dsRNA molecule that suppresses C5 gene expression and its use

Abstract

The present invention provides a modified dsRNA molecule and its use. Specifically, the present invention provides a dsRNA molecule that suppresses the expression of the C5 gene, comprising a sense strand and an antisense strand that complementaryally form a double-stranded region, wherein the sense strand and / or the antisense strand contain 15 to 25 nucleotides, or a dsRNA molecule consisting of 15 to 25 nucleotides, which can be used for the treatment and / or prevention of diseases mediated by the C5 gene.

Description

Technical Field

[0001] (See related applications) The present invention claims the priority of a previous application with patent application number 202310603955.5, invention title "dsRNA molecule for suppressing the expression of C5 gene and its use", which was filed with the China National Intellectual Property Administration on May 26, 2023. All the contents of this previous application are incorporated herein by reference.

[0002] The present invention belongs to the field of molecular biology and relates to a modified dsRNA molecule and its use. Specifically, it relates to a dsRNA molecule for suppressing the expression of complement C5 gene and its pharmaceutical composition, and a method for reducing the expression level of complement C5 gene by using the dsRNA molecule or its pharmaceutical composition.

Background Art

[0003] RNA interference (RNAi) refers to the phenomenon of efficient and specific degradation of homologous mRNA induced by double-stranded RNA (dsRNA), which is highly conserved in the process of evolution. RNAi is a surveillance mechanism that ubiquitously exists in eukaryotes, resists virus invasion, suppresses transposon activity, and regulates gene expression. Small interfering RNA (siRNA: dsRNA) is a kind of short double-stranded RNA molecule with a length of 19 - 30 bp and is one of the important tools in RNAi technology. In natural organisms, after dsRNA enters cells, it is specifically recognized by Dicer enzyme and cleaved into fragments of small RNAs with a length of 21 - 23 nucleotides (i.e., dsRNA). The dsRNA fragments generated by cleavage are unwound and become single-stranded, and form a complex with specific proteins (abbreviated as RISC). RISC can bind to mRNA complementary to dsRNA in cells, cleave and degrade this mRNA, resulting in the inability to synthesize proteins and the occurrence of the "silencing" phenomenon of genes. In industrial production, people tend to chemically synthesize and modify dsRNA to further improve the stability and effectiveness of dsRNA drugs.

[0004] Complement is a group of non-thermally resistant proteins that possess enzymatic activity after activation and are widely present in serum, tissue fluid, and on the surface of cell membranes. It comprises over 30 soluble and membrane-bound proteins and is collectively known as the "complement system." Under physiological conditions, the majority of complement components exist as inactive enzyme precursors. Under the action of different activators (bacteria, antigen-antibody complexes, etc.), they undergo a series of cascade enzymatic reactions, becoming activated and exhibiting multiple biological activities. These activities are involved in specific and non-specific immune mechanisms in the body, manifesting as antimicrobial defense responses, immunomodulation, and damaging responses mediating immunopathology. Excessive activation or suppression of the complement system plays a crucial role in the pathogenesis of various diseases, with a wide range of effects, from acute inflammation such as eye and periodontal diseases to chronic diseases such as cancer, autoimmune diseases, neurodegenerative diseases, kidney diseases, and chronic hemolytic diseases. There are three known complement activation pathways: the classical pathway, the alternative pathway, and the lectin pathway. Complement protein C5 is at the end of the complement cascade reaction, and all pathways of complement activation cause cleavage of the C5 molecule, producing anaphylatoxins C5a and C5b. C5a binds to receptors to exert its primary pro-inflammatory activity, while C5b binds to the other four complement proteins (C6, C7, C8, and C9) to form the C5b-9 complex. C5b-9 causes cell lysis by forming a membrane attack complex (MAC), and sublytic MAC and soluble C5b-9 have even more non-cytolytic immune functions (MAC).The two complement effectors C5a and C5b-9, generated from C5 cleavage, are key components responsible for propagating and / or activating pathological complement systems in different diseases, such as ophthalmic diseases like age-related macular degeneration (AMD), CNS / PNS diseases like Alzheimer's disease (AD) and myasthenia gravis (GMG), renal diseases like atypical hemolytic uremic syndrome (AHUS), C3 glomerulopathy (C3G) and IgA nephropathy, and hematological disorders like paroxysmal nocturnal hemoglobinuria (PNH) and thrombotic microangiopathy (TMAs). Therefore, targeting the C5 protein can modulate complement signaling activated by three different complement pathways.

[0005] In this field, there is a need for alternative and combination therapies for patients with diseases related to complement component C5. [Overview of the project]

[0006] The present invention provides a dsRNA molecule, reagent, kit and pharmaceutical composition therefor that suppresses the expression of the complement C5 gene, as well as a method and use for preventing or treating complement-mediated diseases or symptoms that suppress or reduce the expression of the C5 gene using the dsRNA molecule, reagent, kit or pharmaceutical composition. The dsRNA molecule achieves suppression of C5 gene expression or reduction of C5 gene expression level by promoting the specific degradation of the C5 mRNA sequence through RNAi action.

[0007] In one embodiment, the present invention provides a double-stranded ribonucleic acid (dsRNA) reagent for suppressing the expression of complement component C5, wherein the dsRNA comprises one sense strand and one antisense strand, and the sense strand and / or antisense strand comprises at least 15 consecutive nucleotides having a difference of three or fewer nucleotides from the nucleotide sequences of any sense and antisense sequences listed in Tables 2, 6, and 9.

[0008] In some embodiments, the present invention provides a dsRNA molecule whose sense strand nucleotide sequence is shown in Table 2, and whose antisense strand nucleotide sequence is shown in Table 2. The sense strand and / or the antisense strand contains or consists of 15 to 25 nucleotides, the antisense strand is complementary to 15, 16, 17, 18, 19, 20, 21, 22, 23, 24, or 25 consecutive nucleotides in the sequence listing, the length of the double-stranded region is 15 to 25 bp, preferably 19-21 bp, and at least one nucleotide in the dsRNA molecule is modified.

[0009] In some embodiments, the sense strand and antisense strand include sequences selected from the following groups, which consist of dsRNA molecules named 5-E04, 5-E05, 7-E04, 7-E05, 17-E04, 17-E05, 32-E04, 32-E05, 85-E04, 85-E05, GAL-E5, GAL-E17, GAL-E85-1, and GAL-E85.

[0010] In some embodiments, the modifications are selected from one or more of the following: locked nucleic acid (LNA) modifications, ring-opening or unlocked (UNA) modifications, 2'-methoxyethyl modifications, 2'-O-methyl modifications, 2'-O-allyl modifications, 2'-C-allyl modifications, 2'-fluoro modifications, 2'-deoxy modifications, 2'-hydroxy modifications, phosphorothioate backbone modifications, DNA modifications, fluorescent probe modifications, and ligand modifications.

[0011] In some embodiments, the naked sequence of the sense strand of the dsRNA molecule is shown in (A1), (A2), or (A3), and the naked sequence of the antisense strand of the dsRNA molecule is shown in (A4), (A5), or (A6). (A1) GUGAUUCAAGUUUAUGGAUAC (SEQ ID NO:5) (A2) UGUGUAUUUGGAAGUUGUAUC (SEQ ID NO:17) (A3) GUGAAGAAAUGUUGUUACGAU (SEQ ID NO:85) (A4) GUAUCCAUAAACUUGAAUCACAA (SEQ ID NO:105) (A5) GAUACAACUUCCAAAUACACAUA (SEQ ID NO:117) (A6) AUCGUAACAACAUUUCUUCACUA (SEQ ID NO:185).

[0012] In some embodiments, the modification scheme of the dsRNA molecule provided by the present invention includes: (1) a sense strand: having a length of 17 to 21 nt, for example, 21 nt, composed alternately of 2'-O-methyl modified regions and 2'-fluoro modified regions, each modified region having a length of 1 to 3 nucleotides, and the modification scheme of the first modified region from the 5' end and 3' end being the same; and (2) an antisense strand: having a length of 19 to 23 nt, for example, composed alternately of 23 nt, 2'-O-methyl modified regions, 2'-fluoro modified regions, unmodified regions, or DNA regions, each modified region having a length of 1 to 5 nucleotides, and both the consecutive nucleotide regions from the 2nd to 5th positions from the 5' end and the consecutive nucleotide regions from the 1st to 3rd positions from the 3' end are linked by a phosphorothioate skeleton.

[0013] In some embodiments, the modification scheme of the dsRNA molecule of the present invention includes: (1) a sense strand having a length of 21 nt, with 2'-fluoro modifications at positions 7 and 9-11 from the 5' end, and 2'-O-methyl modifications at the remaining positions, and a continuous nucleotide region from the 5' end to positions 1-3 linked by a phosphorothioate skeleton; and (2) an antisense strand having a length of 23 nt, with 2'-fluoro modifications at positions 2, 14, 16 and any position 6 from the 5' end, and 2'-O-methyl modifications at the remaining positions, and a continuous nucleotide region from the 5' end to positions 1-3, and a continuous nucleotide region from the 3' end to positions 1-3 linked by a phosphorothioate skeleton.

[0014] In some embodiments, the sense strand of the dsRNA molecule has the modification shown in modification motif 1, and the antisense strand of the dsRNA molecule has the modification shown in modification motif 3 or modification motif 4, where, Modification motif 1: XmsXmsXmXmXmXmXfXmXfXfXfXmXmXmXmXmXmXmXmXm, Modification motif 3: XmsXfsXmXmXmXfXmXmXmXmXmXmXmXmXfXmXfXmXmXmXmXmXmsXmsXm, Modification motif 4: XmsXfsXmXmXmXmXmXmXmXmXmXmXmXmXfXmXfXmXmXmXmXmXmsXmsXm, Here, in each modified motif, X represents the ribonucleotides from 5' to 3' of the sense strand in order from 5' to 3', Xm represents a 2'-O-methyl modified ribonucleotide, Xf represents a 2'-fluoro modified ribonucleotide, and s indicates that the two nucleotides before and after are linked by a phosphorothioate skeleton.

[0015] In some embodiments, the structure of the sense strand of the dsRNA molecule is shown in (B1), (B2), or (B3), and the structure of the antisense strand of the dsRNA molecule is shown in (B4), (B5), (B6), (B7), (B8), or (B9), Here, (B1), (B2), or (B3) has (A1), (A2), or (A3) of modifying motif 1, that is, (B1): SEQ ID NO: 5 with modified motif 1 (B2): SEQ ID NO: 17 with modifying motif 1 (B3): SEQ ID NO: 85 with modified motif 1 Here, (B4), (B5), or (B6) is (A4), (A5), or (A6), or (B7) which has modifying motif 3, and (B8), or (B9) is (A4), (A5), or (A6) which has modifying motif 4, that is, (B4): SEQ ID NO: 105 with modifying motif 3 (B5): SEQ ID NO: 117 having modification motif 3 (B6): SEQ ID NO: 185 having modification motif 3 (B7): SEQ ID NO: 105 having modification motif 4 (B8): SEQ ID NO: 117 having modification motif 4 (B9): SEQ ID NO: 185 having modification motif 4 Herein, modification motif 1 is XmsXmsXmXmXmXmXfXmXfXfXfXmXmXmXmXmXmXmXmXm, modification motif 3 is XmsXfsXmXmXmXfXmXmXmXmXmXmXmXfXmXfXmXmXmXmXmsXmsXm, modification motif 4 is XmsXfsXmXmXmXmXmXmXmXmXmXmXmXfXmXfXmXmXmXmXmsXmsXm, and herein, X in each modification motif sequentially represents the ribonucleotides from 5' to 3' of the sense strand from 5' to 3', Xm represents a 2'-O-methyl modified ribonucleotide, Xf represents a 2'-fluoro modified ribonucleotide, and s indicates that the two adjacent nucleotides are linked by a phosphorothioate backbone.

[0016] In some preferred embodiments, the dsRNA molecule is selected from the dsRNA molecules shown below, 5-E04 Sense strand: SEQ ID NO: 5 having modification motif 1, Antisense strand: SEQ ID NO: 105 having modification motif 3. 5-E05 Sense strand: SEQ ID NO: 5 having modification motif 1, Antisense strand: SEQ ID NO: 105 having modification motif 4. 7-E04 Sense strand: SEQ ID NO: 7 having modification motif 1, Antisense strand: SEQ ID NO: 107 having modification motif 3. 7-E05 Sense strand: SEQ ID NO: 7 having modification motif 1, Antisense strand: SEQ ID NO: 107 having modification motif 4. 17-E04 Sense strand: SEQ ID NO: 17 having modification motif 1, Antisense strand: SEQ ID NO: 117 having modification motif 3. 17-E05 Sense strand: SEQ ID NO: 17 having modification motif 1, Antisense strand: SEQ ID NO: 117 having modification motif 4. 32-E04 Sense strand: SEQ ID NO: 32 having modification motif 1, Antisense strand: SEQ ID NO: 132 having modification motif 3. 32-E05 Sense strand: SEQ ID NO: 32 having modification motif 1, Antisense strand: SEQ ID NO: 132 having modification motif 4. 85-E04 Sense strand: SEQ ID NO: 85 having modification motif 1, Antisense strand: SEQ ID NO: 185 having modification motif 3. 85-E05 Sense strand: SEQ ID NO: 85 having modification motif 1, Antisense strand: SEQ ID NO: 185 having modification motif 4.

[0017] In some preferred embodiments, the dsRNA molecule is 85-E04, 85-E05, 5-E05 or 17-E05. In some embodiments, the dsRNA molecule has ligand modification. The ligand is the portion taken up by the host cell, and ligand modification can improve the performance of the dsRNA molecule, such as cellular uptake, intracellular targeting, half-life, or drug metabolism or pharmacokinetics. In some embodiments, ligand-modified dsRNA has enhanced affinity or cellular uptake ability to selected targets (e.g., specific tissue types, cell types, organelles, etc.) such as hepatocytes, compared to unmodified dsRNA. Ligand modification does not affect the activity of the dsRNA.

[0018] In some embodiments, the ligand modification is the modification of one or more ligands to the 3' end, 5' end, and / or intermediate part of the sequence of the dsRNA molecule.

[0019] In some preferred embodiments, the ligand is selected from cholesterol, biotin, vitamins, galactose derivatives or analogs, lactose derivatives or analogs, N-acetylgalactosamine derivatives or analogs, and N-acetylglucosamine derivatives or analogs. The ligand targets cell surface receptors containing galactose, galactosamine, lactose, or an N-acetylgalactosamine / glucosamine moiety. The ligand preferably targets liver cells, particularly hepatic parenchymal cells.

[0020] In some preferred embodiments, the ligand targets the ASGPR receptor. In some preferred embodiments, the ligand may be human serum albumin (HSA), hyaluronic acid, polypeptide, etc. In some preferred embodiments, the ligand is L96, and the structure of L96 and the manner in which it binds to the sense strand nucleotide are as follows. [ka]

[0021] In some preferred embodiments, the ligand-modified dsRNA is selected from one of the following dsRNA molecules. GAL-E5 Sense chain: SEQ ID NO: 5 having modification motif 1, with L96 attached to its 3' end. Antisense chain: SEQ ID NO: 105, having modification motif 4. GAL-E17 Sense chain: SEQ ID NO:17 having modification motif 1, with L96 attached to its 3' end, Antisense chain: SEQ ID NO: 117, having modification motif 4. GAL-E85-1 Sense chain: SEQ ID NO: 85 having modification motif 1, with L96 attached to its 3' end. Antisense chain: SEQ ID NO: 185, having modification motif 3. GAL-E85 Sense chain: SEQ ID NO: 85 having modification motif 1, with L96 attached to its 3' end. Antisense chain: SEQ ID NO: 185, having modification motif 4.

[0022] Here, as described in this application, each modifying motif is based on the following definitions. Modification motif 1: XmsXmsXmXmXmXmXfXmXfXfXfXmXmXmXmXmXmXmXmXm, Modifying motif 2: XmsXmsXfXmXfXmXfXmXfXmXfXfXmXfXmXfXmXmXfXmXm, Modification motif 3: XmsXfsXmXmXmXfXmXmXmXmXmXmXmXmXfXmXfXmXmXmXmXmXmsXmsXm, Modification motif 4: XmsXfsXmXmXmXmXmXmXmXmXmXmXmXmXfXmXfXmXmXmXmXmXmsXmsXm, Modification motif 5: XmsXfsXfXmXfXmXmXfXmXfXmXmXmXmXfXmXfXmXmXmXmXmsXmsXmdTdT, Here, Xm represents a 2'-O-methyl modified ribonucleotide, Xf represents a 2'-fluoro modified ribonucleotide, and s indicates that the two nucleotides are linked by a phosphorothioate skeleton.

[0023] It should be understood that, in this application, when describing that the sense strand of a dsRNA molecule has modifications as shown in modification motif 1 or 2, or when describing that the antisense strand of a dsRNA molecule has modifications as shown in modification motif 3, 4, or 5, X in each modification motif refers to the ribonucleotides from 5' to 3' of the sense strand or antisense strand in order from 5' to 3', where the ribonucleotides from 5' to 3' of the sense strand or antisense strand and the corresponding X at the same position in the modification motif have the same ribonucleotide modification. For example, when describing that the sense strand of a dsRNA molecule has the modifications shown in modification motif 1, it means that the ribonucleotides from 5' to 3' of the sense strand of the dsRNA molecule each have the same ribonucleotide modifications as the respective X from 5' to 3' in modification motif 1, that is, the 7th position and 9th to 11th positions from the 5' end of the sense strand have 2'-fluoro modifications, the remaining positions have 2'-O-methyl modifications, and the consecutive nucleotide regions from the 1st to 3rd positions from the 5' end are connected by a phosphorothioate skeleton, and by the same logic, the antisense strand of a dsRNA molecule is When describing that the dsRNA molecule has the modifications shown in modification motif 4, it means that the ribonucleotides from 5' to 3' of the antisense strand of the dsRNA molecule each sequentially have the same ribonucleotide modifications as each of the X from 5' to 3' in modification motif 4, that is, the 2'-fluoro modifications at positions 2, 14, and 16 from the 5' end of the antisense strand, the remaining positions have 2'-O-methyl modifications, and the consecutive nucleotide regions from the 5' end to positions 1 to 3, and the consecutive nucleotide regions from the 3' end to positions 1 to 3 are linked by a phosphorothioate skeleton. In some embodiments, when describing that the sense strand of the dsRNA molecule has the modifications shown in modification motif 1 or 2, or when describing that the antisense strand of the dsRNA molecule has the modifications shown in modification motif 3, 4, or 5, the nucleotides at each position of the dsRNA molecule do not contain any other chemical modifications other than the nucleotide modifications corresponding to X in the modification motif.In some embodiments, when describing that the sense strand of a dsRNA molecule has the modifications shown in modification motif 1 or 2, or when describing that the antisense strand of a dsRNA molecule has the modifications shown in modification motif 3, 4, or 5, the nucleotides at each position of the dsRNA molecule do not contain any other chemical modifications other than the nucleotide modification corresponding to X in the modification motif and the ligand attached to the 3' end of the sense strand.

[0024] In some more preferred embodiments, the ligand-modified dsRNA is selected from the following molecules. Sense chain: SEQ ID NO: 85 having modification motif 1, with L96 attached to its 3' end. Antisense chain: SEQ ID NO: 185, having modification motif 4. Sense chain: SEQ ID NO: 5 having modification motif 1, with L96 attached to its 3' end. Antisense chain: SEQ ID NO: 105, having modification motif 4.

[0025] In some preferred embodiments, each strand of the dsRNA molecule may have 0% to 100% modified nucleotides, for example, 5%, 10%, 15%, 20%, 25%, 30%, 35%, 40%, 45%, 50%, 55%, 60%, 65%, 70%, 75%, 80%, 85%, 90%, 95%, 99%, or 100% modified nucleotides. The modifications may be in overhang regions or double-stranded regions. The modifications can be used to improve the in vitro or in vivo characteristics of the dsRNA molecule, such as stability, biodistribution, and inhibitory activity. The modifications can be used in combination.

[0026] In some preferred embodiments, the ends of each strand of the dsRNA molecule have overhangs or are blunt ends and include 1 to 8 overhang nucleotides located at the 5' and / or 3' of any single-stranded or double-stranded molecule, e.g., 1, 2, 3, 4, 5, 6, 7, or 8 overhang nucleotides, where the overhang nucleotides are arbitrarily selected from U, A, G, C, T, and dT.

[0027] In some preferred embodiments, the dsRNA molecule can suppress the expression of the C5 gene in humans and cynomolgus monkeys.

[0028] In another aspect, the present invention further relates to biomaterials related to dsRNA. In some embodiments, the biomaterial associated with the dsRNA can be selected from any one of the following: (A) A DNA molecule capable of generating the dsRNA. (B) A carrier capable of expressing the dsRNA. (C) A reagent or kit comprising the dsRNA or DNA molecule or the carrier. (D) A pharmaceutical composition comprising the dsRNA molecule and other pharmaceutically acceptable components.

[0029] In some embodiments, the pharmaceutical composition comprises a pharmacologically effective amount of the dsRNA molecule of the present invention and other pharmaceutically acceptable components, wherein the “effective amount” refers to the amount of dsRNA molecule that can effectively produce the expected pharmacological therapeutic effect.

[0030] In some embodiments, “other components” include water, saline solution, glucose, buffer solution (e.g., PBS), excipients, diluents, disintegrants, binders, lubricants, sweeteners, flavorings, preservatives, or combinations thereof.

[0031] In another aspect, the present invention relates to the use of dsRNA or related biomaterials for preventing and / or treating C5 gene-mediated diseases, or for alleviating the symptoms of C5 gene-mediated diseases. In another aspect, the present invention relates to the use of dsRNA or related biomaterials for producing formulations or drugs that prevent and / or treat C5 gene-mediated diseases, or alleviate the symptoms of C5 gene-mediated diseases.Diseases mediated by the aforementioned C5 gene include paroxysmal nocturnal hemoglobinuria (PNH), atypical hemolytic uremic syndrome (AHUS), asthma, rheumatoid arthritis (RA), antiphospholipid syndrome, lupus nephritis, ischemia-reperfusion injury, typical or infectious hemolytic uremic syndrome (THUS), dense deposit disease (DDD), neuromyelitis optica (NMO), multifocal motor neuropathy (MMN), multiple sclerosis (MS), macular degeneration (e.g., age-related macular degeneration (AMD)), hemolysis, elevated liver enzymes and low platelet count (HELLP) syndrome, thrombotic thrombocytopenic purpura (TTP), spontaneous abortion, minor immune vasculitis, epidermolysis bullosa, recurrent miscarriage, preeclampsia, traumatic brain injury, myasthenia gravis, cold dysplasia, dermatomyositis, bullous pemphigoid, and Shiga toxin. (toxin) Escherichia coli (E. coli)-associated hemolytic uremic syndrome, C3 nephropathy, antineutrophil cytoplasmic antibody-associated vasculitis, fluid and vascular graft rejection, graft dysfunction, myocardial infarction, allogeneic xenotransplantation, sepsis, coronary artery disease, dermatomyositis, Graves' disease, atherosclerosis, Alzheimer's disease, systemic inflammatory response sepsis, septic shock, spinal cord injury, glomerulonephritis, Hashimoto's thyroiditis, type 1 diabetes, psoriasis, pemphigus, autoimmune hemolytic anemia (AIHA), ITP, pulmonary hemorrhagic nephritis syndrome, Degos disease, antiphospholipid syndrome (APS), fulminant APS (CAPS), cardiovascular disease, myocarditis, cerebrovascular disease, peripheral vascular disease, renal vascular disease, mesenteric / intestinal vascular disease This includes, but is not limited to, vasculitis, Henoch-Schonlein purpura nephritis, vasculitis associated with systemic lupus erythematosus, vasculitis associated with rheumatoid arthritis, immune complex vasculitis, Takayasu's arteritis, dilated cardiomyopathy, diabetic vascular disease, Kawasaki disease (arteritis), viral infection-related diseases (e.g., COVID-19 pneumonia), chronic obstructive pulmonary disease (COPD), acute respiratory distress syndrome (ARDS), C5-related tumors (e.g., liver cancer, lung cancer, etc.), venous gas embolism (VGE), and restenosis after stent placement, rotational atherosclerosis, membranous nephropathy, Guillain-Barré syndrome, and percutaneous transluminal coronary angioplasty (PTCA).

[0032] In another aspect, the present invention relates to the use of dsRNA or related biological material for the production of drugs for the prevention and / or treatment of IgA nephropathy.

[0033] In some embodiments, the present invention further provides uses as shown in any one of the following. Use of the dsRNA or biomaterial to suppress the expression of the C5 gene or to manufacture a product for suppressing the expression of the C5 gene. Here, suppressing the expression of the C5 gene means suppressing or reducing the expression level of the human or monkey C5 gene in cells inside or outside the body, and suppressing the expression of the C5 gene means suppressing or reducing the expression level of the C5 gene by at least 95%, 90%, 85%, 80%, 75%, 70%, 60%, 50%, 40%, 30%, 20%, 10%, or 5%. Detection of target gene, target RNA, or target protein levels can be used to predict or evaluate activity, potency, or therapeutic outcomes.

[0034] In some embodiments, the cells are mammalian cells expressing C5, such as primate cells or human cells. More preferably, the target cells express the C5 gene at a high level. More preferably, the cells are derived from the brain, lungs, liver, kidneys, or tumors. Even more preferably, the cells are hepatocellular carcinoma cells.

[0035] In some embodiments, the cells are selected from HepG2, HEP3B, Huh7, MHCC97H, HeLa, cynomolgus monkey primary cells, and human primary cells. In some embodiments, the final cellular concentration of the dsRNA molecule is 0.001 to 1000 nM, for example, 0.001 to 10 nM, 10 to 500 nM, 25 to 300 nM, or 50 to 100 nM. In some embodiments, the dsRNA or related biological material may be administered by any suitable means, such as parenteral administration including intramuscular, intravenous, arterial, peritoneal, or subcutaneous injection, and the administration method may include, but is not limited to, single or multiple doses.

[0036] In some preferred embodiments, the dosage range is 0.1 mg / kg to 100 mg / kg, 0.5 mg / kg to 50 mg / kg, 3 mg / kg to 36 mg / kg, 2.5 mg / kg to 20 mg / kg, 5 mg / kg to 15 mg / kg, for example, 3 mg / kg, 4 mg / kg, 5 mg / kg, 6 mg / kg, 7 mg / kg, 8 mg / kg, 9 mg / kg, 10 mg / kg, 11 mg / kg, 12 mg / kg, 13 mg / kg mg / kg, 14mg / kg, 15mg / kg, 16mg / kg, 17mg / kg, 18mg / kg, 19mg / kg, 20mg / kg, 21mg / kg, 22mg / kg, 23mg / kg, 24mg / kg, 25 mg / kg, 26 mg / kg, 27 mg / kg, 28 mg / kg, 29 mg / kg, 30 mg / kg, 31 mg / kg, 32 mg / kg, 33 mg / kg, 34 mg / kg, 35 mg / kg, 36 mg / kg.

[0037] In some embodiments, a single-dose pharmaceutical composition can be long-lasting, and the reduction in C5 expression can persist for at least 3, 5, 7, 10, 14 days or longer. In some embodiments, the use of the dsRNA or the biomaterial is provided for reducing C5 in serum or for producing a product for reducing C5 in serum. Here, reducing the C5 concentration in the serum means reducing the C5 concentration in human or monkey serum, for example, the concentration or content of C5 in the serum was reduced by at least 5%, 10%, 15%, 20%, 25%, 30%, 35%, 40%, 50%, 60%, 70%, 80%, 90%, 95%, or 98%.

[0038] In some embodiments, the use of the dsRNA or biomaterial is provided to prevent and / or treat diseases mediated by the C5 gene, or to produce products for preventing and / or treating diseases mediated by the C5 gene.

[0039] In some embodiments, the use of the dsRNA or biomaterial is provided to alleviate the symptoms of a C5 gene-mediated disease or to produce a product for alleviating the symptoms of a C5 gene-mediated disease. In some embodiments, the disease mediated by the C5 gene is preferably an immune-related, hematological, or metabolic disease. In some embodiments, the C5 gene-mediated disease or symptom may be caused by overexpression of the C5 gene or overproduction of the C5 protein, and can be regulated by reducing the expression of the C5 gene. The treatment refers to the alleviation, reduction, or cure of the C5 gene-mediated disease or symptom, for example, by reducing serum C5 levels. For example, serum C5 content or concentration was reduced by 5%, 10%, 15%, 20%, 25%, 30%, 35%, 40%, 50%, 60%, 70%, 80%, 90%, and 95%.

[0040] In some embodiments, the present invention provides the use of ligand-modified dsRNA molecules to produce drugs that similarly target the liver, and that the liver-targeting drugs can treat C5 gene-mediated liver diseases. In another aspect, the present invention further provides methods and / or combination therapies for treating subjects having a disease that would benefit from suppressing or reducing the expression of the C5 gene, such as complement component C5-related diseases, e.g., paroxysmal nocturnal hemoglobinuria (PNH) and atypical hemolytic uremic syndrome (aHUS), and these methods and / or combination therapies utilize RNAi compositions that affect the RNA-induced silencing complex (RISC)-mediated cleavage of the RNA transcript (trancrip) of the complement component C5 gene.

[0041] These combination therapies of the present invention involve administering the RNAi reagent of the present invention and another therapeutic agent, such as an anti-complement component C5 antibody or its antigen-binding fragment, such as eculizumab, to a patient having a complement component C5-related disease. These combination therapies of the present invention reduce C5 levels in the subject (e.g., about 30%, 35%, 40%, 45%, 50%, 55%, 60%, 65%, 70%, 75%, 80%, 85%, 90%, 95%, or about 99%) by targeting C5 mRNA with the RNAi reagent of the present invention, thereby reducing treatment costs and enabling a simpler and more convenient method of administering eculizumab, such as subcutaneous administration, by allowing a reduction in the therapeutic (or prophylactic) effective dose of eculizumab required to treat the subject. In some embodiments, this alternative therapeutic agent may be an anti-complement component C5 antibody or its antigen-binding fragment or derivative.

[0042] The ingenuity of this invention specifically demonstrates that 1) modified dsRNA molecules possess high stability and high inhibitory activity, and 2) ligand-modified dsRNA molecules retain relatively high inhibitory activity and stability while also possessing relatively good liver targeting and cell endocytosis-promoting ability, thereby reducing impact on other tissues or organs, and reducing the amount of dsRNA molecules used, thereby achieving the objectives of reducing toxicity and costs. Furthermore, ligand-modified dsRNA molecules can enter target cells and tissues without transfection reagents, reducing adverse effects of transfection reagents such as cytotoxicity or histotoxicity, and enabling targeted therapy. While many modifications can be attempted to improve the performance of dsRNA, these attempts usually only involve RNA interference and are difficult to explain in terms of improved stability in serum (e.g., increased resistance to nucleic acid enzymes and / or extended duration). The modified dsRNA of this invention possesses high stability while simultaneously retaining high inhibitory activity, yielding unpredictable technical effects.

[0043] [Definition] One single strand in an siRNA that can pair complementaryally with the target gene mRNA is called the antisense strand (AS), and the other single strand is called the significance strand or sense strand (SS). "G", "C", "A", "T", and "U" typically represent nucleotides with guanine, cytosine, adenine, thymine, and uracil as bases, respectively. REL (Relative expression level): Relative expression level of mRNA GalNAc: N-acetylgalactosamine Modifications: N=RNA; dN=DNA; Nm=2'OMe modification; Nf=2'F modification; (s)=PS skeleton (i.e., 5'-thio modified phosphate skeleton) The term "complement component C5," used interchangeably with "C5," refers to a well-known gene and polypeptide, also known in this art as Prepro-C5, ECLZB, CPAMD4, C3, and PZP-like α-2-macroglobulin domain-containing protein, anaphylatoxin C5a analog, hemolytic complement (HC), and complement C5. The sequence of the human C5 mRNA transcript is, for example, listed in the gene bank registry number GI:38016946 (NM_001735.2; SEQ ID NO:207). The sequence of the rhesus monkey C5 mRNA is, for example, listed in the gene bank registry number GI:297270262 (XM_001095750.2; SEQ ID NO:208). The sequence of mouse C5 mRNA is, for example, listed in gene bank registry number GI:291575171 (NM_010406.2; SEQ ID NO:209). The sequence of rat C5 mRNA is, for example, listed in gene bank registry number GI:392346248 (XM_345342.4; SEQ ID NO:210). Other examples of C5 mRNA sequences can be easily obtained using publicly available databases, such as gene banks.

[0044] Typically, the majority of nucleotides in each strand of a dsRNA molecule are ribonucleotides, but as described in detail herein, each strand or these two strands may further contain one or more non-ribonucleotides, such as deoxyribonucleotides and / or modified nucleotides. Furthermore, as used herein, “RNAi reagent” may contain chemically modified ribonucleotides, and RNAi reagent may contain modifications that are more numerous on multiple nucleotides. These modifications may include all types of modifications disclosed herein or known in the art. For the purposes of this specification and the claims, any of these modifications used, for example, on an siRNA-type molecule are included in “RNAi reagent”. [Brief explanation of the drawing]

[0045] [Figure 1] This figure shows the results of dsRNA high-throughput screening. [Figure 2] This figure shows the results of a single screening of unmodified candidate dsRNA sequences in HepG2 cells. [Figure 3] This figure shows the results of a single screening of modified dsRNA sequences in HepG2 cells. [Figure 4] This figure shows the IC50 results for modified dsRNA in HepG2 cells. [Figure 5] This figure shows the results of single-dose screening of GalNAc-binding dsRNA in HepG2 cells. [Figure 6] This figure shows the results of a single-dose screening of GalNAc-binding dsRNA in primary hepatocytes of cynomolgus monkeys. [Figure 7] This figure shows the results of detecting the C5 content after a single 1mpk dose in the body. [Figure 8] This figure shows the results of detecting C5 content after a single dose with an in-body dose gradient. [Figure 9] This figure shows the results of detecting C5 content in a single dose administered to cynomolgus monkeys in the body. [Figure 10]This figure shows a comparison of two types of modified motif antisense chains (modified motif 3 and modified motif 4). [Modes for carrying out the invention]

[0046] [Example 1] C5-dsRNA activity screening experiment 1. Design of dsRNA Based on human C5 mRNA sequences, many C5 dsRNAs can be designed by selecting different sites, and all of the designed individual dsRNAs can target all transcripts of target genes (as shown in Table 1). These sequences (as shown in Table 2) are matched by sequence similarity software and have minimal homology with all other non-target gene sequences. This invention uses the sequence of cemdisiran (patent sequence AD-62643), a C5 dsRNA product clinically studied by Alnylam Pharmaceuticals, as the positive reference sequence of this invention, and the associated sequences are named PC, PC-ESC, or GAL-PC in this invention, based on their state (unmodified or modified, binding ligand, etc.), respectively.

[0047] [Table 1]

[0048] [Table 2] JPEG2026519656000005.jpg234168JPEG2026519656000006.jpg231167JPEG2026519656000007.jpg90170

[0049] 2. Synthesis and purification of dsRNA (conjugate) The dsRNA in this invention consists only of ribonucleotides or 2'-methoxy or 2'-fluoro-modified oligonucleotides, which are synthesized according to a theoretical yield of 1 μmol. All oligonucleotides were produced using an LK-192X synthesizer, with the selection of either a 1 μmol general-purpose Frit support (1000 Å = 100 nm, Biocomma) or a CPG support (Asymchem) of the GalNAc derivative L96 with a protecting group. Based on the sequence requirements, all phosphoramidite monomers corresponding to the nucleotides were diluted (all 1:40 (g / mL)) in anhydrous acetonitrile solvent, with a binding time of 3 min and a total of two bindings. Deprotection was performed using 3% TCA, activation was carried out using a 0.3 M benzylthiotetrazole acetonitrile solution, and capping and oxidation were performed with CAPA / CAPB and 50 mM I2 solution, respectively. After triphenylmethyl group removal synthesis (Trityl-off synthesis), the solid support was transferred to a 2 mL centrifuge tube, 1.2 mL of aqueous ammonia was added, and the mixture was heated in a 65°C oven for 3 hours to remove the protecting group. The mixture was then cooled to room temperature, vacuum concentrated for 30 min, filtered through a 0.22 μm filtration membrane, placed in a sample vial, and single-strand purification was performed using a reverse-phase filtration apparatus with a half-portion. The elution gradient was 7%~30% (ACN: 100 mM TEAA), and the process took 10 min at a flow rate of 5 mL / min. After purification, the mixture was vacuum concentrated and spin-dried at room temperature. Finally, the sample was dissolved in water, and the various solutions were desalted using a GE Hi-Trap desalting column to elute the final oligonucleotide product. All characteristics and purity were confirmed using ESI-MS and IEX HPLC, respectively. An ELISA reader was used to determine the concentration by ultraviolet absorption. Equimolar amounts of sense and antisense strands were mixed and placed in a new delivery tube. The mixture was heated at 95°C for 5 minutes, slowly annealed to room temperature, and finally, a vacuum concentrator was used to spin-dry the product at room temperature to obtain the final product.

[0050] III. High-throughput screening and detection of C5-dsRNA activity in vitro 1. Construction of the detection plasmid The psicheck-2 plasmid was used to construct a recombinant plasmid (GenScript Biotech) containing the target sequences of all C5 dsRNAs awaiting measurement, with the Coulombic sites being the 5'XhoI and 3'NotI sites of the psicheck-2 plasmid.

[0051] 2. Cotransfect 293T cells with C5 dsRNA and recombinant plasmid. All cells were purchased from ATCC, and all other reagents are commercially available.

[0052] Cell line transfection: Cells are cultured in DMEM medium containing 10% fetal bovine serum in a 5% CO2, 37°C incubator. Plate transfection is performed when the cells are in the logarithmic growth phase and in good condition (70% confluence). 3 × 10⁶ 293T human fetal kidney cells. 5 The cell solution was adjusted to a concentration of 0.1 ml / ml and added to each well of a 96-well plate, and incubated overnight. Transfection complex preparation: 8 μL Opti-MEM, 8 ng recombinant plasmid, and 2 μL 10 nM dsRNA were mixed, and 9.5 μL Opti-MEM and 0.5 μL Lipofectamine 2000 transfection reagent were mixed and allowed to stand for 5 minutes. Then, the two mixtures were mixed and allowed to stand for 20 minutes. The transfection complex was added to a 96-well plate and incubated in a 5% CO2, 37°C incubator for 6 hours. The supernatant was aspirated, 0.1 mL of complete medium was added to each well, and the culture was continued for 24 hours to collect samples. Each experiment was repeated three times, and the relative expression level of mRNA in the symmetric group (Mock group) with only the transfection reagent was set to 100%, with all values ​​for the other groups representing the relative expression activity or expression level relative to the Mock group.

[0053] 3. DLR assay analysis The assay was performed using the Dual-Luciferase Reporter Assay System kit (Promega). Cells were lysed and processed according to the kit instructions. The fluorescence intensities of Photinus pyralis luciferase and Renilla reniformis luciferase were sequentially detected using the Inifinite Eple ELISA Reader (TECAN). The ratio of fluorescence intensities between Renilla reniformis luciferase and Photinus pyralis luciferase was calculated and normalized using the mock group as a control, with the mock group activity being 100%. Table 3 shows the results of the DLR assay, representing the mean gene expression levels of the dual luciferase reporter for the C5 dsRNA test group compared to the mock group.

[0054] [Table 3] JPEG2026519656000009.jpg23676

[0055] As shown in Figure 1, several favorable sequences were found through C5 dsRNA screening performed in 293T cells. Five dsRNA molecules that showed relatively good efficacy and simultaneously targeted human and cynomolgus monkey C5 were conserved as candidate sequences and numbered 5, 7, 17, 32, and 85. Simultaneously, the unmodified positive symmetric group PC also showed relatively superior inhibitory activity.

[0056] IV. Real-time quantitative PCR analysis of target mRNA levels 1. C5 dsRNA transfection HepG2 cells HepG2 cells were cultured in DMEM medium containing 10% fetal bovine serum in a 5% CO2, 37°C incubator. Plate transfection was performed when the cells were in the logarithmic growth phase and in good condition (70% confluence). The cell density was adjusted to 2 × 10⁶ cells per well. 5The cells were seeded in a 24-well plate. Transfection complex preparation: Mix 250 μL Opti-MEM and 5 μL 1 nM or 0.1 nM dsRNA, then mix 250 μL Opti-MEM and 1.5 μL RNAiMax transfection reagent, let stand for 5 minutes, then mix the two mixtures and let stand for 20 minutes. Add the transfection complex to the 24-well plate and incubate for 6 hours in a 5% CO2, 37°C incubator. Aspirate the supernatant, add 1 mL of complete medium to each well, and continue culturing for 24 hours.

[0057] 2. Real-time fluorescence quantitative PCR analysis After 24 hours of transfection, cells were lysed, and total cellular RNA was extracted using Novozyme's column extraction method, the FastPure Cell / Tissue Total RNA Isolation Kit V2 (see Novozyme RC112-01 instructions). The RNA was reverse transcribed into cDNA using Takara PrimeScript RT Master Mix RR036Q. Table 3 shows the QPCR primer sequence information for PCR reactions performed using the human GAPDH gene as an internal control gene and a Bio-Rad CFX96 fluorescence quantitative PCR instrument in the United States. In the experiment, the mock group was normalized as a control, and the expression level of mock group C5 mRNA was 1.

[0058] [Table 4]

[0059] 4. Data Analysis After the PCR reaction was completed, the Ct error for nine repeats of one sample (three transfections per sample, or three qPCR repeats) was ±0.5. Relative quantitative analysis was performed using CFX96 software against a reference gene, and statistical analysis was performed using GarphPad software. Table 5 shows the results of further validation of the five candidate dsRNA molecules obtained from the above screening in HepG2 cells.

[0060] [Table 5]

[0061] The target sites of the above candidate dsRNAs (relative to the human C5 transcript NM_001735.3) are number 5:147-167; number 7:173-193; number 17:332-352; number 32:598-618; and number 85:2112-2132.

[0062] What should be understood is that in the embodiments of this application, dsRNAs having the same name number and digit all have the same bare sequence (i.e., base sequence).

[0063] [Example 2] Optimization of C5-dsRNA 1. Detection of inhibitory activity To further confirm the repressive activity of the five preferred dsRNA molecules described above, the inventors optimized their sequence modifications (Table 6), applying combinations of fluoro and methoxy modifications to different positions in the candidate sequences. The overall modification strategy involved employing methoxy substitutions as much as possible on the antisense strand, and the sequence designs are shown in Table 6. The transfection cells were HepG2 cells, and the steps of synthesis, transfection, and quantitative PCR detection were the same as in Example 1. Tables 7 and 8 show the mean target gene expression levels relative to the mock group (the relative mRNA expression level of the mock group is 1).

[0064] [Table 6]

[0065] Modification motif 1: XmsXmsXmXmXmXmXfXmXfXfXfXmXmXmXmXmXmXmXmXm Modifying motif 2: XmsXmsXfXmXfXmXfXmXfXfXmXfXmXfXmXfXmXmXm Modification motif 3: XmsXfsXmXmXmXfXmXmXmXmXmXmXmXmXmXfXmXmXmXmXmXmXm Modification motif 4: XmsXfsXmXmXmXmXmXmXmXmXmXmXmXmXfXmXmXmXmXmXmXmXm Modification motif 5: XmsXfsXfXmXfXmXmXfXmXfXmXmXmXfXmXfXmXmXmXmXmXmsXmsXmdTdT

[0066] [Table 7]

[0067] [Table 8]

[0068] As shown in Figures 3 and 4, the chemically modified 5-E05, 17-E05, E85-E05, and E85-E04 exhibit higher inhibitory activity in HepG2 cells, both being superior to or equivalent to the positive reference PC-ESC. At the same time, the modification scheme proves important, with some modifications reducing inhibitory activity. When the sense strand modifications match, a comparison of the two modification motifs of the antisense strand (modification motifs 3 and 4) shows that 5-E05, 17-E05, and E85-E05 are superior to the corresponding 5-E04, 17-E04, and E85-E04. Thus, the strategy of employing 2'-methoxy modification substitutions (modification motif 4, see Figure 10) in the antisense strand of the present invention is effective in improving inhibitory activity.

[0069] [Example 3] In vitro efficacy detection of GalNAc-dsRNA Candidate modified dsRNAs were bound to GalNAc to form GAL-dsRNA complexes, and the structures of each complex are shown in Table 9. The inventors further verified the activity of the complexes in cynomolgus monkey primary hepatocytes and HepG2 cells.

[0070] 1. Detection of mRNA expression levels in primary hepatocytes of cynomolgus monkeys 24-well plates were pre-coated with Collagen I and rat tail, and 2 x 10⁶ primary hepatocytes from cynomolgus monkeys (purchased from Liver Biotechnology) were placed inside. 5 The cells were seeded in 24-well plates at a rate of one cell per well. The following day, the synthesis, transfection, and quantitative PCR detection steps were the same as in Example 1. The final transfection concentration of GalNAc-dsRNA was 10 nM, and the cynomolgus monkey primer sequences are shown in Table 3. As can be seen from the results (Figure 5), the candidate sequences can effectively silence the expression of the C5 gene in primary hepatocytes of cynomolgus monkeys.

[0071] 2. Detection of mRNA expression levels in HepG2 cells The detection step is as described in Example 1, with the monkey GAPDH gene used as the internal control gene, and the primers used for detection are shown in Table 4. Tables 10 and 11 show the mean target gene expression levels relative to the mock group (the relative expression level of mRNA in the mock group is 1).

[0072] [Table 9]

[0073] [Table 10]

[0074] [Table 11]

[0075] The results are shown in Figures 5 and 6. All of the candidate GAL-E5, GAL-E85, and GAL-E85-1 effectively silenced C5 expression in cells, and their activity was superior to that of the positive reference GAL-PC group.

[0076] [Example 4] Detection of efficacy in vivo The study used SPF-grade humanized C5 mice (Shanghai Model Organismas Center, Inc.) aged 6-8 weeks, which were randomly divided into groups of 10 mice each, with an equal number of males and females. Each group received a single subcutaneous injection (the group assignments are shown in Tables 13 and 14). Blood samples were collected on days -3 (before administration), 3, 7, 12, 19, 26, 33, 40, and 54 (the first dose was on day 0). Serum was collected by posterior ocular hemostasis and used to detect C5 protein content.

[0077] [Table 12]

[0078] [Table 13]

[0079] C5 protein ELISA assay 1. Method After diluting the serum at 1:20,000, the ab125963 ELISA assay kit was used to detect the residual C5 content in the serum of each group. Specific operating steps were followed by detection of absorbance at a wavelength of 450 nm using an ELISA reader. The relative residual rate of each group compared to the Blank group was calculated, and statistical analysis was performed using GraphPad software.

[0080] 2.Results The experimental results (Figure 7) showed that, with a single 1mpk dose, the C5 content in the serum of mice administered with all four candidate dsRNA molecules was significantly lower than that of the blank symmetric group and superior to that of the positive reference symmetric group. Further dose-finding test results (Figure 8) showed that while the positive reference GAL-PC (3mpk) returned to pre-administration levels on day 33, GAL-E85 (0.3mpk) returned to pre-administration levels on day 47, and the duration of this extension at higher doses extended further to day 103. Simultaneously, candidate GAL-E5 also showed significantly superior potential compared to the GAL-PC group. In short, the inventors' results demonstrate that the inhibitory effect of the candidate dsRNA molecules on C5 targets of the present invention is superior to that of cemdisiran (AD-62643), which is currently being clinically studied, and that these molecules have the potential to treat C5-related diseases.

[0081] [Example 5] Detection of effectiveness in cynomolgus monkeys The study used adult male cynomolgus monkeys, with three monkeys per group, and administered a single subcutaneous injection (grouping of administration is shown in Table 14). Based on the pre-administration time of day 0 and the drug administration time of day 3, blood samples were collected and detected at the specified time points. The collected serum was used to detect C5 protein content using the ab125963 ELISA assay kit, with the specific steps being the same as in Example 4. The C5 residue rate relative to the pre-administration time was statistically calculated for each group.

[0082] [Table 14]

[0083] The experimental results (Figure 9) showed that both candidate molecules of the present invention, GAL-E85 and GAL-E5, exhibited a stronger and longer-lasting inhibitory effect on the C5 protein compared to the positive reference molecule GAL-PC. The maximum inhibition rate for GAL-PC was 47.5%, while the maximum inhibition rates for GAL-E85 and GAL-E5 were 90.2% and 85.5%, respectively.

[0084] In summary, when the dsRNA of this application uses modification motif 1, using modification motif 4 in the antisense strand results in even better in vitro and in vitro suppression efficiency than using modification motif 3.

[0085] The above description is merely an example of preferred embodiments and does not limit the characteristic combinations required to implement the present application. The title provided is not intended to limit the multiple embodiments of the present application. For example, terms such as “contains,” “includes,” and “inclusive” are not limiting. Furthermore, unless otherwise specifically stated, unless modified by a numeral, it includes multiple forms, and “or,” “or,” means “and / or” / “as well as / or.” Unless otherwise defined, the meaning of all technical and scientific terms used herein is the same as that commonly understood by those skilled in the art. All disclosures and patents referenced in the present application are incorporated herein by reference. Without deviating from the scope and spirit of the present application, multiple modifications and variations of the methods and compositions described herein are obvious to those skilled in the art. Although the present application is described by specific preferred embodiments, it should be understood that the present application to be protected should not be limited to these specific embodiments. In fact, multiple variations described for implementing the present application, which are obvious to those skilled in the art, are also included in the appended claims.

Claims

1. A dsRNA molecule that suppresses the expression of a C5 gene, which includes a sense strand and an antisense strand that complementarily form a double-stranded region, The sense strand and / or the antisense strand comprises 15 to 25 nucleotides, or consists of 15 to 25 nucleotides, the antisense strand is complementary to at least 15, 16, 17, 18, 19, 20, or 21 consecutive nucleotides of the sequence shown in any of SEQ ID NO: 1 to 98, the length of the double-stranded region is 15 to 25 bp, and at least one nucleotide of the dsRNA molecule is modified. dsRNA molecule.

2. The nucleotide sequence of the sense strand is represented by one of SEQ ID NO: 1 to 98, wherein the antisense strand nucleotide sequences corresponding to the sense strand nucleotide sequences SEQ ID NO: 1 to 98 in the dsRNA molecule are represented sequentially by SEQ ID NO: 101 to 198. The dsRNA molecule according to claim 1.

3. The modifications are characterized by being one or more selected from locked nucleic acid modifications, ring-opening or unlocked nucleic acid modifications, 2'-methoxyethyl modifications, 2'-O-methyl modifications, 2'-O-allyl modifications, 2'-C-allyl modifications, 2'-fluoro modifications, 2'-deoxy modifications, 2'-hydroxy modifications, phosphorothioate skeleton modifications, DNA modifications, fluorescent probe modifications, and ligand modifications. The dsRNA molecule according to claim 1 or 2.

4. The modification method for the dsRNA molecule is, (1) Sense strand: Length is 17 to 21 nt, preferably 21 nt, and is composed of alternating 2'-O-methyl modified regions and 2'-fluoro modified regions, with each modified region having a length of 1 to 3 nucleotides, and the modification pattern of the first modified region from the 5' end and the 3' end is the same; (2) Antisense strand: Length is 19 to 23 nt, preferably 23 nt, and is composed of alternating 2'-O-methyl modified regions, 2'-fluoro modified regions, unmodified regions, or DNA regions, with each modified region having a length of 1 to 5 nucleotides, and both the consecutive nucleotide regions from the 2nd to 5th positions from the 5' end and the consecutive nucleotide regions from the 1st to 3rd positions from the 3' end are linked by a phosphorothioate skeleton. Preferably, (1) sense chain: length 21 nt, with 2'-fluoro modifications from the 5' end to position 7, and positions 9-11, and the remaining positions are 2'-O-methyl modified, and the consecutive nucleotide regions from the 5' end to positions 1-3 are linked by a phosphorothioate skeleton; (2) antisense chain: length 23 nt, with 2'-fluoro modifications from the 5' end to positions 2, 14, 16, and any position 6, and the remaining positions are 2'-O-methyl modified, and the consecutive nucleotide regions from the 5' end to positions 1-3, and the consecutive nucleotide regions from the 3' end to positions 1-3 are linked by a phosphorothioate skeleton. A dsRNA molecule according to claim 3, characterized by including the following.

5. The dsRNA molecule according to any one of claims 1 to 4, characterized in that the bare sequence of the sense strand of the dsRNA molecule is shown in (A1), (A2), or (A3), and the bare sequence of the antisense strand of the dsRNA molecule is shown in (A4), (A5), or (A6). (A1) GUGAUUCAAGUUUAUGGAUAC (SEQ ID NO:5) (A2) UGUGUAUUUGGAAGUUGUAUC (SEQ ID NO: 17) (A3) GUGAAGAAAUGUUGUACGAU (SEQ ID NO:85) (A4) GUAUCCAUAAAACUUGAAUCACAA (SEQ ID NO: 105) (A5) GAUACAACUUCCAAAUACACAUA (SEQ ID NO: 117) (A6) AUCGUAACAACAUUUCUUCACUA (SEQ ID NO: 185)

6. The dsRNA molecule according to claim 5, characterized in that the sense strand of the dsRNA molecule has the modification shown in modification motif 1, and the antisense strand of the dsRNA molecule has the modification shown in modification motif 3 or modification motif 4. eff.symbol 1: XmsXmsXmsXmXmXmXfXmXfXfXfXmXmXmXmXmXmXmXm, fox3: XmsXfsXmXmXmXfXmXmXmXmXmXmXmXfXmXmXmXmXmXmXm, fox4: XmsXfsXmXmXmXmXmXmXmXmXmXmXmXfXmXfXmXmXmXmXmXmsXm, Here, in each modified motif, X represents the ribonucleotides from 5' to 3' of the sense strand in order from 5' to 3', Xm represents a 2'-O-methyl modified ribonucleotide, Xf represents a 2'-fluoro modified ribonucleotide, and s indicates that the two nucleotides before and after it are linked by a phosphorothioate skeleton.

7. The dsRNA molecule according to claim 6, further comprising a ligand bound to the 3' end of the sense strand of the dsRNA molecule, wherein the ligand is L96, and the structure of L96 is shown in formula I. 【Chemistry 1】

8. The sense chain has the modification shown in the modification motif 1, and the antisense chain has the modification shown in the modification motif 4. A dsRNA molecule according to any one of claims 5 to 7.

9. A dsRNA molecule according to any one of claims 1 to 8, and a pharmaceutically acceptable excipient, preferably further comprising a complement protein or another compound that suppresses the expression of a complement protein, Pharmaceutical composition.

10. The use of dsRNA selected from any of the following groups, (I) Use of dsRNA according to any one of claims 1 to 8 or the pharmaceutical composition according to claim 9 to suppress the expression of the complement C5 gene or to produce a product for suppressing the expression of the complement C5 gene. (II) Using the dsRNA according to any one of claims 1 to 8 or the pharmaceutical composition according to claim 9 to produce a product that reduces C5 protein in serum, (III) Use of the dsRNA according to any one of claims 1 to 8 or the pharmaceutical composition according to claim 9 to prevent and / or treat a disease mediated by the complement C5 gene, or to produce a product for preventing and / or treating a disease mediated by the complement C5 gene. (IV) Use of dsRNA according to any one of claims 1 to 8 or the pharmaceutical composition according to claim 9 to alleviate the symptoms of a disease mediated by the complement C5 gene, or to manufacture a product for alleviating the symptoms of a disease mediated by the complement C5 gene. Here, the diseases mediated by the complement C5 gene are one or more selected from ophthalmic diseases, hematological diseases, cardiovascular diseases, autoimmune diseases, renal diseases, neurological diseases, or neoplastic diseases. The ophthalmic diseases include dry / wet age-related macular degeneration (AMD), geographic atrophy (GA), etc. The neurological diseases include Alzheimer's disease (AD), myasthenia gravis (GMG), etc. The renal diseases include atypical hemolytic uremic syndrome (AHUS), C3 glomerulosis (C3 G) including IgA nephropathy and lupus nephritis, the hematological disorders include paroxysmal nocturnal hemoglobinuria (PNH), thrombotic microangiopathy (TMAs), etc., the autoimmune diseases include rheumatoid arthritis, lupus erythematosus, etc., the surgery-related diseases include hepatic ischemia-reperfusion injury, burn healing, post-organ transplant rejection, etc., the respiratory diseases include asthma, idiopathic pulmonary fibrosis, chronic obstructive pulmonary disease (COPD), etc., and the tumor diseases include complement-related liver cancer or lung cancer. Use of dsRNA.

11. A double-stranded nucleic acid that suppresses the expression of the C5 gene, or a pharmaceutically acceptable salt thereof, The original double-stranded nucleic acid consists of a first strand and a second strand. The first chain is AUCGUAACAACAUUUCUCACUCA (SEQ ID NO: 185), The aforementioned second chain is GUGAAGAAAAUGUUGUUACGAU (SEQ ID NO: 85), or, The first chain is GUAUCCAAUAAACUUGAAUCACAA (SEQ ID NO: 105), The second strand is GUGAAUUCAAGUUUAUGGAUAC (SEQ ID NO: 5), The first modifying motif mentioned above is modifying motif 4: XmsXfsXmXmXmXmXmXmXmXmXmXmXmXfXmXfXmXmXmXmXmXmsXmsXm, The 3' end of the second site is bound to the L96 ligand and modification motif 1: XmsXmsXmXmXmXmXfXmXfXfXfXmXmXmXmXmXmXmXmXm, Here, Xm represents a 2'-O-methyl modified ribonucleotide A, U, C, or G, Xf represents a 2'-fluoro modified ribonucleotide A, U, C, or G, (s) indicates that the two nucleotides before and after are linked by a phosphorothioate skeleton, and the L96 ligand is attached to the 3' end of the second chain as follows. 【Chemistry 2】

12. A pharmaceutical composition comprising a double-stranded nucleic acid according to claim 11 and a pharmaceutically acceptable carrier.

Images