application Number
JP2025568076
Authority / Receiving Office
JP · JP
Patent Type
Applications
Current Assignee / Owner
Priority Date
2023-05-19
Filing Date
2024-05-17
Publication Date
2026-06-11

AI Technical Summary

Technical Problem

Current therapies for hereditary spastic paraplegia caused by adapter protein complex 4 (AP-4) deficiency are limited, and there is a need for novel therapeutic targets to address neurological disorders such as spasticity and neurodegeneration.

Method used

Development of compounds that modulate intracellular ATG9A transport, using a high-throughput screening assay to identify molecules that correct abnormal protein transport in AP-4-HSP models, combined with multiparametric orthogonal strategies to identify molecular targets and mechanisms of action.

Benefits of technology

The compounds restore ATG9A pathology in disease models, offering potential therapeutic benefits for neurological disorders associated with AP-4 deficiency.

✦ Generated by Eureka AI based on patent content.

Smart Images

  • Figure 2026519013000001_ABST
    Figure 2026519013000001_ABST
Patent Text Reader

Abstract

Compounds that modulate autophagy-related 9A (ATG9A) transport and / or increase autophagy flux are provided herein. Also provided are pharmaceutical compositions comprising these compounds and methods for treating neurological disorders or conditions such as hereditary spastic paraplegia (HSP).
Need to check novelty before this filing date? Find Prior Art

Description

[Technical Field]

[0001] Related applications This application claims priority under 35 U.S. SC § 119(e) to U.S. Provisional Application No. USSN 63 / 503,262, filed on 19 May 2023, which is incorporated in its entirety by reference herein.

[0002] Research funded by the federal government This invention was made with government support under authorization number NS123552 granted by the National Institutes of Health. The government has certain rights to this invention. [Background technology]

[0003] background Despite significant advances in our ability to describe the genetic causes of rare neurological disorders, it is estimated that specific therapies exist for less than 5% of cases. Therefore, there is a great unmet need in developing and implementing novel platforms for drug discovery. Automated, unbiased, cell-based, high-throughput small molecule screening, informed by disease-associated cellular phenotypes, has the potential to discover novel therapeutic targets.

[0004] Adapter protein complex 4 (AP-4)-associated hereditary spastic paraplegia (AP-4-HSP, encompassing AP4B1-associated SPG47 (OMIM #614066), AP4M1-associated SPG50 (OMIM #612936), AP4E1-associated SPG51 (OMIM #613744), and AP4S1-associated SPG52 (OMIM #614067)) is a rare but important genetic mimic of prototype childhood-onset compound hereditary spastic paraplegia (HSP) and cerebral palsy. Children with AP-4-HSP exhibit neurodevelopmental disorders (e.g., early-onset global developmental delay and seizures, microcephaly, and developmental brain malformations) as well as neurodegenerative diseases (e.g., progressive spasticity and weakness, loss of gait, and extrapyramidal motor disorders). AP-4-HSP is caused by a biallelelic loss-of-function mutant in any of the four AP-4 subunits (ε, β4, μ4, σ4), resulting in impaired AP-4 assembly and function. AP-4 is an obligate heterotetrameric protein complex that mediates transport from the trans-Golgi network (TGN) to the pericellular periphery, encompassing the site of autophagosome biosynthesis. The core autophagy protein and lipid scramblase ATG9A have been identified as major cargoes of AP-4, linking loss of AP-4 function to defective autophagy. AP-4 deficiency in non-neuronal and neuronal cells leads to accumulation of ATG9A in the TGN, including in iPSC-derived neurons from AP-4-HSP patients. From this neuronal phenotype and overlapping neuronal phenotypes of AP-4 and Atg9a knockout mice, the following working model for AP-4 deficiency emerges: (1) AP-4 is required for the transport of ATG9A from the TGN; (2) Loss-of-function mutants in the AP-4 subunit result in loss of AP-4 function; (3) ATG9A accumulates in the TGN, leading to reduced axonal delivery of ATG9A; (4) Absence of ATG9A in distal axons impairs autophagy and leads to axonal degeneration. Other AP-4 cargo proteins identified to date include the less-characterized transmembrane proteins SERINC1 and SERINC3, as well as the endocannabinoid-producing enzyme DAG lipase beta (DAGLB). [Overview of the project]

[0005] overview This disclosure stems from the recognition that unbiased phenotypic screening in patient-associated disease models offers the potential to identify novel therapeutic targets for rare diseases. As described herein, a high-throughput screening assay was designed and employed to identify molecules that modify abnormal protein transport in a rare but prototype childhood-onset hereditary spastic paraplegia characterized by adapter protein complex 4 (AP-4) deficiency and deficient transport of autophagy protein ATG9A.

[0006] Thus, the compounds of this disclosure restore ATG9A pathology in multiple disease models, including patient-derived fibroblasts and iPSC-derived neurons. Furthermore, multiparametric orthogonal strategies and integrated transcriptome and proteomics approaches identify the putative molecular targets of the disclosed compounds and their mechanisms of action. Molecular moduliators of intracellular ATG9A transport are also identified.

[0007] Therefore, in one respect, the compound of formula (I): [ka] Also provided herein are pharmaceutically acceptable salts, solvates, hydrates, polymorphs, cocrystals, tautomers, stereoisomers, isotope-labeled derivatives and prodrugs thereof, in which formula: R 1 Each occurrence is independently a halogen, substituted or unsubstituted acyl, substituted or unsubstituted alkyl, substituted or unsubstituted alkenyl, substituted or unsubstituted alkynyl, substituted or unsubstituted heteroaliphatic, substituted or unsubstituted carbocyclyl, substituted or unsubstituted heterocyclyl, substituted or unsubstituted aryl, substituted or unsubstituted heteroaryl, nitrogen protecting group when attached to a nitrogen atom, -OR A , -N(R A )2, -SR A, -CN, -SCN, -C(=NR A )R A , -C(=NR A )OR A , -C(=NR A )N(R A )2, -C(=O)R A , -C(=O)OR A , -C(=O)N(R A )2, -C(=O)NR A S(O)2R A , -NO2, -NR A C(=O)R A , -NR A C(=O)OR A , -NR A C(=O)N(R A )2, -NR A C(=NR A )N(R A )2, -OC(=O)R A , -OC(=O)OR A , -OC(=O)N(R A )2, -NR A S(O)2R A , -OS(O)2R A , -S(O)2NR A C(O)R A , -S(O)2N(R A )2, -S(O)2OR A , or -S(O)2R A ; or two R 1 groups are joined to form a substituted or unsubstituted carbocyclic ring, a substituted or unsubstituted aryl ring, a substituted or unsubstituted heterocyclic ring, or a substituted or unsubstituted heteroaryl ring; t is 0 or a positive integer; and R AEach appearance is independently either hydrogen, a substituted or unsubstituted acyl, a substituted or unsubstituted alkyl, a substituted or unsubstituted alkenyl, a substituted or unsubstituted alkynyl, a substituted or unsubstituted heteroaliphatic, a substituted or unsubstituted carbocyclyl, a substituted or unsubstituted heterocyclyl, a substituted or unsubstituted aryl, a substituted or unsubstituted heteroaryl, a nitrogen protecting group attached to a nitrogen atom, an oxygen protecting group attached to an oxygen atom, or a sulfur protecting group attached to a sulfur atom, or two R A The groups are joined to form a substituted or unsubstituted heterocyclyl ring, or a substituted or unsubstituted heteroaryl ring; If present in the formula, R 1 Each occurrence is bonded to some substitutable atom of the compound.

[0008] In another aspect, a pharmaceutical composition is disclosed comprising a compound of formula (I), or a pharmaceutically acceptable salt, solvate, hydrate, polymorph, cocrystal, tautomer, stereoisomer, isotope-labeled derivative, or prodrug thereof, and a pharmaceutically acceptable excipient.

[0009] In another aspect, a kit is disclosed comprising a compound of formula (I), or a pharmaceutically acceptable salt, solvate, hydrate, polymorph, cocrystal, tautomer, stereoisomer, isotope-labeled derivative or prodrug thereof, or a pharmaceutical composition of the present disclosure, and instructions for administering the compound or pharmaceutical composition to an object requiring such administration.

[0010] In another aspect, a method for treating a neurological disorder or neurological condition is disclosed, comprising administering an effective amount of a compound of formula (I), or a pharmaceutically acceptable salt, solvate, hydrate, polymorph, cocrystal, tautomer, stereoisomer, isotope-labeled derivative, or prodrug or a pharmaceutical composition of the present disclosure, to a subject in need thereof.

[0011] In another aspect, a method for regulating autophagy-related 9A (ATG9A) transport in or out of cells is disclosed, comprising contacting a cell with an effective amount of a compound of formula (I), or a pharmaceutically acceptable salt, solvate, hydrate, polymorph, cocrystal, tautomer, stereoisomer, isotope-labeled derivative or prodrug thereof, or a pharmaceutical composition of the present disclosure.

[0012] In another aspect, a method is disclosed for regulating intracellular vesicular transport and increasing intracellular autophagy flux, comprising contacting a cell with an effective amount of a compound of formula (I), or a pharmaceutically acceptable salt, solvate, hydrate, polymorph, cocrystal, tautomer, stereoisomer, isotope-labeled derivative or prodrug thereof, or a pharmaceutical composition of the present disclosure.

[0013] definition Definitions of specific functional groups and chemical terms are described in more detail below. Chemical elements are defined in Periodic Table of the Elements, CAS version, Handbook of Chemistry and Physics, 75. th Identification follows the Ed. (inside cover), and specific functional groups are generally defined as described therein. In addition, general principles of organic chemistry, as well as specific functional moieties and reactivity, are referred to in *Organic Chemistry*, Thomas Sorrell, University Science Books, Sausalito, 1999; and *Smith and March*, *March's Advanced Organic Chemistry*, 5 th Edition, John Wiley&Sons, Inc., New York, 2001; Larock, Comprehensive Organic Transformations, VCH Publishers, Inc., New York, 1989; and Carruthers, Some Modern Methods of Organic Synthesis, 3 rdThis is described in Edition, Cambridge University Press, Cambridge, 1987.

[0014] The compounds described herein may contain one or more chiral centers and may therefore exist in various stereoisomeric forms, such as enantiomers and / or diastereomers. For example, the compounds described herein may be in the form of individual enantiomers, diastereomers or geometric isomers, or in the form of a mixture of stereoisomers, including racemic mixtures and mixtures in which one or more stereoisomers are concentrated. The isomers may be isolated from the mixture by methods known to those skilled in the art, including chiral high-pressure liquid chromatography (HPLC) and the formation and crystallization of chiral salts; or preferred isomers may be prepared by asymmetric synthesis. For example, see Jacques et al., Enantiomers, Racemates and Resolutions (Wiley Interscience, New York, 1981); Wilen et al., Tetrahedron 33:2725 (1977); Eliel, ELStereochemistry of Carbon Compounds (McGraw-Hill, NY, 1962); and Wilen, SHTables of Resolving Agents and Optical Resolutions p.268 (ELEliel, Ed., Univ. of Notre Dame Press, Notre Dame, IN 1972). In addition, the present invention covers compounds as individual isomers substantially free of other isomers, and compounds as mixtures of various isomers instead.

[0015] Unless otherwise specified, the structures illustrated herein also mean that they encompass different compounds only in the presence of one or more isotopically enriched atoms. For example, the substitution of hydrogen with deuterium or tritium. 18 F 19 Substitution of F, or 13 C or 14 By C12 Compounds having the present structure except for the substitution of C are within the scope of this disclosure. Such compounds are useful, for example, as analytical tools or probes in biological assays.

[0016] When a range of values ​​is listed, it is intended to cover each value and subrange within that range. For example, "C 1-6 "Alkyl" refers to C1, C2, C3, C4, C5, C6, C 1-6 , C 1-5 , C 1-4 , C 1-3 , C 1-2 , C 2-6 , C 2-5 , C 2-4 , C 2-3 , C 3-6 , C 3-5 , C 3-4 , C 4-6 , C 4-5 , and C 5-6 The intention is to cover all alkyl groups.

[0017] The term "aliphatic" refers to alkyl groups, alkenyl groups, alkynyl groups, and carbocyclic groups. Similarly, the term "heteroaliphatic" refers to heteroalkyl groups, heteroalkenyl groups, heteroalkynyl groups, and heterocyclic groups.

[0018] The term "alkyl" refers to a linear or branched saturated hydrocarbon group having 1 to 10 carbon atoms ("C"). 1-10 This refers to an alkyl radical. In certain embodiments, an alkyl group has 1 to 9 carbon atoms (C). 1-9 Alkyl). In certain embodiments, an alkyl group has 1 to 8 carbon atoms ("C"). 1-8 Alkyl). In certain embodiments, an alkyl group has 1 to 7 carbon atoms ("C"). 1-7 Alkyl). In certain embodiments, an alkyl group has 1 to 6 carbon atoms ("C"). 1-6 Alkyl). In certain embodiments, an alkyl group has 1 to 5 carbon atoms ("C"). 1-5Alkyl). In certain embodiments, an alkyl group has 1 to 4 carbon atoms ("C"). 1-4 Alkyl). In certain embodiments, an alkyl group has 1 to 3 carbon atoms ("C"). 1-3 Alkyl). In certain embodiments, an alkyl group has 1 to 2 carbon atoms ("C"). 1-2 ("Alkyl"). In certain embodiments, an alkyl group has one carbon atom ("C1 alkyl"). In certain embodiments, an alkyl group has two to six carbon atoms ("C1 alkyl"). 2-6 Alkyl). C 1-6 Examples of alkyl groups include methyl (C1), ethyl (C2), propyl (C3) (e.g., n-propyl, isopropyl), butyl (C4) (e.g., n-butyl, tert-butyl, sec-butyl, iso-butyl), pentyl (C5) (e.g., n-pentyl, 3-pentanyl, amyl, neopentyl, 3-methyl-2-butanyl, tertiary amyl), and hexyl (C6) (e.g., n-hexyl). Additional examples of alkyl groups include n-heptyl (C7), n-octyl (C8), etc. Unless otherwise specified, each example of an alkyl group is independently either unsubstituted ("unsubstituted alkyl") or substituted with one or more substituents (e.g., halogens such as F) ("substituted alkyl"). In certain embodiments, alkyl groups are unsubstituted C 1-10 Alkyl (unsubstituted C) 1-6 Alkyl groups include, for example, -CH3(Me), unsubstituted ethyl (Et), unsubstituted propyl (Pr, for example, unsubstituted n-propyl (n-Pr), unsubstituted isopropyl (i-Pr)), and unsubstituted butyl (Bu, for example, unsubstituted n-butyl (n-Bu), unsubstituted tert-butyl (tert-Bu or t-Bu), unsubstituted sec-butyl (sec-Bu), and unsubstituted isobutyl (i-Bu)). In certain embodiments, alkyl groups are substituted C 1-10 Alkyl (substituted C) 1-6 Alkyl (e.g., -CF3, Bn, etc.)

[0019] The term "haloalkyl" refers to a substituted alkyl group in which one or more hydrogen atoms are independently replaced by a halogen, e.g., fluoro, bromo, chloro, or iodine. In certain embodiments, the haloalkyl moiety has 1 to 8 carbon atoms ("C"). 1-8 ("Haloalkyl"). In certain embodiments, the haloalkyl portion has 1 to 6 carbon atoms ("C"). 1-6 ("Haloalkyl"). In certain embodiments, the haloalkyl portion has 1 to 4 carbon atoms ("C"). 1-4 ("Haloalkyl"). In certain embodiments, the haloalkyl portion has 1 to 3 carbon atoms ("C"). 1-3 ("Haloalkyl"). In certain embodiments, the haloalkyl portion has 1 to 2 carbon atoms ("C"). 1-2 Haloalkyl groups include -CF3, -CF2CF3, -CF2CF2CF3, -CCl3, -CFCl2, -CF2Cl, etc.

[0020] The term "heteroalkyl" refers to an alkyl group that further includes at least one heteroatom (e.g., 1, 2, 3, or 4 heteroatoms) selected from oxygen, nitrogen, or sulfur, located within one or more terminal positions of the parent chain (i.e., inserted between adjacent carbon atoms) and / or positioned at one or more terminal positions of the parent chain. In certain embodiments, a heteroalkyl group is a saturated group having 1 to 10 carbon atoms and one or more heteroatoms in the parent chain ("heteroC"). 1-10 This refers to an alkyl group. In certain embodiments, a heteroalkyl group is a saturated group having 1 to 9 carbon atoms and 1 or more heteroatoms in its parent chain (heteroC). 1-9 ("Alkyl"). In certain embodiments, a heteroalkyl group is a saturated group having 1 to 8 carbon atoms and 1 or more heteroatoms in the parent chain ("heteroC"). 1-8 ("Alkyl"). In certain embodiments, a heteroalkyl group is a saturated group having 1 to 7 carbon atoms and 1 or more heteroatoms in the parent chain ("hetero C"). 1-7"alkyl"). In certain embodiments, a heteroalkyl group is a saturated group having 1 to 6 carbon atoms and 1 or more heteroatoms in the parent chain ("heteroC 1-6 alkyl"). In certain embodiments, a heteroalkyl group is a saturated group having 1 to 5 carbon atoms and 1 or 2 heteroatoms in the parent chain ("heteroC 1-5 alkyl"). In certain embodiments, a heteroalkyl group is a saturated group having 1 to 4 carbon atoms and 1 or 2 heteroatoms in the parent chain ("heteroC 1-4 alkyl"). In certain embodiments, a heteroalkyl group is a saturated group having 1 to 3 carbon atoms and 1 heteroatom in the parent chain ("heteroC 1-3 alkyl"). In certain embodiments, a heteroalkyl group is a saturated group having 1 to 2 carbon atoms and 1 heteroatom in the parent chain ("heteroC 1-2 alkyl"). In certain embodiments, a heteroalkyl group is a saturated group having 1 carbon atom and 1 heteroatom ("heteroC1 alkyl"). In certain embodiments, a heteroalkyl group is a saturated group having 2 to 6 carbon atoms and 1 or 2 heteroatoms in the parent chain ("heteroC 2-6 alkyl"). Unless otherwise specified, each instance of a heteroalkyl group is independently unsubstituted ("unsubstituted heteroalkyl") or substituted by 1 or more substituents ("substituted heteroalkyl"). In certain embodiments, a heteroalkyl group is unsubstituted heteroC 1-10 alkyl. In certain embodiments, a heteroalkyl group is substituted heteroC 1-10 alkyl.

[0021] The term "alkenyl" refers to a radical of a straight-chain or branched hydrocarbon group having 2 to 10 carbon atoms and 1 or more carbon-carbon double bonds (e.g., 1, 2, 3, or 4 double bonds). In certain embodiments, an alkenyl group has 2 to 9 carbon atoms ("C 2-9 alkenyl"). In certain embodiments, an alkenyl group has 2 to 8 carbon atoms ("C 2-8("Alkenyl"). In certain embodiments, the alkenyl group has 2 to 7 carbon atoms ("C"). 2-7 ("Alkenyl"). In certain embodiments, the alkenyl group has 2 to 6 carbon atoms ("C"). 2-6 ("Alkenyl"). In certain embodiments, the alkenyl group has 2 to 5 carbon atoms ("C"). 2-5 ("Alkenyl"). In certain embodiments, the alkenyl group has 2 to 4 carbon atoms ("C"). 2-4 ("Alkenyl"). In certain embodiments, the alkenyl group has 2 to 3 carbon atoms ("C"). 2-3 "Alkenyl"). In certain embodiments, an alkenyl group has two carbon atoms ("C2 alkenyl"). One or more carbon-carbon double bonds can be internal (e.g., 2-butenyl) or terminal (e.g., 1-butenyl). C 2-4 Examples of alkenyl groups include ethenyl (C2), 1-propenyl (C3), 2-propenyl (C3), 1-butenyl (C4), 2-butenyl (C4), and butadienyl (C4). 2-6 An example of an alkenyl group is the C mentioned above. 2-4 This includes alkenyl groups, as well as pentenyl (C5), pentadienyl (C5), hexenyl (C6), and others. Additional examples of alkenyls include heptenyl (C7), octenyl (C8), octatrienyl (C8), and others. Unless otherwise specified, each example of an alkenyl group is independently either unsubstituted ("unsubstituted alkenyl") or substituted with one or more substituents ("substituted alkenyl"). In certain embodiments, the alkenyl group is an unsubstituted C 2-10 It is an alkenyl. In a particular embodiment, the alkenyl group is a substituted C 2-10 It is an alkenyl. In the alkenyl group, the stereochemistry is not specified for the C=C double bond (for example, -CH=CHCH3 or [ka] ) may also be an (E)- or (Z)- double bond.

[0022] The term “heteroalkenyl” refers to an alkenyl group that further includes at least one heteroatom (for example, 1, 2, 3, or 4 heteroatoms) selected from oxygen, nitrogen, or sulfur, located within one or more terminal positions of the parent chain (i.e., inserted between adjacent carbon atoms) and / or positioned at one or more terminal positions of the parent chain. In certain embodiments, a heteroalkenyl group is a group having 2 to 10 carbon atoms, at least one double bond, and one or more heteroatoms in the parent chain ("hetero C 2-10 This refers to an "alkenyl" group. In certain embodiments, a heteroalkenyl group has 2 to 9 carbon atoms in its parent chain, at least one double bond, and one or more heteroatoms ("hetero C"). 2-9 ("Alkenyl"). In certain embodiments, a heteroalkenyl group has 2 to 8 carbon atoms, at least 1 double bond, and 1 or more heteroatoms in its parent chain ("hetero C"). 2-8 ("Alkenyl"). In certain embodiments, a heteroalkenyl group has 2 to 7 carbon atoms, at least 1 double bond, and 1 or more heteroatoms in its parent chain ("hetero C"). 2-7 ("Alkenyl"). In certain embodiments, a heteroalkenyl group has 2 to 6 carbon atoms, at least 1 double bond, and 1 or more heteroatoms in its parent chain ("hetero C"). 2-6 ("Alkenyl"). In certain embodiments, a heteroalkenyl group has 2 to 5 carbon atoms, at least 1 double bond, and 1 or 2 heteroatoms in its parent chain ("hetero C"). 2-5 ("Alkenyl"). In certain embodiments, a heteroalkenyl group has 2 to 4 carbon atoms, at least 1 double bond, and 1 or 2 heteroatoms in its parent chain ("hetero C"). 2-4 ("Alkenyl"). In certain embodiments, a heteroalkenyl group has 2-3 carbon atoms, at least 1 double bond, and 1 heteroatom in its parent chain ("hetero C"). 2-3 ("Alkenyl"). In certain embodiments, a heteroalkenyl group has 2 to 6 carbon atoms, at least one double bond, and 1 or 2 heteroatoms in its parent chain ("hetero C"). 2-6(Alkenyl). Unless otherwise specified, each example of a heteroalkenyl group is independently either unsubstituted ("unsubstituted heteroalkenyl") or substituted with one or more substituents ("substituted heteroalkenyl"). In certain embodiments, the heteroalkenyl group is an unsubstituted hetero C 2-10 It is an alkenyl. In certain embodiments, the heteroalkenyl group is a substituted heteroC 2-10 It is Alkenil.

[0023] The term "alkynyl" refers to a radical of a linear or branched hydrocarbon group having 2 to 10 carbon atoms and one or more carbon-carbon triple bonds (e.g., 1, 2, 3, or 4 triple bonds) ("C 2-10 ("Alkynyl"). In certain embodiments, the alkynyl group has 2 to 9 carbon atoms ("C"). 2-9 ("Alkynyl"). In certain embodiments, the alkynyl group has 2 to 8 carbon atoms ("C"). 2-8 ("Alkynyl"). In certain embodiments, the alkynyl group has 2 to 7 carbon atoms ("C"). 2-7 ("Alkynyl"). In certain embodiments, the alkynyl group has 2 to 6 carbon atoms ("C"). 2-6 ("Alkynyl"). In certain embodiments, the alkynyl group has 2 to 5 carbon atoms ("C"). 2-5 ("Alkynyl"). In certain embodiments, the alkynyl group has 2 to 4 carbon atoms ("C"). 2-4 ("Alkynyl"). In certain embodiments, the alkynyl group has 2-3 carbon atoms ("C"). 2-3 "Alkynyl"). In certain embodiments, the alkynyl group has two carbon atoms ("C2 alkynyl"). One or more carbon-carbon triple bonds may be internal (e.g., 2-butynyl) or terminal (e.g., 1-butynyl). C 2-4 Examples of alkynyl groups include, but are not limited to, ethynyl (C2), 1-propynyl (C3), 2-propynyl (C3), 1-butynyl (C4), and 2-butynyl (C4). 2-6 An example of an alkenyl group is the C mentioned above. 2-4This includes alkynyl groups, as well as pentynyl (C5) and hexynyl (C6), etc. Additional examples of alkynyls include heptynyl (C7), octinyl (C8), etc. Unless otherwise specified, each example of an alkynyl group is independently either unsubstituted ("unsubstituted alkynyl") or substituted with one or more substituents ("substituted alkynyl"). In certain embodiments, the alkynyl group is an unsubstituted C 2-10 It is an alkynyl group. In certain embodiments, the alkynyl group is a substituted C 2-10 It is alkinyl.

[0024] The term "heteroalkynyl" refers to an alkynyl group that further includes at least one heteroatom (e.g., 1, 2, 3, or 4 heteroatoms) selected from oxygen, nitrogen, or sulfur, located within one or more terminal positions of the parent chain (i.e., inserted between adjacent carbon atoms) and / or positioned at one or more terminal positions of the parent chain. In certain embodiments, a heteroalkynyl group refers to a group having 2 to 10 carbon atoms, at least one triple bond, and one or more heteroatoms in the parent chain ("heteroC"). 2-10 ("Alkynyl"). In certain embodiments, a heteroalkynyl group has 2 to 9 carbon atoms, at least one triple bond, and one or more heteroatoms in its parent chain ("heteroC"). 2-9 ("Alkynyl"). In certain embodiments, a heteroalkynyl group has 2 to 8 carbon atoms, at least one triple bond, and one or more heteroatoms in its parent chain ("heteroC"). 2-8 ("Alkynyl"). In certain embodiments, a heteroalkynyl group has 2 to 7 carbon atoms, at least 1 triple bond, and 1 or more heteroatoms in its parent chain ("heteroC"). 2-7 ("Alkynyl"). In certain embodiments, a heteroalkynyl group has 2 to 6 carbon atoms, at least one triple bond, and one or more heteroatoms in its parent chain ("heteroC"). 2-6 ("Alkynyl"). In certain embodiments, a heteroalkynyl group has 2 to 5 carbon atoms, at least one triple bond, and 1 or 2 heteroatoms in its parent chain ("heteroC"). 2-5("Alkynyl"). In certain embodiments, a heteroalkynyl group has 2 to 4 carbon atoms, at least one triple bond, and 1 or 2 heteroatoms in its parent chain ("heteroC"). 2-4 ("Alkynyl"). In certain embodiments, a heteroalkynyl group has 2-3 carbon atoms, at least one triple bond, and one heteroatom in its parent chain ("heteroC"). 2-3 ("Alkynyl"). In certain embodiments, a heteroalkynyl group has 2 to 6 carbon atoms, at least one triple bond, and 1 or 2 heteroatoms in its parent chain ("heteroC"). 2-6 (Alkynyl). Unless otherwise specified, each example of a heteroalkynyl group is independently either unsubstituted ("unsubstituted heteroalkynyl") or substituted with one or more substituents ("substituted heteroalkynyl"). In certain embodiments, the heteroalkynyl group is an unsubstituted heteroC 2-10 It is an alkynyl group. In certain embodiments, the heteroalkynyl group is a substituted heteroC 2-10 It is alkinyl.

[0025] The term "carbocyclyl" or "carbocyclic" refers to a non-aromatic ring system with 3 to 14 ring carbon atoms ("C"). 3-14 The term refers to a radical of a non-aromatic cyclic hydrocarbon group having 0 heteroatoms ("carbocyryl"). In certain embodiments, the carbocyclyl group has 3 to 10 ring carbon atoms ("C"). 3-10 Carbocyclyl). In certain embodiments, the carbocyclyl group has 3 to 8 ring carbon atoms ("C"). 3-8 Carbocyclyl). In certain embodiments, the carbocyclyl group has 3 to 7 ring carbon atoms ("C"). 3-7 Carbocyclyl). In certain embodiments, the carbocyclyl group has 3 to 6 ring carbon atoms ("C"). 3-6 Carbocyclyl). In certain embodiments, the carbocyclyl group has 4 to 6 ring carbon atoms ("C"). 4-6 Carbocyclyl). In certain embodiments, the carbocyclyl group has 5-6 ring carbon atoms ("C"). 5-6Carbocyclyl). In certain embodiments, the carbocyclyl group has 5 to 10 ring carbon atoms ("C"). 5-10 Carbocyclyl). Exemplary C 3-6 The carbocyclyl group is not limited to but includes cyclopropyl (C3), cyclopropenyl (C3), cyclobutyl (C4), cyclobutenyl (C4), cyclopentyl (C5), cyclopentenyl (C5), cyclohexyl (C6), cyclohexenyl (C6), cyclohexadienyl (C6), etc. Exemplary C 3-8 The carbocyclyl group is not limited to the above C 3-6 This includes carbocyclyl groups, as well as cycloheptyl (C7), cycloheptenyl (C7), cycloheptadienyl (C7), cycloheptatrienyl (C7), cyclooctyl (C8), cyclooctenyl (C8), bicyclo[2.2.1]heptanyl (C7), bicyclo[2.2.2]octanyl (C8), etc. Exemplary C 3-10 The carbocyclyl group is not limited to the above C 3-8 Carbocyclyl group, as well as cyclononyl (C9), cyclononenyl (C9), cyclodecyl (C9) 10 ), cyclodecenyl (C 10 ), octahydro-1H-indenyl (C9), decahydronaphthalenyl (C9) 10 ), spiro[4.5]decanil(C 10) and others. As the above examples show, in certain embodiments, a carbocyclyl group is either monocyclic ("monocyclic carbocyclyl") or polycyclic (for example, including condensed, bridging, or spirocyclic systems such as bicyclic ("bicyclic carbocyclyl") or tricyclic ("tricyclic carbocyclyl")), and may be saturated or may contain one or more carbon-carbon double or carbon-carbon triple bonds. "Carbocyclyl" also includes cyclic systems in which a carbocyclyl ring as defined above is condensed with one or more aryl or heteroaryl groups, with the attachment site on the carbocyclyl ring, and in such examples, the number of carbons continues to specify the number of carbons in the carbocyclic system. Unless otherwise specified, each example of a carbocyclyl group is independently either unsubstituted ("unsubstituted carbocyclyl") or substituted with one or more substituents ("substituted carbocyclyl"). In certain embodiments, the carbocyclyl group is an unsubstituted C 3-14 It is a carbocyclyl. In certain embodiments, the carbocyclyl group is a substituted C 3-14 It is carbocyclyl.

[0026] In certain embodiments, "carbocyrill" is a monocyclic saturated carbocyrill group having 3 to 14 ring carbon atoms ("C 3-14 A cycloalkyl group is a group having 3 to 10 ring carbon atoms ("C"). In certain embodiments, a cycloalkyl group has 3 to 10 ring carbon atoms ("C"). 3-10 ("Cycloalkyl"). In certain embodiments, a cycloalkyl group has 3 to 8 ring carbon atoms ("C"). 3-8 ("Cycloalkyl"). In certain embodiments, a cycloalkyl group has 3 to 6 ring carbon atoms ("C"). 3-6 ("Cycloalkyl"). In certain embodiments, a cycloalkyl group has 4 to 6 ring carbon atoms ("C"). 4-6 ("Cycloalkyl"). In certain embodiments, the cycloalkyl group has 5 to 6 ring carbon atoms ("C"). 5-6 ("Cycloalkyl"). In certain embodiments, the cycloalkyl group has 5 to 10 ring carbon atoms ("C"). 5-10 Cycloalkyl). C 5-6Examples of cycloalkyl groups include cyclopentyl (C5) and cyclohexyl (C5). 3-6 An example of a cycloalkyl group is the C mentioned above. 5-6 This includes cycloalkyl groups as well as cyclopropyl (C3) and cyclobutyl (C4). 3-8 An example of a cycloalkyl group is the C mentioned above. 3-6 This includes cycloalkyl groups as well as cycloheptyl (C7) and cyclooctyl (C8). Unless otherwise specified, each example of a cycloalkyl group is independently either unsubstituted ("unsubstituted cycloalkyl") or substituted with one or more substituents ("substituted cycloalkyl"). In certain embodiments, the cycloalkyl group is unsubstituted C 3-14 It is a cycloalkyl group. In certain embodiments, the cycloalkyl group is a substituted C 3-14 It is a cycloalkyl group.

[0027] "Carbocyclylalkyl" is a subset of "alkyl," referring to an alkyl group substituted with a carbocyclyl group, with the attachment site located on the alkyl portion.

[0028] The term “heterocyclyl” or “heterocyclic” refers to a radical of a 3- to 14-membered non-aromatic ring system having a ring carbon atom and 1 to 4 ring heteroatoms, each heteroatom independently selected from nitrogen, oxygen, and sulfur (“3- to 14-membered heterocyclyl”). In heterocyclyl groups containing one or more nitrogen atoms, the attachment sites can be carbon atoms or nitrogen atoms, as long as the valence allows. Heterocyclyl groups can be monocyclic (“monocyclic heterocyclyl”) or polycyclic (e.g., condensed, bridging, or spirocyclic systems such as bicyclic (“bicyclic heterocyclyl”) or tricyclic (“tricyclic heterocyclyl”)), and can be saturated or may contain one or more carbon-carbon double or carbon-carbon triple bonds. Heterocyclyl polycyclic ring systems may contain one or more heteroatoms in one or both rings. "Heterocyclyl" also includes ring systems in which a heterocyclyl ring as defined above is fused with one or more carbocykyl groups, with the attachment site being either a carbocykyl ring or a heterocyclyl ring, or ring systems in which a heterocyclyl ring as defined above is fused with one or more aryl or heteroaryl groups, with the attachment site being on a heterocyclyl ring, in which case the number of ring members continues to specify the number of ring members of the heterocyclyl ring system. Unless otherwise specified, each instance of a heterocyclyl is independently either unsubstituted ("unsubstituted heterocyclyl") or substituted with one or more substituents ("substituted heterocyclyl"). In certain embodiments, the heterocyclyl group is an unsubstituted 3- to 14-membered heterocyclyl. In certain embodiments, the heterocyclyl group is a substituted 3- to 14-membered heterocyclyl.

[0029] In certain embodiments, the heterocyclyl group is a 5-10 member non-aromatic ring system having a ring carbon atom and 1-4 ring heteroatoms, where each heteroatom is independently selected from nitrogen, oxygen, and sulfur ("5-10 member heterocyclyl"). In certain embodiments, the heterocyclyl group is a 5-8 member non-aromatic ring system having a ring carbon atom and 1-4 ring heteroatoms, where each heteroatom is independently selected from nitrogen, oxygen, and sulfur ("5-8 member heterocyclyl"). In certain embodiments, the heterocyclyl group is a 5-6 member non-aromatic ring system having a ring carbon atom and 1-4 ring heteroatoms, where each heteroatom is independently selected from nitrogen, oxygen, and sulfur ("5-6 member heterocyclyl"). In certain embodiments, the 5-6 member heterocyclyl has 1-3 ring heteroatoms selected from nitrogen, oxygen, and sulfur. In certain embodiments, a 5-6 membered heterocyclil has 1-2 ring heteroatoms selected from nitrogen, oxygen, and sulfur. In certain embodiments, a 5-6 membered heterocyclil has 1 ring heteroatom selected from nitrogen, oxygen, and sulfur.

[0030] Exemplary three-membered heterocyclyl groups containing one heteroatom include, but are not limited to, azilidinyl, oxylanil, and thiranil. Exemplary four-membered heterocyclyl groups containing one heteroatom include, but are not limited to, azetidinyl, oxetanil, and thietanil. Exemplary five-membered heterocyclyl groups containing one heteroatom include, but are not limited to, tetrahydrofuranil, dihydrofuranil, tetrahydrothiophenyl, dihydrothiophenyl, pyrrolidinyl, dihydropyrrolyl, and pyrrolyl-2,5-dione. Exemplary five-membered heterocyclyl groups containing two heteroatoms include, but are not limited to, dioxolanil, oxathiolanil, and dithiolanil. Exemplary five-membered heterocyclyl groups containing three heteroatoms include, but are not limited to, triazolinyl, oxadiazolinyl, and thiadiazolinyl. Exemplary six-membered heterocyclyl groups containing one heteroatom include, but are not limited to, piperidinyl, tetrahydropyranil, dihydropyridinyl, and thianyl. Exemplary six-membered heterocyclyl groups containing two heteroatoms include, but are not limited to, piperazinyl, morpholinil, dithianyl, and dioxanil. Exemplary six-membered heterocyclyl groups containing two heteroatoms include, but are not limited to, triazinyl. Exemplary seven-membered heterocyclyl groups containing one heteroatom include, but are not limited to, azepanyl, oxepanyl, and thiepanyl. Exemplary eight-membered heterocyclyl groups containing one heteroatom include, but are not limited to, azokanyl, oxecanyl, and thiokanyl.Examples of bicyclic heterocyclyl groups include, but are not limited to, indolinyl, isoindolinyl, dihydrobenzofuranyl, dihydrobenzothienyl, tetra-hydro-benzothienyl, tetrahydrobenzofuranyl, tetrahydroindolyl, tetrahydroquinolinyl, tetrahydroisoquinolinyl, decahydroquinolinyl, decahydroisoquinolinyl, octahydroclomenyl, octahydroisoclomenyl, decahydronaphthilidinyl, decahydro-1,8-naphthilidinyl, octahydropyrrolo[3,2-b]pyrrole, indolinyl, phthaliumidyl, naphthaliumidyl, chromanyl, clomenyl, 1H-benzo[e][1,4]diazepinyl, This includes 1,4,5,7-tetra-hydro-pyrano[3,4-b]pyrrol, 5,6-dihydro-4H-floo[3,2-b]pyrrol, 6,7-dihydro-5H-floo[3,2-b]pyranyl, 5,7-dihydro-4H-thieno[2,3-c]pyranyl, 2,3-dihydro-1H-pyrrolo[2,3-b]pyridinyl, 2,3-dihydrofloo[2,3-b]pyridinyl, 4,5,6,7-tetrahydro-1H-pyrrolo-[2,3-b]pyridinyl, 4,5,6,7-tetra-hydro-floo[3,2-c]pyridinyl, 4,5,6,7-tetrahydro-thieno[3,2-b]pyridinyl, 1,2,3,4-tetrahydro-1,6-naphthilidinyl, and others.

[0031] A "heterocyclylalkyl" is a subset of "alkyl" groups, referring to alkyl groups substituted with heterocyclyl groups, where the attachment site lies on the alkyl portion.

[0032] The term "aryl" refers to a radical ("C") of a monocyclic or polycyclic (e.g., bicyclic or tricyclic) 4n+2 aromatic ring system (e.g., having 6, 10, or 14 π electrons shared within a cyclic array) having 6 to 14 ring carbon atoms and 0 heteroatoms provided to the aromatic ring system. 6-14 This refers to an aryl group ("C6 aryl," e.g., phenyl). In certain embodiments, the aryl group has six ring carbon atoms ("C6 aryl"). In certain embodiments, the aryl group has ten ring carbon atoms ("C6 aryl"). 10"Aryl" (for example, naphthyl such as 1-naphthyl and 2-naphthyl). In certain embodiments, the aryl group has 14 ring carbon atoms ("C"). 14 "Aryl" (for example, anthracyl). "Aryl" also encompasses ring systems in which an aryl ring, as defined above, is condensed with one or more carbocyrillic or heterocyclyl groups, and the radical or attachment site lies on the aryl ring, in which case the number of carbon atoms continues to specify the number of carbon atoms in the aryl ring system. Unless otherwise specified, each instance of an aryl group is independently either unsubstituted ("unsubstituted aryl") or substituted with one or more substituents ("substituted aryl"). In certain embodiments, the aryl group is unsubstituted C 6-14 It is aryl. In certain embodiments, the aryl group is substituted C 6-14 It is Ariel.

[0033] "Aralkyl" is a subset of "alkyl," referring to an alkyl group substituted with an aryl group, where the attachment site lies on the alkyl portion.

[0034] The term "heteroaryl" refers to a radical of a 5- to 14-membered monocyclic or polycyclic (e.g., bicyclic, tricyclic) 4n+2 aromatic ring system (e.g., having 6, 10, or 14π electrons shared within a cyclic array) having a ring carbon atom and 1-4 ring heteroatoms, each heteroatom independently selected from nitrogen, oxygen, and sulfur ("5- to 14-membered heteroaryl"). In heteroaryl groups containing one or more nitrogen atoms, the attachment site can be a carbon atom or a nitrogen atom, as long as the valence allows. Heteroaryl polycyclic ring systems may contain one or more heteroatoms in one or both rings. "Heteroaryl" also encompasses ring systems in which a heteroaryl ring as defined above is condensed with one or more carbocyryl or heterocyclyl groups, with the attachment site located on the heteroaryl ring, in which case the number of ring members continues to specify the number of ring members in the heteroaryl ring system. "Hyperaryl" also encompasses ring systems in which a heteroaryl ring, as defined above, is fused with one or more aryl groups, and the attachment site is on either an aryl ring or a heteroaryl ring, in which case the number of ring members specifies the number of ring members in the fused polycyclic (aryl / heteroaryl) ring system. One ring is a polycyclic heteroaryl group that does not contain a heteroatom (e.g., indolyl, quinolinyl, carbazolyl), and the attachment site may be on either a ring containing a heteroatom (e.g., 2-indolyl) or a ring not containing a heteroatom (e.g., 5-indolyl).

[0035] In certain embodiments, the heteroaryl group is a 5-10 membered aromatic ring system having a ring carbon atom provided to the aromatic ring system and 1-4 ring heteroatoms, where each heteroatom is independently selected from nitrogen, oxygen, and sulfur ("5-10 membered heteroaryl"). In certain embodiments, the heteroaryl group is a 5-8 membered aromatic ring system having a ring carbon atom provided to the aromatic ring system and 1-4 ring heteroatoms, where each heteroatom is independently selected from nitrogen, oxygen, and sulfur ("5-8 membered heteroaryl"). In certain embodiments, the heteroaryl group is a 5-6 membered aromatic ring system having a ring carbon atom provided to the aromatic ring system and 1-4 ring heteroatoms, where each heteroatom is independently selected from nitrogen, oxygen, and sulfur ("5-6 membered heteroaryl"). In certain embodiments, the 5-6 membered heteroaryl has 1-3 ring heteroatoms selected from nitrogen, oxygen, and sulfur. In certain embodiments, the 5-6 membered heteroaryl has 1-2 ring heteroatoms selected from nitrogen, oxygen, and sulfur. In certain embodiments, a 5- to 6-membered heteroaryl group has one ring heteroatom selected from nitrogen, oxygen, and sulfur. Unless otherwise specified, each instance of a heteroaryl group is independently either unsubstituted ("unsubstituted heteroaryl") or substituted with one or more substituents ("substituted heteroaryl"). In certain embodiments, the heteroaryl group is an unsubstituted 5- to 14-membered heteroaryl. In certain embodiments, the heteroaryl group is a substituted 5- to 14-membered heteroaryl.

[0036] Exemplary five-membered heteroaryl groups containing one heteroatom include, but are not limited to, pyrrolyl, furanyl, and thiophenyl. Exemplary five-membered heteroaryl groups containing two heteroatoms include, but are not limited to, imidazolyl, pyrazolyl, oxazolyl, isoxazolyl, thiazolyl, and isothiazolyl. Exemplary five-membered heteroaryl groups containing three heteroatoms include, but are not limited to, triazolyl, oxadiazolyl, and thiadiazolyl. Exemplary five-membered heteroaryl groups containing four heteroatoms include, but are not limited to, tetrazolyl. Exemplary six-membered heteroaryl groups containing one heteroatom include, but are not limited to, pyridinyl. Exemplary six-membered heteroaryl groups containing two heteroatoms include, but are not limited to, pyridazinyl, pyrimidinyl, and pyrazinyl. Exemplary six-membered heteroaryl groups containing three or four heteroatoms include, but are not limited to, triazinyl and tetradinyl, respectively. Exemplary seven-membered heteroaryl groups containing one heteroatom include, but are not limited to, azepinyl, oxepinyl, and thiepinyl. Exemplary 5,6-bicyclic heteroaryl groups include, but are not limited to, indolyl, isoindolyl, indazolyl, benzotriazolyl, benzothiophenyl, isobenzothiophenyl, benzofuranil, benzoisofuranil, benzimidazolyl, benzoxazolyl, benzisoxazolyl, benzoxadiazolyl, benzthiazolyl, benzisothiazolyl, benzthiadiazolyl, indolidinyl, and prinyl. Exemplary 6,6-bicyclic heteroaryl groups include, but are not limited to, naphthylidinyl, pteridinyl, quinolinyl, isoquinolinyl, sinnolinyl, quinoxalinyl, phthalazinyl, and quinazolinyl. Exemplary tricyclic heteroaryl groups include, but are not limited to, phenanthridine, dibenzofuranil, carbazolyl, acridinil, phenothiazinil, phenoxadinil, and phenadinil.

[0037] "Heteroaralkyl" is a subset of "alkyl," referring to an alkyl group substituted with a heteroaryl group, where the attachment site lies on the alkyl portion.

[0038] Adding the suffix "-en" to a base indicates that the base is a divalent part. For example, alkylene is the divalent part of alkyl, alkenylene is the divalent part of alkenyl, alkynylene is the divalent part of alkynyl, heteroalkylene is the divalent part of heteroalkyl, heteroalkenylene is the divalent part of heteroalkenyl, heteroalkynylene is the divalent part of heteroalkynyl, carbocyclylene is the divalent part of carbocyclyl, heterocyclylene is the divalent part of heterocyclyl, arylene is the divalent part of aryl, and heteroarylene is the divalent part of heteroaryl.

[0039] Groups are optionally substituted unless otherwise specified. The term “optionally substituted” means substituted or unsubstituted. In certain embodiments, alkyl groups, alkenyl groups, alkynyl groups, heteroalkyl groups, heteroalkenyl groups, heteroalkynyl groups, carbocyclyl groups, heterocyclyl groups, aryl groups and heteroaryl groups are optionally substituted. “Optionally substituted” means a group that may be substituted or unsubstituted (for example, a “substituted” or “unsubstituted” alkyl group, a “substituted” or “unsubstituted” alkenyl group, a “substituted” or “unsubstituted” alkynyl group, a “substituted” or “unsubstituted” heteroalkyl group, a “substituted” or “unsubstituted” heteroalkenyl group, a “substituted” or “unsubstituted” heteroalkynyl group, a “substituted” or “unsubstituted” carbocyclyl group, a “substituted” or “unsubstituted” heterocyclyl group, a “substituted” or “unsubstituted” aryl group, or a “substituted” or “unsubstituted” heteroaryl group). Generally, the term “substituted” means that at least one hydrogen present on the group is substituted by an acceptable substituent, e.g., a substituent that results in a stable compound upon substitution, e.g., a compound that does not spontaneously undergo transformation by rearrangement, cyclization, elimination, or other reactions. Unless otherwise indicated, a “substituted” group has substituents at one or more substituted positions on the group, and if multiple positions in some given structure are substituted, the substituents may be the same or different at each position. The term “substituted” is considered to encompass substitution by all acceptable substituents of an organic compound and includes any of the substituents described herein that result in the formation of a stable compound. The present invention intends for any and all such combinations to arrive at a stable compound. For the purposes of the present invention, heteroatoms such as nitrogen may have hydrogen substituents and / or any preferred substituents described herein that satisfy the valence of the heteroatom and result in the formation of a stable moiety. The present invention is not intended to be limited in any way by the exemplary substituents described herein.

[0040] Exemplary carbon substituents include halogens, -CN, -NO2, -N3, -SO2H, -SO3H, -OH, and -ORaa 、-ON(R bb )2、-N(R bb )2、-N(R bb )3 + X - 、-N(OR cc )R bb 、-SH、-SR aa 、-SSR cc 、-C(=O)R aa 、-CO2H、-CHO、-C(OR cc )2、-CO2R aa 、-OC(=O)R aa 、-OCO2R aa 、-C(=O)N(R bb )2、-OC(=O)N(R bb )2、-NR bb C(=O)R aa 、-NR bb CO2R aa 、-NR bb C(=O)N(R bb )2、-C(=NR bb )R aa 、-C(=NR bb )OR aa 、-OC(=NR bb )R aa 、-OC(=NR bb )OR aa 、-C(=NR bb )N(R bb )2、-OC(=NR bb )N(R bb )2、-NR bb C(=NR bb )N(R bb )2、-C(=O)NR bb SO2R aa 、-NR bb SO2R aa 、-SO2N(R bb )2、-SO2R aa 、-SO2OR aa 、-OSO2R aa 、-S(=O)R aa 、-OS(=O)R aa 、-Si(R aa )3、-OSi(R aa )3-C(=S)N(R bb )2、-C(=O)SRaa -C(=S)SR aa -SC(=S)SR aa -SC(=O)SR aa -OC(=O)SR aa , -SC(=O)OR aa -SC(=O)R aa -P(=O)2R aa -OP(=O)2R aa -P(=O)(R aa )2, -OP(=O)(R aa )2, -OP(=O)(OR cc )2, -P(=O)2N(R bb )2, -OP(=O)2N(R bb )2, -P(=O)(NR bb )2, -OP(=O)(NR bb )2, -NR bb P(=O)(OR cc )2, -NR bb P(=O)(NR bb )2, -P(R cc )2, -P(R cc )3, -OP(R cc )2, -OP(R cc )3, -B(R aa )2, -B(OR cc )2, -BR aa (OR cc ), C 1-10 Alkyl, C 1-10 Perhaloalkyl, C 2-10 Alkenil, C 2-10 Alkinyl, HeteroC 1-10 Alkyl, hetero C 2-10 Alkenyl, HeteroC 2-10 Alkinyl, C 3-10 Carbocyclyl, 3-14 member heterocyclyl, C 6-14 This includes, but is not limited to, aryls and 5- to 14-membered heteroaryls, and each alkyl, alkenyl, alkynyl, heteroalkyl, heteroalkenyl, heteroalkynyl, carbocykrill, heterocyclyl, aryl, and heteroaryl has 0, 1, 2, 3, 4, or 5 R ddThe groups are independently substituted; or the two geminal hydrogens on the carbon atom are substituted by the groups =O, =S, =NN(R bb )2, =NNR bb C(=O)R aa ,=NNR bb C(=O)OR aa ,=NNR bb S(=O)2R aa ,=NR bb , or =NOR cc It has been replaced by; R aa Each example is independent of C 1-10 Alkyl, C 1-10 Perhaloalkyl, C 2-10 Alkenil, C 2-10 Alkinyl, HeteroC 1-10 Alkyl, hetero C 2-10 Alkenyl, HeteroC 2-10 Alkinyl, C 3-10 Carbocyclyl, 3-14 member heterocyclyl, C 6-14 Selected from aryls and 5- to 14-membered heteroaryls, or two R aa The groups join to form a 3-14 membered heterocyclyl or 5-14 membered heteroaryl ring, and each alkyl, alkenyl, alkynyl, heteroalkyl, heteroalkenyl, heteroalkynyl, carbocykrill, heterocyclyl, aryl, and heteroaryl has 0, 1, 2, 3, 4, or 5 R groups. dd It is independently substituted by the base; R bb Each example is independently of hydrogen, -OH, -OR aa , -N(R cc )2, -CN, -C(=O)R aa -C(=O)N(R cc )2, -CO2R aa , -SO2R aa -C(=NR cc )OR aa -C(=NR cc )N(R cc )2, -SO2N(R cc )2, -SO2R cc , -SO2OR cc -SORaa -C(=S)N(R cc )2, -C(=O)SR cc -C(=S)SR cc -P(=O)2R aa -P(=O)(R aa )2, -P(=O)2N(R cc )2, -P(=O)(NR cc )2, C 1-10 Alkyl, C 1-10 Perhaloalkyl, C 2-10 Alkenil, C 2-10 Alkinyl, HeteroC 1-10 Alkyl, hetero C 2-10 Alkenyl, HeteroC 2-10 Alkinyl, C 3-10 Carbocyclyl, 3-14 member heterocyclyl, C 6-14 Selected from aryls and 5- to 14-membered heteroaryls, or two R bb The groups join to form a 3-14 membered heterocyclyl or 5-14 membered heteroaryl ring, and each alkyl, alkenyl, alkynyl, heteroalkyl, heteroalkenyl, heteroalkynyl, carbocykrill, heterocyclyl, aryl, and heteroaryl has 0, 1, 2, 3, 4, or 5 R groups. dd It is independently substituted by the base; R cc Each example is independent of hydrogen, C 1-10 Alkyl, C 1-10 Perhaloalkyl, C 2-10 Alkenil, C 2-10 Alkinyl, HeteroC 1-10 Alkyl, hetero C 2-10 Alkenyl, HeteroC 2-10 Alkinyl, C 3-10 Carbocyclyl, 3-14 member heterocyclyl, C 6-14 Selected from aryls and 5-14 membered heteroaryls, or two Rcc groups are joined to form a 3-14 membered heterocyclil or 5-14 membered heteroaryl ring, and each alkyl, alkenyl, alkynyl, heteroalkyl, heteroalkenyl, heteroalkynyl, carbocykrill, heterocyclyl, aryl, and heteroaryl has 0, 1, 2, 3, 4, or 5 Rdd It is independently substituted by the base; R dd Each example is independently halogen, -CN, -NO2, -N3, -SO2H, -SO3H, -OH, -OR ee , -ON(R ff )2, -N(R ff )2, -N(R ff )3 + X - , -N(OR ee )R ff -SH, -SR ee -SSR ee -C(=O)R ee -CO2H, -CO2R ee -OC(=O)R ee , -OCO2R ee -C(=O)N(R ff )2, -OC(=O)N(R ff )2, -NR ff C(=O)R ee , -NR ff CO2R ee , -NR ff C(=O)N(R ff )2, -C(=NR ff )OR ee -OC(=NR ff )R ee -OC(=NR ff )OR ee -C(=NR ff )N(R ff )2, -OC(=NR ff )N(R ff )2, -NR ff C(=NR ff )N(R ff )2, -NR ff SO2R ee , -SO2N(R ff )2, -SO2R ee , -SO2OR ee , -OSO2R ee -S(=O)R ee , -Si(R ee )3, -OSi(R ee )3, -C(=S)N(R ff )2, -C(=O)SR ee-C(=S)SR ee -SC(=S)SR ee -P(=O)2R ee -P(=O)(R ee )2, -OP(=O)(R ee )2, -OP(=O)(OR ee )2, C 1-6 Alkyl, C 1-6 Perhaloalkyl, C 2-6 Alkenil, C 2-6 Alkinyl, HeteroC 1-6 Alkyl, hetero C 2-6 Alkenyl, HeteroC 2-6 Alkinyl, C 3-10 Carbocyclyl, 3-10 membered heterocyclyl, C 6-10 Selected from aryls and 5-10 membered heteroaryls, each alkyl, alkenyl, alkynyl, heteroalkyl, heteroalkenyl, heteroalkynyl, carbocykrill, heterocyclyl, aryl, and heteroaryl has 0, 1, 2, 3, 4, or 5 R gg Either independently substituted by the base, or two geminal R dd Substituents can join to form either =O or =S; R ee Each example is independent of C 1-6 Alkyl, C 1-6 Perhaloalkyl, C 2-6 Alkenil, C 2-6 Alkinyl, HeteroC 1-6 Alkyl, hetero C 2-6 Alkenyl, HeteroC 2-6 Alkinyl, C 3-10 Carbocyclyl, C 6-10 Selected from aryls, 3-10 membered heterocyclyls, and 3-10 membered heteroaryls, each alkyl, alkenyl, alkynyl, heteroalkyl, heteroalkenyl, heteroalkynyl, carbocykrill, heterocyclyl, aryl, and heteroaryl has 0, 1, 2, 3, 4, or 5 R gg It is independently substituted by the base; R ff Each example is independent of hydrogen, C 1-6 Alkyl, C 1-6Perhaloalkyl, C 2-6 Alkenil, C 2-6 Alkinyl, HeteroC 1-6 Alkyl, hetero C 2-6 Alkenyl, HeteroC 2-6 Alkinyl, C 3-10 Carbocyclyl, 3-10 membered heterocyclyl, C 6-10 Selected from aryls and 5-10 member heteroaryls, or two R ff The groups join to form a 3-10 membered heterocyclyl or 5-10 membered heteroaryl ring, and each alkyl, alkenyl, alkynyl, heteroalkyl, heteroalkenyl, heteroalkynyl, carbocykrill, heterocyclyl, aryl, and heteroaryl has 0, 1, 2, 3, 4, or 5 R groups. gg It is independently substituted by the base; and R gg Each example is independently halogen, -CN, -NO2, -N3, -SO2H, -SO3H, -OH, -OC 1-6 Alkyl, -ON(C 1-6 Alkyl)2,-N(C 1-6 Alkyl)2,-N(C 1-6 Alkyl)3 + X - , -NH(C 1-6 Alkyl)2 + X - -NH2(C 1-6 Alkyl) + X - , -NH3 + X - , -N(OC 1-6 Alkyl)(C 1-6 Alkyl), -N(OH)(C 1-6 Alkyl), -NH(OH), -SH, -SC 1-6 Alkyl, -SS(C 1-6 Alkyl), -C(=O)(C 1-6 Alkyl), -CO2H, -CO2(C 1-6 Alkyl), -OC(=O)(C 1-6 Alkyl), -OCO2(C 1-6 Alkyl), -C(=O)NH2, -C(=O)N(C 1-6 Alkyl)2,-OC(=O)NH(C1-6 Alkyl), -NHC(=O)(C 1-6 Alkyl), -N(C 1-6 Alkyl)C(=O)(C 1-6 Alkyl), -NHCO2(C 1-6 Alkyl), -NHC(=O)N(C 1-6 Alkyl)2,-NHC(=O)NH(C 1-6 Alkyl), -NHC(=O)NH2, -C(=NH)O(C 1-6 Alkyl), -OC(=NH)(C 1-6 Alkyl), -OC(=NH)OC 1-6 Alkyl, -C(=NH)N(C 1-6 Alkyl)2,-C(=NH)NH(C 1-6 Alkyl), -C(=NH)NH2, -OC(=NH)N(C 1-6 Alkyl)2,-OC(NH)NH(C 1-6 Alkyl), -OC(NH)NH2, -NHC(NH)N(C 1-6 Alkyl)2, -NHC(=NH)NH2, -NHSO2(C 1-6 Alkyl), -SO2N(C 1-6 Alkyl)2,-SO2NH(C 1-6 Alkyl), -SO2NH2, -SO2C 1-6 Alkyl, -SO2OC 1-6 Alkyl, -OSO2C 1-6 Alkyl, -SOC 1-6 Alkyl, -Si(C 1-6 Alkyl)3,-OSi(C 1-6 Alkyl)3-C(=S)N(C 1-6 Alkyl)2, C(=S)NH(C 1-6 Alkyl), C(=S)NH2, -C(=O)S(C 1-6 Alkyl), -C(=S)SC 1-6 Alkyl, -SC(=S)SC 1-6 Alkyl, -P(=O)2(C 1-6 Alkyl), -P(=O)(C 1-6 Alkyl)2, -OP(=O)(C 1-6 Alkyl)2, -OP(=O)(OC 1-6 Alkyl)2, C 1-6 Alkyl, C 1-6Perhaloalkyl, C 2-6 Alkenil, C 2-6 Alkinyl, HeteroC 1-6 Alkyl, hetero C 2-6 Alkenyl, HeteroC 2-6 Alkinyl, C 3-10 Carbocyclyl, C 6-10 It is either an aryl, a 3-10 membered heterocyclyl, a 5-10 membered heteroaryl; or two geminal Rs. gg Substituents can join to form =O or =S; X - It is a counterion.

[0041] The term "halo" or "halogen" refers to fluorine (fluoro, -F), chlorine (chloro, -Cl), bromine (bromo, -Br), or iodine (iod, -I).

[0042] The term "hydroxyl" or "hydroxy" refers to the -OH group. The term "substituted hydroxyl" or "substituted hydroxyl" is extended to refer to a hydroxyl group in which the oxygen atom directly attached to the parent molecule is substituted by a group other than hydrogen, -OR aa , -ON(R bb )2, -OC(=O)SR aa -OC(=O)R aa , -OCO2R aa , -OC(=O)N(R bb )2, -OC(=NR bb )R aa -OC(=NR bb )OR aa -OC(=NR bb )N(R bb )2, -OS(=O)R aa , -OSO2R aa , -OSi(R aa )3, -OP(R cc )2, -OP(R cc )3, -OP(=O)2R aa -OP(=O)(R aa )2, -OP(=O)(OR cc )2, -OP(=O)2N(R bb )2, and -OP(=O)(NR bb) encompasses a group selected from 2, R aa , R bb and R cc This is defined herein.

[0043] The term "amino" refers to the -NH2 group. The term "substituted amino" is extended to refer to monosubstituted amino, disubstituted amino, or trisubstituted amino. In certain aspects, "substituted amino" is a monosubstituted amino group or a disubstituted amino group.

[0044] The term "monosubstituted amino" refers to an amino group in which the nitrogen atom directly attached to the parent molecule is substituted by one hydrogen atom and one non-hydrogen group, i.e., -NH(R bb ), -NHC(=O)R aa ,-NHCO2R aa , -NHC(=O)N(R bb )2, -NHC(=NR bb )N(R bb )2, -NHSO2R aa , -NHP(=O)(OR cc )2, and -NHP(=O)(NR bb ) encompasses a group selected from 2, in the formula R aa , R bb and R cc -NH(R bb ) Base R bb It is not hydrogen.

[0045] The term "disubstituted amino" refers to an amino group in which the nitrogen atom directly attached to the parent molecule is replaced by two groups other than hydrogen, i.e., -N(R bb )2, -NR bb C(=O)R aa , -NR bb CO2R aa , -NR bb C(=O)N(R bb )2, -NR bb C(=NR bb )N(R bb )2, -NR bb SO2R aa , -NR bbP(=O)(OR cc )2, and -NR bb P(=O)(NR bb ) encompasses a group selected from 2, R aa , R bb and R cc This is defined herein, provided that the nitrogen atoms directly attached to the parent molecule are not substituted by hydrogen.

[0046] The term "trisubstituted amino" refers to an amino group in which the nitrogen atom directly attached to the parent molecule is substituted by three groups, i.e., -N(R bb )3 and -N(R bb )3 + X - It includes a group selected from R bb and X - This is defined herein.

[0047] The term "acyl" is derived from the general formula -C(=O)R X1 , -C(=O)OR X1 -C(=O)-OC(=O)R X1 -C(=O)SR X1 -C(=O)N(R X1 )2, -C(=S)R X1 -C(=S)N(R X1 )2, and -C(=S)S(R X1 ), -C(=NR X1 )R X1 -C(=NR X1 )OR X1 -C(=NR X1 )SR X1 , and -C(=NR X1 )N(R X1 ) refers to a group having 2, R X1is hydrogen; halogen; substituted or unsubstituted hydroxyl; substituted or unsubstituted thiol; substituted or unsubstituted amino; substituted or unsubstituted acyl, cyclic or acyclic, substituted or unsubstituted, branched or unbranched aliphatic; cyclic or acyclic, substituted or unsubstituted, branched or unbranched heteroaliphatic; cyclic or acyclic, substituted or unsubstituted, branched or unbranched alkyl; cyclic or acyclic, substituted or unsubstituted, branched or unbranched alkenyl; substituted or unsubstituted alkynyl; substituted or unsubstituted aryl, substituted or unsubstituted heteroaryl, aliphatic oxy, heteroaliphatic oxy, alkyl oxy, heteroalkyl oxy, aryl oxy, heteroaryl oxy, aliphatic thio, heteroaliphatic thio, alkyl thio, heteroalkyl thio, aryl thio, heteroaryl thio, mono- or di-aliphatic amino, mono- or di-heteroaliphatic amino, mono- or di-alkylamino, mono- or di-heteroalkylamino, mono- or di-arylamino, or mono- or di-heteroarylamino; or two R X1The groups combine to form a 5- to 6-membered heterocycle. Exemplary acyl groups include aldehydes (-CHO), carboxylic acids (-CO2H), ketones, acyl halides, esters, amides, imines, carbonates, carbamates, and ureas. The acyl substituents include, but are not limited to, any of the substituents described herein that result in the formation of a stable moiety (for example, aliphatic, alkyl, alkenyl, alkynyl, heteroaliphatic, heterocyclic, aryl, heteroaryl, acyl, oxo, imino, thiooxo, cyano, isocyano, amino, azide, nitro, hydroxyl, thiol, halo, aliphatic amino, heteroaliphatic amino, alkylamino, heteroalkylamino, arylamino, heteroarylamino, alkylaryl, arylalkyl, aliphatic oxy, heteroaliphatic oxy, alkyloxy, heteroalkyloxy, aryloxy, heteroaryloxy, aliphatic thiooxy, heteroaliphatic thiooxy, alkyl thiooxy, heteroalkyl thiooxy, aryl thiooxy, heteroaryl thiooxy, acyloxy, etc., each of which may or may not be further substituted).

[0048] The term "oxo" refers to an oxygen group, while the term "thiooxo" refers to an sulfur group.

[0049] Nitrogen atoms can be substituted or unsubstituted, to the extent their valence allows, and include primary, secondary, tertiary, and quaternary nitrogen atoms. Exemplary nitrogen atom substituents include hydrogen, -OH, and -OR. aa , -N(R cc )2, -CN, -C(=O)R aa -C(=O)N(R cc )2, -CO2R aa , -SO2R aa -C(=NR bb )R aa -C(=NR cc )OR aa -C(=NR cc )N(R cc )2, -SO2N(R cc )2, -SO2R cc , -SO2OR cc-SOR aa -C(=S)N(R cc )2, -C(=O)SR cc -C(=S)SR cc -P(=O)2R aa -P(=O)(R aa )2, -P(=O)2N(R cc )2, -P(=O)(NR cc )2, C 1-10 Alkyl, C 1-10 Perhaloalkyl, C 2-10 Alkenil, C 2-10 Alkinyl, HeteroC 1-10 Alkyl, hetero C 2-10 Alkenyl, HeteroC 2-10 Alkinyl, C 3-10 Carbocyclyl, 3-14 member heterocyclyl, C 6-14 This includes, but is not limited to, aryls and 5-14 member heteroaryls, or two R atoms attached to the N atom. cc The groups are joined to form a 3-14 membered heterocyclyl or 5-14 membered heteroaryl ring, and each alkyl, alkenyl, alkynyl, heteroalkyl, heteroalkenyl, heteroalkynyl, carbocykrill, heterocyclyl, aryl, and heteroaryl has 0, 1, 2, 3, 4, or 5 R groups. dd It is substituted independently by the group, R aa , R bb , R cc and R dd This is as defined above.

[0050] In certain embodiments, substituents present on the nitrogen atom are nitrogen protecting groups (also referred to herein as "amino protecting groups"). Nitrogen protecting groups include -OH, -OR aa , -N(R cc )2, -C(=O)R aa -C(=O)N(R cc )2, -CO2R aa , -SO2R aa -C(=NR cc )R aa -C(=NR cc )OR aa -C(=NRcc )N(R cc )2, -SO2N(R cc )2, -SO2R cc , -SO2OR cc -SOR aa -C(=S)N(R cc )2, -C(=O)SR cc -C(=S)SR cc , C 1-10 Alkyl (e.g., aralkyl, heteroaralkyl), C 2-10 Alkenil, C 2-10 Alkinyl, HeteroC 1-10 Alkyl, hetero C 2-10 Alkenyl, HeteroC 2-10 Alkinyl, C 3-10 Carbocyclyl, 3-14 member heterocyclyl, C 6-14 Including, but not limited to, aryl and 5-14 membered heteroaryl groups, alkenyl, alkynyl, heteroalkyl, heteroalkenyl, heteroalkynyl, carbocykrill, heterocyclyl, aralkyl, aryl and heteroaryl groups have 0, 1, 2, 3, 4 or 5 R dd It is substituted independently by the group, R aa , R bb , R cc and R dd The term is defined herein. Nitrogen protecting groups are well known in the art and are incorporated herein by reference in Protecting Groups in Organic Synthesis, TWGreene and PGMWuts, 3 rd This includes the details described in edition, John Wiley & Sons, 1999.

[0051] For example, an amide group (for example, -C(=O)R aaNitrogen protecting groups such as ) include, but are not limited to, formamide, acetamide, chloroacetamide, trichloroacetamide, trifluoroacetamide, phenylacetamide, 3-phenylpropanamide, picolinamide, 3-pyridylcarboxamide, N-benzoylphenylalanyl derivatives, benzamide, p-phenylbenzamide, o-nitrophenylacetamide, o-nitrophenoxyacetamide, acetamide, (N'-dithiobenzyloxyacylamino)acetamide, 3-(p-hydroxyphenyl)propanamide, 3-(o-nitrophenyl)propanamide, 2-methyl-2-(o-nitrophenoxy)propanamide, 2-methyl-2-(o-phenylazofenoxy)propanamide, 4-chlorobutanamide, 3-methyl-3-nitrobutanamide, o-nitrocinnamide, N-acetylmethionine derivatives, o-nitrobenzamide, and o-(benzoyloxymethyl)benzamide.

[0052] Carbamate group (for example, -C(=O)OR) aaNitrogen protecting groups such as methyl carbamate, ethyl carbamante (carbamante), 9-fluorenyl methyl carbamate (Fmoc), 9-(2-sulfo)fluorenyl methyl carbamate, 9-(2,7-dibromo)fluoroenyl methyl carbamate, 2,7-di-t-butyl-[9-(10,10-dioxo-10,10,10,10-tetrahydrothioxantyl)]methyl carbamate (DBD-Tmoc), 4-methoxyphenan Silcarbamate (Phenoc), 2,2,2-trichloroethylcarbamate (Troc), 2-trimethylsilylethylcarbamate (Teoc), 2-phenylethylcarbamate (hZ), 1-(1-adamantyl)-1-methylethylcarbamate (Adpoc), 1,1-dimethyl-2-haloethylcarbamate, 1,1-dimethyl-2,2-dibromoethylcarbamate (DB-t-BOC), 1,1-dimethyl-2,2,2-trichloroethyl Chilcarbamate (TCBOC), 1-methyl-1-(4-biphenylyl)ethylcarbamate (Bpoc), 1-(3,5-di-t-butylphenyl)-1-methylethylcarbamate (t-Bumeoc), 2-(2'-and 4'-pyridyl)ethylcarbamate (Pyoc), 2-(N,N-dicyclohexylcarboxamide)ethylcarbamate, t-butylcarbamate (BOC or Boc), 1-adamantylcarbamate (Adoc), Vinyl carbamate (Voc), allyl carbamate (Alloc), 1-isopropylallyl carbamate (Ipaoc), cinnamyl carbamate (Coc), 4-nitrocinnamyl carbamate (Noc), 8-quinolyl carbamate, N-hydroxypiperidinyl carbamate, alkyl dithiocarbamate, benzyl carbamate (Cbz), p-methoxybenzyl carbamate (Moz), p-nitobenzyl carbamate, p-bromobenzyl carbamate, p-chlorobenzyl carbamate, 2,4-Dichlorobenzylcarbamate, 4-Methylsulfinylbenzylcarbamate (Msz), 9-Anthrylmethylcarbamate, Diphenylmethylcarbamate, 2-Methylthioethylcarbamate, 2-Methylsulfonylethylcarbamate, 2-(p-Toluenesulfonyl)ethylcarbamate, [2-(1,3-Dithianyl)]methylcarbamate (Dmoc), 4-Methylthiophenylcarbamate (Mtpc), 2,4-Dimethylthiophenylcarbamate (Bmpc), 2-Phosphonioethylcarba Mart (Peoc), 2-triphenylphosphonioisopropylcarbamate (Ppoc), 1,1-dimethyl-2-cyanoethylcarbamate, m-chloro-p-acyloxybenzylcarbamate, p-(dihydroxyboryl)benzylcarbamate, 5-benzisoxazolylmethylcarbamate, 2-(trifluoromethyl)-6-chromonylmethylcarbamate (Tcroc), m-nitrophenylcarbamate, 3,5-dimethoxybenzylcarbamate, o-nitrobenzylcarbamate, 3,4-dimethyl Toxy-6-nitrobenzylcarbamate, phenyl(o-nitrophenyl)methylcarbamate, t-amylcarbamate, S-benzylthiocarbamate, p-cyanobenzylcarbamate, cyclobutylcarbamate, cyclohexylcarbamate, cyclopentylcarbamate, cyclopropylmethylcarbamate, p-decyloxybenzylcarbamate, 2,2-dimethoxyacylvinylcarbamate, o-(N,N-dimethylcarboxamide)benzylcarbamate, 1,1-dimethyl-3-(N,N- Dimethylcarboxamide)propylcarbamate, 1,1-dimethylpropynylcarbamate, di(2-pyridyl)methylcarbamate, 2-furanylmethylcarbamate, 2-iodoethylcarbamate, isobornylcarbamate, isobutylcarbamate, isonicotinylcarbamate, p-(p'-methoxyphenylazo)benzylcarbamate, 1-methylcyclobutylcarbamate, 1-methylcyclohexylcarbamate, 1-methyl-1-cyclopropylmethylcarbamate, 1-methyl-1-(3,This includes, but is not limited to, 5-dimethoxyphenyl)ethyl carbamate, 1-methyl-1-(p-phenylazophenyl)ethyl carbamate, 1-methyl-1-phenylethyl carbamate, 1-methyl-1-(4-pyridyl)ethyl carbamate, phenyl carbamate, p-(phenylazo)benzyl carbamate, 2,4,6-tri-t-butylphenyl carbamate, 4-(trimethylammonium)benzyl carbamate, and 2,4,6-trimethylbenzyl carbamate.

[0053] Sulfonamide group (for example, -S(=O)2R) aa Nitrogen protecting groups such as p-toluenesulfonamide (Ts), benzenesulfonamide, 2,3,6-trimethyl-4-methoxybenzenesulfonamide (Mtr), 2,4,6-trimethoxybenzenesulfonamide (Mtb), 2,6-dimethyl-4-methoxybenzenesulfonamide (Pme), 2,3,5,6-tetramethyl-4-methoxybenzenesulfonamide (Mte), 4-methoxybenzenesulfonamide (Mbs), 2,4,6-trimethylbenzenesulfonamide (Mts), 2 This includes, but is not limited to, 6-dimethoxy-4-methylbenzenesulfonamide (iMds), 2,2,5,7,8-pentamethylchroman-6-sulfonamide (Pmc), methanesulfonamide (Ms), β-trimethylsilylethanesulfonamide (SES), 9-anthracenesulfonamide, 4-(4',8'-dimethoxynaphthylmethyl)benzenesulfonamide (DNMBS), benzylsulfonamide, trifluoromethylsulfonamide, and phenacylsulfonamide.

[0054] Other nitrogen protecting groups include phenothiazinyl-(10)-acyl derivatives, N'-p-toluenesulfonylaminoacyl derivatives, N'-phenylaminothioacyl derivatives, N-benzoylphenylalanyl derivatives, N-acetylmethionine derivatives, 4,5-diphenyl-3-oxazolin-2-one, N-phthalimide, N-dithiasuccinimide (Dts), N-2,3-diphenylmaleimide, N-2,5-dimethylpyrrole, and N-1,1,4,4-tetramethyldisilylazacyl Lopentan adduct (STABASE), 5-substituted 1,3-dimethyl-1,3,5-triazacyclohexane-2-one, 5-substituted 1,3-dibenzyl-1,3,5-triazacyclohexane-2-one, 1-substituted 3,5-dinitro-4-pyridone, N-methylamine, N-allylamine, N-[2-(trimethylsilyl)ethoxy]methylamine (SEM), N-3-acetoxypropylamine, N-(1-isopropyl-4-nitro-2-oxo-3-pyrroline-3-yl)amine N-, quaternary ammonium salts, N-benzylamine, N-di(4-methoxyphenyl)methylamine, N-5-dibenzosperylamine, N-triphenylmethylamine (Tr), N-[(4-methoxyphenyl)diphenylmethyl]amine (MMTr), N-9-phenylfluorenylamine (PhF), N-2,7-dichloro-9-fluorenylmethyleneamine, N-ferrocenylmethylamino (Fcm), N-2-picolylamino N'-oxide, N-1,1-dimethylthiomethylamine N-Tyleneamine, N-Benzylideneamine, Np-Methoxybenzylideneamine, N-Diphenylmethyleneamine, N-[(2-Pyridyl)Mesityl]methyleneamine, N-(N',N'-Dimethylaminomethylene)amine, N,N'-Isopropylidenediamine, Np-Nitrobenzylideneamine, N-Salicylideneamine, N-5-Chlorosalicylideneamine, N-(5-Chloro-2-Hydroxyphenyl)phenylmethyleneamine, N-Cyclohexylideneamine, N-(5,This includes, but is not limited to, 5-dimethyl-3-oxo-1-cyclohexenyl)amine, N-borane derivatives, N-diphenylboric acid derivatives, N-[phenyl(pentaacylchromium- or tungsten)acyl]amine, N-copper chelate, N-zinc chelate, N-nitroamine, N-nitrosamine, amine N-oxide, diphenylphosphinamide (Dpp), dimethylthiophosphinamide (Mpt), diphenylthiophosphinamide (Ppt), dialkylphosphoramidates, dibenzylphosphoramidates, diphenylphosphoramidates, benzenesulfenamide, o-nitrobenzenesulfenamide (Nps), 2,4-dinitrobenzenesulfenamide, pentachlorobenzenesulfenamide, 2-nitro-4-methoxybenzenesulfenamide, triphenylmethylsulfenamide, and 3-nitropyridinesulfenamide (Npys).

[0055] In certain embodiments, the substituent present on the oxygen atom is an oxygen protecting group (also referred to herein as a "hydroxyl protecting group"). The oxygen protecting group is -R aa , -N(R bb )2, -C(=O)SR aa -C(=O)R aa , -CO2R aa -C(=O)N(R bb )2, -C(=NR bb )R aa -C(=NR bb )OR aa -C(=NR bb )N(R bb )2, -S(=O)R aa , -SO2R aa , -Si(R aa )3, -P(R cc )2, -P(R cc )3, -P(=O)2R aa -P(=O)(R aa )2, -P(=O)(OR cc )2, -P(=O)2N(R bb )2, and -P(=O)(NR bb )Includes, but is not limited to, R aa , Rbb and R cc The oxygen protecting group is as defined herein. The oxygen protecting group is well known in the art and is incorporated herein by reference in Protecting Groups in Organic Synthesis, TWGreene and PGMWuts, 3 rd This includes the details described in edition, John Wiley & Sons, 1999.

[0056] Exemplary oxygen protecting groups include methyl, methoxymethyl (MOM), methylthiomethyl (MTM), t-butylthiomethyl, (phenyldimethylsilyl)methoxymethyl (SMOM), benzyloxymethyl (BOM), p-methoxybenzyloxymethyl (PMBM), (4-methoxyphenoxy)methyl (p-AOM), guaiacolmethyl (GUM), t-butoxymethyl, 4-pentenyloxymethyl (POM), siloxymethyl, 2-methoxyethoxymethyl (MEM), 2, 2,2-Trichloroethoxymethyl, Bis(2-chloroethoxy)methyl, 2-(trimethylsilyl)ethoxymethyl (SEMOR), Tetrahydropyranyl (THP), 3-Bromotetrahydropyranyl, Tetrahydrothiopyranyl, 1-Methoxycyclohexyl, 4-Methoxytetrahydropyranyl (MTHP), 4-Methoxytetrahydrothiopyranyl, 4-Methoxytetrahydrothiopyranyl S,S-Dioxide, 1-[(2-chloro-4-methyl)phenyl]-4-Meth Xypiperidine-4-yl (CTMP), 1,4-dioxan-2-yl, tetrahydrofuranyl, tetrahydrothiofuranyl, 2,3,3a,4,5,6,7,7a-octahydro-7,8,8-trimethyl-4,7-methanebenzofuran-2-yl, 1-ethoxyethyl, 1-(2-chloroethoxy)ethyl, 1-methyl-1-methoxyethyl, 1-methyl-1-benzyloxyethyl, 1-methyl-1-benzyloxy-2-fluoroethyl, 2,2,2-trichloroethyl , 2-trimethylsilylethyl, 2-(phenylselenyl)ethyl, t-butyl, allyl, p-chlorophenyl, p-methoxyphenyl, 2,4-dinitrophenyl, benzyl (Bn), p-methoxybenzyl, 3,4-dimethoxybenzyl, o-nitrobenzyl, p-nitrobenzyl, p-halobenzyl, 2,6-dichlorobenzyl, p-cyanobenzyl, p-phenylbenzyl, 2-picolyl, 4-picolyl, 3-methyl-2-picolyl N-oxide, diphenylmethyl, p,p'-Dinitrobenzidyl, 5-Dibenzosberyl, Triphenylmethyl, α-Naphthyldiphenylmethyl, p-Methoxyphenyldiphenylmethyl, Di(p-Methoxyphenyl)phenylmethyl, Tri(p-Methoxyphenyl)methyl, 4-(4'-Bromophenacyloxyphenyl)diphenylmethyl, 4,4',4”-Tris(4,5-Dichlorophthalimidophenyl)methyl, 4,4',4”-Tris(Lubrinoyloxyphenyl)methyl, 4,4',4”-Tris(Benzoyloxyphenyl)methyl Tyl, 3-(imidazole-1-yl)bis(4',4"-dimethoxyphenyl)methyl, 1,1-bis(4-methoxyphenyl)-1'-pyrenylmethyl, 9-antryl, 9-(9-phenyl)xanthenyl, 9-(9-phenyl-10-oxo)antryl, 1,3-benzodithiolan-2-yl, benzisothiazolyl S,S-dioxide, trimethylsilyl (TMS), triethylsilyl (TES), triisopropylsilyl (TIPS), dimethylisopropylsilyl (IPDMS), diethylisopropyl Ropyrsilyl (DEIPS), Dimethyltexylsilyl, t-Butyldimethylsilyl (TBDMS), t-Butyldiphenylsilyl (TBDPS), Tribenzylsilyl, Tri-p-Xylylsilyl, Triphenylsilyl, Diphenylmethylsilyl (DPMS), t-Butylmethoxyphenylsilyl (TBMPS), Formate, Benzoylformate, Acetate, Chloroacetate, Dichloroacetate, Trichloroacetate, Trifluoroacetate, Methoxyacetate, Triphenylmethoxyacetate Phenoxyacetate, p-chlorophenoxyacetate, 3-phenylpropionate, 4-oxopentanoate (rebrinate), 4,4-(ethylenedithio)pentanoate (rebrinoyldithioacetal), pivaloate, adamantate, crotonate, 4-methoxycrotonate, benzoate, p-phenylbenzoate, 2,4,6-trimethylbenzoate (methitoate), methylcarbonate, 9-fluorenylmethylcarbonate (Fmoc), ethylcarbonate, 2,2,2-Trichloroethyl carbonate (Troc), 2-(trimethylsilyl)ethyl carbonate (TMSEC), 2-(phenylsulfonyl)ethyl carbonate (Psec), 2-(triphenylphosphonio)ethyl carbonate (Peoc), isobutyl carbonate, vinyl carbonate, allyl carbonate, t-butyl carbonate (BOC or Boc), p-nitrophenyl carbonate, benzyl carbonate, p- Methoxybenzylcarbonate, 3,4-dimethoxybenzylcarbonate, o-nitrobenzylcarbonate, p-nitrobenzylcarbonate, S-benzylthiocarbonate, 4-ethoxy-1-naphthylcarbonate, methyldithiocarbonate, 2-indobenzoate, 4-azidobutyrate, 4-nitro-4-methylpentanoate, o-(dibromomethyl)benzoate, 2-formylbenzenesulfonate, 2-(methyl This includes, but is not limited to, ethylthiomethoxyethyl, 4-(methylthiomethoxy)butyrate, 2-(methylthiomethoxymethyl)benzoate, 2,6-dichloro-4-methylphenoxyacetate, 2,6-dichloro-4-(1,1,3,3-tetramethylbutyl)phenoxyacetate, 2,4-bis(1,1-dimethylpropyl)phenoxyacetate, chlorodiphenylacetate, isobutyrate, monosuccinate, (E)-2-methyl-2-butenoate, o-(methoxyacyl)benzoate, α-naphthate, nitrate, alkyl N,N,N',N'-tetramethylphosphodiamidate, alkyl N-phenylcarbamate, borate, dimethylphosphinthioyl, alkyl 2,4-dinitrophenylsulfenate, sulfate, methanesulfonate (mesylate), benzylsulfonate, and tosylate (Ts). ,

[0057] In certain embodiments, substituents present on a sulfur atom are sulfur protecting groups (also called "thiol protecting groups"). Sulfur protecting groups are -R aa , -N(R bb )2, -C(=O)SR aa -C(=O)R aa , -CO2R aa -C(=O)N(R bb)2, -C(=NR bb )R aa -C(=NR bb )OR aa -C(=NR bb )N(R bb )2, -S(=O)R aa , -SO2R aa , -Si(R aa )3, -P(R cc )2, -P(R cc )3, -P(=O)2R aa -P(=O)(R aa )2, -P(=O)(OR cc )2, -P(=O)2N(R bb )2, and -P(=O)(NR bb )Includes, but is not limited to, R aa , R bb and R cc The term is as defined herein. Sulfur protecting groups are well known in the art and are incorporated herein by reference in Protecting Groups in Organic Synthesis, TWGreene and PGMWuts, 3 rd This includes the details described in edition, John Wiley & Sons, 1999.

[0058] As used herein, the term "salt" refers to all salts, encompassing all pharmaceutically acceptable salts.

[0059] The term "pharmaceutically acceptable salt" refers to a salt that, within the bounds of sound medical judgment, is suitable for use in contact with human and lower animal tissues without excessive toxicity, irritation, allergic reactions, etc., and that is commensurate with a reasonable benefit / risk ratio. pharmaceutically acceptable salts are well known in the art. For example, Berge et al. describe pharmaceutically acceptable salts in detail in J. Pharmaceutical Sciences, 1977, 66, 1-19, which is incorporated herein by reference. pharmaceutically acceptable salts of the compounds of the present invention include those derived from suitable inorganic and organic acids and bases. Examples of pharmaceutically acceptable non-toxic acid addition salts are salts of amino groups formed by using inorganic acids such as hydrochloric acid, hydrobromic acid, phosphoric acid, sulfuric acid, and perchloric acid, or organic acids such as acetic acid, oxalic acid, maleic acid, tartaric acid, citric acid, succinic acid, or malonic acid, or by using other methods known in the art, such as ion exchange. Other pharmaceutically acceptable salts include adipine, alginate, ascorbate, aspartate, benzenesulfonate, benzoate, bisulfate, borate, butyrate, camphor, camphor sulfonate, citrate, cyclopentanepropionate, digluconate, dodecyl sulfate, ethanesulfonate, formate, fumarate, glucoheptonate, glycerophosphate, gluconate, hemisulfate, heptanoate, hexanoate, hydroiodide, 2-hydroxyethanesulfonate, and lac. This includes tobionates, laurates, lauryl sulfates, malates, maleates, malons, methanesulfons, 2-naphthalenesulfons, nicotinates, nitrates, oleates, oxalates, palmitates, pamoates, pectates, persulfates, persulfates, 3-phenylpropionates, phosphates, picrates, pivalates, propions, stearates, succinates, sulfates, tartrates, thiocyans, p-toluenesulfons, undecanoates, valersates, etc. Salts derived from suitable bases include alkali metals, alkaline earth metals, ammonium and N + (C 1-4 Alkyl)4 -This includes salts. Typical alkali metal salts or alkaline earth metal salts include sodium, lithium, potassium, calcium, and magnesium. Further pharmaceutically acceptable salts include non-toxic ammonium, quaternary ammonium, and amine cations formed using counterions such as halides, hydroxides, carboxylates, sulfates, phosphates, nitrates, lower alkyl sulfons, and aryl sulfons, where appropriate.

[0060] The term “solvate” typically refers to a compound or a salt thereof that associates with a solvent by solvolysis. This physical association may include hydrogen bonding. Conventional solvents include water, methanol, ethanol, acetic acid, DMSO, THF, diethyl ether, and the like. The compounds described herein may, for example, be prepared in crystalline form and then solvated. Preferred solvates include pharmaceutically acceptable solvates and further include both stoichiometric and non-stoichiometric solvates. In certain examples, solvates can be isolated, for example, when one or more solvent molecules are incorporated into the crystal lattice of a crystalline solid. “Solvates” encompass both solution-phase solvates and isolable solvates. Representative solvates include hydrates, ethanolates, and methanolates.

[0061] The term "hydrate" refers to a compound that associates with water. Typically, the number of water molecules contained in a compound hydrate is in a constant ratio to the number of compound molecules in the hydrate. Thus, a compound hydrate may be represented, for example, by the general formula R·xH2O, where R is the compound and x is a number greater than 0. A given compound may form several types of hydrates, including, for example, monohydrate (x is 1), lower hydrate (x is a number greater than 0 and less than 1, for example, hemihydrate (R·0.5H2O)), and polyhydrate (x is a number greater than 1, for example, dihydrate (R·2H2O) and hexahydrate (R·6H2O)).

[0062] The terms "tautomer" or "tautomerism" refer to two or more interconvertible compounds resulting from the formal transfer of at least one hydrogen atom and at least one change in valence (e.g., a single bond to a double bond, a triple bond to a single bond, or vice versa). The exact ratio of tautomers depends on several factors, including temperature, solvent, and pH. Tautomerization (i.e., a reaction that yields a tautomer pair) may be catalyzed by an acid or a base. Exemplary tautomerizations include keto-enol, amide-imide, lactam-lactim, enamine-imine, and enamine-(different enamine) tautomerizations.

[0063] It should be understood that compounds having the same molecular formula but differing in the bonding properties or arrangement of their atoms, or in the spatial arrangement of those atoms, are also called "isomers." Isomers that differ in the spatial arrangement of their atoms are called "stereoisomers."

[0064] Stereoisomers that are not mirror images of each other are called "diastereomers," while stereoisomers that are mirror images of each other but cannot be superimposed are called "enantiomers." If a compound has a chiral center, for example, if it is bonded to four different groups, a pair of enantiomers is possible. Enantiomers can be characterized by the absolute configuration of their chiral center, described by Cahn and Prelog's R and S sequencing rules, or by the way the molecule rotates its plane of polarization, and are called dextrorotatory or levorotatory (i.e., as (+) or (-)-isomers, respectively). Chiral compounds can exist as individual enantiomers or mixtures thereof. A mixture containing equal proportions of enantiomers is called a "racemic mixture."

[0065] The term "polymorph" refers to the crystalline form of a compound (or its salts, hydrates, or solvates). All polymorphs have the same elemental composition. Different crystalline forms typically have different X-ray diffraction patterns, infrared spectra, melting points, densities, hardness, crystal shape, optical and electrical properties, stability, and solubility. One crystalline form may become dominant depending on the recrystallization solvent, crystallization rate, storage temperature, and other factors. Various polymorphs of a compound can be prepared by crystallization under different conditions.

[0066] The term “prodrug” refers to a compound that has a cleavable group and is pharmaceutically active in vivo by solvolysis or under physiological conditions to become the compounds described herein. Such examples include, but are not limited to, choline ester derivatives and N-alkylmorpholine esters. Other derivatives of the compounds described herein are active in both their acidic and acid derivative forms, but the acid-sensitive form often offers advantages in solubility, histocompatibility, or delayed release in mammalian organisms (see Bundgard, H., Design of Prodrugs, pp. 7-9, 21-24, Elsevier, Amsterdam 1985). Prodrugs include, for example, acid derivatives well known to those skilled in the art, such as esters prepared by the reaction of a hydrophilic acid with a suitable alcohol, or amides prepared by the reaction of a hydrophilic compound with a substituted or unsubstituted amine or acid anhydride or mixed anhydride. Simple aliphatic or aromatic esters, amides, and anhydrides derived from the acidic group suspended in the compounds described herein are certain prodrugs. In some cases, it is desirable to prepare a double ester type prodrug such as an (acyloxy)alkyl ester or an ((alkoxycarbonyl)oxy)alkyl ester. C of the compounds described herein 1-8 Alkyl, C2-8 alkenyl, C 2-8 Alkinyl, aryl, C 7-12 Substitution aryl and C 7- C 12 Arylalkyl esters are sometimes preferred.

[0067] The “target” to which the drug is intended to be administered refers to humans (i.e., males or females of any age group, e.g., pediatric subjects (e.g., infants, children, or adolescents), or adult subjects (e.g., young adults, middle-aged adults, or elderly adults)), or non-human animals. In certain embodiments, non-human animals are mammals (e.g., primates (e.g., crab-eating macaques or rhesus macaques), commercially viable mammals (e.g., cattle, pigs, horses, sheep, goats, cats, or dogs), or birds (e.g., commercially viable birds such as chickens, ducks, geese, or turkeys). In certain embodiments, non-human animals are fish, reptiles, or amphibians. Non-human animals may be male or female at any developmental stage. Non-human animals may be transgenic animals or genetically modified animals.

[0068] The terms "disease," "disorder," and "condition" are used interchangeably in this specification.

[0069] The terms “administer,” “dosing,” or “administer” refer to embedding, absorbing, ingesting, injecting, inhaling, or otherwise introducing the compounds or compositions described herein into or onto an object.

[0070] As used herein, unless otherwise specified, the terms “to treat,” “to treat,” and “treatment” refer to actions that occur while a subject is suffering from a specified infectious disease or inflammatory condition, and that are intended to reduce the severity of the infectious disease or inflammatory condition or to delay or slow the progression of the infectious disease or inflammatory condition ("therapeutic treatment"), as well as actions that occur before a subject begins to suffer from a specified infectious disease or inflammatory condition ("preventive treatment").

[0071] Generally, the “effective dose” of a compound refers to an amount sufficient to induce a desired biological response. As those skilled in the art will understand, the effective dose of the compound of the present invention may vary depending on factors such as the desired biological endpoint, the pharmacokinetics of the compound, the disease being treated, the mode of administration, and the age, health status, and condition of the subject. The effective dose encompasses both therapeutic and prophylactic treatments.

[0072] As used herein, unless otherwise specified, the “therapeutic dose” of a compound is an amount sufficient to provide a therapeutic benefit in the treatment of an infectious disease or inflammatory condition, or to delay or minimize one or more symptoms associated with an infectious disease or inflammatory condition. The therapeutic dose of a compound means the amount of the therapeutic agent, either alone or in combination with other therapies, that provides a therapeutic benefit in the treatment of an infectious disease or inflammatory condition. The term “therapeutic dose” may encompass amounts that improve overall treatment, reduce or avoid symptoms or causes of an infectious disease or inflammatory condition, and / or enhance the therapeutic efficacy of another therapeutic agent.

[0073] As used herein, unless otherwise specified, the “protective dose” of a compound is an amount sufficient to prevent or prevent the recurrence of one or more symptoms associated with an infectious disease or inflammatory condition, or an infectious disease or inflammatory condition. The protective dose of a compound means the amount of the therapeutic agent, either alone or in combination with other agents, that provides a protective benefit in the prevention of an infectious disease or inflammatory condition. The term “protective dose” may encompass amounts that improve overall protection or enhance the protective efficacy of another prophylactic agent.

[0074] The attached drawings are not drawn to scale. In the drawings, identical or nearly identical components shown in various figures are represented by similar numbers. For clarity, not all components may be labeled in all drawings. In the drawings: [Brief explanation of the drawing]

[0075] Simple description of the drawing [Figure 1A-1B] Figures 1A–1M illustrate the establishment of a cell-based phenotypic small molecule screening platform using the ATG9A translocation as a substitute for AP-4 function, and the primary screening of 28,864 novel small molecule compounds. Figure 1A outlines the primary screening of 28,864 novel small molecule compounds in fibroblasts from patients with AP-4-HSP resulting from a biallelelic loss-of-function mutant in AP4B1. Figure 1B shows a diagram of the automated image analysis pipeline. Representative images of fibroblasts from patients with HSP-SPG47 (negative control, LoF / LoF) and their sex-matched heterozygous parents (positive control, WT / LoF) are shown. Four markers, including phalloidin, DAPI, TGN, and ATG9A, are captured. TGN and ATG9A channels are further illustrated in grayscale. Through a series of masks, the intracellular distribution of ATG9A was calculated at the individual cell level using thousands to millions of cells per experiment. Scale bar: 20 μm. [Figure 1C] Figures 1A–1M show the establishment of a cell-based phenotypic small molecule screening platform using the ATG9A translocation as a substitute for AP-4 function, and the primary screening of 28,864 novel small molecule compounds. Figure 1C shows an overview of the high-throughput platform and workflow. The assay was miniaturized to 96 or 384-well microplates. Cells were stained using an automated liquid handler and imaged using an automated high-content confocal microscope, followed by automated image analysis. The primary metric was the "ATG9A ratio," calculated by dividing the ATG9A fluorescence intensity inside the TGN by the ATG9A fluorescence intensity in the cytoplasm. [Figure 1D-1I]Figures 1A–1M show the establishment of a cell-based phenotypic small molecule screening platform using the ATG9A translocation as a substitute for AP-4 function, and the primary screening of 28,864 novel small molecule compounds. Figures 1D–1F show the distribution of ATG9A fluorescence intensity inside (Figure 1D) and outside (Figure 1E) the TGN, and the ATG9A ratio (Figure 1F) is shown for each cell. 99,927 WT / LoF cells and 119,522 LoF / LoF cells were quantified. Figure 1G shows that the cell number was measured for each experimental well. 1312 wells were analyzed for each condition. Figures 1H and 1I show that repeat plots were generated by random sampling of 82 plates from the primary screening in two groups. Similar locations on the assay plate were plotted against each other with respect to ATG9A fluorescence intensity inside the TGN (Figure 1H) and the ATG9A ratio (Figure 1I). The repeated correlation of both analytical strategies was evaluated by averaging the Pearson correlation coefficients of 100 randomly sampled trials. The ATG9A ratio showed a mean Pearson correlation coefficient (r) of 0.9, while ATG9A fluorescence within the TGN showed a mean r of 0.82. [Figure 1J-1L]Figures 1A–1M show the establishment of a cell-based phenotypic small molecule screening platform using the ATG9A translocation as a substitute for AP-4 function, and the primary screening of 28,864 novel small molecule compounds. Figure 1J demonstrates the discriminative power of the ATG9A ratio in separating positive and negative controls. Statistical testing was performed using a t-test. Quantification was performed using a well-by-well method. 1312 wells were included for each condition. Positive and negative controls showed robust separation (p<0.0001). Figure 1K shows that to test the robustness of the separation of the ATG9A ratio between positive controls (WT / LoF) and negative controls (LoF / LoF), a dataset containing measurements from 99,927 WT / LoF cells and 119,522 LoF / LoF cells was split into a training set (70% of the data) and a test set (30%). A generalized linear model was trained using the training set. The performance of the predictive model using the test set is shown in (Figure 1K). The AUC was 0.96. Figure 1L shows the effects of 28,864 compounds applied at a concentration of 10 μM for 24 hours. The Z-score and ATG9A ratio of the primary metric are shown. All data points represent the mean per well. The mean of the positive control (WT / LoF) is shown as the gray dotted line indicated by "A". The gray shaded area of ​​"A" represents ±1 SD. Active compounds were a priori defined as those that reduce the ATG9A ratio by at least 3 SD compared to the negative control. Toxicity was defined as a reduction in cell number of at least 2 SD compared to the negative control. 501 compounds exhibited activity by reducing the ATG9A ratio by more than 3 SD. [Figure 1M] Figures 1A–1M show the establishment of a cell-based phenotypic small molecule screening platform using the ATG9A translocation as a substitute for AP-4 function, and the primary screening of 28,864 novel small molecule compounds. Figure 1M shows the distribution of Z-scores for all 27,412 non-toxic compounds. Active compounds are highlighted in dark gray. [Figure 2A]Figures 2A–2C show that counterscreening in AP-4-HSP patient-derived fibroblasts identified 16 compounds that result in dose-dependent redistribution of ATG9A. Figure 2A provides an overview of the counterscreening of 503 active compounds identified in the primary screening. To assess dose-dependent effects, compounds were screened in AP-4-HSP patient-derived fibroblasts in 384-well microplates using 11 titrations ranging from 40 nM to 40 μM. All concentrations were screened in double cycles. Active compounds were a priori defined as those that reduced the ATG9A ratio by at least 3 SD compared to a negative control at multiple concentrations. Toxicity was defined as a reduction in cell number of at least 2 SD compared to a negative control. 51 compounds demonstrated clear and reproducible dose-response relationships and did not raise suspicion of autofluorescence in automated and manual reviews. 34 compounds exhibited autofluorescence or produced imaging artifacts. One active compound was unavailable from the manufacturer and was therefore excluded from subsequent testing. [Figure 2B] Figures 2A–2C show that counterscreening in fibroblasts derived from AP-4-HSP patients identified 16 compounds that induce dose-dependent redistribution of ATG9A. Figure 2B shows the baseline difference in ATG9A distribution between WT / LoF (n=269) and LoF / LoF (n=269) fibroblasts. Statistical testing was performed using t-tests. Positive and negative controls showed robust separation (p<0.0001). [Figure 2C-1]Figures 2A–2C show that counterscreening in fibroblasts derived from AP-4-HSP patients identified 16 compounds that result in dose-dependent redistribution of ATG9A. Figure 2C shows dose-response curves fitted using a four-parameter logistic regression model, and then the ED50 concentrations were calculated. All concentrations were tested in biological doubles. Most ED50s were in the low micromolar range (median: 4.66 μM, IQR: 8.63). The black dashed line represents the a priori defined threshold of + / - 3SD compared to the negative control (LoF / LoF). The triangle represents the toxic concentration based on the a priori defined threshold of at least 2 SD of cell count reduction compared to the negative control. The "B" dashed line represents the mean of the negative control, while the "A" dashed line illustrates the mean of the positive control (WT / LoF). A representative image of the ED50 is shown for each active compound. Representative images show the merge of four channels: phalloidin, DAPI, TGN, and ATG9A, as well as the TGN and ATG9A channels in grayscale. [Figure 2C-2] Figures 2A–2C show that counterscreening in fibroblasts derived from AP-4-HSP patients identified 16 compounds that result in dose-dependent redistribution of ATG9A. Figure 2C shows dose-response curves fitted using a four-parameter logistic regression model, and then the ED50 concentrations were calculated. All concentrations were tested in biological doubles. Most ED50s were in the low micromolar range (median: 4.66 μM, IQR: 8.63). The black dashed line represents the a priori defined threshold of + / - 3SD compared to the negative control (LoF / LoF). The triangle represents the toxic concentration based on the a priori defined threshold of at least 2 SD of cell count reduction compared to the negative control. The "B" dashed line represents the mean of the negative control, while the "A" dashed line illustrates the mean of the positive control (WT / LoF). A representative image of the ED50 is shown for each active compound. Representative images show the merge of four channels: phalloidin, DAPI, TGN, and ATG9A, as well as the TGN and ATG9A channels in grayscale. [Figure 2C-3] Figures 2A–2C show that counterscreening in fibroblasts derived from AP-4-HSP patients identified 16 compounds that result in dose-dependent redistribution of ATG9A. Figure 2C shows dose-response curves fitted using a four-parameter logistic regression model, and then the ED50 concentrations were calculated. All concentrations were tested in biological doubles. Most ED50s were in the low micromolar range (median: 4.66 μM, IQR: 8.63). The black dashed line represents the a priori defined threshold of + / - 3SD compared to the negative control (LoF / LoF). The triangle represents the toxic concentration based on the a priori defined threshold of at least 2 SD of cell count reduction compared to the negative control. The "B" dashed line represents the mean of the negative control, while the "A" dashed line illustrates the mean of the positive control (WT / LoF). A representative image of the ED50 is shown for each active compound. Representative images show the merge of four channels: phalloidin, DAPI, TGN, and ATG9A, as well as the TGN and ATG9A channels in grayscale. [Figure 2C-4]Figures 2A–2C show that counterscreening in fibroblasts derived from AP-4-HSP patients identified 16 compounds that result in dose-dependent redistribution of ATG9A. Figure 2C shows dose-response curves fitted using a four-parameter logistic regression model, and then the ED50 concentrations were calculated. All concentrations were tested in biological doubles. Most ED50s were in the low micromolar range (median: 4.66 μM, IQR: 8.63). The black dashed line represents the a priori defined threshold of + / - 3SD compared to the negative control (LoF / LoF). The triangle represents the toxic concentration based on the a priori defined threshold of at least 2 SD of cell count reduction compared to the negative control. The "B" dashed line represents the mean of the negative control, while the "A" dashed line illustrates the mean of the positive control (WT / LoF). A representative image of the ED50 is shown for each active compound. Representative images show the merge of four channels: phalloidin, DAPI, TGN, and ATG9A, as well as the TGN and ATG9A channels in grayscale. [Figure 2C-5] Figures 2A–2C show that counterscreening in fibroblasts derived from AP-4-HSP patients identified 16 compounds that result in dose-dependent redistribution of ATG9A. Figure 2C shows dose-response curves fitted using a four-parameter logistic regression model, and then the ED50 concentrations were calculated. All concentrations were tested in biological doubles. Most ED50s were in the low micromolar range (median: 4.66 μM, IQR: 8.63). The black dashed line represents the a priori defined threshold of + / - 3SD compared to the negative control (LoF / LoF). The triangle represents the toxic concentration based on the a priori defined threshold of at least 2 SD of cell count reduction compared to the negative control. The "B" dashed line represents the mean of the negative control, while the "A" dashed line illustrates the mean of the positive control (WT / LoF). A representative image of the ED50 is shown for each active compound. Representative images show the merge of four channels: phalloidin, DAPI, TGN, and ATG9A, as well as the TGN and ATG9A channels in grayscale. [Figure 2C-6] Figures 2A–2C show that counterscreening in fibroblasts derived from AP-4-HSP patients identified 16 compounds that result in dose-dependent redistribution of ATG9A. Figure 2C shows dose-response curves fitted using a four-parameter logistic regression model, and then the ED50 concentrations were calculated. All concentrations were tested in biological doubles. Most ED50s were in the low micromolar range (median: 4.66 μM, IQR: 8.63). The black dashed line represents the a priori defined threshold of + / - 3SD compared to the negative control (LoF / LoF). The triangle represents the toxic concentration based on the a priori defined threshold of at least 2 SD of cell count reduction compared to the negative control. The "B" dashed line represents the mean of the negative control, while the "A" dashed line illustrates the mean of the positive control (WT / LoF). A representative image of the ED50 is shown for each active compound. Representative images show the merge of four channels: phalloidin, DAPI, TGN, and ATG9A, as well as the TGN and ATG9A channels in grayscale. [Figure 3A-3B] Figures 3A–3O show that five active compounds were identified by orthogonal assays in AP4B1KO SH-SY5Y cells. Figure 3A outlines the orthogonal screening of 16 active compounds in differentiated AP4B1KO SH-SY5Y cells, an AP-4 deficient neuronal model. Active compounds were a priori defined as those that reduced the ATG9A ratio by at least 3 SD compared to negative controls. Toxicity was defined as a reduction in cell number by at least 2 SD compared to negative controls. Figure 3B shows the baseline difference in the ATG9A ratio of AP4B1WT versus AP4B1KO SH-SY5Y cells quantified from 160 AB4B1WT wells and 158 AB4B1KO wells from five assay plates. Statistical testing was performed using t-tests. Positive and negative controls showed robust separation (p<0.0001). [Figure 3C-3D]Figures 3A–3O show that five active compounds were identified by orthogonal assays in AP4B1KO SH-SY5Y cells. Figures 3C–3G show dose-response curves of the ATG9A ratio in AB4B1KO cells treated with different compounds. Data points represent the mean per well from three different assay plates. Dashed lines show the mean Z-scores of positive ("A") and negative ("B") controls. Shaded areas represent ±1 SD. [Figure 3E-3F] Figures 3A–3O show that five active compounds were identified by orthogonal assays in AP4B1KO SH-SY5Y cells. Figures 3C–3G show dose-response curves of the ATG9A ratio in AB4B1KO cells treated with different compounds. Data points represent the mean per well from three different assay plates. Dashed lines show the mean Z-scores of positive ("A") and negative ("B") controls. Shaded areas represent ±1 SD. [Figure 3G] Figures 3A–3O show that five active compounds were identified by orthogonal assays in AP4B1KO SH-SY5Y cells. Figures 3C–3G show dose-response curves of the ATG9A ratio in AB4B1KO cells treated with different compounds. Data points represent the mean per well from three different assay plates. Dashed lines show the mean Z-scores of positive ("A") and negative ("B") controls. Shaded areas represent ±1 SD. [Figure 3H] Figures 3A–3O show the identification of five active compounds by orthogonal assay in AP4B1KO SH-SY5Y cells. Figure 3H shows representative images of the intracellular ATG9A distribution of each compound. The merged image shows beta-3 tubulin, DAPI, TGN, and ATG9A. TGN and ATG9A channels are further illustrated separately in grayscale. Scale bar: 10 μm. [Figure 3I-3J]Figures 3A–3O show that five active compounds were identified by orthogonal assays in AP4B1KO SH-SY5Y cells. Figure 3I shows that the baseline difference in DAGLB ratio between AP4B1WT and AP4B1KO cells was quantified from 192 AB4B1WT wells and 192 AB4B1KO wells from four assay plates. Statistical testing was performed using a t-test. Positive and negative controls showed robust separation (p<0.0001). Figures 3J–3N show dose-response curves of the DAGLB ratio in AB4B1KO cells treated with different compounds. Each data point represents the mean per well from four different assay plates. The dashed line shows the mean Z-scores of the positive ("A") and negative ("B") controls. Shaded areas represent ±1 SD. [Figure 3K-3L] Figures 3A–3O show that five active compounds were identified by orthogonal assays in AP4B1KO SH-SY5Y cells. Figures 3J–3N show dose-response curves of the DAGLB ratio in AB4B1KO cells treated with different compounds. Each data point represents the mean per well from four different assay plates. The dashed lines show the mean Z-scores of positive ("A") and negative ("B") controls. Shaded areas represent ±1 SD. [Figure 3M-3N] Figures 3A–3O show that five active compounds were identified by orthogonal assays in AP4B1KO SH-SY5Y cells. Figures 3J–3N show dose-response curves of the DAGLB ratio in AB4B1KO cells treated with different compounds. Each data point represents the mean per well from four different assay plates. The dashed lines show the mean Z-scores of positive ("A") and negative ("B") controls. Shaded areas represent ±1 SD. [Figure 3O]Figures 3A–3O show the identification of five active compounds by orthogonal assay in AP4B1KO SH-SY5Y cells. Figure 3O shows a representative image of the intracellular DAGLB distribution of each compound. The merges show beta-3 tubulin, DAPI, TGN, and DAGLB. TGN and DAGLB channels are further illustrated separately in grayscale. Scale bar: 10 μm. [Figure 4A] Figures 4A–4G show multiparametric profiling of five active compounds in AP4B1KO SH-SY5Y cells. Figure 4A shows multiparametric profiling of images of 5373 cells acquired using four fluorescence channels. Scale: 10 μm. A total of 90 measurements were generated per cell for the cytoskeleton (beta-3 tubulin), nucleus (DAPI), TGN (TNG46), and ATG9A vesicles (ATG9A). Various steps of data preprocessing and phenotypic clustering using principal component analysis (PCA) are shown. [Figure 4B] Figures 4A–4G show multiparametric profiling of five active compounds in AP4B1KO SH-SY5Y cells. Figure 4B demonstrates that PCA shows different clusters of cells based on 85 phenotypic features. The first two principal components (PC1 and PC2) account for 43.2% of the observed variance. [Figure 4C] Figures 4A–4G show multiparametric profiling of five active compounds in AP4B1KO SH-SY5Y cells. Figure 4C shows a bar plot summarizing the variance explained by the first 10 principal components (PCs). The majority of the variance is explained by PC1, and to a lesser extent by PC2. [Figure 4D-4E]Figures 4A–4G show multiparametric profiling of five active compounds in AP4B1KO SH-SY5Y cells. Figure 4D shows correlation analysis of all 85 feature-specific PC1s using Pearson correlation coefficients. The gray line labeled "A" represents the cutoff for correlations >0.75. Figure 4E shows a zoom-in of the selected feature of interest showing correlations with PC1 >0.75. [Figure 4F-1] Figures 4A–4G show multiparametric profiling of five active compounds in AP4B1KO SH-SY5Y cells. Figure 4F shows line graphs of TGN intensity measurements and descriptors of TGN shape and network complexity for each hit compound, and Figure 4G is summarized using a heatmap visualization. [Figure 4F-2] Figures 4A–4G show multiparametric profiling of five active compounds in AP4B1KO SH-SY5Y cells. Figure 4F shows line graphs of TGN intensity measurements and descriptors of TGN shape and network complexity for each hit compound, and Figure 4G is summarized using a heatmap visualization. [Figure 4G-1] Figures 4A–4G show multiparametric profiling of five active compounds in AP4B1KO SH-SY5Y cells. Figure 4F shows line graphs of TGN intensity measurements and descriptors of TGN shape and network complexity for each hit compound, and Figure 4G is summarized using a heatmap visualization. [Figure 4G-2] Figures 4A–4G show multiparametric profiling of five active compounds in AP4B1KO SH-SY5Y cells. Figure 4F shows line graphs of TGN intensity measurements and descriptors of TGN shape and network complexity for each hit compound, and Figure 4G is summarized using a heatmap visualization. [Figure 5A-5B]Figures 5A–5I show that compound C-01 restores ATG9A and DAGLB transport in iPSC-derived neurons from AP-4-HSP patients. Figure 5A outlines the testing of five active compounds in iPSC-derived cortical neurons from patients with AP4M1-associated SPG50 compared to heterozygous controls (same-sex parents). Active compounds were defined as reducing the ATG9A ratio by at least 3 SD compared to negative controls (patient-derived iPSC neurons treated with the vehicle). Toxicity was defined as a reduction in cell number of at least 2 SD compared to negative controls. Figure 5B shows that the baseline difference in the ATG9A ratio between controls and patient-derived iPSC neurons was quantified using the well-average of 60 wells per condition from five plates. Statistical testing was performed using the t-test. Positive and negative controls showed robust separation (p<0.0001). [Figure 5C] Figures 5A–5I show that compound C-01 restores ATG9A and DAGLB transport in iPSC-derived neurons from AP-4-HSP patients. Figure 5C shows representative images of iPSC neurons from a patient with SPG50 treated with 5 μM of each compound for 24 hours (approximately ED50 in previous experiments). The merges show beta-3 tubulin, DAPI, Golgi, and ATG9A. Golgi and ATG9A channels are further illustrated separately in grayscale. Scale: 10 μm. [Figure 5D] Figures 5A–5I show that compound C-01 restores ATG9A and DAGLB transport in iPSC-derived neurons from AP-4-HSP patients. Figures 5D–5F show dose-response curves for the ATG9A ratio in iPSC neurons from SPG50 patients treated with each compound for 24 hours, along with their morphological profiles illustrated as heatmaps. Each data point represents the mean per well of 3–4 independent differentiations. Dashed lines show the mean Z-scores of positive ("A") and negative ("B") controls. Shaded areas represent ±1SD. [Figure 5E] Figures 5A–5I show that compound C-01 restores ATG9A and DAGLB transport in iPSC-derived neurons from AP-4-HSP patients. Figures 5D–5F show dose-response curves for the ATG9A ratio in iPSC neurons from SPG50 patients treated with each compound for 24 hours, along with their morphological profiles illustrated as heatmaps. Each data point represents the mean per well of 3–4 independent differentiations. Dashed lines show the mean Z-scores of positive ("A") and negative ("B") controls. Shaded areas represent ±1SD. [Figure 5F-5G] Figures 5A–5I show that compound C-01 restores ATG9A and DAGLB transport in iPSC-derived neurons from AP-4-HSP patients. Figures 5D–5F show dose-response curves for the ATG9A ratio in iPSC neurons from SPG50 patients treated with each compound for 24 hours, along with their morphological profiles illustrated as heatmaps. Each data point represents the mean per well of 3–4 independent differentiations. Dashed lines show the mean Z-scores of positive ("A") and negative ("B") controls. Shaded areas represent ±1SD. Figure 5G shows the chemosynthesis and structure of compound C-01. [Figure 5H] Figures 5A–5I show that compound C-01 restores ATG9A and DAGLB transport in iPSC-derived neurons from AP-4-HSP patients. Figures 5H–5I show dose-response curves for ATG9A ratio and DAGLB ratio in iPSC neurons from patients with SPG50 (Figure 5H) and an additional patient with SPG47 (Figure 5I) after 72 hours of long-term treatment with C-01, along with morphological profiles illustrating changes in cellular ATG9A and DAGLB distribution, TGN intensity and morphology, and cell number. Each data point represents the mean per well of two independent differentiations. Dashed lines show the mean Z-scores of positive ("A") and negative ("B") controls. Shaded areas represent ±1 SD. [Figure 5I] Figures 5A–5I show that compound C-01 restores ATG9A and DAGLB transport in iPSC-derived neurons from AP-4-HSP patients. Figures 5H–5I show dose-response curves for ATG9A ratio and DAGLB ratio in iPSC neurons from patients with SPG50 (Figure 5H) and an additional patient with SPG47 (Figure 5I) after 72 hours of long-term treatment with C-01, along with morphological profiles illustrating changes in cellular ATG9A and DAGLB distribution, TGN intensity and morphology, and cell number. Each data point represents the mean per well of two independent differentiations. Dashed lines show the mean Z-scores of positive ("A") and negative ("B") controls. Shaded areas represent ±1 SD. [Figure 6A] Figures 6A–6F show targeted deconvolution using bulk RNA sequencing and weighted gene co-expression network analysis in AP4B1KO SH-SY5Y cells treated with C-01. Figure 6A shows that hierarchical clustering of 12 samples using the mean linking method revealed two major clusters based on vehicle versus C-01 treatment, regardless of cell lineage. [Figure 6B] Figures 6A–6F show targeted deconvolution using bulk RNA sequencing and weighted gene co-expression network analysis in AP4B1KO SH-SY5Y cells treated with C-01. Figure 6B shows a cluster dendrogram of 18,506 expressed genes based on topological overlap. Clusters ("modules") of co-expressed genes were isolated using hierarchical clustering and adaptive branch pruning. [Figure 6C-1]Figures 6A–6F show targeted deconvolution using bulk RNA sequencing and weighted gene co-expression network analysis in AP4B1KO SH-SY5Y cells treated with C-01. Figure 6C shows a heatmap visualization of the correlation between the gene expression profiles of each module ("module-specific genes," ME) and the measured traits. Pearson correlation coefficients are shown for each cell in the heatmap. [Figure 6C-2] Figures 6A–6F show targeted deconvolution using bulk RNA sequencing and weighted gene co-expression network analysis in AP4B1KO SH-SY5Y cells treated with C-01. Figure 6C shows a heatmap visualization of the correlation between the gene expression profiles of each module ("module-specific genes," ME) and the measured traits. Pearson correlation coefficients are shown for each cell in the heatmap. [Figure 6D-1] Figures 6A–6F show targeted deconvolution using bulk RNA sequencing and weighted gene co-expression network analysis in AP4B1KO SH-SY5Y cells treated with C-01. Figure 6D shows intra-module analysis of module membership (MM) and gene significance (GS) for highly correlated modules, enabling the identification of genes with high significance to the treatment and high connectivity to those modules. [Figure 6D-2] Figures 6A–6F show targeted deconvolution using bulk RNA sequencing and weighted gene co-expression network analysis in AP4B1KO SH-SY5Y cells treated with C-01. Figure 6D shows intra-module analysis of module membership (MM) and gene significance (GS) for highly correlated modules, enabling the identification of genes with high significance to the treatment and high connectivity to those modules. [Figure 6E-1]Figures 6A–6F show targeted deconvolution using bulk RNA sequencing and weighted gene co-expression network analysis in AP4B1KO SH-SY5Y cells treated with C-01. Figure 6E shows the ME expression profiles of the top five co-expressed modules. [Figure 6E-2] Figures 6A–6F show targeted deconvolution using bulk RNA sequencing and weighted gene co-expression network analysis in AP4B1KO SH-SY5Y cells treated with C-01. Figure 6E shows the ME expression profiles of the top five co-expressed modules. [Figure 6E-3] Figures 6A–6F show targeted deconvolution using bulk RNA sequencing and weighted gene co-expression network analysis in AP4B1KO SH-SY5Y cells treated with C-01. Figure 6E shows the ME expression profiles of the top five co-expressed modules. [Figure 6F-1] Figures 6A–6F show targeted deconvolution using bulk RNA sequencing and weighted gene co-expression network analysis in AP4B1KO SH-SY5Y cells treated with C-01. Figure 6F shows that gene ontology enrichment analysis revealed enriched pathways in modules 3 and 5. The pathways were thought to be differentially expressed at FDR < 0.05. [Figure 6F-2] Figures 6A–6F show targeted deconvolution using bulk RNA sequencing and weighted gene co-expression network analysis in AP4B1KO SH-SY5Y cells treated with C-01. Figure 6F shows that gene ontology enrichment analysis revealed enriched pathways in modules 3 and 5. The pathways were thought to be differentially expressed at FDR < 0.05. [Figure 6F-3]Figures 6A–6F show targeted deconvolution using bulk RNA sequencing and weighted gene co-expression network analysis in AP4B1KO SH-SY5Y cells treated with C-01. Figure 6F shows that gene ontology enrichment analysis revealed enriched pathways in modules 3 and 5. The pathways were thought to be differentially expressed at FDR < 0.05. [Figures 7A-7B] Figures 7A–7D show targeted deconvolution using unbiased quantitative proteomics in AP4B1KO SH-SY5Y cells and iPSC neurons derived from AP-4-HSP patients treated with C-01. Figures 7A–7C show differential protein enrichment analysis. Statistical tests were performed using a linear model for each protein and empirical Bayesian statistics. Proteins were considered to be differentially enriched with a false discovery rate of <0.05 and a log2 factor change of >0.3. Figure 7A shows SH-SY5Y cells: 8141 intrinsic proteins were analyzed. PCA of the top 500 variable proteins shows robust separation between experimental conditions. The volcano plot summarizes differential protein enrichment of AP4B1WT and AP4B1KO cells pooled into two groups: vehicle vs. C-01 treatment. Differentially enriched proteins are illustrated in black. Proteins with the most consistent enrichment profiles across all experimental conditions (see Figures 14A–14D) are labeled and have adjacent arrows. Figure 7B shows iPSC-derived neurons: 7386 unique proteins were analyzed. PCA of the top 500 variable proteins shows robust separation across experimental conditions. The volcano plot summarizes differential protein enrichment of control and patient-derived neurons pooled into two groups: vehicle vs. C-01 treatment. Differentially enriched proteins are illustrated in black. Proteins with the most consistent enrichment profiles across all experimental conditions (see Figures 14E–14H) are labeled and have adjacent arrows. [Figure 7C]Figures 7A–7D show targeted deconvolution using unbiased quantitative proteomics in AP4B1KO SH-SY5Y cells and iPSC neurons derived from AP-4-HSP patients treated with C-01. Figures 7A–7C show differential protein enrichment analysis. Statistical tests were performed using a linear model for each protein and empirical Bayesian statistics. Proteins were considered to be differentially enriched with a false discovery rate of <0.05 and a log2 factor change of >0.3. Figure 7C shows a combined analysis of SH-SY5Y cells and iPSC-derived neurons: 5357 unique proteins were analyzed. The volcano plot summarizes differential protein enrichment of control cells and AP-4 deficient cells pooled into two groups: vehicle vs. C-01. Proteins with the most consistent enrichment profile across all experimental conditions (see Figures 14I–14L) are labeled and have adjacent arrows. The dot plot summarizes the dysregulated Reactome pathways in the pooled analysis. The pathways appeared to be differentially expressed at FDR < 0.05. [Figure 7D] Figures 7A–7D show targeted deconvolution using unbiased quantitative proteomics in AP4B1KO SH-SY5Y cells and iPSC neurons derived from AP-4-HSP patients treated with C-01. Figures 7A–7C show differential protein enrichment analysis. Statistical tests were performed using a linear model for each protein and empirical Bayesian statistics. Proteins were considered to be differentially enriched with a false discovery rate of <0.05 and a log2 factor change of >0.3. Figure 7D shows that RAB protein family members RAB1B, RAB3C, and RAB12 showed the most consistent profiles in response to C-01 treatment and were selected for further analysis. LFQ intensities in SH-SY5Y cells (pooled AP4B1WT and AP4B1KO) and neurons (pooled control and patient) are shown. Statistical tests were performed using pairwise t-tests. P-values ​​were adjusted for multiple tests using the Benjamini-Hochberg procedure. [Figure 8A]Figures 8A–8I show that RAB3C and RAB12 are involved in C-01-mediated vesicular transport and enhancement of autophagy flux. Figure 8A shows that the LFQ intensities of RAB3C and RAB12 in AP4B1WT (n=11 samples) and AP4B1KO (n=10 samples) SH-SY5Y cells, as well as in control (n=6 samples) and patient-derived (n=6 samples) iPSC-derived neurons, show a high correlation as measured by the Pearson correlation coefficient (r). Although there were no differences between genotypes, C-01-treated cells showed decreased protein levels of RAB3C and RAB12. [Figure 8B-8C]Figures 8A–8I show that RAB3C and RAB12 are involved in C-01-mediated vesicular transport and enhancement of autophagy flux. Figure 8B shows that AP4B1KO SH-SY5Y cells were transfected for 72 hours with RNPs targeting RAB3C, RAB12, or both, compared to NLRP5 as a non-essential control. Vehicle vs. 5 μM C-01 treatment was administered for 24 hours. Each experimental condition was tested in 8–12 wells from 2–3 independent plates. The dashed line represents a -2 SD decrease in the ATG9A ratio compared to the negative control (AP4B1KO+sgNLRP5). Knockout of RAB12 did not significantly alter the ATG9A ratio, but knockout of RAB3C resulted in a -2 SD decrease. Combinations of RAB3C and RAB12 knockout did not produce an additive effect. However, knockout of RAB3C and RAB12 enhanced the effect of C-01 treatment on ATG9A translocation, which was further enhanced by combined knockout. Figures 8C–8F show representative Western blots of whole cell lysates. Cells were treated for 72 hours with vehicle versus 5 μM C-01. All experiments were performed in four biological replicates. AP4B1 KO cells showed decreased AP4E1 levels, indicating reduced AP4 complex formation. The ATG9A ratio was significantly increased in AP4B1 KO cells and did not change with C-01 treatment. In contrast, LC3-I to LC3-II conversion was significantly increased in response to C-01 in both AP4B1 WT and AP4B1 KO cells. To confirm that this increase was due to an increase in the autophagy flux, autophagosome-lysosome fusion was blocked by adding bafilomycin A1 at a concentration of 100 nM over 4 hours before cell harvesting. [Figure 8D]Figures 8A–8I show that RAB3C and RAB12 are involved in C-01-mediated vesicle transport and enhancement of autophagy flux. Figures 8C–8F show representative Western blots of whole cell lysates. Cells were treated for 72 hours with vehicle vs. 5 μM C-01. All experiments were performed in four biological replicates. AP4B1 KO cells showed decreased AP4E1 levels, indicating reduced AP4 complex formation. The ATG9A ratio was significantly increased in AP4B1 KO cells and did not change with C-01 treatment. In contrast, LC3-I to LC3-II conversion was significantly increased in response to C-01 in both AP4B1 WT and AP4B1 KO cells. To confirm that this increase was due to an increase in the autophagy flux, autophagosome-lysosome fusion was blocked by adding bafilomycin A1 at a concentration of 100 nM over 4 hours before cell harvesting. [Figures 8E-8F] Figures 8A–8I show that RAB3C and RAB12 are involved in C-01-mediated vesicle transport and enhancement of autophagy flux. Figures 8C–8F show representative Western blots of whole cell lysates. Cells were treated for 72 hours with vehicle vs. 5 μM C-01. All experiments were performed in four biological replicates. AP4B1 KO cells showed decreased AP4E1 levels, indicating reduced AP4 complex formation. The ATG9A ratio was significantly increased in AP4B1 KO cells and did not change with C-01 treatment. In contrast, LC3-I to LC3-II conversion was significantly increased in response to C-01 in both AP4B1 WT and AP4B1 KO cells. To confirm that this increase was due to an increase in the autophagy flux, autophagosome-lysosome fusion was blocked by adding bafilomycin A1 at a concentration of 100 nM over 4 hours before cell harvesting. [Figure 8G]Figures 8A–8I show that RAB3C and RAB12 are involved in C-01-mediated vesicular transport and enhancement of autophagy flux. Figures 8G–8I show Western blots of whole cell lysates of AP4B1KO SH-SY5Y cells transfected for 72 hours with RNP against RAB3C, RAB12, or both, compared to NLRP5. Vehicle versus C-01 treatment was administered for 48 hours. Neither RAB3C (Figure 8G) knockout alone nor RAB12 (Figure 8H) knockout alone resulted in an increase in baseline LC3-II, but the combined knockout increased the LC3-II to LC3-I ratio to the level achieved by C-01 treatment alone (Figure 8I). In response to bafilomycin A1 treatment (100 nM over 4 hours), both RAB3C knockout alone and the combination of RAB3C and RAB12 knockout resulted in a significant increase in the LC3-II to LC3-I ratio. Statistical testing was performed using pairwise t-tests for all experiments. P-values ​​were adjusted for multiple trials using the Benjamini-Hochberg procedure. [Figure 8H]Figures 8A–8I show that RAB3C and RAB12 are involved in C-01-mediated vesicular transport and enhancement of autophagy flux. Figures 8G–8I show Western blots of whole cell lysates of AP4B1KO SH-SY5Y cells transfected for 72 hours with RNP against RAB3C, RAB12, or both, compared to NLRP5. Vehicle versus C-01 treatment was administered for 48 hours. Neither RAB3C (Figure 8G) knockout alone nor RAB12 (Figure 8H) knockout alone resulted in an increase in baseline LC3-II, but the combined knockout increased the LC3-II to LC3-I ratio to the level achieved by C-01 treatment alone (Figure 8I). In response to bafilomycin A1 treatment (100 nM over 4 hours), both RAB3C knockout alone and the combination of RAB3C and RAB12 knockout resulted in a significant increase in the LC3-II to LC3-I ratio. Statistical testing was performed using pairwise t-tests for all experiments. P-values ​​were adjusted for multiple trials using the Benjamini-Hochberg procedure. [Figure 8I]Figures 8A–8I show that RAB3C and RAB12 are involved in C-01-mediated vesicular transport and enhancement of autophagy flux. Figures 8G–8I show Western blots of whole cell lysates of AP4B1KO SH-SY5Y cells transfected for 72 hours with RNP against RAB3C, RAB12, or both, compared to NLRP5. Vehicle versus C-01 treatment was administered for 48 hours. Neither RAB3C (Figure 8G) knockout alone nor RAB12 (Figure 8H) knockout alone resulted in an increase in baseline LC3-II, but the combined knockout increased the LC3-II to LC3-I ratio to the level achieved by C-01 treatment alone (Figure 8I). In response to bafilomycin A1 treatment (100 nM over 4 hours), both RAB3C knockout alone and the combination of RAB3C and RAB12 knockout resulted in a significant increase in the LC3-II to LC3-I ratio. Statistical testing was performed using pairwise t-tests for all experiments. P-values ​​were adjusted for multiple trials using the Benjamini-Hochberg procedure. [Figure 9A] Figures 9A and 9B show the quality metrics for the ATG9A translocation assay in primary and counter screening. Assay performance was monitored in primary screening (Figure 9A) and counter screening (Figure 9B) using the criteria proposed by Zhang et al., encompassing Z' robustness ≥ 0.3, strictly standardized median difference (SSMD) ≥ 3, and inter-assay coefficient of variation ≤ 10%. To avoid bias due to inter-plate variability, all metrics were calculated for positive and negative controls from the same assay plate. The predetermined threshold ("A" line) was met by all assay plates. [Figure 9B]Figures 9A and 9B show the quality metrics for the ATG9A translocation assay in primary and counter screening. Assay performance was monitored in primary screening (Figure 9A) and counter screening (Figure 9B) using the criteria proposed by Zhang et al., encompassing Z' robustness ≥ 0.3, strictly standardized median difference (SSMD) ≥ 3, and inter-assay coefficient of variation ≤ 10%. To avoid bias due to inter-plate variability, all metrics were calculated for positive and negative controls from the same assay plate. The predetermined threshold ("A" line) was met by all assay plates. [Figure 10A-1] Figures 10A–10B show a summary of counterscreening in AP-4-HSP patient-derived fibroblasts. A summary of counterscreening for 503 active compounds identified in the primary screening. To assess dose-dependent effects, compounds were screened in AP-4-HSP patient-derived fibroblasts in 384-well microplates using 11 titrations ranging from 40 nM to 40 μM. All concentrations were screened in double cycles. Active compounds were a priori defined as those that reduced the ATG9A ratio by at least 3 SD compared to negative controls at multiple concentrations. Toxicity was defined as a reduction in cell number of at least 2 SD compared to negative controls. The dotted line labeled "A" represents the mean of positive controls, and the dotted line labeled "B" points to the mean of negative controls. Triangles point to toxic concentrations. ED50 is indicated where possible. Seventeen compounds demonstrated clear and reproducible dose-response relationships and did not raise suspicion of autofluorescence in automated and manual reviews. Thirty-four compounds were active, but either exhibited autofluorescence or produced imaging artifacts. Dose-response curves for all 503 compounds tested in the secondary screening. [Figure 10A-2]Figures 10A–10B show a summary of counterscreening in AP-4-HSP patient-derived fibroblasts. A summary of counterscreening for 503 active compounds identified in the primary screening. To assess dose-dependent effects, compounds were screened in AP-4-HSP patient-derived fibroblasts in 384-well microplates using 11 titrations ranging from 40 nM to 40 μM. All concentrations were screened in double cycles. Active compounds were a priori defined as those that reduced the ATG9A ratio by at least 3 SD compared to negative controls at multiple concentrations. Toxicity was defined as a reduction in cell number of at least 2 SD compared to negative controls. The dotted line labeled "A" represents the mean of positive controls, and the dotted line labeled "B" points to the mean of negative controls. Triangles point to toxic concentrations. ED50 is indicated where possible. Seventeen compounds demonstrated clear and reproducible dose-response relationships and did not raise suspicion of autofluorescence in automated and manual reviews. Thirty-four compounds were active, but either exhibited autofluorescence or produced imaging artifacts. Dose-response curves for all 503 compounds tested in the secondary screening. [Figure 10B-1]Figures 10A–10B show a summary of counterscreening in AP-4-HSP patient-derived fibroblasts. A summary of counterscreening for 503 active compounds identified in the primary screening. To assess dose-dependent effects, compounds were screened in AP-4-HSP patient-derived fibroblasts in 384-well microplates using 11 titrations ranging from 40 nM to 40 μM. All concentrations were screened in double cycles. Active compounds were a priori defined as those that reduced the ATG9A ratio by at least 3 SD compared to negative controls at multiple concentrations. Toxicity was defined as a reduction in cell number of at least 2 SD compared to negative controls. The dotted line labeled "A" represents the mean of positive controls, and the dotted line labeled "B" points to the mean of negative controls. Triangles point to toxic concentrations. ED50 is indicated where possible. Seventeen compounds demonstrated clear and reproducible dose-response relationships and did not raise suspicion of autofluorescence in automated and manual reviews. Thirty-four compounds were active, but either exhibited autofluorescence or produced imaging artifacts. Dose-response curves for all 503 compounds tested in the secondary screening. [Figure 10B-2]Figures 10A–10B show a summary of counterscreening in AP-4-HSP patient-derived fibroblasts. A summary of counterscreening for 503 active compounds identified in the primary screening. To assess dose-dependent effects, compounds were screened in AP-4-HSP patient-derived fibroblasts in 384-well microplates using 11 titrations ranging from 40 nM to 40 μM. All concentrations were screened in double cycles. Active compounds were a priori defined as those that reduced the ATG9A ratio by at least 3 SD compared to negative controls at multiple concentrations. Toxicity was defined as a reduction in cell number of at least 2 SD compared to negative controls. The dotted line labeled "A" represents the mean of positive controls, and the dotted line labeled "B" points to the mean of negative controls. Triangles point to toxic concentrations. ED50 is indicated where possible. Seventeen compounds demonstrated clear and reproducible dose-response relationships and did not raise suspicion of autofluorescence in automated and manual reviews. Thirty-four compounds were active, but either exhibited autofluorescence or produced imaging artifacts. Dose-response curves for all 503 compounds tested in the secondary screening. [Figure 10B-3]Figures 10A–10B show a summary of counterscreening in AP-4-HSP patient-derived fibroblasts. A summary of counterscreening for 503 active compounds identified in the primary screening. To assess dose-dependent effects, compounds were screened in AP-4-HSP patient-derived fibroblasts in 384-well microplates using 11 titrations ranging from 40 nM to 40 μM. All concentrations were screened in double cycles. Active compounds were a priori defined as those that reduced the ATG9A ratio by at least 3 SD compared to negative controls at multiple concentrations. Toxicity was defined as a reduction in cell number of at least 2 SD compared to negative controls. The dotted line labeled "A" represents the mean of positive controls, and the dotted line labeled "B" points to the mean of negative controls. Triangles point to toxic concentrations. ED50 is indicated where possible. Seventeen compounds demonstrated clear and reproducible dose-response relationships and did not raise suspicion of autofluorescence in automated and manual reviews. Thirty-four compounds were active, but either exhibited autofluorescence or produced imaging artifacts. Dose-response curves for all 503 compounds tested in the secondary screening. [Figure 10B-4]Figures 10A–10B show a summary of counterscreening in AP-4-HSP patient-derived fibroblasts. A summary of counterscreening for 503 active compounds identified in the primary screening. To assess dose-dependent effects, compounds were screened in AP-4-HSP patient-derived fibroblasts in 384-well microplates using 11 titrations ranging from 40 nM to 40 μM. All concentrations were screened in double cycles. Active compounds were a priori defined as those that reduced the ATG9A ratio by at least 3 SD compared to negative controls at multiple concentrations. Toxicity was defined as a reduction in cell number of at least 2 SD compared to negative controls. The dotted line labeled "A" represents the mean of positive controls, and the dotted line labeled "B" points to the mean of negative controls. Triangles point to toxic concentrations. ED50 is indicated where possible. Seventeen compounds demonstrated clear and reproducible dose-response relationships and did not raise suspicion of autofluorescence in automated and manual reviews. Thirty-four compounds were active, but either exhibited autofluorescence or produced imaging artifacts. Dose-response curves for all 503 compounds tested in the secondary screening. [Figure 10B-5]Figures 10A–10B show a summary of counterscreening in AP-4-HSP patient-derived fibroblasts. A summary of counterscreening for 503 active compounds identified in the primary screening. To assess dose-dependent effects, compounds were screened in AP-4-HSP patient-derived fibroblasts in 384-well microplates using 11 titrations ranging from 40 nM to 40 μM. All concentrations were screened in double cycles. Active compounds were a priori defined as those that reduced the ATG9A ratio by at least 3 SD compared to negative controls at multiple concentrations. Toxicity was defined as a reduction in cell number of at least 2 SD compared to negative controls. The dotted line labeled "A" represents the mean of positive controls, and the dotted line labeled "B" points to the mean of negative controls. Triangles point to toxic concentrations. ED50 is indicated where possible. Seventeen compounds demonstrated clear and reproducible dose-response relationships and did not raise suspicion of autofluorescence in automated and manual reviews. Thirty-four compounds were active, but either exhibited autofluorescence or produced imaging artifacts. Dose-response curves for all 503 compounds tested in the secondary screening. [Figure 10B-6]Figures 10A–10B show a summary of counterscreening in AP-4-HSP patient-derived fibroblasts. A summary of counterscreening for 503 active compounds identified in the primary screening. To assess dose-dependent effects, compounds were screened in AP-4-HSP patient-derived fibroblasts in 384-well microplates using 11 titrations ranging from 40 nM to 40 μM. All concentrations were screened in double cycles. Active compounds were a priori defined as those that reduced the ATG9A ratio by at least 3 SD compared to negative controls at multiple concentrations. Toxicity was defined as a reduction in cell number of at least 2 SD compared to negative controls. The dotted line labeled "A" represents the mean of positive controls, and the dotted line labeled "B" points to the mean of negative controls. Triangles point to toxic concentrations. ED50 is indicated where possible. Seventeen compounds demonstrated clear and reproducible dose-response relationships and did not raise suspicion of autofluorescence in automated and manual reviews. Thirty-four compounds were active, but either exhibited autofluorescence or produced imaging artifacts. Dose-response curves for all 503 compounds tested in the secondary screening. [Figure 11-1] Figure 11 shows that orthogonal screening identified 11 compounds that did not show activity in AP4B1KO SH-SY5Y cells. Of the 16 compounds, 11 were excluded due to lack of activity (D-01, E-01, L-01, M-01, N-01, O-01, P-01), suspected artifacts or autofluorescence (I-01, J-01, K-01), or obvious changes in cell morphology (A-01). [Figure 11-2] Figure 11 shows that orthogonal screening identified 11 compounds that did not show activity in AP4B1KO SH-SY5Y cells. Of the 16 compounds, 11 were excluded due to lack of activity (D-01, E-01, L-01, M-01, N-01, O-01, P-01), suspected artifacts or autofluorescence (I-01, J-01, K-01), or obvious changes in cell morphology (A-01). [Figure 11-3]Figure 11 shows that orthogonal screening identified 11 compounds that did not show activity in AP4B1KO SH-SY5Y cells. Of the 16 compounds, 11 were excluded due to lack of activity (D-01, E-01, L-01, M-01, N-01, O-01, P-01), suspected artifacts or autofluorescence (I-01, J-01, K-01), or obvious changes in cell morphology (A-01). [Figure 11-4] Figure 11 shows that orthogonal screening identified 11 compounds that did not show activity in AP4B1KO SH-SY5Y cells. Of the 16 compounds, 11 were excluded due to lack of activity (D-01, E-01, L-01, M-01, N-01, O-01, P-01), suspected artifacts or autofluorescence (I-01, J-01, K-01), or obvious changes in cell morphology (A-01). [Figure 11-5] Figure 11 shows that orthogonal screening identified 11 compounds that did not show activity in AP4B1KO SH-SY5Y cells. Of the 16 compounds, 11 were excluded due to lack of activity (D-01, E-01, L-01, M-01, N-01, O-01, P-01), suspected artifacts or autofluorescence (I-01, J-01, K-01), or obvious changes in cell morphology (A-01). [Figure 11-6] Figure 11 shows that orthogonal screening identified 11 compounds that did not show activity in AP4B1KO SH-SY5Y cells. Of the 16 compounds, 11 were excluded due to lack of activity (D-01, E-01, L-01, M-01, N-01, O-01, P-01), suspected artifacts or autofluorescence (I-01, J-01, K-01), or obvious changes in cell morphology (A-01). [Figure 11-7]Figure 11 shows that orthogonal screening identified 11 compounds that did not show activity in AP4B1KO SH-SY5Y cells. Of the 16 compounds, 11 were excluded due to lack of activity (D-01, E-01, L-01, M-01, N-01, O-01, P-01), suspected artifacts or autofluorescence (I-01, J-01, K-01), or obvious changes in cell morphology (A-01). [Figure 11-8] Figure 11 shows that orthogonal screening identified 11 compounds that did not show activity in AP4B1KO SH-SY5Y cells. Of the 16 compounds, 11 were excluded due to lack of activity (D-01, E-01, L-01, M-01, N-01, O-01, P-01), suspected artifacts or autofluorescence (I-01, J-01, K-01), or obvious changes in cell morphology (A-01). [Figure 11-9] Figure 11 shows that orthogonal screening identified 11 compounds that did not show activity in AP4B1KO SH-SY5Y cells. Of the 16 compounds, 11 were excluded due to lack of activity (D-01, E-01, L-01, M-01, N-01, O-01, P-01), suspected artifacts or autofluorescence (I-01, J-01, K-01), or obvious changes in cell morphology (A-01). [Figure 11-10] Figure 11 shows that orthogonal screening identified 11 compounds that did not show activity in AP4B1KO SH-SY5Y cells. Of the 16 compounds, 11 were excluded due to lack of activity (D-01, E-01, L-01, M-01, N-01, O-01, P-01), suspected artifacts or autofluorescence (I-01, J-01, K-01), or obvious changes in cell morphology (A-01). [Figure 11-11]Figure 11 shows that orthogonal screening identified 11 compounds that did not show activity in AP4B1KO SH-SY5Y cells. Of the 16 compounds, 11 were excluded due to lack of activity (D-01, E-01, L-01, M-01, N-01, O-01, P-01), suspected artifacts or autofluorescence (I-01, J-01, K-01), or obvious changes in cell morphology (A-01). [Figure 11-12] Figure 11 shows that orthogonal screening identified 11 compounds that did not show activity in AP4B1KO SH-SY5Y cells. Of the 16 compounds, 11 were excluded due to lack of activity (D-01, E-01, L-01, M-01, N-01, O-01, P-01), suspected artifacts or autofluorescence (I-01, J-01, K-01), or obvious changes in cell morphology (A-01). [Figures 12A-12B] Figures 12A–12F show multiparametric profiling of five active compounds in AP4B1KO SH-SY5Y cells. PCA analysis of 85 extracted features of the nucleus, cytoskeleton / overall cell morphology, TGN, and ATG9A vesicles is shown. Figure 12A shows baseline analysis of AP4B1WT and AP4B1KO cells. Cell lines were closely clustered and separated only by ATG9A signaling. Figures 12B–12F show spatial clustering of the five active compounds against positive and negative controls. Compound concentrations are illustrated by the legend. [Figures 12C-12D]Figures 12A–12F show multiparametric profiling of five active compounds in AP4B1KO SH-SY5Y cells. PCA analysis of 85 extracted features of the nucleus, cytoskeleton / overall cell morphology, TGN, and ATG9A vesicles is shown. Figure 12A shows baseline analysis of AP4B1WT and AP4B1KO cells. Cell lines were closely clustered and separated only by ATG9A signaling. Figures 12B–12F show spatial clustering of the five active compounds against positive and negative controls. Compound concentrations are illustrated by the legend. C-01-treated AP4B1KO cells clustered closely with controls (Figure 12C), suggesting no significant off-target effects, although all other compounds induced dose-dependent changes in overall cell morphology. The most significant changes were observed for F-01 (Figure 12D) and H-01 (Figure 12F), suggesting off-target effects. [Figures 12E-12F] Figures 12A–12F show multiparametric profiling of five active compounds in AP4B1KO SH-SY5Y cells. PCA analysis of 85 extracted features of the nucleus, cytoskeleton / overall cell morphology, TGN, and ATG9A vesicles is shown. Figure 12A shows baseline analysis of AP4B1WT and AP4B1KO cells. Cell lines were closely clustered and separated only by ATG9A signaling. Figures 12B–12F show spatial clustering of the five active compounds against positive and negative controls. Compound concentrations are illustrated by the legend. C-01-treated AP4B1KO cells clustered closely with controls (Figure 12C), suggesting no significant off-target effects, although all other compounds induced dose-dependent changes in overall cell morphology. The most significant changes were observed for F-01 (Figure 12D) and H-01 (Figure 12F), suggesting off-target effects. [Figure 13A]Figures 13A–13C show that bulk RNA sequencing in AP4B1KO SH-SY5Y cells treated with C-01 reveals a small number of differentially expressed genes primarily involved in the ER stress response. Figure 13A shows a volcano plot illustrating the results of bulk RNA sequencing under different experimental conditions in SH-SY5Y cells (AP4B1WT vs. AP4B1KO treated with vehicle, AP4B1WT vs. AP4B1WT treated with vehicle vs. C-01, AP4B1KO vs. AP4B1KO treated with vehicle vs. C-01, and AP4B1WT and AP4B1KO cells pooled into two groups: vehicle vs. C-01). Differential expression analysis was performed according to the TREAT approach developed by McCarthy and Smyth (2009). Points labeled "A" represent differentially expressed genes with log2 factor change > 0.3 and FDR < 0.05. [Figure 13B] Figures 13A–13C show that bulk RNA sequencing in AP4B1KO SH-SY5Y cells treated with C-01 reveals a small number of differentially expressed genes primarily involved in the ER stress response. Figure 13B shows that gene ontology analysis reveals enriched pathways from pooled analysis. These pathways were thought to be differentially expressed at FDR < 0.05. [Figure 13C] Figures 13A–13C show that bulk RNA sequencing in AP4B1KO SH-SY5Y cells treated with C-01 reveals a small number of differentially expressed genes primarily involved in the ER stress response. Figure 13C depicts a gene conceptual network showing the differentially expressed genes and their pathway membership. [Figure 14A]Figures 14A–14L show unbiased quantitative proteomics in AP4B1KO SH-SY5Y cells and iPSC neurons derived from AP-4-HSP patients treated with C-01. Figures 14A–14D show SH-SY5Y cells: 8141 unique proteins were analyzed. Volcano plots summarize differential protein enrichment under different experimental conditions: Figure 14A shows AP4B1WT vs. AP4B1KO treated with vehicle, Figure 14B shows AP4B1WT vs. AP4B1WT treated with vehicle vs. C-01, Figure 14C shows AP4B1KO vs. AP4B1KO treated with vehicle vs. C-01, and Figure 14D shows pooled AP4B1WT and AP4B1KO cells treated with vehicle vs. C-01. Differentially enriched proteins are illustrated in black. [Figure 14B] Figures 14A–14L show unbiased quantitative proteomics in AP4B1KO SH-SY5Y cells and iPSC neurons derived from AP-4-HSP patients treated with C-01. Figures 14A–14D show SH-SY5Y cells: 8141 unique proteins were analyzed. Volcano plots summarize differential protein enrichment under different experimental conditions: Figure 14A shows AP4B1WT vs. AP4B1KO treated with vehicle, Figure 14B shows AP4B1WT vs. AP4B1WT treated with vehicle vs. C-01, Figure 14C shows AP4B1KO vs. AP4B1KO treated with vehicle vs. C-01, and Figure 14D shows pooled AP4B1WT and AP4B1KO cells treated with vehicle vs. C-01. Differentially enriched proteins are illustrated in black. [Figure 14C]Figures 14A–14L show unbiased quantitative proteomics in AP4B1KO SH-SY5Y cells and iPSC neurons derived from AP-4-HSP patients treated with C-01. Figures 14A–14D show SH-SY5Y cells: 8141 unique proteins were analyzed. Volcano plots summarize differential protein enrichment under different experimental conditions: Figure 14A shows AP4B1WT vs. AP4B1KO treated with vehicle, Figure 14B shows AP4B1WT vs. AP4B1WT treated with vehicle vs. C-01, Figure 14C shows AP4B1KO vs. AP4B1KO treated with vehicle vs. C-01, and Figure 14D shows pooled AP4B1WT and AP4B1KO cells treated with vehicle vs. C-01. Differentially enriched proteins are illustrated in black. [Figure 14D] Figures 14A–14L show unbiased quantitative proteomics in AP4B1KO SH-SY5Y cells and iPSC neurons derived from AP-4-HSP patients treated with C-01. Figures 14A–14D show SH-SY5Y cells: 8141 unique proteins were analyzed. Volcano plots summarize differential protein enrichment under different experimental conditions: Figure 14A shows AP4B1WT vs. AP4B1KO treated with vehicle, Figure 14B shows AP4B1WT vs. AP4B1WT treated with vehicle vs. C-01, Figure 14C shows AP4B1KO vs. AP4B1KO treated with vehicle vs. C-01, and Figure 14D shows pooled AP4B1WT and AP4B1KO cells treated with vehicle vs. C-01. Differentially enriched proteins are illustrated in black. [Figure 14E]Figures 14A–14L show unbiased quantitative proteomics in AP4B1KO SH-SY5Y cells and AP-4-HSP patient-derived iPSC neurons treated with C-01. Figures 14E–14H show iPSC-derived neurons: 7386 unique proteins were analyzed. Volcano plots summarize differential protein enrichment under different experimental conditions. Figure 14E shows control versus patient-derived neurons treated with vehicle, Figure 14F shows control versus control treated with C-01, Figure 14G shows patient-derived neurons treated with vehicle versus patient-derived neurons treated with C-01, and Figure 14H shows two groups of pooled control and patient-derived neurons treated with vehicle versus C-01. Differentially enriched proteins are shown in black. [Figure 14F] Figures 14A–14L show unbiased quantitative proteomics in AP4B1KO SH-SY5Y cells and AP-4-HSP patient-derived iPSC neurons treated with C-01. Figures 14E–14H show iPSC-derived neurons: 7386 unique proteins were analyzed. Volcano plots summarize differential protein enrichment under different experimental conditions. Figure 14E shows control versus patient-derived neurons treated with vehicle, Figure 14F shows control versus control treated with C-01, Figure 14G shows patient-derived neurons treated with vehicle versus patient-derived neurons treated with C-01, and Figure 14H shows two groups of pooled control and patient-derived neurons treated with vehicle versus C-01. Differentially enriched proteins are shown in black. [Figure 14G]Figures 14A–14L show unbiased quantitative proteomics in AP4B1KO SH-SY5Y cells and AP-4-HSP patient-derived iPSC neurons treated with C-01. Figures 14E–14H show iPSC-derived neurons: 7386 unique proteins were analyzed. Volcano plots summarize differential protein enrichment under different experimental conditions. Figure 14E shows control versus patient-derived neurons treated with vehicle, Figure 14F shows control versus control treated with C-01, Figure 14G shows patient-derived neurons treated with vehicle versus patient-derived neurons treated with C-01, and Figure 14H shows two groups of pooled control and patient-derived neurons treated with vehicle versus C-01. Differentially enriched proteins are shown in black. [Figure 14H] Figures 14A–14L show unbiased quantitative proteomics in AP4B1KO SH-SY5Y cells and AP-4-HSP patient-derived iPSC neurons treated with C-01. Figures 14E–14H show iPSC-derived neurons: 7386 unique proteins were analyzed. Volcano plots summarize differential protein enrichment under different experimental conditions. Figure 14E shows control versus patient-derived neurons treated with vehicle, Figure 14F shows control versus control treated with C-01, Figure 14G shows patient-derived neurons treated with vehicle versus patient-derived neurons treated with C-01, and Figure 14H shows two groups of pooled control and patient-derived neurons treated with vehicle versus C-01. Differentially enriched proteins are shown in black. [Figure 14I]Figures 14A–14L show unbiased quantitative proteomics in AP4B1KO SH-SY5Y cells and iPSC neurons derived from AP-4-HSP patients treated with C-01. Figures 14I–14L show integrated analysis of SH-SY5Y cells and iPSC-derived neurons: 5357 unique proteins were analyzed. Volcano plots summarize differential protein enrichment under different experimental conditions. Figure 14I shows control vs. AP-4 deficient cells treated with vehicle, Figure 14J shows control vs. control treated with vehicle vs. control treated with C-01, Figure 14K shows AP-4 deficient cells treated with vehicle vs. AP-4 deficient cells treated with C-01, and Figure 14L shows control and AP-4 deficient cells pooled into two groups: vehicle vs. C-01. Differentially enriched proteins are illustrated in black. Across the entire dataset, differential protein enrichment was statistically tested using a protein-specific linear model and empirical Bayesian statistics. Proteins were thought to be differentially enriched with a false discovery rate of <0.05 and a log2 factor change of >0.3. [Figure 14J]Figures 14A–14L show unbiased quantitative proteomics in AP4B1KO SH-SY5Y cells and iPSC neurons derived from AP-4-HSP patients treated with C-01. Figures 14I–14L show integrated analysis of SH-SY5Y cells and iPSC-derived neurons: 5357 unique proteins were analyzed. Volcano plots summarize differential protein enrichment under different experimental conditions. Figure 14I shows control vs. AP-4 deficient cells treated with vehicle, Figure 14J shows control vs. control treated with vehicle vs. control treated with C-01, Figure 14K shows AP-4 deficient cells treated with vehicle vs. AP-4 deficient cells treated with C-01, and Figure 14L shows control and AP-4 deficient cells pooled into two groups: vehicle vs. C-01. Differentially enriched proteins are illustrated in black. Across the entire dataset, differential protein enrichment was statistically tested using a protein-specific linear model and empirical Bayesian statistics. Proteins were thought to be differentially enriched with a false discovery rate of <0.05 and a log2 factor change of >0.3. [Figure 14K]Figures 14A–14L show unbiased quantitative proteomics in AP4B1KO SH-SY5Y cells and iPSC neurons derived from AP-4-HSP patients treated with C-01. Figures 14I–14L show integrated analysis of SH-SY5Y cells and iPSC-derived neurons: 5357 unique proteins were analyzed. Volcano plots summarize differential protein enrichment under different experimental conditions. Figure 14I shows control vs. AP-4 deficient cells treated with vehicle, Figure 14J shows control vs. control treated with vehicle vs. control treated with C-01, Figure 14K shows AP-4 deficient cells treated with vehicle vs. AP-4 deficient cells treated with C-01, and Figure 14L shows control and AP-4 deficient cells pooled into two groups: vehicle vs. C-01. Differentially enriched proteins are illustrated in black. Across the entire dataset, differential protein enrichment was statistically tested using a protein-specific linear model and empirical Bayesian statistics. Proteins were thought to be differentially enriched with a false discovery rate of <0.05 and a log2 factor change of >0.3. [Figure 14L]Figures 14A–14L show unbiased quantitative proteomics in AP4B1KO SH-SY5Y cells and iPSC neurons derived from AP-4-HSP patients treated with C-01. Figures 14I–14L show integrated analysis of SH-SY5Y cells and iPSC-derived neurons: 5357 unique proteins were analyzed. Volcano plots summarize differential protein enrichment under different experimental conditions. Figure 14I shows control vs. AP-4 deficient cells treated with vehicle, Figure 14J shows control vs. control treated with vehicle vs. control treated with C-01, Figure 14K shows AP-4 deficient cells treated with vehicle vs. AP-4 deficient cells treated with C-01, and Figure 14L shows control and AP-4 deficient cells pooled into two groups: vehicle vs. C-01. Differentially enriched proteins are illustrated in black. Across the entire dataset, differential protein enrichment was statistically tested using a protein-specific linear model and empirical Bayesian statistics. Proteins were thought to be differentially enriched with a false discovery rate of <0.05 and a log2 factor change of >0.3. [Figures 15A-15B] Figures 15A–15E show the mRNA transcript expression and correlation analysis of RAB3C and RAB12. Normalized mRNA transcript counts of RAB3C (Figures 15A, 15C) and RAB12 (Figures 15B, 15D) across different experimental conditions in SH-SY5Y cells (AP4B1WT treated with vehicle, AP4B1WT treated with C-01, AP4B1KO treated with vehicle, AP4B1KO treated with C-01) (Figures 15A, 15B), as well as pooled AP4B1WT and AP4B1KO cells treated with vehicle versus C-01 (Figures 15C, 15D). No significant differences were detected. Statistical testing was performed using pairwise t-tests. P-values ​​were adjusted for multiple tests using the Benjamini-Hochberg procedure. [Figures 15C-15D]Figures 15A–15E show the mRNA transcript expression and correlation analysis of RAB3C and RAB12. Normalized mRNA transcript counts of RAB3C (Figures 15A, 15C) and RAB12 (Figures 15B, 15D) across different experimental conditions in SH-SY5Y cells (AP4B1WT treated with vehicle, AP4B1WT treated with C-01, AP4B1KO treated with vehicle, AP4B1KO treated with C-01) (Figures 15A, 15B), as well as pooled AP4B1WT and AP4B1KO cells treated with vehicle versus C-01 (Figures 15C, 15D). No significant differences were detected. Statistical testing was performed using pairwise t-tests. P-values ​​were adjusted for multiple tests using the Benjamini-Hochberg procedure. [Figure 15E] Figures 15A to 15E show mRNA transcript expression and correlation analysis of RAB3C and RAB12. Figure 15E shows that correlation analysis of RAB3C and RAB12 gene expression in AP4B1WT (n=6 samples) and AP4B1KO (n=6 samples) SH-SY5Y cells shows a moderate inverse correlation as measured by the Pearson correlation coefficient (r). [Figure 16A] Figures 16A to 16D show the original Western blots. Figure 16A shows the original, uncut blot corresponding to Figure 8C. [Figure 16B-16C] Figures 16A to 16D show the original Western blots. Figure 16B shows the original, uncut blot corresponding to Figure 8G. Figure 16C shows the original, uncut blot corresponding to Figure 8H. [Figure 16D] Figures 16A to 16D show the original Western blot. Figure 16D shows the original, uncut blot corresponding to Figure 8I. [Figure 17A] Figures 17A-17B show dose-response curves and cell counts for exemplary compound 10 in an assay test regarding its efficacy in treating AP-4 deficiency. This corresponds to AP4B1-KO+ compound 10 in Table 1. [Figure 17B]Figures 17A-17B show dose-response curves and cell counts for exemplary compound 10 in an assay test regarding its efficacy in treating AP-4 deficiency. This corresponds to AP4B1-KO+ compound 10 in Table 1. [Figure 18A] Figures 18A-18B show dose-response curves and cell counts for exemplary compound 17 in an assay test regarding its efficacy in treating AP-4 deficiency. This corresponds to AP4B1-KO+ compound 17 in Table 1. [Figure 18B] Figures 18A-18B show dose-response curves and cell counts for exemplary compound 17 in an assay test regarding its efficacy in treating AP-4 deficiency. This corresponds to AP4B1-KO+ compound 17 in Table 1. [Modes for carrying out the invention]

[0076] Detailed description of a certain aspect This disclosure describes the use of mallocalization of intracellular ATG9A as a cellular readout for AP-4 deficiency to develop a large-scale, automated, multiparametric, unbiased phenotypic small molecule screening for regulators of ATG9A transport in patient-derived cell models. A diverse library of novel small molecules was screened in AP-4-deficient patient fibroblasts to identify compounds that redistribute ATG9A from the TGN to the cytoplasm. A series of orthogonal assays in neuronal cells, including differentiated AP4B1KO SH-SY5Y cells and patient-derived iPSC-derived neurons, revealed compounds that restore the AP-4-deficient neuronal phenotype.

[0077] Therefore, the compound of formula (I) is described herein. The compound restores the AP-4-deficient neuronal phenotype, modulates intracellular vesicular transport, and increases autophagy flux.

[0078] compound In one aspect, this disclosure relates to compounds of formula (I): [ka] The formula also provides pharmaceutically acceptable salts, solvates, hydrates, polymorphs, cocrystals, tautomers, stereoisomers, isotope-labeled derivatives and prodrugs thereof, in which: R 1 Each appearance is independently of hydrogen, halogen, substituted or unsubstituted acyl, substituted or unsubstituted alkyl, substituted or unsubstituted alkenyl, substituted or unsubstituted alkynyl, substituted or unsubstituted heteroaliphatic, substituted or unsubstituted carbocyclyl, substituted or unsubstituted heterocyclyl, substituted or unsubstituted aryl, substituted or unsubstituted heteroaryl, nitrogen protecting group when attached to a nitrogen atom, -OR A , -N(R A )2, -SR A -CN, -SCN, -C(=NR) A )R A -C(=NR A )OR A -C(=NR A )N(R A )2, -C(=O)R A , -C(=O)OR A -C(=O)N(R A )2, -C(=O)NR A S(O)2R A -NO2, -NR A C(=O)R A , -NR A C(=O)OR A , -NR A C(=O)N(R A )2, -NR A C(=NR A )N(R A )2, -OC(=O)R A , -OC(=O)OR A , -OC(=O)N(R A )2, -NR A S(O)2R A -OS(O)2R A -S(O)2NR A C(O)R A -S(O)2N(R A )2, -S(O)2OR A , or -S(O)2RA is; or two R 1 The groups are joined to form a substituted or unsubstituted carbocyclyl ring, a substituted or unsubstituted aryl ring, a substituted or unsubstituted heterocyclyl ring, or a substituted or unsubstituted heteroaryl ring; t is 0 or a positive integer; and R A Each appearance is independently either hydrogen, a substituted or unsubstituted acyl, a substituted or unsubstituted alkyl, a substituted or unsubstituted alkenyl, a substituted or unsubstituted alkynyl, a substituted or unsubstituted heteroaliphatic, a substituted or unsubstituted carbocyclyl, a substituted or unsubstituted heterocyclyl, a substituted or unsubstituted aryl, a substituted or unsubstituted heteroaryl, a nitrogen protecting group attached to a nitrogen atom, an oxygen protecting group attached to an oxygen atom, or a sulfur protecting group attached to a sulfur atom, or two R A The groups are joined to form a substituted or unsubstituted heterocyclyl ring, or a substituted or unsubstituted heteroaryl ring; If present in the formula, R 1 Each occurrence is bonded to some substitutable atom of the compound.

[0079] In certain embodiments, the compound is not one or more of the following formulas: [ka] ;or [ka] .

[0080] R 1 As described herein, R 1Each appearance is independently of hydrogen, halogen, substituted or unsubstituted acyl, substituted or unsubstituted alkyl, substituted or unsubstituted alkenyl, substituted or unsubstituted alkynyl, substituted or unsubstituted heteroaliphatic, substituted or unsubstituted carbocyclyl, substituted or unsubstituted heterocyclyl, substituted or unsubstituted aryl, substituted or unsubstituted heteroaryl, nitrogen protecting group when attached to a nitrogen atom, -OR A , -N(R A )2, -SR A -CN, -SCN, -C(=NR) A )R A -C(=NR A )OR A -C(=NR A )N(R A )2, -C(=O)R A , -C(=O)OR A -C(=O)N(R A )2, -C(=O)NR A S(O)2R A -NO2, -NR A C(=O)R A , -NR A C(=O)OR A , -NR A C(=O)N(R A )2, -NR A C(=NR A )N(R A )2, -OC(=O)R A , -OC(=O)OR A , -OC(=O)N(R A )2, -NR A S(O)2R A -OS(O)2R A -S(O)2NR A C(O)R A -S(O)2N(R A )2, -S(O)2OR A , or -S(O)2R A is; or two R 1 The groups are joined to form a substituted or unsubstituted carbocyclyl ring, a substituted or unsubstituted aryl ring, a substituted or unsubstituted heterocyclyl ring, or a substituted or unsubstituted heteroaryl ring.

[0081] In a particular manner, R 1 Each occurrence is independently a halogen, substituted or unsubstituted acyl, substituted or unsubstituted alkyl, substituted or unsubstituted alkenyl, substituted or unsubstituted alkynyl, substituted or unsubstituted heteroaliphatic, substituted or unsubstituted carbocyclyl, substituted or unsubstituted heterocyclyl, substituted or unsubstituted aryl, substituted or unsubstituted heteroaryl, nitrogen protecting group when attached to a nitrogen atom, -OR A , -N(R A )2, -SR A -CN, -SCN, -C(=NR) A )R A -C(=NR A )OR A -C(=NR A )N(R A )2, -C(=O)R A , -C(=O)OR A -C(=O)N(R A )2, -C(=O)NR A S(O)2R A -NO2, -NR A C(=O)R A , -NR A C(=O)OR A , -NR A C(=O)N(R A )2, -NR A C(=NR A )N(R A )2, -OC(=O)R A , -OC(=O)OR A , -OC(=O)N(R A )2, -NR A S(O)2R A -OS(O)2R A -S(O)2NR A C(O)R A -S(O)2N(R A )2, -S(O)2OR A , or -S(O)2R A is; or two R 1The groups are joined to form a substituted or unsubstituted carbocyclyl ring, a substituted or unsubstituted aryl ring, a substituted or unsubstituted heterocyclyl ring, or a substituted or unsubstituted heteroaryl ring.

[0082] In a particular manner, R 1 Each occurrence is independently halogen, substituted or unsubstituted acyl, substituted or unsubstituted alkyl, substituted or unsubstituted alkenyl, substituted or unsubstituted alkynyl, substituted or unsubstituted heteroaliphatic, -OR A , -N(R A )2, -SR A -CN, -SCN, -C(=O)R A , -C(=O)OR A -C(=O)N(R A )2, -C(=O)NR A S(O)2R A -S(O)2NR A C(O)R A -S(O)2N(R A )2, -S(O)2OR A , or -S(O)2R A That is the case.

[0083] In a particular manner, R 1 Each occurrence is independently a substituted or unsubstituted acyl, substituted or unsubstituted alkyl, substituted or unsubstituted heteroalkyl, or -OR A , -C(=O)OR A , or -C(=O)N(R A )2.

[0084] In a particular manner, R 1 Each occurrence is independently either a substituted or unsubstituted alkyl, -OR A , -C(=O)OR A , or -C(=O)N(R A )2.

[0085] In a particular manner, R 1 Each occurrence is independently either a substituted or unsubstituted alkyl, -OR A , -C(=O)OR A, or -C(=O)N(R A )2; here, R A Each occurrence is independently hydrogen, a substituted or unsubstituted alkyl group, or a substituted or unsubstituted heteroalkyl group.

[0086] In a particular manner, R 1 Each occurrence is independently an unsubstituted alkyl, -OR A , -C(=O)OR A , or -C(=O)N(R A )2; here, R A Each occurrence is independently hydrogen, a substituted or unsubstituted alkyl group, or a substituted or unsubstituted heteroalkyl group.

[0087] In a particular manner, R 1 Each occurrence is independently an unsubstituted alkyl, -OR A , -C(=O)OR A , or -C(=O)N(R A )2; here, R A Each occurrence is independently of hydrogen, substituted or unsubstituted C. 1-4 Alkyl, or substituted or unsubstituted hetero-C 1-4 It is alkyl.

[0088] In a particular manner, R 1 Each occurrence is independently an unsubstituted alkyl, -OR A , -C(=O)OR A , or -C(=O)N(R A )2; here, R A Each occurrence is independently of hydrogen, unsubstituted C 1-4 Alkyl or unsubstituted heterocarbon C 1-4 It is alkyl.

[0089] In a particular manner, R 1 Each occurrence is independent of the non-substitutive C. 1-4 Alkyl, -OH, -OC 1-4 Alkyl, -C(=O)OC 1-4 Alkyl, or -C(=O)NH-(C 1-4 Alkylene)-OC1-4 It is alkyl.

[0090] In a particular manner, R 1 Each occurrence is independently hydrogen, -CH3, -OH, -OCH3, -C(=O)OCH3, or -C(=O)NH(CH2CH2)OCH3. In certain embodiments, R 1 Each occurrence is independently -CH3, -OH, -OCH3, -C(=O)OCH3, or -C(=O)NH(CH2CH2)OCH3.

[0091] In a particular manner, R 1 Each occurrence of -C(=O)OR is independent. A In a particular manner, R 1 Each occurrence of -C(=O)OR is independent. A And here, R A Each occurrence is independently a substituted or unsubstituted alkyl. In certain embodiments, R 1 Each occurrence of -C(=O)OR is independent. A And here, R A Each occurrence of C is independent of substitution or non-substitution. 1-4 It is alkyl. In a particular embodiment, R 1 Each occurrence of -C(=O)OR is independent. A And here, R A Each occurrence is independent of the non-substitutive C. 1-4 It is alkyl. In a particular embodiment, R 1 Each occurrence of -C(=O)OR is independent. A And here, R A Each occurrence is independent of the non-substitutive C. 1-3 It is alkyl. In a particular embodiment, R 1 Each occurrence of -C(=O)OR is independent. A And here, R A Each occurrence is independent of the non-substitutive C. 1-2 It is alkyl. In a particular embodiment, R 1 Each occurrence of -C(=O)OCH3 is independent.

[0092] In a particular manner, R1 Each occurrence of is independently -C(=O)N(R A )2; where each occurrence of R A is independently hydrogen or substituted or unsubstituted heteroalkyl. In certain embodiments, each occurrence of R 1 is independently -C(=O)N(R A )2; where each occurrence of R A is independently hydrogen or substituted or unsubstituted heteroC 1-4 alkyl. In certain embodiments, each occurrence of R 1 is independently -C(=O)N(R A )2; where each occurrence of R A is independently hydrogen or unsubstituted heteroC 1-4 alkyl. In certain embodiments, each occurrence of R 1 is independently -C(=O)NH-(C 1-4 alkylene)-OC 1-4 alkyl. In certain embodiments, each occurrence of R 1 is independently -C(=O)NH-(C 1-3 alkylene)-OC 1-3 alkyl. In certain embodiments, each occurrence of R 1 is independently -C(=O)NH-(C 1-2 alkylene)-OC 1-2 alkyl. In certain embodiments, each occurrence of R 1 is independently -C(=O)NH(CH2CH2)OCH3.

[0093] In certain embodiments, each occurrence of R 1 is independently substituted or unsubstituted alkyl. In certain embodiments, each occurrence of R 1 is independently substituted or unsubstituted C 1-4 alkyl. In certain embodiments, each occurrence of R 1 is independently unsubstituted C 1-4 alkyl. In certain embodiments, each occurrence of R 1 is independently unsubstituted C 1-3 alkyl. In certain embodiments, each occurrence of R 1Each occurrence is independent of the non-substitutive C. 1-2 It is alkyl. In a particular embodiment, R 1 Each occurrence is independently -CH3.

[0094] In a particular manner, R 1 Each occurrence of -OR is independent. A In a particular manner, R 1 Each occurrence of -OR is independent. A And here, R A Each occurrence is independently hydrogen, or a substituted or unsubstituted alkyl. In certain embodiments, R 1 Each occurrence of -OR is independent. A And here, R A Each occurrence is independently of hydrogen or unsubstituted C. 1-4 It is alkyl. In a particular embodiment, R 1 Each occurrence of -OR is independent. A And here, R A Each occurrence is independently of hydrogen or unsubstituted C. 1-4 It is alkyl. In a particular embodiment, R 1 Each occurrence of -OR is independent. A And here, R A Each occurrence is independently of hydrogen or unsubstituted C. 1-3 It is alkyl. In a particular embodiment, R 1 Each occurrence of -OR is independent. A And here, R A Each occurrence is independently of hydrogen or unsubstituted C. 1-2 It is alkyl. In a particular embodiment, R 1 Each occurrence is independently -OH or -OCH3. In certain embodiments, R 1 Each occurrence is independently -OH. In a particular embodiment, R 1 Each occurrence of -OCH3 is independent.

[0095] In a particular manner, R 1 Each occurrence is independently hydrogen, -OH, or -CH3. In certain embodiments, R 1Each occurrence is independently hydrogen. In a particular embodiment, R 1 Each occurrence is independently either -OH or -CH3.

[0096] As described herein, t is 0 or a positive integer. In certain embodiments, t is an integer between 0 and 10. In certain embodiments, t is an integer between 0 and 8. In certain embodiments, t is an integer between 0 and 6. In certain embodiments, t is an integer between 0 and 5. In certain embodiments, t is an integer between 0 and 4. In certain embodiments, t is an integer between 0 and 3. In certain embodiments, t is an integer between 0 and 2. In certain embodiments, t is 0 or 1. In certain embodiments, t is 1. In certain embodiments, t is 0.

[0097] The aspect of equation (I) In a particular embodiment, the compound of formula (I) is the compound of formula (Ia): [ka] or a pharmaceutically acceptable salt, cocrystal, tautomer, stereoisomer, solvate, hydrate, polymorph, isotope-enriched derivative or prodrug thereof, where R 1 and t are as defined herein.

[0098] In a particular embodiment, the compound of formula (I) is the compound of formula (Ib): [ka] or a pharmaceutically acceptable salt, cocrystal, tautomer, stereoisomer, solvate, hydrate, polymorph, isotope-enriched derivative or prodrug thereof, where R 1 and t are as defined herein.

[0099] In a particular embodiment, a compound of formula (I) is a compound of formula (Ic): [ka] or a pharmaceutically acceptable salt, cocrystal, tautomer, stereoisomer, solvate, hydrate, polymorph, isotope-enriched derivative or prodrug thereof, where R 1 and t are as defined herein.

[0100] In a particular embodiment, the compound of formula (I) is the compound of formula (Id): [ka] or a pharmaceutically acceptable salt, cocrystal, tautomer, stereoisomer, solvate, hydrate, polymorph, isotope-enriched derivative or prodrug thereof, where R 1 This is defined herein.

[0101] In a particular embodiment, the compound of formula (I) is the compound of the following formula: [ka] [ka] [ka] ;or [ka] or a pharmaceutically acceptable salt, cocrystal, tautomer, stereoisomer, solvate, hydrate, polymorph, isotope-enriched derivative, or prodrug thereof.

[0102] In a particular embodiment, the compound of formula (I) is the compound of the following formula: [ka] or a pharmaceutically acceptable salt, cocrystal, tautomer, stereoisomer, solvate, hydrate, polymorph, isotope-enriched derivative, or prodrug thereof.

[0103] In a particular embodiment, the compound of formula (I) is the compound of the following formula: [ka] or a pharmaceutically acceptable salt, cocrystal, tautomer, stereoisomer, solvate, hydrate, polymorph, isotope-enriched derivative, or prodrug thereof.

[0104] In a particular embodiment, the compound of formula (I) is the compound of the following formula: [ka] or a pharmaceutically acceptable salt, cocrystal, tautomer, stereoisomer, solvate, hydrate, polymorph, isotope-enriched derivative, or prodrug thereof.

[0105] In a particular embodiment, the compound of formula (I) is the compound of the following formula: [ka] or a pharmaceutically acceptable salt, cocrystal, tautomer, stereoisomer, solvate, hydrate, polymorph, isotope-enriched derivative, or prodrug thereof.

[0106] Pharmaceutical compositions, kits, and administrations This disclosure provides pharmaceutical compositions comprising a compound of the Disclosure (e.g., a compound of formula (I)) or a pharmaceutically acceptable salt thereof, cocrystal, tautomer, stereoisomer, solvate, hydrate, polymorph, isotope-enriched derivative, or prodrug, and optionally a pharmaceutically acceptable excipient. In certain embodiments, the pharmaceutical compositions described herein comprise a compound of the Disclosure (e.g., a compound of formula (I)) or a pharmaceutically acceptable salt thereof, and a pharmaceutically acceptable excipient.

[0107] In certain embodiments, the compounds of the Disclosure (for example, the compound of formula (I)) are provided in an effective amount in a pharmaceutical composition. In certain embodiments, the effective amount is a therapeutic effective amount. In certain embodiments, the effective amount is a prophylactic effective amount. In certain embodiments, the effective amount is an effective amount for treating a neurological disorder or neurological disorder in a subject that requires treatment for such a disorder. In certain embodiments, the effective amount is an effective amount for preventing a neurological disorder or neurological disorder in a subject that requires treatment for such a disorder. In certain embodiments, the effective amount is an effective amount for treating a neurological disorder or neurological disorder associated with abnormal protein transport. In certain embodiments, the effective amount is an effective amount for treating a neurological disorder or neurological disorder associated with abnormal protein transport in adapter protein complex 4 (AP-4) deficiency. In certain embodiments, the effective amount is an effective amount for treating hereditary spastic paraplegia (HSP). In a particular embodiment, the effective dose is an effective dose for treating adapter protein complex 4 (AP-4)-associated hereditary spastic paraplegia (AP-4-HSP) (e.g., AP4B1-associated SPG47 (OMIM #614066), AP4M1-associated SPG50 (OMIM #612936), AP4E1-associated SPG51 (OMIM #613744), AP4S1-associated SPG52 (OMIM #614067)).

[0108] In certain embodiments, the effective dose is an amount effective in regulating autophagy-related 9A (ATG9A) transport within or from cells. In certain embodiments, the effective dose is an amount effective in regulating intracellular vesicular transport and increasing intracellular autophagy flux.

[0109] The pharmaceutical compositions described herein may be prepared by any method known in the field of pharmacology. Generally, such preparation methods include the steps of associating a composition comprising the compounds of the disclosed herein (e.g., the compounds of formula (I)) with a carrier and / or one or more other auxiliary components, and then, if necessary and / or desired, shaping and / or packaging the product into desired single or multi-dose units.

[0110] Pharmaceutical compositions may be prepared, packaged, and / or sold in bulk as single unit doses and / or as multiple single unit doses. As used herein, “unit dose” is a discrete amount of a pharmaceutical composition containing a given amount of the active ingredient. The amount of the active ingredient is generally equal to the dose of the active ingredient that would be administered to a subject, and / or a convenient fraction of such a dose, such as half or one-third of such a dose.

[0111] The compounds and compositions provided herein may be administered by any route, including enteral (e.g., oral), parenteral, intravenous, intramuscular, intra-arterial, intramedullary, intrathecal, subcutaneous, intraventricular, percutaneous, interdermal, rectal, vaginal, intraperitoneal, topical, mucosal, nasal, buccal, sublingual; intratracheal drip infusion, intrabronchial drip infusion, and / or inhalation; and / or as oral spray, nasal spray, and / or aerosol.

[0112] The compounds or compositions described herein may be administered in combination with one or more additional pharmaceuticals (e.g., therapeutically and / or prophylactically active agents). The compounds or compositions may be administered in combination with additional pharmaceuticals that improve the activity of the composition (e.g., activity in treating disease in subjects that require treatment of disease, in preventing disease in subjects that require prevention of disease, and / or reducing the risk of developing disease in subjects that require reduction of the risk of developing disease (e.g., potency and / or effectiveness)), improve bioavailability, improve the ability of the composition to cross the blood-brain barrier, improve safety, reduce drug resistance, reduce metabolism and / or modify, inhibit excretion, and / or modify distribution in subjects or cells. It will also be understood that the therapies employed may achieve the desired effect for the same disorder, and / or achieve different effects. In certain embodiments, pharmaceutical compositions described herein that include the compounds and additional pharmaceuticals described herein exhibit synergistic effects that are not present in pharmaceutical compositions that include only one of the compounds and / or the additional pharmaceuticals, rather than both. Compounds or pharmaceutical compositions may be administered concurrently with, or prior to, one or more additional pharmaceuticals, which may also be useful as combination therapy, for example. Pharmaceuticals include therapeutic activators. Pharmaceuticals also include prophylactic activators. Pharmaceuticals include drug compounds (for example, compounds approved by the U.S. Food and Drug Administration for human or veterinary use as defined in the Code of Federal Regulations (CFR)), peptides, proteins, carbohydrates, monosaccharides, oligosaccharides, polysaccharides, nucleoproteins, mucoproteins, lipoproteins, synthetic polypeptides or proteins, small molecules linked to proteins, glycoproteins, steroids, nucleic acids, DNA, RNA, nucleotides, nucleosides, oligonucleotides, antisense oligonucleotides, lipids, hormones, vitamins, and small organic molecules such as cells. Each additional pharmaceutical may be administered in the dose and / or time schedule determined for that pharmaceutical.Additional pharmaceuticals may also be administered in single doses together with each other and / or with the compounds or compositions described herein, or separately in different doses. The specific combinations adopted in a regimen will take into account the compatibility of the compounds described herein with the additional pharmaceuticals and / or the desired therapeutic and / or preventive effects to be achieved. Generally, the combined additional pharmaceuticals are expected to be used at levels not exceeding those used individually. In some embodiments, the combined level will be lower than the level used individually.

[0113] In certain embodiments, the subject is an animal. The animal may be of either sex and at any stage of development. In certain embodiments, the subject described herein is a human. In certain embodiments, the subject is a non-human animal. In certain embodiments, the subject is a mammal. In certain embodiments, the subject is a non-human mammal. In certain embodiments, the subject is a domestic animal such as a dog, cat, cow, pig, horse, sheep, or goat. In certain embodiments, the subject is a companion animal such as a dog or cat. In certain embodiments, the subject is a domestic animal such as a cow, pig, horse, sheep, or goat. In certain embodiments, the subject is a zoo animal. In another embodiment, the subject is a research animal such as a rodent (e.g., mouse, rat), dog, pig, or non-human primate. In certain embodiments, the animal is a genetically modified animal. In certain embodiments, the animal is a transgenic animal (e.g., transgenic mouse and transgenic pig). In certain embodiments, the subject is a fish or a reptile.

[0114] This disclosure also covers kits (e.g., pharmaceutical packs). The kits provided may include the pharmaceutical compositions or compounds described herein, and containers (e.g., vials, ampoules, bottles, syringes, and / or dispenser packages or other suitable containers). In some embodiments, the kits provided may optionally further include a second container containing pharmaceutical excipients for dilution or suspension of the pharmaceutical compositions or compounds described herein. In some embodiments, the pharmaceutical compositions or compounds described herein, provided in the first and second containers, are combined to form a single unit dosage form.

[0115] Accordingly, in one aspect, a kit is provided comprising a first container containing a compound or pharmaceutical composition described herein. In certain embodiments, the kit is useful for treating neurological diseases or disorders (e.g., hereditary spastic paraplegia (HSP)) in subjects that require treatment for the neurological disease or disorder (e.g., hereditary spastic paraplegia (HSP)). In certain embodiments, the kit is useful for preventing neurological diseases or disorders (e.g., hereditary spastic paraplegia (HSP)) in subjects that require treatment for the neurological disease or disorder (e.g., hereditary spastic paraplegia (HSP)). In certain embodiments, the kit is useful for reducing the risk of developing neurological diseases or disorders (e.g., hereditary spastic paraplegia (HSP)) in subjects that require reduction of the risk of developing the neurological disease or disorder (e.g., hereditary spastic paraplegia (HSP)). In certain embodiments, the kit is useful for regulating autophagy-related 9A (ATG9A) transport inside or out of cells. In certain embodiments, the kit is useful for regulating intracellular vesicular transport and increasing the autophagy flux of the target and / or within the cell.

[0116] In certain embodiments, the kits described herein further include instructions for using the kit. The kits described herein may also include information as required by regulatory agencies such as the U.S. Food and Drug Administration (FDA). In certain embodiments, the information included in the kit is prescription information. In certain embodiments, the kits described herein may also include one or more additional medicinal products described herein as separate compositions.

[0117] Treatment method This disclosure provides methods for treating cancer. In certain embodiments, this disclosure provides methods for treating neurological diseases or neuropathy. In certain embodiments, this disclosure provides methods for treating neurological diseases or neuropathy associated with abnormal protein transport. In certain embodiments, this disclosure provides methods for treating neurological diseases or neuropathy associated with abnormal protein transport in adapter protein complex 4 (AP-4) deficiency. In certain embodiments, this disclosure provides methods for treating hereditary spastic paraplegia (HSP). In certain embodiments, this disclosure provides methods for treating adapter protein complex 4 (AP-4)-associated hereditary spastic paraplegia. In certain embodiments, this disclosure provides methods for treating AP4B1-associated SPG47 (OMIM #614066). In certain embodiments, this disclosure provides methods for treating AP4M1-associated SPG50 (OMIM #612936). In certain embodiments, this disclosure provides methods for treating AP4E1-associated SPG51 (OMIM #613744). In certain embodiments, the Disclosure provides a method for treating AP4S1-related SPG52 (OMIM #614067).

[0118] In certain embodiments, the disclosure provides methods for regulating autophagy-related 9A (ATG9A) transport in or out of cells. In certain embodiments, the disclosure provides methods for regulating intracellular vesicular transport and increasing autophagy flux in and / or cells. In certain embodiments, cells are mammalian cells. In certain embodiments, cells are human cells. In certain embodiments, cells are within a subject. In certain embodiments, cells are within a mammal. In certain embodiments, cells are within a human.

[0119] In certain embodiments, the methods of the Disclosure involve administering an effective amount of the Compound of the Disclosure (e.g., the Compound of Formula (I)) or a pharmaceutically acceptable salt, cocrystal, tautomer, stereoisomer, solvate, hydrate, polymorph, isotope-enriched derivative, or prodrug or composition thereof to a target. In some embodiments, the effective amount is a therapeutic effective amount. In some embodiments, the effective amount is a prophylactic effective amount.

[0120] In certain embodiments, the subject being treated is an animal. The animal may be of either sex and at any stage of development. In certain embodiments, the subject is a mammal. In certain embodiments, the subject being treated is a human. In certain embodiments, the subject is a domestic animal such as a dog, cat, cow, pig, horse, sheep, or goat. In certain embodiments, the subject is a companion animal such as a dog or cat. In certain embodiments, the subject is a livestock animal such as a cow, pig, horse, sheep, or goat. In certain embodiments, the subject is a zoo animal. In another embodiment, the subject is a research animal such as a rodent (e.g., mouse, rat), dog, pig, or non-human primate. In certain embodiments, the animal is a genetically modified animal. In certain embodiments, the animal is a transgenic animal.

[0121] Certain methods described herein may include administering one or more additional pharmaceuticals in combination with the compounds described herein. The additional pharmaceuticals may be administered simultaneously with the compounds of the disclosure (e.g., the compound of formula (I)) or at a different time. For example, the compounds of the disclosure (e.g., the compound of formula (I)) and any additional pharmaceuticals may be on the same or different administration schedules. All or part of a dose of the compounds of the disclosure (e.g., the compound of formula (I)) may be administered before all or part of a dose of an additional pharmaceutical, all or part of a dose of an additional pharmaceutical, within the administration schedule of the additional pharmaceuticals, or in combination thereof. The timing of administration of the compounds of the disclosure (e.g., the compound of formula (I)) and additional pharmaceuticals may differ for different additional pharmaceuticals.

[0122] In certain embodiments, the additional pharmaceuticals include agents useful for treating neurological diseases or neuropathy. In certain embodiments, the additional pharmaceuticals are useful for treating neurological diseases or neuropathy associated with abnormal protein transport. In certain embodiments, the additional pharmaceuticals are useful for treating neurological diseases or neuropathy associated with abnormal protein transport in adapter protein complex 4 (AP-4) deficiency. In certain embodiments, the additional pharmaceuticals are useful for treating hereditary spastic paraplegia (HSP). In certain embodiments, the additional pharmaceuticals are useful for treating adapter protein complex 4 (AP-4)-associated hereditary spastic paraplegia (AP-4-HSP) (for example, AP4B1-associated SPG47 (OMIM #614066), AP4M1-associated SPG50 (OMIM #612936), AP4E1-associated SPG51 (OMIM #613744), and AP4S1-associated SPG52 (OMIM #614067)).

[0123] In another aspect, the present disclosure provides a method for modulating autophagy-related 9A (ATG9A) transport in or out of cells, comprising contacting cells with a compound of the present disclosure (e.g., a compound of formula (I)), or a pharmaceutically acceptable salt, cocrystal, tautomer, stereoisomer, solvate, hydrate, polymorph, isotope-enriched derivative, or prodrug or composition thereof. In a particular embodiment, the cells are within a subject. In a particular embodiment, the contact is in a biological sample. In a particular embodiment, the contact results in an increase in ATG9A transport from the trans-Golgi network (TGN). In a particular embodiment, the contact results in a decrease in ATG9A within the trans-Golgi network (TGN). In certain embodiments, contact results in a reduction of at least 5%, at least 10%, at least 15%, at least 20%, at least 25%, at least 30%, at least 35%, at least 40%, at least 45%, at least 50%, at least 60%, at least 70%, at least 80%, at least 90%, or at least 95% of ATG9A in the trans-Golgi network (TGN). In certain embodiments, contact results in a reduction in the ratio of ATG9A concentration in the trans-Golgi network (TGN) to ATG9A concentration in the cytoplasm. In certain embodiments, the ratio of ATG9A concentration in the trans-Golgi network (TGN) to ATG9A concentration in the cytoplasm is less than or equal to 1:1, less than or equal to 1.1:1, less than or equal to 1.2:1, less than or equal to 1.3:1, less than or equal to 1.4:1, less than or equal to 1.5:1, less than or equal to 1.6:1, less than or equal to 1.7:1, less than or equal to 1.8:1, less than or equal to 1.9:1, or less than or equal to 2:1 after contacting cells with the compounds of the present disclosure. In certain embodiments, the ratio of ATG9A concentration in the trans-Golgi network (TGN) to ATG9A concentration in the cytoplasm is at least 1:1, at least 1.1:1, at least 1.2:1, at least 1.3:1, at least 1.4:1, at least 1.5:1, at least 1.6:1, at least 1.7:1, at least 1.8:1, at least 1.9:1, or at least 2:1 after contacting cells with the compounds of the present disclosure. In certain embodiments, contact is in vitro. In certain embodiments, contact is in vivo.In certain embodiments, the cells are mammalian cells. In certain embodiments, the cells are human cells.

[0124] In another aspect, the Disclosure provides a method for regulating intracellular vesicular transport and increasing intracellular autophagy flux, comprising contacting cells with a compound of the Disclosure (e.g., a compound of formula (I)), or a pharmaceutically acceptable salt, cocrystal, tautomer, stereoisomer, solvate, hydrate, polymorph, isotope-enriched derivative, or prodrug or composition thereof. In certain embodiments, the cells are within a subject. In certain embodiments, the cells are in a biological sample. In certain embodiments, the contact is in vitro. In certain embodiments, the contact is in vivo. In certain embodiments, the cells are mammalian cells. In certain embodiments, the cells are human cells.

[0125] example Examples are provided below to help the disclosure be better understood. The synthetic and biological examples described herein are provided to illustrate the compounds, pharmaceutical compositions, and methods provided herein and should not be construed as limiting their scope.

[0126] A primary screening of 28,864 compounds in fibroblasts derived from AP-4-HSP patients identified 503 active compounds. A diversity library of 28,864 novel small molecules was sequenced in a 384-well microplate. Primary screening was performed in well-characterized patient-derived fibroblasts containing all core features of SPG47 and a biallele loss-of-function mutant of AP4B1 (NM_001253852.3:c.1160_1161del(p.Thr387ArgfsTer30) / c.1345A>T(p.Arg449Ter)) (Figures 1A-1B). Sex-matched parent-derived fibroblasts (non-affected heterozygous carriers) served as controls. The assay was fully automated, miniaturized in a 384-well microplate, and compounds were added at a single concentration of 10 μM over 24 hours (Figure 1C).

[0127] The ATG9A ratio (ATG9A fluorescence intensity inside the TGN versus ATG9A fluorescence intensity in the cytoplasm) was used as the primary assay metric. The population distribution of subcellular ATG9A signaling inside and outside the TGN at the single-cell level for negative controls (biallelelic loss of function, LoF / LoF) and positive controls (heterozygous carrier, WT / LoF) is shown in Figures 1D and 1E. The ATG9A ratio demonstrated a normal distribution and robust segregation for both groups (Figure 1F). Cell numbers were similar for positive and negative controls, excluding cell death or changes in proliferation rate as possible confounding factors (Figure 1G). To test repeatability, assay plates were randomly sampled into two sets, and similar locations on the assay plates were plotted relative to each other (Figures 1H–1I). Random sampling was simulated 100 times, and the mean covariance was calculated using Pearson correlation coefficients. Using the ATG9A ratio (Figure 1I) as the primary readout resulted in higher repeated correlations (mean r = 0.90 ± 0.002 SD) compared to absolute ATG9A intensity (Figure 1H) (mean r = 0.82 ± 0.0008 SD). The ATG9A ratio demonstrated robust discriminative power between positive and negative controls (LoF / LoF mean: 1.1 ± 0.02 SD, n=1312 wells vs. WT / LoF mean: 1.34 ± 0.05 SD, n=1312 wells; t-test, p < 0.0001) (Figure 1J). The ATG9A ratio as the primary outcome metric was further supported by a generalized linear model, which demonstrated high specificity and sensitivity (Figure 1K, AUC: 0.96).

[0128] During screening, assay performance was monitored using established quality control metrics for cell-based screening (Z' robustness ≥ 0.3, strictly standardized median difference ≥ 3, and inter-assay coefficient of variation ≤ 10%). To avoid bias due to inter-plate variability, all assay metrics were calculated for positive and negative controls from the same assay plate. The predetermined threshold was met by all assay plates (Figure 9A). The results of the primary screening are summarized in Figures 1L and 1M.

[0129] Based on low cell counts or imaging artifacts, 26 out of 28,864 compounds were excluded due to unquantifiable ATG9A signaling. Subsequently, the remaining 28,838 compounds were evaluated for changes in cell count and ATG9A ratio. The majority of compounds (n=26,961, 93.5%) did not show a significant decrease in the ATG9A ratio (defined as a decrease of at least 3 SD). 1,435 compounds (5.0%) were excluded for toxicity, defined as a decrease of at least 2 SD in mean cell count compared to the negative control. Only a small subset of 503 compounds (1.7%) reduced the ATG9A ratio by 3 SD or more compared to the negative control (Figure 1M). Of these, 61 (0.2%) also reduced cell count, while the remaining 442 (1.5%) did not show toxicity.

[0130] In summary, this high-throughput primary screening identified 503 active compounds, and 442 were selected for further testing.

[0131] Counter-screening in fibroblasts derived from AP-4-HSP patients identified 16 compounds that induce dose-dependent redistribution of ATG9A. To confirm and further evaluate the 503 active compounds identified in the primary screening, the compounds were retested for dose-dependency using an 11-point dose range (range: 40 nM to 40 μM) (Figure 2A). All concentrations were screened in biological doubles and subjected to the same quality control metrics as in the primary screening (Figure 9B). Similar to the results of the primary screening, the ATG9A ratios of negative and positive controls showed robust separation (LoF / LoF mean: 1.4 ± 0.07 (SD), n=269 wells; vs. WT / LoF mean: 1.12 ± 0.02 (SD), n=269 wells, T-test, p<0.0001, Figure 2B). Activity in the secondary screening was defined as the ability to reduce the ATG9A ratio by at least 3 SD in both replicates and at least two different concentrations without causing toxicity. 51 compounds (10.1%) met these a priori defined criteria (Figures 10A–10B). After manually verifying image quality and confirming dose-response relationships, the compounds were triaged (Figure 2A, and Figures 10A–10B). Seventeen compounds demonstrated clear and reproducible dose-response relationships without evidence of image artifacts or autofluorescence. The ED50 of most compounds was within the low micromolar range (median: 4.66 μM, IQR: 8.63, Figure 2). Thirty-four compounds were found to possess autofluorescence or imaging artifacts and were therefore excluded from further testing (Figure 10B).

[0132] In summary, counterscreening in fibroblasts from AP-4-deficient patients confirmed and established dose-dependent effects on intracellular ATG9A distribution for 16 compounds (Figure 2C).

[0133] Five active compounds were identified by orthogonal assays in AP-4-deficient neuronal models. To validate active compounds from secondary screening in human cell lines with neuron-like characteristics, the ATG9A assay was optimized for neuroblastoma-derived SH-SY5Y cells after a 5-day neuronal differentiation protocol using retinoic acid (Figure 3A). Stable AP4B1 knockout (AP4B1 KO SH-SY5Y cells with ) functioned as a negative control, whereas AP4B1 wild-type (AP4B1 WT Cells were used as a positive control. All 16 active compounds were tested in 8 point dilutions (range: 50 nM to 30 μM) with a 24-hour treatment time. Quantification of the ATG9A ratio in differentiated SH-SY5Y cells showed robust separation between control conditions (AP4B1). KO : 1.80 ± 0.06 (SD), n=158 wells vs AP4B1 WT (1.17±0.03 (SD), n=160 wells, T-test, p<0.0001, Figure 3B). Compounds were evaluated based on dose-dependent reduction of the ATG9A ratio and the absence of cytotoxicity. Of the 16 compounds, 11 were excluded due to lack of activity (n=7), suspected artifacts or autofluorescence (n=3), or obvious changes in cell morphology (n=1) (Figure 11). Of the remaining 5 compounds, 3 restored the ATG9A ratio to the level of the wild-type control (F-01, G-01, and H-01), while 2 compounds (B-01 and C-01) resulted in a decrease of at least 3 SD at even higher concentrations (Figures 3C-3H).

[0134] To evaluate whether these effects are specific to ATG9A or whether similar effects exist in other AP-4 cargo proteins, a second neuronal AP-4 cargo protein, DAGLB, was used. Similar to ATG9A, the DAGLB ratio (DAGLB fluorescence intensity in the TGN versus DAGLB fluorescence intensity in the cytoplasm) was used for AP4B1. WT Cells and AP4B1 KO It showed robust separation from cells (AP4B1). KO : 1.80 ± 0.1 (SD), n=192 wells vs AP4B1 WT(1.36±0.07 (SD), n=192 wells, T-test, p<0.0001, Figure 3I). All five active compounds showed activity in the DAGLB assay, suggesting a broader effect on the transport of at least two AP-4 cargo proteins from the TGN. Here again, F-01, G-01, and H-01 (Figures 3L-3O) resulted in normalization of intracellular DAGLB distribution, while B-01 and C-01 resulted in a moderate decrease in the DAGLB ratio at even higher concentrations (Figures 3J-3K, Figure 3O).

[0135] Because small molecules can have multifaceted effects on cellular function and organelle morphology, a multiparametric morphological profiling approach was then employed. 85 measurements of the nucleus, cytoskeleton, overall cellular morphology, TGN, and ATG9A vesicles were automatically calculated for each image, serving as a rich and unbiased source of information for investigating the biological perturbations induced by compound treatment. Principal component analysis was used to reduce dimensionality and cluster images based on their characteristics (Figures 4A and 12). Positive and negative controls were closely clustered and separated only by the ATG9A signal (Figures 4B and 12A). B-01, C-01, and G-01 exhibited characteristics comparable to the positive and negative controls, suggesting minimal off-target effects (Figures 4B, 12B-12C, and 12E). However, F-01 and H-01 altered cell morphology in a dose-dependent manner (Figures 4B, 12D, and 12F), and these alterations were primarily caused by a first principal component, which accounted for 31.1% of the observed variance (Figure 4C). To decipher the phenotypic changes responsible for these alterations, the covariance (Pearson correlation coefficient) of the first principal component with each measurement was calculated (Figure 4D). To define the morphological profile, features with a correlation coefficient > 0.75 were selected (Figure 4E). TGN fluorescence intensity and morphology appeared to be the most important drivers of separation, suggesting that disruption of TGN integrity may skew the assessment of the ATG9A ratio in cells treated with compounds F-01 and H-01 (Figures 4B, 12D, and 12F).

[0136] Following these analyses, cells treated with all five active compounds were quantified for TGN fluorescence intensity as an indicator of TGN complexity, as well as morphological measures such as TGN area and elongation, and density and roughness (Figures 4F–4G). C-01 showed stable TGN signaling and morphology across all evaluated measurements, while the other compounds all illustrated some degree of change. Here again, F-01 and H-01 appeared to induce dose-dependent changes in TGN, while B-01 and G-01 resulted in only moderate changes (Figures 4F–4G). Notably, these changes in TGN morphology were undetectable by visual inspection and could only be depicted by automated analysis of approximately 600 images per group, demonstrating the capabilities of an automated, unbiased, high-throughput platform.

[0137] C-01 restored ATG9A and DAGLB transport in iPSC-derived neurons from AP-4-HSP patients. Differentiated AP4B1 KODiscoveries in SH-SY5Y cells provided information, and these results were then investigated to determine whether they could be converted into human neurons. iPSCs derived from patients with AP-4-HSP were generated from biallelelic loss-of-function mutants in AP4M1(NM_004722.4:c.916C>T(p.Arg306Ter) / c.694dupG(p.Glu232GlyfsTer21)) and AP4B1(NM_001253852.3:c.1160_1161del(p.Thr387ArgfsTer30) / c.1345A>T(p.Arg449Ter)) and differentiated into glutamatergic cortical neurons using established protocols. Neurons derived from iPSCs from sex-matched parents (non-affected heterozygous carriers) served as controls (Figure 5A). Baseline quantification of the ATG9A ratio in DIV14 neurons treated with the vehicle for 24 hours showed robust segregation between patient and control lines, exceeding the differences observed in AP-4-deficient fibroblasts and differentiated SH-SY5Y cells (SPG50 patient mean: 4.31 ± 0.4 (SD), n=60 wells vs. heterozygous control: 1.56 ± 0.12 (SD), n=60 wells, t-test, p<0.0001, Figure 5B). Neurons were treated over 24 hours in an 8-point dose escalation experiment. B-01 and G-01 were excluded due to lack of activity in the ATG9A ratio (Figure 5D). In contrast, C-01, F-01, and H-01 showed robust reduction in the ATG9A ratio (Figures 5E-5F). Multiparametric analysis was performed using AP4B1. KOSimilar to observations in SH-SY5Y cells, only C-01 preserved TGN integrity (Figure 5F), while F-01 and H-01 affected TGN morphology, suggesting off-target effects (Figure 5E). Based on its favorable profile, C-01 was resynthesized for further testing (Figure 5G). Orthogonal experiments using long-term treatment of C-01 for 72 hours to test ATG9A and DAGLB translocations demonstrated that C-01 could restore the ratio of both AP-4 cargo proteins to near control levels at approximately 5 μM ED50 while maintaining a favorable profile (Figure 5H). Compared to the approximately 50% decrease in the ATG9A ratio in 24-hour treatment, this greater effect on ATG9A distribution suggests a time-dependent and dose-dependent effect. C-01 altered the ATG9A ratio by decreasing ATG9A intensity within the TGN while simultaneously increasing cytoplasmic ATG9A levels, suggesting ATG9A translocation as the most likely mechanism of action. No changes in TGN morphology or any other cellular measurements were observed, indicating overall preservation of cell morphology and minimal off-target effects. A similar pattern was observed for DAGLB translocations (Figure 5H). These findings were confirmed in a second series of experiments in iPSC-derived neurons from a patient with SPG47 (Figure 5I), demonstrating that the findings extend to other forms of AP-4 deficiency.

[0138] In summary, C-01 emerged as a robust regulator of ATG9A and DAGLB transport in human neurons derived from AP-4-deficient patients.

[0139] Targeted deconvolution using transcriptome and proteomics analysis described the presumed mechanism of action of C-01. To explore the potential mechanisms of action of C-01 in an unbiased manner, a multi-omics approach combining bulk RNA sequencing and unbiased, unlabeled quantitative proteomics was used.

[0140] First, differentiated AP4B1 cells were treated for 72 hours with either the vehicle or compound C-01 (5 μM). WT SH-SY5Y cells and differentiated AP4B1 KOBulk RNA sequencing was performed in SH-SY5Y cells. Differential gene expression analysis identified few significant transcriptional changes in response to C-01 treatment, suggesting that the compound does not induce large changes in gene expression or many off-target effects (Figure 13). Changes in gene expression caused by short-duration small molecule treatment may be too small to reach the predetermined cutoff for standard differential expression analysis, and since the compound may affect gene clusters within a shared pathway rather than modifying a single target gene, an unbiased, unsupervised network approach was adopted to identify co-expressed gene clusters. Hierarchical clustering of samples showed that treatment with C-01 was the main differentiation factor in the dataset, regardless of cell lineage (Figure 6A). To identify the gene networks responsible for these changes, weighted gene co-expression network analysis (WGCNA) was used to group 18,506 expressed genes into 36 co-expression modules (Figure 6B). Gene expression profiles within each module were summarized using "module-specific genes" (MEs), defined as the first principal components (PCs) of the module. Within each module, the association between MEs and measured traits was examined by correlation analysis (Figure 6C). For further evaluation, eight modules exhibiting an absolute correlation coefficient > 0.5 were selected. For these selected modules, ME-based connectivity was determined for all genes by calculating the absolute value of the Pearson correlation between gene expression and each ME, creating a quantitative measure of module membership (MM). Similarly, correlations between individual genes and C-01 treatment were calculated to define C-01 gene significance (GS). Using GS and MM, intra-module analysis was performed, enabling the identification of genes with high significance to the treatment and high connectivity to their respective modules (Figure 6D). Five modules, defined as exhibiting an absolute correlation coefficient > 0.5 between MM and GS, were significantly associated with C-01 treatment (Figure 6E).To summarize the biological information contained in these target modules, gene ontology (GO) analysis was performed, which demonstrated enrichment in biological pathways in three out of five of the evaluated modules (Figure 6F). The top left module (labeled "blue") showed downregulation of pathways involved in axonogenesis, actin filament organization, and proteasome-mediated pathways. The top right module (labeled "light yellow") contained genes involved in the ER stress response, amino acid metabolism, and transcription. Finally, the bottom module (labeled "medium purple 3") illustrated upregulation of genes involved in vesicular transport, particularly TGN- and ER-related transport, as well as membrane and vesicle dynamics. This last module showed the highest gene ratio (defined as the proportion of total differentially expressed genes in a given GO term) and the lowest P-value of all differentially regulated pathways across all modules, suggesting upregulation of an alternative vesicle-mediated transport mechanism by compound C-01 (Figure 6F).

[0141] To evaluate whether similar themes emerged at the protein level, unbiased quantitative proteomics was then used in differentiated SH-SY5Y cells (AP4B1 KO and AP4B1 WT ) and iPSC-derived neurons (patients with AP4B1-associated SPG47 and controls) treated with either vehicle or compound C-01 (5 μM) for 72 h. After quality filtering, 8,141 unique proteins in SH-SY5Y cells and 7,386 unique proteins in iPSC-derived neurons were quantified. Differential enrichment analysis for both cell lines is shown in Figures 7A–7B. AP4B1 KOBaseline quantification of differentially expressed proteins in SH-SY5Y cells showed downregulation of AP-4 subunits, AP4B1, AP4E1, and AP4M1, and increased ATG9A levels (Figure 14A). PCA analysis of SH-SY5Y cells demonstrated four distinct clusters separated by C-01 treatment (explaining 12.3% of the variance) and genotype (explaining 8.7% of the variance) (Figure 7A). Vehicle vs. C-01 treated cells showed AP4B1 WT SH-SY5Y cells and AP4B1 KO SH-SY5Y cells showed a broadly similar group of dysregulated proteins (Figures 14B-14D), suggesting a conserved mechanism of action independent of genotype, which allowed for increased analytical power through cell lineage pooling (Figure 7A). Similar observations were made in iPSC-derived neurons (Figures 7B and 14E-14H). Here, cell lineage was a stronger discriminator, likely due to heterogeneity between positive and negative controls. Again, differentially enriched proteins after C-01 treatment in iPSC neurons showed a high degree of similarity between patient and control lines (Figures 14F-14H), enabling cell lineage pooling (Figure 7B).

[0142] Despite heterogeneity in neuronal samples, significant overlap was observed between differentially enriched proteins in SH-SY5Y cells and those in iPSC-derived neurons. Therefore, the datasets were combined for combinatorial analysis, which detected several dysregulated proteins across all cell and genotypes (Figures 14I–14L), providing strong evidence that these changes were associated with C-01 treatment (Figure 7C). Consistent with the overall changes in gene expression, pathway enrichment analysis using the Reactome database highlighted the involvement of intracellular transport pathways as a potential mechanism of action of C-01 (Figure 7C). Specifically, the regulation of RAB proteins involved in vesicular transport emerged as a consistent theme across cell and genotypes, with the strongest evidence for RAB1B upregulation and RAB3C and RAB12 downregulation. C-01 resulted in significant changes in the protein levels of all three RAB protein family members in SH-SY5Y cells, although only RAB3C and RAB12 were significantly elevated in neurons (Figure 7D). This overall pattern of RAB protein regulation was further supported by the upregulation of RAB protein geranylgeranyltransferase components A1 (CHM) in SH-SY5Y cells and A2 (CHML) in SH-SY5Y cells and neurons, which play a crucial role in tethering RAB proteins to the intracellular membrane. In addition, this was consistent with previous observations showing that a decrease in RAB12 is associated with an increase in TFRC protein levels. 38 Upregulation of transferrin receptor protein 1 (TFRC) was observed (Figure 7C). In summary, these findings suggest a potential role for RAB proteins in regulating vesicular transport in response to C-01 treatment.

[0143] RAB3C and RAB12 knockouts are involved in C-01-mediated vesicle transport and autophagy. RAB3C and RAB12 were selected for further investigation because they showed the strongest and most consistent protein expression changes in both differentiated SH-SY5Y cells and iPSC-derived neurons after treatment with C-01 (Figure 7D). Correlation analysis revealed a strong correlation (r=0.93) between the LFQ intensities of these two proteins in both cell types and across different genotypes in response to C-01 (Figure 8A). To assess whether a correlation also exists at the transcriptional level, AP4B1 was used. WT SH-SY5Y cells and AP4B1 KO In SH-SY5Y cells, RAB3C and RAB12 mRNA levels were analyzed in response to C-01 treatment (Figures 15A-15E). Although no statistically significant differences were detected, there was a trend toward decreased RAB3C mRNA levels (Figures 15A, 15C) and increased RAB12 mRNA levels (Figures 15B, 15D). Correlation analysis demonstrated a moderate inverse correlation between the expression levels of RAB3C and RAB12 (Figure 15E).

[0144] To investigate the potential effects of RAB3C and RAB12 on ATG9A translocation in AP-4 deficiency background, AP4B1 KO CRISPR / Cas9-mediated knockout of RAB3C and RAB12 in SH-SY5Y cells was used (Figure 8B). RAB12 knockout was found to have no effect on ATG9A translocation, while RAB3C knockout caused a moderate decrease in the ATG9A ratio (-2 SD). However, AP4B1 KO Combination knockout of RAB3C and RAB12 in SH-SY5Y cells showed no additive effect. The effect of C-01 on ATG9A translocation was significantly enhanced by knockout of either RAB3C or RAB12 alone, and further increased by combination knockout of both genes. These findings suggest that both RAB3C and RAB12 play some role in C-01-mediated ATG9A redistribution.

[0145] The convergence of ATG9A translocation and changes in RAB protein expression is the regulation of autophagy. To investigate changes in autophagy flux, we used C-01 to study AP4B1 WT SH-SY5Y cells and AP4B1 KO SH-SY5Y cells were treated for 72 hours, and the conversion from LC3-I to LC3-II was measured by Western blotting (Figures 8C-8F and 16A). LC3-II levels were significantly elevated in all cell lines treated with C-01, suggesting regulation of the autophagy pathway. Co-treatment with bafilomycin A1, which blocks autophagosome-lysosome fusion, for 4 hours resulted in further accumulation of LC3-II, indicating that C-01 increases the autophagy flux (Figures 8C-8F).

[0146] To investigate the potential contributions of RAB3C and RAB12 to the regulation of autophagy, CRISPR / Cas9-mediated knockout of RAB3C and RAB12 was performed on AP4B1. KO The cells were introduced into SH-SY5Y cells (Figures 8G-8H and 16B-16D). Neither RAB3C nor RAB12 knockout alone resulted in changes to baseline or C-01-enhanced autophagy flux (Figures 8G-8H). However, the combined RAB3C and RAB12 knockout significantly increased LC3-II to LC3-I conversion (Figure 8I). Upon treatment with bafilomycin A1, both RAB3C knockout alone and the combined RAB3C and RAB12 knockout further increased C-01-mediated LC3-II to LC3-I conversion (Figures 8G-8I). These findings suggest that RAB3C and RAB12 may modulate C-01-mediated ATG9A transport and autophagy induction, at least partially explaining some of the observed effects of C-01.

[0147] Consideration Identifying therapeutic targets for rare neurological disorders represents a major scientific and public health challenge. The increasing number of rare genetic disorders, rising diagnostic rates, and the significant burden on patients, caregivers, and healthcare systems highlight the urgent need for translational research that moves beyond genetic discovery to identify disease mechanisms and therapies.

[0148] Unbiased, high-content small molecule screening is a platform for drug reuse approaches and a starting point for developing the rationale behind new compounds. Disease-related, "screenable" phenotypes across cell models, including patient-derived cells, provide an entry point for the development of automated, high-content screening and analysis platforms.

[0149] In this disclosure, a first high-throughput cell-based phenotypic screening platform has been developed for prototype forms of childhood-onset HSPs caused by defective protein transport. This platform enables users to determine the subcellular localization of the AP-4 cargo protein ATG9A in several AP-4-deficient cell models based on the mislocalization of ATG9A, a key mechanism in the pathogenesis of AP-4-HSPs.

[0150] ATG9A is the only conserved transmembrane autophagy-associated protein, and in the mammalian cell cycle between the TGN and ATG9A vesicles, it associates with endosome and autophagosome formation sites. ATG9A has four transmembrane domains and forms homotrimers with lipid scramblase activity that is hypothesized to equilibrate lipids within the bilayer of nascent autophagosomes. Basal autophagy is essential for neuronal survival, and neuron-specific loss of the autophagy pathway leads to axonal degeneration and cell death. In neurons, autophagosomes form within the distal axon and are subjected to active transport; therefore, efficient vesicular transport and spatial distribution of ATG9A are essential for axonal function, as demonstrated in CNS-specific Atg9a knockout mice.

[0151] Having established a robust and dynamic assay for reliably measuring intracellular ATG9A distribution, a large library of 28,864 novel small molecules was systematically screened for their ability to restore ATG9A transport from TGN to the cytoplasm. Following this primary screening, counter-screening and a series of orthogonal experiments using unbiased multiparametric analysis identified novel small molecule C-01, which can restore the intracellular distribution of ATG9A and the second transmembrane protein and AP-4 cargo, DAGLB, in AP-4-deficient neuronal models, including iPSC-derived neurons from two patients with AP-4-HSP.

[0152] Since the molecular target of C-01 is unknown, a targeted deconvolution strategy was employed using transcriptomics and proteomics profiling to define the cellular pathways affected by this novel small molecule. This approach identified two central themes: 1) regulation of Golgi dynamics and vesicular transport, and 2) involvement of autophagy. At the core of the putative pathways affected by C-01, the Rab proteins RAB1B, RAB3C, and RAB12, as well as the interacting Rab geranyltransferase subunits CHM and CHML, were identified. RAB3C and RAB12 showed the strongest and most consistent association with C-01 treatment in SH-SY5Y cells and iPSC-derived neurons, and analysis suggested that these two proteins are involved in C-01-mediated redistribution of ATG9A vesicles and increased autophagy flux.

[0153] Rab proteins comprise a large family of small guanosine triphosphate (GTP)-binding proteins that act as crucial regulators of intracellular membrane transport in eukaryotic cells at all stages, including cytoplasmic cargo sorting, vesicle budding, docking, fusion, and membrane organization. Rab GTPases function as soluble endogenous membrane proteins and specifically localized endogenous membrane proteins, the latter mediated by prenylation. Of the approximately 70 known Rab proteins, more than 20 are primarily associated with transglottic neural pathways (TGN), where they regulate Golgi organization, harmonize vesicle transport, and interact with various stages of the autophagy pathway.

[0154] Following treatment with C-01, RAB protein family members RAB3C and RAB12 were consistently downregulated in SH-SY5Y cells and iPSC-derived neurons, and knockout experiments of these two proteins suggested C-01-mediated ATG9A translocation and enhancement of autophagy flux. RAB3C, part of the RAB3 superfamily, is primarily expressed in brain and endocrine tissues, where it localizes to Golgi and synaptic vesicles and is involved in the regulation of exocytosis and neurotransmitter release. RAB12, on the other hand, is known to regulate endosomal transport and lysosomal degradation and has been identified as a regulator of autophagy via negative regulation of rapamycin target protein complex 1 (mTORC1). RAB12 primarily localizes to recycling endosomes, whose known cargo is the transferrin receptor (TfR). Knockdown of RAB12 in mouse embryonic fibroblasts increased TfR protein levels, while overexpression resulted in a decrease. Consistently, treatment with C-01 was found to robustly elevate transferrin receptor protein 1 (TFRC) while decreasing RAB12 protein levels. Although interactions between RAB3C and RAB12 have not been reported in the literature, the data suggest that both proteins may be involved in C-01-mediated regulation of vesicular transport and autophagy flux.

[0155] This approach describes the development of a small molecule screening platform for rare genetic disorders that leverages robust cellular phenotypes. This approach may also create a paradigm for other rare and more common disorders of protein transport. The increased autophagy flux via C-01 offers an intriguing possibility that this compound could be considered for the treatment of other autophagy-related disorders.

[0156] material and method Clinical Data from Patients with AP-4-HSP: This trial was approved by the Institutional Review Board of Boston Children's Hospital (IRB-P00033016 and IRB-P00016119). Two patients with AP-4-HSP and a clinically unaffected, sex-matched parent were enrolled in the International Registry and Natural History Study for Early-Onset Hereditary Spastic Paraplegia (ClinicalTrials.gov identifier: NCT04712812). Both patients underwent clinical and molecular diagnoses of AP-4-HSP and presented with key clinical and imaging features. 8 Patient 1 was diagnosed with AP4B1-associated SPG47 and carries the following compound heterozygous mutant: NM_001253852.3, c.1160_1161del(p.Thr387ArgfsTer30) / c.1345A>T(p.Arg449Ter). The sex-matched parent carries the heterozygous c.1160_1161del;p.Thr387Argfs*30 mutant. Patient 2 was diagnosed with AP4M1-associated SPG50 and carries the following compound heterozygous mutant: NM_004722.4, c.916C>T(p.Arg306Ter) / c.694dupG(p.Glu232GlyfsTer21). Sex-matched parents carry the heterozygous c.694dupG(p.Glu232GlyfsTer21) mutant.

[0157] Antibodies and reagents. The following reagents were used: bovine serum albumin (AmericanBIO, catalog number 9048-46-8), saponin (Sigma, #47036-50G-F), normal goat serum (Sigma-Aldrich, catalog number G9023-10ML), Dulbecco's phosphate-buffered saline (DPBS) (Thermo Fisher Scientific, catalog number 14190-250), trypsin (Thermo Fisher Scientific, catalog number 25200056), 4% paraformaldehyde (4%) (Boston BioProducts, catalog number BM-155), dimethyl sulfoxide (DMSO) (American Bioanalytical, catalog number AB03091-00100), bafilomycin A1 (Enzo Life Sciences, catalog number BML-CM110-0100), Molecular Probes Hoechst 33258 (Thermo Fisher Phalloidin labeled with ALEXA FLUOR® 647 (Thermo Fisher Scientific, catalog number H3569) and Thermo Fisher Scientific, catalog number A22287. The following primary antibodies were used: anti-AP4E1 at 1:500 (BD Bioscience, catalog number 612019), anti-ATG9A at 1:500-1:1000 (Abcam, catalog number ab108338), anti-DAGLB at 1:500 (Abcam, catalog number 191159), anti-TGN46 at 1:800 (Bio-Rad, catalog number AHP500G), anti-Golgi 97 at 1:500 (Abcam, catalog number 169287), anti-betatubulin III at 1:1000 (Synaptic Systems, catalog number 302304), anti-betaactin at 1:10,000 (Sigma, catalog number A1978-100UL), and anti-LC3B at 1:1000 (Novus, catalog number 100-2220).Fluorescently labeled secondary antibodies were used at a 1:2000 ratio for immunocytochemistry (Thermo Fisher Scientific, catalog numbers A11008, A11016, A21245), and fluorescently labeled secondary antibodies were used at a 1:5000 ratio for Western blotting (LI-COR Biosciences, catalog numbers 926-68022, 926-68023, 926-32212, 926-32213).

[0158] Small molecule library. A diverse small molecule library containing 28,864 compounds was provided by Astellas Pharma Inc. Compounds were arranged in 384-well microplates at a final concentration of 10 mM in DMSO (1000 times the screening concentration). Assay plates were stored at -80°C and thawed 30 minutes prior to cell plating. Active compounds from the primary screening were re-screened in a secondary screening using 11 point concentrations (range: 0.04 μM, 0.08 μM, 0.16 μM, 0.31 μM, 0.63 μM, 1.25 μM, 2.5 μM, 5 μM, 10 μM, 20 μM, 40 μM) in two biological replicates.

[0159] Fibroblast culture. Fibroblast cell lines were established from routine skin punch biopsy material from both patients and their respective sex-matched heterozygous parents. Primary human dermal fibroblasts were cultured and maintained. Briefly, cells were maintained in DMEM high glucose (Gibco, #11960044) supplemented with 20% FBS (Gibco, #10082147), penicillin 100 U / ml, and streptomycin 100 μg / ml (Gibco, #15140122). Cells were maintained in culture for up to 8 passages and routinely tested for the presence of mycoplasma contamination. For high-throughput imaging, 2 × 10⁶ cells were dispensed into 384-well plates (Greiner Bio-One, #781090) using a Multidrop Combi Reagent Dispenser (Thermo Fisher Scientific, #11388-558). 3Fibroblasts were seeded at a density of / well. The culture medium was changed every 2-3 days, and drugs were administered 24 hours before fixation.

[0160] SH-SY5Y cell culture. AP4B1 wild type (AP4B1 WT and AP4B1 knockout (AP4B1 KO SH-SY5Y cells were pre-generated. Undifferentiated SH-SY5Y cells were maintained at 37°C under 5% CO2 in DMEM / F12 (Gibco, catalog no. 11320033) supplemented with 10% thermoinactivated fetal bovine serum (Gibco, catalog no. 10438026), 100 U / ml penicillin, and 100 μg / ml streptomycin. SH-SY5Y cells were passaged every 2-3 days and differentiated into neuronal-like states using a 5-day differentiation protocol with all-trans retinoic acid (MedChemExpress, #HY-14649). To evaluate ATG9A translocation, differentiated SH-SY5Y cells were plated at a density of 10,000 cells / well in 96-well plates (Greiner Bio-One, catalog no. 655090). The culture medium was changed every 2-3 days, and drugs were administered 24-72 hours before fixation.

[0161] Generation of iPSC strains and neuronal differentiation. Fibroblasts were reprogrammed into iPSCs using non-integrated Sendai virus. Quality control experiments, including karyotype analysis, embryoid body formation, pluripotency marker expression, STR profiling, and Sanger sequencing for AP-4 mutation confirmation, have been previously reported. Cortical neurons were differentiated according to the protocol published by Zhang et al. (Zhang Y, et al. Neuron 78, 785-798 (2013)). For evaluation of ATG9A translocation, neurons were plated in 96-well plates at a density of 40,000 cells / well. Medium changes were performed every 2-3 days, and drugs were administered 24-72 hours before fixation.

[0162] Immunocytochemistry. The immunocytochemistry protocol was optimized for high-throughput staining by using automated pipettes and reagent dispensers (Thermo Fisher Scientific MULTIDROP® Combi Reagent Dispenser, Integra VIAFLO 96 / 384 liquid handler, Integra VOYAGER pipette). Fibroblasts and SH-SY5Y cells were fixed using 3% and 4% PFA, respectively, permeabilized with 0.1% saponin in PBS, and blocked in 1% BSA / 0.01% saponin (blocking solution) in PBS. iPSC-derived neurons were fixed in 4% PFA and permeabilized and blocked using 0.1% TRITON® X-100 / 2% BSA / 0.05% NGS in PBS. Primary antibodies (diluted with blocking solution) were added over 1 hour at room temperature (fibroblasts and SH-SY5Y cells) or overnight at 4°C (iPSC neurons). The plates were gently washed three times with blocking solution (fibroblasts and SH-SY5Y cells) or PBS (iPSC neurons), followed by the addition of a fluorescent dye-conjugated secondary antibody, Hoechst 33258, and phalloidin at room temperature for 30 minutes (fibroblasts), or Hoechst 33258 at room temperature for 60 minutes (SH-SY5Y cells and iPSC neurons). The plates were then gently washed three times with PBS and covered from light.

[0163] High-content imaging and automated image analysis. High-throughput confocal imaging was performed using the ImageXpress Micro Confocal Screening System (Molecular Devices) via an experimental pipeline. For experiments with fibroblasts, images were acquired using a 20×S Plan Fluor objective lens (NA 0.45 μM, WD 8.2–6.9 mm). Four fields of view were acquired per well in a 2×2 format (384-well plate). For experiments with SH-SY5Y cells and iPSC neurons, up to 36 fields of view were acquired in a 6×6 format (96-well plate) using a 40×S Plan Fluor objective lens (NA 0.60 μm, WB 3.6–2.8 mm). Image analysis was performed using a customized image analysis pipeline in MetaXpress (Molecular Devices): In short, cells were identified based on the presence of DAPI signaling within the cell body of phalloidin (fibroblasts) or TUBB3 (SH-SY5Y cells and iPSC neurons) positive cell bodies. (1) A continuous mask was generated for TGN by outlining the region covered by the TGN marker TGN46 (TGN46-positive region in fibroblasts and SH-SY5Y cells) or Golgi 97 (Golgi 97-positive region in iPSC neurons), and (2) a continuous mask was generated for the cellular region outside TGN (actin-positive region - TGN46-positive region). ATG9A fluorescence intensity was measured in both compartments within each cell, and the ATG9A ratio was calculated by dividing the ATG9A fluorescence intensity of TGN by the ATG9A fluorescence intensity of the rest of the cell body (Figure 1B). For each plate, the Z' factor robust value and the strictly standardized median difference (SSMD) were calculated, and only plates that met the predetermined quality metrics of Z' factor robustness ≥ 0.3 and SSMD ≥ 3 were included in subsequent analysis.

[0164] Western blotting was performed. Briefly, cells were lysed in RIPA Lysis Buffer (Thermo Fisher Scientific catalog number 89900) supplemented with COMPLETE® protease inhibitor (catalog number 04693124001) and PHOSSTOP® phosphatase inhibitor (Roche catalog number 4906845001). Total protein concentration was determined using the Pierce BCA Protein Assay Kit (Thermo Fisher Scientific, #23225). Equal amounts of protein were solubilized under reducing conditions in LDS sample buffer (Thermo Fisher Scientific, catalog no. NP0008), separated by gel electrophoresis using 4–12% (Thermo Fisher Scientific, catalog no. NW04125BOX) or 12% Bis-Tris gel (Thermo Fisher Scientific, catalog no. NP0343BOX) and MOPS or MES buffer (Thermo Fisher Scientific, #NP0001 and #NP0002), and transferred to PVDF or nitrocellulose membranes (EMD Millipore, #SLHVR33RS). After blocking with blocking buffer (LI-COR Biosciences, #927-70001), the membranes were incubated overnight with their respective primary antibodies. Near-infrared fluorescently labeled secondary antibodies (IR800CW, IR680LT; LI-COR Biosciences) were used, and quantification was performed using the Odyssey infrared imaging system and Image Studio Software (LI-COR Biosciences).

[0165] Sample preparation for RNA extraction. SH-SY5Y cells were differentiated using retinoic acid as described above, and then treated with the target compound for 72 hours before lysis using Quiagen RTL-Buffer supplemented with 1% β-mercaptoethanol. RNA extraction, library preparation, and sequencing were performed at Azenta Life Sciences (South Plainfield, NJ, USA). Total RNA was extracted from frozen cell pellet samples using the Qiagen RNEASY® mini-kit according to the manufacturer's instructions (Qiagen, Hilden, Germany).

[0166] Library preparation was performed by poly(A) selection and Illumina sequencing. RNA samples were quantified using a Qubit 4 Fluorometer (Life Technologies, Carlsbad, CA, USA), and RNA integrity was checked using an Agilent TapeStation 4200 (Agilent Technologies, Palo Alto, CA, USA). RNA sequencing libraries were prepared using the NEBNext Ultra II RNA Library Prep Kit for Illumina, following the manufacturer's instructions (NEB, Ipswich, MA, USA). Briefly, mRNA was first enriched using Oligod(T) beads. The enriched mRNA was fragmented at 94°C for 15 minutes. Subsequently, first and second strand cDNAs were synthesized. The cDNA fragments were repaired at the ends, adenylated at the 3' end, ligated with a universal adapter, followed by indexing and library enrichment by PCR in a limited number of cycles. The sequencing library was validated using an Agilent TapeStation (Agilent Technologies, Palo Alto, CA, USA) and quantified using a Qubit 4 Fluorometer (Invitrogen, Carlsbad, CA) and quantitative PCR (KAPA Biosystems, Wilmington, MA, USA). The sequencing library was clustered in three lanes of a flow cell. After clustering, the flow cell was loaded into an Illumina instrument (HiSeq 4000 or equivalent) according to the manufacturer's instructions. Samples were sequenced using a 2 × 150 bp Paired End (PE) configuration. Image analysis and base calling were performed using Control software. The generated raw sequence data (.bcl file) was converted from the sequencing instrument to a fastq file and demultiplexed using Illumina's bcl2fastq 2.17 software. One mismatch was tolerated for index sequence identification.

[0167] Downstream RNA sequencing analysis. Sequence reads were mapped to the GRCh38 reference genome available at ENSEMBL using STAR aligner v.2.7.9a. Differential expression analysis was performed using the TREAT approach developed by McCarthy and Smyth (McCarthy DJ, Smyth GK. Bioinformatics 25, 765-771 (2009)) and implemented in the edgeR package in R. Raw counts were obtained using STAR, and low-expression genes were excluded using the method described by Chen et al. (Chen Y, Lun AT, Smyth GK. F1000Res 5, 1438 (2016)). Expression data were normalized using the trimmed-mean method of M values ​​implemented in the edgeR package. Genes were assumed to be differentially expressed according to the default option with a false-find rate (Benjamini-Hochberg procedure) <0.05 and log2 factor change >0.3. Gene ontology (GO) enrichment analysis was performed using clusterProfiler. The pathway was thought to be differentially expressed at FDR < 0.05.

[0168] Network connectivity analysis. Weighted gene coexpression network analysis (WGCNA) was performed to identify transcriptional changes in the coexpression groups of genes after compound treatment. Raw counts were generated, and low-expression genes were removed as described above. Data were normalized using variance-stabilizing transformations as described by Anders et al. (Anders S, Huber W. Genome Biol 11, R106 (2010)). Batch effects were removed using the limma package in R. The preprocessed data were then analyzed using the WGCNA package in R. Briefly, pairwise Pearson correlations were calculated across all genes, and positively correlated genes were selected to form a "directional" correlation matrix. Correlations were then raised to approximate a scale-free network. Appropriate forces were selected based on soft thresholding for large-scale independence greater than 0.8, while maintaining average connectivity of 200-500. Next, genes were grouped based on topological overlap, and clusters were isolated using hierarchical clustering and adaptive branching pruning of hierarchical cluster dendrograms, resulting in co-expressed gene sets, so-called modules. Gene expression profiles within each module were summarized using “module-specific genes” (MEs), defined as the first principal component of each module. Within each module, the association between MEs and measured clinical traits was examined by correlation analysis. For these selected modules, connectivity based on module-specific genes was determined for all genes by calculating the absolute value of the Pearson correlation between gene expression and each ME, creating a quantitative measure of module membership (MM). Similarly, correlations between individual genes and traits of interest were calculated to define gene significance (GS). Using GS and MM, intra-module analysis was performed, enabling the identification of genes with high significance to treatment and high connectivity to their modules. The biological information contained in the modules of interest was summarized using gene ontology (GO) enrichment analysis with clusterProfiler. Pathways were considered to be expressed differentially at FDR < 0.05.

[0169] Sample preparation for mass spectrometry. Cells were lysed for total proteome analysis in RIPA Lysis Buffer (Thermo Fisher Scientific, catalog number 89900) supplemented with COMPLETE® protease inhibitor (catalog no. 04693124001) and PHOSSTOP® phosphatase inhibitor (Roche catalog no. 4906845001), and sonicated using a BIORUPTOR® Pico Sonication System (one 30-second on / off cycle at 4°C). Protein concentrations were determined using the Pierce BCA Protein Assay Kit (Thermo Fisher Scientific catalog no. 23225). The lysates were stored at -80°C until further processing. To generate peptide samples for analysis by mass spectrometry, 30–50 μg of protein was precipitated by incubation overnight in 5 volumes of ice-cold acetone at -20°C and pelletized by centrifugation at 10,000 × g for 5 minutes at 4°C. All subsequent steps were performed at room temperature. The precipitated protein pellet was air-dried, denatured, and resuspended for reduction in digestion buffer (50 mM Tris pH 8.3, 8 M urea, 1 mM dithiothreitol (DTT)) and incubated for 15 minutes. The protein was alkylated by adding 5 mM iodoacetamide in the dark for 20 minutes. After reduction and alkylation, the protein was enzymatically digested by adding LysC (1 μg per 50 μg of protein; Wako, catalog no. 129-02541) for overnight incubation. The sample was then diluted fourfold with 50 mM Tris pH 8.3, and trypsin (1 μg per 50 μg of protein; Sigma-Aldrich, catalog no. T6567) was added for 3 hours. The digestion reaction was stopped by the addition of 1% (v / v) trifluoroacetic acid (TFA), and the sample was incubated on ice for 5 minutes to precipitate contaminants. This was then pelletized by centrifugation at 10,000 × g for 5 minutes.Poly(styrenedivinylbenzene) reversed-phase sulfonate (SDB-RPS; Sigma-Aldrich, catalog number 66886-U) StageTip. 76 Prior to purification by solid-phase extraction using [tool name missing], the acidified peptide was transferred to a new tube. A StageTip with three SDB-RPS plugs was washed with 100% acetonitrile, equilibrated with StageTip equilibration buffer (30% [v / v] methanol, 1% [v / v] TFA), and washed with 0.2% (v / v) TFA. Subsequently, 20 μg of peptide in 1% TFA was loaded into an activated StageTip and washed with 100% isopropanol, and then with 0.2% (v / v) TFA. By applying a process gradient increasing the acetonitrile concentration, the peptide was eluted into three consecutive fractions: 20 μL of SDB-RPS-1 (100 mM ammonium formate, 40% [v / v] acetonitrile, 0.5% [v / v] formic acid), followed by 20 μL of SDB-RPS-2 (150 mM ammonium formate, 60% [v / v] acetonitrile, 0.5% [v / v] formic acid), followed by 30 μL of SDB-RPS-3 (5% [v / v] NH4OH, 80% [v / v] acetonitrile). The eluted peptide was dried in a centrifugal vacuum concentrator, resuspended in buffer A* (0.1% (v / v) TFA, 2% (v / v) acetonitrile), and stored at -20°C until analysis by mass spectrometry.

[0170] Mass spectrometry. Mass spectrometry was performed using an Exploris 480 mass spectrometer connected online to an EASY-nLC 1200 via a nanoelectrospray ion source (both Thermo Fisher Scientific). For each sample, 250 ng of peptide was loaded onto a 50 cm × 75 μm inner diameter column packed with ReproSil-Pur C18-AQ 1.9 μm silica beads (Dr Maisch GmbH). The column was operated at 50°C using a proprietary oven. A two-component buffer system consisting of buffer A (0.1% [v / v] formic acid) and buffer B (80% acetonitrile, 0.1% [v / v] formic acid) was used, and the peptide was separated at a constant flow rate of 300 nL / min using a linear 110-minute gradient. The gradient progressed from 5% to 30%B in 84 minutes, then increased to 60%B in 8 minutes, further increasing to 95%B in 4 minutes, remaining constant at 95%B for 4 minutes, then washing out to 5%B in 5 minutes, and re-equilibriumating at 5%B for 5 minutes. The Exploris 480 was controlled by Xcalibur software (v.4.4, Thermo Fisher Scientific), and data were acquired using the data-dependent top-15 method over the entire scan range from 300 to 1650th Th. The MS1 survey scan was 3 × 10⁻¹⁶ 6 Images were acquired at a resolution of 60,000 using an automated gain control (AGC) target and a maximum ion implantation time of 25 milliseconds. Selected precursor ions were isolated within a 1.4Th window and fragmented by high-energy collision dissociation (HCD) with 30 normalized collision energies. MS2 fragment scans were 1 × 10⁻⁶. 5 The simulation was performed at a resolution of 15,000 using an AGC target for charge, a maximum injection time of 28 milliseconds, and 30 seconds of precursor dynamic exclusion.

[0171] Raw mass spectrometry data analysis. Raw mass spectrometry files were processed in MaxQuant Version 2.1.4.0 using the human SwissProt canonical and isoform protein database retrieved from UniProt (2022_09_26; uniprot.org). Unlabeled quantification was performed using the MaxLFQ algorithm. Matching between runs allowed for matching between equivalent peptide fractions and adjacent peptide fractions within the iteration. The LFQ minimum ratio count was set to 1, and default parameters were used for all other settings. All downstream analyses were performed on the "protein group" file output from MaxQuant.

[0172] Proteomics downstream data analysis. Differential enrichment analysis of proteomics data was performed using the DEP package in R. Pretreatment and quality filtering were performed separately for SH-SY5Y cells and iPSC-derived neurons. Proteins identified only by modification site or matching the reverse portion of the decoy database, and commonly occurring contaminants were removed. Duplicate proteins were removed based on the corresponding gene name by retaining the highest total MS / MS count across all samples. For each cell type (SH-SY5Y cells (Figures 7A and 14A-14D) and iPSC-derived neurons (Figures 7B and 14E-14H)), as well as for the pooled dataset (Figures 7C and 14I-14L), the following steps were performed separately. Low-quality entries were removed by retaining only proteins with valid MS / MS counts in all replicate samples under at least one experimental condition. Finally, only proteins with a maximum of one missing LFQ value under at least one experimental condition were retained. The filtered data were normalized using variance-stabilizing transformations, and missing values ​​were attributed using a manually defined left-shifted Gaussian distribution with a width of 0.3 and a left shift of 2.2 SD. Johnson et al. (Johnson WE, Li C, Rabinovic A. Biostatistics) Batch effects were corrected using the method described in 8,118-127 (2007). Statistical tests for differential protein enrichment were performed using a linear model for each protein and empirical Bayesian statistics implemented in the limma package in R. Proteins were considered to be differentially enriched with a false discovery rate of <0.05 and a log2 factor change >0.3. Biological information contained in differentially enriched proteins was summarized using Reactome pathway annotation in clusterProfiler. The pathway was considered to be differentially expressed with an FDR <0.05.

[0173] Electroporation. sgRNAs for NLRP5, RAB3C, and RAB12 were purchased from Synthego as a multi-guide knockout kit, diluted to the desired stock concentrations, and kept at -80°C. Electroporation was performed under RNAse-free conditions using a Lonza 4D-Nucleofector according to the manufacturer's protocol. Briefly, SH-SY5Y cells were harvested and resuspended in Nucleofector Solution at a concentration of 400 × 10^3 cells / ml. sgRNAs were incubated with Cas9 protein to form ribonucleoprotein complexes (RNPs) according to the manufacturer's instructions. The cell solution was then incubated with a fixed amount of each RNP and transferred to nucleofection cuvettes. The cuvettes were placed in the 4D-Nucleofector System and electroporation was performed using the G-004 program. After electroporation, pre-warmed medium was added and the cells were plated. Compound treatment was initiated 48 hours after electroporation. The knockout efficiency of sgRNAs was evaluated using the Synthego ICE Analysis online tool. For this purpose, genomic DNA was extracted from nucleofected cells using the **kit** according to the manufacturer's instructions and sequenced using the following primers: NLRP5 forward: CTTGAGAATTTGCTGCAAGATCCT, NLRP5 reverse: CGATTCTTCCCTGTTCCCATGAG, RAB3C forward: CCACTCGCCTCCTGAGTGTCTG, RAB3C reverse: GAACAAGGCAGAAAGTTTCTCCC, RAB12 forward: CGAGTAGGGAGGAGTGAAAAGG, RAB12 reverse: GGCACGAAAACCTCTGCCAGGC.

[0174] Statistical testing. Depending on the distribution of the data tested by visualization using histograms, quantile-quantile plots, and normality tests with the Shapiro-Wilk test, statistical analysis of continuous variables was performed using either the mean and standard deviation (SD) or the median and interquartile range (IQR) with R version 4.2.1 (2022-06-23) and RStudio (version 2022.07.1; RStudio, Inc.). The sample size is indicated (n) for each analysis. T-tests (for normally distributed variables) and Mann-Whitney U tests (for nonparametric distributions) were performed to test for statistical differences.

[0175] Assay performance metrics for primary screening in AP-4-HSP patient-derived fibroblasts. Measurements of ATG9A fluorescence (intra-TGN, extra-TGN, and ATG9A ratio) at the individual cell level (219,448 cells total) in fibroblasts from AP-4-HSP patients with a biallele loss-of-function mutant (LoF / LoF) of AP4B1, along with their sex-matched parental controls (WT / LoF) treated with vehicle (DMSO), serve as negative controls (LoF / LoF) and positive controls (WT / LoF) in each of the 82 assay plates, enabling the calculation of standard metrics for assay performance. Robust control isolation (Figures 1D-1K), and strong Z' robustness, SSMD, and coefficient of variance assist in the selection of ATG9A ratios as primary readouts for primary screening.

[0176] Assay performance metrics for primary screening in AP-4-HSP patient-derived fibroblasts. Assay performance was monitored using established criteria for cell-based assays, with Z' robustness ≥ 0.3, strictly standardized median difference (SSMD) ≥ 3, and inter-assay coefficient of variation ≤ 10%. To avoid bias due to inter-plate variability, the overall assay metric was calculated using positive and negative controls from the same assay plate. The predetermined threshold was met by all assay plates.

[0177] Complete source data for primary screening in AP-4-HSP patient-derived fibroblasts. ATG9A fluorescence metrics (intra-TGN, extra-TGN, and ATG9A ratio) and cell counts were automatically calculated for each experimental well (28,864 compounds and controls) in all 82 assay plates. Compounds were classified as "inactive" (ATG9A ratio greater than -3SD), "active" (ATG9A ratio less than or equal to -3SD), "toxic" (cell count less than or equal to -2SD), "positive control," and "negative control."

[0178] Complete source data for counterscreening in AP-4-HSP patient-derived fibroblasts. ATG9A fluorescence metrics (intra-TGN, extra-TGN, and ATG9A ratio) and cell count were automatically calculated for each experimental well in 34 assay plates (503 compounds across 11 dose ranges, and a control in a biological double). Compounds were classified as "inactive" (ATG9A ratio greater than -3SD), "active" (at least 3SD reduction in ATG9A ratio in both replicates and at least two different concentrations), "toxic" (cell count ≤ -2SD), "positive control," and "negative control."

[0179] Assay performance metrics for counterscreening in AP-4-HSP patient-derived fibroblasts. Assay performance was monitored using established criteria for cell-based assays: Z' robustness ≥ 0.3, strictly standardized median difference (SSMD) ≥ 3, and inter-assay coefficient of variation ≤ 10%. To avoid bias due to inter-plate variability, the overall assay metric was calculated using positive and negative controls from the same assay plate. The predetermined threshold was met by all assay plates.

[0180] AP4B1 WT and AP4B1 KOComplete source data for orthogonal screening in SH-SY5Y cells. To evaluate dose-dependent effects in AP-4-deficient neuronal models, active compounds identified in counter-screening were found in differentiated AP4B1 cells. WT SH-SY5Y cells and differentiated AP4B1 KO In SH-SY5Y cells, rescreening was performed using 8-stop titrations in the range of 50 nM to 30 μM. Active compounds were a priori defined as those that reduced the ATG9A ratio or DAGLB ratio by at least 3 SD compared to negative controls at multiple concentrations. Toxicity was defined as a reduction in cell number of at least 2 SD compared to negative controls.

[0181] compound synthesis Compounds of formula (I) were prepared according to the synthesis scheme and procedures described in detail below. The examples described herein are provided to illustrate the compounds, pharmaceutical compositions, and methods provided herein and should not be construed as limiting their scope. Compounds of this disclosure not expressly described in the following procedures may be prepared by similar methods. Those skilled in the art will understand how to prepare such compounds from the disclosures provided herein and by means known in the field of organic synthesis. For example, those described in R. Larock, Comprehensive Organic Transformations, VCH Publishers (1989); TW. Greene and PG. MWuts, Protective Groups in Organic Synthesis, 2nd ed., John Wiley and Sons (1991); L. Fieser and M. Fieser, Fieser and Fieser's Reagents for Organic Synthesis, John Wiley and Sons (1994); and L. Paquette, ed., Encyclopedia of Reagents for Organic Synthesis, John Wiley and Sons (1995), as well as subsequent editions, are representative and educational. Methods for optimizing reaction conditions and, where necessary, minimizing competition by products are known in the art. Aspects of this disclosure encompass methods for synthesizing the compounds described herein using any of the compounds, reactants, and / or processes described herein. [ka]

[0182] 4,5,6,7-tetrahydro-1H-imidazo[4,5-c]pyridine (18.82 g, 117.90 mmol, 2 equivalents, HCl) and K2CO3 (24.44 g, 176.85 mmol, 3 equivalents) were dissolved in dioxane (150 mL) and H2O (150 mL). 2-chloro-1,3-benzothiazole (10 g, 58.95 mmol, 7.67 mL, 1 equivalent) was added to this solution and the mixture was stirred at 100 °C for 16 hours. LC-MS (EW52308-8-P1A2) showed that 4.7% of reaction product 1 remained, and 94% of the desired mass was detected. To remove the dioxane, the reaction mixture was concentrated under reduced pressure, extracted using EA (100 mL x 3), and concentrated under vacuum to obtain the residue. The residue was purified by reverse-phase HPLC (water (FA)-ACN conditions). Compound 1 (C-01) (11 g, 42.42 mmol, yield 71.96%, purity 98.856%) was obtained as a white solid. LC-MS: MS (ESI) retention time: 0.467 min, (M+1) + =257.1.1H NMR(400 MHz,DMSO-d6)δ=2.77(br t,J=5.64 Hz,2 H)3.93(t,J=5.76 Hz,2 H)4.59(s,2 H)7.02-7.12(m,1 H)7.23-7.32(m,1 H)7.47(d,J=7.84 Hz,1 H)7.56(s,1 H)7.73-7.80(m,1 H)8.15(s,1 H) [ka]

[0183] Compound A (200 mg, 1.00 mmol, 1 equivalent) was dissolved in DMF (1 mL) and K2CO3 (415.33 mg, 3.01 mmol, 3 equivalents) and compound B (148.04 mg, 1.20 mmol, 1.2 equivalents) were added. The mixture was stirred at 40°C for 12 hours. LC-MS showed that the desired mass was detected. The reaction mixture was filtered and concentrated under reduced pressure to obtain a solution. The solution was purified by reverse-phase HPLC (0.1% FA conditions). Compound 9 (100 mg, 349.22 μmol, yield 34.86%, purity 93%) was obtained as a white solid. LC-MS: MS(ESI) retention time: 0.607 min (M+1) + =287.3.1H NMR(400 MHz,METHANOL-d4)δ=8.26(s,1H),7.81(s,1H),7.26(dd,J=0.8,8.0 Hz,1H),7.07(t,J=8.0 Hz,1H),6.90(d,J=8.0 Hz,1H),4.69(s,2H),4.00(t,J=5.6 Hz,2H),3.96(s,3H),2.87(br t,J=5.6 Hz,2H)

[0184] To a solution of compound 9 (50 mg, 174.61 μmol, 1 equivalent) in DCM (4 mL), BBr3 (1 M, 349.22 μL, 2 equivalents) was added at -70°C. The mixture was stirred at 25°C for 24 hours. LC-MS showed that the desired mass was detected. The reaction mixture was quenched with 10 mL of added saturated NaHCO3, then filtered and concentrated under reduced pressure to obtain the residue. The residue was purified by preparative HPLC (column: Phenomenex luna C18 150*25 mm*10 μm; mobile phase: [water (FA)-ACN]; gradient: 8%~28% B over 9 minutes). Compound 10 (2.29 mg, 8.39 μmol, yield 4.81%, purity 99%) was obtained as a white solid. LC-MS: MS(ESI) retention time: 0.472 min (M+1) +=273.1.1H NMR(400 MHz,METHANOL-d4)δ=7.86(br s,1H),7.17(dd,J=1.0,8.0 Hz,1H),6.96(t,J=8.0 Hz,1H),6.77(dd,J=0.8,8.0 Hz,1H),4.72(s,2H),4.01(t,J=5.6 Hz,2H),2.89(br t,J=5.6 Hz,2H).

[0185] Compounds 11-14, 17-19, and 25-29 were prepared in a similar manner.

[0186] [ka] Compound 11: To obtain the desired compound (120 mg, 410.68 μmol, yield 27.33%, purity 98%) as a white solid, the residue was purified by preparative HPLC (0.1% FA conditions). LC-MS: MS(ESI) retention time: 0.398 min (M+1) + =287.1.1H NMR(400 MHz,CHLOROFORM-d)δ=7.63(s,1H),7.47(d,J=8.8 Hz,1H),7.16(d,J=2.2 Hz,1H),6.91(dd,J=2.4,8.8 Hz,1H),4.67(s,2H),4.00(br t,J=5.6 Hz,2H),3.83(s,3H),2.89(br s,2H).

[0187] [ka] Compound 12: To obtain the desired compound (19.44 mg, 71.39 μmol, 40.88% yield, 100% purity) as a white solid, the residue was purified by preparative HPLC (column: Phenomenex luna C18 150*25 mm*10 μm; mobile phase: [water (FA)-ACN]; gradient: 1%~22% B over 10 minutes). LC-MS: MS(ESI) retention time: 0.654 min (M+1) +=273.1.1H NMR(400 MHz,METHANOL-d4)δ=8.22(s,1H),7.85(s,1H),7.33(d,J=8.8 Hz,1H),7.09(d,J=2.4 Hz,1H),6.79(dd,J=2.4,8.8 Hz,1H),4.65(s,2H),3.94(t,J=5.6 Hz,2H),2.87(br t,J=5.6 Hz,2H).

[0188] [ka] Compound 13: To obtain the desired compound (250 mg, 855.59 μmol, 34.16% yield, 99% purity) as a white solid, the residue was purified by preparative HPLC (0.1% FA conditions). LC-MS: MS(ESI) retention time: 0.559 min (M+1) + =287.3.1H NMR(400 MHz,CHLOROFORM-d)δ=7.59(s,1H),7.47(d,J=8.8 Hz,1H),7.17(d,J=2.4 Hz,1H),6.91(dd,J=2.4,8.8 Hz,1H),4.67(s,2H),4.01(t,J=5.6 Hz,2H),3.83(s,3H),2.89(br t,J=5.6 Hz,2H)

[0189] [ka] Compound 14: To obtain the desired compound (2.22 mg, 8.07 μmol, yield 2.31%, purity 99%) as a white solid, the residue was purified by preparative HPLC (column: Phenomenex luna C18 150*25 mm*10 μm; mobile phase: [water (FA)-ACN]; gradient: 1%~22% B over 10 minutes). LC-MS: MS(ESI) retention time: 0.688 min (M+1) +=273.1.1H NMR(400 MHz,METHANOL-d4)δ=8.26(s,1H),7.79(s,1H),7.33(d,J=8.8 Hz,1H),7.08(d,J=2.4 Hz,1H),6.78(dd,J=2.4,8.8 Hz,1H),4.63(s,2H),3.94(t,J=5.6 Hz,2H),2.86(br t,J=5.6 Hz,2H).

[0190] [ka] Compound 17: To obtain the desired compound (68.55 mg, 253.56 μmol, 46.57% yield, 100% purity) as a white solid, the residue was purified by preparative HPLC (column: Phenomenex luna C18 150*25 mm*10 μm; mobile phase: [water (FA)-ACN]; gradient: 12%~36% B over 8 minutes). LC-MS: MS(ESI) retention time: 0.632 min (M+1) + =271.4.1H NMR(400 MHz,CHLOROFORM-d)δ=7.60(s,1H),7.46(d,J=7.2 Hz,1H),7.12(br d,J=7.2 Hz,1H),7.04-6.95(m,1H),4.73(s,2H),4.06(br t,J=5.6 Hz,2H),2.90(br t,J=5.2 Hz,2H),2.58(s,3H).

[0191] [ka] Compound 18: To obtain the desired compound (56.41 mg, 208.65 μmol, yield 38.32%, purity 100%) as a white solid, the residue was purified by preparative HPLC (column: Phenomenex luna C18 150*25 mm*10 μm; mobile phase: [water (FA)-ACN]; gradient: 9%~39% B over 10 minutes). LC-MS: MS(ESI) retention time: 0.637 min (M+1) +=271.1.1H NMR(400 MHz,CHLOROFORM-d)δ=7.63(br d,J=1.6 Hz,1H),7.56-7.46(m,1H),7.44-7.35(m,1H),7.04-6.85(m,1H),4.70(br d,J=7.6 Hz,2H),4.06(br d,J=5.2 Hz,2H),2.98-2.84(m,2H),2.51-2.38(m,3H).

[0192] [ka] Compound 19: To obtain the desired compound (31.45 mg, 110.51 μmol, yield 10.15%, purity 94%) as a yellow solid, the residue was purified by preparative HPLC (0.1% FA conditions). LC-MS: MS(ESI) retention time: 0.628 min (M+1) + =271.4.1H NMR(400 MHz,METHANOL-d4)δ=7.72(s,1H),7.47(s,1H),7.38(d,J=8.4 Hz,1H),7.12(dd,J=1.2,8.4 Hz,1H),4.66(s,2H),3.97(t,J=5.6 Hz,2H),2.86(t,J=5.6 Hz,2H),2.38(s,3H)

[0193] [ka] Compound 25: To obtain the desired compound (600 mg, 1.91 mmol, yield 46.15%, purity 100%) as a white solid, the residue was purified by preparative HPLC (0.1% FA conditions). LC-MS: MS(ESI) retention time: 0.612 min (M+1) + =315.3.1H NMR(400 MHz,CHLOROFORM-d)δ=8.33(br s,1H),8.09-7.97(m,1H),7.69-7.44(m,2H),4.74(br s,2H),4.21-4.04(m,2H),3.92(br s,3H),3.00-2.79(m,2H).

[0194] [ka] Compound 27: To obtain the desired compound (39.20 mg, 120.96 μmol, yield 55.08%, purity 96%) as an off-white solid, the residue was purified by preparative HPLC (0.1% FA conditions). LC-MS: MS(ESI) retention time: 0.641 min (M+1) + =315.3.1H NMR(400 MHz,CHLOROFORM-d)δ=7.79(d,J=7.6 Hz,1H),7.73(d,J=8.0 Hz,1H),7.64(s,1H),7.37(t,J=8.0 Hz,1H),4.79(s,2H),4.07(br t,J=5.6 Hz,2H),3.99(s,3H),2.92(br s,2H)

[0195] [ka] Compound 29: To obtain the desired compound (16.47 mg, 59.09 μmol, 20.05% yield, 97% purity) as a white solid, the residue was purified by preparative HPLC (column: Phenomenex luna C18 150*25 mm*10 μm; mobile phase: [water (FA)-ACN]; gradient: 12%~36% B over 8 minutes). LC-MS: MS(ESI) retention time: 0.454 min (M+1) + =271.1.1H NMR(400 MHz,CHLOROFORM-d)δ=8.63(s,1H),7.67-7.48(m,2H),7.33-7.28(m,1H),7.09(t,J=7.6 Hz,1H),4.70(s,2H),3.96(t,J=5.6 Hz,2H),2.87(br t,J=5.0 Hz,2H),2.51(s,3H).

[0196] [ka] To a solution of compound 25 (100 mg, 318.10 μmol, 1 equivalent) in THF (2 mL), 3,4,6,7,8,9-hexahydro-2H-pyrimido[1,2-a]pyrimidine (221.40 mg, 1.59 mmol, 5 equivalents) and 2-methoxyethaneamine (28.67 mg, 381.73 μmol, 33.18 μL, 1.2 equivalents) were added. The mixture was stirred at 25°C for 12 hours. To obtain the desired compound (24.09 mg, 64.03 μmol, yield 20.13%, purity 95%) as a yellow solid, the residue was purified by preparative HPLC (column: Welch Ultimate XB-SiOH 250*50*10 μm; mobile phase: [hexane-EtOH]; gradient: 15%~55%B over 15 minutes). LCMS:MS(ESI) retention time: 0.547 min (M+1) + =358.3.1H NMR(400 MHz,METHANOL-d4)δ=8.10(d,J=2.0 Hz,1H),7.93(s,1H),7.71(dd,J=2.0,8.4 Hz,1H),7.43(d,J=8.4 Hz,1H),4.68(s,2H),3.96(t,J=5.6 Hz,2H),3.50(s,3H),3.24(td,J=1.6,3.2 Hz,4H),2.84(br t,J=5.6 Hz,2H).

[0197] [ka] To a solution of compound 27 (100 mg, 318.10 μmol, 1 equivalent) in THF (2 mL), 3,4,6,7,8,9-hexahydro-2H-pyrimido[1,2-a]pyrimidine (221.40 mg, 1.59 mmol, 5 equivalents) and 2-methoxyethaneamine (28.67 mg, 381.73 μmol, 33.18 μL, 1.2 equivalents) were added. The mixture was stirred at 25°C for 12 hours. To obtain the desired compound (30 mg, 75.54 μmol, yield 47.49%, purity 96%) as a white solid, the residue was purified by preparative HPLC (column: Welch Ultimate XB-SiOH 250*50*10 μm; mobile phase: [hexane-EtOH]; gradient: 15%~55%B over 15 minutes). LCMS:MS(ESI) retention time: 0.441 min (M+1) + =358.1.1H NMR(400 MHz,METHANOL-d4)δ=8.25(s,1H),7.91(s,1H),7.61(t,J=7.2 Hz,2H),7.37(t,J=8.0 Hz,1H),4.72(s,2H),4.00(t,J=5.6 Hz,2H),3.59(s,4H),3.38(s,3H),2.88(br t,J=5.6 Hz,2H).

[0198] [ka] Compound 1A (7.14 g, 44.54 mmol, 3 equivalents) was added to a solution of Compound A (3 g, 14.85 mmol, 1 equivalent) in DMF (20 mL). The mixture was stirred at 160 °C for 4 hours. LC-MS showed that the desired mass was detected. The reaction mixture was adjusted to pH 5, then diluted with 50 mL of H2O, and extracted with 300 mL (100 mL x 3) of EA. The combined organic layers were washed with 200 mL (100 mL x 2) of brine, dried over Na2SO4, filtered, and concentrated under reduced pressure to obtain the residue. The residue was purified by column chromatography (SiO2, petroleum ether / ethyl acetate = 10 / 1 to 0 / 1). Compound B (1.5 g, 6.84 mmol, yield 46.09%) was obtained as a white solid. LCMS:MS(ESI) retention time: 0.695 min (M+1) + = 198.4.

[0199] To a solution of compound B (1.5 g, 7.60 mmol, 1 equivalent) in DMF (15 mL), K2CO3 (3.15 g, 22.81 mmol, 3 equivalents) and MeI (1.40 g, 9.88 mmol, 615.35 μL, 1.3 equivalents) were added. The mixture was stirred at 30°C for 12 hours, and LC-MS showed that the desired mass was detected. The reaction mixture was diluted with 200 mL of H2O and extracted with 150 mL (50 mL x 3) of EA. The combined organic layers were washed with 300 mL (150 mL x 2) of brine, dried over Na2SO4, filtered, and concentrated under reduced pressure to obtain the residue. The residue was purified by column chromatography (SiO2, petroleum ether / ethyl acetate = 20 / 1~2 / 1). Compound C (1.3 g, 6.15 mmol, yield 80.91%) was obtained as a white solid. LC-MS: MS (ESI) retention time: 0.595 min (M+1) + =212.2.1H NMR(400 MHz,METHANOL-d4)δ=7.44-7.36(m,2H),6.88(dd,J=2.0,7.2 Hz,1H),3.96(s,3H),2.78(s,3H).

[0200] Oxon (11.35 g, 18.46 mmol, 3 equivalents) was added to a solution of compound C (1.3 g, 6.15 mmol, 1 equivalent) in THF (10 mL) and H2O (5 mL). The mixture was stirred at 30°C for 12 hours. LC-MS showed that the desired mass was detected. The reaction mixture was diluted with 50 mL of H2O and extracted with 300 mL (100 mL x 3) of EA. The combined organic layers were washed with 200 mL (100 mL x 2) of brine, dried over Na2SO4, filtered, and concentrated under reduced pressure to obtain the residue, which was used in the next step without purification. Compound D (1.5 g, crude) was obtained as a yellow solid. LC-MS: MS(ESI) retention time: 0.723 min (M+1) + =243.9.1H NMR(400 MHz,CHLOROFORM-d)δ=7.81(d,J=8.4 Hz,1H),7.57(t,J=8.0 Hz,1H),6.99(d,J=8.0 Hz,1H),4.03(s,3H),3.40(s,3H).

[0201] 184.96 mmol (8.97 mL, 100% purity, 30 equivalents) was added under N2 conditions. The mixture was stirred at 100°C for 1 hour, and LC-MS showed that the desired mass was detected. The reaction mixture was filtered and concentrated under reduced pressure to obtain the residue. The residue was used in the next step without purification. Compound E (880 mg, 4.51 mmol, yield 73.11%) was obtained as a yellow solid. LC-MS: MS(ESI) retention time: 0.289 min (M+1)+=296.1. 1H NMR (400 MHz, DMSO-d6) δ=7.20-7.11 (m, 1H), 6.96 (dd, J=0.8, 8.0 Hz, 1H), 6.63 (d, J=7.6 Hz, 1H), 5.02 (br s, 2H), 3.86 (s, 3H).

[0202] To a solution of compound E (780 mg, 4.00 mmol, 1 equivalent) in DCM (5 mL), SOCl2 (7.13 g, 59.93 mmol, 4.35 mL, 15 equivalents) was added. The mixture was stirred at 55 °C for 0.5 hours. LC-MS showed that the desired mass was detected. The reaction mixture was adjusted to pH 8 using saturated NaHCO3, then diluted with 20 mL of H2O, and extracted with 300 mL (100 mL x 2) of EA. The combined organic layers were washed with 100 mL (50 mL x 2) of brine, dried over Na2SO4, filtered, and concentrated under reduced pressure to obtain the residue. The residue was then used in the next step without purification. Compound F (600 mg, 3.01 mmol, yield 75.22%) was obtained as a yellow solid. LCMS:MS(ESI) retention time: 0.633 min (M+1)+=200.1.1H NMR(400 MHz,CHLOROFORM-d)δ=7.58(d,J=8.0 Hz,1H),7.44(t,J=8.0 Hz,1H),6.87(d,J=8.0 Hz,1H),3.99(s,3H)

[0203] Compound F (300 mg, 1.50 mmol, 1 equivalent) was dissolved in DMF (2 mL) and K2CO3 (622.99 mg, 4.51 mmol, 3 equivalents) and compound 6 A (222.06 mg, 1.80 mmol, 1.2 equivalents) were added. The mixture was stirred at 40°C for 12 hours. LC-MS showed that the desired mass was detected. The reaction mixture was filtered and concentrated under reduced pressure to obtain a solution, and the crude product was purified by reverse-phase HPLC (0.1% FA conditions). Compound 15 (120 mg, 419.07 μmol, yield 27.89%, purity 99%) was obtained as a white solid. LC-MS: MS(ESI) retention time: 0.516 min (M+1) + =287.1.1H NMR(400 MHz,METHANOL-d4)δ=7.73(s,1H),7.32-7.20(m,1H),7.14(dd,J=0.8,8.0 Hz,1H),6.71(d,J=7.6 Hz,1H),4.68(s,2H),3.99(t,J=5.6 Hz,2H),3.93(s,3H),2.87(t,J=6.0 Hz,2H).

[0204] To a solution of compound 15 (100 mg, 349.22 μmol, 1 equivalent) in DCM (7 mL), BBr3 (1 M, 698.44 μL, 2 equivalents) was added under N2 at -70°C. The mixture was stirred at 0°C for 2 hours. LC-MS showed that the desired mass was detected. The reaction mixture was adjusted to pH 8 using saturated NaHCO3, then filtered and concentrated under reduced pressure to obtain the residue. To provide compound 16 (22.26 mg, 81.74 μmol, yield 23.41%, purity 99%) as a white solid, the residue was purified by preparative HPLC (column: Phenomenex Luna C18 150*25 mm*10 μm; mobile phase: [water (FA)-ACN]; gradient: 1%~30% B over 10 minutes). LC-MS: MS(ESI) retention time: 0.639 min (M+1) + =273.0.1H NMR(400 MHz,METHANOL-d4)δ=7.83(s,1H),7.15-7.10(m,1H),7.06-7.02(m,1H),6.54(dd,J=0.8,8.0 Hz,1H),4.69(s,2H),3.99(t,J=5.6 Hz,2H),2.89(t,J=5.6 Hz,2H).

[0205] [ka] Compound 1A (12.92 g, 80.62 mmol, 3 equivalents) was added to a solution of Compound A (5 g, 26.87 mmol, 1 equivalent) in DMF (30 mL). The mixture was stirred at 160 °C for 4 hours. LC-MS showed that the desired mass was detected. The reaction mixture was quenched with 10 mL of added HCl (1 M), then diluted with 50 mL of H2O, and extracted with 500 mL (250 mL x 2) of EA. The combined organic layers were washed with 100 mL (50 mL x 2) of brine, dried over Na2SO4, filtered, and concentrated under reduced pressure to obtain the residue. The residue was purified by column chromatography (SiO2, petroleum ether / ethyl acetate = 20 / 1~3 / 1). Compound B (4.8 g, crude) was obtained as a yellow oily substance. LCMS:MS(ESI) retention time: 0.555 min (M+1)+=182.1.1H NMR(400 MHz,DMSO-d6)δ=13.76(br s,1H),7.35-7.28(m,1H),7.17-7.10(m,2H),2.33(s,3H).

[0206] To a solution of compound B (4.8 g, 26.48 mmol, 1 equivalent) in DMF (25 mL), MeI (7.52 g, 52.96 mmol, 3.30 mL, 2 equivalents) was added. The mixture was stirred at 25°C for 1 hour. Then, K2CO3 (10.98 g, 79.44 mmol, 3 equivalents) was added. The mixture was stirred at 25°C for 11 hours. LC-MS showed that the desired mass was detected. The reaction mixture was diluted with 50 mL of H2O and extracted with 300 mL (150 mL x 2) of EA. The combined organic layers were washed with 300 mL (100 mL x 3) of brine, dried over Na2SO4, filtered, and concentrated under reduced pressure to obtain the residue. The residue was purified by column chromatography (SiO2, petroleum ether / ethyl acetate = 20 / 1~3 / 1). Compound C (5.6 g, crude) was obtained as a yellow oily substance. LC-MS: MS (ESI) retention time: 0.916 min (M+1) ± 196.1.

[0207] Oxon (31.48 g, 51.20 mmol, 2 equivalents) was added to a solution of compound C (5 g, 25.60 mmol, 1 equivalent) in THF (50 mL) and H2O (15 mL). The mixture was stirred at 25°C for 12 hours. LC-MS showed that the desired mass was detected. To remove THF, the reaction mixture was concentrated under reduced pressure, then diluted with 50 mL of H2O, and extracted with 300 mL (150 mL x 2) of EA. The combined organic layers were washed with 200 mL (100 mL x 2) of brine, dried over Na2SO4, filtered, and concentrated under reduced pressure to obtain the residue. The residue was used in the next step without purification, and compound D (4.6 g, 20.24 mmol, yield 79.05%) was obtained as a white solid. This was confirmed by 1H NMR (EW43310-71-P1A). LCMS:MS(ESI) retention time: 0.723 min (M+1)+=228.0.1H NMR(400 MHz,CHLOROFORM-d)δ=8.05(d,J=8.4 Hz,1H),7.57(t,J=8.0 Hz,1H),7.39(d,J=7.6 Hz,1H),3.42(s,3H),2.64(s,3H).

[0208] To a solution of compound D (2.3 g, 10.12 mmol, 1 equivalent) in EtOH (15 mL), hydrazine hydrate (15.20 g, 303.56 mmol, 14.73 mL, 100% purity, 30 equivalents) was added under N2 conditions. The mixture was stirred at 100°C for 1 hour. LC-MS showed that the desired mass was detected. The reaction mixture was filtered and concentrated under reduced pressure to obtain the residue. Compound E (1.6 g, crude) was obtained as a white solid. LCMS:MS(ESI) retention time: 0.298 min (M+1)+=180.1.1H NMR(400 MHz,METHANOL-d4)δ=7.24-7.20(m,1H),7.19-7.13(m,1H),6.87(d,J=7.2 Hz,1H),2.42(s,3H).

[0209] To a solution of compound E (1 g, 5.58 mmol, 1 equivalent) in DCM (6 mL), SOCl2 (9.96 g, 83.69 mmol, 6.08 mL, 15 equivalents) was added. The mixture was stirred at 55 °C for 0.5 hours. LC-MS showed that the desired mass was detected. The reaction mixture was adjusted to pH 8 using saturated NaHCO3, then diluted with 20 mL of H2O, and extracted with 300 mL (100 mL x 2) of EA. The combined organic layers were washed with 100 mL (50 mL x 2) of brine, dried over Na2SO4, filtered, and concentrated under reduced pressure to obtain the residue. The residue was used in the next step without purification, and compound F (800 mg, 4.36 mmol, yield 78.08%) was obtained as a yellow solid. LCMS:MS(ESI) retention time: 0.612 min (M+1)+=184.0.1H NMR(400 MHz,METHANOL-d4)δ=7.72(d,J=8.4 Hz,1H),7.43(t,J=8.0 Hz,1H),7.26(d,J=7.6 Hz,1H),2.50(s,3H).

[0210] Compound F (200 mg, 1.09 mmol, 1 equivalent) was dissolved in DMF (4 mL), to which K2CO3 (451.51 mg, 3.27 mmol, 3 equivalents) and compound 6A (160.94 mg, 1.31 mmol, 1.2 equivalents) were added. The mixture was stirred at 60°C for 12 hours. LC-MS showed that the desired mass was detected. The reaction mixture was filtered and concentrated under reduced pressure to obtain a solution. The residue was purified by preparative HPLC (column: Phenomenex Luna C18 150*25 mm*10 μm; mobile phase: [water (FA)-ACN]; gradient: 12%~32% B over 9 minutes). Compound 20 (87.12 mg, 315.80 μmol, yield 29.00%, purity 98%) was obtained as a white solid. LCMS:MS(ESI) retention time: 0.751 min (M+1)+=271.4.1H NMR(400 MHz,METHANOL-d4)δ=7.79(s,1H),7.35(d,J=8.0 Hz,1H),7.22(t,J=8.0 Hz,1H),6.93(d,J=7.6 Hz,1H),4.71(s,2H),4.01(t,J=5.6 Hz,2H),2.89(t,J=5.6 Hz,2H),2.45(s,3H).

[0211] [ka] Compound 1A (3.66 g, 22.81 mmol, 3 equivalents) was added to a solution of Compound A (2 g, 7.60 mmol, 1 equivalent) in DMF (15 mL). The mixture was stirred at 160 °C for 4 hours, and LC-MS showed that the desired mass was detected. The reaction mixture was adjusted to pH 5 with HCl (1 M), then diluted with 50 mL of H2O, and extracted with 300 mL of EA (100 mL x 3). The combined organic layers were washed with 200 mL of brine (100 mL x 2), dried over Na2SO4, filtered, and concentrated under reduced pressure to obtain the residue. The residue was purified by column chromatography (SiO2, petroleum ether / ethyl acetate = 10 / 1 to 3 / 1). Compound B (600 mg, 2.84 mmol, yield 37.35%) was obtained as a yellow solid. LCMS:MS(ESI) retention time: 0.652 min, (M+1)+=212.3.1H NMR(400 MHz,DMSO-d6)δ=12.73-11.94(m,1H),7.97-7.88(m,2H),7.40(t,J=8.0 Hz,1H).

[0212] To a solution of compound B (300 mg, 1.42 mmol, 1 equivalent) in DMF (0.5 mL) and POCl3 (8.23 g, 53.64 mmol, 5 mL, 37.77 equivalents), PCl5 (887.13 mg, 4.26 mmol, 3 equivalents) was added. The mixture was stirred at 100°C for 3 hours. The reaction mixture was filtered and concentrated under reduced pressure to obtain a solution. The solution was used in the next step without purification, and compound 3 (300 mg, 1.29 mmol, yield 91.03%) was obtained as a black oily substance.

[0213] A solution of compound C (200 mg, 861.75 μmol, 1 equivalent) in MeOH (20 mL) was stirred at 25°C for 0.5 hours. LC-MS showed that the desired mass was detected. The reaction mixture was filtered and concentrated under reduced pressure to obtain the residue. The residue was purified by preparative HPLC (column: Phenomenex Luna C18 150*25 mm*10 μm; mobile phase: [water (FA)-ACN]; gradient: 36%~66% B over 10 minutes). Compound D (60 mg, 255.64 μmol, yield 29.66%, purity 97%) was obtained as a white solid. LC-MS: MS(ESI) retention time: 0.521 min (M+1)+=228.3.

[0214] Compound D (60 mg, 263.54 μmol, 1 equivalent) was dissolved in DMF (1 mL), to which K2CO3 (109.27 mg, 790.63 μmol, 3 equivalents) and compound 4A (48.69 mg, 395.31 μmol, 1.5 equivalents) were added. The mixture was stirred at 40°C for 12 hours. LC-MS showed that the desired mass was detected. The reaction mixture was filtered and concentrated under reduced pressure to obtain a solution. The solution was purified by preparative HPLC (column: Phenomenex Luna C18 150*25 mm*10 μm; mobile phase: [water(FA)-ACN]; gradient: 7%~37%B over 10 minutes). Compound 21 (50 mg, 158.89 μmol, yield 60.29%, purity 99%) was obtained as an off-white solid. LCMS:MS(ESI) retention time: 0.604 min (M+1) + =315.3.1H NMR(400 MHz,METHANOL-d4)δ=7.92-7.80(m,3H),7.13(t,J=8.0 Hz,1H),4.77(s,2H),4.07(t,J=6.0 Hz,2H),3.94(s,3H),2.89(t,J=5.6 Hz,2H).

[0215] Compound 21 (40 mg, 127.24 μmol, 1 equivalent) was dissolved in THF (1 mL) and 3,4,6,7,8,9-hexahydro-2H-pyrimido[1,2-a]pyrimidine (88.56 mg, 636.21 μmol, 5 equivalents) and Compound 5A (14.34 mg, 190.86 μmol, 16.59 μL, 1.5 equivalents) were added. The mixture was stirred at 30°C for 12 hours. LC-MS showed that the desired mass was detected. The reaction mixture was filtered and concentrated under reduced pressure to obtain the residue. The residue was purified by preparative HPLC (column: Phenomenex Luna C18 150*25 mm*10 μm; mobile phase: [water (FA)-ACN]; gradient: 12%~32% B over 10 minutes). Compound 22 (4.57 mg, 12.66 μmol, yield 9.95%, purity 99%) was obtained as a white solid. LC-MS: MS (ESI) retention time: 0.459 min (M+1) + =358.2.1H NMR(400 MHz,METHANOL-d4)δ=10.70-10.54(m,1H),8.16-8.03(m,1H),7.85(dd,J=1.2,7.2 Hz,1H),7.73-7.58(m,1H),7.25-7.15(m,1H),4.74(br s,2H),4.19-4.06(m,2H),3.69(dt,J=4.8,9.2 Hz,4H),3.51-3.44(m,3H),2.97-2.89(m,2H). [ka]

[0216] Compound 1A (7.32 g, 45.68 mmol, 3 equivalents) was added to a solution of Compound A (3 g, 15.23 mmol, 1 equivalent) in DMF (20 mL). The mixture was stirred at 160 °C for 4 hours. LC-MS showed that the desired mass was detected, and the reaction mixture was adjusted to pH 5 with HCl (1 M), then diluted with 50 mL of H2O, and extracted with 300 mL of EA (100 mL x 3). The combined organic layers were washed with 200 mL of brine (100 mL x 2), dried over Na2SO4, filtered, and concentrated under reduced pressure to obtain the residue. The residue was purified by column chromatography (SiO2, petroleum ether / ethyl acetate = 20 / 1~2 / 1). Compound B (3 g, crude) was obtained as a yellow solid. LCMS:MS(ESI) retention time: 0.526 min (M+1)+=193.1.1H NMR (400 MHz,CHLOROFORM-d)δ=8.10(s,1H),7.59-7.48(m,2H).

[0217] To a solution of compound B (3 g, 15.60 mmol, 1 equivalent) in DMF (20 mL), MeI (4.43 g, 31.21 mmol, 1.94 mL, 2 equivalents) and K2CO3 (6.47 g, 46.81 mmol, 3 equivalents) were added. The mixture was stirred at 25°C for 12 hours. LC-MS showed that the desired mass was detected. The reaction mixture was quenched with 50 mL of added NH4Cl, then diluted with 100 mL of H2O, and extracted with 600 mL (200 mL x 3) of EA. The combined organic layers were washed with 200 mL (100 mL x 2) of brine, dried over Na2SO4, filtered, concentrated under reduced pressure to obtain the residue, which was purified by column chromatography (SiO2, petroleum ether / ethyl acetate = 20 / 1~3 / 1). Compound C (1.2 g, 5.82 mmol, yield 37.28%) was obtained as a white solid. LC-MS: MS(ESI) retention time: 0.596 min(M+1)+=207.1.

[0218] Oxon (17.88 g, 29.09 mmol, 5 equivalents) was added to a solution of compound C (1.2 g, 5.82 mmol, 1 equivalent) in THF (15 mL) and H2O (5 mL). The mixture was stirred at 25 °C for 12 hours. LC-MS showed that the desired mass was detected. To obtain the solution, the reaction mixture was filtered, concentrated under reduced pressure to remove THF, then diluted with 50 mL of H2O, and extracted with 300 mL (100 mL x 3) of EA. The combined organic layers were washed with 200 mL (100 mL x 2) of brine, dried over Na2SO4, filtered, and concentrated under reduced pressure to obtain the residue. The residue was used in the next step without purification. Compound D (500 mg, crude) was obtained as a white solid. LCMS:MS(ESI) retention time: 0.592 min (M+1)+=239.3.1H NMR(400 MHz,DMSO-d6)δ=8.95(d,J=0.8 Hz,1H),8.63(d,J=8.4 Hz,1H),8.14(dd,J=1.6,8.4 Hz,1H),3.68(s,3H).

[0219] Compound D (500 mg, 2.10 mmol, 1 equivalent) was dissolved in DMF (8 mL), to which K2CO3 (870.00 mg, 6.29 mmol, 3 equivalents) and compound 4A (691.27 mg, 2.73 mmol, 1.3 equivalents) were added. The mixture was stirred at 25°C for 12 hours. LC-MS showed that the desired mass was detected. The reaction mixture was filtered and concentrated under reduced pressure to obtain a solution, which was purified by preparative HPLC (column: Phenomenex Luna C18 150*25 mm*10 μm; mobile phase: [water (FA)-ACN]; gradient: 32%~62% B over 10 minutes). Compound E (320 mg, 777.46 μmol, yield 37.05%) was obtained as a colorless oil. LCMS:MS(ESI) retention time: 0.751 min (M+1)+=412.3.1H NMR(400 MHz,CHLOROFORM-d)δ=7.80(d,J=1.2 Hz,1H),7.68(d,J=8.0 Hz,1H),7.58(br s,1H),7.33(dd,J=1.6,8.0 Hz,1H),5.23(s,2H),4.66(s,2H),4.14(t,J=5.6 Hz,2H),3.54-3.45(m,2H),2.91(br t,J=5.2 Hz,2H),0.96-0.85(m,2H),-0.02(s,9H).

[0220] Compound E (150 mg, 364.44 μmol, 1 equivalent) was dissolved in HCl / MeOH (5 mL). The mixture was stirred at 60°C for 12 hours. LC-MS (EW43310-133-P1B) indicated the detection of the desired mass, and the reaction mixture was concentrated under reduced pressure to obtain the residue. The crude product was triturated with MeCN for 5 minutes, then filtered and concentrated under reduced pressure to obtain the residue. The residue was used in the next step without purification. Compound 23 (80 mg, 239.21 μmol, yield 65.64%, purity 94%) was obtained as a white solid. LC-MS: MS(ESI) retention time: 0.726 min (M+1) +=315.1.1H NMR(400 MHz,METHANOL-d4)δ=8.88(s,1H),8.18(s,1H),7.90(s,2H),4.98(s,2H),4.14(s,2H),3.94(s,3H),3.07(s,2H).

[0221] To a solution of compound 23 (20 mg, 63.62 μmol, 1 equivalent) in THF (2 mL), 3,4,6,7,8,9-hexahydro-2H-pyrimido[1,2-a]pyrimidine (44.28 mg, 318.10 μmol, 5 equivalents) and 2-methoxyethaneamine (7.17 mg, 95.43 μmol, 8.30 μL, 1.5 equivalents) were added. The mixture was stirred at 50°C for 12 hours. LC-MS showed that the desired mass was detected. The reaction mixture was filtered and concentrated under reduced pressure to obtain the residue. The residue was purified by preparative HPLC (column: Phenomenex Luna C18 150*25 mm*10 μm; mobile phase: [water (FA)-ACN]; gradient: 2%~32% B over 10 minutes). Compound 24 (7.92 mg, 20.83 μmol, yield 32.74%, purity 94%) was obtained as an off-white solid. LC-MS: MS (ESI) retention time: 0.693 min (M+1) + =358.1.1H NMR(400 MHz,METHANOL-d4)δ=7.93(d,J=1.6 Hz,1H),7.77-7.71(m,2H),7.55(dd,J=1.6,8.4 Hz,1H),4.70(s,2H),4.01(t,J=5.6 Hz,2H),3.58(s,4H),3.39(s,3H),2.88(br t,J=5.6 Hz,2H).

[0222] [ka] To a solution of compound A (5 g, 22.39 mmol, 1 equivalent) in THF (40 mL), NIS (7.56 g, 33.59 mmol, 1.5 equivalents) was added under N2 conditions. The mixture was stirred at 25°C for 1 hour. LC-MS showed that the desired mass was detected. To remove THF, the reaction mixture was concentrated under reduced pressure, then quenched with 20 mL of saturated NaHCO3, diluted with 50 mL of H2O, and extracted with 300 mL (100 mL x 3) of EA. The combined organic layers were washed with 200 mL (100 mL x 2) of brine, dried over Na2SO4, filtered, and concentrated under reduced pressure to obtain the residue. The residue was purified by column chromatography (SiO2, petroleum ether / ethyl acetate = 20 / 1~1 / 2). Compound B (3 g, 8.59 mmol, yield 38.37%) was obtained as a yellow solid. 1H NMR(400 MHz,CHLOROFORM-d)δ=4.51(br s,2H),3.71(br s,2H),2.72(br t,J=5.2 Hz,2H),1.48(s,9H).

[0223] To a solution of compound 2 (3 g, 8.59 mmol, 1 equivalent) in THF (60 mL), NaH (378.01 mg, 9.45 mmol, 60% purity, 1.1 equivalents) was added. The mixture was stirred at 25°C for 1.5 hours. Then, 2-(chloromethoxy)ethyl-trimethyl-silane (1.58 g, 9.45 mmol, 1.67 mL, 1.1 equivalents) was added at 0°C, and the mixture was stirred at 25°C for 5 hours. LC-MS showed that the desired mass was detected. The reaction mixture was quenched with 50 mL of added NH4Cl, then diluted with 200 mL of H2O, and extracted with 900 mL (300 mL x 3) of EA. The combined organic layers were washed with 200 mL (100 mL x 2) of brine, dried over Na2SO4, filtered, and concentrated under reduced pressure to obtain the residue. The residue was purified by flash silica gel chromatography (column: Welch Ultimate XB-SiOH 250*70*10um; mobile phase: [hexane-EtOH]; gradient: 1%~15%B over 15 minutes). Compound C (350 mg, 730.04 μmol, yield 8.50%) was obtained as a yellow solid.

[0224] Compound C (250 mg, 521.46 μmol, 1 equivalent) was dissolved in MeOH (30 mL) and TEA (105.53 mg, 1.04 mmol, 145.16 μL, 2 equivalents) and Pd(PPh3)4 (120.51 mg, 104.29 μmol, 0.2 equivalents) were added. The mixture was stirred at 100 °C for 2 hours under CO (50 psi). LC-MS showed that the desired mass was detected. The reaction mixture was filtered and concentrated under reduced pressure to obtain the residue. The residue was purified by preparative HPLC (column: Phenomenex luna C18 150*25 mm*10 μm; mobile phase: [water (FA)-ACN]; gradient: 56%~86% B over 10 minutes). Compound D (150 mg, 364.46 μmol, yield 69.89%) was obtained as a yellow oily substance. 1H NMR(400 MHz,CHLOROFORM-d)δ=5.93-5.64(m,2H),4.64-4.45(m,2H),3.95(s,3H),3.81-3.67(m,2H) ,3.61-3.52(m,2H),2.82-2.69(m,2H),1.51-1.47(m,9H),0.96-0.84(m,2H),-0.02(d,J=4.0 Hz,9H).

[0225] To a solution of compound D (100 mg, 242.97 μmol, 1 equivalent) in DCM (0.6 mL), TFA (307.00 mg, 2.69 mmol, 0.2 mL, 11.08 equivalents) was added. The mixture was stirred at 25°C for 4 hours. LC-MS showed that the desired mass was detected. The reaction mixture was filtered and concentrated under reduced pressure to obtain the residue. The residue was purified by preparative HPLC (column: Phenomenex luna C18 150*25 mm*10 μm; mobile phase: [water(FA)-ACN]; gradient: 0%~6%B over 6 minutes). Compound E (30 mg, 165.57 μmol, yield 68.14%) was obtained as a white solid.

[0226] Compound E (30 mg, 165.57 μmol, 1 equivalent) was dissolved in DMF (0.5 mL) and K2CO3 (68.65 mg, 496.71 μmol, 3 equivalents) and compound F (33.70 mg, 198.68 μmol, 25.87 μL, 1.2 equivalents) were added. The mixture was stirred at 40°C for 12 hours. LC-MS showed that the desired mass was detected. The reaction mixture was filtered and concentrated under reduced pressure to obtain a solution. The solution was purified by preparative HPLC (column: Phenomenex luna C18 150*25 mm*10 μm; mobile phase: [water (FA)-ACN]; gradient: 26%~46% B over 9 minutes). Compound 30 (1.76 mg, 5.43 μmol, yield 4.92%, purity 97%) was obtained as an off-white solid. LCMS:MS(ESI) retention time: 0.718 min, (M+1) +=315.1.1H NMR(400 MHz,METHANOL-d4)δ=7.68(d,J=7.6 Hz,1H),7.51(d,J=8.0 Hz,1H),7.31(t,J=8.0 Hz,1H),7.11(t,J=7.6 Hz,1H),4.72(s,2H),4.03(t,J=5.6 Hz,2H),3.92(s,3H),2.93(t,J=6.0 Hz,2H).

[0227] To a solution of compound 30 (10 mg, 31.81 μmol, 1 equivalent) in THF (4 mL), 3,4,6,7,8,9-hexahydro-2H-pyrimido[1,2-a]pyrimidine (22.14 mg, 159.05 μmol, 5 equivalents) and 2-methoxyethaneamine (2.87 mg, 38.17 μmol, 3.32 μL, 1.2 equivalents) were added. The mixture was stirred at 25°C for 12 hours. The reaction mixture was filtered and concentrated under reduced pressure to obtain the residue. The residue was purified by preparative HPLC (column: Phenomenex luna C18 150*25 mm*10 μm; mobile phase: [water (FA)-ACN]; gradient: 23%~53% B over 10 minutes). Compound 31 (2.81 mg, 7.67 μmol, yield 24.12%, purity 97.6%) was obtained as a white solid. LC-MS: MS(ESI) retention time: 0.776 min, (M+1) + =358.2.1H NMR(400 MHz,METHANOL-d4)δ=7.68(d,J=8.0 Hz,1H),7.51(d,J=8.0 Hz,1H),7.33-7.28(m,1H),7.14-7.07(m,1H),4.77-4.62(m,2H),4.02(br t,J=5.2 Hz,2H),3.56(s,4H),3.39(s,3H),2.92(br s,2H).

[0228] Testing of compounds for treating AP-4 deficiency SH-SY5Y cell culture. AP4B1 wild type (AP4B1 WT )SH-SY5Y cells and AP4B1 knockout (AP4B1 KOSH-SY5Y cells were pre-generated (PMID:38233389, PMID:35217685). Undifferentiated SH-SY5Y cells were maintained at 37°C under 5% CO2 in DMEM / F12 (Gibco, catalog no. 11320033) supplemented with 10% thermoinactivated fetal bovine serum (Gibco, catalog no. 10438026), 100 U / mL penicillin, and 100 g / mL streptomycin. SH-SY5Y cells were passaged every 2-3 days and differentiated into neuronal-like states using a 5-day differentiation protocol with all-trans retinoic acid (MedChemExpress, #HY-14649). To evaluate ATG9A translocation, differentiated SH-SY5Y cells were placed in 96-well plates (Greiner Bio-One, catalog no. 655090) at a rate of 1 × 10⁶ 4 Cells were plated at a cell / well density. The culture medium was changed every 2-3 days, and drugs were administered 24 hours before fixation.

[0229] Immunocytochemistry. The immunocytochemistry workflow was optimized for high throughput using automated pipettes and reagent dispensers (Thermo Fisher Scientific Multidrop Combi Reagent Dispenser, Integra VIAFLO 96 / 384 liquid handler, Integra VOYAGER pipette). SH-SY5Y cells were fixed with 4% PFA, permeabilized with 0.1% saponin in PBS, and blocked with 1% BSA / 0.01% saponin in PBS (blocking solution). Primary antibody (diluted with blocking solution) was added at room temperature over 1 hour. The plates were gently washed three times with blocking solution, followed by the addition of fluorescent dye-conjugated secondary antibody and Hoechst 33258 at room temperature over 30 minutes. The plates were then gently washed three times with PBS and protected from light.

[0230] High-content imaging and automated image analysis. High-throughput confocal imaging was performed using an ImageX-press Micro Confocal Screening System (Molecular Devices) with an experimental pipeline modified from the pipeline described by Behne et al. (PMID:31915823). Up to 36 fields of view were acquired in 6×6 format (96-well plate) using a 40×SPlan Fluor objective lens (NA 0.60 μm, WB 3.6~2.8 mm). Image analysis was performed using a customized image analysis pipeline in MetaXpress (Molecular Devices): In short, cells were identified based on the presence of DAPI signaling inside TUBB3-positive cells. (1) A continuous mask was generated for TGNs by contouring the region covered by the TGN marker TGN46 (TGN46-positive region), and (2) a continuous mask was generated for cellular regions outside TGNs (TUBB3-positive region-TGN46-positive region). ATG9A fluorescence intensity (FU) was measured within both compartments of each cell, and the ATG9A ratio was calculated by dividing the ATG9A fluorescence intensity within the TGN by the ATG9A fluorescence intensity in the rest of the cell body.

number

[0231] For each plate, the Z' factor robust value and the strictly standardized median difference (SSMD) were calculated, and only plates meeting the predetermined quality metrics of Z' factor robustness 0.3 and SSMD 3 were included in the analysis.

[0232] The results in Table 1 demonstrate that the compounds of this disclosure are effective in treating AP-4 deficiency. Figures 17A and 18A show the dose-response curves for compounds 10 and 17.

[0233] [Table 1]

[0234] Equivalents and range Unless otherwise indicated or otherwise obvious from the context, articles such as “a,” “an,” and “the” in a claim may mean one or more. Unless otherwise indicated or otherwise obvious from the context, a claim or statement containing “or” among one or more members of a group is considered satisfied if one member, more than one member, or all members of that group are present in, adopted into, or otherwise related to a given product or process. The present invention encompasses embodiments in which exactly one member of that group is present in, adopted into, or otherwise related to a given product or process. The present invention encompasses embodiments in which more than one or all of the members of that group are present in, adopted into, or otherwise related to a given product or process.

[0235] Furthermore, the present invention encompasses all variations, combinations, and permutations in which one or more limitations, elements, clauses, and descriptive terms from one or more of the enumerated claims are introduced into another claim. For example, any claim dependent on another claim may be modified to encompass one or more limitations found in any other claim dependent on the same basic claim. Where elements are presented, for example, as enumerated in Markush group form, each subgroup of the element is also disclosed, and any element may be removed from the group. In general, where the present disclosure or an aspect thereof is considered to include certain elements and / or features, it should be understood that certain aspects of the present invention or aspects of the present invention consist of, or essentially follow, such elements and / or features. For the sake of brevity, those aspects are not specifically defined in this specification in haec verba. It should also be noted that the terms “comprising” and “containing” are intended to be open and allow for the inclusion of additional elements or processes. When a scope is given, endpoints are also included. Furthermore, unless otherwise indicated or otherwise evident from the context and the understanding of those skilled in the art, values ​​expressed as ranges may be assumed to be any specific value or a subrange of the ranges described in different embodiments of the present invention, up to 10 times the lower limit of the range, unless the context explicitly indicates otherwise.

[0236] This application references various issued patents, published patent applications, journal articles, and other publications, all of which are incorporated herein by reference. In the event of any conflict between any of the incorporated references and this specification, this specification shall prevail. In addition, any particular aspect of the Invention that falls within the scope of prior art may be expressly excluded from any one or more of the claims. Such aspects may be excluded even if the exclusion is not expressly stated herein, as they would be considered known to those skilled in the art. Any particular aspect of the Invention may be excluded from any of the claims for any reason, whether or not it relates to the existence of prior art.

[0237] Those skilled in the art will recognize many equivalents to the specific embodiments described herein, or at best, can verify this using routine experiments. The scope of the embodiments described herein is not intended to be limited to the foregoing, but rather as described in the appended claims. Those skilled in the art will understand that various changes and modifications to this description may be made without departing from the spirit or scope of the invention, as defined in the following claims.

Claims

1. Compound of formula (I): 【Chemistry 1】 or a pharmaceutically acceptable salt thereof (in the formula: R 1 Each occurrence of A is, independently, halogen, substituted or unsubstituted acyl, substituted or unsubstituted alkyl, substituted or unsubstituted alkenyl, substituted or unsubstituted alkynyl, substituted or unsubstituted heteroaliphatic, substituted or unsubstituted carbocyclic, substituted or unsubstituted heterocyclic, substituted or unsubstituted aryl, substituted or unsubstituted heteroaryl, a nitrogen protecting group when attached to a nitrogen atom, -OR A ) 2 , -SR A , -CN, -SCN, -C(=NR A )R A , -C(=NR A )OR A , -C(=NR A )N(R A ) 2 , -C(=O)R A , -C(=O)OR A , -C(=O)N(R A ) 2 , -C(=O)NR A S(O) 2 R A , -NO 2 , -NR A C(=O)R A , -NR A C(=O)OR A , -NR A C(=O)N(R A ) 2 , -NR A C(=NR A )N(R A ) 2 , -OC(=O)R A , -OC(=O)OR A , -OC(=O)N(R A ) 2 , -NR A S(O) 2 R A , -OS(O) 2 R A , -S(O) 2 NR A C(O)R A , -S(O) 2 N(R A ) 2 , -S(O) 2 Ure A , or -S(O) 2 R A is; or two R 1 The groups are joined to form a substituted or unsubstituted carbocyclyl ring, a substituted or unsubstituted aryl ring, a substituted or unsubstituted heterocyclyl ring, or a substituted or unsubstituted heteroaryl ring; t is 0 or a positive integer; and R A Each appearance is independently either hydrogen, a substituted or unsubstituted acyl, a substituted or unsubstituted alkyl, a substituted or unsubstituted alkenyl, a substituted or unsubstituted alkynyl, a substituted or unsubstituted heteroaliphatic, a substituted or unsubstituted carbocyclyl, a substituted or unsubstituted heterocyclyl, a substituted or unsubstituted aryl, a substituted or unsubstituted heteroaryl, a nitrogen protecting group attached to a nitrogen atom, an oxygen protecting group attached to an oxygen atom, or a sulfur protecting group attached to a sulfur atom, or two R A The groups are joined to form a substituted or unsubstituted heterocyclyl ring, or a substituted or unsubstituted heteroaryl ring; If present in the formula, R 1 Each occurrence is bonded to some substitutable atom of the compound.

2. The compound is given by formula (Ia): 【Chemistry 2】 The compound according to claim 1, or a pharmaceutically acceptable salt thereof.

3. The compound is given by formula (Ib): 【Transformation 3】 The compound according to claim 1 or 2, or a pharmaceutically acceptable salt thereof.

4. The compound is given by formula (Ic): 【Chemistry 4】 The compound according to any one of claims 1 to 3, or a pharmaceutically acceptable salt thereof.

5. The compound is given by formula (Id): 【Transformation 5】 The compound according to any one of claims 1 to 4, or a pharmaceutically acceptable salt thereof.

6. R 1 Each occurrence is independently a halogen, substituted or unsubstituted acyl, substituted or unsubstituted alkyl, substituted or unsubstituted alkenyl, substituted or unsubstituted alkynyl, substituted or unsubstituted heteroaliphatic, -OR A , -N(R A ) 2 , -SR A -CN, -SCN, -C(=O)R A , -C(=O)OR A , -C(=O)N(R A ) 2 -C(=O)NR A S(O) 2 R A , -S(O) 2 NR A C(O)R A , -S(O) 2 N(R A ) 2 , -S(O) 2 Ure A , or -S(O) 2 R A That is, A compound according to any one of claims 1 to 5, or a pharmaceutically acceptable salt thereof.

7. R 1 Each occurrence independently represents a substituted or unsubstituted acyl, substituted or unsubstituted alkyl, substituted or unsubstituted heteroalkyl, or -OR A , -C(=O)OR A , or -C(=O)N(R A ) 2 That is, A compound according to any one of claims 1 to 6, or a pharmaceutically acceptable salt thereof.

8. R 1 Each occurrence independently indicates a substituted or unsubstituted alkyl, -OR A , -C(=O)OR A , or -C(=O)N(R A ) 2 That is, A compound according to any one of claims 1 to 7, or a pharmaceutically acceptable salt thereof.

9. R 1 Each occurrence of which is, independently, substituted or unsubstituted alkyl, -OR A , -C(=O)OR A , or -C(=O)N(R A ) 2 where; each occurrence of R A is, independently, hydrogen, substituted or unsubstituted alkyl, or substituted or unsubstituted heteroalkyl. A compound according to any one of claims 1 to 8, or a pharmaceutically acceptable salt thereof.

10. R 1 each occurrence of which is, independently, unsubstituted alkyl, -OR A , -C(=O)OR A , or -C(=O)N(R A ) 2 ; wherein each occurrence of R A is, independently, hydrogen, substituted or unsubstituted alkyl, or substituted or unsubstituted heteroalkyl, A compound according to any one of claims 1 to 9, or a pharmaceutically acceptable salt thereof.

11. R 1 Each occurrence of is independent of the non-substitution C 1-4 alkyl, -OH, -OC 1-4 Alkyl, -C(=O)OC 1-4 Alkyl, or -C(=O)NH-(C 1-4 Alkylene)-OC 1-4 It is alkyl. A compound according to any one of claims 1 to 10, or a pharmaceutically acceptable salt thereof.

12. R 1 Each occurrence of -CH is independent. 3 -OH, -OCH 3 -C(=O)OCH 3 , or -C(=O)NH(CH 2 CH 2 )OCH 3 That is, A compound according to any one of claims 1 to 11, or a pharmaceutically acceptable salt thereof.

13. t is 0 or 1. A compound according to any one of claims 1 to 12, or a pharmaceutically acceptable salt thereof.

14. t is 0, A compound according to any one of claims 1 to 13, or a pharmaceutically acceptable salt thereof.

15. t is 1, A compound according to any one of claims 1 to 13, or a pharmaceutically acceptable salt thereof.

16. The compound is the compound according to claim 1, or a pharmaceutically acceptable salt thereof, which is not of the following formula: 【Transformation 6】 ;or 【Transformation 7】 。

17. The compound is given by the following formula: 【Chemistry 8-1】 【Chemistry 8-2】 【Chemistry 8-3】 or 【Chemistry 9】 The compound according to claim 1, or a pharmaceutically acceptable salt.

18. The compound is given by the following formula: 【Chemistry 10】 The compound according to claim 1, or a pharmaceutically acceptable salt.

19. The compound is given by the following formula: 【Chemistry 11】 The compound according to claim 1, or a pharmaceutically acceptable salt.

20. The compound is given by the following formula: 【Chemistry 12】 The compound according to claim 1, or a pharmaceutically acceptable salt.

21. A pharmaceutical composition comprising a compound according to any one of claims 1 to 20, or a pharmaceutically acceptable salt thereof, and a pharmaceutically acceptable excipient.

22. A kit comprising a compound according to any one of claims 1 to 20, or a pharmaceutically acceptable salt thereof, or a pharmaceutical composition according to claim 21, and instructions for administering the compound or pharmaceutical composition to a subject requiring such administration.

23. A method for treating a neurological disease or neurological disorder, comprising administering an effective amount of a compound according to any one of claims 1 to 20, or a pharmaceutically acceptable salt thereof, or a pharmaceutical composition according to claim 21, to a subject in need thereof.

24. The method according to claim 23, wherein the neurological disorder or neurological condition is hereditary spastic paraplegia (HSP).

25. The method according to claim 23 or 24, wherein the neurological disorder or neurological condition is adapter protein complex 4 (AP-4)-associated hereditary spastic paraplegia (AP-4-HSP).

26. A method for regulating autophagy-related 9A (ATG9A) transport in or out of cells, comprising contacting a cell with an effective amount of a compound according to any one of claims 1 to 20, or a pharmaceutically acceptable salt thereof, or a pharmaceutical composition according to claim 21.

27. The method according to claim 26, wherein contact results in an increase in the transport of ATG9A from the trans-Golgi network (TGN).

28. The method according to claim 26 or 27, wherein contact causes a reduction in ATG9A within the trans-Golgi network (TGN).

29. The method according to any one of claims 26 to 28, wherein contact causes a decrease in the ratio of the concentration of ATG9A in the trans-Golgi network (TGN) to the concentration of ATG9A in the cytoplasm.

30. A method for regulating intracellular vesicular transport and increasing intracellular autophagy flux, comprising contacting a cell with an effective amount of a compound according to any one of claims 1 to 20, or a pharmaceutically acceptable salt thereof, or a pharmaceutical composition according to claim 21.

31. The method according to any one of claims 26 to 30, wherein the contact is performed in vitro.

32. The method according to any one of claims 26 to 30, wherein the contact is in vivo.

33. The method according to any one of claims 26 to 32, wherein the cells are mammalian cells.

34. The method according to any one of claims 26 to 33, wherein the cells are human cells.