Promoters for gene expression in retinal cells and vector systems containing the same

A retinal cell-specific promoter and vector system addresses the limitations of AAV-based therapies by enabling high-level, tissue-specific gene expression in retinal cells, improving therapeutic efficacy and vector efficiency.

JP2026519396APending Publication Date: 2026-06-16KOREA RES INST OF BIOSCIENCE & BIOTECHNOLOGY

Patent Information

Authority / Receiving Office
JP · JP
Patent Type
Applications
Current Assignee / Owner
KOREA RES INST OF BIOSCIENCE & BIOTECHNOLOGY
Filing Date
2024-04-26
Publication Date
2026-06-16

AI Technical Summary

Technical Problem

Existing AAV-based gene therapies for retinal diseases face limitations due to small packaging capacity and lack of tissue specificity, restricting the use of endogenous promoters and effective targeting of specific retinal cells.

Method used

Development of a retinal cell-specific promoter and vector system with a nucleotide sequence at least 90% identical to SEQ ID NO: 6 or 7, or 100 to 400 nucleotides in length, including enhancers to enhance expression in retinal cells, particularly photoreceptors.

Benefits of technology

The solution enables high-level, tissue-specific gene expression in retinal cells, reducing vector size and enhancing therapeutic efficacy by targeting specific retinal cell types, thus overcoming limitations of current AAV-based therapies.

✦ Generated by Eureka AI based on patent content.

Smart Images

  • Figure 2026519396000001_ABST
    Figure 2026519396000001_ABST
Patent Text Reader

Abstract

The present invention relates to a promoter for the intracellular expression of a gene in retina and a vector system comprising the same. The promoter for the intraretinal expression of a gene according to the present invention and the vector system containing the same have a minimum unit for action on the promoter and can be used to maximize the intraretinal expression of a target protein in retinal cells by maintaining a high expression level of the target gene, unlike conventionally known promoters.
Need to check novelty before this filing date? Find Prior Art

Description

Technical Field

[0001] The present invention relates to a promoter for in - retinal - cell expression of a gene and a vector system containing the same.

Background Art

[0002] Diseases related to retinal degeneration are lesions with high potential for the development of therapeutic agents for adeno - associated virus (AAV) - mediated gene therapy. AAV vectors can mediate long - term gene expression in the retina and induce minimal immune responses, and the potential for gene therapy using these vectors is very high. The retina is a light - sensitive tissue on the back of the eye composed of various cell types including retinal cells, photoreceptor cells, retinal pigment epithelial cells, and retinal ganglion cells. Target cell types and vector delivery pathways for AAV gene therapy vectors can have various effects on disease indications. For example, a phase I clinical trial for age - related macular degeneration uses intravitreal delivery of the vector to transduce retinal ganglion cells, and a recent clinical trial for the treatment of patients with Leber congenital amaurosis type 2, a form of retinitis pigmentosa, uses subretinal delivery of the RPE65 gene to transduce retinal pigment epithelial cells.

[0003] In light of the above - mentioned usefulness, it is necessary to develop new agonists and methods for improving AAV delivery to the eye.

[0004] However, the development of therapeutic agents related to this has been very slow. That is, although one approach to treating diseases is gene therapy (especially AAV - based gene therapy), the therapeutic approach is limited in two major aspects.

[0005] <Firstly, in the case of AAV-based gene therapy for direct application to cells via the retina, the size of usable genes is extremely limited. Specifically, the AAV packaging capacity is limited to 4.7kb, which is insufficient to accommodate endogenous promoters that are typically several kilobits in length, thus posing a significant limitation in vector design.

[0006] Secondly, as mentioned above, various types of cells exist in the retina, but the cells that cause disease can be limited to specific cells. In other words, for disease treatment, the types of cells that require genetic correction or treatment must be identified, and the therapeutic agent must work accordingly. However, the general AAV-based technologies used to date have not shown sufficient efficacy in terms of tissue specificity.

[0007] In other words, designing a vector that includes the appropriate promoter and enhancer within the small size range of AAV's packaging capacity of 4.7kb, and ensuring that such a vector specifically overexpresses the target protein in target cells to achieve sufficient efficacy, is extremely difficult. Therefore, gene therapies developed to date use universal promoters that are expressed in all cells, and therapeutic agents that are specifically expressed in target cells are considered to be extremely limited. Expression in target cells is important as a way to minimize the side effects of gene therapy agents.

[0008] Against this backdrop, the inventors have developed a novel retinal cell-specific, minimized promoter and a vector system containing it, thereby completing the present invention. [Overview of the project] [Problems that the invention aims to solve]

[0009] The present invention aims to provide a promoter having a nucleotide sequence that is at least 90% identical to the sequence of SEQ ID NO: 6 or SEQ ID NO: 7, or a promoter having a length of 100 to 400 nucleotides that includes the sequence of SEQ ID NO: 6 or SEQ ID NO: 7 as a core nucleotide sequence.

[0010] The present invention aims to provide an expression cassette comprising a promoter having a nucleotide sequence that is at least 90% identical to the sequence of SEQ ID NO: 6 or SEQ ID NO: 7, or a promoter having a length of 100 to 400 nucleotides that includes the sequence of SEQ ID NO: 6 or SEQ ID NO: 7 as a core nucleotide sequence.

[0011] The present invention relates to a. a promoter having a nucleotide sequence that is at least 90% identical to the sequence of SEQ ID NO: 6 or SEQ ID NO: 7, or a promoter having a length of 100 to 400 nucleotides that includes the sequence of SEQ ID NO: 6 or SEQ ID NO: 7 as a core nucleotide sequence, b. The objective is to provide an expression cassette containing one enhancer selected from the group consisting of SEQ ID NOs: 12-18 and SEQ ID NOs: 28-31.

[0012] The present invention also aims to provide a vector comprising the promoter and / or expression cassette.

[0013] The present invention also aims to provide an adeno-associated virus (AAV) vector comprising the promoter and / or expression cassette.

[0014] The present invention also aims to provide cells transformed with the expression cassette or a vector containing the expression cassette.

[0015] The present invention also aims to provide a pharmaceutical composition comprising the expression cassette or a vector containing the expression cassette and a pharmaceutically acceptable excipient.

[0016] The present invention also aims to provide a pharmaceutical composition for the prevention or treatment of eye diseases, comprising the expression cassette or a vector containing the expression cassette.

[0017] The present invention also aims to provide therapeutic applications for the expression cassette or vectors containing the same for eye diseases.

[0018] The present invention also aims to provide a method for treating an eye disease, comprising the step of administering the expression cassette or a vector containing the same to a subject requiring it.

[0019] The present invention also aims to provide a method for increasing the expression of a target gene in the retina, comprising the step of administering the expression cassette or a vector containing the same to a target body requiring it. [Means for solving the problem]

[0020] The present invention provides a novel promoter and an expression cassette containing the same, which, due to its short length, is suitable for use in vector systems, such as viral vector systems, particularly AAV vector systems, and can specifically induce gene expression to a high level in retinal cells.

[0021] A "promoter" refers to a regulatory component that directs the transcription of an operably ligated nucleic acid. Promoters can regulate both the rate and efficiency of transcription of an operably ligated nucleic acid. Promoters can also be operably ligated to other regulatory components that enhance ("enhancers") or repress ("repressors") the promoter-dependent transcription of nucleic acids. "Promoter activity" refers to the ability of a promoter to initiate transcription of an operably ligated nucleic acid.

[0022] "Operably linked" means that nucleic acid sequences associate on a single nucleic acid molecule and one action is affected by another. For example, a promoter is operably linked to an encoding sequence if it can affect the expression of such an encoding sequence, i.e., if the encoding sequence is under the transcriptional control of the promoter.

[0023] Thus, the present invention provides a nucleotide sequence having at least 90% identity with the sequence of SEQ ID NO: 6 or SEQ ID NO: 7, or a promoter that is 100 to 400 nucleotides in length and contains the sequence of SEQ ID NO: 6 or SEQ ID NO: 7 as a core nucleotide sequence.

[0024] More specifically, the present invention provides a retinal cell-specific promoter that is a nucleotide sequence having at least 90% identity with the sequence of SEQ ID NO: 6 or SEQ ID NO: 7, or is 100 to 400 nucleotides in length and contains the sequence of SEQ ID NO: 6 or SEQ ID NO: 7 as a core nucleotide sequence.

[0025] Thus, it is possible to provide a sequence having a nucleotide sequence having at least 90% identity with the sequence of SEQ ID NO: 6 or SEQ ID NO: 7 according to the present invention.

[0026] In the present invention, retinal cells are a general term for cells constituting the retina. Retinal cells include photoreceptor cells, retinal ganglion cells, Muller cells, bipolar cells, amacrine cells, horizontal cells and / or retinal pigment epithelial cells, etc., and the retina is constituted centering around these cells.

[0027] The promoter according to the present invention can exhibit a high expression level in retinal cells as a promoter that acts specifically on retinal cells. More specifically, it can exhibit specifically high expression with respect to photoreceptor cells.

[0028] The promoter of the present invention, as a retina-specific promoter, exhibits relevant activity, and when introduced into retinal cells, it can initiate transcription of the nucleic acid to which it is operably ligated to, to a high level of expression. "Retina-specific" is understood to mean a promoter that is primarily active within retinal cells. It should be understood that generally lower expression in other tissues or cells is not entirely excluded.

[0029] The promoter of Sequence ID No. 6 or Sequence ID No. 7 according to the present invention is a promoter sequence that maintains tissue specificity and high expression while reducing the size by a certain level or more compared to conventional RS1 promoter sequences known to be used specifically for photoreceptors. Having a shorter promoter sequence is advantageous because it reduces the overall size (or length) of the vector, particularly in the rAAV genome. This makes it possible to produce rAAV vectors with more efficiently packaged genomes.

[0030] More specifically, the sequence of Sequence ID No. 6 according to the present invention is a region of the GRK1 promoter sequence. Compared to the more specifically known GRK1 promoter region, it has a total of 215 shorter sequences and can exhibit high tissue specificity and high expression levels.

[0031] The sequence of Sequence ID No. 7 according to the present invention is a region of the PDE6B promoter sequence. Compared to the more specifically known PDE6B promoter region, it has a total of 114 shorter sequences and can exhibit high tissue specificity and high expression levels.

[0032] In the present invention, "at least 90% identity" means having at least 90, 91, 92, 93, 94, 95, 96, 97, 98, 99%, or 100% identity.

[0033] Specifically, the promoter of the present invention may be a functional variant having at least 90, 91, 92, 93, 94, 95, 96, 97, 98, 99%, or 100% identity with the sequence of SEQ ID NO: 6 or SEQ ID NO: 7. "Sequence identity" refers to the number (%) of positional matches (homogeneous nucleic acid residues) from the alignment of two nucleotide sequences. Sequence identity is measured by comparing sequences when they are aligned to maximize overlap and homogeneity while minimizing sequence gaps. In particular, sequence identity depends on the lengths of the two sequences and can be measured using any of a number of mathematical whole-or local alignment algorithms.

[0034] A functional variant is one whose essential characteristic is the maintenance of the nucleotide sequence. Generally, variants are very similar overall and identical to the original nucleotide in many regions. The sequence of a variant may differ depending on the nucleotide substitution, deletion, or insertion of one or more nucleotides within the sequence, which does not impair promoter activity. The variant may be the same length as the original sequence, or it may be shorter or longer.

[0035] In the present invention, the "core" region (which may also be referred to in this application as "core sequence," "core nucleotide sequence," "consensus region," or "consensus nucleotide sequence") refers to a central sequence capable of specifically and highly inducing gene expression within retinal cells. The phrase "promoter containing a core nucleotide sequence" should be interpreted as meaning that the promoter has at least a core nucleotide sequence, but may also contain additional components such as additional nucleotide sequences.

[0036] If the sequence is slightly elongated by including additional nucleotides (for example, by generating what is defined in this application as an "extended core" region), this can be referred to as an "extended core region," an "extended core sequence," or an "extended core nucleotide sequence," etc.

[0037] Therefore, a promoter is provided which has a length of 100 to 400 nucleotides and includes the sequence of SEQ ID NO: 6 or SEQ ID NO: 7 as a core nucleotide sequence. Here, the core nucleotide sequence means that the sequence of SEQ ID NO: 6 or 7 mentioned above is included as is, or includes some additional extension sequences within the individual sequence, but includes the entire nucleotide sequence.

[0038] The number of such sequences is not limited, but additional sequences may be included at the 3',5' ends, as long as the number of nucleotides is not more than 400, which is the minimum length required to provide a vector for use in AAV vectors and the like. The aforementioned number of any additional nucleotides includes any integer that can be set within the aforementioned total length of 400 or less.

[0039] That is, based on the sequence of each GRK1 promoter or PDE6B promoter, the sequence may further include at least 10, at least 15, or at least 20 consecutive nucleotides at the 3' end of each of the sequences mentioned above. Also, based on the sequence of each GRK1 promoter or PDE6B promoter, the sequence may further include at least 10, at least 15, or at least 20 consecutive nucleotides at the 5' end of each of the sequences mentioned above.

[0040] The promoter, which has a length of 100 to 400 nucleotides as mentioned above, may preferably have 100 to 350 nucleotides, more preferably 110 to 300 nucleotides. Even more preferably, it may have more than the minimum sequence number of each SEQ ID NO: 6 or SEQ ID NO: 7, but less than 400. It may also have more than the minimum sequence number of SEQ ID NO: 6 or SEQ ID NO: 7, but less than 350. It may also have more than the minimum sequence number of SEQ ID NO: 6 or SEQ ID NO: 7, but less than 300.

[0041] More preferably, the promoter region of Sequence ID No. 6 or Sequence ID No. 7 may further include a 5'UTR region at its 5' end. Specifically, the UTR sequence may be a sequence found upstream (5'UTR) of the GRK1 promoter or PDE6B promoter found in the human genome sequence or a portion thereof. More specifically, the UTR sequence may include lengths of at least 1 bp, 2 bp, 3 bp, 4 bp, 5 bp, 6 bp, 7 bp, 8 bp, 9 bp, 10 bp, 20 bp, 30 bp, 40 bp, 50 bp, 60 bp, 70 bp, 80 bp, 90 bp, 100 bp, 200 bp, 300 bp, 400 bp, 500 bp, 600 bp, 700 bp, 800 bp, 900 bp, 1 Kb, 2 Kb, 3 Kb, 4 Kb, 5 Kb, 6 Kb, 7 Kb, 8 Kb, 9 Kb, and 10 Kb.

[0042] More preferably, the 5'UTR can be optimized for the desired protein expression level. Such an optimized sequence may, but is not limited to, the nucleotide sequence of, for example, SEQ ID NO: 8, SEQ ID NO: 9, or SEQ ID NO: 24.

[0043] Sequence ID 8 is preferred as the 5'UTR region relative to the GRK1 promoter.

[0044] Sequence ID 9 is preferred as the 5'UTR region relative to the PDE6B promoter.

[0045] The addition of such a 5'UTR provides improved efficacy in terms of both tissue specificity and expression efficacy.

[0046] The present invention provides an expression cassette containing a promoter having a nucleotide sequence having at least 90% identity with the sequence of SEQ ID NO: 6 or SEQ ID NO: 7, or a promoter having a length of 100 to 400 nucleotides that includes the sequence of SEQ ID NO: 6 or SEQ ID NO: 7 as a core nucleotide sequence, and a nucleotide that encodes a polypeptide operably linked thereto.

[0047] "Expression cassette" means a nucleic acid preparation containing an encrypted sequence and one or more sequences required for the expression of the encrypted sequence. In particular, one of these regulatory sequences is the promoter of the present invention.

[0048] An expression cassette contains a cryptographic sequence and regulatory sequences prior to (5' unencrypted) and after (3' unencrypted) the cryptographic sequence required for the expression of the selected gene product. Therefore, an expression cassette typically contains a promoter sequence, a cryptographic sequence, and a 3' unencrypted region generally containing a polyadenylation site and / or transcription terminator. An expression cassette may also contain additional regulatory components, such as enhancer sequences, polylinker sequences that facilitate / splice DNA fragments within the vector or signal sequences. Expression cassettes are generally included within vectors to facilitate cloning and transformation.

[0049] The promoter of the present invention is operablely ligated to a heterogeneous nucleic acid. As used in this application, the term "heterogeneous" means a nucleic acid other than the nucleic acid to which the promoter is operablely ligated within a naturally occurring genome.

[0050] In one embodiment, the nucleotides that encode the polypeptide operably linked to the promoter of the present invention encode the target polypeptide. The target polypeptide may be a polypeptide whose expression is desired in retinal cells.

[0051] The target polypeptide may be a therapeutic polypeptide or a reporter protein.

[0052] The target gene may be any gene intended for expression in the retina, preferably in photoreceptor cells.

[0053] In one embodiment, the nucleic acid operably linked to the promoter of the present invention is, that is, a target gene that encodes a therapeutic polypeptide, preferably a therapeutic gene.

[0054] A target gene, preferably a therapeutic gene, means a gene that encodes a therapeutic protein useful for treating a pathological condition. When a therapeutic gene is expressed, it provides a beneficial effect in the cells or tissues in which it is present, or in the patient in whom the gene is expressed. Examples of beneficial effects include alleviation of signals or symptoms of a condition or disease, prevention or suppression of a condition or disease, or conferral of a desirable trait. A therapeutic gene includes a gene that partially or completely corrects a genetic defect in a patient. In particular, a therapeutic gene may be, but is not limited to, a nucleic acid sequence that encodes a protein useful in gene therapy to alleviate a defect caused by the deletion or defect of the protein within the cells or tissues of the subject.

[0055] Examples of therapeutic genes include, but are not limited to, RS1, RP1, Rho, Rom1, SPATA7, PCARE, CRB1, IMPG1, GNAT1, RPGRIP1, OPN1SW, TULP1, ABCA4, GUCA1A, CNGB1, GUCA1B, PRCD, RGR, CDHR1, RP1L, RBP3, PRPH2, IMPG2, PDE6B, RD3, GNB1, OPN1LW, OPN1MW, MYO7A, MAK, USH1C, PROM1, CRX, GUCY2D, NR2E3, OPN3, OPN4, IQCB1, and / or GNGT1.

[0056] The reporter protein is detectable from living retinal cells. Under the regulation of the promoter of the present invention, the expression of the reporter protein is made to specifically detect or identify retinal cells. The reporter protein may be, for example, a fluorescent protein (e.g., GFP), a calcium indicator (e.g., GCamP), luciferase, alkaline phosphatase, β-galactosidase, β-lactamase, horseradish peroxidase, mCherry, and its variants.

[0057] The expression cassette according to the present invention may include one or more undecoded regions (UTRs) or sequences, and more preferably further include a 5'UTR sequence. The UTR sequence may be a sequence found upstream (5'UTR) of the GRK1 promoter or PDE6B promoter found in the human genome sequence or a portion thereof. More specifically, the UTR sequence may include lengths of at least 1 bp, 2 bp, 3 bp, 4 bp, 5 bp, 6 bp, 7 bp, 8 bp, 9 bp, 10 bp, 20 bp, 30 bp, 40 bp, 50 bp, 60 bp, 70 bp, 80 bp, 90 bp, 100 bp, 200 bp, 300 bp, 400 bp, 500 bp, 600 bp, 700 bp, 800 bp, 900 bp, 1 Kb, 2 Kb, 3 Kb, 4 Kb, 5 Kb, 6 Kb, 7 Kb, 8 Kb, 9 Kb, and 10 Kb.

[0058] More preferably, the 5'UTR can be optimized for the desired protein expression level. Such an optimized sequence may, for example, have the nucleotide sequence of SEQ ID NO: 8 or SEQ ID NO: 9, but is not limited thereto. More specifically, the 5'UTR that binds to the promoter of the present invention is preferably the UTR of the gene to be inserted.

[0059] The expression cassette according to the present invention may contain a polyA sequence. The polyA sequence may preferably be a polyA sequence derived from the PCK6 AS1 gene (SEQ ID NO: 35) or a polyA sequence derived from the bovine growth hormone (BGH) gene (SEQ ID NO: 36), and more preferably a polyA sequence derived from the BGH gene.

[0060] The expression cassette according to the present invention preferably includes an operably coupled enhancer. Specifically, it further includes any one enhancer selected from the group consisting of SEQ ID NOs: 12-18 and SEQ ID NOs: 28-31. The present invention also includes sequences that exhibit functional identicalness to the sequences referred to as SEQ ID NOs: 12-18 and exhibit sequence identity of 90% or more.

[0061] More preferably, the present invention provides an expression cassette comprising: a. a nucleotide sequence having at least 95% identity with the sequence of SEQ ID NO: 6 or SEQ ID NO: 7, or a promoter having a length of 100 to 400 nucleotides and containing the sequence of SEQ ID NO: 6 or SEQ ID NO: 7 as a core nucleotide sequence; b. an enhancer selected from the group consisting of SEQ ID NOs: 12 to 18 and SEQ ID NOs: 28 to 31; and c. a nucleotide for encoding a polypeptide operably linked thereto.

[0062] Enhancer sequence elements can be located at any position, such as downstream or upstream of a gene. Preferably, they are located upstream of promoter sequence elements.

[0063] If necessary, the expression cassette may further include a spacer sequence of any number of nucleotides from 1 to 1000. Such spacers may be located between the enhancer and the promoter and may be any sequence that does not affect the action of each sequence. According to one embodiment of the present invention, the spacers may be the nucleotides of SEQ ID NO: 25 or SEQ ID NO: 34.

[0064] The enhancer according to the present invention is derived from the sequence of region 2291-2440 of intron 4 of GRK1, and may be the nucleotide of sequence number 12.

[0065] Furthermore, the aforementioned sequence may be shortened to one or more sequences selected from the group consisting of sequence numbers 13 to 18. In addition, any of these sequences may be repeated at least once, twice, or three times.

[0066] The expression cassette of the present invention may include a promoter and an enhancer and one or more nucleic acids operably ligated thereto. For example, the promoter and enhancer may be operably ligated to nucleic acids that encode one or more therapeutic genes.

[0067] More preferably, the present invention provides an expression cassette comprising: a. a nucleotide sequence having at least 90% identity with the sequence of SEQ ID NO: 6 or SEQ ID NO: 7, or a promoter having a length of 100 to 400 nucleotides and containing the sequence of SEQ ID NO: 6 or SEQ ID NO: 7 as a core nucleotide sequence; b. any one enhancer selected from the group consisting of SEQ ID NOs: 12 to 18 and SEQ ID NOs: 28 to 31; c. the 5'UTR of SEQ ID NO: 8 or SEQ ID NO: 9; and d. a nucleotide that encodes a polypeptide operably linked thereto.

[0068] If necessary, the expression cassette according to the present invention further comprises an RS1 promoter sequence or a sequence having at least 90% identity thereto. More specifically, it may further comprise the promoter region of SEQ ID NO: 22 or a sequence having at least 90% identity thereto. Such a sequence is preferably located downstream of the enhancer, based on the enhancer.

[0069] The expression cassette according to the present invention may preferably include a. a promoter having a nucleotide sequence having at least 90% identity with SEQ ID NO: 7, or a promoter having a length of 100 to 400 nucleotides that includes the sequence of SEQ ID NO: 7 as a core nucleotide sequence; b. an enhancer of SEQ ID NO: 12; and c. a nucleotide that encodes a polypeptide operably linked thereto.

[0070] The expression cassette according to the present invention may preferably include a. a promoter having a nucleotide sequence having at least 90% identity with SEQ ID NO: 7, or a promoter having 100 to 400 nucleotides in length that includes the sequence of SEQ ID NO: 7 as a core nucleotide sequence; b. an enhancer for SEQ ID NO: 12; c. the 5'UTR for SEQ ID NO: 9; and d. a nucleotide that encodes a polypeptide operably linked thereto. More specifically, the 5'UTR that binds to the promoter of the present invention is preferably the UTR of the gene to be inserted.

[0071] The expression cassette according to the present invention may preferably include a. the RS1 promoter of SEQ ID NO: 22 or a nucleotide sequence having at least 90% identity thereto; b. the enhancer of SEQ ID NO: 12; c. a nucleotide sequence having at least 90% identity with SEQ ID NO: 7, or a promoter having 100 to 400 nucleotides in length that includes the sequence of SEQ ID NO: 7 as a core nucleotide sequence; d. the 5'UTR of SEQ ID NO: 9; and e. a nucleotide that encodes a polypeptide operably linked thereto. Here, the enhancer may be located between the RS1 promoter of SEQ ID NO: 22 and the PDE6B promoter sequence of SEQ ID NO: 7, and spacers may also be further included between these sequences. More specifically, the 5'UTR bound to the promoter of the present invention is preferably the UTR of the gene to be inserted.

[0072] The expression cassette according to the present invention may preferably include a. a promoter having a nucleotide sequence having at least 90% identity with SEQ ID NO: 7, or a promoter having a length of 100 to 400 nucleotides that includes the sequence of SEQ ID NO: 7 as a core nucleotide sequence; b. enhancers of SEQ ID NOs: 30 to 31; c. the 5'UTR of SEQ ID NO: 24; and d. a nucleotide that encodes a polypeptide operably linked thereto. More specifically, the 5'UTR that binds to the promoter of the present invention is preferably the UTR of the RS1 gene (SEQ ID NO: 24).

[0073] The expression cassette can highly express nucleotides that encode polypeptides specifically and operably linked to photoreceptors.

[0074] The present invention also provides a vector comprising the promoter and / or expression cassette mentioned above.

[0075] The term "vector" refers to a nucleic acid molecule used as a vehicle for transmitting genetic material, and in particular, for transmitting nucleic acids into host cells in vitro or in vivo. Vectors include, but are not limited to, plasmids, phasmids, cosmids, transportable elements, viruses, and artificial chromosomes (e.g., YACs).

[0076] Preferably, the vectors of the present invention are vectors suitable for use in gene or cell therapy, and are particularly suitable for targeting retinal cells, more specifically, photoreceptor cells.

[0077] The vector of the present invention is preferably a viral genome vector that includes certain elements required to establish the expression of a target polypeptide in a host cell, such as a promoter, for example, the promoter of the present invention, an ITR, a ribosome-binding element, an enhancer, a selection marker, an intron, a polyA signal, and / or an origin of replication.

[0078] In some embodiments, the vector is Moloney murine leukemia virus vector (MoMLV), MSCV, SFFV, MPSV or SNV, lentivirus vector (e.g., derived from human immunodeficiency virus (HIV), simian immunodeficiency virus (SIV), feline immunodeficiency virus (FIV), bovine immunodeficiency virus (BIV) or equine infectious anemia virus (EIAV)), adenovirus (Ad) vector, adeno-associated virus (AAV) vector, anellovirus, Simian virus 40 (SV-40) vector, bovine papillomavirus vector, Epstein-Barr virus, herpesvirus vector, vaccinia virus vector, Harvey murine sarcoma virus vector, murine mammary tumor virus vector, Rous sarcoma virus This is a virus vector that originates from a virus vector.

[0079] In a specific embodiment, the vector is a retroviral vector, preferably a lentiviral vector or a nonpathogenic parvovirus.

[0080] As is well known in the art, a suitable sequence can be introduced into the vector of the present invention, such as an AAV ITR for AAV vectors or an LTR for lentiviral vectors, in order to obtain a functional viral vector using a special viral vector considered for use.

[0081] In some embodiments, the vector is a nonviral vector. Nonviral vectors are broadly classified into cationic polymers and cationic liposomes. Cationic polymers refer to polymers containing cations that are artificially synthesized or naturally formed, and cationic lipid particles refer to artificially manufactured phospholipid vesicles having a bilayer membrane. Nonviral vectors include, but are not limited to, lipid nanoparticles (LNPs), polymer nanoparticles (PNPs), exosomes, and virus-like particles (VLPs). The nonviral vectors can be delivered into cells by any method known in the art to which the present invention belongs, including calcium phosphate coprecipitation, liposome transfection, cell fusion, receptor-transduction gene transfer, naked DNA injection, electroporation, and biological ballistic flight or molecular acceleration.

[0082] In a preferred embodiment, the vector is an AAV vector.

[0083] Human parvovirus adeno-associated virus (AAV) is a naturally non-replicating dependovirus that can integrate into the genome of infected cells and establish potential infection. AAV vectors are known as safe vectors because most (>99%) of the therapeutic genes transmitted into the nucleus are not inserted into the cell's genetic makeup but are expressed in transient expression for extended periods. In the case of wild-type AAV (wtAAV), the Rep gene can be triggered by helper viruses such as herpes simplex virus (HSV) and adenovirus (Ad), enabling in vivo / intracellular replication. However, recombinant AAV (rAAV) used for therapeutic purposes has the Rep gene removed and is used as an AAV non-replicating viral vector. Furthermore, while the Rep gene of wtAAV is known to be able to be inserted with a low probability (<0.01%) into a specific site in the human genome called AAVS1 located on human chromosome 19 (19ql3.3-qter), in the case of rAAV, the Rep gene is removed from this region to ensure safety. Therefore, AAV has attracted considerable interest as a potential vector for human gene therapy. Among the desirable characteristics of the virus are its absence from certain human diseases, its ability to infect both dividing and non-dividing cells, and the wide range of cell lines from which it can be induced, derived from different tissues.

[0084] As used in this application, the term "AAV vector" means a polynucleotide vector comprising at least one AAV terminal inverted repeat (ITR), preferably one or more heterologous sequences (i.e., nucleic acid sequences not derived from AAV) flanked by two ITRs. When present in a host cell, such an AAV vector can be replicated and packaged within an infectious viral vector particle that expresses AAVrep and cap gene products (i.e., AAVRep and Cap proteins) and is infected with a suitable helper virus (or expresses a suitable helper function).

[0085] The term "inverted terminal repeat" or "ITR" is a well-known term in the art and refers to a relatively short sequence found at the ends of a viral genome that exists in a contralateral orientation. An "AAV inverted terminal repeat (ITR)" is a nearly 145-nucleotide sequence present at both ends of a natural single-stranded AAV genome. The outermost 125 nucleotides of an ITR exist as one of two alternating orientations, creating heterogeneity between different AAV genomes and between the two ends of a single AAV genome. The outermost 125 nucleotides also contain several shorter, self-complementary regions that allow for intra-strand base pairing occurring within the ITR site. The AAV ITR for use in the vector of this invention may have a wild-type nucleotide sequence or can be modified by insertion, deletion, or substitution. The serotype of the inverted terminal repeat (ITR) of an AAV vector may be selected from any known human or non-human AAV serotype.

[0086] When an AAV vector is introduced into a larger polynucleotide (e.g., within a chromosome or into another vector such as a plasmid used for cloning or phenotypic infection), the AAV vector can be replicated and capsidated in the presence of AAV packaging function and suitable helper function, and can be referred to as a “rescue” “pro-vector.” The AAV vector of the present invention may include, but is not limited to, a plasmid, a linear artificial chromosome complexed with lipids, encapsulated within a liposome, or a viral particle, such as a linear artificial chromosome capsidated within an AAV particle, and may be any one of a number of other forms.

[0087] The promoter or expression cassette of the present invention can be introduced into the vector by any method known to experts.

[0088] The vector of the present invention can be packaged within a viral capsid that generates a "viral particle." Therefore, the present invention also relates to a viral particle containing the vector of the present invention.

[0089] In a particular embodiment, the vector is an AAV vector, packaged within an AAV-derived capsid, to produce an "adeno-associated virus particle" or "AAV particle." Thus, as used herein, the term "AAV particle" means a viral particle composed of at least one AAV capsid protein and a capsidized AAV vector genome.

[0090] The capsid serotype determines the tropic range of AAV particles.

[0091] Numerous serotypes of adeno-associated virus (AAV) are currently identified, including 12 human serotypes and more than 100 serotypes from non-human primates. Other currently used AAV serotypes include, but are not limited to, AAV1, AAV3, AAV4, AAV5, AAV6, AAV7, AAV8, AAVrh8, AAV9, AAV10, AAVrh10, AAV11, AAV12, AAVrh74, and AAVdj. Furthermore, examples of non-naturally processed mutants may include AAV2.7m8, AAVLK03, AAV-Spark9001, AAV-R100, AAV-C102, AAV-A101, AAVr3.45, AAV-PHP.eB, AAV-PHP.S, AAV-retro, and AAV-QuadYF, and preferably AAV2.7m8, AAVLK03, AAV-Spark9001, AAV-R100, and AAV-C102. In particular, the capsid protein may be a mutant containing one or more amino acid substitutions that improve the phenotypic induction efficiency.

[0092] Different AAV serotypes are used to optimize the transduction of specific target cells or target-specific cell types within specific target tissues (e.g., retinal cells). AAV particles may contain viral proteins and viral nucleic acids of the same serotype or any natural or artificial sequence variants of AAV. For example, AAV particles may contain the AAV2 capsid protein and at least one, preferably two, AAV2 ITRs. Any combination of AAV serotypes for the production of AAV particles is provided herein, each combination as expressed and described herein.

[0093] AAV viruses can be processed using conventional molecular biology techniques, allowing for optimization of these particles for cell-specific delivery of nucleic acid sequences, minimizing immunogenicity, adjusting stability and particle lifetime, effective degradation, and precise delivery to the nucleus.

[0094] Instead of using natural AAV serotypes, artificial AAV serotypes containing, but not limited to, AAVs with non-naturally occurring capsid proteins can be used in the context of this invention. Such artificial capsids can be generated by a preferred technique using a selected AAV sequence (e.g., a fragment of the VP1 capsid protein) combined with a heterologous sequence that can be obtained from a non-AAV virus source or from different selected AAV serotypes that are discontinuous sites of the same AAV serotype from a non-viral source. The artificial AAV serotype may, but is not limited to, a chimeric AAV capsid or a mutated AAV capsid.

[0095] A chimeric capsid comprises a VP capsid derived from at least two different AAV serotype-derived VP capsid proteins, or at least one chimeric VP protein that encapsulates at least two AAV serotype-derived VP protein regions or domains.

[0096] Capsid proteins can also be mutated to enhance their phenotypic efficacy. Mutant AAV capsids can be obtained by error-prone PCR and / or peptide insertion, or from inserted capsid deformations involving one or more amino acid substitutions. In particular, mutations can be produced at one or more tyrosine residues of native or non-native capsid proteins (e.g., VP1, VP2, or VP3). Preferably, the mutated residue is a surface-exposed tyrosine residue. Exemplary mutations include, but are not limited to, phenylalanine substitutions to tyrosine such as Y252F, Y272F, Y444F, Y500F, Y700F, Y704F, Y730F, Y275F, Y281F, Y508F, Y576F, Y612G, Y673F, and Y720F.

[0097] In a preferred embodiment, the AAV particles include a capsid derived from AAV2-. In this embodiment, the capsid may include phenylalanine substitutions for one or more tyrosines, and preferably includes a Y444F substitution.

[0098] Numerous methods for the production of viral particles, including parasympathetic infection, stable cell line production, and infectious hybrid virus production systems, including adenovirus-AAV hybrids, herpesvirus-AAV hybrids, and baculovirus-AAV hybrids, and in particular AAV particles, are known in the art.

[0099] The necessary elements for producing AAV virus particles are: For animal cell line-based applications, the following are required: 1) an animal cell line such as HeLa, A549, CHO, or HEK293 cells; 2) a helper plasmid encoding adenovirus genes E4, E2A, VA, or a helper virus such as adenovirus (Ad) or herpesvirus (HSV); 3) AAVrep and cap genes and gene products; 4) at least one AAV ITR sequence, for example, a nucleic acid in which the nucleotide sequence of a therapeutic gene or reporter protein between ITR sequences is coded by the vector of the present invention; and 5) an AAV production-compatible medium and culture medium components optimized for adherent or suspension cell culture.

[0100] For insect cell line-based formulations, the following are required: 1) an SF9 or SF9-derived insect cell line; 2) a baculovirus or baculovirus-derived virus capable of genetic transduction into SF9; 3) a baculovirus or baculovirus-derived virus containing Rep, Cap genes, ITR-therapeutic gene / reporter protein coding, and E4, E2A, and VA information of a helper plasmid, which can be transduced into two, three, or more vectors; and 4) an AAV production-compatible medium and culture medium components optimized for suspension cell culture of SF9 or SF9-derived insect cells.

[0101] More preferably, the AAV particles may include the vector and AAV-derived capsid according to the present invention.

[0102] The present invention also relates to isolated host cells transformed or phenotypic infected with the expression cassette, vector, or viral particles of the present invention.

[0103] The host cell may be an animal cell, plant cell, bacterial cell, or yeast. Preferably, the host cell is a mammalian cell or insect cell. More preferably, the host cell is a human cell.

[0104] In a preferred embodiment, the host cells are human retinal cells.

[0105] The expression cassettes or vectors of the present invention include, but are not limited to, calcium phosphate-DNA precipitation, DEAE-dextran phenotypic infection, electroporation, microneedle injection, biolistic injection, lipid infection, or viral infection, and can be maintained in an ectopic form within host cells or integrated into the genome.

[0106] In a preferred embodiment, the expression cassette or vector of the present invention is transfected into host cells, preferably using the viral particles of the present invention, and more preferably using the AAV particles of the present invention.

[0107] The present invention also provides a composition for increasing the expression of a target gene in the retina, comprising the expression cassette, vector, viral particles, or cells of the present invention. Preferably, the present invention provides a composition for increasing the expression of a target gene in photoreceptor cells, comprising the expression cassette, vector, viral particles, or cells of the present invention.

[0108] The present invention also relates to a pharmaceutical composition comprising the expression cassette, vector, viral particles, or cells of the present invention.

[0109] Such compositions comprise a therapeutically effective amount of a therapeutic formulation (the expression cassette, vector, viral particle, or cell of the present invention) and a pharmaceutically acceptable excipient. As used herein, the term “pharmaceutically acceptable” means approved by a regulatory body or recognized pharmacopoeia, such as the European Pharmacopoeia, for use in animals and / or humans. The term “excipient” means a diluent, adjuvant, carrier, or vehicle with which the therapeutic formulation is administered.

[0110] Pharmaceutically acceptable excipients, as well as those well known in the art, are relatively inert substances that facilitate the administration of pharmacologically effective substances and can be supplied as liquid solutions or suspensions, as emulsions, or as solids suitable for dissolving or suspending in liquid immediately before use. For example, excipients can provide form or consistency, or act as diluents. Suitable excipients include, but are not limited to, stabilizers, wetting and emulsifying agents, salts for altering osmotic pressure, encapsulating agents, pH buffers, and buffering agents. Such excipients also include any pharmaceutical formulation suitable for direct delivery to the eye that can be administered without excessive toxicity. Pharmaceutically acceptable excipients include, but are not limited to, sorbitol, any of the various tween compounds, and liquids such as water, saline solution, glycerol, and ethanol. This may include pharmaceutically acceptable salts, such as inorganic salts of hydrochlorides, hydrobromids, phosphates, and sulfates; and organic salts of acetates, propionates, malonates, and benzoates. A complete discussion of pharmaceutically acceptable excipients is available in Remington's Pharmaceutical Sciences, 15th Edition.

[0111] Preferably, the composition is formulated for administration, particularly by intraocular injection, e.g., subretinal and / or intravitreous administration. Therefore, the composition can be combined with pharmaceutically acceptable excipients such as saline solution, Ringer's balanced salt solution (pH 7.4).

[0112] The pharmaceutical compositions described herein may be packaged in single-unit doses or multiple-dose forms.

[0113] In one embodiment, the pharmaceutical composition comprises the vector or viral particles of the present invention, more preferably the AAV vector or particles.

[0114] In other embodiments, the pharmaceutical composition comprises host cells of the present invention, preferably human host cells of the present invention transformed or transfected with the expression cassette, vector, or viral particles of the present invention, preferably AAV particles.

[0115] Compositions optionally containing host cells can be frozen for storage at any temperature suitable for cell storage. For example, cells can be frozen at approximately -20°C to -80°C or some other suitable temperature. Cryogenically frozen cells, when stored in appropriate containers and prepared for storage, can reduce the risk of cell damage and maximize the tendency of cells to withstand thawing. Alternatively, cells can be maintained at room temperature under refrigeration, for example, approximately 4°C.

[0116] The amount of pharmaceutical composition to be administered can be measured by a standard process that is well known to the skilled practitioners in the art.

[0117] The patient's physiological data (e.g., age, body size, and weight) and the type and severity of the disease being treated should be considered in determining the appropriate dosage.

[0118] The pharmaceutical compositions of the present invention can be administered in single or multiple doses.

[0119] In a special embodiment, the pharmaceutical composition comprises the virus particles of the present invention, and each unit dose is 10 8 ~10 13 Virus particles, preferably 10 9 ~10 12 It contains particles of the form.

[0120] The pharmaceutical composition may also contain one or more additional active ingredients such as corticosteroids, antibiotics, analgesics, immunosuppressants, trophic factors, or any combination thereof.

[0121] The present invention provides a pharmaceutical composition for the prevention or treatment of eye diseases comprising an expression cassette or a vector containing an expression cassette according to the present invention.

[0122] In additional aspects, the present invention also, -A pharmaceutical composition of the present invention for use in the treatment of eye diseases. - Expression cassette, vector, viral particle or host cell of the present invention for use in the treatment of eye diseases - Uses of the expression cassette, vector, viral particle or host cell of the present invention for the manufacture of pharmaceuticals for the treatment of eye diseases, and -The present invention relates to a method for treating an eye disease, comprising administering a therapeutically effective amount of the pharmaceutical composition of the present invention to a subject in need thereof.

[0123] - A method for treating an eye disease, comprising the step of administering an expression cassette or a vector containing the same to a subject requiring it.

[0124] - A method is provided to increase the expression of a target gene in the retina, comprising the step of administering an expression cassette or a vector containing the same to a target body that requires it. Preferably, a method is provided to increase the expression of a target gene in photoreceptor cells, comprising the step of administering an expression cassette or a vector containing the same to a target body that requires it.

[0125] - A method is provided for increasing the expression of a target gene in retinal cells, comprising the step of treating retinal cells ex vivo and / or in vitro with an expression cassette or a vector containing the same. Preferably, the retinal cells are photoreceptor cells.

[0126] In one embodiment, the eye disease is a retinal disease.

[0127] Examples of retinal diseases include retinitis pigmentosa (RP), including X-chromosome-associated, recessive, dominant, and sporadic types; rod-cone dystrophy; Usher's syndrome; Stargardt's disease; rod-cone dystrophy; cone dystrophy; total color blindness; blue cone monochromacy; enhanced S-cone syndrome; rod dystrophy; choroideremia; Leber's congenital amaurosis; and juvenile X-chromosome linked retinal schizophrenia. retinoschisis;JXLR), fundus albipunctatus, retinitis punctata albescens, fleck retina of Kandori, bietti crystalline retinal dystrophy, fenestrated sheen macular dystrophy, adult-onset foveomacular vitelliform dystrophy), Batten's disease, congenital stationary night blindness, familial exudative vitreoretinopathy;FEVR), ocular albinism, oculocutaneous albinism, fovea hypoplasia, abetalipoproteinemia, Stickler syndrome, retinal dystrophy (Bothnia type), crystalline maculopathy (drug-related, hyperoxaluria, cystinosis, Sjögren-Larsson syndrome), West African crystalline maculopathy, solar retinopathy, talc retinopathy, diabetic retinopathy, sickle cell retinopathy, macular telangectasia, Eales disease Drug-induced macular disease, peripheral retinoschisis, central / branch retinal artery occlusion (CRAO / BRAO), central / branch retinal vein occlusion (CRVO / BRVO), hemorrhagic occlusive retinal vasculitis (HORV), drug-induced macular disease including chloroquine, hydroxychloroquine, phenothiazine, quinine sulfate, thioridazine, clofazimine, chlorpromazine, deferoxamine, chloroquinin derivatives, cisplatin, carmustine, clofazimine and vigabatrin; crystallin-induced macular disease including tamoxifen, talc, canthaxanthin, methoxyflurane and nitrofurantoin; cystoid macular edema including epinephrine, latanoprost and nicotinic acid edema;CME); progressive outer retinal necrosis;PORN), acute retinal necrosis (ARN), CMV-retinitis, sarcoidosis, acute syphilitic posterior placoid chorioretinitis, tuberculosis chorioretinitis, toxoplasmic retinochoroiditis, posterior uveitis and retinal vasculitis, intermediate uveitis, parsplanitis + / - CME, endophthalmitis (anterior and / or posterior), posterior scleritis, masquerade syndrome, multifocal choroiditis and panuveitis This includes, but is not limited to, panuveitis (MCP), punctate inner choroidopathy (PIC), birdshot retinochoroidopathy, retinitis pigmentosa, white punctate retinopathy, acute macular neuroretinopathy (AMN), and acute zonal occult outer retinopathy (AZOOR).

[0128] As used in this application, the terms “treat,” “treat,” or “treat” mean all actions intended to alleviate a patient’s health condition, such as the treatment, prevention, prevention, and delay of a disease. In certain embodiments, such terms mean the alleviation or elimination of a disease or symptoms associated with a disease. In other embodiments, such terms mean minimizing the spread or exacerbation of a disease that results from administering one or more therapeutic agents to a subject having such a disease.

[0129] In particular, the term “treatment of eye disease” may refer to a treatment that provides improved vision, prevents the progression of the disease to overall blindness, prevents the spread of damage to undamaged eye cells, improves damage in damaged eye cells, prevents the development of retinal damage, or helps eyes with mild or advanced disease. In some embodiments, the term refers to preventing, reducing, or halting retinal cell degeneration by providing therapeutic proteins that correct a patient’s genetic defect.

[0130] "Therapeutic effective dose" refers to the amount of the pharmaceutical composition of the present invention administered to a subject sufficient to constitute a treatment for eye diseases as defined above.

[0131] In the method of the present invention, the expression cassette, vector, and / or pharmaceutical composition of the present invention are preferably administered intraocularly, more preferably subretinal or intravitreousally.

[0132] The method of the present invention may also include administering at least one additional therapeutic agent to a subject. In particular, the therapeutic agent may be selected from the group consisting of corticosteroids, antibiotics, analgesics, immunosuppressants, or nutritional elements, or any combination thereof.

[0133] The compositions of the present invention can be administered before or after a disease has symptoms, for example, before or after partial or complete degeneration of retinal cells and / or before or after partial or complete loss of vision.

[0134] The present invention also relates to non-human animal models comprising the expression cassette, vector, viral particle, or host cell of the present invention.

[0135] Such animal models can be used for in vivo studies of retinal cell function. When using the promoter, cassette, vector, or viral particles of the present invention, it is possible to identify or track retinal cells, or monitor their activity, for example, by expressing a reporter protein or voltage or calcium-sensitive protein.

[0136] Non-human animal models can also be used as screening methods to identify or select pharmaceutical formulations that act on retinal cells.

[0137] Preferably, the non-human animal model is a mammal, more preferably a primate, rodent, rabbit, or miniature pig. The promoter, expression cassette, or vector can be maintained in episodic form within the cell of the model or integrated into its genome.

[0138] Methods for producing transduced animals that express a target nucleic acid sequence by transfecting or transforming animal cells, or by controlling them with a selected promoter, i.e., the promoter of the present invention, are well known to experts and can be readily adopted depending on the cells and animals.

[0139] All characteristics and / or all steps of all methods or processes described herein (including all attached claims, abstract and drawings) may be combined with any of the aforementioned characteristics and / or steps in any combination, except for any combinations in which at least some of such characteristics and / or steps are mutually exclusive.

[0140] All patents, patent applications, provisional applications, and publications mentioned or cited herein, including all drawings and tables, are incorporated herein by reference in their entirety to the extent that they do not conflict with the express teachings herein.

[0141] The following examples are provided for illustrative purposes only and are not limited thereto. [Effects of the Invention]

[0142] The promoter for the intraretinal expression of a gene according to the present invention and the vector system containing the same have the minimum unit for action on the promoter and, unlike promoters conventionally known in retinal cells, can be used to maximize the intraretinal expression of a target protein by maintaining a high expression level of the target gene. [Brief explanation of the drawing]

[0143] For a better understanding of the present invention and to illustrate how its embodiments can be put into practice, references to the accompanying drawings are made as examples.

[0144] [Figure 1] The results of confirming the Gaussia Luciferase intensity of candidate promoters for expression cassettes intended for overexpression in retinal cells are shown. [Figure 2] (A) The design of expression cassettes containing the GRK1 promoter and PDE6B promoter selected from the candidate promoter group, and (B) the results of confirming their Gaussia Luciferase intensity in HEK293FT and Y79 cells are shown. IRBBe was used as the enhancer. [Figure 3] (A) The GRK1-derived enhancer sequence ((GRK1e)) was selected as the IRBP enhancer (IRBPe) from a group of novel enhancer candidates. An expression cassette was designed by binding it to the GRK1 promoter and PDE6B promoter selected in Figure 2, and (B, C) the results of confirming the Gaussia Luciferase intensity in HEK293FT, WERI-RB1, and Y79 cells are shown. [Figure 4](A) The GRK1 promoter and PDE6B promoter were simply inserted into a well-known photoreceptor-specific expression cassette (RS1 / IRBPe / RS1), and (B, C) the changes in relative tissue-specific expression efficiency were confirmed in HEK293FT, WERI-RB1, and Y79 cells. [Figure 5] (A) The N-terminus was removed from a well-known photoreceptor-specific expression cassette (RS1 / IRBPe / RS1), and the selected (GRK1e-PDE6B cassette shown in Figure 3) was inserted. (B) The results of confirming the expression effect of the expression cassette system in photoreceptor cells 661W are shown. [Figure 6] (A) Vectors were designed to confirm the increase and decrease in expression associated with the repetition of certain sequences in the GRK1-derived enhancer (GRK1e) sequence, and the results of confirming the expression effects in HEK293FT, (C) 661W, and (D) rMC1 cells are shown. [Figure 7] (A) A vector was designed in which the polyA signal sequence in the expression system shown in Figure 6 was replaced with a sequence derived from the bovine growth hormone gene. (B) The results of confirming the expression effect in HEK293FT, (C) MIO-M1, and (D) 661W cells are shown. [Figure 8] (A) The expression cassette selected in Figure 6 was packaged with adenovirus serotype 8, and the results of confirming the expression effect in the retina of wild-type mice by immunofluorescence staining are shown. (B) Results after intravitreous injection. (C) Results after subretinal injection. [Figure 9] Figure 8 shows the results of packaging the expression cassette system according to the present invention with AAVserotype 8 in a sample as shown, and confirming the expression effect in wild-type mice. (A) A figure showing an eyelid image using SLO (Scanning laser ophthalmoscopy). (B) A figure showing the quantified results in a graph. [Modes for carrying out the invention]

[0145] The present invention will be described in more detail below with reference to examples. However, these examples are for illustrative purposes only, and the scope of the present invention is not limited to these examples.

[0146] Example 1: Cell culture and maintenance HEK293FT (R70007, ThermoFisher), Y79 (HTB-18, ATCC), WERI-RB1 (HTB-169-ATCC), rMC-1 (ENW001, Kerafast), MIO-M1 (RPID:CVCL_0433, provided by Prof. G. Astrid Limb, Institute of Ophthalmology, London, UK), and 661W (provided by Prof. Muayyad Al-Ubaidi, University of Houston) were inoculated and cultured in 100mm diameter flask dishes at 37°C and 5% carbon dioxide concentration. Subculturing was performed at 2-3 day intervals with inoculations in a 1:5 ratio. HEK293FT, rMC-1, and 661W were cultured in DMEM and high glucose (Gibco, 11995-065), Y79 and WERI-RB1 were cultured in RPMI 1640 (Gibco, 31800-022), and MIO-M1 was cultured in DMEM and high glucose (Gibco, 11995-065) supplemented with 1% Glutamax (Gibco, 35050061). All culture media used were supplemented with 10% FBS (Gibco, 12483020) and 1% PS (penicillin / streptomycin, Gibco, 15140122).

[0147] Example 2: Selection of promoter types for the introduction of novel promoter sequences To select retina-specific promoters, we investigated genes specifically expressed in retinal tissue. For this purpose, we selected types of promoters capable of functioning as retina-specific promoters. More specifically, we considered PDE6B, GRK1, RHO, ABCA4, RLBP1, GUCY2F, RBP3, and RS1 promoters as candidate groups, confirmed Gaussia luciferase expression, and selected a group of promoters that were likely to exhibit high expression levels.

[0148] More specifically, the coding sequence for Gaussia luciferase and the PCK6 AS1 poly A signal sequence were inserted into the 3' end of the promoter mentioned above. The resulting vectors were then transmitted to HEK293FT cells using 500 ng each of Lipofectamine 2000 (11668019, Invitrogen). As a control, 500 ng of a vector expressing firefly luciferase via the SV40 promoter was simultaneously transmitted. After 24 hours, the intensity of each luciferase was quantified, and the expression changes were confirmed by dividing the Gaussia luciferase intensity by the firefly luciferase intensity.

[0149] The results are shown in Figure 1, and the promoters that can significantly increase expression levels were identified as PDE6B and GRK1.

[0150] Furthermore, the promoter sequences of the PDE6B and GRK1 genes have been elucidated with relatively high accuracy, and these promoter sequences are known to contain some 5'-UTR sequences. Considering this, subsequent experiments were conducted using PDE6B and GRK1, which have high potential for development as promoters.

[0151] Example 3: Promoter Optimization Progress To optimize the function and length of the promoter, various versions of the promoter were created. Promoter designs focused on promoter sequences that included or did not include the 5'-UTR of GRK1 and PDE6B. The 3' end of these promoters was then fitted with the encrypted Gaussia Luciferase sequence and the PCK6 AS1 poly A signal sequence.

[0152] Specifically, the designed sequence-related information is shown in Table 1 and Figure 2(A) below.

[0153] [Table 1]

[0154] As mentioned above, we designed the expression cassette sequence for use in AAV to include the enhancer, promoter, and 5'UTR sequence. In particular, in this experiment, we used IRBP as a known enhancer to confirm the characteristics of the promoter.

[0155] The prepared vectors were transmitted to HEK293FT and Y79 cells using 500 ng each of Lipofectamine 2000. As a control, 500 ng of a vector expressing firefly luciferase via the SV40 promoter was simultaneously transmitted. After 24 hours, the intensity of each luciferase was quantified, and the expression changes were confirmed by dividing the Gaussia luciferase intensity by the firefly luciferase intensity.

[0156] The results are shown in Figure 2(B), confirming that both the GRK1 and PDE6B promoters according to the present invention exhibit expression increase efficiencies above a predetermined level in HEK293FT Y79 cells. In particular, the efficacy of the PDE6B promoter was confirmed to be superior.

[0157] Furthermore, we confirmed that including the 5'UTR sequence resulted in improved expression levels in both cases, and therefore, we designed the sequence to include both in the promoter sequence.

[0158] Example 4: Enhancer Optimization Progress Since the desired therapeutic efficacy can be maximized when the expression level in retinal cells and other cells is very high, the enhancer was modified to further optimize the increase in expression levels.

[0159] Specifically, the experiment was conducted by designing an expression cassette in a manner similar to that of Example 3, but replacing the IRBP enhancer with a GRK1 enhancer. The specific vector design is shown in Table 2 and Figure 3(A).

[0160] [Table 2]

[0161] Experiments were conducted in HEK293FT, Y79, and WERI-RB1 cells to confirm changes in Gaussia Luciferase expression according to the method described in Example 3.

[0162] The results are shown in Figures 3(B) and (C), confirming that when the GRK1 enhancer (SEQ ID NO: 12) is used instead of the commonly used IRBP enhancer, a significantly improved expression level is observed.

[0163] Therefore, the GRK1 enhancer was used as the primary enhancer for subsequent experiments.

[0164] Furthermore, in order to optimize the GRK1 enhancer, sequences SEQ ID NOs. 13-18 and 28-31 were designed separately as components of it. After replacing only the enhancer using the same method as the promoter mentioned above, a novel expression cassette was fabricated by combining them.

[0165] Example 5: Fabrication of a combined RS1 promoter moiety expression cassette for improved tissue specificity The AAV8-scRS1 / IRBP-hRS1 vector is a vector system manufactured during the course of a clinical trial registered as NCT02317887, and is known as a vector intended for photoreceptor-specific expression. However, this vector system requires high-dose administration, which can lead to inflammatory responses, or it may not exhibit sufficient efficacy at low doses.

[0166] Therefore, we designed an expression cassette with improved expression characteristics by using GRK1 and PDE6B promoters designed to exhibit overexpression properties. Specifically, we attempted to verify the efficacy of changing the sequence corresponding to hRS1 in the GRK1 and PDE6B promoters based on the scRS1 / IRBP-hRS1 sequence.

[0167] More specifically, an expression cassette was designed using a method similar to that of Example 3, and this is shown in Table 3 and Figure 4(A).

[0168] [Table 3]

[0169] Experiments were conducted in HEK293FT, Y79, and WERI-RB1 cells to confirm changes in expression according to the method described in Example 3. The results are shown in Figures 4(B) and (C), confirming that changing to the PDE6B or GRK1 promoter improved activity compared to the expression cassette known as scRS1 / IRBP-hRS1.

[0170] Furthermore, while expression levels increased overall, expression also increased in some HEK293FT cells. However, in terms of specificity, the increase in expression was remarkably high in WERI-RB1 and Y79 cells.

[0171] Example 6: Confirmation of retinal cell-specific promoter activity Based on the results described above, we were able to select candidate promoters and enhancers that can increase the absolute expression level.

[0172] Against this backdrop, we considered the combination of the GRK1 enhancer and the PDE6B promoter as a combination that can significantly increase expression specifically in retinal cells, and investigated how much improvement in tissue specificity this combination provides compared to known scRS1 / IRBP-hRS1 expression cassette systems.

[0173] For the aforementioned comparison, an expression cassette was designed using a method similar to that of Example 3, and the vector design is shown in Table 4 and Figure 5(A).

[0174] [Table 4]

[0175] Experiments were conducted to confirm changes in expression in 661W cells, which are photoreceptor cells, according to the method described in Example 3, and the results are shown in Figure 5(B).

[0176] As can be seen in Figure 5(B), neither pRS1-IRBPe-RS1 nor pIRBPe-△N-RS1 showed tissue-specific expression efficacy in 661W cells, which are retinal photoreceptor cells. On the other hand, in the case of p(GRK1e-PDE6B), it was confirmed that it showed significantly improved expression efficacy specifically in photoreceptors in 661W cells.

[0177] In particular, these results demonstrate that the p(GRK1e-PDE6B-based expression cassette according to the present invention can significantly increase the expression of target genes in target cells specifically, even without the RS1 promoter, which is known to be photoreceptor cell-specific.

[0178] This confirmed that the candidate promoters and enhancers according to the present invention can be used as a more suitable expression cassette system compared to conventionally known photoreceptor-specific expression systems.

[0179] Example 7: GRK1 enhancer engineering and confirmation of expression efficiency Novel expression cassettes (sequences 32, 33) were fabricated by combining sequences (sequences 30, 31) consisting of two repeats of the Ga1 (sequence number 28) or Ga4 (sequence number 29) sequence, derived from the GRK1 enhancer (sequence number 17), with the PDE6B promoter (sequence number 7) and RS15'UTR (sequence number 24), respectively.

[0180] Specific vector designs are shown in Table 5 and Figure 6(A).

[0181] [Table 5]

[0182] Experiments were conducted in HEK293FT, 661W, and rMC-1 cells to confirm changes in expression according to the method described in Example 3. The results for each cell type are shown in Figures 6(B) to (D), and it was confirmed that the most improved expression level was observed when an enhancer with two repeats of the Ga1 sequence was used.

[0183] Example 8: Confirmation of improved expression by alteration of the polyA signal sequence. In the expression system of Example 7, the polyA signal sequence was replaced. More specifically, the polyA signal sequence derived from the PCK6 AS1 gene, located at the 3' end of the Gaussia Luciferase coding sequence, was replaced with a polyA signal sequence derived from the Bovine Growth Hormone (BGH) gene.

[0184] Specific vector designs are shown in Table 6 and Figure 7(A).

[0185] [Table 6]

[0186] Experiments were conducted in HEK293FT, 661W, and MIO-M1 cells to confirm changes in expression according to the method described in Example 3. The results for each cell type are shown in Figures 7(B) to (D), and it was confirmed that the most improved expression level was observed when the BGHpolyA signaling sequence was used.

[0187] Example 9: AAV vector preparation and virus production In Example 7, the combination of the GRK1 enhancer and PDE6B promoter, which demonstrated excellent expression capabilities, was inserted into an AAV vector. More specifically, the respective enhancers and the PDE6B promoter were sequentially inserted between the ITR sequences located at both ends, and the mCherry coding gene and the human beta globin polyA sequence were inserted at the 3' end of the promoter. The completed vector was packaged with adenovirus serotype 8 (Vectorbuilder) and subsequently used in in vivo experiments.

[0188] AAV was prepared using a three-plasmid transfection system that does not use Helper virus, utilizing HEK293 cells; pHelper (#6230, AAVpro Helper Free System, TAKARA BIO INC) to perform the role of Helper virus; pAAV-Promter-mCherry to express the mCherry fluorescent protein prepared in Example 8; and the pRep2-Cap8 vector for AAVserotype8 capsid packaging. After AAV packaging in HEK293 cells, high-purity AAV was prepared by CsCl2 ultracentrifugation, and genomic titer was measured using Primer-F:CACTACGACGCTGAGGTCAA (SEQ ID NO: 37) and Primer-R:TAGTCCTCGTTGTGGGAGGT (SEQ ID NO: 38).

[0189] Example 10: In vivo AAV injection and immunofluorescence The mice (c57BL / 6J, DBL) were 8-week-old males and were reared in an SPF facility. AAV was administered to these mice using a nanofil syringe (world Precision Instruments Inc., Sarasota, FL, USA) fitted with a 35-gauge needle, at a dose of 4.5 × 10⁻⁶. 10 The solution was injected at a dose of vg / 1.5 μl using intravitreal injection and subretinal injection.

[0190] Four weeks after viral injection, the mice were euthanized under anesthesia, their eyeballs were removed, and mCherry fluorescent protein gene expression in the retina was confirmed using SLO (Scanning laser ophthalmoscopy). After separating the retina from the removed eyeballs, primary anti-mCherry antibody (PA5-34974, Invitrogen) and secondary anti-mCherry antibody (DONKEY anti-Rabbit IgG(H+L) Highly Cross-Adsorbed Secondary Antibody, Alexa Fluor) were applied to retinal sections. TM The cells were stained with 568, A10042, and Invitrogen, and the distribution and intensity of mCherry protein in the retina were imaged using a confocal microscope (Leica DMi8; Leica). mCherry expression intensity was quantified using ImageJ, and statistical analysis was performed using the Kruskal-Wallis test with the SPSS statistical program (version 22.0 for Windows; IBM Corp., Armonk, NY). Postmortem verification was performed using the Mann-Whitney assay.

[0191] The results using intravitreal injection are shown in Figure 8(B), and the results using subretinal injection are shown in Figure 8(C) and Figure 9.

[0192] As can be seen in Figure 8(B), the expression system with the combination of Ga1X2 enhancer and PDE6B promoter (denoted as Ga1X2P in Figure 8) showed improved protein expression compared to the conventional patent model (denoted as RIR in Figure 8) and (GRK1eP in Figure 8). As shown in Figure 8(C) and Figure 9, the same results were observed during subretinal injection, and it can be confirmed that the expression level was approximately 2.6 times higher than that of the conventional patent model when gene expression was quantified.

[0193] From the above description, those skilled in the art in which the present invention pertains will understand that the invention can be implemented in other specific forms without altering the technical idea or essential features of the invention. In this regard, it should be understood that the embodiments described above are illustrative in all respects and not limiting. The scope of the present invention should be interpreted as encompassing the meaning and scope of the claims, which will be described later rather than in the above detailed description, and all modified or altered forms derived from their equivalent concepts.

Claims

1. A promoter comprising a nucleotide sequence having at least 90% identity with the sequence of SEQ ID NO: 6 or SEQ ID NO: 7, or a promoter having a length of 100 to 400 nucleotides that includes the sequence of SEQ ID NO: 6 or SEQ ID NO: 7 as a core nucleotide sequence.

2. The promoter according to claim 1, wherein the promoter is a retina-specific promoter.

3. The promoter according to claim 1, wherein the promoter comprises a nucleotide sequence having the sequence of SEQ ID NO: 6 or SEQ ID NO:

7.

4. An expression cassette comprising a promoter having a nucleotide sequence having at least 90% identity with the sequence of SEQ ID NO: 6 or SEQ ID NO: 7, or a promoter having a length of 100 to 400 nucleotides that includes the sequence of SEQ ID NO: 6 or SEQ ID NO: 7 as a core nucleotide sequence, and a nucleotide that encapsulates a polypeptide operably linked thereto.

5. The expression cassette according to claim 4, further comprising any one enhancer selected from the group consisting of SEQ ID NOs: 12-18 and SEQ ID NOs: 28-31.

6. The expression cassette according to claim 4, wherein the promoter comprises a nucleotide sequence having the sequence of SEQ ID NO: 6 or SEQ ID NO:

7.

7. The expression cassette according to claim 4, further comprising one 5'UTR selected from the group consisting of SEQ ID NO: 8, SEQ ID NO: 9, or SEQ ID NO:

24.

8. The expression cassette according to claim 4, wherein the polypeptide is a therapeutic protein or a reporter protein.

9. A vector comprising an expression cassette according to any one of claims 4 to 8.

10. The vector according to claim 9, wherein the vector is a viral vector or a nonviral vector.

11. The aforementioned viral vectors include Moloney mouse leukemia virus (MoMLV), MSCV, SFFV, MPSV or SNV, lentivirus vectors (e.g., derived from human immunodeficiency virus (HIV), simian immunodeficiency virus (SIV), feline immunodeficiency virus (FIV), bovine immunodeficiency virus (BIV), or equine infectious anemia virus (EIAV)), adenovirus (Ad) vectors, adeno-associated virus (AAV) vectors, Simian virus 40 (SV-40) vectors, bovine papillomavirus vectors, Epstein-Barr virus, herpesvirus vectors, vaccinia virus vectors, and Harvey mouse sarcoma virus. The vector according to claim 10, which is one selected from the group consisting of a virus vector, a mouse mammary tumor virus vector, an anelovirus vector, and a Rous sarcoma virus vector.

12. The vector according to claim 11, wherein the viral vector is an adeno-associated virus vector.

13. The vector according to claim 10, wherein the nonviral vector is selected from the group consisting of lipid nanoparticles (LNPs), polymer nanoparticles (PNPs), exosomes, and virus-like particles (VLPs).

14. A virus particle comprising the vector described in claim 9.

15. AAV particles comprising the vector and AAV-derived capsid described in claim 9.

16. Cells transformed with an expression cassette according to any one of claims 4 to 8.

17. The cell according to claim 16, wherein the cell is a photoreceptor cell.

18. A pharmaceutical composition comprising an expression cassette according to any one of claims 4 to 8 and a pharmaceutically acceptable excipient.

19. A pharmaceutical composition for the prevention or treatment of eye diseases, comprising an expression cassette according to any one of claims 4 to 8.

20. A method for increasing the expression of a target gene in the retina, comprising the step of administering an expression cassette according to any one of claims 4 to 8 to a subject that requires it.