Treatment methods for muscular dystrophy targeting the LAMA1 gene

Abstract

The present invention aims to provide a novel therapeutic method for human muscular dystrophy (particularly MDC1A). The present invention provides a polynucleotide comprising the following base sequence: (a) The base sequence encoding a fusion protein of a nuclease-deficient CRISPR effector protein and a transcription activator, and (b) A nucleotide sequence encoding a guide RNA that targets the continuous region represented by Sequence ID No. 8 in the expression regulatory region of the human LAMA1 gene.

Description

[Technical Field]

[0001] The present invention relates to a method for treating muscular dystrophy targeting the laminin-α1 chain (LAMA1) gene, particularly merosin-deficient congenital muscular dystrophy (MDC1A) (also known as the treatment or prevention of LAMA2-congenital muscular dystrophy). More specifically, the present invention relates to a method for treating or preventing muscular dystrophy by upregulating the expression of the human LAMA1 gene, which is not normally expressed much in muscle tissue, using a guide RNA that targets a specific sequence of the human LAMA1 gene, and a fusion protein of a transcription activator and a CRISPR effector protein, thereby compensating for LAMA2 or its function that is deleted due to mutation, as well as a therapeutic or prophylactic agent for muscular dystrophy. [Background technology]

[0002] Muscular dystrophy is a general term for genetic disorders characterized by progressive muscle atrophy and weakness. Currently, there is no effective cure for muscular dystrophy, and only symptomatic treatment is available. One type of muscular dystrophy is merosine-deficient congenital muscular dystrophy (MDC1A), an autosomal recessive disorder.

[0003] MDC1A is a Western-type congenital muscular dystrophy without intellectual disability, caused by a deficiency of merosin, a component of the skeletal muscle basement membrane. Merosin is a heterotrimer composed of laminin chains, bound to α-dystroglycan via a glycosylation structure. Its deficiency disrupts the link between the cytoskeleton and the extracellular matrix via the dystrophin glycoprotein complex. It is the most common congenital muscular dystrophy in Europe and North America (approximately 50%). It is caused by a mutation in the laminin α2 chain gene (LAMA2 gene) located at 6q22.33.

[0004] Cohn et al. found that the dy 2J / dy 2JWe report a method for correcting splice site mutations in the LAMA2 gene in a mouse model through systemic delivery of adeno-associated virus (AAV) containing CRISPR / Cas9 genome editing components. 2J / dy 2J The mice showed substantial improvement in muscle histopathology and function, and no signs of paralysis were observed (Non-Patent Literature 1). Furthermore, Bassi demonstrated that the LAMA1 gene may be a disease-modifying gene for MDC1A. The LAMA1 gene encodes a laminin α1 chain protein that is structurally similar to the laminin α2 chain. Specifically, experiments using mice have shown the possibility of upregulating LAMA1 expression using the S. aureus CRISPR / Cas9 system to compensate for the deficiency of the laminin α2 chain (Non-Patent Literature 2, Non-Patent Literature 3). Furthermore, Arockiaraj AI et al. have reported that LAMA1 upregulation by CRISPRa could be a mutation-independent and feasible therapeutic option for MDC1A. Previous studies on gene expression activation using the CRISPRa system have shown that a combination of 3-4 sgRNAs is generally more effective than a single sgRNA; therefore, in this strategy, a combination of multiple sgRNAs was administered (Non-Patent Literature 4). [Prior art documents] [Non-patent literature]

[0005] [Non-Patent Document 1] Kemaladewi, D. U., Maino, E., Hyatt, E., Hou, H., Ding, M., Place, K. M., Zhu, X., Bassi, P., Baghestani, Z., Deshwar, A. G., Merico, D., Xiong, H. Y., Frey, B. J., Wilson, M. D., Ivakine, E. A., Cohn, R. D. Nat Medicine. 23:8. 2017: Correction of a splicing defect in a mouse model of congenital muscular dystrophy type 1A using a homology-directed-repair-independent mechanism [Non-Patent Document 2] Prabhpreet Singh Bassi, A thesis submitted in conformity with the requirements for the degree of Master of Science, Department of Molecular Genetics, University of Toronto. 2017: Assessing the Therapeutic Potential of CRISPR / Cas9-Mediated Gene Modulation in Merosin-Deficient Congenital Muscular Dystrophy Type 1A [Non-Patent Document 3] Dwi U. Kemaladewi, Prabhpreet S. Bassi, Steven erwood, Dhekra Al-Basha, Kinga I. Gawlik, Kyle Lindsay, elzbieta Hyatt, rebekah Kember, Kara M. Place, ryan M. Marks, Madeleine Durbeej, Steven A. Prescott, evgueni A. Ivakine & ronald D. Cohn, Nature 572, p125, 2019: A mutation-independent approach for muscular dystrophy via upregulation of a modifier gene [Non-Patent Document 4] Annie I Arockiaraj, Marie A Johnson, Anushe Munir, Prasanna Ekambaram, Peter C Lucas, Linda M McAllister-Lucas, Dwi U Kemaladewi. bioRxiv [Preprint]. 2023: CRISPRa-induced upregulation of human LAMA1 compensates for LAMA2-deficiency in Merosin-deficient congenital muscular dystrophy [Overview of the Initiative]

[0006] technical challenges The object of the present invention is to provide a novel therapeutic method for human muscular dystrophy (particularly MDC1A).

[0007] As a result of diligent research into the above-mentioned problems, the inventors have discovered that the expression of the human LAMA1 gene (Gene ID: 284217) can be upregulated in muscle cells by using a guide RNA that targets a specific sequence of the human LAMA1 gene, and a fusion protein of a transcription activator and a CRISPR effector protein lacking nuclease activity. Based on these findings, the inventors have completed the present invention.

[0008] The present invention may include the following inventions. [1] Polynucleotides containing the following base sequence: (a) The base sequence encoding a fusion protein of a nuclease-deficient CRISPR effector protein and a transcription activator, and (b) A nucleotide sequence encoding a guide RNA that targets the continuous region represented by Sequence ID No. 8 in the expression regulatory region of the human LAMA1 gene. [2] The base sequence encoding the guide RNA is The base sequence represented by Sequence ID No. 8, or The polynucleotide described in [1] above, comprising (i) a base sequence in which 1 to 6 bases are deleted or added from the 5' end, and / or (ii) a base sequence in which 1 base is substituted within 9 bases from the 5' end. [3] The polynucleotide according to [1] or [2] above, wherein the transcriptional activator is selected from the group consisting of VP64, VP160, VPH, VPR, VP64-miniRTA (miniVR), microVR, and their variants having transcriptional activating ability. [4] The polynucleotide described in [3] above, wherein the transcription activator is miniVR. [5] A polynucleotide as described in any of [1] to [4] above, wherein the nuclease-deficient CRISPR effector protein is dCas9. [6] The polynucleotide described in [5] above, wherein dCas9 is derived from Staphylococcus aureus. [7] The polynucleotide according to any one of [1] to [6] above, further comprising a promoter sequence for a nucleotide sequence encoding a guide RNA and / or a promoter sequence for a nucleotide sequence encoding a fusion protein of a nuclease-deficient CRISPR effector protein and a transcription activator. [8] The polynucleotide described in [7] above, wherein the promoter sequence for the base sequence encoding the guide RNA is selected from the group consisting of the U6 promoter, SNR6 promoter, SNR52 promoter, SCR1 promoter, RPR1 promoter, U3 promoter, and H1 promoter. [9] The polynucleotide described in [8] above, wherein the promoter sequence for the base sequence encoding the guide RNA is the U6 promoter.

[10] The polynucleotide according to any one of [7] to [9] above, wherein the promoter sequence for the base sequence encoding a fusion protein of a nuclease-deficient CRISPR effector protein and a transcription activator is a ubiquitous promoter or a muscle-specific promoter.

[11] The polynucleotide according to

[10] above, wherein the ubiquitous promoter is selected from the group consisting of the EFS promoter, the CMV promoter, and the CAG promoter.

[12] The polynucleotide described in

[11] above, wherein the muscle-specific promoter is selected from the group consisting of the CK8 promoter, myosin heavy chain kinase (MHCK) promoter, muscle creatine kinase (MCK) promoter, synthetic C5-12 (Syn) promoter, and unc45b promoter.

[13] A vector containing any of the polynucleotides described in [1] to

[12] above.

[14] The vector described in

[13] above, wherein the vector is a plasmid vector or a viral vector.

[15] The vector described in

[14] above, wherein the viral vector is selected from the group consisting of adeno-associated virus (AAV) vectors, adenovirus vectors, and lentiviral vectors.

[16] The vector according to

[15] above, wherein the AAV vector is selected from the group consisting of AAV1, AAV2, AAV6, AAV7, AAV8, AAV9 and variants thereof (e.g., MyoAAV).

[17] A therapeutic or prophylactic agent for MDC1A, comprising the polynucleotide according to any one of [1] to

[12] above, or the vector according to any one of

[13] to

[16] above.

[18] A method for treating or preventing MDC1A, comprising administering to a subject in need thereof the polynucleotide according to any one of [1] to

[12] above, or the vector according to any one of

[13] to

[16] above.

[19] Use of the polynucleotide according to any one of [1] to

[12] above, or the vector according to any one of

[13] to

[16] above, for the treatment or prevention of MDC1A.

[20] Use of the polynucleotide according to any one of [1] to

[12] above, or the vector according to any one of

[13] to

[16] above, in the manufacture of a pharmaceutical composition for the treatment or prevention of MDC1A.

[21] A method for upregulating the expression of the human LAMA1 gene in a cell, comprising expressing in the cell (c) a fusion protein of a nuclease-deficient CRISPR effector protein and a transcriptional activator, and (d) a guide RNA targeting a continuous region represented by SEQ ID NO: 8 in the expression control region of human LAMA1. The method comprising the above.

[22] A ribonucleoprotein comprising: (c) a fusion protein of a nuclease-deficient CRISPR effector protein and a transcriptional activator, and (d) a guide RNA targeting (i) a continuous region represented by SEQ ID NO: 8 in the expression control region of the human LAMA1 gene.

[23] A kit for upregulating the expression of the human LAMA1 gene, comprising: (e) A fusion protein of a nuclease-deficient CRISPR effector protein and a transcriptional activator, or a polynucleotide encoding the fusion protein, and (f) A guide RNA targeting (i) a continuous region represented by SEQ ID NO: 8 in the expression control region of the human LAMA1 gene, or a polynucleotide encoding the guide RNA.

[24] A method for treating or preventing MDC1A, comprising the step of administering the following (e) and (f): (e) A fusion protein of a nuclease-deficient CRISPR effector protein and a transcriptional activator, or a polynucleotide encoding the fusion protein, and (f) A guide RNA targeting (i) a continuous region represented by SEQ ID NO: 8 in the expression control region of the human LAMA1 gene, or a polynucleotide encoding the guide RNA.

[25] Use of the following (e) and (f) in the production of a pharmaceutical composition for treating or preventing MDC1A: (e) A fusion protein of a nuclease-deficient CRISPR effector protein and a transcriptional activator, or a polynucleotide encoding the fusion protein, and (f) A guide RNA targeting (i) a continuous region represented by SEQ ID NO: 8 in the expression control region of the human LAMA1 gene, or a polynucleotide encoding the guide RNA. Advantageous effects of the invention

[0009] According to the present invention, the expression of the human LAMA1 gene can be upregulated, and as a result, the present invention is expected to be able to treat MDC1A.

Brief description of the drawings

[0010] [Figure 1] Figure 1 is a diagram showing the position of the targeted genomic region in the human LAMA1 gene. [Figure 2]Figure 2 shows the results of evaluating the expression enhancement effect on the human LAMA1 gene in primary skeletal muscle myoblasts (HSMM cells) derived from donor #3 using sgRNAs containing crRNAs encoded by targeting sequences represented by sequence numbers 1-15 and mini-VR. The horizontal axis represents the sgRNAs containing crRNAs encoded by each targeting sequence, and the vertical axis represents the ratio of LAMA1 gene expression levels using each sgRNA to the expression level using the control sgRNA, with the expression level using the control sgRNA set to 1. For the control, sgLAMA1-25 (sequence number 15), sgLAMA1-207 (sequence number 8), and sgLAMA1-208 (sequence number 9), the experiment was repeated four times, and the mean and standard deviation (SD) are shown. [Figure 3] Figure 3 shows the results of evaluating the expression enhancement effect on the human LAMA1 gene in immortalized human myoblasts (iCM cells) using sgRNAs (sg207 and sg25, respectively) containing crRNAs encoded by targeting sequences represented by sequence numbers 8 and 15, and mini-VR. The horizontal axis shows the MOI of AAV9-pED261-sg25 or sg207, and the vertical axis represents the ratio of LAMA1 gene expression levels using each sgRNA to the LAMA1 gene expression level using the control sgRNA, with the control sgRNA expression level set to 1. The experiment was repeated three times, and the mean and SD are shown. Left column: AAV9-GNDM1-h25, Right column: AAV9-GNDM1-h207. [Figure 4A] Figure 4 shows the induction of LAMA1 expression by GNDM with high specificity in vitro and in vivo. (A) Genomic features of the GNDM target site. Lama1 locus in mouse genome (mm9 genome assembly). Each track shows mouse Lama1 gene annotation, chromosome 17 coordinates, and H3K4me histone mark enrichment determined in C2C12 cells by ChIP-seq assay. Regions highlighted with dotted lines were selected for gRNA screening for Lama1 upregulation in C2C12 cells. [Figure 4B]Figure 4 shows the induction of LAMA1 expression by GNDM with high specificity in vitro and in vivo. (B) Summary of gRNA screening results in C2C12 cells. Relative Lama1 mRNA levels were determined by QPCR, normalizing the expression values ​​of each sample to the values ​​of non-targeting gRNA (NTG) samples. Bars represent mean values, and error bars represent SEM (n=3). [Figure 4C] Figure 4 shows the induction of LAMA1 expression by GNDM with high specificity in vitro and in vivo. (C) 7-week-old wild-type C57BL6 mice were systemically administered AAV9 containing NTG or m31 gRNA via the tail vein at the indicated doses. A schematic diagram of the CRISPR-GNDM vector is shown here. [Figure 4D] Figure 4 shows the induction of LAMA1 expression by GNDM with high specificity in vitro and in vivo. (D) QPCR analysis of Lama1 expression in various organs / tissues. Bars represent mean values, and error bars represent SEM results (n=4). [Figure 4E] Figure 4 shows the induction of LAMA1 expression by GNDM with high specificity in vitro and in vivo. (E) RNA-seq plot after systemic administration of AAV9-GNDM to mouse calf muscle tissue. In the volcano plot (bottom panel), Lama1 is shown as the transcript that was most significantly suppressed overall. This data is representative of the mean of four independent repeated measures. [Figure 4F] Figure 4 shows the induction of LAMA1 expression by GNDM with high specificity in vitro and in vivo. (F) RNA-seq read alignment across the entire Lama1 gene compared between gastrocnemius tissue of AAV9-GNDM-NTG treated mice and gastrocnemius tissue of AAV9-GNDM-m31 treated mice. [Figure 5A]Figure 5 shows that AAV9-GNDM upregulates Lama1, significantly extending lifespan and improving muscle pathology in dyw mice. (A) PND2 mice were systemically administered AAV9 containing NTG or m31 gRNA via the temporal vein at the indicated dose. After 28 days, the mice were euthanized, and multiple tissues were collected for various endpoint analyses. [Figure 5B] Figure 5 shows that AAV9-GNDM upregulates Lama1, significantly extending lifespan and improving muscle pathology in dyw mice. (B) Lama1 mRNA levels were evaluated by RT-PCR and normalized to HPrt. Relative Lama1 levels are shown compared to wild-type C57BL6 mice of the same age. [Figure 5C] Figure 5 shows that AAV9-GNDM upregulates Lama1, significantly extending lifespan and improving muscle pathology in dyw mice. (C) Immunofluorescence images of Lama1 and Lama2 in transverse sections of the gastrocnemius muscle (left) and heart (right) obtained from each treatment group. [Figure 5D] Figure 5 shows that AAV9-GNDM upregulates Lama1, significantly extending lifespan and improving muscle pathology in dyw mice. (D) Hematoxylin and eosin (H&E) staining of transverse sections of gastrocnemius muscle obtained from each treatment group. [Figure 5E] Figure 5 shows that AAV9-GNDM upregulates Lama1, significantly extending lifespan and improving muscle pathology in dyw mice. (E) Measurement of minimum ferret diameter and central nucleus from each treatment group. [Figure 5F] Figure 5 shows that AAV9-GNDM upregulates Lama1, significantly extending lifespan and improving muscle pathology in dyw mice. (F) Measurement of serum creatine kinase from each treatment group. [Figure 6A]Figure 6 shows that AAV9-CRISPR-GNDM-m31 induces functional laminin-111 protein in muscle tissue, effectively mitigating the pathophysiology of the dyw disease model and resulting in a significant increase in lifespan and body weight. (A) PND2 mice were systemically administered AAV9 containing NTG or m31 gRNA via the temporal vein at the indicated doses. Grip strength was assessed, body weight was measured, and survival was monitored over time. [Figure 6B] Figure 6 shows that AAV9-CRISPR-GNDM-m31 induces functional laminin-111 protein in muscle tissue, effectively mitigating the pathophysiology of the DYW disease model, resulting in a significant increase in lifespan and body weight. (B) Body weight and survival monitoring. [Figure 6C] Figure 6 shows that AAV9-CRISPR-GNDM-m31 induces functional laminin-111 protein in muscle tissue, effectively mitigating the pathophysiology of the DYW disease model, resulting in a significant increase in lifespan and body weight. (C) Grip strength assessment. [Figure 7] Figure 7 shows that AAV9-GNDM induces sustained expression of GNDM and LAMA1 in dy2j mice for up to 12 months, while the immune response to the transgene is transient. mRNA levels of GNDM and LAMA1 are persistent. [Figure 8A] Figure 8 shows that MyoAAV-CRISPR-GNDM-m31 demonstrated potent efficacy in dyw mice at significantly lower doses compared to AAV9. (A) BioD of MyoAAV. [Figure 8B] Figure 8 shows that MyoAAV-CRISPR-GNDM-m31 demonstrated potent efficacy in dyw mice at significantly lower doses compared to AAV9. (B) Improvement in BW and grip strength. [Figure 9A] Figure 9 shows that MyoAAV-GNDM-c58 is safe and well-tolerated when administered systemically to patients with NHP. (A) In vitro cynomolgus monkey (cyno) gRNA screening. [Figure 9B]Figure 9 shows that MyoAAV-GNDM-c58 is safe and well-tolerated when administered systemically to patients with NHP. (B) Study plan and blood chemistry. [Figure 9C] Figure 9 shows that MyoAAV-GNDM-c58 is safe and well-tolerated when administered systemically to patients with NHP. (C) NHP-3 histological data. [Figure 10] Figure 10 shows that systemic administration of MyoAAV-GNDM in NHP results in widespread and selective in vivo distribution within skeletal muscle tissue, demonstrating successful epigenetic editing, supported by significant target binding and LAMA1 gene upregulation throughout the muscle tissue. [Figure 11A] Figure 11 shows that systemic administration of MyoAAV-GNDM is safe and well-tolerated in young NHP patients. (A) Study plan. [Figure 11B] Figure 11 shows that MyoAAV-GNDM is safe and well-tolerated when administered systemically to young NHP patients. (B) Liver enzymes. [Figure 12A] Figure 12 shows that even at low doses, systemic administration of MyoAAV-GNDM is highly effective in young NHP patients. (A) VCN. [Figure 12B] Figure 12 shows that even at low doses, systemic administration of MyoAAV-GNDM is highly effective in young NHP patients. (B) LAMA1 and GNDM mRNA. [Modes for carrying out the invention]

[0011] Description of the Embodiment Embodiments of the present invention will be described in detail below.

[0012] 1. Polynucleotides The present invention provides a polynucleotide (hereinafter sometimes referred to as "the polynucleotide of the present invention") comprising the following base sequence: (a) The base sequence encoding a fusion protein of a nuclease-deficient CRISPR effector protein and a transcription activator, and (b) Guide RNA targeting the continuous region represented by Sequence ID No. 8 in the expression regulatory region of the human LAMA1 gene The base sequence that codes for something. The polynucleotide of the present invention, when introduced into a desired cell and transcribed, generates a fusion protein of a nuclease-deficient CRISPR effector protein and a transcription activator, as well as a guide RNA that targets a specific region within the expression regulatory region of the human LAMA1 gene. These fusion protein and guide RNA form a complex (hereinafter sometimes referred to as "ribonucleoprotein (RNP)") which acts cooperatively on the aforementioned specific region to activate the transcription of the human LAMA1 gene.

[0013] (1) Definition In this specification, "human laminin-α1 chain (LAMA1) gene expression regulatory region" means any region to which the expression of the human LAMA1 gene can be activated by the binding of an RNP to that region. In this specification, when an expression regulatory region is represented by a specific sequence, the expression regulatory region is a concept that includes both its sense strand sequence and antisense strand sequence. In the present invention, a fusion protein of a nuclease-deficient CRISPR effector protein and a transcription activator is recruited by guide RNA to a specific region within the expression regulatory region of the human LAMA1 gene. In this specification, "guide RNA targeting ~" means "guide RNA that recruits the fusion protein to ~". In this specification, "guide RNA (sometimes also referred to as 'gRNA')" refers to RNA containing genome-specific CRISPR-RNA (referred to as "crRNA"). crRNA is RNA that binds to the complementary sequence of the targeting sequence (described later). When Cpf1 is used as the CRISPR effector protein, "guide RNA" refers to RNA containing crRNA and a specific sequence attached to its 5' end (for example, in the case of FnCpf1, the RNA sequence represented by Sequence ID No. 16). When Cas9 is used as the CRISPR effector protein, "guide RNA" refers to chimeric RNA (referred to as "single guide RNA (sgRNA)") containing crRNA and a trans-activating crRNA (referred to as "tracrRNA") ligated to its 3' end. (See, for example, Zhang F. et al., Hum Mol Genet. 2014 Sep 15;23(R1):R40-6 and Zetsche B. et al., Cell. 2015 Oct 22; 163(3): 759-71, the entire contents of which are incorporated herein by reference). In this specification, the complementary sequence to the crRNA-binding sequence within the regulatory region of the human LAMA1 gene is referred to as the "targeting sequence." Specifically, in this specification, the "targeting sequence" is a DNA sequence located within the regulatory region of the human LAMA1 gene that is adjacent to a protospacer adjacent motif (PAM). When Cpf1 is used as the CRISPR effector protein, the PAM is adjacent to the 5' side of the targeting sequence. When Cas9 is used as the CRISPR effector protein, the PAM is adjacent to the 3' side of the targeting sequence. The targeting sequence may be located on either the sense strand or antisense strand side of the expression regulatory region of the human LAMA1 gene (see, for example, Zhang F. et al., Hum Mol Genet. 2014 Sep 15;23(R1):R40-6 and Zetsche B. et al., Cell. 2015 Oct 22; 163(3): 759-71, the entire contents of which are incorporated herein by reference).

[0014] (2) Nuclease-deficient CRISPR effector protein In this invention, a nuclease-deficient CRISPR effector protein is used to recruit a transcription activator fused to it to the expression regulatory region of the human LAMA1 gene. The nuclease-deficient CRISPR effector protein used in this invention (hereinafter simply referred to as "CRISPR effector protein") is not particularly limited as long as it forms a complex with gRNA and is recruited to the expression regulatory region of the human LAMA1 gene, but examples include nuclease-deficient Cas9 (hereinafter sometimes referred to as "dCas9") or nuclease-deficient Cpf1 (hereinafter sometimes referred to as "dCpf1"). Examples of the above-mentioned dCas9 include, but are not limited to, nuclease-deficient variants of Cas9 derived from Streptococcus pyogenes (SpCas9; PAM sequence: NGG (N is A, G, T, or C; the same applies hereafter)), Cas9 derived from Streptococcus thermophilus (StCas9; PAM sequence: NNAGAAW (W is A or T; the same applies hereafter)), Cas9 derived from Neisseria meningitidis (NmCas9; PAM sequence: NNNNGATT), or Cas9 derived from Staphylococcus aureus (SaCas9; PAM sequence: NNGRRT (R is A or G; the same applies hereafter)). (e.g., Nishimasu et al., Cell. 2014 Feb 27; See 156(5): 935-49, Esvelt KM et al., Nat Methods. 2013 Nov;10(11):1116-21, Zhang Y. Mol Cell. 2015 Oct 15;60(2):242-55, and Friedland AE et al., Genome Biol. 2015 Nov 24;16:257 (the entire contents of these are incorporated herein by reference). For example, in the case of SpCas9, a double mutant (sometimes referred to as "dSpCas9") can be used in which the 10th Asp residue is converted to an Ala residue and the 840th His residue is also converted to an Ala residue (see, for example, Nishimasu et al., Cell. 2014 above).Alternatively, in the case of SaCas9, a double mutant (SEQ ID NO: 17) in which the 10th Asp residue is converted to an Ala residue and the 580th Asn residue is converted to an Ala residue, or a double mutant (SEQ ID NO: 18) in which the 10th Asp residue is converted to an Ala residue and the 557th His residue is converted to an Ala residue (hereinafter, both double mutants may be referred to as "dSaCas9") can be used (see, for example, Friedland AE et al., Genome Biol. 2015 mentioned above, the entire contents of which are incorporated herein by reference). Furthermore, in one aspect of the present invention, a modified dCas9 may be used in which a portion of the amino acid sequence of dCas9 is further modified, and which forms a complex with gRNA and is recruited to the expression regulatory region of the human LAMA1 gene. Examples of such modified dCas9 include a shortened modified dCas9 in which a portion of the amino acid sequence is deleted, and a modified dCas9 in which a portion of the amino acid sequence of dCas9 is modified (deleted, added, and / or substituted). In one aspect of the present invention, the modified dCas9 may be used as described in WO219049913A1, WO2019235627A1, and WO2020085441A1 (the entire contents of which are incorporated herein by reference). Specifically, one may use dSaCas9 (SEQ ID NO: 19), which is a double mutant of dSaCas9 in which the 10th Asp residue is converted to an Ala residue and the 580th Asn residue is converted to an Ala residue, and the amino acids from 721 to 745 of that double mutant dSaCas9 are deleted, or dSaCas9 in which the deleted portion is replaced with a peptide linker (for example, SEQ ID NO: 21 shows the deletion with the GGSGGS linker (SEQ ID NO: 20)), or dSaCas9 (SEQ ID NO: 22), which is the double mutant of dSaCas9 in which the amino acids from 482 to 648 are deleted, or dSaCas9 in which the deleted portion is replaced with a peptide linker (SEQ ID NO: 23 shows the deletion with the GGSGGS linker). In another embodiment, dSaCas9 (dSaCas9-PFv51) obtained by amino acid substitution (E782K_L800R_T927K_K929N_N968R_N985A_R991A_A1021S_I1017F) of dSaCas9, a double mutant in which the 10th Asp residue is replaced with an Ala residue and the 580th Asn residue is replaced with an Ala residue. In this specification, the alphabet displayed to the left of the number indicating the number of amino acid residues up to the substitution site in the amino acid sequence of SaCas9 indicates the single-letter code of the amino acid before substitution, and the alphabet displayed to the right indicates the single-letter code of the amino acid after substitution. Examples of the above-mentioned dCpf1 include, but are not limited to, nuclease-deficient variants of Cpf1 (FnCpf1; PAM sequence: NTT) derived from Francisella novicida, Cpf1 (AsCpf1; PAM sequence: NTTT) derived from Acidaminococcus sp., or Cpf1 (LbCpf1; PAM sequence: NTTT) derived from Lachnospiraceae bacteria. (e.g., Zetsche B. et al., Cell. 2015 Oct 22;163(3):759-71, Yamano T et al., Cell. 2016 May 5;165(4):949-62, and Yamano T et al., Mol Cell. 2017 Aug) See 17;67(4):633-45 (the entire contents of which are incorporated herein by reference). For example, in the case of FnCpf1, a double mutant can be used in which the 917th Asp residue is converted to an Ala residue and the 1006th Glu residue is converted to an Ala residue (see, for example, Zetsche B et al., Cell. 2015 mentioned above (the entire contents of which are incorporated herein by reference)). In one aspect of the present invention, dCpf1 may be a modified variant of dCpf1 in which a portion of the amino acid sequence is altered, and which forms a complex with gRNA and is recruited to the expression regulatory region of the human LAMA1 gene. In one embodiment of the present invention, dCas9 is used as the CRISPR effector protein, and in a specific embodiment, dSaCas9 is used. Polynucleotides containing the base sequence encoding a CRISPR effector protein can be cloned, for example, by synthesizing oligoDNA primers to cover the region encoding a desired part of the protein based on their cDNA sequence information, and amplifying the polynucleotide by PCR using total RNA or mRNA fraction prepared from cells producing the protein as a template. Alternatively, polynucleotides containing the base sequence encoding a CRISPR effector protein can be obtained by introducing mutations into the cloned CRISPR effector protein encoding nucleotide sequence using known site-directed mutagenesis methods to convert amino acid residues at sites important for DNA cleavage activity (for example, in the case of SaCas9, the 10th Asp residue, the 557th His residue, and the 580th Asn residue; in the case of FnCpf1, the 917th Asp residue and the 1006th Glu residue, etc., but not limited to these) with other amino acids. Alternatively, polynucleotides containing the base sequences encoding CRISPR effector proteins can be obtained by chemical synthesis, or by a combination of chemical synthesis and PCR or Gibson Assembly, based on their cDNA sequence information. Furthermore, they can be constructed as base sequences with codon optimization to produce codons suitable for human expression.

[0015] (3) Transfer activator In the present invention, human LAMA1 gene expression is activated by the action of a transcription activator fused to a CRISPR effector protein. In this specification, "transcription activator" means a protein having the ability to activate the transcription of the human LAMA1 gene or a peptide fragment that retains that function. The transcription activator used in the present invention is not particularly limited as long as it can activate the expression of the human LAMA1 gene, but includes, for example, VP64, VP160, VPH, VPR, miniVR, and microVR, as well as their modified counterparts having transcriptional activating ability. VP64 is exemplified by a peptide consisting of 50 amino acids represented by SEQ ID NO: 24. VP160 is exemplified by a peptide consisting of 131 amino acids represented by SEQ ID NO: 25. VPH is a fusion protein of VP64, p65, and HSF1, and is specifically exemplified by a peptide consisting of 376 amino acids represented by SEQ ID NO: 26. VPR is a fusion protein of VP64, p65, and the Epstein-Barr virus replication and transcription activator (RTA), specifically exemplified by the 523-amino acid peptide represented by Sequence ID No. 27. VP64, VPH, and VPR are publicly known and are disclosed in detail, for example, Chavez A. et al., Nat Methods. 2016 Jul;13(7):563-7 and Chavez A. et al., Nat Methods. 2015 Apr;12(4):326-8 (their entire contents are incorporated herein by reference). miniVR and microVR are peptides containing the transcriptional activation domains of VP64 and RTA. The transcriptional activation domain of RTA is publicly known and is disclosed, for example, J Virol. 1992 Sep;66(9):5500-8, the entire contents of which are incorporated herein by reference. Specifically, miniVR is exemplified by a peptide consisting of 167 amino acids represented by SEQ ID NO: 28, and microVR is exemplified by a peptide consisting of 140 amino acids represented by SEQ ID NO: 29.The amino acid sequence represented by Sequence ID No. 28 consists of an amino acid sequence obtained by linking amino acid residues at positions 493-605 of the RTA with VP64 via a GSGS linker (Sequence ID No. 30). The amino acid sequence represented by Sequence ID No. 29 consists of an amino acid sequence obtained by linking amino acid residues at positions 520-605 of the RTA with VP64 via a GSGS linker. Details of miniVR and microVR are described in WO2020 / 032057A1, the entire contents of which are incorporated herein by reference. Any of the above transcriptional activators may be modified and / or altered in any way, as long as their transcriptional activating ability is maintained. Polynucleotides containing the base sequence encoding transcription activators can be constructed by chemical synthesis, or by a combination of chemical synthesis and PCR or Gibson assembly. Furthermore, polynucleotides containing the base sequence encoding transcription activators can also be constructed as codon-optimized DNA sequences to produce codons suitable for human expression. A polynucleotide containing a sequence encoding a fusion protein of a transcription activator and a CRISPR effector protein can be prepared by directly adding a sequence encoding a linker, an NLS (nuclear localization signal), and / or a tag to the sequence encoding the transcription activator, and then ligating it with a sequence encoding a CRISPR effector protein. In this invention, the transcription activator may be fused to either the N-terminus or the C-terminus. As the linker, a linker with approximately 2 to 50 amino acids can be used, and examples include, but are not limited to, a GSGS linker in which glycine (G) and serine (S) are alternately linked.

[0016] (4) Guide RNA In the present invention, a fusion protein of a CRISPR effector protein and a transcription activator can be recruited to the expression regulatory region of the human LAMA1 gene by a guide RNA. As described in section (1) Definitions above, the guide RNA includes a crRNA, which binds to the complementary sequence of the targeting sequence. The crRNA does not have to be perfectly complementary to the complementary sequence of the targeting sequence, as long as the guide RNA can recruit the fusion protein to the target region, and may be a sequence in which (i) 1 to 6 bases are deleted or substituted from the 5' end, and / or (ii) 1 base is substituted within 9 bases from the 5' end. The targeting sequence can be set using publicly available gRNA design websites (such as CRISPR Design Tool or CRISPR direct) when using dCas9 as the CRISPR effector protein. Specifically, candidate targeting sequences of approximately 20 nucleotides in length, adjacent to the PAM (e.g., NNGRRT in the case of SaCas9) on the 3' end, are listed from the sequence of the target gene (i.e., the human LAMA1 gene). From these candidate targeting sequences, those with a small number of off-target sites in the human genome can be used as the targeting sequence. The base length of the targeting sequence is 18 to 24 nucleotides, preferably 20 to 23 nucleotides, and more preferably 21 to 23 nucleotides. Numerous bioinformatics tools are publicly known and available for primary screening to predict the number of off-target sites and can be used to predict the targeting sequence with the smallest off-target effect. Examples of bioinformatics tools include Benchling (https: / / benchling.com) and COSMID (CRISPR Off-target Sites with Mismatches, Insertions and Deletions) (available online at https: / / crispr.bme.gatech.edu), which can be used to summarize the similarity of gRNAs to the target nucleotide sequences. If the gRNA design software used does not have a function to search for off-target sites in the target genome, off-target sites can be searched for by, for example, performing a Blast search on the target genome for the 8-12 nucleotides at the 3' end of the candidate targeting sequence (seed sequences with high discriminative ability for target nucleotide sequences). In one embodiment of the present invention, the following region located at the GRCh38.p13 position of human chromosome 18 (Chr18) can serve as a regulatory region for human LAMA1 gene expression. This region is strongly suggested to be an expression regulatory region based on its histone modification pattern. Therefore, in one embodiment of the present invention, the targeting sequence can be a base sequence of 18 to 24 nucleotides, preferably 20 to 23 nucleotides, and more preferably 21 to 23 nucleotides, located in at least one of the following regions at the GRCh38.p13 position of human chromosome 18 (Chr18): 7,117,996-7,118,428. In one embodiment of the present invention, the targeting sequence can be the nucleotide sequence represented by Sequence ID No. 8. When the targeting sequence represented by Sequence ID No. 8 (CCGAGCCTGGGTGGCTTCCCG) is introduced into cells as a base sequence encoding crRNA, the crRNA transcribed from this sequence becomes GCCGAGCCUGGGUGGCUUCCCG (Sequence ID No. 31), which binds to CGGGAAGCCACCCAGGCTCGG (Sequence ID No. 32), the complementary sequence of the base sequence represented by Sequence ID No. 8, located in the expression regulatory region of the human LAMA1 gene. In gRNA, the seed region adjacent to the PAM sequence is important, and mutations near the 5' end have little effect on activity (Cem Kuscu et al., Nat Biotechnol. 2014 Jul; 32(7): 677-83., Xuebing Wu et al., Nat Biotechnol. 2014 Jul; 32(7): 670-6.). Therefore, in another embodiment, a targeting sequence in which at least 1 to 6 bases are deleted or added from the 5' end can be used as the crRNA encoding sequence, as long as the guide RNA can recruit the fusion protein to the target region. In yet another embodiment, a targeting sequence in which one base is substituted within 9 bases from the 5' end can be used as the crRNA encoding sequence, as long as the guide RNA can recruit the fusion protein to the target region. Therefore, in one embodiment of the present invention, the sequence represented by Sequence ID No. 8, or such a sequence in which (i) 1 to 6 bases are deleted or substituted from the 5' end and / or (ii) one base is substituted within 9 bases from the 5' end can be used as the crRNA encoding sequence. As shown in the examples, the gRNA of the present invention has a strong upregulation effect on LAMA1 mRNA expression. Therefore, what previously required the use of multiple vectors and multiple gRNAs can now be carried out with a single vector and a single gRNA. When using dCpf1 as the CRISPR effector protein, the base sequence encoding the gRNA can be designed as a DNA sequence encoding a crRNA with a specific RNA attached to its 5' end. The RNA attached to the 5' end of such a crRNA and the DNA sequence encoding said RNA can be appropriately selected by those skilled in the art depending on the dCpf1 used. For example, when using dFnCpf1, the base sequence encoding the gRNA is sequence number 33;AATT at the 5' end of the targeting sequence. TCTAC TGTT GTAGA A nucleotide sequence with a T attached can be used (when transcribed into RNA, the underlined sequences form base pairs and take on a stem-loop structure). Such a sequence attached to the 5' end may be a sequence in which at least 1 to 6 nucleotides are deleted, substituted, inserted, and / or added to a sequence commonly used for various Cpf1 proteins, as long as the gRNA can recruit the fusion protein to the expression regulatory region after transcription. Furthermore, when using dCas9 as a CRISPR effector protein, the nucleotide sequence encoding the gRNA can be designed as a DNA sequence in which a DNA sequence encoding a known tracrRNA is ligated to the 3' end of the DNA sequence encoding the crRNA. Such tracrRNA and the DNA sequence encoding the tracrRNA can be appropriately selected by those skilled in the art depending on the dCas9 used. For example, when using dSaCas9, the nucleotide sequence represented by Sequence ID No. 34 is used as the DNA sequence encoding the tracrRNA. The DNA sequence encoding the tracrRNA may be a sequence in which at least 1 to 6 nucleotides are deleted, substituted, inserted, and / or added to a nucleotide sequence encoding a tracrRNA commonly used for various Cas9 proteins, as long as the gRNA can recruit the fusion protein to the expression regulatory region after transcription. Polynucleotides containing the base sequence encoding the gRNA designed in this way can be chemically synthesized using known DNA synthesis methods. In another embodiment of the present invention, the polynucleotide of the present invention may include two or more gRNAs having different crRNAs.

[0017] (5) Promoter sequence In one aspect of the present invention, a promoter sequence may be operably ligated to the upstream portion of the nucleotide sequence encoding a fusion protein of a CRISPR effector protein and a transcription activator, and / or the nucleotide sequence encoding a gRNA. The promoter to which it can be ligated is not particularly limited as long as it has promoter activity in the target cell. For example, promoter sequences that can be ligated upstream of the nucleotide sequence encoding the fusion protein include, but are not limited to, the EFS promoter, CMV (cytomegalovirus) promoter, CK8 promoter, MHC promoter, MYOD promoter, hTERT promoter, SRα promoter, SV40 promoter, LTR promoter, CAG promoter, and RSV (Roussarcoma virus) promoter. Promoter sequences that can be ligated upstream of the nucleotide sequence encoding a gRNA include, but are not limited to, pol III-type promoters such as the U6 promoter, SNR6 promoter, SNR52 promoter, SCR1 promoter, RPR1 promoter, U3 promoter, H1 promoter, and tRNA promoter. In one aspect of the present invention, a muscle-specific promoter can be used as the promoter sequence that can be ligated upstream of the nucleotide sequence encoding the fusion protein.Examples of such muscle-specific promoters include, but are not limited to, the CK8 promoter, CK6 promoter, CK1 promoter, CK7 promoter, CK9 promoter, cardiac troponin C promoter, α-actin promoter, myosin heavy chain kinase (MHCK) promoter, myosin light chain 2A promoter, dystrophin promoter, muscle creatine kinase promoter, dMCK promoter, tMCK promoter, enh348MCK promoter, synthetic C5-12(Syn) promoter, unc45b promoter, Myf5 promoter, MLC1 / 3f promoter, MYOD promoter, Myog promoter, and Pax7 promoter. (For further details on muscle-specific promoters, see, for example, US2011 / 0212529A, McCarthy JJ et al., Skeletal Muscle. 2012 May;2(1):8, and Wang B. et al., Gene Ther. 2008 Nov;15(22):1489-99, etc., and the entire contents of those publications are incorporated herein by reference.) Preferably, the promoter sequence that can be ligated upstream of the nucleotide sequence encoding the fusion protein is the CK8 promoter, and the promoter sequence that can be ligated upstream of the nucleotide sequence encoding the gRNA is the U6 promoter.

[0018] (6) Other base sequences Furthermore, the polynucleotide of the present invention may further include known sequences such as polyadenylation signals and Kozak consensus sequences, for the purpose of improving the translation efficiency of mRNA produced by the transcription of a base sequence encoding a fusion protein of a CRISPR effector protein and a transcription activator. In addition, the polynucleotide of the present invention may include a base sequence encoding a linker sequence, a base sequence encoding an NLS, and / or a base sequence encoding a tag.

[0019] 2. Vector The present invention provides a vector comprising the polynucleotide of the present invention (hereinafter sometimes referred to as "the vector of the present invention"). The vector of the present invention may be a plasmid vector or a viral vector. When the vector of the present invention is a plasmid vector, the plasmid vector used is not particularly limited and may be any plasmid vector, such as a cloning plasmid vector or an expression plasmid vector. The plasmid vector is prepared by inserting the polynucleotide of the present invention into the plasmid vector using a known method. When the vector of the present invention is a viral vector, examples of viral vectors that can be used include, but are not limited to, adenovirus vectors, adeno-associated virus (AAV) vectors, lentivirus vectors, retrovirus vectors, and Sendai virus vectors. In this specification, "viral vector" or "viral vector" also includes its derivatives. Considering its use in gene therapy, AAV vectors are preferably used because they allow for long-term expression of the introduced gene and are highly safe because they are derived from non-pathogenic viruses. The viral vector containing the polynucleotide of the present invention can be prepared by known methods. In short, a plasmid vector for viral expression into which the polynucleotide of the present invention is inserted is prepared, this is transfected into a suitable host cell to transiently produce the viral vector containing the polynucleotide of the present invention, and the viral vector is recovered. In one embodiment of the present invention, when an AAV vector is used, the serotype of the AAV vector is not particularly limited as long as it can activate the expression of the human LAMA1 gene in the target, and any of AAV1, AAV2, AAV3, AAV4, AAV5, AAV6, AAV7, AAV8, AAV9, or AAV10 and its derivatives may be used (see WO2005 / 033321 for the diverse serotypes of AAV, the entire contents of which are incorporated herein by reference). Examples of AAV derivatives include, but are not limited to, novel serotypes with modified capsids (e.g., WO2012 / 057363, the entire contents of which are incorporated herein by reference). MyoAAV (sometimes written as MYOAAV) is a derivative of the AAV9 capsid and can be used for gene transfer targeting muscle. MyoAAVs can deliver gene therapy more efficiently and at lower doses by using a modified outer shell protein (known as the capsid) of AAV (Tabebordbar M. et al., Cell. 2021 Sep 16;184(19):4919-4938). Several serotypes of MyoAAV exist, specifically MyoAAV 3A-3F and MyoAAV 4A-4E. MyoAAV 3A is mentioned as a preferred example of MyoAAV. In one example of preparing an AAV vector, a vector plasmid is first constructed containing the inverted terminal repeats (ITRs) at both ends of the wild-type AAV genome sequence and the polynucleotides of the present invention, which are inserted in place of the DNA encoding the Rep protein and capsid protein. Meanwhile, the DNA encoding the Rep protein and capsid protein, which are necessary for the formation of viral particles, is inserted into a separate plasmid. Furthermore, a plasmid containing genes responsible for the adenovirus helper function necessary for AAV replication (E1A, E1B, E2A, VA, and E4orf6) is constructed as an adenovirus helper plasmid. By co-transfecting host cells with these three plasmids, recombinant AAV (i.e., AAV vector) is produced within the cells. Preferably, the host cell is one that can supply some of the gene products (proteins) of the genes responsible for the helper function (e.g., 293 cells). When such cells are used, it is not necessary to include the genes encoding the proteins that can be supplied from the host cell in the adenovirus helper plasmid. Since the produced AAV vector resides in the nucleus, the virus is recovered by freezing and thawing the host cell to destroy it, and the desired AAV vector is prepared by separating and purifying the viral fraction using density gradient ultracentrifugation or column chromatography with cesium chloride. AAV vectors offer significant advantages in terms of safety and gene transfer efficiency, and are used in gene therapy. However, it is known that there are limitations on the size of polynucleotides that can be loaded into AAV vectors. For example, in one aspect of the present invention, the base length of a polynucleotide containing a nucleotide sequence encoding a fusion protein of dSaCas9 and miniVR or microVR, a nucleotide sequence encoding a gRNA targeting the expression regulatory region of the human LAMA1 gene, and promoter sequences including the EFS promoter sequence and the U6 promoter sequence, as well as the total length including the ITR portion, is approximately 4.85 kb, and therefore can be loaded into a single AAV vector.

[0020] 3. Therapeutic or prophylactic agents for MDC1A The present invention also provides a therapeutic or prophylactic agent for MDC1A (hereinafter sometimes referred to as "the agent of the present invention") comprising the polynucleotide or vector of the present invention. The agent of the present invention may contain the polynucleotide or vector of the present invention as an active ingredient, and may be prepared as a formulation comprising such active ingredient (i.e., the polynucleotide or vector of the present invention) and a conventionally pharmaceutically acceptable carrier. The agents of the present invention may be administered parenterally, and may also be administered topically or systemically. The agents of the present invention may, for example, be administered intravenously, intra-arterially, subcutaneously, intraperitoneally, or intramuscularly. The dosage of the agent of the present invention administered to the target subject is not particularly limited, as long as it is a therapeutic and / or prophylactic effective dose. It may be appropriately optimized depending on the active ingredient, dosage form, the age and weight of the target subject, the administration schedule, and the method of administration. In one embodiment of the present invention, the agent of the present invention can be administered prophylactically not only to subjects suffering from MDC1A, but also to subjects who are likely to develop MDC1A in the future based on genetic background analysis, etc. Furthermore, the term "treatment" as used herein may include not only the cure of the disease but also remission of the disease. Furthermore, the term "prevention" may include not only preventing the onset of the disease but also delaying the onset of the disease. The agent of the present invention may also be referred to as "the pharmaceutical composition of the present invention," etc.

[0021] 4. Treatment or prevention methods for MDC1A The present invention also provides a method for treating or preventing MDC1A (hereinafter sometimes referred to as "the method of the present invention"), comprising administering the polynucleotide or vector of the present invention to a subject requiring such treatment or prevention. The present invention also includes the polynucleotide or vector of the present invention for use in treating or preventing MDC1A. Furthermore, the present invention includes the use of the polynucleotide or vector of the present invention in the manufacture of pharmaceutical compositions for treating or preventing MDC1A. The method of the present invention can be carried out by administering the agent of the present invention described above to a subject suffering from MDC1A, and the dosage, route of administration, subject, etc., are the same as described above. The measurement of symptoms may be performed before the start of treatment using the method of the present invention, or at any time after treatment to determine the subject's response to the treatment. The method of the present invention may improve the function of the target skeletal muscle and / or cardiac muscle. The muscles whose function is improved are not particularly limited, and any muscle or muscle group can be exemplified.

[0022] 5. Ribonucleotide protein The present invention provides a ribonucleotide (hereinafter sometimes referred to as "RNP of the present invention") comprising the following: (c) A fusion protein of a nuclease-deficient CRISPR effector protein and a transcription activator, and (d) In the expression regulatory region of the human LAMA1 gene, The continuous region represented by sequence number 8, A guide RNA that targets [a specific target]. The CRISPR effector protein, transcription activator, and guide RNA included in the RNP of the present invention can be those described in detail in the "1. Polynucleotide" section above. Furthermore, the fusion protein of the CRISPR effector protein and transcription activator included in the RNP of the present invention can be produced, for example, by introducing and expressing a polynucleotide encoding the fusion protein in cells, bacteria, or other organisms, or by using the polynucleotide in an in vitro translation system. The guide RNA included in the RNP of the present invention can be produced, for example, by chemical synthesis or by using a polynucleotide encoding the guide RNA in an in vitro translation system. The RNP of the present invention can be prepared by mixing the CRISPR effector protein and guide RNA thus produced. Other substances, such as gold particles, may be mixed as needed. To directly deliver the RNP of the present invention to target cells or tissues, the RNP may be encapsulated in lipid nanoparticles (LNPs) by known methods. The RNP of the present invention can be introduced into target cells or tissues by known methods. For methods of encapsulation and introduction into LNPs, see, for example, Lee K., et al., Nat Biomed Eng. 2017; 1:889-901, and WO 2016 / 153012 (the entire contents of which are incorporated herein by reference). In one aspect of the present invention, the guide RNA contained in the RNP of the present invention targets a contiguous 18-24 nucleotide length, preferably 20-23 nucleotide length, more preferably 21-23 nucleotide length, in at least one of the following regions located at the GRCh38.p13 position of human chromosome 18 (Chr18): 7,117,996-7,118,428. In one embodiment, the guide RNA targets a region containing all or part of the sequence represented by Sequence ID No. 8.

[0023] 6. Others The present invention also provides compositions or kits for activating the expression of the human LAMA1 gene, including: (e) A fusion protein of a nuclease-deficient CRISPR effector protein and a transcription activator, or a polynucleotide encoding said fusion protein, and (f) The continuous region represented by Sequence ID No. 8 in the expression regulatory region of the human LAMA1 gene, A guide RNA that targets a specific target, or a polynucleotide that encodes the guide RNA. The present invention also provides a method for treating or preventing MDC1A, comprising administering (e) and (f) below: (e) A fusion protein of a nuclease-deficient CRISPR effector protein and a transcription activator, or a polynucleotide encoding said fusion protein, and (f) In the expression regulatory region of the human LAMA1 gene, The continuous region represented by sequence number 8, A guide RNA that targets a specific target, or a polynucleotide that encodes the guide RNA. The CRISPR effector proteins, transcription activators, guide RNAs, polynucleotides encoding them, and vectors on which they are carried can be those described in detail in the sections "1. Polynucleotides," "2. Vectors," and "5. Ribonucleoproteins" above. The dosage, route of administration, target population, and formulations described in (e) and (f) above are the same as those described in the section "3. Therapeutic or prophylactic agents for MDC1A." Other features of the present invention will become apparent from the following exemplary embodiments given for the purpose of describing the invention, but are not intended to be limited thereto.

[0024] Other features of the present invention will become apparent from the following exemplary embodiments given for the purpose of describing the invention, but are not intended to be limited thereto. [Examples]

[0025] Experimental method Selection of LAMA1 targeting sequences Based on the H3K4me3 and H3K27Ac patterns of the human skeletal muscle cell genome, we scanned the expanded region of the human LAMA1 gene regulatory domain near TSS (TSS-2) and searched for sequences targeted by catalytically inactive SaCas9 (D10A and N580A variants; dSaCas9) compounded with gRNAs defined herein as targeting sequences. The location of the target genomic region relative to the LAMA1 gene is shown in Figure 1, and its coordinates are as follows: Chr18:GRCh38 / hg38;7,117,996-7,118,428->~0.5kb(TSS-2)

[0026] The targeting sequence was identified as a 21-nucleotide segment (5'-21nt targeting sequence-NNGRRT-3') adjacent to a protospacer-adjacent motif (PAM) containing the sequence NNGRRT (Table 1) (where N=A / C / T / G and R=A / G).

[0027] Table 1. Targeting sequences used for screening the LAMA1 gene expression regulatory region.

[0028] [Table 1]

[0029] In Table 1, "Location" indicates the candidate cleavage sites for SaCas9 for all the gRNAs shown when using SaCas9. Sequence IDs 1-14 are located in the TSS-2 region (Figure 1).

[0030] Construction of lentivirus-introduced plasmids (pED176 and derived plasmids) pLentiCRISPR v2 was purchased from Genscript (https: / / www.genscript.com) and the following modifications were made: the SpCas9 gRNA scaffold sequence was replaced with the SaCas9 gRNA scaffold sequence; and the SpCas9-FLAG was replaced with dSaCas9 fused to a codon-optimized VP64-miniRTA (also known as miniVR). The transcriptional activation domain of VP64-MiniRTA, when localized to the promoter, can activate gene expression by activating transcription. VP64-miniRTA binds to the C-terminus of dSaCas9 (D10A and N580A variants) (hereinafter referred to as dSaCas9-VR) and targets the regulatory region of the human LAMA1 gene as indicated by the targeting sequence (Table 1, Figure 1). The prepared backbone plasmid was named pED176.

[0031] Construction of adeno-associated virus gene transfer plasmids (pED261 and derived plasmids) The sequences between ITRs were replaced with dSaCas9 fused with a VP64-miniRTA driven by the CK8 promoter, and a SaCas9 gRNA scaffold sequence driven by the U6 promoter. The prepared backbone plasmid was named pED261.

[0032] gRNA cloning Three control non-targeting sequences and 14 targeting sequences (Table 1) were cloned into pED176 or pED261. The following sequences were also used as targeting sequences. Sequence ID 15 (sgLAMA1-25 / sg25); position: 7116449, chain: -1; sequence (5'→3'): ACCGGAGCTGGAAACGCAGCA, PAM: TTGAAT Forward and reverse oligos were synthesized by Integrated DNA Technologies in the following format: forward; 5'CACC(G)-20 base pair targeting sequence-3', and reverse; 5'AAAC-19~21 base pair reverse complementary targeting sequence-(C)-3' (bases in parentheses were added if the target did not begin with G). The oligos were resuspended in Tris-EDTA buffer (pH 8.0) at 100 μM. 1 μl of each complementary oligo was added to 10 μl of reaction mixture in NE Buffer 3.1 (NEB catalog number: B7203S). This reaction mixture was heated to 95°C and cooled to 25°C in a thermocycler to anneal oligos with sticky end overhangs suitable for cloning to pED176 or pED261. The annealed oligonucleotides were digested with BsmBI (BsaI in the case of pED261), gel-purified pED176 or pED261, and ligated with T4 DNA ligase (NEB catalog number: M0202S) according to the manufacturer's protocol. 10 μl of NEB Stable Competent cells (NEB catalog number: C3040I) were transformed with 2 μl of the ligation reaction mixture according to the manufacturer's protocol. The resulting constructs drive the expression of sgRNAs, including crRNAs encoded by individual targeting sequences fused with tracrRNA (SEQ ID NO: 35), via the U6 promoter.

[0033] Lentivirus preparation HEK293TA cells were placed in a 6-well cell culture dish (VWR catalog number: 10062-892) at a rate of 0.75 x 10⁴. 6Cells were seeded in wells and cultured for 24 hours at 37°C / 5% CO2 in 2 ml of growth medium (DMEM medium supplemented with 10% FBS, 2 mM fresh L-glutamine, 1 mM sodium pyruvate, and non-essential amino acids). The following day, the TransIT-VirusGEN transfection reaction was set up according to the manufacturer's protocol using 1.5 μg of packaging plasmid mix [1 μg of packaging plasmid (pCMV delta R8.2; see addgene # 12263) and 0.5 μg of envelope expression plasmid (pCMV-VSV-G; see addgene # 8454)] and 1 μg of transplasm containing a sequence encoding the sgRNA labeled dSaCas9-VR. Lentiviruses were recovered 48 hours after transfection by passing the supernatant of the medium through a 0.45 μM PES filter (VWR catalog number: 10218-488). The purified and dispensed lentiviruses were stored in a -80°C freezer until use.

[0034] rAAV9 virus preparation All rAAV9 viruses were generated using the Umass Chan Medical School viral vector core with either the pED261-sg25 or sg207 gene transfer vector.

[0035] Lentiviral transduction of HSMM cells Primary skeletal muscle myoblasts (HSMMs) were obtained from Lonza Inc., collected from two different human donors (referred to as Donor #3 and Donor #617) at different ages (0-26 years). The cells were cultured in primary skeletal muscle growth medium [SkGM-2 Skeletal Muscle Growth Bullet Kit medium (Lonza #CC-3244 & CC-3246)]. For transduction, cells were placed in a 6-well cell culture dish (VWR catalog number: 10062-894) containing growth medium, with a density of 0.125-0.33 × 10⁴ cells. 6Cells were seeded in cells / wells and cultured at 37°C / 5% CO2 for 24 hours. The next day, 1.5 ml of growth medium supplemented with 8 μg / ml polybrene (Sigma catalog number: TR-1003-G) and 1.0 ml of lentiviral supernatant (see above) corresponding to each sgRNA containing crRNA encoded by an individual targeting sequence (Table 1) and tracrRNA were added to each well. After incubating the cells with the lentivirus for 6 hours, the virus medium was removed and replaced with fresh growth medium. 72 hours after transduction, the cells were given selection medium [growth medium supplemented with 0.5 μg / ml puromycin (Sigma Aldrich catalog number: P8833)]. Fresh selection medium was given to the cells every 2 - 3 days. 7 - 10 days after placing the cells in the selection medium, the cells were harvested and RNA was extracted using the RNeasy 96 kit (Qiagen catalog number: 74182) according to the manufacturer's instructions.

[0036] AAV9 transduction to immortalized human myoblasts (iCMs) Immortalized primary skeletal muscle myoblasts (iCM) were obtained from the Association Institut de Myologie in France. The cells were cultured in primary skeletal muscle cell growth medium [SkGM-2 Skeletal Muscle Growth BulletKit medium (Lonza #CC-3244 & CC-3246)]. For AAV9 transduction, 0.3×10 6 cells / well were seeded in a 24-well cell culture dish containing growth medium and cultured at 37°C / 5% CO2 for 24 hours. Then, the cells were transduced with AAV9-pED261-sg25 or sg207 at MOIs of 1.5×10 5 , 4.5×10 5 , 1.35×10 6 and 4.05×10 6Cells were transduced using vg. After incubation with AAV for 24 hours, the viral medium was removed and replaced with fresh growth medium. Cells were given fresh selective medium every 2-3 days. After culturing in growth medium for 6-8 days, cells were harvested and RNA was extracted using the RNeasy 96 kit (Qiagen, catalog number: 74182) according to the manufacturer's instructions.

[0037] Gene expression analysis cDNA was prepared in 10 μl volumes from approximately 0.5–1.0 μg of total RNA according to the protocol of the High-Capacity cDNA Reverse Transcription Kit (AppliedBiosystems; Thermo Fisher catalog number: 4368813). The cDNA was diluted 10-fold and used as a template for the subsequent assay. For gene expression analysis using QPCR, Taqman Fast Advanced Master Mix was used according to the manufacturer's protocol. Taqman probes (LAMA1: Assay Id Hs01074489_m1 FAM; HPRT: Assay Id Hs99999909_m1 VIC_PL) were obtained from Life Technologies. Taqman probe-based real-time PCR reactions were performed and analyzed using the QuantStudio 5 Real-Time PCR system according to the Taqman Fast Advanced Master Mix protocol. For gene expression analysis using ddPCR, PCR reaction mixtures were prepared using 2×ddPCR Supermix for probes (Bio-Rad, catalog number: 186-3026), 20× Taqman probes (LAMA1: Assay ID Hs01074489_m1 FAM; HPRT: Assay ID Hs99999909_m1 VIC_PL), and cDNA template (variable volume) to a final volume of 20 μL. Each prepared ddPCR reaction mixture was loaded into the sample wells of an 8-channel disposable droplet generator cartridge (Bio-Rad). 60 μL of droplet generation oil (Bio-Rad) was loaded into the oil well for each channel. The cartridge was placed in the droplet generator (Bio-Rad). The cartridge was removed from the droplet generator, and the droplets collected in the drop wells were manually transferred to a 96-well PCR plate using a multichannel pipette. The plates were heat-sealed with foil seals and then placed in a conventional thermal cycler for amplification up to the endpoint (40-55 cycles). After PCR, the 96-well PCR plates were loaded into a droplet reader (Bio-Rad), and droplets were automatically read from each well of the plate. The ddPCR data were analyzed using the QX Manager analysis software (Bio-Rad) included with the droplet reader.

[0038] QPCR Data Analysis For each sample and three controls, the deltaCt value was calculated by subtracting the average Ct value of the LAMA1 probe obtained from three technically repeated experiments from the average Ct value of the HPRT probe (average Ct LAMA1 - average Ct HPRT). The expression value was calculated for each sample. -(deltaCt) This was calculated using the formula shown. Next, the expression levels of the samples were normalized by the mean of the expression levels of three controls for each experiment, and the relative LAMA1 expression levels of each sample were determined.

[0039] cell culture C2C12 cell lines (ATCC) were maintained in DMEM medium (Invitrogen) containing 10% fetal bovine serum (FBS) and antibiotics (penicillin / streptomycin) at 37°C and 5% CO2. For transfection experiments, approximately 100,000 cells were seeded per well in 12-well plates to achieve 70-80% confluence. Following the manufacturer's instructions, cells were transfected with 1 μg of plasmid DNA and 2 μL of Lipofectamine 2000 (Invitrogen). Successful transfection was confirmed by cell survival after 48 hours of selection with 2 μg / mL of puromycin, after which RNA was recovered and subjected to gene expression analysis.

[0040] Lentiviral transduction into cynomolgus monkey myoblasts Primary skeletal muscle myoblasts from cynomolgus monkeys were obtained from BioIVT. The cells were cultured in SkGM-2 Skeletal Muscle Growth Bullet Kit medium (Lonza). For transduction, cells were seeded at 125,000 cells / well in a 12-well plate containing growth medium and cultured at 37°C / 5% CO2 for 24 hours. The following day, 1.5 ml of growth medium supplemented with 8 μg / ml of polyblen (Sigma catalog number: TR-1003-G) and 1.0 ml of lentiviral supernatant (see above) corresponding to the sgRNA containing the crRNA encoded by the individual targeting sequences and tracrRNAs were added to each well. To enhance transduction efficiency, the cells were centrifuged at 1200 × g for 1 hour, after which the viral medium was removed and replaced with fresh growth medium. 72 hours after transduction, the cells were given selective medium containing 0.5 μg / ml of puromycin every 2-3 days. After culturing in selective medium for 7-10 days, the cells were harvested and RNA was extracted using the RNeasy 96 kit (Qiagen) according to the manufacturer's instructions.

[0041] Extraction of RNA and DNA from animal tissues To isolate mRNA from mouse tissue, TRIzol TM-A hybrid protocol combining chloroform phase separation and Qiagen RNeasy 96 (Qiagen) was used. First, the tissue was treated with 1 mL of TRIzol TM The solution was placed in a lysing matrix A tube (MP Biomedicals) along with (Invitrogen) and dissolved using a bead mill. After centrifugation at 12,000 × g for 10 minutes, the supernatant was collected in a Phasemaker. TM The solution was transferred to an Invitrogen tube, and 160 μL of chloroform was added. The tube was vigorously shaken by hand for 20 seconds, and then the solution was centrifuged at 10,000 × g for 18 minutes at 4°C to separate the phases. Subsequently, the aqueous supernatant was mixed with the same volume of 70% ethanol. This mixture was transferred to a Qiagen RNeasy 96 plate, and isolation was continued according to the manufacturer's protocol. Genomic DNA isolation was performed according to the Qiagen DNeasy Blood and Tissue Kit (Qiagen). If necessary, tissue was dissolved overnight in buffer ATL with Proteinase K at 56°C under moderate agitation. The lysate was mixed with buffer AL / E and transferred to a DNeasy 96 plate. Centrifuge was then performed, and the column was washed with buffer AW1, then buffer AW2. Genomic DNA was eluted with buffer AE.

[0042] Gene expression analysis using QPCR Using less than 1 μg of total RNA, cDNA was prepared in 10 μL of solution according to the High-Capacity cDNA Reverse Transcription Kit (ThermoFisher) protocol. The cDNA was then diluted 10-fold and analyzed using Taqman Fast Advanced Master Mix according to the manufacturer's instructions. Real-time PCR reactions using Taqman probes were processed and analyzed using the QuantStudio 5 Real-Time PCR system according to the Taqman Fast Advanced Master Mix protocol. For each sample, the deltaCt value was calculated by subtracting the average Ct value of the target gene (calculated from 3 technically replicated experiments) from the Ct value of the housekeeping gene. Expression values ​​were calculated for each sample. -(deltaCt) The expression levels were determined using the following formula. Next, these sample expression levels were normalized by the control expression levels for each experiment to determine the relative expression levels of the target gene.

[0043] RNA and VCN quantification by ddPCR mRNA isolated from animal tissue was reverse transcribed using a high-capacity RT Kit (Thermo Scientific) according to the manufacturer's protocol. The resulting cDNA was subjected to droplet digital PCR (ddPCR) analysis, and the expression levels of the target gene were evaluated using mouse HPRT as a housekeeping reference. The vector copy number was evaluated using isolated genomic DNA and mouse TFRC as a reference. The genome copy number was 2. All ddPCR tests were performed using two-color analysis with a QX200 Automated Droplet Generator and QX200 Droplet Digital PCR System (Bio-Rad), following the manufacturer's instructions. A reaction mixture consisting of appropriate primer-probe sets, RNase-free water, ddPCR Supermix (Bio-Rad, 1863024), and diluted cDNA or gDNA was prepared, loaded into the QX200 AutoDG, and the DNA was split into droplets. Subsequently, the DNA was amplified by PCR, the droplets were counted individually, and the positive / negative status of the FAM signal and VIC signal was determined using a QX200 Droplet Reader. Target gene expression was analyzed in each sample by dividing the number of FAM-positive droplets (target genes) by the number of VIC-positive droplets (housekeeping genes). In genomic DNA analysis, the number of vector copies per diploid genome was determined by dividing the number of FAM-positive droplets by the number of VIC-positive droplets and then multiplying by two.

[0044] NHP and injection Group 1 of this study included 12 healthy 2-year-old female cynomolgus monkeys. Group 2 included 4 young 8- or 9-month-old cynomolgus monkeys (3 males and 1 female). Prior to enrollment, the animals were confirmed to be serologically negative for the relevant AAV serotype and Cas9. All enrolled animals received immunosuppressive treatment the day before AAV administration and weekly throughout their lives. All treated animals were anesthetized and AAV was administered intravenously over 30 minutes. After administration, the animals were closely monitored to check for any acute reactions. At the end of their lives, the animals were anesthetized and peripheral blood was collected. The animals were humanely euthanized, necropsies were performed, and tissue samples from various organs were collected. All animal care and protocols were implemented and approved under the guidelines of the relevant Institutional Animal Care and Use Committee.

[0045] AAV production and purification Suspended HEK293 cells were transfected with plasmids necessary for AAV production, namely the Ad helper plasmid, the target GNDM gene plasmid, and the rep / cap plasmid. Three days after transfection, the cells were lysed, treated with benzonase (Millipore Sigma), and clarified by depth filtration and sterile filtration. The clarified lysate was purified by affinity chromatography and anion exchange (AEX) chromatography to concentrate the genome-containing capsid prior to final concentration and buffer exchange.

[0046] Immunofluorescence staining and H&E staining OCT-embedded mouse skeletal muscle tissue was sectioned to a thickness of 7 μm on glass slides, and a hydrophobic barrier was drawn around the tissue using a PAP pen (Vector Labs). The tissue was then rehydrated with PBS and fixed with 4% Formal Fixx (Epredia) at 4°C for 8 minutes. After washing the slides with PBS, they were permeabilized in a TBS (50 mM Tris pH 7.4, 90 mM NaCl) solution containing 0.2% Triton at room temperature for 10 minutes. Next, the sections were blocked with 10% normal goat serum (Invitrogen) at room temperature for 1 hour. The slides were incubated overnight at 4°C with primary antibodies in 10% normal goat serum and 1% bovine serum albumin (Fisher Scientific, BP1600-100). The following morning, the slides were washed with TBS and incubated with secondary antibodies at room temperature for 1 hour. The slides were cleaned with TBS, then mounted with a fade-resistant mounting medium containing DAPI (Vector Labs), and covered with coverslips. The primary antibodies used in this study were as follows: rabbit monoclonal anti-mouse laminin-α1 (Genscript, custom-made, 1:200), mouse monoclonal anti-mouse laminin-α2 (4H8-2, Santa Cruz Biotechnology, 1:50), rat monoclonal anti-CD8 (clone 4SM16, Invitrogen, 1:200), and CD11b. All microscopic images were taken using an ECHO Revolution color camera (ECHO Revolution microscope, USA) with ECHO Application Suite software (version 2).

[0047] SaCas9 enzyme-linked immunosorbent spot (ELISpot) assay The frequency of SaCas9-specific T cells was measured using the IFN-γ ELISpot assay. Splenocytes were isolated from the spleens of control and treatment mice at each time point, and 200,000 splenocytes were seeded in each well. Cells were stimulated in vitro with 10 mg / ml of SaCas9 protein (Genscript Inc.) for 48 hours. IFN-γ-producing cells were indirectly detected as spots using a mouse-specific IFN-γ ELISpot kit (Immunospot, Cleveland, OH, USA) according to the manufacturer's instructions. Spots were analyzed and counted using ImmunoSpot software (version 7, Cellular Technology Limited, Cleveland, OH, USA) on an ImmunoSpot® S6 Analyzer (Cellular Technology Limited). The number of IFN-γ-producing cells was expressed as spot-forming units (SFUs) per million cells. PHA was used as a positive control in each assay. Culture medium was used as a negative control in each assay. Untreated naive mice were evaluated as baseline. The assay was performed using triple repeated measures.

[0048] Monkey IFN-g ELISPOT assay PBMCs were isolated from each animal in the treatment and control groups, and 25,000 PBMCs were seeded in each well. These were then stimulated in vitro with SaCas9 protein (Genscript Inc.) at 10 mg / ml for 48 hours. IFN-γ-producing cells were indirectly detected as spots using the monkey-specific IFN-γ ELISpot kit (MabTech, USA) according to the manufacturer's instructions. Spots were analyzed and counted using ImmunoSpot software (version 7, Cellular Technology Limited, Cleveland, OH, USA) on an ImmunoSpot® S6 Analyzer (Cellular Technology Limited). The number of IFN-γ-producing cells was expressed as spot-forming units (SFUs) per million cells. PHA was used as a positive control in each assay. Culture medium was used as a negative control in each assay. Untreated naive mice were evaluated as baseline. Assays were performed using double repeated measures.

[0049] Antibody assay Serum levels of anti-AAV9 or anti-SaCas9 antibodies were evaluated by enzyme-linked immunosorbent assay (ELISA). If necessary, 2.5 ng / ml of AAV9 or SaCas9 protein (Genscript Inc., USA) in carbonate buffer was coated onto microtiter plates. Serum was prepared starting with a 1:25 dilution and serially diluted 2-fold. Anti-Cas9 IgG was detected using horseradish peroxidase (HRP)-conjugated goat anti-mouse IgG (1:10000; Southern Biotech, USA) for mouse serum samples, and HRP-conjugated goat anti-CynoIgG (Southern Biotech, USA) for monkey serum samples. The absorbance of each sample was measured at 450 nm using a GloMax Microplate Spectrophotometer (Promega, USA). Each sample was measured using triple repeated assays, and the data were plotted as absorbance values ​​at 450 nm relative to a 1:100 serum dilution.

[0050] RNA sequencing Illumina sequencing was performed by GeneWiz, LLC, and gene expression libraries were prepared using the NEBNext Ultra RNA Library Prep Kit (NEB, Ipswich, MA, USA) according to the manufacturer's protocol. The sequencing libraries were clustered into three lanes of an Illumina HiSeq flow cell and sequenced in a 2×150 paired-end configuration. The obtained raw sequence data (.bcl files) were converted to fastq files using Illumina's bcl2fastq 2.17 software and demultiplexed. One mismatch was tolerated in the identification of the index sequences. The fastq files were aligned to the human genome assembly GRCh38.p12, which includes GNDM sequence modifications, using the STAR aligner (Dobin, A., et al., 2013). Differential analysis was performed using DESeq2 (Love, M., et al., 2014), and plots were created using plotly (https: / / plot.ly) with a custom R script. Furthermore, the reads were mapped and visualized on the genome using the Integrated Genomics Viewer (https: / / igv.org / ).

[0051] result Activation of LAMA1 gene expression by dSaCas9-VR:sgRNA We constructed lentiviruses that introduced VP64-miniRTA expression cassettes and sgRNAs for each target sequence into primary HSMM cells. Transduced cells were selected for puromycin resistance, and LAMA1 expression was quantified using the Taqman assay. The expression values ​​for each sample were normalized to the mean LAMA1 expression in cells transduced with control sgRNA. As shown in Figure 2, among the 14 sequences examined, sg207 increased LAMA1 mRNA expression by approximately 15 to 20 times in HSMM donor #3 cells (Figure 2), outperforming sg25, which had previously been the best sequence in the same experiment. To further validate the superior activity of the newly identified sg207, it was cloned into the all-in-one GNDM AAV vector pED261, and its ability to upregulate LAMA1 in immortalized human myoblast cell lines was evaluated in parallel with sg25. As shown in Figure 3, under all four MOI conditions examined, the sg207 vector consistently induced LAMA1 levels that were, on average, 3 to 5 times higher than those of sg25.

[0052] AAV9-CRISPR-GNDM-m31 induced LAMA1 transcription and showed high specificity. To identify the most potent guide RNA (gRNA) that upregulates mouse LAMA1 expression, C2C12 cells were transfected with a plasmid expressing GNDM and an arrayed library containing 45 gRNAs covering a 2kb region near the LAMA1 transcription start site (Figures 4A and 4B). This region was selected because it is likely to contain key regulators. qPCR analysis revealed that several gRNAs significantly increased LAMA1 expression compared to control gRNAs, leading to the selection of gRNA m31 for further validation. Optimizing efficient epigenetic editing in AAV vectors is crucial due to the packaging size limitations of AAV genomes. Extensive optimization of each vector element led to the development of a final vector with streamlined components to maximize efficiency and specificity. This final configuration includes a CK8 promoter responsible for muscle-specific expression, a codon-optimized GNDM gene for enhanced expression, a compact polyadenylation signal, and a gRNA m31 expression cassette, collectively referred to as GNDM-m31. Seven-week-old wild-type mice were administered AAV9 encapsulated with GNDM-m31 at a dose of 1.5E14 vg / kg (Figure 4C). Eleven weeks after administration, the animals were euthanized, and various tissues were collected and analyzed by qPCR. Our results indicate that in animals treated with AAV9-GNDM, significant upregulation of LAMA1 mRNA was observed in skeletal muscle and cardiac tissue, while no upregulation was observed in non-target tissues such as the liver (Figure 4D). To evaluate the in vivo specificity of CRISPR-GNDM-m31, total RNA was isolated from calf muscle and whole transcriptome RNA sequencing was performed (Figures 4E and 4F). Mapping of reads obtained from non-transduction tissue and tissues transductioned with GNDM, control sgRNA, and Lama1 target sgRNA to the Lama1 gene revealed increased Lama1 mRNA expression. Lama1 upregulation did not have any observable effect on the expression of genes directly upstream or downstream of Lama1. Furthermore, overall mRNA expression analysis in animals transductioned with control sgRNA or Lama1 sgRNA showed minimal impact on overall gene expression, with Lama1 mRNA exhibiting significantly higher expression. These data highlight the transcriptional specificity of CRISPR-GNDM-m31. Combined with targeted delivery and expression in specific tissues, this supports the potential of CRISPR-GNDM technology for precise gene therapy.

[0053] AAV9-GNDM-m31 induces Lama1 protein expression in muscle tissue, and dy W The pathophysiology in the disease model was relaxed (Figures 5A-5F and 6A-6C). Homozygous dyW mice lack functional Lama2 expression and exhibit a severe muscular dystrophy phenotype that replicates the clinical symptoms of LAMA2-CMD. To evaluate the efficacy of AAV9-GNDM-m31, dyW mice at postnatal day 2 (PND2) were administered a 4.5E11 vector genome (vg) (approximately 3E14vg / kg) via the temporal vein. Four weeks later, significant Lama1 protein expression was detected in treated mice by immunofluorescence staining. This expression pattern was similar to that of Lama2 protein in wild-type mice, and the Lama1 protein was localized to the basement membrane of muscle fibers and cardiomyocytes. These results suggest that the induced LAMA1 protein forms a functional laminin complex and is effectively integrated into the extracellular matrix of these tissues. dyW mice showed elevated serum creatine kinase (CK) levels, an indicator of muscle damage, compared to wild-type mice. However, treatment with AAV9-GNDM-m31 significantly reduced serum CK levels. Next, we examined the morphology of skeletal muscle. In dyW mice treated with AAV9-GNDM-NTG, H&E staining revealed large clusters of small muscle fibers with numerous centrally located nuclei, indicating active muscle degeneration. In contrast, the muscles of mice treated with AAV9-GNDM-m31 showed significantly fewer central nuclei and exhibited a nearly normal morphology, suggesting that LAMA1 expression induced by GNDM protected muscle fibers from degeneration. Furthermore, we investigated whether the histopathological improvements observed in dyW mice also led to lifespan extension and growth promotion. dyW mice were divided into four groups and treated with PND2 as follows: 1. Mock-up procedure; 2. AAV9-GNDM-NTG high dose (3.6E11vg / mouse); 3. AAV9-GNDM-m31 low dose (1.8E11vg / mouse); 4. AAV9-GNDM-m31 high dose (3.6E11vg / mouse). After 80 days, the survival rate was 50% in the mock-treated or NTG-treated groups, while 100% of dyW mice treated with low or high doses of AAV9-GNDM-m31 survived. The improvement in survival due to treatment became more apparent around 120 days post-treatment. At this point, the survival rate was only 5% in the AAV9-GNDM-NTG mice, while dyW mice treated with AAV9-GNDM-m31 showed extended survival rates of 95% in the low-dose group and 100% in the high-dose group. Notably, more than 50% of mice in the low-dose group survived for more than 300 days, and more than 50% of mice in the high-dose group survived for more than 400 days. In addition, mice treated with AAV9-GNDM-m31 showed a significant increase in body weight compared to mock-treated or AAV9-GNDM-NTG-treated mice, and this effect was maintained throughout life. Furthermore, when grip strength of the forelimbs and all limbs (total of all four limbs) was measured at 5, 7, and 9 weeks of age, dyW mice treated with AAV9-GNDM-m31 showed a significant improvement in grip strength at all measurement points. This effect was dose-dependent and indicated enhanced muscle function. Taken together, these results support the effectiveness of GNDM technology when applied to muscle-related symptoms of LAMA2-CMD.

[0054] AAV9-GNDM induced sustained expression of GNDM and LAMA1 for up to 12 months in dy2j mice, and the immune response to the transgene was transient (Figure 7). To evaluate the persistence of transgene expression and the effects of transgene-mediated immunogenicity, a dy2j LAMA1 disease mouse model was used. Unlike dyW mice, which have a shorter lifespan, dy2j mice have a normal lifespan similar to C57B / 6 mice and exhibit a mild phenotype. Systemic administration of AAV9-GNDM at a dose of 3 × 10 e14 induced potent GNDM and LAMA1 expression in muscle tissue from week 1 to year 1 (Figure 7). Quantification of GNDM-specific T cell response by IFNg ELISPOT assay showed a transient GNDM-specific T cell response induced at week 2, but this response rapidly decreased by week 4 and remained at extremely low levels throughout the study period. Antibody response analysis of serum samples by IgG ELISA showed that AAV9-GNDM administration induced an antibody response against GNDM. Furthermore, the effects of the GNDM-specific systemic immune response on target muscle tissue were evaluated. Immunohistochemical analysis of GC muscle tissue using CD8-specific and CD11b-specific antibodies showed increased CD8 T cell infiltration at 2 weeks after AAV9-GNDM administration, but this infiltration significantly decreased after 4 weeks and remained at low levels throughout the study period. On the other hand, no differences were observed between control and treated animals in the CD11b-positive population. qPCR analysis of different immune markers in muscle tissue using TaqMan probes showed elevated levels of CD8, IFNg, and GranB at 2 weeks, followed by a decreasing trend similar to the T cell response in ELISPOT data. Meanwhile, Foxp3 expression increased at 2 weeks in AAV9-GNDM-treated animals and remained high for the following year. Consistent with previous reports, muscle-targeted AAV administration induces persistent Foxp3 T cells in muscle tissue, indicating a balance in the immune response in muscle tissue. This data indicates that AAV9-GNDM administration induces transient T-cell and antibody responses to the transgene, but these responses have minimal or no impact on target muscle tissue.

[0055] MyoAAV-GNDM-m31 demonstrated potent efficacy in dyw mice at significantly lower doses compared to AAV9 (Figures 8A and 8B). In recent years, MyoAAV, a genetically modified muscle-targeting AAV capsid, has emerged as a promising vector for efficient delivery of gene payloads to muscle tissue. MyoAAV is a modified version of AAV9 obtained through targeted evolution, with a 7-amino acid peptide containing an RGD sequence added at position 588. This modification significantly enhances muscle targeting, and is expected to enable viral vector administration at lower doses compared to conventional AAV9 vectors. To evaluate the efficacy of MyoAAV-GNDM-m31, it was administered intravenously at a dose of 2E13vg / kg to 15-day-old (PND15) DyW mice. This dose was significantly lower than the dose used with AAV9-GNDM-m31. MyoAAV 3A was used in this study. PND15 was chosen because it corresponds to a developmental stage in humans under 36 months of age, making it a better fit for the LAMA2-CMD patient population we target. Analysis of the mice after 6 weeks yielded results consistent with previous findings using the AAV9 vector. Specifically, strong expression levels of the GNDM transgene and significant upregulation of LAMA1 mRNA in skeletal muscle tissue were observed, while no effect was observed in non-target tissues such as the liver. Immunofluorescence staining confirmed significant expression of LAMA1 protein in the basement membrane of muscle fibers. Consistent with previous findings, treated dyW mice showed a significant increase in body weight compared to untreated mice, reflecting improvements in overall health and muscle growth. Furthermore, treated mice exhibited a significant improvement in grip strength, providing compelling evidence of improved muscle function after the intervention. Of particular note is the fact that these results were achieved at doses more than five times lower compared to studies using AAV9 vectors. This highlights the superior efficiency and efficacy of the novel MyoAAV capsid in targeting muscle tissue, offering significant advantages over conventional AAV9 vectors in gene therapy applications.

[0056] Systemic administration of MyoAAV-GNDM-c58 was safe and well-tolerated in NHP patients (Figure 9A-9C). While successful epigenetic editing has been demonstrated in mouse models without apparent toxicity, concerns remain regarding safety and efficacy when applying this technology to patients. Despite positive results in mice, concerns have been raised that systemically overexpressing exogenous proteins such as Cas9 in primates could lead to serious immunotoxicity due to the complex immune system and outbred nature of the population. However, no studies have previously investigated these concerns in primates. Furthermore, allometric translation of gene therapy vectors in large animals and humans is known to be problematic. Therefore, in this study, we conducted a non-GLP trial to evaluate the safety and in vivo distribution of our vector in adult cynomolgus monkeys. First, a similar in vitro gRNA screening was performed in primary monkey myoblasts to identify the most potent gRNA, and as a result, gRNA c58 was selected for in vivo evaluation. After one week of standard immunosuppressive treatment, MyoAAV-GNDM-c58 was administered to three female cynomolgus monkeys via peripheral intravenous administration at a dose of 1e14vg / kg (one monkey was excluded from subsequent analysis because seroconversion to AAV was retrospectively confirmed before administration). MyoAAV-GNDM-c58 was well tolerated, no obvious adverse events were observed, and no significant changes in body weight or health status were observed throughout the study period. Blood chemistry tests showed a transient increase in liver enzymes, but these normalized within 2-3 weeks. Other clinicopathological findings were comparable between the treatment and control groups, demonstrating a favorable safety profile for the CRISPR-GNDM vector. Several weeks after administration, serum antibodies against MyoAAV capsid and GNDM protein (Cas9) were observed. The antibody response to GNDM protein was slower and weaker than the antibody response to MyoAAV capsid. Furthermore, a T cell response to GNDM protein was observed by ELISPOT assay, peaking at week 2 and then declining. In other words, both the humoral and cellular immune systems recognized GNDM protein and induced a response. However, lymphocyte infiltration in target muscle tissue was minimal, and no obvious tissue damage was observed. We hypothesize that constitutive expression of GNDM may induce anergy in T cells, rendering these GNDM-specific T cells dysfunctional. This point will be investigated in future studies. These results support the safety of our CRISPR-GNDM construct from an immunological perspective.

[0057] Administration of MyoAAV-GNDM in NHP resulted in broad and selective in vivo distribution within skeletal muscle tissue, demonstrating the success of epigenetic editing as indicated by significant target engagement and upregulation of the LAMA1 gene in muscle tissue (Figure 10). ddPCR analysis of the AAV genome in diverse muscle and non-muscle tissues revealed that MyoAAV-GNDM-cy58 exhibited widespread systemic distribution after a single administration. GNDM expression analysis showed that, due to the muscle-specific promoter used in the vector, GNDM was strongly expressed only in muscle tissue and not in non-muscle tissues such as the liver. Notably, the MyoAAV-GNDM-cy58 vector enhanced GNDM mRNA expression in muscle tissue by up to 60-fold compared to previous NHP datasets using the AAV9 vector (data hidden). These data indicate that GNDM expression remained strongly maintained even 43 days post-administration, despite high transgene expression and the induction of an immune response to the protein. As mentioned above, the success of epigenetic editing in NHP has not been demonstrated until now. Furthermore, from a broader perspective, it had not been investigated whether epigenetic editing approaches like our method could induce potent target gene expression from silenced loci in large animal genomes. Administration of MyoAAV-GNDM-cy58 induced significant levels of LAMA1 mRNA in various muscle tissues of monkeys. To compare the induced LAMA1 mRNA levels with housekeeping genes, LAMA1 mRNA levels were normalized to endogenous HPRT mRNA levels. In all muscle tissues analyzed, the induced LAMA1 levels were approximately 3-6% of endogenous HPRT levels. This represents a significant increase in LAMA1 mRNA, considering that LAMA1 expression in muscle tissue is almost undetectable in untreated animals, and that HPRT genes are highly expressed. Furthermore, LAMA1 / HPRT mRNA levels were elevated in the heart (approximately 0.04), and some LAMA1 mRNA expression was observed in the liver (approximately 0.03). However, these levels did not significantly exceed the endogenous levels in the liver, indicating that MyoAAV-GNDM-cy58-mediated induction of LAMA1 is muscle-specific. This clearly demonstrates that CRISPR-GNDM technology can reactivate gene expression from physiologically silenced loci in large animals.

[0058] Systemic administration of MyoAAV-GNDM in young NHP patients was safe and well-tolerated (Figures 11A and 11B). LAMA2-CMD is a congenital disorder, and its symptoms manifest from birth. Patients initially follow a nearly normal physiological developmental pathway, experiencing body and muscle growth. However, muscle atrophy begins immediately after birth, and early intervention is expected to yield clinically superior results. Therefore, the clinical application of our vector is expected to target infants and children. We extended our study to evaluate the safety and efficacy of MyoAAV-GNDM in 8-month-old NHPs. This age group in NHPs is very similar to the developmental stage of the patient population we are targeting. These juvenile NHPs were administered 5e13vg / kg of MyoAAV-GNDM-cy58. This dose was carefully selected to strike an optimal balance between efficacy and safety for a younger and more vulnerable patient population. We also extended the study period to 13 weeks (in contrast to 6 weeks in adult NHP studies). This allowed for a deeper understanding of the safety, efficacy, and sustainability of MyoAAV-GNDM treatment by observing the treatment effects in more detail over time. Similar to our previous study in 2-year-old NHP, all young animals in this extended 13-week study well tolerated MyoAAV-GNDM treatment, and no toxicity was observed. Histopathological evaluation revealed no adverse macroscopic findings in the tissues examined. Microscopic examination showed minimal mononuclear cell inflammation in the biceps brachii and gastrocnemius muscles, which was considered to be due to mechanical injury rather than treatment. All other microscopic findings were deemed unrelated to AAV administration, given their low incidence and severity, similar findings in the control group, and consistency with expected background findings in cynomolgus monkeys. These findings are consistent with expected background observations in cynomolgus monkeys and further support the safety profile of this treatment.

[0059] Low-dose MyoAAV-GNDM in young NHP patients showed a superior pharmacodynamic profile compared to adults (Figures 12A and 12B). In our analysis of vector copy number (VCN) in various tissues, we observed that the VCN was approximately half the value recorded in previous studies. This is consistent with the fact that the dose used in this study was half the previous dose. Surprisingly, even at this lower dose, GNDM transgene mRNA levels in young NHPs were significantly higher than those in older NHPs across all muscle tissue types. This indicates more effective GNDM transgene expression in young NHPs. Furthermore, high GNDM transgene expression resulted in a significant enhancement of LAMA1 mRNA induction. These findings highlight the need for age-appropriate dosage settings and suggest the possibility of achieving high efficacy at lower doses in younger subjects. [Industrial applicability]

[0060] According to the present invention, the expression of the LAMA1 gene can be upregulated in muscle cells derived from MDC1A patients. Therefore, the present invention is expected to be extremely useful for the treatment and / or prevention of MDC1A. This application is based on U.S. provisional patent applications (No. 63 / 563,050, filed March 8, 2024) and (No. 63 / 641,618, filed May 2, 2024), the contents of which are fully incorporated herein.

Claims

1. Polynucleotides containing the following base sequence: (a) The base sequence encoding a fusion protein of a nuclease-deficient CRISPR effector protein and a transcription activator, and (b) A nucleotide sequence encoding a guide RNA that targets the continuous region represented by Sequence ID No. 8 in the expression regulatory region of the human LAMA1 gene.

2. The base sequence that codes for guide RNA is The base sequence represented by Sequence ID No. 8, or The polynucleotide according to claim 1, comprising (i) a base sequence in which 1 to 6 bases are deleted or added from the 5' end, and / or (ii) a base sequence in which one base is substituted within 9 bases from the 5' end.

3. The polynucleotide according to the claim, wherein the transcription activator is selected from the group consisting of VP64, VP160, VPH, VPR, VP64-miniRTA (miniVR), microVR, and their variants having transcriptional activating ability.

4. The polynucleotide according to claim 3, wherein the transcription activator is miniVR.

5. The polynucleotide according to claim 1, wherein the nuclease-deficient CRISPR effector protein is dCas9.

6. The polynucleotide according to claim 5, wherein dCas9 is dCas9 derived from Staphylococcus aureus.

7. The polynucleotide according to claim 1, further comprising a promoter sequence for a nucleotide sequence encoding a guide RNA and / or a promoter sequence for a nucleotide sequence encoding a fusion protein of a nuclease-deficient CRISPR effector protein and a transcription activator.

8. The polynucleotide according to claim 7, wherein the promoter sequence for the base sequence encoding the guide RNA is selected from the group consisting of the U6 promoter, SNR6 promoter, SNR52 promoter, SCR1 promoter, RPR1 promoter, U3 promoter, and H1 promoter.

9. The polynucleotide according to claim 8, wherein the promoter sequence for the base sequence encoding the guide RNA is a U6 promoter.

10. The polynucleotide according to claim 7, wherein the promoter sequence for the base sequence encoding a fusion protein of a nuclease-deficient CRISPR effector protein and a transcription activator is a ubiquitous promoter or a muscle-specific promoter.

11. The polynucleotide according to claim 10, wherein the ubiquitous promoter is selected from the group consisting of the EFS promoter, the CMV promoter, and the CAG promoter.

12. The polynucleotide according to claim 11, wherein the muscle-specific promoter is selected from the group consisting of the CK8 promoter, myosin heavy chain kinase (MHCK) promoter, muscle creatine kinase (MCK) promoter, synthetic C5-12 (Syn) promoter, and unc45b promoter.

13. A vector comprising a polynucleotide according to any one of claims 1 to 12.

14. The vector according to claim 13, wherein the vector is a plasmid vector or a viral vector.

15. The vector according to claim 14, wherein the viral vector is selected from the group consisting of adeno-associated virus (AAV) vectors, adenovirus vectors, and lentiviral vectors.

16. The vector according to claim 15, wherein the AAV vector is selected from the group consisting of AAV1, AAV2, AAV6, AAV7, AAV8, and AAV9 and their variants (e.g., MyoAAV).

17. A therapeutic or prophylactic agent for MDC1A comprising a polynucleotide according to any one of claims 1 to 12, or a vector containing the same.

18. A method for treating or preventing MDC1A, comprising administering a polynucleotide according to any one of claims 1 to 12, or a vector containing the same, to a subject in need thereof.

19. Use of a polynucleotide according to any one of claims 1 to 12, or a vector containing the same, for the treatment or prevention of MDC1A.

20. Use of a polynucleotide according to any one of claims 1 to 12, or a vector containing the same, in the manufacture of a pharmaceutical composition for the treatment or prevention of MDC1A.

21. A method for upregulating the expression of the human LAMA1 gene in cells, wherein in the cells (c) A fusion protein of a nuclease-deficient CRISPR effector protein and a transcription activator, and (d) Guide RNA targeting the continuous region represented by Sequence ID No. 8 in the expression regulatory region of human LAMA1 A method including expressing a certain substance.

22. Ribonucleotide protein, including the following: (c) A fusion protein of a nuclease-deficient CRISPR effector protein and a transcription activator, and (d) A guide RNA that targets the continuous region represented by Sequence ID No. 8 in the expression regulatory region of the human LAMA1 gene.

23. A kit for upregulating the expression of the human LAMA1 gene, including the following: (e) A fusion protein of a nuclease-deficient CRISPR effector protein and a transcription activator, or a polynucleotide encoding said fusion protein, and (f) A guide RNA or polynucleotide encoding the guide RNA that targets the continuous region represented by Sequence ID No. 8 in the expression regulatory region of the human LAMA1 gene.

24. A method for treating or preventing MDC1A, comprising the steps of administering (e) and (f) below: (e) A fusion protein of a nuclease-deficient CRISPR effector protein and a transcription activator, or a polynucleotide encoding said fusion protein, and (f) A guide RNA or polynucleotide encoding the guide RNA that targets the continuous region represented by Sequence ID No. 8 in the expression regulatory region of the human LAMA1 gene.

25. Use of (e) and (f) below in the manufacture of a therapeutic or prophylactic pharmaceutical composition for MDC1A: (e) A fusion protein of a nuclease-deficient CRISPR effector protein and a transcription activator, or a polynucleotide encoding said fusion protein, and (f) A guide RNA or polynucleotide encoding the guide RNA that targets the continuous region represented by Sequence ID No. 8 in the expression regulatory region of the human LAMA1 gene.

Images