Product preparation based on the application of sgRNA for the treatment of Huntington's disease

Abstract

This disclosure relates to sgRNAs and their applications in the preparation of products for the treatment of Huntington's disease. By designing and screening this disclosure, we obtained sgRNAs that target exon 1 of the human HTT gene, as shown in SEQ ID NO: 1 or SEQ ID NO: 2. A CRISPR / Cas9-mediated HTT gene knockout strategy based on these sgRNAs and their high homologous sgRNAs can efficiently knock out the human huntingtin gene and achieve gene therapy for Huntington's disease.

Description

Technical Field

[0001] The present disclosure generally relates to the technical field of disease treatment, and more particularly to sgRNA and its application in the preparation of products for the treatment of Huntington's disease.

Background Art

[0002] Huntington's disease (HD) is an autosomal dominant neurodegenerative disorder associated with an unstable repeat expansion (more than 36 repeats) of CAG trinucleotides in exon 1 of the Huntingtin gene (HTT), which expresses a mutant Huntingtin protein (mHTT) with a gain-of-function neurotoxic effect. Huntington's disease is always a neurodegenerative disorder caused by the HTT gene, and thus any onset process caused by this genetic factor can be a potential therapeutic target. The current investigation of HD treatment modalities follows this process. In HD, the excessive expansion of CAG trinucleotide repeats in exon 1 of the HTT gene results in the ubiquitous expression of mutant Huntingtin protein. mHTT is considered to be the main cause of HD toxicity, and thus its onset process may be slowed by directly reducing mHTT expression.

[0003] Gene therapy refers to an emerging therapeutic approach that modifies or manipulates gene expression to alter the biological properties of cells. Gene therapy acts directly on genetic material and has three main mechanisms of action: (1) substitution: replacing disease-causing genes with normal genes; (2) inactivation: inactivating abnormal genes; and (3) insertion: introducing new or modified genes into cells. Research into therapeutic tools that affect mHTT expression has developed rapidly in recent years. For example, gene silencing strategies include RNA interference (RNAi) using siRNA or microRNA, and gene silencing (ASO) based on antisense oligonucleotides that act on mRNA to inhibit huntingtin protein synthesis. In addition, DNA editing using zinc finger nucleases (ZFNs) and CRISPR-Cas9 technology is also included to suppress huntingtin gene expression.

[0004] ASO and RNAi complexes can selectively bind to mRNA via Watson-Crick base pairing, thus triggering RNA degradation mechanisms. ASOs are synthetic single-stranded DNA molecules that bind to pre-mRNA of target genes in the nucleus and catalyze their degradation by RNase H. RNAi are RNA-based gene silencing techniques, including siRNA (small interfering RNA), shRNA (short hairpin RNA), and miRNA (microRNA), which bind to mature mRNA in the cytoplasm and can be degraded by RNA-induced silencing complexes (RISC). ASOs differ from RNAi in that they act on different target genes at different sites. RNAi acts on spliced ​​mRNA and can target only exons. However, ASOs are more flexible in sequence selection because they interact with pre-mRNA and can thereby target both exons and introns. Since single-stranded DNA is more diffusible in the central nervous system and can be taken up by neurons and other cells, ASOs injected into the cerebrospinal fluid of mice or mammals can be widely dispersed in the brain. However, because double-stranded RNA has poor diffusivity in the central nervous system (CNS) and is not effectively absorbed by cells, RNAi must in most cases be delivered via viral vectors, requiring local injection into the brain parenchyma. This drug delivery approach is more complex, but it can achieve lifelong treatment with a single drug injection. While research on ASO and RNAi-based treatments for Huntington's disease has made some progress in several in vitro and in vivo animal models, none of these studies have yet led to successful clinical trials.

[0005] Directly targeting DNA to suppress transcription of the mutated huntingtin gene appears more promising than targeting RNA, and the design and use of gene editing technologies to treat Huntington's disease, though more challenging, could, in principle, improve all aspects of HD, including translation initiated in a non-ATG manner, potentially altered splicing, and other possible mechanisms that are more difficult to address with RNA reduction therapy. The leading HD gene therapies currently being investigated that target DNA involve zinc finger nucleases (ZFNs) and CRISPR-Cas9, both of which are in preclinical studies. CRISPR-Cas9 uses the Cas9 nuclease, along with guide RNA, to enable editing of targeted genes. When both the Cas9 protein and single-stranded guide RNA (sgRNA) are expressed in the cell, the sgRNA binds to a specific sequence on the genome, recruiting the Cas9 protein and causing a DNA double-strand break that activates the DNA double-strand break repair mechanism. Sequence insertions or deletions (indels) are introduced near the site of damage, resulting in the appearance of immature stop codons and gene inactivation. Genome editing using CRISPR-Cas9 is a rapidly growing field with great potential for the study and treatment of diseases, including Huntington's disease.

[0006] However, current CRISPR / Cas-based HTT knockout strategies still suffer from low gene editing efficiency, limited improvement in disease deficiency, and short-term timescale studies of treatment efficacy. [Overview of the Initiative]

[0007] Therefore, the objective of this disclosure is to provide sgRNAs for CRISPR / Cas systems that have high efficiency in HTT gene knockout, significant improvement in disease phenotype, and long-term tracking of the duration of treatment effect.

[0008] sgRNA has a nucleotide sequence that includes the nucleotide sequence shown in SEQ ID NO: 1 or SEQ ID NO: 2; or a nucleotide sequence that has at least 95% homology to the nucleotide sequence shown in SEQ ID NO: 1 or SEQ ID NO: 2 and has the same function; or a nucleotide sequence that includes a nucleotide sequence obtained by deleting, substituting, or adding 1 to 6 bases from the nucleotide sequence shown in SEQ ID NO: 1 or SEQ ID NO: 2 and has the same function.

[0009] In one embodiment, the nucleotide sequence of the sgRNA is a nucleotide sequence that has at least 98% homology to the nucleotide sequence shown in SEQ ID NO: 1 or SEQ ID NO: 2, and has the same function.

[0010] In one embodiment, the nucleotide sequence of the sgRNA is obtained by deleting, substituting, or adding 1 to 3 bases at the 5' or 3' end of the nucleotide sequence shown in SEQ ID NO: 1 or SEQ ID NO: 2, and is a nucleotide sequence having the same function.

[0011] This disclosure also provides a DNA fragment encoding the above-mentioned sgRNA, and a recombinant expression vector comprising the above-mentioned DNA fragment.

[0012] In one embodiment, the recombinant expression vector further comprises a fragment of a sequence encoding a Cas nuclease.

[0013] In one embodiment, the Cas endonuclease coding sequence is the SaCas9 endonuclease coding sequence, the SpCas9 endonuclease coding sequence, the Cas12a endonuclease coding sequence, the Cas12b endonuclease coding sequence, the Cas12e endonuclease coding sequence, the Cas12j endonuclease coding sequence, the Cas12f1 endonuclease coding sequence, the Cas13a endonuclease coding sequence, or the Cas14a endonuclease coding sequence.

[0014] In one embodiment, the recombinant expression vector is a lentiviral vector, adenovirus vector, adeno-associated virus vector, herpesvirus vector, poxvirus vector, baculovirus vector, papillomavirus vector, or papillomavirus vector. In one embodiment, the recombinant expression vector is an AAV9 virus vector.

[0015] This disclosure also provides a virus having a genome containing a nucleotide sequence encoding the above-mentioned sgRNA.

[0016] In one embodiment, the virus is a lentivirus, adenovirus, adeno-associated virus, herpesvirus, poxvirus, baculovirus, papillomavirus, or papillary polyomavirus.

[0017] In one of the embodiments, the virus is the AAV9 virus.

[0018] This disclosure also provides host cells having a genome containing the above-mentioned DNA fragment or recombinant expression vector.

[0019] In one embodiment, the host cell is a CHO cell, COS cell, NSO cell, HeLa cell, BHK cell, or HEK293T cell.

[0020] This disclosure also provides the use of the above-mentioned sgRNA, DNA fragments, recombinant expression vectors, viruses, or host cells in the preparation of products for the treatment of Huntington's disease.

[0021] In one embodiment, the product is a reagent, a kit, a drug, or a device.

[0022] This disclosure also provides a drug for the treatment of Huntington's disease, comprising the above-mentioned sgRNA, DNA fragment, recombinant expression vector, virus, or host cell, and a pharmaceutically usable excipient.

[0023] In one of the embodiments, the dosage form of the drug is an injection.

[0024] In one of the embodiments, the excipient includes one or more of a diluent, a preservative, a buffer, a disintegrant, an antioxidant, a suspending aid, a coloring agent, and an excipient.

[0025] The present disclosure also provides an HTT knockout method, including the step of exogenously expressing the above-mentioned sgRNA in target cells and the step of having a Cas endonuclease.

[0026] The present disclosure also provides a method for treating Huntington's disease, including the step of delivering the above-mentioned Cas endonuclease system and sgRNA to the striatal and cortical regions of the brain of an affected individual.

[0027] In one of the embodiments, the delivery is stereotactic injection of the brain.

[0028] By screening the present disclosure, an sgRNA targeting exon 1 of the human-derived HTT gene having the nucleotide sequence shown in SEQ ID NO: 1 or SEQ ID NO: 2 was obtained. Based on the CRISPR / Cas9-mediated HTT gene knockout strategy using this sgRNA and its highly homologous sgRNAs, the human-derived huntingtin gene can be efficiently knocked out, and gene therapy for Huntington's disease can be achieved. In experimental tests, by delivering the above-mentioned SaCas9 endonuclease and sgRNA targeting exon 1 of the human HTT gene to both the striatal region and the cortical region of the brain via an AAV9 vector, the expression of the HTT protein decreased by approximately 90%, especially at the individual level, thereby significantly improving the HD-related phenotypic defects. This gene therapy strategy has great potential to provide new ideas and techniques for the treatment of Huntington's disease.

Brief Description of the Drawings

[0029] [Figure 1]This is a schematic diagram of an AAV9-SaCas9-HTT sgRNA vector according to an exemplary embodiment of the present disclosure, comprising a U6 promoter-driven sgRNA and a CMV promoter-driven SaCas9 inserted into an AAV vector, having a sequence length of 4.5 kb between two ITRs. ITR: inverted terminal repeat, NLS: nuclear localization signal sequence, and 3×HA: three tandem repeats of the human influenza hemagglutinin (HA) tag.

[0030] [Figure 2A] The results of sgRNA editing efficiency of the HTT gene in HEK293T cells according to the embodiments of this disclosure are shown. Figure 2A is a fluorescence micrograph (scale bar: 100 μm) of HEK293T cells in which co-transfection of pEGFPc3-HTT-exon 1-20Q / 120Q together with AAV-SaCas9-sgRNA reduced huntingtin protein expression and aggregation. [Figure 2B] Figure 2B shows the quantitative analysis of fluorescence intensity in Figure 2A. The data were analyzed by one-way ANOVA with Tukey's post-hoc test. The data are presented from left to right as mean ± SEM for control sgRNA, hHTT sgRNA1, and hHTT sgRNA2, where **p<0.01, ***p<0.001 (in the 20 CAG repeat group, N=4 for control sgRNA, N=3 for hHTT sgRNA1 and hHTT sgRNA2, and N=3 for each in the 120 CAG repeat group)).

[0031] [Figure 3A] The effectiveness of a protein immunoblotting assay for detecting sgRNA-mediated editing of the HTT gene according to an exemplary embodiment of this disclosure is shown. Figure 3A shows transfection of sgRNA1 and sgRNA2 in HEK293T cells exogenously expressing GFP-tagged HTT-exons 1-20Q, and the expression levels of SaCas9 and exons 1-20Q were detected by an immunoblotting assay using anti-HA antibody and anti-GFP antibody (β-actin is the internal reference of the protein). [Figure 3B] Figure 3B shows the quantitative analysis of GFP signal (left panel) and HA signal (right panel) levels from Figure 3A, from left to right, for control sgRNA, hHTT sgRNA1, and hHTT sgRNA2, respectively. For anti-GFP, the GFP expression level of the sgRNA1 group compared to the control group was 0.2844±0.1551 (p=0.0087), and the expression level of the sgRNA2 group compared to the control group was 0.5706±0.1099 (p=0.0727). For anti-HA, the SaCas9 expression level in the sgRNA1 group was 0.8814±0.1487 (p=0.7178), and the expression level in the sgRNA2 group was 0.9048±0.0.1049 (p=0.8040). [Figure 3C] Figure 3C shows the transfection of sgRNA1 and sgRNA2 in HEK293T cells exogenously expressing GFP-tagged HTT-exon 1-120Q, with Western blotting experiments used to detect SaCas9 and exon 1, and the expression levels of 120Q (β-actin as control). [Figure 3D] Figure 3D shows the quantitative analysis of GFP signal (left panel) and HA signal (right panel) levels in Figure 3C. From left to right, the data are for control sgRNA, hHTT sgRNA1, and hHTT sgRNA2. For anti-GFP, the GFP expression level of the sgRNA1 group was 0.0688 (p=0.0069) relative to the control group, and the expression level of the sgRNA2 group was 0.7238±0.1447 (p=0.1675) relative to the control group. For anti-HA, the SaCas9 expression level of the sgRNA1 group was 1.162±0.093 (p=0.6217) relative to the control group, and the expression level of the sgRNA2 group was 0.9782±0.1835 (p=0.9907) relative to the control group. The data were analyzed using one-way ANOVA with Tukey's post-hoc test, where ** indicates p<0.01 and N=3 in each experimental group.

[0032] [Figure 4]The expression patterns of AAV9-GFP in the primary motor cortex and striatum according to embodiments of this disclosure are shown, where M1 is the primary motor cortex, M2 is the secondary motor cortex, CC is the corpus callosum, LV is the lateral ventricle, and Str is the striatum (scale bar: 500 μm).

[0033] [Figure 5] The left panel shows the levels of mHTT protein expression in the striatum, cortex, and cerebellum of 4-month-old, 7-month-old, and 11-month-old BAC226Q-HTTg1 mice according to embodiments of this disclosure. The left panel shows immunoblotting responses to detect mHTT protein expression in the striatum, cortex, and cerebellum of 4-month-old and 7-month-old non-tg-SaCas9, BAC226Q-SaCas9, and BAC226Q-HTTg1 mice. AAV9-SaCas9 or AAV9-SaCas9-HTTg1 was injected only into the striatum and cortex of the mice, and not into the cerebellum. The right panel shows the expression of mHTT protein in the striatum of 11-month-old uninjected wild-type mice (non-tg-uninjected), non-tg-SaCas9 mice, BAC226Q-SaCas9 mice, and BAC226Q-HTTg1 mice, as determined by immunoblotting (mHTT protein was detected by 1C2 antibody, and β-actin was an internal control).

[0034] [Figure 6A] Figure 6A shows the mHTT signaling in the upper striatum and lower primary motor cortex of 4-month-old mice detected by the S830 antibody according to embodiments of this disclosure. Figure 6A shows immunofluorescence staining of the mHTT signaling in the striatum of 4-month-old non-tg-SaCas9, HD-SaCas9 (BAC226Q-SaCas9), and HD-HTTg1 (BAC226Q-HTTg1) mice, where mHTT is labeled with the S830 antibody and the nuclei are labeled with the nuclear stain DAPI. A1 and A2 in the far right column are magnified images of the corresponding regions 50 on the left (scale bar: 50 μm). [Figure 6B]Figure 6B shows the quantitative analysis of the agglutination signal of striatal mHTT from Figure 6A, with data from non-tg-SaCas9, HD-SaCas9, and HD-HTTg1 from left to right. The agglutination signal of mHTT was analyzed using ImageJ's Analyze particles (aggregation signal = agglutination count × integrated density). [Figure 6C] Figure 6C shows immunofluorescence staining of mHTT signaling in the primary motor cortex of 4-month-old non-tg-SaCas9 mice, HD-SaCas9 (BAC226Q-SaCas9) mice, and HD-HTTg1 (BAC226Q-HTTg1) mice. C1 and C2 in the far right column are magnified images of the corresponding regions on the left (scale bar: 50 μm). [Figure 6D] Figure 6D shows the statistics of mHTT aggregation signals in the primary motor cortex in Figure 6C, with data from non-tg-SaCas9, HD-SaCas9, and HD-HTTg1 from left to right. The data were analyzed by one-way ANOVA with Tukey's post-hoc test, where *** indicates p<0.001, ** indicates p<0.01, and * indicates p<0.05, with N=5 in each experimental group.

[0035] [Figure 7A] In one embodiment of this disclosure, the mHTT signal in the striatum (upper) and primary motor cortex (lower) of 7-month-old mice detected by the S830 antibody is shown. Figure 7A shows immunofluorescence staining of the mHTT signal in the striatum of 7-month-old non-tg-SaCas9 mice, HD-SaCas9 (BAC226Q-SaCas9) mice and HD-HTTg1 (BAC226Q-HTTg1) mice, where mHTT is labeled with the S830 antibody. The nuclei are labeled with the nuclear stain DAPI, and the rightmost columns A1 and A2 are magnified images of the corresponding regions on the left (scale bar: 50 μm). [Figure 7B] Figure 7B shows the statistics of mHTT signals in the striatum from Figure 7A. The mHTT signals were counted as aggregation signals using the particle analysis function in Image J. [Figure 7C]Figure 7C shows immunofluorescence staining of mHTT signaling in the primary motor cortex of 7-month-old non-tg-SaCas9 mice, HD-HTTg1(BAC226Q-HTTg1) mice, and HD-HTTg1(BAC226Q-HTTg1) mice. C1 and C2 in the far right column are magnified images of the corresponding regions on the left (scale bar: 50 μm). [Figure 7D] Figure 7D shows the statistics of mHTT signaling in the primary motor cortex in Figure 7C. The data were analyzed by one-way ANOVA with Tukey's post-hoc test, where *** indicates p<0.001, ** indicates p<0.01, and * indicates p<0.05, with N=5 in each experimental group.

[0036] [Figure 8A] Figure 8A shows the mHTT signal in the brains of 11-month-old mice detected by the S830 antibody according to an embodiment of this disclosure. Figure 8A shows immunohistochemical staining of the mHTT signal in the brains of 11-month-old BAC226Q-GFP (left) mice and BAC226Q-HTTg1 (right) mice injected with AAV9-SaCas9-HTTg1 or AAV9-GFP as a control, where the mHTT signal was labeled with the S830 antibody, and the images were obtained by whole-brain slice scans (scale bar: 2000 μm). [Figure 8B] Figure 8B is a magnified image corresponding to the light gray box (left) and dark gray box (right) in Figure 8A, showing the mHTT staining signal in the striatum.

[0037] [Figure 9]The phenotypic results for AAV-SaCas9-HTTg1 according to the embodiments of this disclosure are shown, with a significant enhancement of the phenotype in BAC226Q mice in the rotorod test. Behavioral performance of 11- to 16-week-old non-tg-SaCas9, BAC226Q-SaCas9, and BAC226Q-HTTg1 mice on a uniformly accelerated rotorod, as well as records of the time the mice remained on the rotorod (latency to fall), are shown. Data were analyzed by two-way ANOVA with Bonferroni post-hoc test, where *** indicates p<0.001, ** indicates p<0.01, and * indicates p<0.05, and data are presented as mean ± SEM. There were N=9 for the BAC226Q-HTTg1 group, N=10 for the BAC226Q-SaCas9 group, and N=10 for the non-tg-SaCas9 group.

[0038] [Figure 10A] The phenotypic results of BAC226Q mice rescued with AAV-SaCas9-HTTg1 in gait analysis according to the embodiments of this disclosure are shown. Figure 10A shows representative footprints of 6-month-old non-tg-SaCas9 mice (top), BAC226Q-SaCas9 mice (center), and BAC226Q-HTTg1 mice (bottom) in gait analysis. [Figure 10B] Figure 10B shows the gait regularity index of non-tg-SaCas9 mice, BAC226Q-SaCas9 mice, and BAC226Q-HTTg1 mice at 2.5, 4, and 6 months of age. [Figure 10C] Figure 10C shows the footprint areas of 2.5-month-old non-tg-SaCas9, BAC226Q-SaCas9, and BAC226Q-HTTg1 mice. The data were analyzed by one-way ANOVA with Tukey's post-hoc test, where in Figures 10C-E, *** indicates p<0.001, ** indicates p<0.01, and * indicates p<0.05. Data are presented as mean ± SEM, with N=10 for all other groups except N=9 for the 2.5 and 4-month-old BAC226Q-HTTg1 groups. [Figure 10D]Figure 10D shows the footprint areas of 4-month-old non-tg-SaCas9 mice, BAC226Q-SaCas9 mice, and BAC226Q-HTTg1 mice. [Figure 10E] Figure 10E shows the footprint areas of 6-month-old non-tg-SaCas9, BAC226Q-SaCas9, and BAC226Q-HTTg1 mice. The data were analyzed by one-way ANOVA with Tukey's post-hoc test, where *** indicates p<0.001, ** indicates p<0.01, and * indicates p<0.05. Data are presented as mean ± SEM, with N=10 for all other groups except N=9 for the 2.5 and 4-month-old BAC226Q-HTTg1 groups.

[0039] [Figure 11A] The behavioral data of mice in an open field test according to an embodiment of this disclosure are shown. Figure 11A is a heatmap showing the location and time of 6-month-old non-tg-SaCas9 mice (left), BAC226Q-SaCas9 mice (center), and BAC226Q-HTTg1 mice (right) in an open field experiment. Darker colors indicate longer time spent in that location, and lighter colors indicate shorter time spent in that location. The trajectories of spontaneous movement of non-tg-SaCas9 mice mainly followed the perimeter of the open field, the trajectories of BAC226Q-SaCas9 mice mainly stayed in one corner, and the trajectories of BAC226Q-HTTg1 mice were more dispersed than those of BAC226Q-SaCas9 mice. [Figure 11B] Figure 11B shows the standard deviation of walking distance in the four quadrants for 6-month-old mice, reflecting the difference in time spent in each quadrant (N=10 for each group). [Figure 11C] Figure 11C shows the total distance traveled in open field by 2.5, 4, and 6-month-old non-tg-SaCas9 mice, BAC226Q-SaCas9 mice, and BAC226Q-HTTg1 mice, with N=9 for each group in the 2.5 and 4-month-old groups, and N=10 for each group in the 6-month-old groups. [Figure 11D]Figure 11D shows the stereotypic counts (stereotypic counts) of 2.5, 4, and 6-month-old non-tg-SaCas9, BAC226Q-SaCas9, and BAC226Q-HTTg1 mice in an open field. For 2.5-month-old and 4-month-old mice, there were N=9 for each group, and for 6-month-old mice, there were N=10 for each group. From left to right, the data are for non-tg-SaCas9, BAC226Q-SaCas9, and BAC226Q-HTTg1. The data were analyzed by one-way ANOVA with Tukey's post-hoc test, where *** indicates p<0.001, ** indicates p<0.01, and * indicates p<0.05. Data are presented as mean ± SEM.

[0040] [Figure 12] The body weight of BAC226Q mice after SaCas9-HTTg1 treatment according to the embodiments of this disclosure is shown, along with the changes in body weight of non-tg-SaCas9 mice, BAC226Q-SaCas9 mice, and BAC226Q-HTTg1 mice recorded from week 0 to week 30 after viral injection. The initial number of mice in the non-tg-SaCas9 group was 27, and the initial number of mice in the BAC226Q-SaCas9 and BAC226Q-HTTg1 groups was 26. At the end of the study, the initial number of mice in the non-tg-SaCas9 group was 6, the final number of mice in the BAC226Q-SaCas9 group was 3, and the final number of mice in the BAC226Q-HTTg1 group was 5. The data were analyzed by two-way ANOVA with Tukey's post-hoc test, where ** indicates p<0.01 and * indicates p<0.05, and the data are presented as mean ± SEM.

[0041] [Figure 13] The survival curves of BAC226Q mice treated with SaCas9-HTTg1 according to the embodiments of this disclosure are shown. The initial number of mice in the non-tg-SaCas9, BAC226Q-SaCas9, and BAC226Q-HTTg1 groups were 17, 17, and 21, respectively. The data were analyzed by the log-rank (Mantel-Cox) test, and the p-value for the comparison between the BAC226Q-SaCas9 and BAC226Q-HTTg1 groups was 0.0061.

[0042] [Figure 14A] The phenotypic analysis of BAC226Q mice after striatal injection of AAV9-SaCas9-HTTg1 according to embodiments of this disclosure is shown. Figure 14A shows a rotarod test performed on 12-16 week old wild-type and BAC226Q mice after injection of AAV-SaCas9-HTTg1 or AAV-SaCas9, N=13. [Figure 14B] Figure 14B shows the results of open-field studies conducted on 3-month-old, 3.5-month-old, and 5-month-old wild-type mice and BAC226Q mice after injection of AAV-SaCas9-HTTg1 or AAV-SaCas9, respectively, with N=8. [Figure 14C] Figure 14C shows the body weight of mice at one-month intervals, and there was no significant difference in body weight between BAC226Q-SaCas9 and BAC226Q-HTTg1 (non-tg-SaCas9, N=17-28; BAC226Q-SaCas9, N=15-27; BAC226Q-HTTg1, N=15-32). The data were analyzed by one-way ANOVA with Tukey's post-hoc test, and ns showed no significant difference; the data are presented as mean ± SEM.

[0043] [Figure 15A]The editing efficiency and off-target effects of PEM-Seq detection of SaCas9-HTTg1 according to embodiments of this disclosure were demonstrated using genomic DNA from the striatum and cortex of 2-month and 13-month-old BAC226Q mice, or from primary cultured neurons of BAC226Q infected with AAV-SaCas9-HTTg1, and primary cultured neurons of BAC226Q not infected with AAV-SaCas9-HTTg1 (negative control). Figure 15A shows the gene editing efficiency by PEM-Seq detection of SaCas9-HTTg1, where gene editing efficiency is the ratio of editing events to all events, with N=2 for the neuron-control group, N=2 for the neuron-HTTg1 group, N=10 for the 2m BAC226Q-HTTg1 group, and N=4 for the 13m BAC226Q-HTTg1 group. Data are shown as mean ± SEM. [Figure 15B] Figure 15B shows the frequency of off-target events for SaCas9 detected by PEM-Seq, with N=2 for the neuron-control group, N=2 for the neuron-HTTg1 group, N=10 for the 2m BAC226Q-HTTg1 group, and N=4 for the 13m BAC226Q-HTTg1 group. Data are shown as mean ± SEM. [Figure 15C] Figure 15C is a circos diagram of off-target loci detected by PEM-Seq, where arrows point to the loci of the human HTT gene and the off-target loci of the mouse HTT gene, curves connect the targeted and off-target loci, off-target loci cause chromosomal translocation between the two loci, black base sequences represent the HTT sgRNA1 targeted locus, gray base sequences represent the PAM sequence of SaCas9, and mismatches between human HTT and mouse HTT are shown in lowercase.

[0044] [Figure 16A]The edited human mHTT gene according to the embodiments of this disclosure is shown. Figure 16A shows the insertion-deletion morphology of human-derived mHTT cleavage sites detected by PEM-Seq, from the brains of 2-month and 13-month-old BAC226Q mice injected with AAV-SaCas9-HTTg1. Black base sequences represent HTT sgRNA1 targeting sites, black underlined base sequences represent SaCas9 PAM sequences, base insertions are shown in lowercase, base deletions are shown by short horizontal lines, and vertical dashed lines represent SaCas9 endonuclease cleavage sites. [Figure 16B] Figure 16B shows the relative frequencies of the five major edit products of the human mHTT gene, N=7. [Modes for carrying out the invention]

[0045] To facilitate understanding of this disclosure, a more comprehensive description of this disclosure and preferred embodiments are provided below. However, this disclosure can be implemented in many different forms and is not limited to the embodiments described herein. Rather, these embodiments are provided for the purpose of providing a more complete and comprehensive understanding of this disclosure.

[0046] Unless otherwise defined, all technical and scientific terms used herein have the same meaning as those generally understood by those skilled in the art to which this disclosure belongs. Terms used herein in this disclosure are for illustrative purposes only and are not intended to limit this disclosure. Where used herein, the term "and / or" includes any combination of one or more of the related enumerated items.

[0047] One embodiment of the present disclosure relating to sgRNA includes a nucleotide sequence shown in SEQ ID NO: 1 (guide sequence 1: 5'-TGGAAAAGCTGATGAAGGCCT-3') or SEQ ID NO: 2 (guide sequence 2: 5'-GAAGGCCTTCATCAGCTTTTC-3'); or a nucleotide sequence; or a nucleotide sequence having at least 95% homology, for example 95% homology, 96% homology, 97% homology, 98% homology, 99% homology, etc., and having the same function as the aforementioned nucleotide sequence; or a nucleotide sequence obtained by deletion, substitution, or addition of 1 to 6 bases from the nucleotide sequence shown in SEQ ID NO: 1 or SEQ ID NO: 2 (for example, a nucleotide sequence obtained by deletion, substitution, or addition of 1, 2, 3, 4, 5 or 6 bases), and having the same function.

[0048] This disclosure describes how, through research design and screening, sgRNAs targeting exon 1 of the human HTT gene, having the nucleotide sequence shown in SEQ ID NO: 1 or SEQ ID NO: 2, can be obtained. A CRISPR / Cas9-mediated HTT gene knockdown strategy based on this sgRNA and its high homologous sgRNAs allows for efficient knockdown of the human huntingtin gene for gene therapy of Huntington's disease. In experimental studies, delivery of the AAV9 vector SaCas9 endonuclease and the aforementioned sgRNAs targeting exon 1 of the human HTT gene to both striatal and cortical regions of the brain resulted in approximately 90% reduction in HTT protein expression, particularly a significant improvement in HD-related phenotypic deficiency at the individual level. This gene therapy strategy has great potential to provide novel ideas and techniques for the treatment of Huntington's disease.

[0049] In some specific cases, the nucleotide sequence of the sgRNA has at least 98% homology to the nucleotide sequence shown in SEQ ID NO: 1 or SEQ ID NO: 2, and is a nucleotide sequence that has the same function.

[0050] In other specific examples, the nucleotide sequence of sgRNA is a nucleotide sequence that has the same function as the nucleotide sequence shown in SEQ ID NO: 1 or SEQ ID NO: 2, obtained by deletion, substitution, or addition of 1 to 3 bases at the 5' or 3' end.

[0051] A DNA fragment according to one embodiment of the present disclosure, encoding the above-mentioned sgRNA.

[0052] A recombinant expression vector according to one embodiment of the present disclosure, comprising the DNA fragment described above. Examples of vector types include, but are not limited to, plasmids; phage particles; coase plasmids; artificial chromosomes such as yeast artificial chromosomes (YACs), bacteriophage artificial chromosomes (BACs), or P1-derived artificial chromosomes (PACs); phages such as lambda phages or M13 phages; and animal viruses. Examples of animal viruses that can be used as vectors include, but are not limited to, retroviruses (including lentiviruses), adenoviruses, adeno-associated viruses, herpesviruses (e.g., herpes simplex virus), poxviruses, baculoviruses, papillomaviruses, and papillary polyomaviruses (e.g., SV40).

[0053] One specific example is the recombinant expression vector, which is an adeno-associated virus vector. Adeno-associated viruses are single-stranded DNA viruses that are effective gene therapy delivery vectors and can reside in host cells as episomes for the long-term expression of target genes. Adeno-associated virus vectors are available in different serotypes, each with different histotropy and cytotropy, with common serotypes including AAV1, AAV2, AAV5, AAV6, AAV8, and AAV9, preferably AAV9. The AAV-CRISPR / Cas9 system can achieve efficient in vivo gene editing and has great potential for application. AAV9 has high infection efficiency in the CNS and is therefore well-suited for use as a gene delivery vector in the treatment of CNS diseases.

[0054] In one specific example, the recombinant expression vector also contains a fragment of a sequence encoding a Cas nuclease, such as, but not limited to, SaCas9, SpCas9, Cas12a, Cas12b, Cas12e, Cas12j, Cas13a, Cas12f1, or Cas14a. In some cases, the above Cas endonuclease encoding sequence is the SaCas9 endonuclease encoding sequence. The use of SaCas9 nuclease from Staphylococcus aureus allows for the packaging of SaCas9 and sgRNA into the same adeno-associated virus vector, improving gene editing delivery efficiency. SaCas9 has nearly the same gene editing efficiency as the more commonly used SpCas9, but its gene length is 20% smaller (SaCas9: 3.2kb (1053 amino acids), SpCas9: 4.2kb (1368 amino acids)). Since the AAV9 packaging capacity can be limited to only 4.7kb, SaCas9 and sgRNA expression components can be constructed simultaneously in the same AAV vector, and the simultaneous construction of Cas9 protein and sgRNA in the AAV viral vector can achieve more efficient in vivo delivery.

[0055] A virus in one embodiment of the present disclosure has a genome comprising a nucleotide sequence encoding the above-described sgRNA. Examples of virus types include, but are not limited to, retroviruses (including lentiviruses), adenoviruses, adeno-associated viruses, herpesviruses (e.g., herpes simplex virus), poxviruses, baculoviruses, papillomaviruses, and papillary polyomaviruses (e.g., SV40).

[0056] This disclosure also provides host cells having a genome containing the above-mentioned DNA fragment or recombinant expression vector. Examples of host cell types include, but are not limited to, prokaryotic cells such as Escherichia coli (E. coli) or Clostridium perfringens, fungal cells such as yeast cells or Aspergillus, insect cells such as Drosophila S2 cells or Sf9 cells, or human cells such as fibroblasts, CHO cells, COS cells, NSO cells, HeLa cells, BHK cells or HEK293T cells, or animal cells.

[0057] This disclosure also provides the use of the above-mentioned sgRNA, DNA fragments, recombinant expression vectors, viruses, or host cells in the preparation of products for the treatment of Huntington's disease.

[0058] In one specific example, the above-mentioned products include reagents, kits, drugs, or devices. It is understood that specific types are not limited to these.

[0059] A drug for treating Huntington's disease according to one embodiment of the present disclosure comprises the above-mentioned sgRNA, DNA fragment, recombinant expression vector, virus, or host cell, and a pharmaceutically usable excipient.

[0060] In one specific example, the dosage form of the above-mentioned drug is an injection, but it is not limited to this.

[0061] In one specific example, the excipients include one or more of the following: diluents, preservatives, buffers, disintegrants, antioxidants, co-suspending agents, colorants, and excipients.

[0062] In one specific example, the diluent is selected from one or more of polyethylene glycol, propylene glycol, vegetable oil, and mineral oil. In another specific example, the preservative is selected from one or more of sorbic acid, methyl sorbate, methylparaben, ethylparaben, propylparaben, butylparaben, benzylparaben, sodium methylparaben, benzoic acid, and benzyl alcohol. In yet another specific example, the buffer is selected from one or more of sodium hydrogen phosphate, sodium dihydrogen phosphate, sodium citrate, sodium tartrate, and sodium acetate. In yet another specific example, the disintegrant is selected from one or more of cross-linked carboxymethylcellulose sodium, carboxymethyl starch sodium, cross-linked polyvinylpyrrolidone, or low-substituted hydroxypropylcellulose. In another specific example, the antioxidant is selected from one or more of ethylenediaminetetraacetic acid, disodium ethylenediaminetetraacetic acid, dibutylhydroxytoluene, glycine, inositol, ascorbic acid, sodium ascorbate, lecithin, malic acid, hydroquinone, citric acid, succinic acid, and sodium metabisulfite. In yet another specific example, the co-suspension is selected from one or more of beeswax, ethyl hydroxyethylcellulose, chitin, chitosan, methylcellulose, carboxymethylcellulose, agar, hydroxypropyl methylcellulose, and xanthan gum. In yet another specific example, the colorant is selected from one or more of carbon black, iron black, iron brown, iron red, and titanium dioxide. In yet another specific example, the excipient is selected from one or more of mannitol, glucose, lactose, dextran, dextrose, and sodium chloride.

[0063] An HTT knockout method according to an embodiment of this disclosure includes the step of exogenously expressing the above-mentioned sgRNA and Cas nucleic acid endonuclease in a cell. It will be understood that the HTT knockout method may be used not only for the purpose of diagnosing and treating diseases, but also for the purpose of diagnosing and treating non-diseases.

[0064] A method for treating Huntington's disease according to the embodiments of this disclosure includes the step of delivering the above-described Cas nuclease system and sgRNA to the striatal and cortical regions of the brain of an affected individual. Delivery of both sgRNA and the Cas endonuclease system to the striatum and cortex of an affected individual has been shown to be more effective in rescuing the disease phenotype in HD patients. Synergistic interactions between multiple brain regions, particularly between the striatum and cortex, are important for rescuing the disease phenotype in HD patients.

[0065] In one specific example, delivery is via stereotactic injection, enabling precise and efficient delivery of the target gene to a specific region of the brain. In another specific example, the delivery approach may include, but is not limited to, subarachnoid injection, lateral ventricle injection, cerebellomedulla pool injection, intravenous injection, and other delivery approaches.

[0066] This disclosure will be described in further detail below, in conjunction with specific embodiments and accompanying drawings.

[0067] 1. Experimental Method

[0068] 1.1 Construction of the AAV-SaCas9-sgRNA vector

[0069] The single-stranded guide RNA was inserted into the AAV-Cas9 vector by annealing the sense and antisense oligomer strands of the phosphorylated single-stranded guide RNA to form a double-stranded structure, followed by digestion with Bsa I endonuclease and ligation. The resulting ligation product was then transformed into Stbl3 competent cells, and plasmid DNA was isolated using the QIAprep spin miniprep kit according to the instructions. The sequence of the obtained DNA was confirmed by sequencing with the LKO.1 5' primer (LKO.1 5' primer sequence: 5'-GACTATCATATGCTTACCGT-3'). The structure of the AAV-SaCas9-sgRNA vector is shown in Figure 1. The vector backbone containing the SaCas9 and sgRNA sequences is from Addgene (plasmid #61591), and the specific sequences of the sgRNA and PAM are shown below. Guide array 5'-TGGAAAAGCTGATGAAGGCCT-3' 5'-GAAGGCCTTCATCAGCTTTTC-3' PAM 5'-TCGAGT-3' 5'-CAGGGT-3'

[0070] 1.2 Culture and transfection of HEK293T cells

[0071] Human fetal kidney (HEK) 293 T cells (ATCC, CRL-1573) were cultured in DMEM medium (Dulbeccoo's modified Eagle medium, Thermo Fisher) supplemented with 10% (v / v) fetal bovine serum (FBS, Thermo Fisher), 1% (v / v) penicillin and streptomycin (penicillin-streptomycin, Thermo Fisher), and 1% (v / v) L-glutamine (Thermo Fisher). The culture conditions were 37°C and a 5% CO2 environment. 293T cells were cultured to approximately 70% density and transfected with 2.5 μg of AAV-SaCas9-sgRNA vector. The kit used for transfection was Lipofectamine 2000 (Invitrogen, 11668030), and 2.5 μg of pEGFPc3-human HTT exon 1-120Q or pEGFPc3-human HTT exon 1-20Q was transfected after 16 hours.

[0072] 1.3 Purification of AAV9 virus vector

[0073] The AAV vector was amplified as previously reported (Ding et al., 2016; Grieger et al., 2006). Briefly, 10 plates of HEK293T cells were cultured to 90% density in 15 cm diameter dishes prior to transfection, and 5 mL of a plasmid and PEI (polyethyleneimine, Sigma-Aldrich, 76509) mixture was added to each plate. The mixture contained 70 μg of AAV9 vector, 200 μg of Ad-helper plasmid, 70 μg of AAV-Rep / Cap plasmid, and PEI (1 μg / μL). The PEI-to-DNA ratio used in this experiment was 5:1 (v / g). Each reagent in the mixture was added to DMEM up to a final volume of 50 mL and thoroughly mixed for later use. 60 hours after transfection, cells were harvested using culture medium and centrifuged at 1000 rpm for 10 minutes. Finally, the cell pellet was resuspended in 5 mL of cell lysis buffer (150 mM NaCl, 20 mM Tris, pH 8.0).

[0074] Cell lysates were freeze-thawed three times under liquid nitrogen and 37°C water bath conditions to release the virus from the disrupted cell membranes. A final concentration of 1 mM MgCl2 and 250 U / mL of nuclease benzoase (Sigma, E8263-25k) were added to the cell lysates, and the mixture was incubated at 37°C for 15 minutes to dissolve DNA / protein aggregates. The cell lysates were then centrifuged at 4000 rpm at 4°C for 30 minutes, and the supernatant was collected to obtain the virus solution.

[0075] The virus solution was added to the iodixanol gradient solution. The volume and density of the gradient solutions from bottom to top are as follows: 17% in 6 mL (5 mL of 10×PBS, 0.05 mL of 1M MgCl2, 0.125 mL of 1M KCl, 10 mL of 5M NaCl, 12.5 mL of Optiprep (Sigma, D1556), with water added up to 50 mL), 25% in 6 mL (5 mL of 10×PBS, 0.05 mL of 1M MgCl2, 0.125 mL of 1M KCl, 20 mL of Optiprep, with water added up to 50 mL), 40% in 5 mL (5 mL of 10×PBS, 0.05 mL of 1M MgCl2, 0.125 mL of 1M KCl, 33.3 mL of Optiprep, with water added up to 50 mL), and 60% in 4 mL (0.05 mL of 1M MgCl2, 0.125 mL of 1M The solution was KCl, 50 mL of Optiprep. The sample was then centrifuged at 14°C and 53,000 rpm for 160 minutes, and the virus was recovered from 40% of the layer.

[0076] The viral components were mixed with PBS solution and F188 (1:10000, Polomaxer, Sigma), added to an Amacon 100K filter (UFC910008, Millipore Sigma), and centrifuged at 3500 rpm at 4°C for 20 minutes to remove iodixanol and concentrate the virus. The filtrate was then removed, and PBS solution containing F188 was added to the viral fraction. The filter tube was then centrifuged at 3500 rpm at 4°C for 20 minutes. The filtrate was discarded again to obtain the viral fraction in PBS. The viral fraction was then centrifuged at 3500 rpm at 4°C for 20 minutes until the viral volume was concentrated to 500 μL.

[0077] The viral titer could be determined by quantitative PCR. Subsequently, SDS-PAGE and Coomassie blue staining experiments were performed to confirm the purity of the viral vector. In this experiment, the only proteins observed on the SDS-PAGE gel were VP1, VP2, and VP3, which constitute the viral capsid particle, with molecular weights of 87 kDa, 73 kDa, and 62 kDa, respectively.

[0078] 1.4 Stereotactic injection into the mouse brain

[0079] In this example, the BAC226Q HD mouse model was used in a preclinical proof-of-concept study. The BAC226Q mouse model was created by transgenically expressing a human mHTT gene with 226 CAA-CAG mixed repeats in wild-type mouse embryos using a bacterial artificial chromosome (BAC). BAC226Q mice can express a human mHTT protein with 226 glutamines. Expression of this protein causes BAC226Q mice to exhibit a range of HD patient-associated phenotypes, and the BAC226Q mouse model is currently the only HD mouse model that can accurately reproduce the disease phenotype of Huntington's disease patients, without any other phenotypes that are not present in patients.

[0080] AAV stereotactic injections were performed into BAC226Q mice or non-transgenic control mice between 26 and 30 days of age. Mice were first anesthetized and then fixed with a stereotactic device (RWD, 68019). Subsequently, the scalps of the mice were disinfected with alcohol and povidone-iodine, the scalps were incised to expose the skulls, and the skulls were then punched out at specific and appropriate coordinate positions. The corresponding anterior-posterior (AP) and lateral-medial (ML) stereotactic coordinates were calculated on the dura mater surface of the mice. A total volume of 2.5 μL of AAV9 virus was injected into the striatum of the mice at a rate of 0.3 μL / min (coordinates: rostral +0.8 mm relative to the bregma, lateral ±2.1 mm relative to the medial side, and ventral -3.1 mm from the brain surface). Next, a total volume of 0.5 μL was injected at a rate of 0.1 μL / min into the primary motor cortex of mice (coordinates: rostral +1.5 mm relative to the bregma, lateral ±1.5 mm relative to the medial side, and ventral -1.0 mm from the brain surface). The titer of AAV9 was 2 × 10⁻¹⁶. 13 The amount of viral genome / mL was injected bilaterally, so the amount of virus injected per mouse brain was 1.2 × 10⁻⁶. 11 The sample was a viral genome. The equipment used for viral injection was a Hamilton syringe connected to a microsyringe pump (RWD, 788130). The Hamilton syringe used for viral delivery was a 1701 Hamilton microsyringe (Hamilton, 7853-01) equipped with a 33-gauge needle (Hamilton, 7803-05). To reduce perfusion of the viral solution when the needle was withdrawn, the needle was left in place for 15 minutes after each injection. After the procedure, the mice were placed on a heated blanket to allow them to recover from anesthesia.

[0081] 1.5 Altered expression of HTT protein in mouse brain by immunoprotein blotting

[0082] Mouse brains were dissected in an ice bath of PBS. Brain tissue was incubated in RIPA buffer (150 mM NaCl, 0.1% SDS, 1% sodium deoxycholate, 50 mM triethanolamine, 1% NP-40, pH 7.4) containing a protease inhibitor cocktail (Sigma, 111M4009) and the caspase inhibitor Boc-D-FMK (Abcam, ab142036, pH 7.4), and lysed on ice using an ultrasonic vibrator (Fisherbrand, FB120) at 20% sonication intensity (1 second sonication followed by a 2-second pause), and this process was repeated 20-25 times. The lysate was incubated at 4°C for 1 hour, and then the insoluble fraction was removed by centrifugation at 16100 g for 20 minutes at 4°C. The protein concentration in the lysate was determined by detecting the peak absorption at 562 nm using the BCA protein assay kit (Thermo Scientific, 23225). Then, NuPAGE 4×LDS sample buffer and 10× sample reducing agent (Invitrogen) were added to the lysate, and the sample preparation was completed by heating at 70°C for 10 minutes. 90–120 μg of protein was loaded onto a 4%–12% NuPAGE Bis-Tris gel with MOPS electrophoresis buffer. The protein blot was transferred to an Immobilon-FL PVDF membrane (Millipore, IPFL00010) using a wet transfer method. The PVDF membrane with the immunoblot was then treated in Odyssey blocking buffer (LI-COR, 927-40000) for 1 hour. After TBST rinsing, the PVDF membrane was incubated overnight at 4°C in primary antibody buffer diluted with blocking buffer. Next, the PVDF membrane with the immunoblot is rinsed three times in TBST (10 minutes each time) and incubated with IRDye680RD goat anti-mouse (1:10000, LI-COR, 926-68070) or goat anti-rabbit (1:10000, LI-COR, 926-68071) secondary antibody at room temperature for 1 hour. The protein signal can be detected using an Odyssey CLx imager (LI-COR) under 700 nm channel conditions.The primary antibodies used in this example are listed below: 1C2 (1:5000, mouse, Millipore, MAB1574), β-actin (1:2000, rabbit, Cell Signaling, 4970), and GFAP (1:50000, rabbit, Abcam, ab7260).

[0083] 1.6 Detection of HTT protein expression in mouse brain by immunofluorescence and immunohistochemical staining

[0084] Experimental mice were anesthetized and perfused with 4% paraformaldehyde, and then the mouse brains were fixed overnight in the same fixative. The fixed brains were sliced ​​to a thickness of 30 μm or 40 μm using a vibrating blade microtome (Leica, VT1200S). The brain sections were then blocked for 1 hour at room temperature in PBS buffer supplemented with 10% sheep serum containing 0.1%–0.3% Triton X-100, incubated overnight at 4°C with the primary antibody solution, and then the antibody was washed off. Staining was continued by incubation with a fluorescent secondary antibody for immunofluorescence staining. Alternatively, the sections were treated with a biotinylated protein A and ABC peroxidase complex, incubated with diaminobenzidine, and the sections were mounted on slides for subsequent observation.

[0085] 1.7 Behavioral tests in mice to detect treatment effects

[0086] Mouse behavioral analyses were performed under identical environmental conditions, time constraints, and with the same experimental staff. The mouse genotypes and experimental treatment conditions were unknown at the time of the experiment.

[0087] Rotorod Experiment: Mice were trained on a rotorod treadmill (Med Associates, Inc., ENV-574M) three times a day for three consecutive days. Mice were trained for one minute each time at a constant speed of 10 rpm / min. Mice that fell from the rotorod during training trials were gently returned. Mice were tested three times a day for three days a week, with a minimum 15-minute rest period between each trial. During the test, the rotorod accelerated from 5 rpm to 40 rpm over a maximum of 300 seconds. The latency to fall from the rotorod was recorded, and all data obtained from the experiment were statistically analyzed. Latency to fall was defined as the time it took for the mouse to fall from the rotorod or the time it took for the mouse to hold the rod for more than three cycles. All rotorod experiments were performed during the dark phase of the light cycle.

[0088] Open-field experiment: The mice used in the open-field experiment were 4 and 7 months old. The experiment was conducted for 10 minutes, following an established experimental procedure. All experiments were performed at the same time. The apparatus for the open-field experiment consisted of a transparent glass box (28 × 28 cm, Med Associates, Inc., ENV-510). A schematic diagram showing the time and position of the mice in the cage was completed using R (https: / / www.r-project.org / ), which represents the average data from 9 experiments per mouse (3 days, 3 times per day).

[0089] Gait Analysis Experiment: Mouse gait was analyzed using CatWalk XT (Noldus Information Technology, Wageningen, Netherlands) software. The CatWalk system consists of an enclosed walking channel mounted on a glass platform, which the mouse traverses from one end to the other during the experiment. Fully internally reflected green light can only be emitted in the area where the feet are in contact with the glass plate. A high-speed camera positioned beneath the walkway records the footprints. Image data from the captured footprints is used for footprint classification and subsequent analysis experiments. Prior to the experiment, mice were trained at least four times a day for at least four days using a non-coercive, intrusive method to adapt to the process of walking a 70 cm long walkway. The experiment was conducted in a darkroom and under silent conditions. On the experimental days, mice were tested three times a day at the same point in time for three consecutive days. Behaviors including wall climbing, hair grooming, and staying in the walkway were not statistically analyzed. Mice that did not successfully complete CatWalk training were not counted in the experimental results. Each mouse used for gait analysis underwent an average of 3 to 6 fitting trials. The software used for the analysis was CatWalk XT10.6.

[0090] Body weight: After surgery, the weight of the mice was measured weekly and the results were expressed in grams.

[0091] Survival: Experimental mice were raised in mixed genotypes with 3-5 mice per cage. After the procedure, the survival rate of the mice was counted weekly.

[0092] 1.8 Detection of editing efficiency and off-target efficiency by primer extension sequence determination

[0093] Brain samples from cultured primary neurons transduced with AAV9-HTTg1 and from AAV9-HTTg1-injected mice (2 and 13 months old) were collected, washed with PBS, and digested with lysis buffer (50 mM Tris-HCl, 50 mM EDTA, 1% SDS, 1% protease K). Genomic DNA was then extracted by phenol-chloroform extraction, and a PEM library was prepared as previously reported (Yin et al., 2019). Genomic DNA was sonicated to 300–500 bp, and biotinylated CTCAGGTTCTGCTTTTACCTGCG sequences were used for primer extension experiments followed by bridge adapter ligation. CCGAGGCCTCCGGGGACTGC sequences were used for nested PCR, followed by tagged PCR using primers compatible with Illumina Hiseq. Processing of raw data has been previously reported, and gene editing efficiency is defined as the percentage of insertion-deletion and translocation events relative to all events. The off-target rate is calculated as the percentage of off-target translocation events relative to the total number of edit events.

[0094] 2. Characterization data and effect data of the examples and comparative examples

[0095] 2.1 In vitro assay for detecting the effect of CRISPR / Cas9 editing on the mHTT gene

[0096] HEK293T cells were transfected with human HTT exon 1 containing 20 or 120 CAG repeats and fused with the GFP protein sequence. When the GFP reporter is expressed with an overextended 120Q, it forms an inclusion body that localizes within the cell. Fusion expression of the GFP protein with human HTT exon 1 allows for the detection of SaCas9-sgRNA cleavage efficiency. After transfection of HEK293T cells with either AAV-SaCas9-hHTT sgRNA1 (SaCas9-HTTg1) or AAV-SaCas9-hHTT sgRNA2 (SaCas9-HTTg2), GFP expression was significantly reduced in cells expressing either 20 or 120 CAG repeats, demonstrating that human HTT exon 1 can be edited by the CRISPR / Cas9 system used. In cells co-expressing exon 1 with a sequence overextended with CAG, there was a significant reduction in the number of human mutant HTT aggregates (Figure 2A). Statistically, the number of aggregates in transfected HTTg1 cells was reduced to 43.78% of the number of aggregates in the control group and 63.02% of the number of aggregates in the HTTg2 group under similar SaCas9 expression conditions (Figure 2B). These in vitro results confirm that the CRISPR / Cas9 system can achieve efficient HTT gene editing.

[0097] GFP and SaCas9 expression in HEK293T cells were also analyzed by immunoblotting. The results showed that in cells expressing GFP-HTT-exon 1-20Q, transient transfection with sgRNA1 significantly reduced GFP expression levels at the same level of SaCas9 expression, while sgRNA2 also reduced GFP expression levels compared to the control group, but not as significantly as sgRNA1 (Figures 3A and 3B). The same results were observed in cells expressing GFP-HTT-exon 1-120Q (Figures 3C and 3D). These results reaffirm the success of SaCas9 expression in cells and the knockdown effect of HTT sgRNA1 on the human HTT gene.

[0098] 2.2 CRISPR / Cas9 gene editing in BAC226Q mice

[0099] Using HTT sgRNA1 as an example, we will investigate the role of the AAV9-SaCas9-sgRNA system in BAC226Q HD mice and comprehensively and deeply evaluate the therapeutic effects of CRISPR / Cas9-mediated in vivo mHTT knockdown in terms of long-term disease state and disease phenotype in mice.

[0100] 2.2.1 Precise Infection of Mouse Striatum and Primary Motor Cortex Using AAV9

[0101] AAV9-GFP was injected into the striatum and primary motor cortex of 26-30 day-old non-transgenic mice by stereotactic injection. One month after injection, mouse brain sections were collected for GFP expression analysis. Precise expression of GFP was observed in the striatum and primary motor cortex (Figure 4), demonstrating the successful delivery of the AAV9 virus to the mouse brain and the stable expression of the genes contained therein.

[0102] 2.2.2 SaCas9-HTTg1 significantly reduced the expression of mHTT protein in BAC226Q mice.

[0103] Proteins from the striatum and cortex were extracted from 4, 7, and 11-month-old mice, respectively, and immunoblotting experiments were performed. These two brain regions received only one injection of AAV9-SaCas9-HTTg1 or AAV9-SaCas9 at 26-30 days of age. BAC226Q mice injected with AAV9-SaCas9-HTTg1 were the experimental group (referred to as BAC226Q-HTTg1), while BAC226Q mice injected with AAV9-SaCas9 and wild-type mice were the control group (referred to as BAC226Q-SaCas9 and non-tg-SaCas9).

[0104] In 4-month-old mice, mHTT protein expression in the striatum was significantly lower in BAC226Q-HTTg1 mice compared to the BAC226Q-SaCas9 group, and the same result was observed in the cortex. However, mHTT protein expression in BAC226Q-HTTg1 mice was less altered in the cerebellar region not treated with the virus compared to BAC226Q-SaCas9 mice. These results suggest that the sgRNA1-based AAV-CRISPR / Cas9 system may mediate the reduction of mHTT protein expression in the brain of BAC226Q mice. The same experiment was performed in 7-month-old mice, and immunoblotting results showed that mHTT protein expression was somewhat reduced in the striatum and cortex of AAV-SaCas9-HTTg1-injected mice compared to BAC226Q mice injected with AAV-SaCas9, but not in the cerebellum. Next, we examined mHTT expression in the striatum of 11-month-old mice, and found that mHTT protein levels in the striatum of BAC226Q-HTTg1 mice were significantly reduced compared to the BAC226-SaCas9 control group (Figure 5).

[0105] 2.2.3 SaCas9-HTTg1 continuously and significantly reduces mHTT expression and aggregation in the brains of BAC226Q mice.

[0106] The most important pathological features in the brains of HD patients are neuropil aggregates and nuclear inclusions composed of mutant HTT in striatal and cortical neurons. mHTT aggregates appear in BAC226Q mice from 4 months of age and evolve into widely distributed protein inclusions as the disease progresses. Brain sections from these mice were immunostained with S830, an antibody that recognizes exon 1 of mHTT and detects not only the soluble form of the mHTT protein but also neuropil aggregates and nuclear inclusions with high specificity.

[0107] BAC226Q mice injected with AAV-SaCas9-HTTg1 (referred to as BAC226Q-SaCas9 or HD-SaCas9) showed a significant reduction in mHTT aggregates and nuclear inclusions in the striatal region of the brain at 4 months compared to BAC226Q mice that received only AAV-SaCas9 injections (referred to as BAC226Q-SaCas9 or HD-SaCas9-HTTg1) (Figures 6A and 6B). The total signal for mHTT was 0.6004±0.0612 in non-tg-SaCas9, 922.3±195.8 in BAC226Q-SaCas9, and 192.2±73.8 in BAC226Q-HTTg1. In the primary motor cortex, SaCas9-HTTg1 injection also reduced mHTT aggregates and nuclear inclusions in 4-month-old BAC226Q mice (p=0.096). Total mHTT signal was 0.1038±0.1038 in non-tg-SaCas9, 473.9±125.6 in BAC226Q-SaCas9, and 258.2±57.59 in BAC226Q-HTTg1 (Figures 6C and 6D).

[0108] mHTT in the striatum and cortex was predominantly in the form of nuclear inclusions in 7-month-old mice compared to 4-month-old mice, with a significant increase in density and size of inclusions. In 7-month-old BAC226Q-SaCas9 mice, mHTT signaling in the striatum and cortex was consistently increased, while mHTT signaling in the striatum of BAC226Q-HTTg1 mice was consistently decreased. Compared to BAC226Q-SaCas9, mHTT nuclear inclusion signaling was significantly reduced in the striatum of 7-month-old BAC226Q-SaCas9-HTTg1 brains (Figures 7A and 7B). The total signal strength for mHTT was 0.0294±0.0294 for non-tg-SaCas9, 1129±87.26 for BAC226Q-SaCas9, and 168.2±35.26 for BAC226Q-HTTg1.

[0109] mHTT signaling in the primary motor cortex of BAC226Q-HTTg1 mice was not significantly reduced (p=0.4982), but it was less pronounced in the form of nuclear inclusions, with mHTT primarily present in the form of aggregates. The total mHTT signal was 0.6066±0.3189 in 7-month-old non-tg-SaCas9 mice, 558.0±148.7 in BAC226Q-SaCas9 mice, and 406.3±59.86 in BAC226Q-HTTg1 mice (Figures 7C and 7D).

[0110] The experimental results described above showed that the signaling of mHTT aggregates and inclusions in the brains of BAC226Q mice injected with AAV-SaCas9-HTTg1 was substantially reduced compared to BAC226Q-SaCas9 mice. Since these signals are thought to be causal factors in the pathogenesis of HD, the reduction in mHTT signaling was considered to improve the phenotype of the mice.

[0111] In addition, to test whether the in vivo clearance effect of the AAV9-CRISPR / Cas9 system on mHTT would persist throughout the lifespan of mice, immunohistochemical experiments were performed using brain section samples obtained from 11-month-old mice to detect mutant HTT aggregates. Whole-brain section scans showed a significant reduction in mHTT aggregates, represented by S830-positive signals, in the primary motor cortex and dorsal striatum regions of BAC226Q mice injected with AAV-SaCas9-HTTg1 compared to controls injected with AAV-GFP alone (Figures 8A and 8B). These results suggest that a single dose of CRISPR / Cas9 delivery can achieve a significant reduction in human mutant HTT aggregates in vivo throughout life.

[0112] 2.2.4 SaCas9-HTTg1 successfully improves motor impairment in BAC226Q mice.

[0113] BAC226Q mice exhibit early and severe Huntington's disease-like spontaneous motor dysfunction, and these phenotypes develop gradually. BAC226Q mice have normal spontaneous motor function at 2 months of age, but develop a severe hyperactive phenotype starting at 3 months of age. Subsequently, the mice exhibit a reduced motor phenotype after 7 months of age.

[0114] To investigate whether in vivo CRISPR / Cas9-mediated human mutant HTT gene editing can rescue disease phenotypes in BAC226Q mice, this study focused on its effects on motor function. Disruption of human mutant HTT expression by injecting AAV-SaCas9-HTTg1 into the striatum and primary motor cortex regions of BAC226Q mice was found to significantly delay disease processes at multiple disease-related time points.

[0115] The rotarod test is a widely accepted test for detecting motor-related phenotypes in Huntington's disease. It is often used to assess coordination and balance in mice. By measuring the time it takes for mice to fall from a rotarod, BAC226Q mice injected with AAV-SaCas9-HTTg1 into the striatum and primary motor cortex were found to show significant improvement and enhancement of coordination and spontaneous motor ability early in the disease process (12–16 weeks of age) compared with mice injected with AAV-SaCas9 alone (Figure 9).

[0116] Another Huntington's disease phenotype affecting patient survival quality is abnormal gait behavior; therefore, the gait phenotype of BAC226Q mice was evaluated using the Catwalk gait analysis system. This system records the gait behavior of mice by capturing their behavior as they pass through channels. Gait analysis showed that 6-month-old BAC226Q-SaCas9 mice exhibited a severe gait abnormality and impaired phenotype (which was recovered in BAC226Q-HTTg1 mice) compared to non-tg-SaCas9 mice, and that CRISPR / Cas9-mediated HTT knockdown rescued the gait phenotype in HD mice (Figure 10A). Gait analysis revealed a progressive motor deficit phenotype in BAC226Q mice. During gait analysis, mice exhibited six typical gait patterns, following the order in which they used the left forelimb (LF), right forelimb (RF), left hindlimb (LH), and right hindlimb (RH): AA (RF-RH-LF-LH), AB (LF-RH-RF-LH), CA (RF-LF-RH-LH), CB (LF-RF-LH-RH), RA (RF-LF-LH-RH), and RB (LF-RF-RH-LH). The step sequence regularity index was used to reflect regular gait patterns without interference from missed steps, meaning that the more missed steps scattered between regular step patterns, the smaller the value of the step sequence regularity index. Therefore, this value is often used in gait analysis to reflect the degree of coordination in gait. Step sequence regularity decreased with age in BAC226Q mice injected with AAV-SaCas9, with a particularly significant decrease observed in 6-month-old BAC226Q-SaCas9 mice. However, BAC226Q mice injected with AAV-SaCas9-HTTg1 maintained nearly the same level of step sequence regularity as non-transgenic mice (Figure 10B). Furthermore, by analyzing the size of the mouse footprint area (Figures 10C, 10D, and 10E), the footprint area of ​​BAC226Q mice aged 2.5–4 months gradually decreased compared to non-tg-SaCas9 control mice, and this decrease was more pronounced in 6-month-old mice.However, AAV-SaCas9-HTTg1 injection was effective in rescuing this disease phenotype in 4- and 6-month-old BAC226Q mice. This demonstrates the rescue effect of human mutant HTT gene disruption on motor performance in BAC226Q mice.

[0117] The following example investigates whether the phenotype of BAC226Q-HTTg1 mice is rescued in open-field experiments. After acclimatizing the mice in an open field for 10 minutes three times a day for three days, the mice's spontaneous motor behavior in the open field was monitored for 10 minutes three times a day for three consecutive days, and the spontaneous motor phenotype of the mice in the open field was analyzed (Figures 11A-11D). The phenotype of the mice in the open field better reflected spontaneous activity after prolonged acclimatization and was therefore better used to detect the mouse phenotype in relation to spontaneous movement. At 6 months of age, non-tg-SaCas9 mice tended to move more around the edge of the open field (Figure 11A left). However, BAC226Q-SaCas9 mice tended to stay in a specific corner of the open field and circle around it (Figure 11A center). BAC226Q mice injected with AAV-SaCas9-HTTg1 had more opportunities to move around in open fields (Figure 11A right). The standard deviation of the distance traveled in each quadrant was used as statistical data. A minimum standard deviation of 0.1829 was found for non-tg-SaCas9, while a standard deviation of 0.5026 was found for BAC226Q-SaCas9 and 0.3295 for BAC226Q-HTTg1 (Figure 11B), indicating that BAC226Q mice were more likely to move around in open fields after SaCas9-HTTg1 expression. BAC226Q mice had a more average spontaneous movement area in open fields.

[0118] In addition, total distance traveled in open-field experiments decreased at 4 months of age and slightly decreased at 6 months of age in BAC226Q mice injected with AAV-SaCas9-HTTg1 compared to BAC226Q mice injected with AAV-SaCas9 alone (Figure 11C). Stereotypic behaviors, including stereotypic counting and self-grooming, which reflect mouse rotation, also decreased in BAC226Q mice injected with AAV-SaCas9-HTTg1 (Figure 11D). Together with walking performance, these data suggest that AAV-SaCas9-HTTg1-mediated gene editing can delay motor impairment in BAC226Q mice.

[0119] 2.2.5 SaCas9-HTTg1 increases body weight to a normal level and significantly improves mouse survival in BAC226Q mice.

[0120] BAC226Q mice exhibited disease phenotypes similar to those of HD patients, including weight loss and shortened lifespan, making this HD mouse model highly useful for evaluating the long-term therapeutic effects of candidate treatments in terms of quality of survival. In this study, the body weight of mice after gene therapy was recorded weekly for a total of 0–30 weeks after viral injection (Figure 12). The weight loss phenotype was attenuated in BAC226Q mice injected with AAV-SaCas9-HTTg1 compared to mice injected with AAV-SaCas9, in the striatum and primary motor cortex regions (Figure 12).

[0121] Mouse survival was continuously tracked throughout life, and was similarly significantly improved in BAC226Q mice injected with AAV-SaCas9-HTTg1 compared to BAC226Q-SaCas9 mice (Figure 13) (p=0.0061). At the endpoint of this study (day 385), survival rates remained above 50% for both non-transgenic mice injected with AAV-SaCas9 and BAC226Q mice injected with AAV-SaCas9-HTTg1. However, all BAC226Q mice injected with AAV-SaCas9 died by the end of the study, and the median survival time for these BAC226Q mice was 302 days. In conclusion, these data suggest that CRISPR / Cas9-mediated human HTT knockout can successfully mitigate HD-related phenotypes in BAC226Q mice.

[0122] 2.2.6 Phenotypic assay of BAC226Q mice after AAV9-SaCas9-HTTg1 striatal injection

[0123] Preliminary results showed that when the CRISPR / Cas9 system was injected only into the striatum, motor impairment in BAC226Q did not significantly improve from rotarod and open-field experiments (Figures 14A and 14B), and weight loss in mice did not significantly improve (Figure 14C), despite a reduction in both mHTT protein and aggregates in the striatal region. Therefore, this suggests that HD can be better treated by targeting both striatal and cortical brain regions.

[0124] 2.2.7 PEM-Seq assay for editing efficiency and off-target rate of the AAV9-SaCas9-HTTg1 system

[0125] To investigate the editing efficiency and specificity of CRISPR / Cas9 in BAC226Q mice, we used PEM-Seq (primer extension-mediated sequencing), a well-established deep sequencing method, to detect CRISPR / Cas9 editing events, including indels, large deletions, and genome-wide translocations. This allows for the simultaneous determination of gene editing efficiency, off-target hotspots, and gene editing products.

[0126] Genomic DNA was extracted from the striatum and cortex of BAC226Q mice injected with AAV-SaCas9-HTTg1, as well as from primary cultured neurons of BAC226Q mice treated with Cas9-HTTg1, and editing events were analyzed using PEM-Seq experiments. The editing efficiency was 11.0% ± 0.9% in primary cultured neurons of BAC226Q mice detected by PEM-Seq, and 12.94% ± 0.91% and 8.90% ± 1.75% in the brains of 2-month-old and 13-month-old BAC226Q mice, respectively (Figure 15A). These results not only demonstrate the presence of mHTT gene editing events in the brains of BAC226Q mice, but also indicate that the results of HTT gene editing in the brains of BAC226Q mice can persist throughout their lifespan, which is consistent with results observed in immunoblotting experiments and immunofluorescence staining assays.

[0127] PEM-Seq can be used to detect all insertion, deletion, and translocation events during gene editing. The presence of off-target junctions causes chromosomal translocations between the target and the off-target junction, which can be detected by PEM-Seq. Off-target translocation efficiency is the ratio of off-target junctions to all gene editing events (insertions, deletions, and chromosomal translocations). In primary cultured neurons, only 0.0198% ± 0.0006% of off-target translocation events were detected, and the off-target efficiency was 0.0130% ± 0.0022% in 2-month-old BAC226Q-SaCas9 mouse brains and 0.0127% ± 0.0047% in 13-month-old brains (Figure 15B), indicating that the off-target efficiency of the SaCas9-HTTg1 system is very low. Further analysis of off-target sites revealed no other off-target cleavage events except for the mouse HTT gene, and the presence of this off-target site in the mouse HTT gene was also attributed to sequence homology between the mouse HTT gene and the human HTT gene in the sgRNA target region (Figure 15C).

[0128] Morphological analysis of the gene-edited products revealed that editing events at the target site of human HTT primarily consisted of small insertions and deletions (Figure 16A). 2bp deletions and 1bp insertions resulted in changes from glutamine to alanine and threonine, as well as an early termination codon in exon 1; 1bp and 4bp deletions resulted in changes from glutamine to serine and aspartate, as well as an early termination codon in exon 2; and 3bp deletions did not result in a frameshift mutation. Analysis of the relative frequencies of the five major edited products in the gene editing described above showed that 52.70% ± 3.71% of the edited products were 2bp deletions, and only 4.126% ± 1.959% were 3bp deletions without a frameshift mutation (Figure 16B). In summary, these data demonstrate the editing effects of SaCas9-HTTg1 at the human HTT locus, along with predictable off-target editing effects at the mouse HTT locus.

[0129] In addition, sgRNA2 has been experimentally tested to have a similar effect to sgRNA1, but slightly smaller than sgRNA1.

[0130] Each of the technical features of the embodiments described above can be combined in any manner, and for the sake of brevity, not all possible combinations of each of the technical features of the embodiments described above have been described. However, as long as these combinations of technical features are not contradictory, they should be considered to be within the scope of this specification.

[0131] The embodiments described above represent only a few embodiments of the present disclosure, which are described in more specific and detailed terms, but they should not be construed as limitations on the scope of the patents in this disclosure. Those skilled in the art will note that several modifications and improvements can be made without departing from the concepts of the present disclosure, all of which fall within the scope of the patents in this disclosure. Accordingly, the scope of the patents in this disclosure shall be subject to the claims attached.

Claims

1. sgRNA having one or more nucleotide sequences that have a function for the CRISPR / Cas system, One of the nucleotide sequences described in SEQ ID NO: 1 or SEQ ID NO: 2, One of the nucleotide sequences having at least 95% homology to the nucleotide sequence described in SEQ ID NO: 1 or SEQ ID NO: 2, and having the same function, or One of the nucleotide sequences derived from the nucleotide sequence described in SEQ ID NO: 1 or SEQ ID NO: 2 by deletion, substitution, or addition of 1 to 6 bases, and having the same function. sgRNA, including

2. The sgRNA according to claim 1, further comprising one of the nucleotide sequences of the sgRNA which is at least 98% homologous to the nucleotide sequence described in SEQ ID NO: 1 or SEQ ID NO: 2 and has the same function.

3. The sgRNA according to claim 1, further comprising one of the nucleotide sequences of the sgRNA, which is obtained by deletion, substitution, or addition of 1 to 3 bases at the 5' or 3' end of the nucleotide sequence described in SEQ ID NO: 1 or SEQ ID NO: 2, and which has the same function.

4. A DNA fragment encoding an sgRNA according to any one of claims 1 to 3.

5. A recombinant expression vector comprising the DNA fragment described in claim 4.

6. The recombinant expression vector according to claim 5, further comprising a fragment of a Cas endonuclease coding sequence.

7. The recombinant expression vector according to claim 6, wherein the Cas endonuclease coding sequence is a SaCas9 endonuclease coding sequence, a SpCas9 endonuclease coding sequence, a Cas12a endonuclease coding sequence, a Cas12b endonuclease coding sequence, a Cas12e endonuclease coding sequence, a Cas12j endonuclease coding sequence, a Cas12f1 endonuclease coding sequence, a Cas13a endonuclease coding sequence, or a Cas14a endonuclease coding sequence.

8. The recombinant expression vector according to claim 5, which is a lentiviral vector, adenovirus vector, adeno-associated virus vector, herpesvirus vector, poxvirus vector, baculovirus vector, papillomavirus vector, or papillary polyomavirus vector.

9. The recombinant expression vector according to claim 5, which is an AAV9 virus vector.

10. A virus having a genome comprising a nucleotide sequence encoding the sgRNA described in any one of claims 1 to 3.

11. The virus according to claim 10, which is a lentivirus, adenovirus, adeno-associated virus, herpesvirus, poxvirus, baculovirus, papillomavirus, or papillary polyomavirus.

12. The virus according to claim 10, which is the AAV9 virus.

13. A host cell whose genome comprises the DNA fragment described in claim 4 and the recombinant expression vector described in any one of claims 5 to 9.

14. The host cell according to claim 13, which is a CHO cell, a COS cell, an NSO cell, a HeLa cell, a BHK cell, or a HEK293T cell.

15. sgRNA according to any one of claims 1 to 3, further comprising the DNA fragment according to claim 4, the recombinant expression vector according to any one of claims 5 to 9, the virus according to any one of claims 10 to 12, or the host cell according to any one of claims 13 and 14, in the preparation of a product for treating Huntington's disease.

16. The sgRNA according to claim 15, wherein the product is a reagent, a kit, a drug, or a device.

17. A drug for treating Huntington's disease, comprising an sgRNA according to any one of claims 1 to 3, a DNA fragment according to claim 4, a recombinant expression vector according to any one of claims 5 to 9, a virus according to any one of claims 10 to 12, or a host cell according to any one of claims 13 and 14, and a pharmaceutical excipient.

18. The drug according to claim 17, wherein the dosage form is administered by injection.

19. The drug according to claim 17, wherein the excipient comprises one of a diluent, a preservative, a buffer, a disintegrant, an antioxidant, a suspending agent, and a coloring agent.

20. A method for HTT knockout, comprising the steps of exogenously expressing the sgRNA in a target cell according to any one of claims 1 to 3, and having a Cas endonuclease.

21. A method for treating Huntington's disease, comprising the step of delivering Cas endonuclease and sgRNA according to any one of claims 1 to 3 to striatal and cortical regions of the brain of an affected individual.

22. The method according to claim 21, wherein the delivery step is a stereotactic injection into the brain.

Images