Integrin-targeted antibodies and their applications
Antibodies with defined CDR sequences targeting ITGA3 on cancer cells enhance cancer treatment specificity and efficacy by internalizing cytotoxic agents, addressing the limitations of conventional chemotherapy and antibody-drug conjugates.
Patent Information
- Authority / Receiving Office
- JP · JP
- Patent Type
- Applications
- Current Assignee / Owner
- NIO BIOPHARMACEUTICALS INC
- Filing Date
- 2023-12-18
- Publication Date
- 2026-06-16
Smart Images

Figure 2026519408000001_ABST
Abstract
Description
[Technical Field]
[0001] This relates to cancer cell-specific antibodies and their applications. [Background technology]
[0002] Cancer is one of the leading causes of death, and the number of patients is expected to increase with the aging population, yet the demand for treatment remains insufficient. Conventional chemotherapy drugs have problems such as side effects due to cytotoxicity not only to tumor cells but also to normal cells, and insufficient efficacy due to the inability to administer adequate drug doses. For this reason, in recent years, more selective molecular targeted drugs or antibody drugs have been developed that target molecules exhibiting characteristic mutations or high expression in cancer cells, or specific molecules involved in the carcinogenesis of cells.
[0003] Antibodies are expected to reduce side effects because they have high blood stability and specifically bind to target antigens, and many antibody drugs targeting molecules highly expressed on the surface of cancer cells have been developed. One technology that utilizes the antigen-specific binding ability of antibodies is antibody-drug conjugates (ADCs). An ADC is an antibody that can bind to an antigen expressed on the surface of cancer cells and internalize the antigen into the cell through this binding, and a drug with cytotoxic activity is attached to it. By efficiently delivering drugs to cancer cells, ADCs are expected to accumulate drugs within cancer cells and kill the cancer cells.
[0004] Characteristics of target antigens suitable for ADCs (antitumor drug) include specific high expression on the surface of cancer cells, low or no expression in normal cells, the ability to be internalized within cells, and the absence of secretion from the cell surface. Furthermore, important characteristics of antibodies suitable for ADCs include specific binding to the target antigen and high internalization ability. Antibody internalization ability depends on the properties of both the target antigen and the antibody; it is difficult to predict suitable antigen-binding sites from the molecular structure of the target, or to easily infer antibodies with high internalization ability from their binding strength or physical properties. Therefore, obtaining antibodies with high internalization ability against target antigens is a crucial challenge in developing highly effective ADCs. [Overview of the project] [Problems that the invention aims to solve]
[0005] Therefore, the inventors have discovered antibodies that bind to and internalize target antigens, reflecting phenotypic structural characteristics that can solve the problems of current cancer drug development and treatment methods, and have developed substances applicable to the development of antibody-based pharmaceuticals such as antibody-drug conjugates.
[0006] One aspect of the present invention provides an antibody or functional fragment thereof that is specific to a membrane protein of cancer stem cells or cancer cells, comprising (a) VH CDR1 containing any one amino acid sequence from SEQ ID NOs. 1 to 4; (b) VH CDR2 containing any one amino acid sequence from SEQ ID NOs. 5 to 8; (c) VH CDR3 containing any one amino acid sequence from SEQ ID NOs. 9 to 12; (d) VL CDR1 containing any one amino acid sequence from SEQ ID NOs. 13 to 16; (e) VL CDR2 containing any one amino acid sequence from SEQ ID NOs. 17 to 20; and (f) VL CDR3 containing any one amino acid sequence from SEQ ID NOs. 21 to 24.
[0007] Another aspect is to provide a pharmaceutical composition for cancer treatment or prevention, which comprises the antibody or a functional fragment thereof.
[0008] Another aspect is to provide a chimeric antigen receptor (CAR) protein comprising an antibody or a functional fragment thereof.
[0009] Another aspect is to provide an immune cell comprising the chimeric antigen receptor protein.
[0010] Another aspect is to provide a polynucleotide encoding the antibody or a functional fragment thereof.
[0011] Another aspect is to provide a recombinant vector comprising the polynucleotide.
[0012] Another aspect is to provide a recombinant cell comprising the vector.
[0013] Another aspect is to provide a composition for cancer diagnosis, which comprises an antibody or a functional fragment thereof.
[0014] Another aspect is to provide a kit for cancer diagnosis, which comprises the composition.
[0015] Another aspect is to provide a reagent composition comprising the antibody or the polynucleotide.
[0016] Another aspect is to provide a method for cancer treatment or prevention, which comprises the step of administering an effective amount of the antibody or a functional fragment thereof to an individual who needs it.
Means for Solving the Problems
[0017] One embodiment provides an antibody or functional fragment thereof that is specific to a membrane protein of cancer stem cells or cancer cells, comprising (a) VH CDR1 containing any one amino acid sequence from SEQ ID NOs. 1 to 4; (b) VH CDR2 containing any one amino acid sequence from SEQ ID NOs. 5 to 8; (c) VH CDR3 containing any one amino acid sequence from SEQ ID NOs. 9 to 12; (d) VL CDR1 containing any one amino acid sequence from SEQ ID NOs. 13 to 16; (e) VL CDR2 containing any one amino acid sequence from SEQ ID NOs. 17 to 20; and (f) VL CDR3 containing any one amino acid sequence from SEQ ID NOs. 21 to 24.
[0018] In one specific example, the antibody or its functional fragment is (a) VH CDR1 of SEQ ID NO: 1, VH CDR2 of SEQ ID NO: 5, VH CDR3 of SEQ ID NO: 9, VL CDR1 of SEQ ID NO: 13, VL CDR2 of SEQ ID NO: 17, and VL CDR3 of SEQ ID NO: 21; (b) VH CDR1 of SEQ ID NO: 2, VH CDR2 of SEQ ID NO: 6, VH CDR3 of SEQ ID NO: 10, VL CDR1 of SEQ ID NO: 14, VL CDR2 of SEQ ID NO: 18, and VL CDR3 of SEQ ID NO: 22; (c) VH CDR1 of SEQ ID NO: 3, VH CDR2 of SEQ ID NO: 7, VH CDR3 of SEQ ID NO: 11, VL CDR1 of SEQ ID NO: 15, VL CDR2 of SEQ ID NO: 19, and VL CDR3 of SEQ ID NO: 23; or (d) VH CDR1 of SEQ ID NO: 4, VH CDR2 of SEQ ID NO: 8, VH CDR3 of SEQ ID NO: 12, VL CDR1 of SEQ ID NO: 16, and VL CDR1 of SEQ ID NO: 20 It may also include CDR2 and VL CDR3 of sequence number 24.
[0019] In one specific example, the antibody or its functional fragment may include (a) a heavy chain variable region containing any one amino acid sequence from SEQ ID NOs. 25 to 28 or a sequence having at least 90% homology to any one amino acid sequence from SEQ ID NOs. 25 to 28; and (b) a light chain variable region containing any one amino acid sequence from SEQ ID NOs. 29 to 32 or a sequence having at least 90% homology to any one amino acid sequence from SEQ ID NOs. 29 to 32.
[0020] In one specific example, the antibody or its functional fragment comprises: (a) a heavy chain variable region containing the amino acid sequence of SEQ ID NO: 25 or a sequence having at least 90% homology to the amino acid sequence of SEQ ID NO: 25; and a light chain variable region containing the amino acid sequence of SEQ ID NO: 29 or a sequence having at least 90% homology to the amino acid sequence of SEQ ID NO: 29; (b) a heavy chain variable region containing the amino acid sequence of SEQ ID NO: 26 or a sequence having at least 90% homology to the amino acid sequence of SEQ ID NO: 26; and a light chain variable region containing the amino acid sequence of SEQ ID NO: 30 or a sequence having at least 90% homology to the amino acid sequence of SEQ ID NO: 30. Variable regions; (c) heavy chain variable region containing the amino acid sequence of SEQ ID NO: 27 or a heavy chain variable region containing a sequence having at least 90% homology to the amino acid sequence of SEQ ID NO: 27; and light chain variable region containing the amino acid sequence of SEQ ID NO: 31 or a light chain variable region containing a sequence having at least 90% homology to the amino acid sequence of SEQ ID NO: 31; or (d) heavy chain variable region containing the amino acid sequence of SEQ ID NO: 28 or a heavy chain variable region containing a sequence having at least 90% homology to the amino acid sequence of SEQ ID NO: 28; and light chain variable region containing the amino acid sequence of SEQ ID NO: 32 or a light chain variable region containing a sequence having at least 90% homology to the amino acid sequence of SEQ ID NO: 32.
[0021] In one specific example, the CDRs of each variable region of the light chain and each variable region of the heavy chain may be freely combined.
[0022] In one specific example, the membrane protein of the cancer stem cell or cancer cell may be ITGA3 (Integrin Subunit Alpha 3) or VLA3 (Integrin alpha 3 beta 1).
[0023] Integrins are heterodimeric cell surface receptors that bind to extracellular matrix (ECM) proteins and are involved in cell adhesion, proliferation, and migration. Integrins can also recruit various proteins and influence signaling pathways to regulate gene expression and cell survival.
[0024] Integrin proteins consist of a total of 18 alpha (α) subunits and 8 beta (β) subunits, resulting in 24 different integrins based on various combinations of α and β subunit heterodimers. Among these combinations, cancer-specific integrin complexes exist.
[0025] The nucleotide and protein sequences of ITGA3 are known for many species. For example, the human sequence is NCBI accession number NG_029107.2, and may also be Uniprot accession number P23006.
[0026] The aforementioned ITGA3 and VLA3 include variants, isoforms, homologs, orthologs, and paralogs. For example, antibodies specific to human ITGA3 or VLA3 proteins may, in certain cases, cross-react with ITGA3 or VLA3 proteins from non-human species.
[0027] In one specific example, the antibody or its functional fragment is IgG, Fab, Fab', F(ab')2, xFab, scFab, dsFv, Fv, scFv, scFv-Fc, scFab-Fc, diabody (scFv2, diabody), minibody (minibody), scAb, dAb (domain antibody, V H or V L ), may be selected from the group consisting of Fc-scFv, scFv-Fc-scFv, IgG-scFv, scFv-IgG, and combinations thereof. Specifically, the antibody or its functional fragment may be a diabody, dAb, scFv, or scFv-Fc.
[0028] In this specification, a "Fab fragment" consists of one light chain and one heavy chain, each containing only a variable region and CH1. The heavy chain of a Fab molecule cannot form disulfide bonds with other heavy chain molecules. scFab is formed by linking two Fab molecules with a flexible linker.
[0029] In this specification, "Fab' fragment" includes a region between the CH1 and CH2 domains of the heavy chain in addition to the Fab fragment, and a disulfide bond can be formed between the double chains of two molecules of the Fab' fragment that produce an F(ab')2 molecule.
[0030] In this specification, “F(ab')2 fragment” comprises two light chains and two heavy chains, as mentioned above, comprising a variable region, CH1 and a portion of the normal region between the CH1 and CH2 domains, thereby comprising two intrachain disulfide bonds. Thus, the F(ab')2 fragment is composed of two Fab' fragments, the two Fab' fragments meeting each other by disulfide bonds between them.
[0031] In this specification, "cross-Fab fragment," "xFab fragment," or "crossover Fab fragment" refers to a Fab fragment in which the variable or normal regions of the heavy and light chains are exchanged. Two different chain compositions are possible for crossover Fab molecules. The variable regions of the Fab heavy chain and light chain can be exchanged. That is, a cross-Fab molecule includes a peptide chain composed of the light chain variable region (VL) and the heavy chain constant region (CH1), and a peptide chain composed of the heavy chain variable region (VH) and the light chain normal region (CL). This crossover Fab molecule is also called CrossFab(VLVH). On the other hand, when the normal regions of the Fab heavy chain and light chain are exchanged, the cross-Fab molecule includes a peptide chain composed of the heavy chain variable region (VH) and the light chain normal region (CL), and a peptide chain composed of the light chain variable region (VL) and the heavy chain constant region (CH1). This crossover Fab molecule is also called CrossFab(CLCH1).
[0032] In this specification, “single-stranded Fab fragment” or “scFab” is a polypeptide comprising an antibody heavy chain variable domain (VH), an antibody normal domain 1 (CH1), an antibody light chain variable domain (VL), an antibody light chain normal domain (CL), and a linker. Here, the antibody domain and the linker have one of the following sequences from N-terminus to C-terminus: a) VH-CH1-linker-VL-CL, b) VL-CL-linker-VH-CH1, c) VH-CL-linker-VL-CH1, or d) VL-CH1-linker-VH-CL; the linker is a polypeptide of at least 30 amino acids, preferably 32 to 50 amino acids. The single-stranded Fab fragment is stabilized through a natural disulfide bond between the CL domain and the CH1 domain. Furthermore, such single-chain Fab molecules can be further stabilized by the formation of interchain disulfide bonds through the insertion of cysteine residues (e.g., at position 44 of the variable heavy chain and position 100 of the variable light chain via Kabat numbering).
[0033] In this specification, "Fv region" refers to an antibody fragment that includes the variable regions of the heavy and light chains but does not include the normal region. sdFV is a fragment in which the heavy and light chains are linked by disulfide bonds. scFv is a fragment in which the single-stranded variable regions (scFv) of the heavy and light chains are linked via a flexible linker. scFv-Fc is a fragment in which Fc is linked to scFv and can be described as a maxibody. The minibody is a fragment in which CH3 is linked to scFv. The diabody contains scFv from two molecules.
[0034] In one specific example, the scFv may be a configuration in which a heavy chain variable region and a light chain variable region are connected via a linker.
[0035] In one embodiment, the scFv contained in the antibody may include heavy chain variable regions and light chain variable regions in any order. For example, the scFv contained in the antibody may include heavy chain variable regions and light chain variable regions in the direction from the N-terminus to the C-terminus, with a peptide linker selectively between them, or alternatively, the antibody may include a light chain variable region and a heavy chain variable region in the direction from the N-terminus to the C-terminus, and optionally a peptide linker between them.
[0036] The term “peptide linker” may contain any number of amino acids, from 1 to 100, 2 to 50, or 10 to 25, and any type of amino acid may be included without any limitation. The peptide linker may contain, for example, Gly, Asn, and / or Ser residues, and may also contain neutral amino acids such as Thr and / or Ala. Suitable amino acid sequences for peptide linkers may be publicly known in the relevant art. On the other hand, the length of the peptide linker can be determined in various ways within a range that does not affect the function of the antibody. For example, the peptide linker may be formed by containing one or more total of about 1 to about 100, about 2 to about 50, or about 5 to about 25 selected from the group consisting of Gly, Asn, Ser, Thr, and Ala. In one embodiment, the peptide linker may be (G4S)n, (SG4)n, or G4(SG4)n, where “n” is a number generally between 1 and 10, typically 2 to 4. The peptide linker may be, for example, GGGGS (SEQ ID NO: 33), GGGGSGGGGS (SEQ ID NO: 34), SGGGGSGGGG (SEQ ID NO: 35), GGGGSGGGGSGGGG (SEQ ID NO: 36), GSPGSSSSGS (SEQ ID NO: 37), GGGGSGGGGSGGGGS (SEQ ID NO: 38), GSGSGSGS (SEQ ID NO: 39), GSGSGNGS (SEQ ID NO: 40), GGSGSGSG (SEQ ID NO: 41), GGSGSG (SEQ ID NO: 42), GGSG (SEQ ID NO: 43), GGSGNGSG (SEQ ID NO: 44), GGNGSGSG (SEQ ID NO: 45), or GGNGSG (SEQ ID NO: 46).
[0037] The linker may include a mutated linker. The mutated linker may further contain Cysteine (Cys, C) in the linker. The linker may also contain the amino acid sequence GGGGSGGGSCGGGGS (SEQ ID NO: 47).
[0038] In this specification, a "short-chain antibody (scAb)" is a single polypeptide chain comprising a variable region of either the heavy chain or the normal light chain, linked by a flexible linker. The short-chain antibody may be described by reference to U.S. Patent No. 5,260,203, which is disclosed herein by reference.
[0039] In this specification, "domain antibody (dAb)" is an immunologically functional immunoglobulin fragment that contains only the variable region of the heavy chain or only the variable region of the light chain.
[0040] In this specification, "full-length IgG" is defined as containing essentially complete IgG, but this does not necessarily mean that it possesses all the functions of intact IgG. Full-length IgG contains two heavy chains and two light chains. Each chain contains normal (C) and variable (V) regions, which can be broken down into domains designated as CH1, CH2, CH3, VH, and CL, VL.
[0041] In one specific example, Fc may include an amino acid sequence derived from human, mouse, chicken, monkey, or camel.
[0042] In one specific example, the antibody or its functional fragment may be a chimeric antibody, a humanized antibody, or a fully human antibody.
[0043] The term "chimeric antibody" refers to an antibody in which different parts of the antibody molecule originate from different animal species, for example, an antibody that has a variable region derived from a mouse monoclonal antibody and a normal human immunoglobulin region. Methods for producing chimeric antibodies are publicly known in this field.
[0044] The term "humanized antibody" refers to an antibody molecule derived from a non-human antibody that binds to a desired antigen, having one or more complementarity-determining regions (CDRs) from a non-human species and a framework region from a human immunoglobulin molecule. Various framework residues in the human framework region are substituted with corresponding residues from a CDR donor antibody to alter, and preferably improve, antigen binding. Such framework substitutions are confirmed by methods widely known in the art, for example, by modeling the interaction between the CDR and framework residues to identify framework residues important for antigen binding and by sequence comparison to identify abnormal framework residues at specific locations (see, e.g., Queen et al., U.S. Patent No. 5,585,089, which is included in its entirety by reference).
[0045] The term "fully human antibody" is particularly preferred for the therapeutic treatment of human patients. Human antibodies can be produced by various methods known in the art, including phage display methods using antibody libraries derived from human immunoglobulin sequences.
[0046] In one specific example, the antibody or its functional fragment may be a monoclonal antibody.
[0047] In one specific example, the antibody or its functional fragment may be IgG1, IgG2, IgG3, IgG4, or a combination thereof.
[0048] One embodiment provides an immunoconjugate comprising an anti-ITGA3 or anti-VLA3 antibody, as described in this application, conjugated (chemically linked) to one or more therapeutic agents such as a cytotoxic agent, chemotherapeutic agent, drug, growth inhibitor, toxin (e.g., protein toxin, enzyme-active toxin of bacterial, fungal, plant or animal origin, or fragment thereof), or radioisotope.
[0049] In one specific example, the immunoconjugate is an antibody-drug conjugate (ADC) in which an antibody is conjugated to one or more of the aforementioned therapeutic agents. The antibody-drug conjugate may be one in which the two molecules are directly conjugated, or it may be one in which the two molecules are indirectly conjugated by any means such as a linker. The linker may be a non-cleaving linker or a cleaving linker. Generally, it is known that ADCs are ideally designed so that the drug can be cleaved inside the targeted cell after being indirectly conjugated by means such as a linker. The linker may be a peptide linker that can be cleaved by cleaving agents present in the intracellular environment, e.g., lysosomes or endosomes, e.g., intracellular peptidases or protease enzymes, e.g., lysosomes or endosomal proteases. Generally, peptide linkers have a length of at least two amino acids. In one example, the cleaving linker may be pH sensitive and sensitive to hydrolysis at a specific pH value. Generally, a pH-sensitive linker indicates that it can be hydrolyzed under acidic conditions. For example, acid-unstable linkers that can be hydrolyzed in lysosomes may include hydrazones, semicarbazones, thiosemicarbazones, cis-aconitic amides, orthoesters, acetals, and ketals. Another example is that the linker can be cleaved under reducing conditions, for example, disulfide linkers. Various disulfide bonds can be formed using SATA (N-succinimidyl-S-acetylthioacetate), SPDP (N-succinimidyl-3-(2-pyridyldithio)propionate), SPDB (N-succinimidyl-3-(2-pyridyldithio)butyrate), and SMPT (N-succinimidyl-oxycarbonyl-alpha-methyl-alpha-(2-pyridyl-dithio)toluene).
[0050] The aforementioned therapeutic agents are (a) erlotinib, bortezomib, fulvestrant, sutent, letrozole, imatinib mesylate, and PTK787 / ZK 222584, oxaliplatin, 5-fluorouracil, leucovorin, rapamycin, lapatinib, lonafarnib, sorafenib, gefitinib, AG1478, AG1571, thiotepa, cyclophosphamide, busulfan, improsulfan, piposulfan, benzodopa, carboquone, meturedopa, uredopa, ethylenimine, alto Altretamine, triethylenemelamine, trietylenephosphoramide, triethiylenethiophosphoramide, trimethylolomelamine, bullatacin, bullatacinone, camptothecin, topotecan, bryostatin, callystatin, CC-1065, adozelesin, carzelesin, bizelesin, cryptophycin 1, cryptophycin 88) Dolastatin, duocarmycin, KW-2189, CB1-TM1, eleutherobin, pancratistatin, sarcodictyin, spongistatin, chlorambucil, chlornaphazine, colophosphamide, estramustine, ifosfamide, mechlorethamine, melphalan, nobembichin, phenesterine, prednimustine, trofosfamide, uracil mustard Mustard), carmustine, chlorozotocin, fotemustine, lomustine, nimustine, ranimnustine, calicheamicin, calicheamicin gamma 1, calicheamicin omega 1, dynemicin, dynemicin A, clodronate, esperamicin, neocarzinostatin chromophoreChromophore, aclasinomycin, actinomycin, antremycin, azaserine, bleomycins, cactinomycin, carabicin, carninomycin, carzinophilin, chromomycins, dactinomycin, daunol Daunorubicin, Detorubucin, 6-diazo-5-oxo-L-norleucine, Doxorubicin, Morpholino-doxorubicin, Cyanomorpholino-doxorubicin, 2-pyrrolino-doxorubicin, Liposomal doxorubicin, Deoxydoxorubicin, Epirubicin, Esorubicin, Marcellomycin, Mitomycin C, Mycophenolic acidacid), nogalamycin, olivomycins, peplomycin, potfiromycin, puromycin, quelamycin, rodorubicin, streptomigrin, streptozocin, tubercidin, ubenimex (u Benimex), zinostatin, zorubicin, 5-fluorouracil, denopterin, methotrexate, pteropterin, trimetrexate, fludarabine, 6-mercaptopurine, thiamiprine, Thioguanine, ancitabine, azacitidine, 6-azauridine, carmofur, cytarabine, dideoxyuridine, doxifluridine, enocitabine, floxuridine, calusterone, dromostanolone, propionate, epithiostanol, mepitiostane, testolactone, aminoglutethimide, mitotane, trilostane, folinic acid acid), aceglatone, aldophosphamide glycoside, aminolevulinic acidacid), eniluracil, amsacrine, bestrabucil, bisantrene, edatraxate, defofamine, demecolcine, diaziquone, elfornithine, elliptinium acetate, etoglucid, gallium nitrate Nitrate, hydroxyurea, lentinan, lonidainine, maytansine, ansamitocins, mitoguazone, mitoxantrone, mopidanmol, nitraerine, pentostatin, phenamet, pirarubicin, losoxantrone, 2-ethylhydrazide, procarbazine, polysaccharide K, razoxane, rhizoxin, sizofiran, spirogermanium, tenuazonic acid (acid), triaziquone, 2,2',2''-trichlorotriethylamine, T-2 toxin, verracurin A, roridin AA) Anguidine, urethane, vindesine, dacarbazine, mannomustine, mitobronitol, mitolactol, pipobroman, gacytosine, arabinoside, cyclophosphamide, thiotepa, paclitaxel, albumin-engineered nanoparticle formulation of paclitaxel Paclitaxel, docetaxel, chlorambucil, gemcitabine, 6-thioguanine, mercaptopurine, cisplatin, carboplatin, vinblastine, platinum, etoposide, ifosfamide, mitoxantrone, vincristine, vinorelbine, novantrone, teniposide, edatrexate, daunomycin, aminopterin, xeloda, ibandronate, CPT-11, topoisomerase inhibitor RFS 2000, difluoromethylornithine, retinoic acid (acid), capecitabine or its pharmaceutically acceptable salts, solvates, or acids; (b) monokine, lymphokine, traditional polypeptide hormone, parathyroid hormone, thyroxine, relaxin, prorelaxin, glycoprotein hormone, follicle-stimulating hormone, thyroid-stimulating hormone, luteinizing hormone, hepatic growth factor (fibroblast growth factor), prolactin, placental lactogen, tumor necrosis factor, tumor necrosis factor-α, tumor necrosis factor-β, Müllerian inhibitory substance, mouse gonadotropin-associated peptide peptide), inhibin, activin, vascular endothelial growth factor, thrombopoietin, erythropoietin, osteoinductive factor, interferon, interferon-α, interferon-β, interferon-γ, colony stimulating factor,CSF), macrophage-CSF, granulocyte-macrophage-CSF, granulocyte-CSF, interleukin (IL), IL-1, IL-1α, IL-2, IL-3, IL-4, IL-5, IL-6, IL-7, IL-8, IL-9, IL-10, IL-11, IL-12, tumor necrosis factor, polypeptide factors, LIF, kit ligands, or combinations thereof; (c) Diphtheria toxin, botulinum toxin, tetanus toxin, dysentery toxin, cholera toxin, amanitin, α-amanitin, pyrrolobenzodiazepine, pyrrolobenzodiazepine derivatives, indolinobenzodiazepine, pyridinobenzodiazepine, tetrodotoxin, brevetoxin, ciguatoxin, lysine, AM toxin, auristatin, tubulysin, geldanamycin, maytansinoid, calicheamycin, daunomycin, doxorubicin, methotrexate, vindesine, SG2285, dolastatin, dolastatin analog analogs), auristatin, cryptophycin, camptothecin, rhizoxin, rhizoxin derivatives, CC-1065, CC-1065, duocarmycin, enediyne antibiotic, esperamicin, epothilone, toxoids, or combinations thereof; (d) immunomodulatory compounds, anticancer agents, antiviral agents, antibacterial agents, antifungal agents, and antiparasitic agents, or formulations thereof; (e) Tamoxifen, raloxifene, droloxifene, 4-hydroxytamoxifen, trioxifene, keoxifene, LY117018, onapristone, or toremifene; (f) 4(5)-imidazole, aminoglutethimide, megestrol acetate, exemestane, letrozole, or anastrozole; or (g) One or more selected from the group consisting of flutamide, nilutamide, bicalutamide, leuprolide, goserelin, or troxacitabine.
[0051] The antibody or its functional fragment not only binds to ITGA3 or VLA3, but also has the advantage of being internalized within the cell and, when applied in an antibody-drug conjugate (ADC), effectively delivering the conjugated drug into the cell.
[0052] Another embodiment provides a chimeric antigen receptor (CAR) protein containing the antibody or a functional fragment thereof.
[0053] Another embodiment provides immune cells containing the chimeric antigen receptor protein.
[0054] In this invention, the term "chimeric antigen receptor (CAR)" refers to a non-naturally occurring receptor that can confer specificity to a particular antigen to an immune effector cell. Typically, the CAR refers to a receptor used to transfer the specificity of a monoclonal antibody to a T cell. A CAR is generally composed of an extracellular domain (Ectodomain), a transmembrane domain, and an intracellular domain (Ectodomain).
[0055] The extracellular domain comprises the antibody or a functional fragment thereof, which includes an antigen-binding site (antigen recognition region). The antibody used in CAR is preferably in the form of an antibody fragment, and may also be in the form of an scFv, but is not particularly limited thereto.
[0056] Furthermore, the membrane-passing domain of the CAR may be in a form linked to the extracellular domain and may be of natural or synthetic origin. If it is of natural origin, it may be derived from a membrane-bound or membrane-permeable protein, and may be, but not limited to, a portion derived from the membrane-permeable region of various proteins such as the alpha, beta, or zeta chains of the T cell receptor, CD28, CD3 epsilon, CD45, CD4, CD5, CDDS, CD9, CD16, CD22, CD33, CD37, CD64, CD80, CD86, CD134, CD137, CD154, or CD8. The sequences of such membrane-passing domains can be obtained from publicly known literature in the art that provides information on the membrane-permeable region of membrane-permeable proteins.
[0057] In the CAR described above, the intracellular signaling domain is located inside the cell in a form linked to the membrane-transmissible domain. The intracellular signaling domain of the present invention is a region that generates and / or transmits a signal that first leads to cell activation when an antigen binds to the antigen-binding site of the CAR (i.e., the antibody or a functional fragment thereof of the present invention).
[0058] The term "cells" is not particularly limited in type, but may preferably be immune cells (immune effector cells). The term "immune cells" is not particularly limited in type, as long as they are cells known in the art to be involved in the body's immune function, but includes, for example, T cells, NK (Natural Killer) cells, NKT (Natural Killer T) cells, mononuclear cells, macrophages, or dendritic cells, and also includes their precursor cells.
[0059] In this specification, “antibody” means an intact antibody, antigen-binding fragment, or any isotype of an intact immunoglobulin or an intact antibody or antigen-binding fragment for binding to a target antigen. This includes, for example, chimeric, humanized, fully human, and bispecific antibodies or their antigen-binding fragments. The antibody is itself a type of antigen-binding protein. The intact antibody generally contains at least two full-length heavy chains and two full-length light chains, although in some cases, antibodies naturally found in camels may contain only heavy chains. The antibody or its antigen-binding fragment may originate from only one source or from a chimera. The chimeric antibody contains portions derived from two other antibodies, which are described in more detail below. The antibody or its antigen-binding fragment may be produced by hybridoma, recombinant DNA technology, or enzymatic or chemical cleavage of an intact antibody. Unless otherwise noted, the term “antibody” in this specification includes its derivatives, variants, fragments, and mutants, examples of which are given below.
[0060] In this specification, the terms “antibody fragment” or “antigen-binding fragment” are parts of an antibody, such as scFv-Fc, F(ab')2, F(ab)2, Fab', Fab, Fv, scFv, etc., as used herein. Regardless of structure, an antibody fragment binds to the same antigen recognized by the intact antibody. The terms “antibody fragment” include aptamers, enantiomers, scFv, dAb, diabodies, and maxibodies, etc. The terms “antibody fragment” also include any synthetic or genetically engineered protein that acts similarly to an antibody by binding to a specific antigen and forming a complex.
[0061] A “single-stranded variable fragment” or “v” refers to a fusion protein of the variable regions of the heavy chain (VH) and light chain (VL) of an immunoglobulin. In one specific example, the regions may be linked by a short linker peptide of 10 to about 25 amino acids. The linker is rich in glycine for flexibility and serine or threonine for solubility, and can link the N-terminus of the VH to the C-terminus of the VL, or vice versa. In one specific example, the linker may also contain mutations. This protein retains the intrinsic immunoglobulin specificity in the removal of the normal region and the introduction of the linker. The scFv molecule is publicly known in the art and is described, for example, in U.S. Patent 5,892,019.
[0062] The antibodies referred to above include a wide range of polypeptides that can be biochemically distinguished. Those skilled in the art will see that the heavy chains are classified into gamma, mu, alpha, delta, or epsilon (γ, μ, α, δ, ε), some of which include subclasses (e.g., γl-γ). It is the nature of this chain that the “classification” of the antibody is determined as IgG, IgM, IgA, IgG, or IgE, respectively. The immunoglobulin subclasses (isotypes), e.g., IgG1, IgG2, IgG3, IgG4, IgG5, etc., are well characterized and It is known to confer specific properties. Modified versions of each of these classifications and isotypes are readily distinguishable to those skilled in the art in consideration of the present invention. With respect to IgG, a standard immunoglobulin molecule comprises two identical light-chain polypeptides with a molecular weight of approximately 23,000 daltons and two identical heavy-chain polypeptides with molecular weights of 53,000–70,000. The four chains are typically linked by disulfide bonds in a "Y" configuration, with the light chains starting from the "Y" entry point and continuing through the variable region to bracket the heavy chains.
[0063] An example of an antibody, its antigen-binding polypeptide, variant, or derivative may include, but is not limited to, polyclonal, monoclonal, multispecific, human, humanized, primated, or chimeric antibodies, single-chain antibodies, epitope-binding fragments, e.g., Fab, Fab' and F(ab')2, Fd, Fvs, single-chain Fv(scFv), single-chain antibodies, disulfide-bound Fv(sdFv), fragments containing VK or VH domains, fragments produced by Fab expression libraries, and anti-idiotype (anti-Id) antibodies. An example of an immunoglobulin or antibody molecule may be a type of immunoglobulin molecule (e.g., IgGl, IgG2, IgG3, IgG4, IgAl, and IgA2) or a subclass of the immunoglobulin molecule.
[0064] Light chains are classified as kappa or lambda (Κ, λ). Each heavy chain classification can also be coupled to a kappa or lambda light chain. Generally, light and heavy chains are covalently bonded to each other, and the “tail” portions of the double chains are linked to each other by covalent disulfide bonds, or by non-covalent bonds when the immunoglobulin is produced by a hybridoma, B cell, or genetically engineered host cell. In the heavy chain, the amino acid sequence extends from the N-terminus of the branched end of the Y-constituent form to the C-terminus of the base of each chain.
[0065] Both the light and heavy chains are divided into regions of structural and functional homology. The terms “normal” and “variable” are used functionally. In this regard, it is found that the variable domains of both the light chain (VL) and heavy chain (VH) portions determine antigen recognition and specificity. Conversely, the normal domains of the light chain (CL) and heavy chain (CH1, CH2, or CH3) confer important biological properties such as secretion, transplacental mobility, Fc receptor binding, and complement binding. By convention, the numbering of normal region domains increases as they move away from the antigen-binding site or amino acid-terminus of the antibody. The N-terminal portion is the variable region, and the C-terminal portion is the normal region; the CH3 and CL domains actually contain the carboxy-terminus of the heavy and light chains, respectively.
[0066] As described above, the variable region allows the antibody to selectively recognize and specifically bind to an epitope on the antigen. That is, the VL and VH domains of the antibody, or a subset of the complementarity-determining regions (CDRs), combine to form the variable region that defines the three-dimensional antigen-binding site. Such a quaternary structure forms the antigen-binding site located at each N-terminus of the Y. More specifically, the antigen-binding site is defined by three CDRs on the VH and VL chains, respectively (i.e., CDR-H1, CDR-H2, CDR-H3, CDR-L1, CDR-L2, and CDR-L3). In some cases, for example, certain immunoglobulin molecules derived from or manipulated based on camelid species, complete immunoglobulin molecules may consist only of heavy chains without light chains. See, for example, Hamers-Casterman et al., Nature 363:446-448 (1993).
[0067] In naturally occurring antibodies, the six "complementarity-determining regions" or "CDRs" present in each antigen-binding domain are short, discontinuous sequences of amino acids specifically positioned to form the antigen-binding domain, as the antibody takes on a three-dimensional configuration in an aqueous environment. The remaining amino acids in the antigen-binding domain, referred to as the "framework" region, exhibit even less intermolecular variability. The framework region primarily takes on the β-sheet three-dimensional structure, and the CDRs link the β-sheet structure, forming loops that, in some cases, form part of it. Thus, the framework region acts to form a scaffold that positions the CDRs into the correct orientation through non-covalent interactions between the chains. The antigen-binding domain formed by the positioned CDRs defines a surface complementary to the epitope on the immunoreactive antigen. This complementary surface promotes the non-covalent binding of the antibody to this cognate epitope. Since the CDR and the amino acids including the framework region are precisely defined, they can be readily identified by those skilled in the art for any given heavy or light chain variable region (see www.bioinf.org.uk:Dr. Andrew CRMartin's Group; "Sequences of Proteins of Immunological Interest," Kabat, E., et al., USD Department of Health and Human Services, (1983); and Chothia and Lesk, J.MoI. Biol., 196:901-917 (1987)).
[0068] Where there are two or more definitions of a term used and / or encompassed in the relevant art, the definitions of such terms as used herein are intended to include all such meanings unless expressly referred to to the contrary. A specific example is the use of the term “complementarity-determining region” (“CDR”) to describe the discontinuous antigen combination sites found within the variable regions of both heavy and light chain polypeptides. Numerous methods can be used to define CDRs. Current technology utilizes various numbering systems that take advantage of different definitions of CDR length and position. For example, the Kabat numbering system predicts CDRs using a “variability parameter” (a value obtained by dividing the number of different amino acids at a given position by the frequency of the amino acid that occurs most frequently at that position) of a given amino acid position based on sequence alignment. The Chothia numbering system, on the other hand, is a structure-based numbering system in which antibody crystal structures are aligned, when loop structures are defined as CDRs. The Martin numbering system focuses on the structural alignment of different framework regions of atypical lengths. The IMGT numbering system is a standardized numbering system based on sequence alignment from a complete reference gene database, including the whole immunoglobulin superfamily. Honneger's numbering system (AHo's) is based on the structural alignment of 3D structures in a variable region and uses structurally preserved Cα positions to infer framework and CDR lengths.
[0069] When numbered by the Kabat numbering system, these are residues 24-34 (L1), 50-56 (L2), and 89-97 (L3) in the VL, and around 31-35 (H1), 50-65 (H2), and 95-102 (H3) in the VH (Kabat et al. Sequences of Proteins of Immunological Interest, 5th Ed. Public Health Service, National Institutes of Health, Bethesda, MD, 1991); when numbered by the Chothia numbering system, these are residues 24-34 (L1), 50-56 (L2), and 89-97 (L3) in the VL, and around 26-32 (H1), 52-56 (H2), and 95-101 (H3) in the VH (Chothia and (Lesk. J. Mol. Biol. 1987, 196, 901-917); when numbered by the IMGT numbering system, residues 27-38 (L1), 56-65 (L2), and 105-120 (L3) in VL, and 27-38 (H1), 56-65 (H2), and 105-120 (H3) in VH (Lefranc et al. Nucl. Acids Res. 1999, 27, 209-212, Ruiz et al. Nucl. Acids Res. 1999, 27, 209-212, Ruiz et al. Nucl. Acids Res. 1999, 27, 209-212) (Res.2000, 28, 219-221); when numbered by Honneger's numbering system (AHo's), the positions in VL are 28, 36 (L1), 63, 74-75 (L2) and 123 (L3) and in VH are 28, 36 (H1), 63, 74-75 (H2) and 123 (H3) around [Honneger and Plunkthun (Mol. Biol.2001, 309, 657-670)].
[0070] Those skilled in the art will recognize that the definition of CDR varies depending on the method used. Any method of defining CDR is considered in conjunction with the arrangement disclosed herein.
[0071] In this specification, the antibodies disclosed may be derived from any animal, including birds and mammals. For example, the antibodies may be human, rodent, donkey, rabbit, goat, guinea pig, camel, llama, horse, or chicken antibodies.
[0072] In this specification, the term “heavy chain constant region” includes an amino acid sequence derived from an immunoglobulin heavy chain. A polypeptide comprising a heavy chain constant region comprises at least one of the following: a CH1 domain, a hinge (e.g., upper, middle, and / or lower hinge regions) domain, a CH2 domain, a CH3 domain, or a variant or fragment thereof. For example, antigen-binding polypeptides for use in the present invention may include: a polypeptide chain comprising a CH1 domain; a polypeptide chain comprising a CH1 domain, at least a portion of a hinge domain, and a CH2 domain; a polypeptide chain comprising a CH1 domain and a CH3 domain; a polypeptide chain comprising a CH1 domain, at least a portion of a hinge domain, and a CH3 domain; or a polypeptide chain comprising a CH1 domain, at least a portion of a hinge domain, a CH2 domain, and a CH3 domain. Those skilled in the art will understand that the heavy chain constant region can be modified to have a different amino acid sequence from that of naturally occurring immunoglobulin molecules.
[0073] The heavy chain constant region of the antibody disclosed herein may be derived from different immunoglobulin molecules. For example, the heavy chain constant region of a polypeptide may include a CH1 domain derived from an IgG1 molecule and a hinge region derived from an IgG3 molecule. In other examples, the heavy chain constant region may include hinge regions partially derived from an IgG1 molecule and partially derived from an IgG3 molecule. In other examples, the heavy chain portion may include a chimeric hinge partially derived from an IgG1 molecule and partially derived from an IgG4 molecule.
[0074] In this specification, the term "normal light chain region" includes an amino acid sequence derived from an antibody light chain. For example, the normal light chain region includes at least one of a normal kappa domain or a normal lambda domain.
[0075] The subunit structures and three-dimensional configurations of the normal regions of various immunoglobulin classifications are widely known. As used herein, the term “domain” includes the amino-terminal variable domain of the immunoglobulin heavy chain, and the term “domain” includes the first (most amino acid terminal) normal region domain of the immunoglobulin heavy chain. The CH1 domain is adjacent to the VH domain and is amino-terminal with respect to the immunoglobulin heavy chain molecule and the hinge region.
[0076] In this specification, the term “domain” includes, for example, the portion of the heavy chain molecule extending from approximately antibody residue 244 to residue 360 using a standard numbering scheme (residues 244–360, Kabat numbering system; and residues 231–340, EU numbering system; see Kabat et al., USDept. of Health and Human Services, “Sequences of Proteins of Immunological Interest” (1983)). The CH2 domain is also unique in that it does not form a close pair with any other domain. Rather, two N-linked branched carbohydrate chains are interposed between the two CH2 domains of the intact and unique IgG molecule. The CH3 domain is also commonly recorded as extending from the CH2 domain to the C-terminus of the IgG molecule and containing approximately 108 residues.
[0077] In this specification, the term “hinge region” includes a portion of the heavy chain molecule that binds the CH1 domain to the CH2 domain. This hinge region comprises approximately 25 residues, is flexible, and therefore allows the two N-terminal antigen-binding regions to move independently. The hinge region can be subdivided into three distinct domains: upper, middle, and lower hinge domains (Roux et al., J.Immunol 161:4083 (1998)).
[0078] In this specification, the term “disulfide bond” includes the covalent bond formed between two sulfur atoms. The amino acid cysteine contains a thiol group that can form a disulfide bond or bridge with a second thiol group. In most naturally occurring IgG molecules, the CH1 and CL regions are linked by a disulfide bond, and the two heavy chains are linked by two disulfide bonds at positions corresponding to 239 and 242 (position 226 or 229, EU numbering system) using the Kabat numbering system.
[0079] Here, “antigen-binding region or site” refers to a protein or part of a protein that specifically binds to a particular antigen. For example, it refers to a part of an antibody that contains amino acid residues that interact with the antigen to provide an antibody with specificity and affinity for that antigen. This antigen-binding region typically includes one or more “complementary determining regions (CDRs).” A particular antigen-binding region also includes one or more “framework (FR)” regions. These framework regions help maintain the proper form of such CDRs and facilitate binding between the antigen-binding region and antigens.
[0080] In this specification, the "Fc" region comprises two heavy chain fragments containing the CH2 and CH3 domains of the antibody. These two heavy chain fragments are linked to each other by two or more disulfide bonds and hydrophobic interactions of the CH3 domain.
[0081] The Fc domain may be an IgG Fc domain, for example, IgG1, IgG2, IgG3, IgG4, or a combination thereof, and the immunoglobulin's Fc domain may be not only a wild-type Fc domain but also an Fc domain variant. Furthermore, as used herein, the term "Fc domain variant" may refer to a form that differs from the glycosylation pattern of a wild-type Fc domain, has increased glycans compared to a wild-type Fc domain, decreased glycans compared to a wild-type Fc domain, or has been deglycosylated. Aglycosylated Fc domains are also included. The Fc domain or variant may have a number of sialic acid, fucosylation, or glycosylations that have been adjusted through culture conditions or host genetic recombination.
[0082] The Fc region plays a role in enhancing the stability of the antibody and may have effects such as extending the half-life (e.g., in vivo half-life) and / or reducing renal filtration. In one specific example, the Fc region of the immunoglobulin may be selected from the Fc region of IgG1 and the Fc region of IgG4. The Fc region of IgG1 may include the CH2 domain, CH3 domain, or CH2+CH3 domain of IgG1 and may or may not include the hinge region of IgG1 at the N-terminus. The Fc region of IgG4 may include the CH2 domain, CH3 domain, or CH2+CH3 domain of IgG4 and may or may not include the hinge region of IgG4 at the N-terminus.
[0083] IgG1 may be derived from primates such as humans or rodents such as mice and rats, for example, human IgG1 (UniProtKB P01857). IgG4 may be derived from primates such as humans or rodents such as mice and rats, for example, human IgG4 (UniprotKB P01861).
[0084] When the Fc region of an immunoglobulin is used to extend the (in vivo) half-life of a protein ligated to its N-terminus or C-terminus, it is important to minimize any effector function of the Fc region to reduce side effects. In this respect, the human IgG4 Fc region is advantageous compared to other IgG serve-types due to its lower binding affinity between FcγR and complement factors. Furthermore, the human IgG4 Fc region may have further reduced effector function due to the inclusion of amino acid substitutions. The amino acid substitutions in the human IgG4 Fc region to reduce the effector function may include one or more of the following: substitution of phenylalanine at residue 234 of human IgG4 (UniprotKB P01861) to alanine, and substitution of leucine at residue 235 to alanine (included in the CH2-CH3 domain region of IgG4 Fc; the amino acid residue numbers are based on EU numbering [Kabat, EA et al. (1991) Sequences of Proteins of Immunological Interest, 5th edition, USD ept. of Health and Human Services, Bethesda, MD, NIH Publication no. 91-3242]). Furthermore, the Fc region of IgG4 may include amino acid substitutions that stabilize heavy chain dimer formation and prevent the formation of half-IgG4 Fc chains. Such amino acid substitutions may include substitution of serine at amino acid residue 228 of the human IgG4 (UniprotKB P01861) Fc region (based on EU numbering; included in the hinge region) to proline.
[0085] In this specification, the terms “antigen” or “immunogen” mean, for example, a molecule or part of a molecule to which an antigen-binding protein (e.g., an antibody or its immunologically functional antigen-binding fragment) can bind and which can be used to produce an antibody that can bind to an antigen in an animal. The antigen may comprise one or more epitopes that can interact with different antibodies or fragments thereof. In one embodiment, the antigen may be a membrane protein of a cancer stem cell or cancer cell, and specifically, ITGA3 (Integrin Subunit Alpha 3) or VLA3 (Integrin alpha 3 beta 1).
[0086] In this specification, the term “epitope” refers to a part of a molecule that is bound to or recognized by an antigen-binding protein or antibody, and includes any determinant that can specifically bind to an antigen-binding protein, such as an antibody or a T-cell receptor. The epitope may be continuous or discontinuous; for example, in a polypeptide sequence, it may be amino acid residues that are not continuous with each other but are bound by one antigen-binding protein on a molecular side, such as a structural epitope, or it may be separated from each other. In one specific example, the epitope may be a mimetic in that it includes a three-dimensional structure similar to an epitope used in antibody production, but does not include the residues found in the epitope, or may include only some of the residues. Generally, the epitope is a protein, but it may be another type of substance, such as a nucleic acid. The epitope-determining factors may be chemically active groups formed on the surface by molecules such as amino acids, sugar side chains, phosphoryl groups, or sulfonyl groups, or they may have specific three-dimensional structural properties and / or specific charge properties. Generally, antibodies specific to a particular target antigen recognize epitopes of the target antigen present in protein and / or polymer complexes.
[0087] In this specification, “amino acid” includes the general meaning as understood in the art. The 20 naturally occurring amino acids and their abbreviations are the same as those commonly used in the art (Immunology-A Synthesis, 2nd Edition, ESGolub and DR Green, eds., Sinauer Associates: Sunderland, Mass. 1991). The amino acids include typical amino acids, stereoisomers of the 20 typical amino acids (D-amino acids), unnatural amino acids, such as α- and α-disubstituted amino acids, N-alkyl amino acids, and other atypical amino acids. Examples of atypical amino acids include 4-hydroxyproline, γ-carboxyglutamate, ε-N,N,N-trimethyllysine, ε-N-acetyllysine, O-phosphoserine, N-acetylserine, N-formylmethionine, 3-methylhistidine, 5-hydroxylysine, σ-N-methylarginine, and other similar amino acids and imino acids (e.g., 4-hydroxyproline). In the polypeptide mark used herein, the left side of the sequence represents the amino terminus and the right side represents the carboxy terminus, as is commonly used in the industry.
[0088] In this specification, “polypeptide” and “protein” mean polymers of amino acid residues and are used interchangeably herein. This also includes polymers of naturally occurring amino acid residues as well as polymers of their analogues or mimetics. Furthermore, the polypeptide or protein may include modifications such as the addition of carbohydrates for phosphorylation or glycosylation. In addition, the polypeptide or protein may be produced in recombinant or naturally occurring cells. Furthermore, the polypeptide or protein may include wild-type sequences or sequences in which parts of the amino acid sequence are deleted, added, and / or substituted. Furthermore, the polypeptide or protein may be an antibody or antigen-binding fragment, or a sequence in which one or more amino acids are deleted, added, and / or substituted. Furthermore, “polypeptide fragment” means a polypeptide having amino-terminal deletions, carboxyl-terminal deletions, and / or internal deletions compared to a full-length protein. This fragment may also contain modified amino acids compared to a full-length protein. In one specific example, the fragment may have an amino acid length of about 5 to 500, for example, at least 5, 6, 8, 10, 14, 20, 50, 70, 100, 110, 150, 200, 250, 300, 350, 400, 450, 500, 550, 600, 650, 700, 750, 800, 850 or more. In consideration of the object of the present invention, the useful polypeptide fragment includes an immunologically functional fragment of an antibody containing an antigen-binding domain. In the case of a cancer stem cell or cancer cell membrane protein-binding antibody according to one specific example, such a useful fragment includes, but is not limited to, a CDR sequence containing one, two, or three heavy or light chains, or all or part of an antibody chain containing variable or normal regions of heavy or light chains.
[0089] In this specification, “isolated polypeptide, antibody, or protein” means that there are no other proteins commonly found with them, and at least about 50% or more of the lipids, carbohydrates, and polynucleotides naturally linked to them have been removed. Typically, the isolated protein, polypeptide, or antibody contains about 5% or more, about 10% or more, about 25% or more, or about 50% or more in a particular composition. The polypeptide may be encoded by genomic DNA, cDNA, mRNA, or other synthetically derived RNA, or any combination thereof. In particular, the isolated protein, polypeptide, or antibody is substantially free of other protein or other polypeptide contaminants that would hinder its application to therapeutic, diagnostic, and preventive research or other uses.
[0090] The antibodies and / or antigen-binding fragments disclosed herein may include “variants,” which may refer to polypeptides in which one or more amino acid residues are inserted, deleted, added, and / or substituted from the polypeptide sequence, and may include fusion polypeptides by linking to other polypeptides, as long as the desired biological activity and / or structure of the antibody and / or antigen-binding fragment is maintained. Furthermore, the variants may include modifications that are altered by protein enzymatic cleavage, phosphorylation, and / or other post-translational modifications, but which maintain the biological activity of the antibody and / or antigen-binding fragments disclosed herein, for example, binding and specificity to ITGA3 or VLA3. The variant may have 80% or more, 85% or more, 90% or more, 95% or more, 96% or more, 97% or more, 98% or more, or 99% or more sequence identity with respect to the sequence of the antibody or antigen-binding fragment disclosed herein, for example, it may have about 99%, 98%, 97%, 96%, 95%, 94%, 93%, 92%, 91%, 90%, 89%, 88%, 87%, 86%, 85%, 84%, 83%, 82%, 81%, or 80% sequence identity. The percentage identity (%) or homology can be calculated as 100 × [(same position) / min (TGA, TGB)], where TGA and TGB are the sum of the number of residues of sequences A and B being compared. Comparison and location of internal gaps (Russell et al., J. Mol Biol., 244:332-350 (1994)).
[0091] In this specification, "conservative amino acid substitution" means a substitution that does not substantially affect the activity or antigenicity of the polypeptide. The polypeptide may contain one or more conservative substitutions.
[0092] In this specification, a "derivative" of a polypeptide means a polypeptide that has been chemically modified from one or more residues by conjugation with another chemical moiety, which is different from insertion, deletion, addition, or substitution mutants.
[0093] In this specification, “identity” means the sequence similarity between two or more polypeptides or polynucleotides, determined by sequence-comparing them. Such sequence identity is generally expressed as an “identity percentage,” which represents the ratio of identical amino acids or nucleotides between the molecules being compared, calculated based on the size of the smallest molecule among those being compared.
[0094] One embodiment relates to an antibody that binds to cancer stem cells or cancer cell membrane proteins, specifically a recombinant antibody that specifically binds to ITGA3 or VLA3 or its antigen-binding fragment. In this embodiment, the “recombinant protein” is a protein produced using recombinant technology, i.e., through the expression of a recombinant nucleic acid according to one specific example. Methods and techniques for producing recombinant proteins are widely known in the art.
[0095] In this specification, the terms “affinity” or “binding strength” refer to the strength of the interaction between an antibody or its antigen-binding fragment and an antigen, which is determined by the characteristics of the antigen, such as its size, shape, and / or charge, and the CDR sequence of the antibody or antigen-binding fragment. Methods for determining such affinity are known in the art.
[0096] The antibody or its antigen-binding fragment has a dissociation constant (K D ) is 10 -6 When the antibody is less than or equal to M, it is said to "specifically bind" to a target such as an antigen. D is 1 x 10 -8 If the value is M or less, it binds specifically to the target with "high affinity".
[0097] As demonstrated in the examples, the antibodies specific to cancer stem cells or cancer cell membrane proteins disclosed herein, specifically anti-ITGA3 or anti-VLA3 antibodies, exhibit ITGA3 or VLA3 binding ability, binding ability to ITGA3 or VLA3 expressed on the cell surface, and high ITGA3 or VLA3 binding affinity. Furthermore, as demonstrated in the examples, the anti-ITGA3 or anti-VLA3 antibodies disclosed herein have antitumor effects in vivo.
[0098] Such anti-ITGA3 or anti-VLA3 antibodies may be useful for therapeutic purposes, such as treating various types of cancer, and may also be used for diagnostic and prognostic purposes.
[0099] Another embodiment provides a pharmaceutical composition for the treatment or prevention of cancer, comprising the antibody or a functional fragment thereof.
[0100] Another embodiment provides a method for treating or preventing cancer, comprising the step of administering an effective amount of the antibody or a functional fragment thereof to an individual in need.
[0101] The aforementioned cancers include blood cancer, lung cancer, stomach cancer, liver cancer, bone cancer, pancreatic cancer, skin cancer, head and neck cancer, skin melanoma, uterine cancer, ovarian cancer, rectal cancer, brain cancer, colorectal cancer, colon cancer, breast cancer, triple-negative breast cancer, uterine sarcoma, fallopian tube carcinoma, endometrial carcinoma, uterine cervical carcinoma, vaginal carcinoma, vulva carcinoma, and esophageal cancer. Cancer, laryngeal cancer, small-intestine cancer, thyroid cancer, parathyroid cancer, soft-tissue sarcoma, urethral cancer, penile cancer, prostate cancer, chronic or acute leukemia, solid tumors in juvenile stage, differentiated lymphoma, bladder cancer, oral cavity carcinoma, renal cancer, renal cell carcinoma, renal pelvic cancerThis may include, but is not limited to, carcinoma, primary central nervous system lymphoma, spinal axis tumors, glioma, brain stem glioma, and pituitary adenoma.
[0102] The aforementioned cancer may include solid tumors and non-solid tumors.
[0103] In this specification, “therapeutic agent” or “pharmaceutical composition” means a molecule or composition administered to a target organism for a targeted therapeutic effect. The organism includes non-human mammals, such as primates, or humans. Examples of therapeutic agents include proteins, nucleic acids, antibodies, or small molecular compounds, including peptides and polypeptides. In other words, the therapeutic agent may be used as an antibody or, conjugated to an antibody, as a therapeutic agent for diseases such as cancer.
[0104] In this specification, the term “treatment(t)” means the alleviation or treatment of an injury, disease, or the symptoms of a disease, including any objective or subjective parameters, including reduction or alleviation of the injury, disease, or condition, or enabling the patient to better tolerate the symptoms of the injury, disease, or disease, or slowing the rate of progression of the symptoms of the injury, disease, or disease, or improving the patient’s mental or physical quality of life. Such treatment or improvement of the symptoms of an injury, disease, or disease may be determined based on the results of a physical examination, various disease-related indicator tests and imaging tests.
[0105] In this specification, “effective amount (dose)” means an amount sufficient to reduce the severity and / or frequency of a disease, eliminate the underlying cause of the disease, prevent the onset of symptoms caused by the underlying cause of the disease, and / or improve or correct the damage caused by the disease. In one specific example, the effective amount is a therapeutic effective amount or a prophylactic effective amount. The “therapeutic or pharmaceutically effective dose” is an amount sufficient to treat, prevent, delay, or reverse the progression of symptoms or conditions associated with a disease. The “prophylactic effective dose” is a dose for preventing, delaying, or reducing the onset or recurrence of a disease or its symptoms. The complete therapeutic or prophylactic effect may be achieved by multiple doses rather than a single dose. Therefore, the therapeutic or prophylactic effective dose can be delivered by one or more doses. The effective amount can be appropriately selected by those skilled in the art depending on the cells or organisms being selected. The severity of the disease, the patient's age, weight, health, sex, the patient's sensitivity to the drug, the time of administration, the route of administration and elimination rate, the duration of treatment, the composition used and any drugs that are compounded or used concurrently, and other factors well known in the medical field.
[0106] The method of treating a cancer patient includes administering a pharmaceutical composition comprising an antibody, an antibody conjugate, a pharmaceutically acceptable salt thereof, or a solvate thereof in a therapeutically effective amount, and a pharmaceutically acceptable diluent, carrier, solubilizer, emulsifier, preservative, and / or adjuvant. The term “patient” includes human patients.
[0107] The pharmaceutical composition may contain a pharmaceutically acceptable carrier. The carrier is used in the sense of being an excipient, diluent, or auxiliary agent. The carrier may be selected from the group consisting of, for example, lactose, dextrose, sucrose, sorbitol, mannitol, xylitol, erythritol, maltitol, starch, acacia gum, alginic acid, gelatin, calcium phosphate, calcium silicate, cellulose, methylcellulose, polyvinylpyrrolidone, water, physiological saline, buffer such as PBS, methyl hydroxybenzoate, propyl hydroxybenzoate, talc, magnesium stearate, and mineral oil. The composition may also contain fillers, anti-agglomerates, lubricants, wetting agents, flavoring agents, emulsifiers, preservatives, or combinations thereof.
[0108] The aforementioned pharmaceutical composition can be prepared in any dosage form by conventional methods. The composition can be formulated, for example, as an oral dosage form (e.g., powder, tablet, capsule, syrup, pill, or granule) or as a parenteral dosage form (e.g., injection). The composition can also be manufactured as a systemic dosage form or as a topical dosage form.
[0109] Another embodiment provides a polynucleotide encoding the antibody or a functional fragment thereof.
[0110] Another embodiment provides a recombinant vector containing the polynucleotide.
[0111] Another embodiment provides recombinant cells containing the vector.
[0112] In this specification, “polynucleotide” or “nucleic acid” includes single or double-stranded nucleotide polymers. Such polynucleotides may be ribonucleotides or deoxyribonucleotides, or modified forms thereof.
[0113] In this specification, “isolated nucleic acid molecule” means DNA or RNA derived from a genome, or mRNA, cDNA, or a combination thereof, which is linked to a polynucleotide that is not associated with a naturally occurring or undiscovered polynucleotide, in whole or in part. For the purposes of the present invention, the nucleic acid molecule containing a particular nucleic acid sequence does not include an intact chromosome. Instead, the isolated nucleic acid molecule containing a particular nucleic acid sequence may, in addition to that particular sequence, contain at least several additional protein-coding sequences, or further contain regulatory sequences and / or vectors for the expression of the particular nucleic acid sequence.
[0114] In this specification, the term “regulatory sequence” means a polynucleotide sequence that can be operably linked to influence the expression and processing of a coding sequence. The properties of a regulatory sequence are influenced by the host type. For example, a regulatory sequence applicable to prokaryotic cells may include a promoter, optionally an operator, a ribosome binding site, and a transcription termination sequence. In eukaryotic cells, the regulatory sequence may include a promoteor comprising a multiple recognition site, a transcription enhancer, a polyadenylation sequence, and a transcription termination sequence. The regulatory sequence may further include a reader sequence and / or a fusion partner sequence.
[0115] In this specification, “vector” means all molecules used to transmit protein-encoding nucleic acid molecules to host cells, including, for example, nucleic acids, plasmids, bacteriophages, or viruses.
[0116] In this specification, “expression vector” or “recombinant vector” means a vector suitable for transforming host cells and includes a nucleic acid sequence that is operably ligated to the expression vector to regulate the expression of a heterologous sequence encoding a target protein. The expression vector may also include sequences that can be operably ligated to the coding sequence and that perform transcription, translation, and, if introns are present, RNA splicing or affect it.
[0117] In this specification, “operably connected or linked” means that the nucleic acid sequence to be linked is positioned so that it can perform its targeting function under appropriate conditions. For example, in a vector containing a coding sequence and a regulatory sequence, if the transcription of the coding sequence is affected by the regulatory sequence under appropriate conditions, it is operably linked.
[0118] In this specification, “host cell” means a cell that is transformed by a target nucleic acid sequence or that can express the target gene to be transformed. The same term includes offspring of the host cell, regardless of the host cell’s identity, morphology, and genetic makeup, as long as they express the target gene.
[0119] In this specification, “transduction” generally refers to the transfer of nucleic acids from one bacterium to another by a bacteriophage. This includes, for example, the transfer of nucleic acids to a eukaryotic cell using a non-replicating retrovirus.
[0120] In this specification, “transfection” means that a cell acquires foreign or exogenous DNA, in which case the DNA is introduced into the cell through the cell membrane. This can be seen in methods known in the art, e.g., Sambrook et al., Molecular Cloning: A Laboratory Manual, 4th ed., Cold Spring Harbor Laboratory Press, Cold Spring Harbor, NY (2012), and Ausubel et al., Current Protocols in Molecular Biology, Greene Publishing Associates.
[0121] In this specification, “transformation” means a change in the genetic characteristics of a cell, in which the cell is altered to contain new DNA or RNA. For example, a cell can be transformed by introducing new genetic material through transduction, transfection, or other techniques, thereby altering the cell’s genetic characteristics. DNA transformed by methods such as transduction or transfection may exist physically integrated into the cell’s chromosomes, exist transiently as an episome without replication, or exist as a replicable plasmid. When transformed DNA is replicated by host cell division, it is considered stably transformed.
[0122] Another embodiment provides a cancer diagnostic composition comprising an antibody or a functional fragment thereof.
[0123] Another embodiment provides a cancer diagnostic kit containing the composition.
[0124] A diagnostic composition containing an antibody or fragment thereof according to one specific example can be used to diagnose diseases associated with the presence or degree of expression of ITGA3 or VLA3, or diseases mediated by ITGA3 or VLA3, such as cancer.
[0125] The aforementioned cancer diagnostic kit may further comprise a composition, solution, or apparatus having one or more other components suitable for the analytical method.
[0126] Another embodiment provides a reagent composition comprising the aforementioned composition. [Effects of the Invention]
[0127] An antibody specific to a membrane protein of cancer stem cells or cancer cells according to one embodiment exhibits strong affinity for ITGA3 or VLA3 and excellent intracellular integration. Based on this antibody, unconjugated antibodies, antibody-drug conjugates (ADCs), and other antibody conjugates can be usefully used in the diagnosis, treatment, or development of therapeutic agents for various cancers. [Brief explanation of the drawing]
[0128] [Figure 1] This document outlines methods for discovering intracellularly located antibodies and identifying antigens. [Figure 2] This outlines a method for discovering antibodies that bind to and internalize cancer stem cell membranes. [Figure 3] Figure 3a shows a histogram of validated and selected antibodies specific to cancer stem cell membranes and cancer cell membrane proteins, and Figure 3b shows a histogram of validated and selected scFv-Fc antibodies specific to cancer stem cell membranes and cancer cell membrane proteins. [Figure 4a] This shows the representative ITGA3 peptide and ITGB1 peptide sequences identified by LC-MS / MS as the antigen of the PS4 antibody being VLA-3. [Figure 4b] This graph shows the results of PS4 selection antibodies against target proteins integrin alpha3 and integrin β1 (left) and the results of verifying the specificity of PS4 antibodies against antigens using ELSIA on various recombinant proteins (right). [Figure 4c]The specificity of the PS4 antibody against cell membrane target antigens was analyzed by transfecting HEK293T cells with ITGA3, ITGB1, and ITGA1 / ITGB1 cDNA. [Figure 4d] This is the result of analyzing the specificity of the PS4 antibody after knocking out the ITGA3 gene in the MDA-MB-231 cancer stem cell line using CRISPR-Cas9 and then binding the PS4 antibody to it. [Figure 4e] This is the result of analyzing the PS4 antibody specificity after treating the MDA-MB-231 cell line with ITGA3, ITGB1, and ITGA1 / ITGB1 siRNA. [Figure 5a] This graph shows the intracellular integration rate of the PS4-002 antibody in the MDA-MB-453 cell line. [Figure 5b] This is the result of verifying that antibodies are co-localized to lysosomes via immunofluorescence staining. [Figure 6a] This shows the affinity analysis results of the PS4-002 antibody for recombinant VLA-3 protein, depending on the presence or absence of co-factor divalent cations (Mn2+, Ca2+, Mg2+) and chelates (EDTA). [Figure 6b] This is the result of analyzing the affinity between PS4-002 and VLA-3 using a buffer without chelate (EDTA). [Figure 6c] This is the result of measuring the off-rate of the PS4 antibody using HBS-EP buffer containing 3 mM EDTA. The ligand was PS4-002 and the analyte was VLA-3. [Figure 7a] This report presents the results of an analysis of the specificity of the PS4-001 antibody and the expression of target antigens in various breast cancer, gastric cancer, pancreatic cancer, and colorectal cancer cell lines. [Figure 7b] This report presents the results of an analysis of the specificity of the PS4-002 antibody and the expression of target antigens in various breast cancer, gastric cancer, pancreatic cancer, colorectal cancer, and ovarian cancer cell lines. [Figure 7c]This report presents the results of an analysis of the specificity of the PS4-004 antibody and the expression of its target antigen in various breast cancer, pancreatic cancer, and colorectal cancer cell lines. [Figure 8] This is a graph showing the results of a comparative analysis of the expression of ITGA3 in normal tissues and cancer: BLCA, bladder urothelial carcinoma; BRCA, breast invasive carcinoma; CESC, Cervical squamous cell carcinoma and endocervical adenocarcinoma; CHOL, Cholangiocarcinoma; COAD, Colon adenocarcinoma; ESCA, Esophageal carcinoma; GBM, Glioblastoma multiforme; HNSC, Head and Neck. squamous cell carcinoma;KICH, Kidney Chromophobe;KIRC, Kidney renal clear cell carcinoma;KIRP, Kidney renal papillary cell carcinoma;LIHC, Liver hepatocellular carcinoma;LUAD, Lung adenocarcinoma;LUSC, Lung squamous cell carcinoma;PADD, Pancreatic adenocarcinoma;PCPG, Pheochromocytoma and Paraganglioma;PRAD, Prostate adenocarcinoma;READ, Rectum adenocarcinoma;SARC, Sarcoma;SKCM, Skin Cutaneous Melanoma;STAD, Stomach adenocarcinoma;THYM, Thymoma;THCA, Thyroid carcinoma;UCEC, Uterine Corpus Endometrial Carcinoma. [Figure 9a] This graph shows a comparative analysis of ITGA3 expression in normal tissue and bladder cancer. [Figure 9b]This graph shows a comparative analysis of ITGA3 expression based on bladder cancer molecular subtypes. [Figure 9c] This graph shows a comparative analysis of ITGA3 expression based on individual patient bladder cancer stages. [Figure 10a] This graph shows a comparative analysis of ITGA3 expression in normal tissue and pancreatic cancer. [Figure 10b] This graph shows a comparative analysis of ITGA3 expression based on individual pancreatic cancer stages in patients. [Figure 11a] This graph compares the mRNA expression levels of ITGA3 in normal pancreas and pancreatic cancer. [Figure 11b] This graph compares and analyzes the overall survival probability based on ITGA3 expression in pancreatic cancer patients. [Figure 11c] This graph compares and analyzes the overall survival probability based on ITGA3 expression in TNBC patients. [Figure 12] This diagram shows a schematic representation of the production of a PS4 antibody variant: WT stands for PS4, and the inserted Cys region is indicated by a red circle. [Figure 13a] This shows the RP-HPLC chromatograms of PS4-002 (red) and PS4-vcMMAE (blue). [Figure 13b] This shows the MALDI-TOF mass spectra of PS4-002(a) and PS4-002-vcMMAE(C~E). [Figure 13c] This image shows an enlarged SEC-HPLC chromatogram of PS4-002-vcMMAE. [Figure 13d] This is the result of a comparative analysis of the efficacy of PS4-002-vcMMAE conjugates across batches. [Figure 14a] The left side shows the results of analyzing the target antigen binding ability of PS4 and PS4 variant antibodies and their MMAE drug conjugates based on VLA-3 antigen concentration, while the right side shows the results of analyzing the antigen binding ability based on the concentrations of PS4 antibody and PS4-antibody drug conjugate. [Figure 14b]This is the result of an analysis of the efficacy of PS4-002 and PS4-002 variants conjugated with MMAE drugs in killing breast and pancreatic cancer cell lines. [Figure 15] This is the result of an analysis of the thermal stability between the PS4 antibody and the PS4 antibody-drug conjugate. [Figure 16a] The following are the results of in-vitro efficacy analysis of PS4 antibody-drug conjugates in various cancer cell lines: pancreatic cancer cell lines Panc-1, Aspc-1; triple-negative breast cancer cell lines BT-20, MDA-MB-468, MDA-MB-231, MDA-MB-453; gastric cancer cell line MKN4; lung cancer cell line A549; and negative control cell line MDA-MB-231 ITGA3 KO. [Figure 16b] This report presents the results of an in-vitro efficacy analysis of PS4 antibodies and PS4 antibody-drug conjugates in bladder cancer cell lines: bladder cancer cell lines UMUC-3, CoCaB1, SCaBER, SW780, and the negative control cell line UMUC3-ITGA3 KO. The control ADC was hIgG-MMAE. [Figure 17a] This shows the in vivo anticancer efficacy results of the PS4-vcMMAE antibody-drug conjugate in a triple-negative breast cancer BALB / c model. [Figure 17b] This shows the in vivo anticancer efficacy results of the PS4-vcMMAE antibody-drug conjugate in a triple-negative breast cancer NOD / SCID model. [Figure 17c] This is the in vivo anticancer efficacy result of the PS4-vcMMAE antibody-drug conjugate in a triple-negative breast cancer model. [Figure 18] This result confirms that the PS4-vcMMAE conjugate suppresses tumor growth in a pancreatic cancer PANC-1 xenograft model. [Modes for carrying out the invention]
[0129] The following are preferred embodiments to aid in understanding the present invention. However, the following embodiments are provided to facilitate understanding of the present invention and do not limit the scope of the present invention.
[0130] Preparation example 1. Cell culture All cell lines were cultured according to the supplier's guidelines unless otherwise specified. Cells were cultured at 37°C and 5% CO2 using DMEM and RPMI1640 culture medium containing 10% FBS and 1% penicillin / streptomycin. CHO-DG44 cells were cultured at 37°C and 5% CO2 incubator in DMEM / F12 HEPES (Invitrogen) containing 10% FBS, 1% penicillin / streptomycin, and an HT supplement (sodium hypoxanthine, thymidine mixture). Cancer stem cells (CSCs) were constructed based on MDA-MB-453 and confirmed to overexpress stem cell markers such as CD44 / CD133 (Kim, EG et al. Conjugates. Biomolecules 2020, 10, 955).
[0131] Example 1. Discovery and validation of internalizing antibodies that bind to cancer stem cell lines. To discover antibodies that recognize the phenotypic structure (native phenotypic structure and microenvironment of the target protein) of cancer stem cell membrane proteins and possess superior intracellular internalization capabilities, we utilized live-cell biopanning as shown in Figure 1 to secure antibodies and identify the antigens that these antibodies specifically recognize through characterization analysis.
[0132] Antibodies that bind to the cancer stem cell membrane while also internalizing were obtained by performing the following biopanning technique (Figure 2). Cancer stem cell line 1 × 10 6 cells and 1 × 10 10After mixing the pfu scFv-phage antibodies and incubating them at 4°C for 1.5 hours, they were centrifuged at 400×g for 5 minutes to separate the cells and the phage-scFv antibodies. The scFv-phage antibodies that did not bind to the cell line were removed by performing a washing process 5 times with DMEM / 1% BSA. Incubation was carried out for 1 hour in a 37°C CO₂ incubator for the internalization of the phage-scFv bound to the cell line. To separate the antibodies that specifically bind to cancer stem cells, the cells were placed in dibutylphthalate:cyclohexane 9:1 non-miscible organic lower phase and then centrifuged at 10,000×g for 10 minutes. After freezing the organic phase using dry ice, the lower part of the tube was cut off to remove the supernatant. After washing the cell pellet with PBS, the phage-scFv antibodies bound to the cell membrane were separated using a solution of 150 mM NaCl, 0.1 M glycine, pH 2.8. The phage-scFv antibodies internalized inside the cells were obtained by lysing the cells with a 100 mM trimethylamine (TEA) solution.
[0133] Example 2. Selection of Specific Single Antibodies That Bind to Cancer Stem Cell Lines Antibodies with the ability to recognize the native phenotypic structure / microenvironment of the target protein expressed on the cancer stem cell membrane and internalize were selected as follows.
[0134] Phage antibodies or maxibodies (2.5 μg / mL) and cells (1×10 6The cells were incubated at 4°C for 1 hour to allow binding, and then washed three times with PBS, 1% BSA, 0.03% NaN3, and pH 7.4 buffer. Mouse anti-M13 phage antibody (Thermo Scientific) and Alexa Flour 647 goat anti-mouse antibody (Jackson Immunoresearch) were added in that order, and the phage antibodies that specifically bound to the cells were fluorescently labeled. Fluorescence detection and data analysis of the labeled antibodies were performed using a FACS caliber (BD Bioscience) and CellQuest Pro software. To verify the specificity of the selected phage antibodies against cancer stem cell membrane antigens, the phage antibodies were converted to the scFv-human IgG1 Fc form (referred to herein as Maxibody) with the Fc domain of human IgG1 bound, and then fluorescently labeled with anti-huIgG antibodies using the method described above.
[0135] Maxibodies were prepared using a technique similar to one previously reported in our laboratory (Kim, EGet al., Biomolecules 2020, 10, 955). Briefly, the scFv portion of the phage antibody was cloned into a pCEP4 vector containing the human IgG1 Fc domain, and then antibody expression was carried out in Expi-CHO cells according to Thermo's manual. The expressed antibody was purified and isolated via the ATKA system using a MabselectSuRe column.
[0136] In this way, the binding of antibodies to cell surface integrin proteins was confirmed using MDA-MB-453 (CSC) and MDA-MB-453 (NCSC). As a result, phage-antibodies that bind to CHO cell lines, a negative control group compared to cancer stem cells (CSCs), were comparatively analyzed, and phage-antibodies that specifically bind to cancer stem cell membrane proteins were selected (Figure 3a). Furthermore, phage-antibodies were converted to Maxibody antibodies (scFv-human IgG1 Fc / scFv-Fc) and their specific binding to cancer cell membrane proteins was verified (Figure 3b). The antibodies selected in this way were named PS4-001, PS4-002, PS4-003, and PS4-004, respectively (hereinafter referred to as PS4 antibodies), and their scFv sequences are shown in Tables 1 to 4 below.
[0137] [Table 1] JPEG2026519408000003.jpg14154
[0138] [Table 2] JPEG2026519408000005.jpg39154
[0139] [Table 3] JPEG2026519408000007.jpg14154
[0140] [Table 4] JPEG2026519408000009.jpg26154
[0141] Example 3. Analysis and validation of PS4 antibody-recognized antigen (target). In situ immunoprecipitation and LC-MS / MS analysis were performed to identify the target antigen of a screening antibody that specifically binds to MDA-MB-453 cancer stem cells.
[0142] In short, the PS4 Maxibody antibody from Example 2 was incubated in the target cancer cell line. The antibody and antigen were then stably chemically bound using the BS3 chemical binder, and the antibody-antigen complex was pulled down. After SDS-PAGE separation of the obtained antibody-antigen complex, the presence of the complex was compared with the control group using a western blot to confirm the target antibody / antigen position. In-gel digestion was then performed on the expected antibody / antigen gel portion on the SDS-PAGE. Through this process, LC-MS / MS analysis was performed on the extracted peptide, and the protein recognized by the antibody was identified using protein database search tools such as PD 2.3 and PEAKS studio. To ensure reliable target protein identification, the PS4 antibody target was identified as ITGA3 / ITGB1(VLA-3) through a process of selecting a candidate group of target antigens by comparing proteins identified in the negative control group with proteins specifically identified in the sample group containing PS4 antibodies using label-free quantitative analysis.
[0143] The identified PS4 target proteins were validated by ELISA and flow cytometry as follows: Recombinant proteins were coated onto ELISA plates, blocked with PBS / 3% milk, and then incubated with 1 μg / mL of selected antibodies and control human IgG antibody at room temperature for 1.5 hours. Anti-human Fc-HRP (1 / 5000 dilution) was added to each plate well and incubated at room temperature for 1 hour. After adding the TMB substrate and allowing the reaction to proceed, the HRP reaction was stopped with 0.25 M sulfuric acid and the signal was detected at 450 nm.
[0144] Flow cytometry proceeded as follows: 1 × 10⁶ cells were placed in a 100 mm cell culture plate. 6HEK293T cells were seeded. The following day, ITGA3, ITGB1, or ITGA3 / ITGB1 expression plasmids were transfected in a DNA:PEI ratio of 1:3 (w:w). After 4 hours, the medium was changed to DMEM / 10% FBS, and the cells were cultured for 48 hours. The binding of transfected cells to PS4 antibody was analyzed. ITGA3 and ITGB1 knockout (KO) or knockdown (KD) proceeded in MDA-MB-231 cells as follows: Knockdown of the target antigen was performed by placing MDA-MB-231 cells in a 6-well plate at a ratio of 1 × 10⁶ 5 After seeding at cells / mL, the experiment was performed when the cell count reached 60-80 confluent. 10 μM each of ITGA3 and ITGB1 siRNA were mixed with siRNA transfection medium and the cell line was treated and cultured for 6 hours. After 6 hours, the medium was replaced with DMEM / 10% FBS / 1% P / S, and the cells were cultured for 48 hours. The transfected cells were cultured and their binding to PS4 antibody was analyzed.
[0145] MDA-MB-231 cells with the ITGA3 gene knocked out were prepared using the following method: sgRNAs targeting exon 17 (CCAGACCTCGCTTAGCATGTGGG) of the ITGA3 gene were subcloned using the CRISPR-Cas9-2A-Puro V2.0 (Addgene) system. MDA-MB-231 cells were transfected with CRISPR-Cas9 / sgRNA and cultured at 37°C and 5% CO2 for 72 hours. Subsequently, puromycin, a sorting marker for the CRISPR-Cas9 vector, was added at 250 ng / mL for 18 days to allow sorting to proceed. Afterward, the target protein knockout efficiency was measured using flow cytometry (FACS calibur, FACS Aria, BD Biosciences), and knocked-out cells were secured. ITGA3-knocked MDA-MB-231, i.e., MDA-MB-231 / ITGA3 KO cell lines, were analyzed using flow cytometry techniques with 3 μg / mL PS4 antibody and anti-Human Fc-gamma specific Alexa Fluor-647 (1:800 dilution, Jackson ImmunoResearch Laboratories Inc.). Additionally, MDA-MB-231 / ITGA3 KO cell lysates (30 μg) were separated by SDS-PAGE and then analyzed by western blot using anti-ITGA3 (Antibodies-online) and anti-mouse Fc-gamma specific HRP. Sample loading was compared using anti-beta-actin.
[0146] The selected PS4-002 cancer stem cell antibody and the pulled-down cancer stem cell membrane target antigen were analyzed by LC-MS / MS. Compared to the negative control group, specific proteins in the target samples were identified by label-free protein quantitative analysis, analysis of electrophoretic transfer of protein mass on SDS-PAGE using a cross-linked technique, and identification of the cancer stem cell membrane target antigen recognized by the PS4 antibody through peptide sequence identification. Label-free protein analysis (spectral counting) based quantitative proteomic analysis identified integrin ITGA3 and ITGB1 peptide as target proteins of the PS4 antibody specific to MDA-MB453 (Figure 4a). Based on previously reported findings that integrin ITGA3 is formed by a specific heterodimer with integrin ITGB1, the target protein of the PS4 antibody was estimated to be ITGA3 / ITGB1, i.e., VLA-3. Furthermore, ELISA confirmed that the discovered monoclonal PS4 antibody specifically binds to recombinant human VLA-3 protein, particularly the ITGA3 subunit (Figure 4b). To analyze whether the PS4 antibody recognizes and specifically binds to cell membrane VLA-3, we temporarily overexpressed ITGA3, ITGB1, or ITGA3 / ITGB1 in HEK293T cells with low VLA-3 expression. We confirmed that the PS4 antibody selected from the experimental group compared to the control group showed increased binding affinity to HEK293T / ITGA3 and even stronger binding to HEK293 / ITGA3 / ITGB1 (i.e., VLA-3) (Figure 4c). We also confirmed that PS4 antibody binding is inhibited or reduced during ITGA3 knockout or ITGA3 / ITGB1 knockdown in MDA-MB-231 cells that overexpress VLA-3 (Figures 4d and 4e). Western blot analysis confirmed that ITGA3 was not expressed in MDA-MB-231 KO cells, and FACS verified that the PS4 antibody did not bind to the MDA-MB-231 / ITGA3 KO cell line (Figure 4d).
[0147] Therefore, the binding affinity of the PS4 antibody specifically increased in HEK293T cells overexpressing ITGA3, while in MDA-MB-231 cells, a tendency for decreased binding affinity was observed in both ITGA3 and ITGB1 knock-out / down samples. Thus, it was shown that the PS4 antibody exhibits relatively higher binding affinity to ITGA3 compared to IGBB1, but also specifically binds to the ITGA3 / BETA1 complex.
[0148] Example 4. Analysis of intracellular location characteristics of PS4 antibody The intracellular relocation characteristics of a specific PS4 antibody were analyzed as follows using flow cytometry and immunofluorescence.
[0149] Flow cytometry was performed similarly to Example 3, in which cells were conjugated with scFv or Maxibody PS4 antibody, followed by incubation at 37°C for various durations to compare and analyze the PS4 antibody bound to the cell membrane surface after antibody internalization.
[0150] Intracellular integration characteristics were analyzed via immunofluorescence using the following method: Cancer stem cells cultured in approximately 70% confluence in a confocal imaging dish were treated with scFv or Maxibody PS4 antibody and allowed to bind on ice for 1 hour. After washing once with cold PBS, the culture medium was added and incubated in a 37°C CO2 incubator for 2 hours, while control samples were kept on ice. After the intracellular integration reaction was complete, all samples were washed twice with cold PBS and fixed with 4% paraformaldehyde at room temperature for 20 minutes. Subsequently, the cell membranes were permeable with 0.1% Triton X-100 for 5 minutes and washed twice with PBS. scFv-Fc was stained with Alexa594-labeled anti-human IgG (Jackson Immunoresearch) secondary antibody, and lysosomes were stained with LAMP1 antibody (BioLegend) and Alexa Fluor 647-labeled F(ab')2 anti-mouse IgG. The nuclei were stained with 300 nM DAPI. After all reactions were complete, the cells were covered with mounting medium and coverslips, and then imaged using a confocal microscope (ZEISS LSM 880).
[0151] As a result, flow cytometry confirmed that PS4 antibodies in scFv and scFv-Fc forms exhibited rapid intracellular integration into cancer stem cell lines (Figure 5a). In particular, it was confirmed that approximately 70% of the PS4-002 PS4 antibody was internalized after 15 minutes of incubation at 37°C. Furthermore, immunofluorescence also confirmed that PS4 antibodies have the ability to internalize over time (Figure 5b). In addition, it was confirmed that after internalization of PS4 antibodies into the cell, they undergo co-localization with the lysozyme marker LAMP1.
[0152] Thus, by verifying the rapid intracellular deployment capability of the PS4 antibody using flow cytometry and immunofluorescence, these results indicate that the PS4 antibody is a suitable antibody for drug delivery systems such as antibody-drug conjugate platforms.
[0153] Example 5. Target binding affinity analysis of PS4 antibody The binding affinity between a specific PS4 antibody and a target protein (Acrobiosystem) was confirmed as follows through surface plasmon resonance (SPR) analysis.
[0154] Analysis was performed using Octet Red equipment (Sartorius) according to the manufacturer's guidelines. First, 50 nM PS4-002 antibody was loaded onto an AHC sensor (Anti-hIgG Fc, Sartorius) for 20 minutes. After washing with kinetic buffer (1 mM phosphate, 15 mM NaCl, 0.002% Tween20, 0.005% Azide, 0.1 mg / mL BSA, pH 7.4) for 10 minutes, VLA-3 recombinant protein (50 nM) and 2 mM Ca were added to the kinetic buffer. 2+ Mg 2+ Mn 2+ Alternatively, an analyte containing EDTA was added, and the association between VLA-3 antigen and PS4 antibody was measured for 1 hour. Then, the sample was washed with kinetic buffer, and disassociation was measured for 2 hours. The binding affinity of the PS4 antibody proceeded in the manner described above, but with some modifications as follows: 100 nM PS4 antibody was loaded onto an AHC biosensor that had been hydrated in kinetic buffer for 30 minutes for 10 minutes. After washing the biosensor with kinetic buffer, association with 25-120 nM of target recombinant protein proceeded for 40 minutes, followed by dissociation for 50 minutes. Affinity data measured with Octet Red were analyzed using a 1:1 fitting model with Fortebio Data Analysis 8.2 software.
[0155] Furthermore, the binding affinity of the PS4-002 antibody was analyzed using a BIAcore T200 instrument. The effect of kinetic running buffer HBS-EP and HBS-EP+ running buffer, both containing 3 mM EDTA, on the binding affinity of the PS4 antibody was investigated using the BIAcore SPR method with some modifications as follows: After immobilizing the PS4 antibody on the Sensor Chip CM5, target recombinant protein was added at concentrations of 250, 125, 62.5, 31.3, 15.6, 7.8, and 3.9 nM, and then sterilized using running buffer (10 mM HEPES, 150 mM NaCl, 3 mM EDTA, and 0.05% v / v Surfactant P20). D The value was measured.
[0156] Integrins are classified into three structural types—bent closed, extended closed, and extended open—depending on their level of activity, but it has been reported that the binding affinity between ligands and integrins varies greatly depending on the integrin structure (Peterson RJ and Koval M (2021) Above the Matrix: Functional Roles for Apically Localized Integrins. Front. Cell Dev. Biol. 9:699407). 2+ EDTA converts the ITGA3 / BETA1 protein into an inactive form, while Mg 2+ and Mn 2+ It is known that this contributes to the conversion of the ITGA3 / BETA1 protein to its active form and regulates its ligand binding with VLA-3. Therefore, in this experiment, we confirmed the difference in binding affinity between the active and inactive forms of the ITGA3 / BETA1 protein of the PS4 antibody and analyzed the antibody binding affinity due to divalent cations that affect the integrin structure.
[0157] As a result, Ca, which is known to inhibit the binding of VLA-3 to ligands,2+ Alternatively, in the comparison group containing EDTA, the binding affinity between VLA-3 and the antibody was lower, particularly the dissociation rate (off-rate 10%). -3 ~10 -4 ) was observed (Figure 6a, Table 5). In contrast, Mn, known as the ITGA3 / BETA1 activator, 2+ and Mg 2+ In the comparison group that included [the specified factor], the VLA-3 antigen-PS4 antibody binding affinity (off-rate 10) was [the specified factor]. -5 ~10 -6 We confirmed that the K between VLA-3 and PS4 antibody increases in the absence of divalent cations. D It was measured at 2.15 ± 1.2 nM. Furthermore, the HBS-EP running buffer typically used in the BIAcore technique for measuring affinity contains 3 mM EDTA. Therefore, the K measured with Biacore using the HBS-EP buffer... D The values are measured higher compared to the Octet Red equipment, and the reason for this is, as mentioned above, the measured K between Biacore and Octet Red due to the effect of off-rate. D It is determined that this had an influence on the value.
[0158] [Table 5]
[0159] Thus, we confirmed that divalent cations significantly affect the binding affinity between the ligand and ITGA3 / BETA1, and the degree of heterodimer complex formation of ITGA3 / BETA1. Through our observation that the affinity between the PS4 antibody and the ITGA3 / BETA1 protein is high in the activator form, we inferred that the antibody epitope is related to the ligand-ITGA3 / BETA1 protein binding site. In particular, we hypothesize dynamic structural changes in ITGA3 / BETA1 due to cancer progression caused by changes in divalent cation concentration in the microtumor environment, and we suggest that the antibody involved in one specific example is a cancer-specific antibody.
[0160] Example 6. Analysis of binding characteristics of cancer stem cell antibodies The binding affinity of a specific PS4 antibody to various cancer types was confirmed through flow cytometry.
[0161] First, PS4 antibodies conjugated to cell membrane antigens were labeled using selected PS4 maxibody antibodies (0.5 μg / mL) and anti-human Alexa Flour 647 secondary antibodies (Jackson Immunoresearch). Fluorescence detection and data analysis of the labeled antibodies were performed using FACS calibur (BD Bioscience) and CellQuest Pro software. Human IgG was used as the control antibody.
[0162] Furthermore, we utilized numerous database tools to analyze the differences in expression of the PS4 antibody target protein in normal and cancerous tissues and their impact on prognosis, as follows: We used a comprehensive web portal (ualcan.path.uab.edu / index.html) for in-depth analysis of TCGA gene expression data to confirm integrin RNA expression rates in normal and cancerous cells. UALCAN allows us to estimate the impact of gene expression levels and clinicopathological features on patient survival using RNA-seq and clinical data from 31 cancer types in the TCGA database. In this experiment, we used UALCAN's "TCGA Analysis" module and a dataset for 24 cancer types to obtain and analyze ITGA3 expression data in normal and cancerous cells. The Kaplan-Meier Plotter (kmplot.com / analysis / index.php?p=background) is a meta-analysis platform that allows for the discovery and validation of survival biomarkers and the analysis of genes (mRNA, miRNA, proteins) and prognosis related to breast survival. Expression for ITGA3 was confirmed at the median (or upper / lower quartile) level. For the analysis, the patient group was defined as overall survival, and ITGA3 expression and patient prognosis were analyzed. For breast cancer, HER2, ER, and PR negative groups were selected separately, and ITGA3 expression and patient prognosis in triple-negative breast cancer were analyzed. 95% (HR) confidence intervals and log-rank p-values were also calculated for each cancer.
[0163] As a result, we confirmed that the PS4 antibody related to one specific example binds to breast cancer (TNBC), gastric cancer, pancreatic cancer, ovarian cancer, colorectal cancer, and pediatric brain cancer cell lines (Figures 7a to 7c). In contrast, it showed relatively weak binding affinity to normal cell lines such as HEK293T, CHO-DG44, and PBMC cell lines, verifying that the antibody related to one specific example specifically binds to cancer cell membrane target proteins. Furthermore, we confirmed the association between VLA-3 expression levels in various cancers and cancer through immunohistochemical analysis (IHC) of genes and patient tissues, showing that the antigen recognized by the PS4 antibody, i.e., VLA-3, is overexpressed in various cancers (Figures 8 to 11). In particular, we confirmed that ITGA3 mRNA is overexpressed in pancreatic cancer compared to normal pancreas, and that higher expression is associated with a poorer prognosis. In breast cancer, ITGA3 expression has a positive effect on patient prognosis, but in triple-negative breast cancer, we confirmed that higher ITGA3 mRNA expression is associated with a poorer prognosis.
[0164] These results suggest that a specific PS4 antibody could be used as a diagnostic and therapeutic agent for various solid cancers, including breast cancer (including triple-negative breast cancer (TNBC)), gastric cancer, pancreatic cancer, colorectal cancer, melanoma, head and neck cancer, and bladder cancer, which have clinical unmet needs. Furthermore, because VLA-3 is predicted to have a greater impact on cancer cell migration and metastasis than on cell growth / proliferation, it could also be used as a combination therapy with existing cancer treatments.
[0165] Example 7. Production of PS4 maxibody and maxibody mutants To produce antibody-drug conjugates (ADCs) with a tuned drug-to-antibody ratio (DAR), five maxibody antibody variants, including the PS4 wild type (WT), were created as follows.
[0166] PS4 maxibody mutant 1 (huFc-KC mutant) was synthesized by substituting Lysine 478 at the huFc portion of PS4-002 maxibody with Cysteine (K478C). PS4 maxibody mutant 2 (Linker-C mutant) was synthesized by inserting Cysteine into the scFv portion of the PS4 antibody as follows (GGGGSGGGSCGGGGS) to create Linker-C (SEQ ID NO: 47). PS4-maxibody mutant 3 (Linker-C / huFc-KC) was synthesized by fusing the huFc-KC mutant and the Linker-C mutant. Furthermore, WT-DeltaC (WT-ΔC), a variant 4 designed to produce a lower DAR of the antibody-drug conjugate, was created using the Agilent mutagenesis kit manual by producing primers 5'-GTAAGCTTGAGCCCAAATCTGACAAAACTTATACATGCCC-3' and 5'-GGGCATGTATAAGTTTTGTCAGATTTGGGCTCAAGCTTAC-3' to remove Cys233. The PS4 maxibody variant was expressed, purified, and analyzed using the same method as the previously described PS4 maxibody.
[0167] The DAR of the antibody-drug conjugate is a crucial component in the efficacy of ADCs. That is, tuning the DAR based on the titer of the payload used in ADC production is important. Furthermore, the antibody site to which the payload binds, i.e., the payload binding site, also affects the overall efficacy of the antibody. Therefore, as described above, three PS4 maxibody mutants were created by inserting Cysteine amino acids that bind the payload into the PS4 maxibody antibody in order to tune the payload binding amount (antibody:payload ratio) and the binding site (payload conjugation site) (Figure 12): PS4 maxibody huFc-terminal 447C mutation (huFc-KC); V H -V LCys was added to the linker (Linker-C); and DNA sequencing confirmed the creation of a Linker-C / huFc-KC mutant, a combination of huFc-KC and the Linker-C mutant.
[0168] By using cysteine during antibody-drug conjugate fabrication, additional drugs can be bound to the inserted cysteine residue, allowing for the creation of antibody-drug conjugates with various DAR properties at different positions. Furthermore, maxibody variants can also be applied to the optimization of maxibody-based drug conjugates (MDCs).
[0169] Example 8. Preparation and analysis of PS4 antibody-drug conjugates (ADCs) The cytotoxic drug monomethyl auristatin E (MMAE) was conjugated to PS4 WT and three PS4 mutants using the method described in the paper to produce PS4 maxibody-vcMMAE conjugates (PS4-vcMMAE MDC) (Mol Cancer Ther (2008) 7(8):2486-2497). Briefly, the antibody was partially reduced with 2.5-fold molar excess Tris(2-carboxyethyl)phosphorine (TCEP) at 37°C for 1.5 hours. After the reduced antibody was conjugated with vcMMAE (Medchemexpress) on ice for 0.5 hours, the conjugation reaction was quenched by adding 5.3-fold N-acetylcysteine. After the reaction was complete, excess vcMMAE, TCEP, etc. were removed from the mixture using a 10kDa Amicon concentrator, and the buffer composition was changed to 10mM Imidazole 2.5% glycerol in DPBS pH 6.4.
[0170] The drug-versus-antibody ratio (DAR) for the prepared PS4-vcMMAE ADC was analyzed by RP-HPLC-MALDI-TOF MS. DAR of PS4-vcMMAE ADC was analyzed using a Dionex Ultimate 3000-RSLC system with a polymer reversed-phase column (PLRP-S, Agilent Technologies). Gradient elution was performed at 70°C with 10-95% mobile phase B (ACN, 0.05% TFA), where mobile phase A was 0.05% TFA in water. The gradient was performed starting with 10% mobile phase B (ACN, 0.05% TFA) for 10 minutes at a flow rate of 0.25 mL / min, then linearly increasing to 80% mobile phase B for 30 minutes, and finally to 95% mobile phase B. All DAR fractions were manually collected upon sample injection and concentrated through a 10K Ultra Centrifugal filter (Millipore, Billerica, MA, USA). The intact mass of the DAR fraction was measured using a matrix-assisted laser desorption / ionization time-of-flight mass spectrometer (MALDI-TOF, Bruker Daltonics). The concentrated DAR fraction (1 μL) was air-dried onto a polished stainless steel 96-well MALDI plate. Then, 20 μg / μL of sinapinic acid containing 30% ACN / 0.1% TFA was overlaid with 1 μL of matrix solution (1:1 v / v), air-dried, and analyzed by MALDI-TOF MS. To optimize the experimental conditions, the high (20-160 kDa) molecular weight range was manually corrected using a BSA and huIgG mixture. A 20x detector gain with a sampling rate of 0.5 GS / s was used. Spectra were obtained on a basis of an average of 1600 shots at different positions at a frequency of 60 Hz at the same sample site. Weight-average DAR was measured as follows: Weight average DAR=Σ{(Drug load×Relative peak area(%)) / 100}
[0171] Monomers and aggregates of PS4 ADC were analyzed using a size exclusion column (SEC, TSKgel G3000SWXL, Tosoh Bioscience). Homogeneous solvent elution was performed at 25°C for 30 minutes at a flow rate of 0.5 mL / min using 0.1 M phosphate and 0.1 M sodium sulfate, pH 6.7. To improve the accuracy of molecular weight estimation, the system was calibrated using a Gel Filtration Standard (MW1,350-670,000, Bio-Rad) according to the manufacturer's guidelines. The equilibrium distribution coefficient (Kav) was measured as follows: Kav=(V e -V o ) / (V c -V o ) *V c :Total column volume(geometric), V e Elution volume, V o :Void volume
[0172] As a result, RP-HPLC analysis confirmed that, unlike PS4-002, PS4-002-vcMMAE increased retention time based on hydrophobicity due to increased payload distribution (Figure 13a). DAR was determined by collecting the respective RP-HPLC peak fractions and measuring the molecular weight by MALDI-TOF-MS (Figure 13b). The average DAR of PS4-002-vcMMAE was calculated as 4.09 using the weight-average DAR formula. The DAR for PS4 mutant-vcMMAE was measured and calculated using the same method. It was confirmed that MDCs of PS4 and PS4 mutants 1-3 bound to vcMMAE all had approximately ~4 DAR, with DARs ranging from 3.6 to 4.5. On the other hand, PS4 mutant 4 was confirmed to bind with ~2 DAR. Therefore, an MDC platform was constructed that can produce PS4 MDCs with DAR2 or DAR4 depending on the efficacy of cytotoxic drugs, and the characteristics and efficacy analysis of MDCs based on this platform were performed. Furthermore, when the monomers and aggregates of PS4-vcMMAE were analyzed by SEC-HPLC, PS4-vcMMAE was able to maintain a monomer concentration of >95% (Figure 13c, Table 6). In contrast, although optimization of PS4 mutant-drug conjugate production is necessary, it was confirmed that the MMAE drug conjugate of the PS4 mutant could also maintain a monomer concentration of >90% (Table 6). In addition, analysis of the quality of PS4-vcMMAE conjugates by DAR, % monomer concentration, and in vitro efficacy analysis confirmed that there was no significant variation between batches (lot to lot) in the production of PS4-vcMMAE conjugates (Table 6). Furthermore, when the efficacy of PS4-vcMMAE produced in different batches was analyzed on MDA-MB-231 and PANC-1 cell lines, it was confirmed that PS4-vcMMAE exhibited very similar cell growth inhibitory efficacy regardless of the batch in which it was produced (Figure 13d).
[0173] [Table 6]
[0174] Example 9. Analysis of binding characteristics between PS4 antibody-drug conjugate and antigen. To analyze the antigen-binding affinity of a specific PS4 antibody and its PS4 antibody-drug conjugate, an ELISA was performed against the target antigen.
[0175] First, VLA-3 (0.125~1.5 nM, R&D system) was coated onto the sample, and then 1 μg / mL of each antibody and antibody-drug conjugate variant was added to conjugate to the antigen. Nonspecifically conjugated antibodies were removed by washing with PBS / 0.05% Tween-20 buffer, and then the anti-human-Fc HRP antibody and TMB substrate were added and reacted. Antigen-antibody binding was analyzed by measuring the absorbance at A450 nm. Each sample was repeated three times.
[0176] As a result, all PS4 WT and variant antibodies showed EC with VLA-3 antigen 50 The values were measured at ~1 nM (Figure 14a). Furthermore, it was verified that there was no difference in the binding affinity of each produced PS4 WT and variant to the target antigen between the corresponding antibody-drug conjugates. In addition, it was confirmed that PS4 and PS4 variants conjugated with MMAE exhibited similar efficacy in killing breast cancer cell lines (MDA-MB-231) and pancreatic cancer cell lines (PANC-1) (Figure 14b). Therefore, it was confirmed that PS4 antibodies with various binding sites and the binding methods utilizing them, as described in one specific example, do not affect the binding of antigens to antibodies, and that it is possible to bind the drug to the optimal antibody site based on its cytotoxic drug properties.
[0177] Example 10. Analysis of the thermal stability characteristics of PS4 antibody-drug conjugates Real-time thermal stability experiments were conducted to analyze the thermal stability of a specific PS4 antibody and antibody-drug conjugate.
[0178] The method and principle of the experiment performed are as follows: As the temperature of a folded protein increases, if it denatures, hydrophobic regions are exposed, and the SYPRO orange detection dye binds to these regions, resulting in fluorescence. 1 / 2 RFU max The location is indicated by the melting point (Tm) value. 22.5 μL of the analyte sample and 2.5 μL of 50x SYPRO stock solution were placed in a 96-well PCR plate (VOLO Semi-Skirted PCR Plate) so that the final concentration of the sample used in the experiment was 2 μM. The fluorescence was then measured using Quantstudio Real-Time PCR (Thermo Fisher Scientific) while increasing the temperature from 10.0°C to 95°C at a rate of 0.5°C per 10 seconds. Each sample was repeated three times. The fluorescence value of the antibody buffer was set as the background, and the value with the largest slope in the microscalar of the fluorescence values excluding the background (dTRFU) was analyzed as the Tm of the corresponding protein.
[0179] As a result, the Tm values between the PS4 maxibody and the PS4-vcMMAE complex were measured to be almost identical at 66.67±0.24°C and 64.67±0.24°C, respectively (Figure 15). These results indicate that no thermal instability is induced by drug binding to the PS4 antibody. Furthermore, it was confirmed that the PS4 maxibody and the PS4 maxibody-drug conjugate (MDC) maintain Tm values in a range similar to that of the FDA-approved anti-VEGF (bevacizumab, Avastin) antibody (Tm 69.94°C). This means that the maxibody-based PS4 and PS4-drug conjugate in this specific example have thermal stability similar to that of full-IgG antibodies such as Avastin.
[0180] Example 11. In vitro efficacy analysis of PS4 antibody-drug conjugates The in vitro efficacy of a specific PS4 antibody-drug conjugate was confirmed as follows:
[0181] First, an appropriate number of cells (3 × 10) for each cancer cell line. 3〜1×10 4 Cells were dispensed into each well of a 96-well plate and cultured at 37°C and 5% CO2 for 24 hours. After replacing with fresh growth medium, diluted antibody-drug conjugates were sequentially added to each well. The cells were then cultured at 37°C and 5% CO2 for 4 days, treated with Alamar Blue (Invitrogen), and fluorescence values were measured at 2, 4, and 6 hours using Ex530 and Em590 (PerkinElmer Victor x4). The obtained fluorescence values were analyzed using Prism4 (GraphPad) and EC2 was calculated. 50 The values were measured. Each experiment was repeated three times.
[0182] As a result, it was confirmed that PS4-vcMMAE, a PS4-drug conjugate related to one specific example, has cell growth inhibitory efficacy against various cancer cell lines (Figure 16). Among these, the cell lines with the most superior cell growth inhibitory ability were identified as breast cancer cell lines, particularly triple-negative breast cancer MDA-MB-231 (IC50 0.77±0.63nM), pancreatic cancer Panc-1 (IC50 2.70±1.21nM), and lung cancer A549 (IC50 5.22±2.17nM). In addition, the in vitro efficacy of the PS4 antibody-drug conjugate was confirmed in brain cancer and bladder cancer cell lines, among others (Table 7). In contrast, no cancer cell growth inhibitory efficacy was observed in breast cancer cell lines in which the ITGA3 subunit of the VLA-3 antigen targeted by the PS4 antibody was knocked out (MDA-MB-231 ITGA KO). This means that the PS4-vcMMAE conjugate has the efficacy to inhibit the growth of targeted cancer cells. Furthermore, it means that the PS4-drug conjugate, as described in one specific example, has anticancer efficacy not only against breast cancer, including triple-negative breast cancer, and pancreatic cancer, but also against various other cancers such as lung cancer and gastric cancer, and can be applied as an anticancer treatment agent.
[0183] [Table 7]
[0184] Example 12. Evaluation of the in vivo efficacy of PS4 antibody-drug conjugate in suppressing triple-negative breast cancer. The in vivo efficacy evaluation of a specific PS4 antibody-drug conjugate was conducted as follows.
[0185] Triple-negative breast cancer (TNBC) MDA-MB-231 cells 2×10⁶ in BALB / c nude or NOD / SCID mice (Nara Bio) 6 Cells were mixed with materigel in a 1:1 (v / v) ratio and injected subcutaneously. The tumor volume was 100 mm³. 3 When this occurred, the PS4-vcMMAE antibody-drug conjugate was administered intraperitoneally at a dose of 5 mg / kg or 10 mg / kg once every 5 days for a total of 5 doses. Two to three mice were used per group. All animal experiments were conducted according to protocols approved by the Animal Experiment Committee (IACUC) of Kangwon National University (KW-210728-3).
[0186] As a result, compared to the control group, tumor growth was observed to be suppressed in a PS4-MMAE dose-dependent manner in the experimental group administered the PS4-vcMMAE conjugate (Figures 17a and 17c). Furthermore, the size and weight of excised cancer tissue were reduced by approximately 55% in the experimental group treated with the PS4-vcMMAE conjugate. In addition, in the triple-negative breast cancer NOD / SCID experimental group administered 10 mg / kg of PS4 MDC drug, no significant difference in tumor size was observed compared to the time of drug administration (Figure 17b). These results suggest that the PS4-vcMMAE conjugate, in this specific example, has anticancer efficacy against triple-negative breast cancer.
[0187] Example 13. Evaluation of the in vivo efficacy of PS4 antibody-drug conjugate in suppressing pancreatic cancer. The in vivo efficacy evaluation of a specific PS4 antibody-drug conjugate was conducted as follows.
[0188] NOD / SCID (female 5-week old) mice were given PANC-1 (3 x 10) 6Cancer cells were injected subcutaneously. The tumor volume was 100 m³. 3 When tumors were formed, PS4-vcMMAE conjugates were administered intraperitoneally at a dose of 5 mg / kg or 10 mg / kg once every 5 days for a total of 3 doses. The control group was treated with PBS, and efficacy evaluation was performed on 3-4 mice per group. After the experiment, the tumors were removed and the size of the cancerous tissue was compared for each experimental group. All animal experiments were conducted according to protocols approved by the Animal Experiment Committee (IACUC) of Kangwon National University (KW-210728-3).
[0189] As a result, compared to the control group, tumor growth was observed to be suppressed in a PS4-MMAE dose-dependent manner in the experimental group treated with the PS4-vcMMAE conjugate (Figure 18). Furthermore, the size and weight of excised cancer tissue were confirmed to be reduced in the experimental group treated with the PS4-vcMMAE conjugate. In particular, a minimum 60% reduction in tumor size was confirmed in the experimental group treated with 10 mg / kg PS4 MDC drug. Therefore, it was confirmed that the PS4 antibody-drug conjugate has anticancer efficacy in animal experimental models of triple-negative breast cancer and pancreatic cancer. These results suggest that the PS4-vcMMAE conjugate, as described in this specific example, also has anticancer efficacy in pancreatic cancer.
[0190] Thus, by verifying that the PS4-drug conjugate described in this specific example has the efficacy to suppress tumor growth in vivo, similar to its efficacy in in vitro testing, and by predicting that PS4-drug conjugates in which other toxic drugs other than MMAEs are bound to the PS4 antibody will also exhibit anticancer efficacy in animal models of other species in which the antigen recognized by the PS4 antibody is overexpressed.
Claims
1. (a) VH CDR1 containing any one amino acid sequence from sequence numbers 1 to 4; (b) VH CDR2 containing any one amino acid sequence from sequence numbers 5 to 8; (c) VH CDR3 containing any one amino acid sequence from sequence numbers 9 to 12; (d) VL CDR1 containing any one amino acid sequence from sequence numbers 13 to 16; (e) VL CDR2 containing any one amino acid sequence from SEQ ID NOs: 17 to 20; and (f) An antibody or functional fragment thereof that is specific to a membrane protein of cancer stem cells or cancer cells, comprising a VL CDR3 containing any one of the amino acid sequences of sequence numbers 21 to 24.
2. (a) VH CDR1 of SEQ ID NO: 1, VH CDR2 of SEQ ID NO: 5, VH CDR3 of SEQ ID NO: 9, VL CDR1 of SEQ ID NO: 13, VL CDR2 of SEQ ID NO: 17, and VL CDR3 of SEQ ID NO: 21; (b) VH CDR1 of SEQ ID NO: 2, VH CDR2 of SEQ ID NO: 6, VH CDR3 of SEQ ID NO: 10, VL CDR1 of SEQ ID NO: 14, VL CDR2 of SEQ ID NO: 18, and VL CDR3 of SEQ ID NO: 22; (c) VH CDR1 of SEQ ID NO: 3, VH CDR2 of SEQ ID NO: 7, VH CDR3 of SEQ ID NO: 11, VL CDR1 of SEQ ID NO: 15, VL CDR2 of SEQ ID NO: 19, and VL CDR3 of SEQ ID NO: 23; or (d) The antibody or functional fragment thereof according to claim 1, comprising VH CDR1 of SEQ ID NO: 4, VH CDR2 of SEQ ID NO: 8, VH CDR3 of SEQ ID NO: 12, VL CDR1 of SEQ ID NO: 16, VL CDR2 of SEQ ID NO: 20, and VL CDR3 of SEQ ID NO:
24.
3. (a) A heavy chain variable region containing any one amino acid sequence from Sequence ID No. 25 to 28 or a heavy chain variable region containing a sequence having at least 90% homology to any one amino acid sequence from Sequence ID No. 25 to 28; and (b) The antibody or functional fragment thereof according to claim 1, comprising a light chain variable region containing any one amino acid sequence from SEQ ID NOs. 29 to 32, or a light chain variable region containing a sequence having at least 90% homology to any one amino acid sequence from SEQ ID NOs. 29 to 32.
4. (a) A heavy chain variable region containing the amino acid sequence of SEQ ID NO: 25 or a sequence having at least 90% homology to the amino acid sequence of SEQ ID NO: 25; and a light chain variable region containing the amino acid sequence of SEQ ID NO: 29 or a sequence having at least 90% homology to the amino acid sequence of SEQ ID NO: 29; (b) A heavy chain variable region containing the amino acid sequence of SEQ ID NO: 26 or a sequence having at least 90% homology to the amino acid sequence of SEQ ID NO: 26; and a light chain variable region containing the amino acid sequence of SEQ ID NO: 30 or a sequence having at least 90% homology to the amino acid sequence of SEQ ID NO: 30; (c) A heavy chain variable region containing the amino acid sequence of SEQ ID NO: 27 or a heavy chain variable region containing a sequence having at least 90% homology to the amino acid sequence of SEQ ID NO: 27; and a light chain variable region containing the amino acid sequence of SEQ ID NO: 31 or a light chain variable region containing a sequence having at least 90% homology to the amino acid sequence of SEQ ID NO: 31; or (d) A heavy chain variable region comprising the amino acid sequence of SEQ ID NO: 28 or a sequence having at least 90% homology to the amino acid sequence of SEQ ID NO: 28; and a light chain variable region comprising the amino acid sequence of SEQ ID NO: 32 or a sequence having at least 90% homology to the amino acid sequence of SEQ ID NO: 32, according to claim 1, or a functional fragment thereof.
5. The antibody or functional fragment thereof according to claim 1, wherein the membrane protein of the cancer stem cell or cancer cell is ITGA3 (Integrin Subunit Alpha 3) or VLA3 (Integrin Alpha 3 beta 1).
6. The antibody or functional fragment according to claim 1, wherein the antibody or functional fragment is selected from the group consisting of VH, VL, IgG, Fab, Fab', F(ab')2, crossover Fab, scFab, dsFv, Fv, scFv, scFv-Fc, scFab-Fc, diabody, minibody, scAb, dAb, Fc-scFv, scFv-Fc-scFv, IgG-scFv, scFv-IgG, and combinations thereof.
7. The antibody or functional fragment thereof according to claim 6, wherein the antibody or functional fragment thereof is a diabody, dAb, scFv, or scFv-Fc.
8. The antibody or functional fragment thereof according to claim 6, wherein the scFv is a heavy chain variable region and a light chain variable region linked via a linker.
9. The antibody or functional fragment thereof according to claim 8, wherein the linker comprises the amino acid sequence of SEQ ID NO:
47.
10. The antibody or functional fragment thereof according to claim 6, wherein Fc comprises an amino acid sequence derived from human, mouse, chicken, monkey, or camel.
11. The antibody or functional fragment thereof according to claim 1, wherein the antibody or functional fragment thereof is a chimeric antibody, a humanized antibody, or a fully human antibody.
12. The antibody or functional fragment thereof according to claim 1, wherein the antibody or functional fragment thereof is a monoclonal antibody.
13. The antibody or functional fragment according to claim 1, wherein the antibody or functional fragment is IgGl, IgG2, IgG3, IgG4, or a combination thereof.
14. The antibody or functional fragment thereof according to claim 1, wherein a drug is conjugated to the antibody or functional fragment thereof.
15. The antibody or a functional fragment thereof according to claim 14, wherein the drug is a cytotoxic agent, a chemotherapeutic agent, an anticancer agent, a growth inhibitor, a toxin, or a radioisotope or a combination thereof.
16. A chimeric antigen receptor (CAR) protein comprising the antibody or a functional fragment thereof as described in claim 1.
17. An immune cell comprising the protein described in claim 16.
18. The immune cells according to claim 17, wherein the immune cells are selected from the group consisting of T cells, NK (Natural Killer) cells, NKT (Natural Killer T) cells, mononuclear cells, macrophages, and dendritic cells.
19. A pharmaceutical composition for the treatment or prevention of cancer, comprising the antibody or a functional fragment thereof as described in claim 1, the protein as described in claim 16, or the immune cells as described in claim 17.
20. The aforementioned cancers include blood cancer, lung cancer, stomach cancer, liver cancer, bone cancer, pancreatic cancer, skin cancer, head and neck cancer, skin melanoma, uterine cancer, ovarian cancer, rectal cancer, brain cancer, colorectal cancer, colon cancer, breast cancer, and triple-negative breast cancer. Negative breast cancer, uterine sarcoma, fallopian tube cancer, endometrial cancer, uterine cervical cancer, vaginal cancer, vulva cancer, esophageal cancer, laryngeal cancer, small intestine cancer, thyroid cancer, parathyroid cancer Cancer, soft tissue sarcoma, urethral cancer, penile cancer, prostate cancer, chronic or acute leukemia, solid tumors in juvenile stage, differentiated lymphoma, bladder cancer, oral cavity cancer, renal cancer, renal cell carcinoma, renal pelvic cancerA pharmaceutical composition for the treatment or prevention of cancer according to claim 19, selected from the group consisting of carcinoma, primary central nervous system lymphoma, spinal axis tumors, glioma, brainstem glioma, and pituitary adenoma.
21. A polynucleotide encoding the antibody or a functional fragment thereof as described in claim 1.
22. A recombinant vector comprising a polynucleotide according to claim 21.
23. Recombinant cells comprising the vector according to claim 22.
24. A cancer diagnostic composition comprising the antibody or a functional fragment thereof as described in claim 1, or the polynucleotide as described in claim 21.
25. A cancer diagnostic kit comprising the antibody or a functional fragment thereof as described in claim 1, or the polynucleotide as described in claim 21.
26. A reagent composition comprising the antibody or a functional fragment thereof as described in claim 1, or the polynucleotide as described in claim 21.