Conjugate composition containing a phosphorylguanidine bond and its use
Substituting phosphorothioate bonds with phosphorylguanidine bonds in drug-antibody conjugates of inhibitory nucleic acids addresses the issue of rapid clearance and charge-related instability, enhancing the in vivo stability and activity of these conjugates.
Patent Information
- Authority / Receiving Office
- JP · JP
- Patent Type
- Applications
- Current Assignee / Owner
- アトリウム セラピューティクスインク
- Filing Date
- 2024-05-31
- Publication Date
- 2026-06-23
AI Technical Summary
The presence of phosphorothioate internucleotide bonds in drug-antibody conjugates of inhibitory nucleic acids reduces their in vivo bioactivity and stability due to rapid clearance, likely caused by the negative charge of the P=S bonds.
Substituting phosphorothioate internucleotide bonds with phosphorylguanidine (PG) bonds to reduce the negative charge and enhance the activity and stability of drug-antibody conjugates of inhibitory nucleic acids.
The use of phosphorylguanidine bonds improves the in vivo stability and activity of drug-antibody conjugates, such as siRNA and ASO, by reducing rapid clearance and maintaining effective mRNA expression levels in target tissues.
Smart Images

Figure 2026520509000001_ABST
Abstract
Description
[Technical Field]
[0001] cross reference This application claims the benefit of U.S. Provisional Patent Application No. 63 / 505,925, filed on 2 June 2023, which is incorporated herein by reference in its entirety. [Background technology]
[0002] RNA-induced gene silencing provides several levels of control: transcriptional inactivation, small interfering RNA (siRNA)-induced mRNA degradation, and siRNA-induced transcriptional decay. In some cases, RNA interference (RNAi) provides long-lasting effects across multiple cell divisions. Therefore, RNAi offers a viable method for drug target validation, gene function analysis, pathway analysis, and disease treatment.
[0003] Phosphodiester (PO) or phosphorothioate (P=S) internucleotide linkages are used to conjugate single-stranded and double-stranded nucleotides, such as inhibitory nucleic acids, double-stranded siRNA, or single-stranded antisense oligonucleotides (ASOs). P=S internucleotide linkages are used to improve the stability of single-stranded and double-stranded nucleotides by substituting PO bonds on them and enhancing their resistance to nucleases. However, the presence of two or more single-stranded and double-stranded nucleotides (e.g., siRNA) with P=S bonds conjugated to an antibody (e.g., a drug-to-antibody ratio 2:1 (DAR2) conjugate or a DAR2 antibody-oligonucleotide conjugate (AOC)) reduces the activity and stability of the DAR2 conjugate in vivo. The loss of in vivo bioactivity is likely due to the rapid clearance of the DAR2 conjugate caused by the negative charge of the P=S bonds of the two siRNA molecules conjugated to the antibody. Therefore, there is a need to improve the chemistry of the internucleotide bond by reducing the negative charge of the two siRNAs and thereby improving the activity and stability of the DAR2 AOC conjugate. [Overview of the project]
[0004] This disclosure provides methods and compositions for reducing the negative charge of inhibitory nucleic acids (e.g., siRNA, ASO, phosphorodiamidate morpholino oligomer (PMO), etc.) by reducing the number of phosphorothioate (P=S) internucleotide bonds in the inhibitory nucleic acid (e.g., siRNA, ASO, PMO, etc.) molecule, and / or by substituting the phosphorothioate (P=S) internucleotide bonds with phosphorylguanidine (PG) internucleotide bonds, since phosphorylguanidine (PG) is neutrally charged and P=S is negatively charged. In addition, this disclosure provides methods and compositions for modifying inhibitory nucleic acids (e.g., siRNA, ASO, PMO, etc.) by substituting PO bonds with PG bonds to increase the number of PG bonds in the inhibitory nucleic acid (e.g., siRNA, ASO, PMO, etc.) molecule. The presence of two PG internucleotide bonds on the inhibitory nucleic acid (e.g., siRNA, ASO, PMO, etc.) molecule in DAR2 AOC improves the activity and stability of DAR2 AOC.
[0005] In one embodiment, in this specification, formula (I) A-(XB) n Equation (I) (In the formula, A is the connecting part, B is a double-stranded oligonucleotide containing a guide strand and a passenger strand. X is a linker or connector. n is a number greater than or equal to 2. It is a conjugate of, The above guide chain or passenger chain is given by formula (II)
[0006] [ka] (In the formula, R 11 , R 12 , R 13 and R 14 These are -H and -C respectively. 1-10 Alkyl, -C 2-10 Alkenyl, -C 2-10 Alkinyl or -C6-10 independently selected from aryl, optionally, R 12 and R 13 together with the atom to which they are attached form a 5- to 8-membered heterocyclic substituent moiety selected from the group consisting of N-pyrrolidinyl, N-piperidinyl, N-azepanyl, N-azocanyl, and imidazolidine) comprising at least one modified internucleotide linkage comprising the structure of a conjugate is provided. In some embodiments, R 12 and R 13 together with the atom to which they are attached form imidazolidine. In some embodiments, the internucleotide linkage is of formula (III)
[0007]
Chemical formula
[0008]
Chemical formula
[0009] In another embodiment, a method is provided herein for modulating the mRNA expression level of a gene in a subject, comprising the steps of: providing a conjugate disclosed herein; and administering the conjugate to a subject, wherein the conjugate reduces the mRNA expression level of the gene in the subject. In some embodiments, the conjugate reduces the gene expression level by at least about 20%, 25%, 30%, 35%, 40%, 45%, 50%, 55%, 60%, 65%, 70%, 75%, 80%, 85%, 90%, or 95% compared to a control sample. In some embodiments, the conjugate has an increased plasma half-life compared to a similar conjugate containing a phosphorothioate nucleotide bond exchanged at the site of a modified nucleotide bond of formula (II).
[0010] In another aspect, the Specified provides a method for treating amyotrophy or myotonic dystrophy in a subject requiring treatment of amyotrophy or myotonic dystrophy, comprising the steps of: providing a conjugate disclosed herein; and administering the conjugate to the subject, wherein the conjugate mediates RNA interference with a target mRNA in the subject, thereby treating the amyotrophy or myotonic dystrophy in the subject. [Brief explanation of the drawing]
[0011] The following drawings form part of this specification and are included to further illustrate certain aspects of this disclosure. This disclosure can be better understood by referring to one or more of these drawings in conjunction with the detailed descriptions of the specific embodiments presented herein.
[0012] [Figure 1] The SAX chromatogram of a DAR2 conjugate (DAR2 AOC) containing myostatin (MSTN) siRNA (R3668) modified with 8 phosphorylguanidine (PG) links is shown. [Figure 2] The SAX chromatogram of a DAR2 conjugate (DAR2 AOC) containing MSTN siRNA (R3669) modified with 12 PG bonds is shown. [Figure 3] The mass spectrometry data for the molecular weight (MW) of an MSTN passenger chain (PS) with 8 PG bonds is shown. [Figure 4] The MW mass spectrometry data for MSTN PS with 12 PG bonds is shown. [Figure 5] The mass spectrometry data for the MW of an MSTN guide chain (GS) containing vinyl phosphonate vpUq is shown. [Figure 6] The ion-pair reversed-phase (IP-RP) chromatogram of MSTN GS containing vinyl phosphonate vpUq is shown. [Figure 7] The IP-RP chromatogram of MSTN PS with 8 PG bonds is shown. [Figure 8]The IP-RP chromatogram of MSTN PS with 12 PG bonds is shown. [Figure 9] This shows an undenatured IP-RP of an MSTN bihedra with 8 PG bonds. [Figure 10] This shows an undenatured IP-RP of an MSTN double hemisphere with 12 PG bonds. [Figure 11] This shows the SAX-HPLC of an MSTN double helix with 8 PG bonds. [Figure 12] This shows the SAX-HPLC results of an MSTN double helix with 12 PG bonds. [Figure 13A] Figure 13A shows the in vivo dose-response of MSTN mRNA expression levels in the gastrocnemius muscle at day 28 in mice administered DAR2 AOC containing PG-modified siRNA at increasing concentrations (2, 4, 8, and 15 mg / kg mAb). [Figure 13B] This shows the in vivo time-dependent response of MSTN mRNA expression levels in the gastrocnemius muscle at days 14, 28, and 56 in mice administered a dose of DAR2 AOC containing PG-modified siRNA (7.5 mg / kg mAb). [Figure 14A] This shows six different sets of in vivo MSTN mRNA expression levels in the gastrocnemius muscle of mice administered a single dose (7.5 mg / kg mAh) of DAR2 AOC containing PG-modified siRNA at day 28. [Figure 14B] This shows an overview of the in vivo distribution of MSTN mRNA expression levels in the gastrocnemius muscle of mice that received a single dose (7.5 mg / kg mAb) of DAR2 AOC containing PG-modified siRNA at day 28. [Figure 15A] The time-dependent plasma concentrations of siRNA at 24, 72, and 168 hours post-injection are shown as a percentage of a single dose (10 mg / kg mAb) of DAR2 AOC containing PG-modified siRNA administered to mice. [Figure 15B] Figure 15B shows the calculated area under the curve (AUC) of the PG-modified siRNA 168 hours after injection. [Figure 16A] This shows the in vivo SSB mRNA expression levels at day 28 in the gastrocnemius or cardiac muscle of mice administered DAR2 AOC (5 mg / kg mAb) containing siRNA modified with 0, 4, 8, or 12 PGs on the passenger strand. [Figure 16B] This shows the in vivo SSB mRNA expression levels at day 28 in the gastrocnemius or cardiac muscle of mice administered DAR2 AOC (5 mg / kg mAb) containing siRNA modified with 0, 4, 8, or 12 PGs on the passenger strand. [Figure 16C] The plasma concentration of SSB siRNA at 6 hours post-injection is shown as a percentage of a single dose (5 mg / kg mAh) of DAR2 AOC with 0 or 8 PG-modified siRNA administered to mice. [Figure 16D] The plasma concentration of MSTN siRNA at 6 hours post-injection is shown as a percentage of a single dose (5 mg / kg mAh) of DAR2 AOC containing siRNA modified with 0 PG, 4 PG, 8 PG, or 15 PG administered to mice. [Figure 17A] This shows the in vivo MSTN mRNA levels in the gastrocnemius muscle of mice administered a single dose (7.5 mg / kg mAh) of DAR2 AOC containing PG-modified siRNA at day 28. [Figure 17B] This shows the tissue concentration (nM) of siRNA on day 14 after administering DAR2 AOC (5 mg / kg mAh) containing PG-modified siRNA to mice. [Figure 18A] The images show in vivo MSTN mRNA levels in the gastrocnemius muscle of mice administered a single dose (7.5 mg / kg mAh) of DAR2 AOC containing PG-modified siRNA at day 14 (left) and day 28 (right). [Figure 18B] The images show the tissue concentrations (mM) of siRNA in the gastrocnemius muscle of mice at day 14 (left) and day 28 (right) after administration of DAR2 AOC (5 mg / kg mAh) containing PG-modified siRNA. [Figure 19]This shows the in vivo MSTN mRNA levels in the gastrocnemius muscle of mice at day 28 after being administered a single dose (7.5 mg / kg mAh) of DAR2 AOC containing siRNA modified with 8 PGs on the passenger strand. [Figure 20] This shows the in vivo MSTN mRNA levels in the gastrocnemius muscle of mice at day 28 after being administered a single dose (7.5 mg / kg mAh) of DAR2 AOC containing siRNA modified with 1 or 12-15 PGs on the passenger strand. [Figure 21A] This shows in vivo MSTN mRNA levels in the gastrocnemius muscle of mice administered a single dose (7.5 mg / kg mAh) of DAR2 AOC containing siRNA modified with 0, 4, 8, or 12 prostaglandins, at day 14 or day 28. [Figure 21B] This shows the in vivo MSTN mRNA expression levels in the gastrocnemius muscle of mice at day 28 after being administered a single dose (7.5 mg / kg mAh) of DAR2 AOC containing 0, 4, 6, or 8 modified siRNAs. [Figure 22] The positions of phosphorylguanidine (PG)-modified internucleotide bonds on the guide strand, passenger strand, or both strands of the two siRNAs in AOC are illustrated. [Figure 23] The positions of phosphorylguanidine (PG)-modified nucleotide bonds on the guide strand, passenger strand, or both strands of the two siRNAs in DAR2 AOC are illustrated. [Modes for carrying out the invention]
[0013] Therapeutic Molecular Platform Nucleic acid-based therapies (e.g., RNAi) are targeted therapies with high selectivity and specificity. However, in some cases, nucleic acid-based therapies are hampered by poor intracellular uptake, insufficient intracellular concentrations in target cells, low efficacy, and poor in vivo stability. To address these issues, various modifications of nucleic acid compositions are explored, including modifications of nucleotide interbonding to increase the stability of nucleic acid molecules. This specification discloses, in several embodiments, the structures of modified nucleotide interbonding (e.g., phosphoguanidine (PG) nucleotide interbonding) that can be incorporated into oligonucleotides (or polynucleic acids). In some embodiments, the modified nucleotide interbonding described herein can substitute one or more phosphodiester bonds or one or more phosphorothioate (P=S) nucleotide interbonding of DNA, RNA, DNA / RNA hybrids, or synthetic oligonucleotides. In some embodiments, the nucleotide interbonding described herein increases the in vivo stability or half-life of oligonucleotides. In some embodiments, the nucleotide interbonding described herein increases the in vivo stability or half-life of oligonucleotides without any substantial or significant change in toxicity.
[0014] Drug conjugate In some embodiments, drug conjugates (e.g., therapeutic oligonucleotide conjugates) are disclosed herein. In some embodiments, the drug conjugate disclosed herein is formula (I): A-(XB) n Equation (I) It is a conjugate of.
[0015] In some embodiments, A is a binding portion, B is a drug, and X is a linker or binding agent. In some embodiments, B is an oligonucleotide drug. In some embodiments, the oligonucleotide drug is a single-stranded oligonucleotide (e.g., a single-stranded antisense oligonucleotide). In some embodiments, the oligonucleotide drug is a double-stranded oligonucleotide (e.g., dsRNA, siRNA). In some embodiments, the drug is an oligonucleotide drug comprising at least one modified internucleotide bond having the structure of formula (II). In some embodiments, the oligonucleotide drug is a double-stranded oligonucleotide (e.g., siRNA), and at least one or both strands of the double-stranded oligonucleotide (guide strand and / or passenger strand) comprises at least one modified internucleotide bond having the structure of formula (II). In some embodiments, the number of drug molecules coupled or conjugated to a single binding portion is at least 2 or at least about 2. In some embodiments, the number of drug molecules coupled or conjugated to a single binding portion molecule in the composition is at least 2 or at least about 2. In some embodiments, the average number of drug molecules coupled or conjugated to a single binding submolecule in the composition is at least about 2, 3, 4, 5, 6, 7, 8, 9, 10, 11, 12, 13, 14, 15, 16, or greater. In some embodiments, the average number of drug molecules coupled or conjugated to a single binding submolecule in the composition is about 2–12, about 2–10, about 2–8, about 4–8, or about 6–8.
[0016] Oligonucleotide drug molecules In some embodiments, the drug in the drug-binding conjugate is an oligonucleotide drug (polynucleotide acid drug). In some embodiments, the oligonucleotide drug is an RNA oligonucleotide, a DNA oligonucleotide, or an RNA / DNA hybrid oligonucleotide. In some embodiments, the oligonucleotide drug is a synthetic oligonucleotide. In some embodiments, the oligonucleotide drug is a modified RNA oligonucleotide, a DNA oligonucleotide, or an RNA / DNA hybrid oligonucleotide. In some examples, RNA oligonucleotides include small interfering RNA (siRNA), small hairpin RNA (shRNA), microRNA (miRNA), and double-stranded RNA (dsRNA).
[0017] In some embodiments, the oligonucleotide is a single-stranded oligonucleotide. In some embodiments, the oligonucleotide is a single-stranded antisense oligonucleotide. In some embodiments, the oligonucleotide is a single-stranded phosphorodiamidate morpholino oligomer (PMO). In some examples, the oligonucleotides described herein include single-stranded nucleic acids with a length of about 15-50, 15-40, 15-35, 15-30, 15-25, 15-20, 20-30, 25-30, 16-30, 17-30, 18-30, 18-27, 18-25, 18-23, 19-23, 20-23, or 21-23 nucleotides. In some embodiments, the oligonucleotide includes single-stranded nucleic acids with a length of about 15, 16, 17, 18, 19, or 20 nucleotides. In some embodiments, the oligonucleotide includes single-stranded nucleic acids with a length of about 21, 22, 23, 24, or 25 nucleotides. In some embodiments, the oligonucleotide comprises a single-stranded nucleic acid approximately 26, 27, 28, 29, or 30 nucleotides long. In some examples, the oligonucleotide described herein comprises a single-stranded nucleic acid approximately 21 nucleotides long. In some examples, the oligonucleotide described herein comprises a single-stranded oligonucleotide approximately 23 nucleotides long.
[0018] In some embodiments, the oligonucleotide is a double-stranded oligonucleotide. In some embodiments, the oligonucleotide is a dsRNA. In some embodiments, the oligonucleotide is an siRNA. In some examples, the double-stranded oligonucleotide comprises a sense strand and an antisense strand. As used herein, the term “sense strand” may be used interchangeably with the term “passenger strand,” and the term “antisense strand” may be used interchangeably with the term “guide strand.” The sense strand and the antisense strand are at least partially complementary to each other to form a double-stranded oligonucleotide. In some examples, each strand of the double-stranded oligonucleotide contains about 19, 20, 21, 22, 23, 24, or 25 nucleotides in length. In some examples, one strand of the double-stranded oligonucleotide is 1, 2, or 3 nucleotides longer than the other strand, thereby forming an overhang structure at the 5' or 3' end.
[0019] In some embodiments, modified oligonucleotides are described herein. In some embodiments, oligonucleotides include natural, synthetic, or artificial nucleotide analogs or bases. In some cases, oligonucleotides include combinations of DNA, RNA, and / or synthetic or artificial nucleotide analogs (e.g., with ribose ring modifications (e.g., open ring structures, locked ring structures, LNA, GNA, PNA, TNA, etc.), with base modifications, or debase-debase analogs, or combinations thereof). In some examples, the synthetic or artificial nucleotide analogs or bases include modifications to one or more of the ribose moiety, phosphate moiety, nucleoside moiety, or combinations thereof. In some examples, oligonucleotides contain at least 1, 2, 3, 4, 5, 6, 7, 8, 9, 10, 11, 12, 13, 14, 15, 16, 17, 18, 19, 20, 21, 22, 23, 24, 25, 26, 27, 28, 29, 30, 31, 32, 33, 34, 35, 36, 37, 38, 39, 40, 41, 42, 43, 44, 45, 46, 47, 48, 49, 50 or more modifications. In some examples, oligonucleotides contain a nucleic acid sequence in which at least 10%, 20%, 30%, 40%, 50%, 60%, 70%, 80%, or 90% contains one or more modifications. In some examples, oligonucleotides contain a fully modified nucleic acid sequence.
[0020] In some embodiments, there is a double-stranded oligonucleotide comprising a guide chain and a passenger chain, wherein the guide chain or passenger chain comprises at least one modified internucleotide bond having the structure of formula (II), where R 11 , R 12 , R 13 , and R 14 These are -H and -C, respectively, independently. 1-10 Alkyl, -C 2-10 Alkenyl, -C 2-10 Alkinyl, or -C 6-10 Selected from the aryl, and arbitrarily, R 12 and R 13These atoms, together with the atoms to which they are bonded, form a 5- to 8-membered heterocyclic substituent moiety selected from the group consisting of N-pyrrolidinyl, N-piperidinyl, N-azepanyl, N-azocanyl, and imidazolidine. In some embodiments, R 12 and R 13 These, together with the atoms to which they are bonded, form an imidazolidine. In some embodiments, the internucleotide bond has the structure of formula (III). In some embodiments, R 11 , R 12 , R 13 , and R 14 is -C 1-10 It is alkyl. In some embodiments, the internucleotide bond has the structure of formula (IV).
[0021] In some embodiments, at least one modified nucleotide bond of formula (II) is located at the 5' or 3' end of the guide strand. In some embodiments, at least one modified nucleotide bond of formula (II) is located at an internal position on the guide strand. In some embodiments, at least one modified nucleotide bond of formula (II) is located at the 3' overhang of the double-stranded oligonucleotide. In some embodiments, at least one modified nucleotide bond of formula (II) is not located at a cleavage site on the passenger strand. In some embodiments, at least one modified nucleotide bond of formula (II) is located at the 5' or 3' end of the passenger strand. In some embodiments, at least one modified nucleotide bond of formula (II) is located at an internal position on the passenger strand.
[0022] Modified nucleotide inter-nucleotide bonds In some embodiments, the oligonucleotides disclosed herein are of formula (II)
[0023] [ka] (In the formula, R 11 , R 12 , R 13and R 14 These are independently -H and -C 1-10 Alkyl, -C 2-10 Alkenyl, -C 2-10 Alkinyl, or -C 6-10 Selected from the alphabet, Optionally, R 12 and R 13 These atoms, together with the atoms to which they are bonded, form a 5- to 8-membered heterocyclic substituent moiety selected from the group consisting of N-pyrrolidinyl, N-piperidinyl, N-azepanyl, N-azocanyl, and imidazolidine. It contains at least one internucleotide bond represented by .
[0024] In some embodiments, R 12 and R 13 These atoms, together with the atoms to which they are bonded, form a 5- to 8-membered heterocyclic substituent moiety. In some embodiments, R 12 and R 13 These, together with the atoms to which they are bonded, form a five-membered heterocyclic substituent moiety. In some embodiments, R 12 and R 13 These, together with the atoms to which they are bonded, form a six-membered heterocyclic substituent moiety. In some embodiments, R 12 and R 13 These, together with the atoms to which they are bonded, form a seven-membered heterocyclic substituent moiety. In some embodiments, R 12 and R 13 These atoms, together with the atoms to which they are bonded, form an eight-membered heterocyclic substituent.
[0025] In some embodiments, R 12 and R 13 These, together with the atoms to which they are bonded, form N-pyrrolidinyl. In some embodiments, R 12 and R 13 These, together with the atoms to which they are bonded, form N-piperidinyl. In some embodiments, R 12 and R 13They combine with the atoms to which they are attached to form N-azepanyl. In some embodiments, R 12 and R 13 combine with the atoms to which they are attached to form N-azocanyl. In some embodiments, R 12 and R 13 combine with the atoms to which they are attached to form imidazolidine.
[0026] In some embodiments, R 11 , R 12 , R 13 , and R 14 are each independently selected from -H, -C 1-10 alkyl, -C 2-10 alkenyl, -C 2-10 alkynyl, or -C 6-10 aryl. In some embodiments, R 11 is -H, -C 1-10 alkyl, -C 2-10 alkenyl, -C 2-10 alkynyl, or -C 6-10 aryl. In some embodiments, R 11 is methyl. In some embodiments, R 12 is -H, -C 1-10 alkyl, -C 2-10 alkenyl, -C 2-10 alkynyl, or -C 6-10 aryl. In some embodiments, R 12 is methyl. In some embodiments, R 13 is -H, -C 1-10 alkyl, -C 2-10 alkenyl, -C 2-10 alkynyl, or -C 6-10 aryl. In some embodiments, R 13 is methyl. In some embodiments, R 14 is -H, -C 1-10 alkyl, -C 2-10 alkenyl, -C 2-10 alkynyl, or -C 6-10 arylaryl. In some embodiments, R14 It is methyl.
[0027] In some embodiments, R 11 , R 12 , R 13 , and R 14 is -C 1-10 It is alkyl. In some embodiments, R 11 is -C 1-10 It is alkyl. In some embodiments, R 11 is methyl. In some embodiments, R 12 is -C 1-10 It is alkyl. In some embodiments, R 12 is methyl. In some embodiments, R 13 is -C 1-10 It is alkyl. In some embodiments, R 13 is methyl. In some embodiments, R 14 is -C 1-10 It is alkyl. In some embodiments, R 14 It is methyl.
[0028] In some embodiments, the oligonucleotide is given by formula (III)
[0029] [ka] It contains at least one internucleotide bond represented by .
[0030] In some embodiments, the oligonucleotide is of formula (IV)
[0031] [ka] It contains at least one internucleotide bond represented by .
[0032] In some embodiments, the oligonucleotide is of formula (V)
[0033] [ka] (In the formula, Each of the R4 cells is independently either hydrogen or C 1-10 Selected from alkyl groups, Each of R5 is independently hydrogen, halogen, hydroxyl, alkoxy, or C 1-10 (Selected from alkyl) It contains at least one internucleotide bond represented by .
[0034] In some embodiments, the oligonucleotide is of formula (V)
[0035] [ka] (In the formula, R 4 Each of them is independently hydrogen or C 1-10 Selected from alkyl groups, (An oligonucleotide contains at least 12 nucleotides.) It contains at least one internucleotide bond represented by .
[0036] In some embodiments, the oligonucleotide comprises a sequence of monomer subunits linked by internucleotide binding groups, where at least one of the internucleotide binding groups is of formula (V)
[0037] [ka] (In the formula, R 4 Each of them is independently hydrogen or C 1-10 Selected from alkyl groups, R 5 Each of these is independently hydrogen, halogen, hydroxyl, alkoxy, or C 1-10 (Selected from alkyl groups) It is represented by [this].
[0038] In some embodiments, the second oligonucleotide comprises a sequence of monomer subunits linked by internucleotide binding groups, where at least one of the internucleotide binding groups is of formula (V)
[0039] [ka] (In the formula, R 4 Each of them is independently hydrogen or C 1-10 Selected from alkyl groups, R 5 Each of these is independently hydrogen, halogen, hydroxyl, alkoxy, or C 1-10 (Selected from alkyl groups) It is represented by [this].
[0040] In some embodiments, the oligonucleotide is given by formula (V*)
[0041] [ka] (In the formula, B is selected independently from the heterocyclic base moiety. R 1 These are independently selected from hydrogen, hydroxyl, halogen, or alkoxy. R 2 It is independently hydrogen, R 1 and R 2 (These atoms can, optionally, become one with the atom to which they are bonded, forming a C3-C4 carbon ring.) It includes at least one monomer subunit of the monomer subunit represented by .
[0042] In some embodiments, the oligonucleotide is given by formula (VI)
[0043] [ka] (In the formula, Each of B is independently selected from the heterocyclic base moiety. R 1 Each is independently selected from hydrogen, hydroxyl, halogen, or alkoxy, and R 2 Each of them is independently hydrogen, R 1 and R 2 They can optionally form a C3-C4 carbon ring by becoming one with the atom to which they are bonded. R 4 Each of them is independently hydrogen or C 1-10 Selected from alkyl, R 5 Each of these is independently hydrogen, halogen, hydroxyl, alkoxy, or C 1-10 (Selected from alkyl groups) It comprises at least two monomer subunits of a continuous sequence joined by formula (V) represented by .
[0044] In some embodiments, R 1 Each is independently selected from hydrogen, hydroxyl, halogen, or alkoxy. In some cases, R 1 It is hydrogen. Depending on the case, R 1 It is hydroxyl. In some cases, R 1 It is a halogen. Depending on the case, R 1 It is fluorine. Depending on the case, R 1 is C 1-6 It is alkyl.
[0045] In some embodiments, R 4 Each of them is independently hydrogen or C 1-6 Selected from alkyl. In some embodiments, R4 is independently selected from hydrogen. In some embodiments, R 4 Each of them is independently C 1-6 Selected from alkyl groups.
[0046] In some embodiments, R 1 and R 2 They optionally form a C3 carbon ring by becoming one with the atom to which they are bonded. In some cases, R1 and R 2 These atoms, optionally, unite with the atoms to which they are bonded to form a C4 carbon ring.
[0047] In some embodiments, the heterocyclic base moiety is a modified base, as described elsewhere in this specification.
[0048] In some embodiments, the internucleotide bonds are represented by formulas (II), (III), (IV), or (V), respectively.
[0049] In some embodiments, the modified nucleotide bond is a phosphorylguanidine (PG) bond of formula (II), (III), (IV), or (V). In some embodiments, the modified nucleotide bond is phosphorylguanidine (PG) of formula (II). In some embodiments, the modified nucleotide bond is phosphorylguanidine (PG) of formula (III). In some embodiments, the modified nucleotide bond is phosphorylguanidine (PG) of formula (IV). In some embodiments, the modified nucleotide bond is phosphorylguanidine (PG) of formula (V).
[0050] In some embodiments, the oligonucleotide contains at least about 1, about 2, about 3, about 4, about 5, about 6, about 7, about 8, about 9, about 10, about 11, about 12, about 13, about 14, about 15, about 16, about 17, about 18, about 19, about 20, about 21, about 22, about 23, about 24, about 25, about 30 or more modified internucleotide bonds of formula (II), formula (III), formula (IV), or formula (V). Optionally, the oligonucleotide contains at least about 1, about 2, about 3, about 4, about 5, about 6, about 7, about 8, about 9, about 10, about 11, about 12, about 13, about 14, about 15 or more modified intercleotide bonds of formula (II), formula (III), formula (IV), or formula (V). Depending on the case, an oligonucleotide may contain up to approximately 1, 2, 3, 4, 5, 6, 7, 8, 9, 10, 11, 12, 13, 14, 15, or more modified nucleotide bonds of formula (II), formula (III), formula (IV), or formula (V). In some examples, the modified nucleotide bonds of formula (II), formula (III), formula (IV), or formula (V) are located in tandem within the oligonucleotide. In other examples, the modified nucleotide bonds of formula (II), formula (III), formula (IV), or formula (V) are scattered within the oligonucleotide along with nucleotides modified by one or more additional modifications.
[0051] In some examples, oligonucleotides include at least one of the following modifications: approximately 5% to approximately 100%, approximately 10% to approximately 100%, approximately 20% to approximately 100%, approximately 30% to approximately 100%, approximately 40% to approximately 100%, approximately 50% to approximately 100%, approximately 60% to approximately 100%, approximately 70% to approximately 100%, approximately 80% to approximately 100%, and approximately 90% to approximately 100%, where the modification is a modified internucleotide bond of formula (II), formula (III), formula (IV), or formula (V). For example, if an oligonucleotide has 20 nucleosides, an oligonucleotide with approximately 60% modification includes approximately 12 nucleosides substituted with 12 modified internucleotide bonds of formula (II), formula (III), formula (IV), or formula (V).
[0052] In some embodiments, at least one modified nucleotide bond of formula (II), (III), (IV), or (V) is located at the 3' end of the guide strand. In some embodiments, at least one modified nucleotide bond of formula (II) is located at the 3' end of the guide strand. In some embodiments, at least one modified nucleotide bond of formula (III) is located at the 3' end of the guide strand. In some embodiments, at least one modified nucleotide bond of formula (IV) is located at the 3' end of the guide strand. In some embodiments, at least one modified nucleotide bond of formula (V) is located at the 3' end of the guide strand.
[0053] In some embodiments, at least one modified nucleotide linkage of formula (II), (III), (IV), or (V) is located within 5, 4, 3, or 2 nucleotides at the 3' end of the guide strand. In some embodiments, at least one modified nucleotide linkage of formula (II) is located within 5, 4, 3, or 2 nucleotides at the 3' end of the guide strand. In some embodiments, at least one modified nucleotide linkage of formula (III) is located within 5, 4, 3, or 2 nucleotides at the 3' end of the guide strand. In some embodiments, at least one modified nucleotide linkage of formula (IV) is located within 5, 4, 3, or 2 nucleotides at the 3' end of the guide strand. In some embodiments, at least one modified nucleotide linkage of formula (V) is located within 5, 4, 3, or 2 nucleotides at the 3' end of the guide strand.
[0054] In some embodiments, at least one modified nucleotide bond of formula (II), (III), (IV), or (V) is located at the 5' end of the guide strand. In some embodiments, at least one modified nucleotide bond of formula (II) is located at the 5' end of the guide strand. In some embodiments, at least one modified nucleotide bond of formula (III) is located at the 5' end of the guide strand. In some embodiments, at least one modified nucleotide bond of formula (IV) is located at the 5' end of the guide strand. In some embodiments, at least one modified nucleotide bond of formula (V) is located at the 5' end of the guide strand.
[0055] In some embodiments, at least one modified nucleotide linkage of formula (II), (III), (IV), or (V) is located within 5, 4, 3, or 2 nucleotides at the 5' end of the guide strand. In some embodiments, at least one modified nucleotide linkage of formula (II) is located within 5, 4, 3, or 2 nucleotides at the 5' end of the guide strand. In some embodiments, at least one modified nucleotide linkage of formula (III) is located within 5, 4, 3, or 2 nucleotides at the 5' end of the guide strand. In some embodiments, at least one modified nucleotide linkage of formula (IV) is located within 5, 4, 3, or 2 nucleotides at the 5' end of the guide strand. In some embodiments, at least one modified nucleotide linkage of formula (V) is located within 5, 4, 3, or 2 nucleotides at the 5' end of the guide strand.
[0056] In some embodiments, at least one modified nucleotide bond of formula (II), (III), (IV), or (V) is located on the 3' overhang of the double-stranded oligonucleotide. In some embodiments, at least one modified nucleotide bond of formula (II) is located on the 3' overhang of the double-stranded oligonucleotide. In some embodiments, at least one modified nucleotide bond of formula (III) is located on the 3' overhang of the double-stranded oligonucleotide. In some embodiments, at least one modified nucleotide bond of formula (IV) is located on the 3' overhang of the double-stranded oligonucleotide. In some embodiments, at least one modified nucleotide bond of formula (V) is located on the 3' overhang of the double-stranded oligonucleotide. In some embodiments, at least one modified nucleotide bond of formula (II), (III), (IV), or (V) is located on the 3' overhang of the guide strand of the double-stranded oligonucleotide.
[0057] In some embodiments, at least one modified nucleotide bond of formula (II), (III), (IV), or (V) is located on the 5' overhang of the double-stranded oligonucleotide. In some embodiments, at least one modified nucleotide bond of formula (II) is located on the 5' overhang of the double-stranded oligonucleotide. In some embodiments, at least one modified nucleotide bond of formula (III) is located on the 5' overhang of the double-stranded oligonucleotide. In some embodiments, at least one modified nucleotide bond of formula (IV) is located on the 5' overhang of the double-stranded oligonucleotide. In some embodiments, at least one modified nucleotide bond of formula (V) is located on the 5' overhang of the double-stranded oligonucleotide. In some embodiments, at least one modified nucleotide bond of formula (II), (III), (IV), or (V) is located on the 5' overhang of the guide strand of the double-stranded oligonucleotide.
[0058] In some embodiments, the guide chain contains less than 20, less than 19, less than 18, less than 17, less than 16, less than 15, less than 14, less than 13, less than 12, less than 11, less than 10, less than 9, less than 8, less than 7, less than 6, less than 5, less than 4, less than 3, less than 2, or less than 1 phosphorothioate nucleotide interbonds. In some embodiments, the guide chain contains 1 or less, 2 or less, or 3 or less phosphorothioate nucleotide interbonds at either the 5' or 3' end. In some embodiments, the guide chain contains a total of 1 or less, 2 or less, 3 or less, or 4 or less phosphorothioate nucleotide interbonds at both the 5' and 3' ends. In some embodiments, the guide chain contains 1 or less, 2 or less, 3 or less, or 4 or less phosphorothioate nucleotide interbonds at each of the 5' and 3' ends.
[0059] In some embodiments, the guide chain comprises at least about 20, 19, 18, 17, 16, 15, 14, 13, 12, 11, 10, 9, 8, 7, 6, 5, 4, 3, 2, or 1 phosphorothioate nucleotide interbondings. In some embodiments, the guide chain further comprises at least 1 phosphorothioate nucleotide interbonding. In some embodiments, the guide chain further comprises at least 2 phosphorothioate nucleotide interbondings. In some embodiments, the guide chain further comprises at least 3 phosphorothioate nucleotide interbondings. In some embodiments, the guide chain further comprises at least 4 phosphorothioate nucleotide interbondings. In some embodiments, the guide chain further comprises at least 5 phosphorothioate nucleotide interbondings. In some embodiments, the guide chain further comprises at least 6 phosphorothioate nucleotide interbondings. In some embodiments, the guide chain further comprises at least 7 phosphorothioate nucleotide interbondings. In some embodiments, the guide chain further comprises at least eight phosphorothioate nucleotide interbondings. In some embodiments, the guide chain further comprises at least nine phosphorothioate nucleotide interbondings. In some embodiments, the guide chain further comprises at least ten phosphorothioate nucleotide interbondings. In some embodiments, the guide chain further comprises at least eleven phosphorothioate nucleotide interbondings. In some embodiments, the guide chain further comprises at least twelve phosphorothioate nucleotide interbondings. In some embodiments, the guide chain further comprises at least thirteen phosphorothioate nucleotide interbondings. In some embodiments, the guide chain further comprises at least fourteen phosphorothioate nucleotide interbondings. In some embodiments, the guide chain further comprises at least fifteen phosphorothioate nucleotide interbondings.
[0060] In some embodiments, at least one phosphorothioate nucleotide bond and at least one modified nucleotide bond comprising the structure of formula (II), (III), (IV), or (V) are adjacent to each other (for example, the phosphorothioate nucleotide bond is located between the second and third nucleotides, and the modified nucleotide bond comprising the structure of formula (II), (III), (IV), or (V) is located between the third and fourth nucleotides in the chain). In some embodiments, at least one phosphorothioate nucleotide bond and at least one modified nucleotide bond comprising the structure of formula (II) are adjacent to each other. In some embodiments, at least one phosphorothioate nucleotide bond and at least one modified nucleotide bond comprising the structure of formula (III) are adjacent to each other. In some embodiments, at least one phosphorothioate nucleotide bond and at least one modified nucleotide bond comprising the structure of formula (IV) are adjacent to each other. In some embodiments, at least one phosphorothioate nucleotide bond and at least one modified nucleotide bond having the structure of formula (V) are adjacent to each other.
[0061] In some embodiments, the passenger chain includes at least one modified nucleotide linkage of formula (II), (III), (IV), or (V). In some embodiments, the passenger chain includes at least two modified nucleotide linkages of formula (II), (III), (IV), or (V). In some embodiments, the passenger chain includes at least three modified nucleotide linkages of formula (II), (III), (IV), or (V). In some embodiments, the passenger chain includes at least four modified nucleotide linkages of formula (II), (III), (IV), or (V). In some embodiments, the passenger chain includes at least five modified nucleotide linkages of formula (II), (III), (IV), or (V). In some embodiments, the passenger chain includes at least six modified nucleotide linkages of formula (II), (III), (IV), or (V). In some embodiments, the passenger chain includes at least seven modified nucleotide bonds of formula (II), (III), (IV), or (V). In some embodiments, the passenger chain includes at least eight modified nucleotide bonds of formula (II), (III), (IV), or (V). In some embodiments, the passenger chain includes at least nine modified nucleotide bonds of formula (II), (III), (IV), or (V). In some embodiments, the passenger chain includes at least ten modified nucleotide bonds of formula (II), (III), (IV), or (V). In some embodiments, the passenger chain includes at least eleven modified nucleotide bonds of formula (II), (III), (IV), or (V). In some embodiments, the passenger chain includes at least twelve modified nucleotide bonds of formula (II), (III), (IV), or (V). In some embodiments, the passenger strand includes at least 13 modified internucleotide bonds of formula (II), (III), (IV), or (V). In some embodiments, the passenger strand includes at least 14 modified internucleotide bonds of formula (II), (III), (IV), or (V).In some embodiments, the passenger chain includes at least 15 modified internucleotide bonds of formula (II), (III), (IV), or (V).
[0062] In some embodiments, the passenger strand has up to 18 internucleotide bonds of formula (II), (III), (IV), or (V). In some embodiments, the passenger strand has up to 17 internucleotide bonds of formula (II), (III), (IV), or (V). In some embodiments, the passenger strand has up to 16 internucleotide bonds of formula (II), (III), (IV), or (V). In some embodiments, the passenger strand has up to 15 internucleotide bonds of formula (II), (III), (IV), or (V). In some embodiments, the passenger strand has up to 14 internucleotide bonds of formula (II), (III), (IV), or (V). In some embodiments, the passenger strand has up to 13 internucleotide bonds of formula (II), (III), (IV), or (V). In some embodiments, the passenger strand has up to 12 internucleotide bonds of formula (II), (III), (IV), or (V). In some embodiments, the passenger strand has up to 11 internucleotide bonds of formula (II), (III), (IV), or (V). In some embodiments, the passenger strand has up to 10 internucleotide bonds of formula (II), (III), (IV), or (V). In some embodiments, the passenger strand has up to 9 internucleotide bonds of formula (II), (III), (IV), or (V). In some embodiments, the passenger strand has up to 8 internucleotide bonds of formula (II), (III), (IV), or (V). In some embodiments, the passenger strand has up to 7 internucleotide bonds of formula (II), (III), (IV), or (V). In some embodiments, the passenger strand has up to six internucleotide bonds of formula (II), (III), (IV), or (V). In some embodiments, the passenger strand has up to five internucleotide bonds of formula (II), (III), (IV), or (V). In some embodiments, the passenger strand has up to four internucleotide bonds of formula (II), (III), (IV), or (V). In some embodiments, the passenger strand has up to three internucleotide bonds of formula (II), (III), (IV), or (V).In some embodiments, the passenger strand has up to two internucleotide bonds of formula (II), (III), (IV), or (V). In some embodiments, the passenger strand has one internucleotide bond of formula (II), (III), (IV), or (V).
[0063] In some embodiments, at least one modified nucleotide linkage of formula (II), (III), (IV), or (V) is located within 5, 4, 3, or 2 nucleotides at the 3' end of the passenger strand. In some embodiments, at least one modified nucleotide linkage of formula (II) is located within 5, 4, 3, or 2 nucleotides at the 3' end of the passenger strand. In some embodiments, at least one modified nucleotide linkage of formula (III) is located within 5, 4, 3, or 2 nucleotides at the 3' end of the passenger strand. In some embodiments, at least one modified nucleotide linkage of formula (IV) is located within 5, 4, 3, or 2 nucleotides at the 3' end of the passenger strand. In some embodiments, at least one modified nucleotide linkage of formula (V) is located within 5, 4, 3, or 2 nucleotides at the 3' end of the passenger strand.
[0064] In some embodiments, at least one modified nucleotide bond of formula (II), (III), (IV), or (V) is located within 5, 4, 3, or 2 nucleotides at the 5' end of the passenger strand. In some embodiments, at least one modified nucleotide bond of formula (II) is located within 5, 4, 3, or 2 nucleotides at the 5' end of the passenger strand. In some embodiments, at least one modified nucleotide bond of formula (III) is located within 5, 4, 3, or 2 nucleotides at the 5' end of the passenger strand. In some embodiments, at least one modified nucleotide bond of formula (IV) is located within 5, 4, 3, or 2 nucleotides at the 5' end of the passenger strand. In some embodiments, at least one modified nucleotide bond of formula (V) is located within 5, 4, 3, or 2 nucleotides at the 5' end of the passenger strand.
[0065] In some embodiments, at least one modified nucleotide-to-nucleotide bond of formula (II), (III), (IV), or (V) is located within 4 or 3 nucleotides at the 5' end of the passenger strand, and at least one modified nucleotide-to-nucleotide bond of formula (II), (III), (IV), or (V) is located within 4 or 3 nucleotides at the 3' end of the passenger strand. In some embodiments, at least two modified nucleotide-to-nucleotide bonds of formula (II), (III), (IV), or V are located within 4 or 3 nucleotides at the 5' end of the passenger strand, and at least two modified nucleotide-to-nucleotide bonds of formula (II), (III), (IV), or (V) are located within 4 or 3 nucleotides at the 3' end of the passenger strand.
[0066] In some embodiments, the passenger chain contains less than 18, less than 17, less than 16, less than 15, less than 14, less than 13, less than 12, less than 11, less than 10, less than 9, less than 8, less than 7, less than 6, less than 5, less than 4, less than 3, less than 2, or less 1 phosphorothioate nucleotide interbonds. In some embodiments, the passenger chain contains 1 or less, 2 or less, or 3 or less phosphorothioate nucleotide interbonds at either the 5' or 3' end. In some embodiments, the passenger chain contains a total of 1 or less, 2 or less, 3 or less, or 4 or less phosphorothioate nucleotide interbonds at both the 5' and 3' ends. In some embodiments, the passenger chain contains 1 or less, 2 or less, 3 or less, or 4 or less phosphorothioate nucleotide interbonds at each of the 5' and 3' ends.
[0067] In some embodiments, at least one modified nucleotide-nucleotide bond of formula (II), (III), (IV), or (V) is not located at a cleavage site on the passenger strand. In some embodiments, at least one modified nucleotide-nucleotide bond of formula (II) is not located at a cleavage site on the passenger strand. In some embodiments, at least one modified nucleotide-nucleotide bond of formula (III) is not located at a cleavage site on the passenger strand. In some embodiments, at least one modified nucleotide-nucleotide bond of formula (IV) is not located at a cleavage site on the passenger strand. In some embodiments, at least one modified nucleotide-nucleotide bond of formula (V) is not located at a cleavage site on the passenger strand. As used herein, a cleavage site refers to a site in an oligonucleotide that is cleaved by an RNA-induced silencing complex (RISC) assembly or Ago2.
[0068] In some embodiments, internucleotide bonds of formula (II), (III), (IV), or (V) on the guide or passenger strand enhance the activity of the conjugate of formula (I). In some embodiments, internucleotide bonds of formula (II) on the guide or passenger strand enhance the activity of the conjugate of formula (I). In some embodiments, internucleotide bonds of formula (III) on the guide or passenger strand enhance the activity of the conjugate of formula (I). In some embodiments, internucleotide bonds of formula (IV) on the guide or passenger strand enhance the activity of the conjugate of formula (I). In some embodiments, internucleotide bonds of formula (V) on the guide or passenger strand enhance the activity of the conjugate of formula (I).
[0069] In some embodiments, nucleotide-nucleotide binding of formulas (II), (III), (IV), or (V) on the guide or passenger strand of siRNA increases the stability (e.g., half-life) of the conjugate of formula (I). In some embodiments, nucleotide-nucleotide binding of formula (II) on the guide or passenger strand of siRNA increases the stability of the conjugate of formula (I). In some embodiments, nucleotide-nucleotide binding of formula (III) on the guide or passenger strand of siRNA increases the stability of the conjugate of formula (I). In some embodiments, nucleotide-nucleotide binding of formula (IV) on the guide or passenger strand of siRNA increases the stability of the conjugate of formula (I). In some embodiments, nucleotide-nucleotide binding of formula (V) on the guide or passenger strand of siRNA increases the stability of the conjugate of formula (I).
[0070] In some embodiments, the oligonucleotide comprises at least one internucleotide bond of formula (II), (III), (IV), or (V). In some embodiments, at least one modified internucleotide bond of formula (II), (III), (IV), or (V) is located within the guide chain. In some embodiments, at least one modified internucleotide bond of formula (II), (III), (IV), or (V) is located within the passenger chain.
[0071] In some embodiments, the oligonucleotide contains at least about 1, about 2, about 3, about 4, about 5, about 6, about 7, about 8, about 9, about 10, about 11, about 12, about 13, about 14, about 15, about 16, about 17, about 18, about 19, about 20, about 21, about 22, about 23, about 24, about 25, about 30, or more internucleotide bonds of formula (II), (III), (IV), or (V). In some cases, the oligonucleotide contains at least about 1, about 2, about 3, about 4, about 5, about 6, about 7, about 8, about 9, about 10, about 11, about 12, about 13, about 14, about 15, or more intercleotide bonds of formula (II), (III), (IV), or (V). In some embodiments, the oligonucleotide contains at least about 10, about 11, about 12, about 13, about 14, about 15, about 16, about 17, about 18, about 19, about 20, about 21, about 22, about 23, about 24, about 25, about 30, or more intercleotide bonds of formula (II), (III), (IV), or (V). In some embodiments, the oligonucleotide contains at least about 15, about 16, about 17, about 18, about 19, about 20, about 21, about 22, about 23, about 24, about 25, about 30, or more intercleotide bonds of formula (II), (III), (IV), or (V). In some embodiments, the oligonucleotide comprises at least about 20, about 21, about 22, about 23, about 24, about 25, about 30, or more internucleotide bonds of formula (II), (III), (IV), or (V).
[0072] In some embodiments, the oligonucleotide has at least one internucleotide binding group represented by formula (II), (III), (IV), or (V). In some embodiments, the oligonucleotide has at least two internucleotide binding groups represented by formula (II), (III), (IV), or (V). In some embodiments, the oligonucleotide has at least three internucleotide binding groups represented by formula (II), (III), (IV), or (V). In some embodiments, the oligonucleotide has at least four internucleotide binding groups represented by formula (II), (III), (IV), or (V). In some embodiments, the oligonucleotide has at least five internucleotide binding groups represented by formula (II), (III), (IV), or (V). In some embodiments, the oligonucleotide has at least six internucleotide binding groups represented by formula (II), (III), (IV), or (V). In some embodiments, the oligonucleotide has at least seven internucleotide binding groups represented by formula (II), (III), (IV), or (V). In some embodiments, the oligonucleotide has at least eight internucleotide binding groups represented by formula (II), (III), (IV), or (V). In some embodiments, the oligonucleotide has at least nine internucleotide binding groups represented by formula (II), (III), (IV), or (V). In some embodiments, the oligonucleotide has at least ten internucleotide binding groups represented by formula (II), (III), (IV), or (V). In some embodiments, the oligonucleotide has at least eleven internucleotide binding groups represented by formula (II), (III), (IV), or (V). In some embodiments, the oligonucleotide has at least twelve internucleotide binding groups represented by formula (II), (III), (IV), or (V). In some embodiments, the oligonucleotide has at least 13 internucleotide binding groups represented by formula (II), (III), (IV), or (V).In some embodiments, the oligonucleotide has at least 14 internucleotide binding groups represented by formula (II), (III), (IV), or (V). In some embodiments, the oligonucleotide has at least 15 internucleotide binding groups represented by formula (II), (III), (IV), or (V). In some embodiments, the oligonucleotide has at least 20 internucleotide binding groups represented by formula (II), (III), (IV), or (V).
[0073] In some embodiments, the oligonucleotide contains at least 1, 2, 3, 4, 5, 6, or 7 internucleotide binding groups represented by formula (II), (III), (IV), or (V) at the 5' end or in the first 7-11 nucleotides from the 5' end, and at least 1, 2, 3, 4, 3, 6, or 7 internucleotide binding groups represented by formula (II), (III), (IV), or (V) at the 3' end or in the first 7-11 nucleotides from the 3' end. In some examples, the oligonucleotide contains more internucleotide binding groups represented by formula (II), (III), (IV), or (V) at the 5' end than at the 3' end. In some examples, the oligonucleotide contains more internucleotide binding groups represented by formula (II), (III), (IV), or (V) at the 3' end than at the 5' end.
[0074] In some embodiments, the passenger strand includes a modified nucleotide bond of formula (II) linking the first 1, 2, 3, 4, 5, 6, 7, 8, 9, 10, 11, 12, 13, 14, 15, 16, 17, or 18 nucleotides starting from the 3' end. In some embodiments, the passenger strand includes a modified nucleotide bond of formula (II) linking the first 1, 2, 3, 4, 5, 6, 7, 8, 9, 10, 11, 12, 13, 14, 15, 16, 17, or 18 nucleotides starting from the 5' end. In some embodiments, the passenger strand includes a modified nucleotide bond of formula (II) linking the first 1, 2, 3, 4, 5, 6, 7, 8, 9, 10, 11, 12, 13, 14, 15, 16, 17, or 18 nucleotides starting from the 3' end and the first 1, 2, 3, 4, 5, 6, 7, 8, 9, 10, 11, 12, 13, 14, 15, 16, 17, or 18 nucleotides starting from the 5' end. In some embodiments, the passenger strand includes a modified nucleotide bond of formula (II) linking all nucleotides.
[0075] In some embodiments, the guide chain includes a modified nucleotide bond of formula (II) that connects the first 1, 2, 3, 4, 5, 6, 7, 8, 9, 10, 11, 12, 13, 14, 15, 16, 17, or 18 nucleotides starting from the 3' end. In some embodiments, the guide chain includes a modified nucleotide bond of formula (II) that connects the first 1, 2, 3, 4, 5, 6, 7, 8, 9, 10, 11, 12, 13, 14, 15, 16, 17, or 18 nucleotides starting from the 5' end. In some embodiments, the guide chain includes a modified nucleotide bond of formula (II) that connects the first 1, 2, 3, 4, 5, 6, 7, 8, 9, 10, 11, 12, 13, 14, 15, 16, 17, or 18 nucleotides starting from the 3' end and the first 1, 2, 3, 4, 5, 6, 7, 8, 9, 10, 11, 12, 13, 14, 15, 16, 17, or 18 nucleotides starting from the 5' end. In some embodiments, the guide chain includes a modified nucleotide bond of formula (II) that connects all nucleotides.
[0076] In some embodiments, the passenger strand consists of the first 1, 2, 3, 4, 5, 6, 7, 8, 9, 10, 11, 12, 13, 14, 15, 16, 17, or 18 nucleotides starting from the 3' end and modified nucleotides of formula (II) joining the first 1, 2, 3, 4, 5, 6, 7, 8, 9, 10, 11, 12, 13, 14, 15, 16, 17, or 18 nucleotides starting from the 5' end. The guide chain includes an internucleotide bond, which connects the first 1, 2, 3, 4, 5, 6, 7, 8, 9, 10, 11, 12, 13, 14, 15, 16, 17, or 18 nucleotides starting from the 3' end and the first 1, 2, 3, 4, 5, 6, 7, 8, 9, 10, 11, 12, 13, 14, 15, 16, 17, or 18 nucleotides starting from the 5' end.
[0077] Depending on the case, at least one monomer subunit may be represented by formula (V*). Depending on the case, at least two monomer subunits may be represented by formula (V*). Depending on the case, at least three monomer subunits may be represented by formula (V*). Depending on the case, at least four monomer subunits may be represented by formula (V*). Depending on the case, at least five monomer subunits may be represented by formula (V*). Depending on the case, at least six monomer subunits may be represented by formula (V*). Depending on the case, at least seven monomer subunits may be represented by formula (V*). Depending on the case, at least eight monomer subunits may be represented by formula (V*). At least nine monomer subunits may be represented by formula (V*). In some cases, at least 10 monomer subunits of the monomer subunit are represented by formula (V*). In some cases, at least 11 monomer subunits of the monomer subunit are represented by formula (V*). In some cases, at least 12 monomer subunits of the monomer subunit are represented by formula (V*). In some cases, at least 13 monomer subunits of the monomer subunit are represented by formula (V*). In some cases, at least 14 monomer subunits of the monomer subunit are represented by formula (V*). In some cases, at least 15 monomer subunits of the monomer subunit are represented by formula (V*). In some cases, at least 20 monomer subunits of the monomer subunit are represented by formula (V*).
[0078] In some examples, oligonucleotides contain at least one of the following modifications: approximately 5% to approximately 100%, approximately 10% to approximately 100%, approximately 20% to approximately 100%, approximately 30% to approximately 100%, approximately 40% to approximately 100%, approximately 50% to approximately 100%, approximately 60% to approximately 100%, approximately 70% to approximately 100%, approximately 80% to approximately 100%, and approximately 90% to approximately 100%, where the modification is an internucleotide bond of formula (II), (III), (IV), or (V). For example, if an oligonucleotide has 20 internucleotide bonds, an oligonucleotide with approximately 60% modification contains approximately 12 internucleotide bonds in the oligonucleotide that are replaced by internucleotide bonds of formula (II), (III), (IV), or (V).
[0079] In some embodiments, one or more modifications involve a modified phosphate skeleton in which the modification generates a neutral or uncharged skeleton. In some examples, the phosphate skeleton is modified by alkylation to generate an uncharged or neutral phosphate skeleton. As used herein, alkylation includes methylation, ethylation, and propylation. Where applicable, when used herein in the context of alkylation, alkyl refers to a linear or branched saturated hydrocarbon group containing 1 to 6 carbon atoms. In some examples, exemplary alkyl groups include, but are not limited to, methyl, ethyl, n-propyl, isopropyl, n-butyl, isobutyl, sec-butyl, tert-butyl, n-pentyl, isopentyl, neopentyl, hexyl, isohexyl, 1,1-dimethylbutyl, 2,2-dimethylbutyl, 3,3-dimethylbutyl, and 2-ethylbutyl groups. Where applicable, the modified phosphate is a phosphate group described in U.S. Patent 9481905.
[0080] In some embodiments, the double-stranded oligonucleotides disclosed herein further comprise modified internucleotide bonds selected from alkylphosphonates, triesters, and mesylphosphoramidiates. In some embodiments, the double-stranded oligonucleotides disclosed herein further comprise modified internucleotide bonds of alkylphosphonates. In some embodiments, the double-stranded oligonucleotides disclosed herein further comprise modified internucleotide bonds of triesters. In some embodiments, the double-stranded oligonucleotides disclosed herein further comprise modified internucleotide bonds of mesylphosphoramidiates.
[0081] In some embodiments, the further modified phosphate skeleton includes alkylphosphonates, triesters, methylphosphonates, ethylphosphonates, methylthiophosphonates, or methoxyphosphonates. In some cases, the modified phosphate is a methylphosphonate. In some cases, the modified phosphate is an ethylphosphonate. In some cases, the modified phosphate is a methylthiophosphonate. In some cases, the modified phosphate is a methoxyphosphonate.
[0082] In some embodiments, the further modified phosphate skeleton includes one of the following:
[0083] [ka]
[0084] In some examples, oligonucleotides contain modified phosphate backbones other than those of formulas (II), (III), (IV), or (V) in numbers less than 10, less than 9, less than 8, less than 7, less than 6, less than 5, less than 4, less than 3, less than 2, or less than 1. In some examples, oligonucleotides contain phosphate backbones other than those of formulas (II), (III), (IV), or (V) in numbers less than 18, less than 17, less than 16, less than 15, less than 14, less than 13, less than 12, less than 11, less than 10, less than 9, less than 8, less than 7, less than 6, or less than 5.
[0085] In some embodiments, the oligonucleotide further hybridizes with a second oligonucleotide to form a double helix. In some examples, the oligonucleotide is a sense strand or a passenger strand. In some examples, the second oligonucleotide is an antisense strand or a guide strand. In some embodiments, the second oligonucleotide is an RNA oligonucleotide. In some cases, the second oligonucleotide is a modified oligonucleotide. In some cases, the second oligonucleotide has at least one internucleotide binding group represented by formula (II), (III), (IV), or (V).
[0086] Modified ribose In some embodiments, the oligonucleotide comprises a synthetic or artificial nucleotide analog or base. In some embodiments, the oligonucleotide comprises at least one non-natural nucleotide. In some examples, the synthetic or artificial nucleotide analog or base comprises a nucleic acid having a modification to the 2'-hydroxyl group of the ribose moiety (a 2'-modified nucleotide). In some examples, the modification comprises H, OR, R, halo, SH, SR, NH2, NHR, NR2, or CN, where R is the alkyl moiety. Exemplary alkyl moieties include, but are not limited to, halogens, sulfur, thiols, thioethers, thioesters, amines (primary, secondary, or tertiary), amides, ethers, esters, alcohols, and oxygen. In some examples, the alkyl moiety comprises further modifications. In some examples, modifications include azo groups, keto groups, aldehyde groups, carboxyl groups, nitro groups, nitroso groups, nitrile groups, heterocyclic (e.g., imidazole, hydrazino, or hydroxylamino) groups, isocyanate or cyanate groups, or sulfur-containing groups (e.g., sulfoxides, sulfones, sulfides, or disulfides). In some examples, the alkyl moiety further includes heterosubstituted groups. In some examples, the carbon of the heterocyclic group is substituted with nitrogen, oxygen, or sulfur. In some examples, heterocyclic substitutions include, but are not limited to, morpholino, imidazole, and pyrrolidino groups.
[0087] In some embodiments, at least one 2'-modified nucleotide includes a nucleotide modified with 2'-O-methyl, 2'-O-methoxyethyl (2'-O-MOE), 2'-O-aminopropyl, 2'-deoxy, 2'-deoxy-2'-fluoro, 2'-O-aminopropyl (2'-O-AP), 2'-O-dimethylaminoethyl (2'-O-DMAOE), 2'-O-dimethylaminopropyl (2'-O-DMAP), 2'-O-dimethylaminoethyloxyethyl (2'-O-DMAEOE), or 2'-ON-methylacetamide (2'-O-NMA). In some embodiments, the 2'-modified nucleotide includes a nucleotide modified with 2'-O-methyl. In some embodiments, the 2'-modified nucleotide includes a nucleotide modified with 2'-O-methoxyethyl (2'-O-MOE). In some embodiments, the 2'-modified nucleotide includes a nucleotide modified with 2'-O-aminopropyl. In some embodiments, the 2'-modified nucleotide includes a 2'-deoxy-modified nucleotide. In some embodiments, the 2'-modified nucleotide includes a 2'-deoxy-2'-fluoro-modified nucleotide. In some embodiments, the 2'-modified nucleotide includes a 2'-O-aminopropyl (2'-O-AP)-modified nucleotide. In some embodiments, the 2'-modified nucleotide includes a 2'-O-dimethylaminoethyl (2'-O-DMAOE)-modified nucleotide. In some embodiments, the 2'-modified nucleotide includes a 2'-O-dimethylaminopropyl (2'-O-DMAP)-modified nucleotide. In some embodiments, the 2'-modified nucleotide includes a 2'-O-dimethylaminoethyl (2'-O-DMAOE)-modified nucleotide. In some embodiments, the 2'-modified nucleotide includes a 2'-ON-methylacetamide (2'-O-NMA)-modified nucleotide. In some examples, the modification at the 2' hydroxyl group is a 2'-O-aminopropyl modification, in which an extended amine group containing a propyl linker bonds the amine group to the 2' oxygen.In some cases, this modification neutralizes the overall negative charge derived from the phosphate group of the oligonucleotide molecule by introducing one positive charge from the amine group per sugar, thereby improving its cellular uptake properties due to its zwitterionic nature. A typical chemical structure of 2'-O-aminopropyl nucleoside phosphoramidite is shown below.
[0088] [ka]
[0089] In some cases, modification at the 2' hydroxyl group is a 2'-O-aminopropyl modification, in which an extended amine group containing a propyl linker bonds the amine group to the 2' oxygen. In some cases, this modification neutralizes the overall negative charge derived from the phosphate of the oligonucleotide molecule by introducing one positive charge from the amine group per sugar, thereby improving its cellular uptake properties due to its zwitterionic properties.
[0090] In some embodiments, the oligonucleotides described herein include at least 1, 2, 3, 4, 5, 6, 7, 8, 9, 10, 11, 12, 13, 14, 15, 16, 17, 18, 19, 20, 21, 22, 23, 24, 25, 26, 27, 28, 29, 30, 31, 32, 33, 34, 35, 36, 37, 38, 39, 40, 41, 42, 43, 44, 45, 46, 47, 48, 49, 50 or more 2'-modified nucleotides. In some embodiments, the oligonucleotides described herein comprise a sense strand (passenger strand) and an antisense strand (guide strand), wherein the sense strand or the antisense strand comprises at least 1, 2, 3, 4, 5, 6, 7, 8, 9, 10, 11, 12, 13, 14, 15, 16, 17, 18, 19, 20, 21, 22, 23, 24, 25 or more 2'-modified nucleotides. In some embodiments, the oligonucleotides described herein comprise a sense strand (passenger strand) and an antisense strand (guide strand), wherein the antisense strand comprises at least 1, 2, 3, 4, 5, 6, 7, 8, 9, 10, 11, 12, 13, 14, 15, 16, 17, 18, 19, 20, 21, 22, 23, 24, 25 or more 2'-modified nucleotides.
[0091] In some cases, 5'-phosphonate-modified nucleotides are further modified with a 2'-hydroxyl group in locked or cross-linked ribose modification (e.g., locked nucleic acids or LNA), where the oxygen molecule bonded at the 2' carbon is bonded to the 4' carbon by a methylene group, thus forming a 2'-C,4'-C-oxymethylene-bonded bicyclic ribonucleotide monomer. An exemplary representation of the chemical structure of 5'-phosphonate-modified LNA is shown below (where J is an internucleotide bond).
[0092] [ka]
[0093] In some embodiments, at least one 2'-modified nucleotide comprises ethylene nucleic acid (ENA). ENA is part of the crosslinked nucleic acid class of modified nucleic acids, which also includes LNA. Exemplary chemical structures of ENA and crosslinked nucleic acids are shown below.
[0094] [ka]
[0095] In some embodiments, the oligonucleotides described herein comprise at least 1, 2, 3, 4, 5, 6, 7, 8, 9, 10, 11, 12, 13, 14, 15, 16, 17, 18, 19, 20 or more locked nucleic acids (LNAs) or ethylene nucleic acids (ENAs). In some embodiments, the oligonucleotides described herein comprise a sense strand (passenger strand) and an antisense strand (guide strand), wherein the sense strand or antisense strand comprises at least 1, 2, 3, 4, 5, 6, 7, 8, 9, 10 or more locked nucleic acids (LNAs) or ethylene nucleic acids (ENAs). In some embodiments, the oligonucleotides described herein comprise a sense strand (passenger strand) and an antisense strand (guide strand), wherein the sense strand comprises at least 1, 2, 3, 4, 5, 6, 7, 8, 9, 10 or more locked nucleic acids (LNAs) or ethylene nucleic acids (ENAs). In some embodiments, the oligonucleotides described herein comprise a sense strand (passenger strand) and an antisense strand (guide strand), wherein the antisense strand comprises at least 1, 2, 3, 4, 5, 6, 7, 8, 9, 10 or more locked nucleic acids (LNA) or ethylene nucleic acids (ENA).
[0096] In some embodiments, nucleotide analogs include, but are not limited to, the following modified bases (e.g., heterocyclic base moieties): 5-propynyluridine, 5-propynylcytidine, 6-methyladenine, 6-methylguanine, N,N,-dimethyladenine, 2-propyladenine, 2-propylguanine, 2-aminoadenine, 1-methylinosine, 3-methyluridine, 5-methylcytidine, 5-methyluridine, and others having modifications at the 5-position. Deazanucleotides such as nucleotides, 5-(2-amino)propyluridine, 5-halocytidine, 5-halolysine, 4-acetylcytidine, 1-methyladenosine, 2-methyladenosine, 3-methylcytidine, 6-methyluridine, 2-methylguanosine, 7-methylguanosine, 2,2-dimethylguanosine, 5-methylaminoethyluridine, 5-methyloxyuridine, 7-deazaadenosine, 6-azouridine, 6-azo This includes cytidine, 6-azothymidine, 5-methyl-2-thiouridine, 2-thiouridine and 4-thiouridine and other thiobases such as 2-thiocytidine, dihydrouridine, pseudouridine, keuosin, archeosin, naphthyl groups and substituted naphthyl groups, O- and N-alkylated purines and pyrimidines such as N6-methyladenosine, 5-methylcarbonylmethyluridine, uridine 5-oxyacetic acid, pyridine-4-one, pyridine-2-one, phenyl groups and modified phenyl groups such as aminophenol or 2,4,6-trimethoxybenzene, modified cytosine that functions as a G-clamp nucleotide, 8-substituted adenine and guanine, 5-substituted uracil and thymine, azapyrimidine, carboxyhydroxyalkyl nucleotides, carboxyalkylaminoalkyli nucleotides, and alkylcarbonylalkylated nucleotides. Modified nucleotides also include nucleotides modified with respect to a sugar moiety, as well as nucleotides having a non-ribosyl sugar or sugar analogue. For example, the sugar moiety may be mannose, arabinose, glucopyranose, galactopyranose, 4'-thioribose, and other sugars, heterocyclic or carbocyclic, or based thereon.The term nucleotide includes those known in the art as universal bases. Examples of universal bases include, but are not limited to, 3-nitropyrrole, 5-nitroindole, or nebularin.
[0097] In some embodiments, nucleotide analogs further include morpholino, peptide nucleic acid (PNA), methylphosphonate nucleotide, thiolphosphonate nucleotide, 2'-fluoroN3-P5'-phosphoramidite, 1,5'-anhydrohexitol nucleic acid (HNA), or combinations thereof. Morphorino or phosphorodiamidate morpholino oligomers (PMOs) include synthetic molecules that mimic native nucleic acid structures by deviating from the usual sugar and phosphate structures. In some examples, a five-membered ribose ring is replaced by a six-membered morpholino ring containing four carbons, one nitrogen, and one oxygen. In some cases, the ribose monomer is bonded by a phosphorodiamidate group instead of a phosphate group. In such cases, the backbone modification removes all positive and negative charges, allowing the morpholino neutral molecule to cross the cell membrane without the help of cell delivery agents such as those used by charged oligonucleotides.
[0098] [ka]
[0099] In some embodiments, the 5'-phosphonate-modified morpholino or PMO described herein is a PMO containing a positive or cationic charge. In some examples, PMO is PMOplus(Sarepta). PMOplus refers to a phosphorodiamidate oligomer containing any number of (1-piperazino)phosphenylideneoxy(1-(4-(omega-guanidino-alkanoyl))-piperazino)phosphenylideneoxy bonds (e.g., as described in International Patent Application Publication WO2008 / 036127). In some cases, PMO is the PMO described in U.S. Patent No. 7,943,762.
[0100] In some embodiments, the morpholino or PMO described herein is PMO-X (Sarepta). In some cases, PMO-X refers to a phosphorodiamidate morpholino oligomer comprising at least one bond or disclosed terminal modification, e.g., at least one of those disclosed in International Patent Application Publication WO2011 / 150408 and U.S. Patent Application Publication 2012 / 0065169.
[0101] In some embodiments, the morpholino or PMO described herein is the PMO listed in Table 5 of U.S. Patent Application Publication No. 2014 / 0296321.
[0102] In some embodiments, peptide nucleic acids (PNAs) do not contain sugar rings or phosphate bonds, and the bases are linked by oligoglycine-like molecules, appropriately spaced apart, thereby eliminating the charge of the backbone.
[0103] [ka]
[0104] In some embodiments, one or more modifications occur selectively at the internucleotide bond. In some examples, the modified internucleotide bond may include, but is not limited to, phosphorothioates, phosphorodithioates, methylphosphonates, 5'-alkylenephosphonates, 5'-methylphosphonates, 3'-alkylenephosphonates, boron trifluoride, boron phosphates and selenium phosphates having a 3'-5' or 2'-5' bond, phosphate triesters, thioalkyl phosphate triesters, phosphonic acid hydrogen bonds, alkylphosphonates, alkylphosphonothioates, arylphosphonothioates, phosphoroselennoates, phosphorodiselenoates, phosphinates, phosphoramides, 3'-alkylphospholamidates, aminoalkylphospholamidates, thiophospholamidates, and more. Examples include sphoropiperadates, phosphoranilothioates, phosphoranilideates, ketones, sulfones, sulfonamides, carbonates, carbamates, methylenehydrazo, methylenedimethylhydrazo, formacetal, thioformacetal, oximes, methyleneimino, methylenemethylimino, thioamides, bonds having a riboacetyl group, aminoethylglycine, silyl or siloxane bonds, saturated or unsaturated and / or substituted and / or heteroatom-containing alkyl or cycloalkyl bonds having or not having heteroatoms (e.g., 1 to 10 carbon atoms), morpholino structures, amides, polyamides in which a base is directly or indirectly bonded to the aza nitrogen of the backbone, and combinations thereof. Phosphothioate antisense oligonucleotides (PS ASOs) are antisense oligonucleotides having a phosphorothioate bond. Exemplary PS ASOs are shown below.
[0105] [ka]
[0106] In some examples, the modifications are methyl or thiol modifications, such as methylphosphonate or thiolphosphonate modifications. Exemplary thiolphosphonate nucleotides (left) and methylphosphonate nucleotides (right) are shown below.
[0107] [ka]
[0108] In some cases, modified nucleotides
[0109] [ka] This includes, but is not limited to, 2'-fluoroN3-P5' phosphoramidites shown as such.
[0110] In some cases, modified nucleotides
[0111] [ka] This includes, but is not limited to, hexitol nucleic acids (or 1',5'-anhydrohexitol nucleic acids (HNAs)) as shown below.
[0112] In some embodiments, the oligonucleotide comprises a sense strand and an antisense strand, and the sense strand or antisense strand includes a terminal cap portion at the 5' end, 3' end, or both the 5' and 3' ends of the sense strand. In other embodiments, the terminal cap portion is an inverted deoxydecate portion. In some embodiments, at least one inverted deoxydecate portion is at least one terminal.
[0113] In some embodiments, the double-stranded oligonucleotide and / or oligonucleotide comprising the above-mentioned nucleotide analog or artificial nucleotide base further comprises a nucleotide with a 5'-terminal vinylphosphonate modification. In some embodiments, the above-mentioned nucleotide analog or artificial nucleotide base comprises a 5'-vinylphosphonate modified nucleotide having a modification to the 5'-hydroxyl group of the ribose moiety. In some embodiments, the 5'-vinylphosphonate modified nucleotide is selected from the nucleotides presented below, where the linker is O or S and B is a heterocyclic base moiety.
[0114] [ka]
[0115] Further examples of 5'-vinylphosphonate modified nucleic acids are shown below, where the linker is O or S, B is the heterocyclic base moiety, and J is the internucleotide bond.
[0116] [ka] (In the formula, B is the base portion of the heterocycle, R 4 , and R 5 These are independently selected from hydrogen, halogen, alkyl, or alkoxy. J is an internucleotide binding group that binds to adjacent nucleotides in an oligonucleotide.
[0117] [ka] (In the formula, B is the base portion of the heterocycle, R 6 It is selected from hydrogen, halogen, alkyl, or alkoxy, J is an internucleotide binding group that binds to adjacent nucleotides in an oligonucleotide.
[0118] [ka] (In the formula, B is the base portion of the heterocycle, J is an internucleotide binding group that binds to adjacent nucleotides in an oligonucleotide.
[0119] [ka] (In the formula, B is the base portion of the heterocycle, R6 is selected from hydrogen, halogen, alkyl, or alkoxy. J is an internucleotide binding group that binds to adjacent nucleotides in an oligonucleotide. That is the case.
[0120] In some examples, the oligonucleotide comprises a first and a second strand. In some embodiments, the first strand is: a sense strand; an RNA oligonucleotide; conjugated to a binding moiety, polymer, or combination thereof; consisting of about 10 to about 30 nucleotides; comprising at least one internucleotide binding group having formula (II), (III), (IV), or (V); and comprising at least one monomer subunit of formula (V*). In some embodiments, the second strand is: a non-transcription strand; an RNA oligonucleotide; consisting of about 10 to about 30 nucleotides; comprising at least one internucleotide binding group having formula (II), (III), (IV), or (V); and comprising at least one monomer subunit of formula (V*).
[0121] In some examples, the oligonucleotide is approximately 10 to 50 nucleotides long. In some examples, the oligonucleotide is approximately 10 to 45 nucleotides long. In some examples, the oligonucleotide is approximately 10 to 40 nucleotides long. In some examples, the oligonucleotide is approximately 10 to 35 nucleotides long. In some examples, the oligonucleotide is approximately 10 to 30 nucleotides long. In some examples, the oligonucleotide is approximately 10 to 25 nucleotides long. In some examples, the oligonucleotide is approximately 10 to 20 nucleotides long. In some examples, the oligonucleotide is approximately 15 to 25 nucleotides long. In some examples, the oligonucleotide is approximately 19 to 23 nucleotides long. In some examples, the oligonucleotide is approximately 15 to 30 nucleotides long. In some examples, the oligonucleotide is approximately 12 to 30 nucleotides long. In some embodiments, the oligonucleotide is approximately 8 to 50 nucleotides long.
[0122] In some embodiments, the oligonucleotide is about 50 nucleotides long. In some examples, the oligonucleotide is about 45 nucleotides long. In some examples, the oligonucleotide is about 40 nucleotides long. In some examples, the oligonucleotide is about 35 nucleotides long. In some examples, the oligonucleotide is about 30 nucleotides long. In some examples, the oligonucleotide is about 25 nucleotides long. In some examples, the oligonucleotide is about 20 nucleotides long. In some examples, the oligonucleotide is about 19 nucleotides long. In some examples, the oligonucleotide is about 18 nucleotides long. In some examples, the oligonucleotide is about 17 nucleotides long. In some examples, the oligonucleotide is about 16 nucleotides long. In some examples, the oligonucleotide is about 15 nucleotides long. In some examples, the oligonucleotide is about 14 nucleotides long. In some examples, the oligonucleotide is about 13 nucleotides long. In some examples, the oligonucleotide is about 12 nucleotides long. In some examples, the oligonucleotide is about 11 nucleotides long. In some examples, the oligonucleotide is about 10 nucleotides long.
[0123] In some embodiments, the oligonucleotide comprises a sense strand (passenger strand) and an antisense strand (guide strand), where at least one or each of the sense strand (passenger strand) and the antisense strand (guide strand) is about 10 to about 50 nucleotides long. In some examples, at least one or each of the sense strand (passenger strand) and the antisense strand (guide strand) is about 10 to about 30, about 15 to about 30, about 18 to about 25, about 18 to about 24, about 19 to about 23, or about 20 to about 22 nucleotides long.
[0124] In some examples, at least one or each of the sense strand (passenger strand) and antisense strand (guide strand) is about 10–50, 10–45 nucleotides, 10–40 nucleotides, 10–35 nucleotides, 10–30 nucleotides, 10–25 nucleotides, 10–20 nucleotides, 15–25 nucleotides, 15–30 nucleotides, 19–23 nucleotides, or 12–30 nucleotides in length.
[0125] In some examples, at least one or each of the sense strand (passenger strand) and antisense strand (guide strand) is approximately 50, 45, 40, 35, 30, 25, or 20 nucleotides long. In some examples, at least one or each of the sense strand (passenger strand) and antisense strand (guide strand) is approximately 19, 18, 17, 16, 15, 14, 13, 12, 12, or 11 nucleotides long.
[0126] In some cases, the guide chain is approximately 50 nucleotides long. In some cases, the guide chain is approximately 45 nucleotides long. In some cases, the guide chain is approximately 40 nucleotides long. In some cases, the guide chain is approximately 35 nucleotides long. In some cases, the guide chain is approximately 30 nucleotides long. In some cases, the guide chain is approximately 25 nucleotides long. In some cases, the guide chain is approximately 20 nucleotides long. In some cases, the guide chain is approximately 19 nucleotides long. In some cases, the guide chain is approximately 18 nucleotides long. In some cases, the guide chain is approximately 17 nucleotides long. In some cases, the guide chain is approximately 16 nucleotides long. In some cases, the guide chain is approximately 15 nucleotides long. In some cases, the guide chain is approximately 14 nucleotides long. In some cases, the guide chain is approximately 13 nucleotides long. In some cases, the guide chain is approximately 12 nucleotides long. In some cases, the guide chain is approximately 11 nucleotides long. In some cases, the guide chain is approximately 10 nucleotides long. In some examples, the guide chain is approximately 10 to 50 nucleotides long. In some examples, the guide chain is approximately 10 to 45 nucleotides long. In some examples, the guide chain is approximately 10 to 40 nucleotides long. In some examples, the guide chain is approximately 10 to 35 nucleotides long. In some examples, the guide chain is approximately 10 to 30 nucleotides long. In some examples, the guide chain is approximately 10 to 25 nucleotides long. In some examples, the guide chain is approximately 10 to 20 nucleotides long. In some examples, the guide chain is approximately 15 to 25 nucleotides long. In some examples, the guide chain is approximately 15 to 30 nucleotides long. In some examples, the guide chain is approximately 12 to 30 nucleotides long.
[0127] In some cases, the passenger chain is approximately 50 nucleotides long. In some cases, the passenger chain is approximately 45 nucleotides long. In some cases, the passenger chain is approximately 40 nucleotides long. In some cases, the passenger chain is approximately 35 nucleotides long. In some cases, the passenger chain is approximately 30 nucleotides long. In some cases, the passenger chain is approximately 25 nucleotides long. In some cases, the passenger chain is approximately 20 nucleotides long. In some cases, the passenger chain is approximately 19 nucleotides long. In some cases, the passenger chain is approximately 18 nucleotides long. In some cases, the passenger chain is approximately 17 nucleotides long. In some cases, the passenger chain is approximately 16 nucleotides long. In some cases, the passenger chain is approximately 15 nucleotides long. In some cases, the passenger chain is approximately 14 nucleotides long. In some cases, the passenger chain is approximately 13 nucleotides long. In some cases, the passenger chain is approximately 12 nucleotides long. In some cases, the passenger strand is approximately 11 nucleotides long. In some cases, the passenger strand is approximately 10 nucleotides long. In some cases, the passenger strand is approximately 10 to 50 nucleotides long. In some cases, the passenger strand is approximately 10 to 45 nucleotides long. In some cases, the passenger strand is approximately 10 to 40 nucleotides long. In some cases, the passenger strand is approximately 10 to 35 nucleotides long. In some cases, the passenger strand is approximately 10 to 30 nucleotides long. In some cases, the passenger strand is approximately 10 to 25 nucleotides long. In some cases, the passenger strand is approximately 10 to 20 nucleotides long. In some cases, the passenger strand is approximately 15 to 25 nucleotides long. In some cases, the passenger strand is approximately 15 to 30 nucleotides long. In some cases, the passenger strand is approximately 12 to 30 nucleotides long.
[0128] In some embodiments, the oligonucleotide includes a blunt end, an overhang, or a combination thereof. In some examples, the blunt end is a 5' blunt end, a 3' blunt end, or both. By chance, the overhang is a 5' overhang, a 3' overhang, or both. By chance, the overhang contains 1, 2, 3, 4, 5, 6, 7, 8, 9, or 10 non-base-pairing nucleotides. By chance, the overhang contains 1, 2, 3, 4, 5, or 6 non-base-pairing nucleotides. By chance, the overhang contains 1, 2, 3, or 4 non-base-pairing nucleotides. By chance, the overhang contains 1 non-base-pairing nucleotide. By chance, the overhang contains 2 non-base-pairing nucleotides. By chance, the overhang contains 3 non-base-pairing nucleotides. By chance, the overhang contains 4 non-base-pairing nucleotides.
[0129] In some embodiments, the oligonucleotide sequence is at least 40%, 50%, 55%, 60%, 65%, 70%, 75%, 80%, 85%, 90%, 95%, 98%, 99%, or 99.5% complementary to the target sequence described herein. Examples of target sequences include, but are not limited to, any sequence of the MSTN gene or its mRNA, or the SSB gene or its mRNA. In some embodiments, the oligonucleotide sequence is at least 50% complementary to the target sequence described herein. In some embodiments, the oligonucleotide sequence is at least 60% complementary to the target sequence described herein. In some embodiments, the oligonucleotide sequence is at least 70% complementary to the target sequence described herein. In some embodiments, the oligonucleotide sequence is at least 80% complementary to the target sequence described herein. In some embodiments, the oligonucleotide sequence is at least 90% complementary to the target sequence described herein. In some embodiments, the oligonucleotide sequence is at least 95% complementary to the target sequence described herein. In some embodiments, the oligonucleotide sequence is at least 99% complementary to the target sequence described herein. In some examples, the oligonucleotide sequence is 100% complementary to the target sequence described herein.
[0130] In some embodiments, the oligonucleotide sequence has fewer than 5 mismatches with respect to the target sequence described herein. In some embodiments, the oligonucleotide sequence has fewer than 4 mismatches with respect to the target sequence described herein. In some examples, the oligonucleotide sequence has fewer than 3 mismatches with respect to the target sequence described herein. In some cases, the oligonucleotide sequence has fewer than 2 mismatches with respect to the target sequence described herein. In some cases, the oligonucleotide sequence has fewer than 1 mismatch with respect to the target sequence described herein.
[0131] In some embodiments, the specificity of the oligonucleotide hybridizing to the target sequence described herein is 95%, 98%, 99%, 99.5%, or 100% sequence complementarity of the oligonucleotide to the target sequence. In some examples, hybridization is performed under highly stringent hybridization conditions.
[0132] In some embodiments, the oligonucleotide hybridizes to at least 8, 9, 10, 11, 12, 13, 14, 15, 16, 17, 18, 19, 20 or more consecutive bases of the target sequence described herein. In some embodiments, the oligonucleotide hybridizes to at least 8 consecutive bases of the target sequence described herein. In some embodiments, the oligonucleotide hybridizes to at least 9 consecutive bases of the target sequence described herein. In some embodiments, the oligonucleotide hybridizes to at least 10 consecutive bases of the target sequence described herein. In some embodiments, the oligonucleotide hybridizes to at least 11 consecutive bases of the target sequence described herein. In some embodiments, the oligonucleotide hybridizes to at least 12 consecutive bases of the target sequence described herein. In some embodiments, the oligonucleotide hybridizes to at least 13 consecutive bases of the target sequence described herein. In some embodiments, the oligonucleotide hybridizes to at least 14 consecutive bases of the target sequence described herein. In some embodiments, the oligonucleotide hybridizes to at least 15 consecutive bases of the target sequence described herein. In some embodiments, the oligonucleotide hybridizes to at least 16 consecutive bases of the target sequence described herein. In some embodiments, the oligonucleotide hybridizes to at least 17 consecutive bases of the target sequence described herein. In some embodiments, the oligonucleotide hybridizes to at least 18 consecutive bases of the target sequence described herein. In some embodiments, the oligonucleotide hybridizes to at least 19 consecutive bases of the target sequence described herein. In some embodiments, the oligonucleotide hybridizes to at least 20 consecutive bases of the target sequence described herein.
[0133] Additional modifications In some embodiments, the nucleotide analogs or artificial nucleotide bases described herein include 5'-phosphonate-modified nucleotide nucleic acids having a modification on the 5'-hydroxyl group of the ribose moiety. In some embodiments, the nucleotide analogs or artificial nucleotide bases described herein include 5'-vinylphosphonate-modified nucleotide nucleic acids having a modification on the 5'-hydroxyl group of the ribose moiety.
[0134] In some examples, the modification is a methyl or thiol modification, such as a methylphosphonate or thiolphosphonate modification. Exemplary thiolphosphonate nucleotides (left), phosphorodithioate (center), and methylphosphonate nucleotides (right) are shown below.
[0135]
Chemical formula
[0136] In some examples, the 5'-vinylphosphonate-modified nucleotides
[0137]
Chemical formula
[0138] In some examples, the modified internucleotide linkage is a phosphorodiamidate linkage. Non-limiting examples of phosphorodiamidate linkages having a morpholino backbone are shown below.
[0139]
Chemical formula
[0140] In some examples, the modified internucleotide linkage is a methylphosphonate linkage. Non-limiting examples of methylphosphonate linkages are shown below.
[0141] [ka]
[0142] In some examples, the modified nucleotide bond is an amide bond. Non-restrictive examples of amide bonds are shown below.
[0143] [ka]
[0144] In some embodiments, one or more modifications optionally further include modifications of the ribose moiety, phosphate backbone, and nucleotide, or modifications of nucleotide analogs at the 3' or 5' end. For example, the 3' end optionally includes a 3' cationic group or inverts the nucleotide at the 3' end by a 3'-3' bond. In another alternative, the 3' end is optionally conjugated with an aminoalkyl group, e.g., 3'C5 aminoalkyl dT. In yet another alternative, the 3' end is optionally conjugated with an abasic site, e.g., an aprinic acid site or an apyrimidine acid site.
[0145] In some embodiments, the oligonucleotide is conjugated with NH2-C1- at the 5' end of the modified oligonucleotide. 12 It has an alkyl group. In some embodiments, the NH2-C1-6 alkyl group is conjugated to the 5' end of the oligonucleotide. In some embodiments, the modified oligonucleotide has the NH2-C6 alkyl group conjugated to the 5' end of the modified oligonucleotide.
[0146] In some embodiments, an oligonucleotide comprising at least one internucleotide linkage represented by formula (II), (III), (IV), or (V) further comprises one or more of the artificial nucleotide analogs described herein. In some examples, an oligonucleotide comprising at least one internucleotide linkage represented by formula (II), (III), (IV), or (V) further comprises one or more additional modifications, e.g., 1, 2, 3, 4, 5, 6, 7, 8, 9, 10, 11, 12, 13, 14, 15, 16, 17, 18, 20, 25, or more, the additional modifications being, but not limited to, 2'-O-methyl, 2'-O-methoxyethyl (2'-O-MOE), 2'-O-aminopropyl, 2'-deoxy, 2'-deoxy-2'-fluoro, These include 2'-O-aminopropyl (2'-O-AP), 2'-O-dimethylaminoethyl (2'-O-DMAOE), 2'-O-dimethylaminopropyl (2'-O-DMAP), 2'-O-dimethylaminoethyloxyethyl (2'-O-DMAEOE), 2'-ON-methylacetamide (2'-O-NMA) modified compounds, LNA, ENA, PNA, HNA, morpholino, methylphosphonate nucleotides, thiolphosphonate nucleotides, 2'-fluoroN3-P5'-phosphoramidite, or combinations thereof.In some examples, an oligonucleotide containing at least one internucleotide bond represented by formula (II), (III), (IV), or (V) further comprises 1, 2, 3, 4, 5, 6, 7, 8, 9, 10, 11, 12, 13, 14, 15, 16, 17, 18, 20, 25, or more artificial nucleotide analogs, said artificial nucleotide analogs being 2'-O-methyl, 2'-O-methoxyethyl (2'-O-MOE), 2'-O-aminopropyl, 2'-deoxy, 2'-deoxy-2'-fluoro, 2'-O- The oligonucleotides are selected from aminopropyl (2'-O-AP), 2'-O-dimethylaminoethyl (2'-O-DMAOE), 2'-O-dimethylaminopropyl (2'-O-DMAP), 2'-O-dimethylaminoethyloxyethyl (2'-O-DMAEOE), 2'-ON-methylacetamide (2'-O-NMA) modified nucleotides, LNA, ENA, PNA, HNA, morpholino, methylphosphonate nucleotides, thiolphosphonate nucleotides, 2'-fluoroN3-P5'-phosphoramidite, or combinations thereof. In some examples, the oligonucleotides further include 1, 2, 3, 4, 5, 6, 7, 8, 9, 10, 11, 12, 13, 14, 15, 16, 17, 18, 20, 25, or more 2'-O-modified nucleotides. In some examples, the oligonucleotide further comprises 1, 2, 3, 4, 5, 6, 7, 8, 9, 10, 11, 12, 13, 14, 15, 16, 17, 18, 20, 25, or more 2'-O-methoxyethyl (2'-O-MOE) modified nucleotides. In some examples, the oligonucleotide containing at least one internucleotide bond represented by formula (II), (III), (IV), or (V) further comprises 1, 2, 3, 4, 5, 6, 7, 8, 9, 10, 11, 12, 13, 14, 15, 16, 17, 18, 20, 25, or more thiol phosphonates.
[0147] In some examples, oligonucleotides ranging from about 5% to about 100% contain artificial nucleotide analogs described herein. Therapeutic peptides obtain about 5%, 10%, 15%, 20%, 25%, 30%, 35%, 40%, 45%, 50%, 55%, 60%, 65%, 70%, 75%, 80%, 85%, 90%, 95% of oligonucleotides or their nucleotide analogs. In some embodiments, artificial nucleotide analogs include 2'-O-methyl, 2'-O-methoxyethyl (2'-O-MOE), 2'-O-aminopropyl, 2'-deoxy, 2'-deoxy-2'-fluoro, 2'-O-aminopropyl (2'-O-AP), 2'-O-dimethylaminoethyl (2'-O-DMAOE), 2'-O-dimethylaminopropyl (2'-O-DMAP), 2'-O-dimethylaminoethyloxyethyl (2'-O-DMAEOE), 2'-ON-methylacetamide (2'-O-NMA) modified, LNA, ENA, PNA, HNA, morpholino, methylphosphonate nucleotides, thiolphosphonate nucleotides, 2'-fluoroN3-P5'-phosphoramidite, or combinations thereof.
[0148] In some embodiments, the oligonucleotides disclosed herein include RNA or DNA. In some cases, the oligonucleotides include RNA. In some examples, they include short interfering RNA (siRNA), short hairpin RNA (shRNA), microRNA (miRNA), double-stranded RNA (dsRNA), transfer RNA (tRNA), ribosomal RNA (rRNA), or heteronuclear RNA (hnRNA). In some examples, RNA includes shRNA. In some examples, RNA includes miRNA. In some examples, RNA includes dsRNA. In some examples, RNA includes tRNA. In some examples, RNA includes rRNA. In some examples, RNA includes hnRNA. In some examples, RNA includes siRNA. In some cases, the oligonucleotide includes the sense strand (or passenger strand) of siRNA. In other cases, the oligonucleotide includes the antisense strand (or guide strand) of siRNA.
[0149] In some embodiments, the oligonucleotide hybridizes to at least 8, 9, 10, 11, 12, 13, 14, 15, 16, 17, 18, or 19 consecutive bases of the target gene sequence. In some embodiments, the oligonucleotide hybridizes to a region of the target gene that is at least 80%, 85%, 90%, 95%, or 99% complementary to the nucleic acid sequence of the oligonucleotide. In some examples, the oligonucleotide contains a nucleic acid sequence of at least 14, 15, 16, 17, 18, or 19 consecutive nucleotides complementary to the target gene sequence with 1, 2, or 3 or fewer mismatches. In some embodiments, the target gene is associated with the onset, progression, or prognosis of a disease. In some embodiments, the target gene is associated with the onset, progression, or prognosis of cancer. In some embodiments, the target gene is associated with the onset, onset, or prognosis of an immune disorder. In some embodiments, the target gene is associated with the onset, progression, or prognosis of muscle atrophy or muscular dystrophy.
[0150] joining part In some embodiments, an oligonucleotide containing an internucleotide bond of formula (II), (III), (IV), or (V) is conjugated with a binding moiety to form a conjugate (e.g., a therapeutic oligonucleotide conjugate). In some embodiments, the binding moiety is conjugated to the 5' end of the oligonucleotide. In some embodiments, the binding moiety is conjugated to the 3' end of the oligonucleotide. In some embodiments, the binding moiety is conjugated to the 5' end of the passenger chain of the oligonucleotide. In some embodiments, the binding moiety is conjugated to the 3' end of the passenger chain of the oligonucleotide. In some embodiments, the binding moiety contains an antibody or its antigen-binding fragment. In some embodiments, the binding moiety contains a peptide or a small molecule. In some embodiments, the binding moiety contains a peptide. In some embodiments, the binding moiety contains a small molecule. In some embodiments, the binding moiety contains an aptamer.
[0151] In some embodiments, the binding portion disclosed herein binds to a cell surface receptor. In some embodiments, the antibody or antigen-binding fragment disclosed herein binds to a cell surface receptor.
[0152] In some embodiments, the binding site disclosed herein is selected from the group consisting of polypeptides, proteins, or antibodies or their antigen-binding fragments. In some embodiments, the binding site is a polypeptide. In some embodiments, the binding site is a protein. In some embodiments, the binding site is an antibody or its antigen-binding fragment. In some embodiments, the binding site is a polypeptide. In some examples, the polypeptide is an antibody or its fragment. In some cases, the fragment is an antigen-binding fragment. In some examples, antibodies or their antigen-binding fragments include humanized antibodies or their antigen-binding fragments, human antibodies or their antigen-binding fragments, anti-mouse antibodies (e.g., anti-mouse antibodies, anti-rat antibodies, etc.), anti-human antibodies (e.g., anti-human transferrin receptor antibodies), mouse antibodies or their antigen-binding fragments, chimeric antibodies or their antigen-binding fragments, monoclonal antibodies or their antigen-binding fragments, monovalent Fab', bivalent Fab2, F(ab)'3 fragments, single-chain variable fragments (scFv), bis-scFv (bis-scFv), (scFv)2, diabodies, minibodies, nanobodies, triabodies, tetrabodies, disulfide-stabilized Fv proteins (dsFv), single-domain antibodies (sdAb), Ig NARs, camelid antibodies or their antigen-binding fragments, bispecific antibodies or their binding fragments, or chemically modified derivatives thereof.
[0153] In some cases, the binding site is an antibody or its antigen-binding fragment. In some cases, the binding site is a humanized antibody or its antigen-binding fragment, a mouse antibody or its antigen-binding fragment, an antibody, a chimeric antibody or its antigen-binding fragment, a monoclonal antibody or its antigen-binding fragment, a monovalent Fab', a bivalent Fab2, an F(ab)'3 fragment, a single-chain variable fragment (scFv), a bis-scFv, (scFv)2, a diabody, a minibody, a nanobody, a triabody, a tetrabody, a disulfide-stabilized Fv protein ("dsFv"), a single-domain antibody (sdAb), an Ig NAR, a camelid antibody or its antigen-binding fragment, a bispecific antibody or its binding fragment, or a chemically modified derivative thereof. In some cases, the binding site is a humanized antibody or its antigen-binding fragment. In some cases, the binding site is a mouse antibody or its antigen-binding fragment. In some cases, the binding site is a chimeric antibody or its antigen-binding fragment. In some cases, the binding site is a monoclonal antibody or its antigen-binding fragment. In some cases, the binding site is a full-size antibody. In some cases, the binding site is monovalent Fab'. In some cases, the binding site is divalent Fab2. In some cases, the binding site is a single-chain variable fragment (scFv).
[0154] In some embodiments, the binding site is a bispecific antibody or its antigen-binding fragment. In some examples, the bispecific antibody is a trifunctional antibody or a bispecific mini-antibody. In some cases, the bispecific antibody is a trifunctional antibody. In some examples, the trifunctional antibody is a full-length monoclonal antibody containing binding sites for two different antigens. Exemplary trifunctional antibodies include catumaxomab (targeting EpCAM and CD3; Fresenius Biotech / Trion Pharma), ertumaxomab (targeting HER2 / neu / CD3; Fresenius Biotech / Trion Pharma), and lymphomun FBTA05 (targeting CD20 / CD3; Fresenius Biotech / Trion Pharma). Examples include RG7221 (RO5520985; targeting angiopoietin / VEGF; Roche), RG7597 (targeting Her1 / Her3; Genentech / Roche), MM141 (targeting IGF1R / Her3; Merrimack), ABT122 (targeting TNFα / IL17; Abbvie), ABT981 (targeting IL1α / IL1β; Abbott), LY3164530 (targeting Her1 / cMET; Eli Lilly), and TRBS07 (Ektomab; targeting GD2 / CD3; Trion Research GmbH). Further exemplary trifunctional antibodies include mAbs from F-star Biotechnology Ltd. 2include. In some examples, the bispecific antibody is a bispecific trifunctional antibody. In some embodiments, exemplary bispecific antibodies include catumaxomab (targeting EpCAM and CD3; Fresenius Biotech / Trion Pharma), ertumaxomab (targeting HER2 / neu / CD3; Fresenius Biotech / Trion Pharma), lymphomun FBTA05 (targeting CD20 / CD3; Fresenius Biotech / Trion Pharma), RG7221 (RO5520985; targeting Angiopoietin / VEGF; Roche), RG7597 (targeting Her1 / Her3; Genentech / Roche), MM141 (targeting IGF1R / Her3; Merrimack), ABT122 (targeting TNFα / IL17; Abbvie), ABT981 (targeting IL1α / IL1β; Abbott), LY3164530 (targeting Her1 / cMET; Eli Lilly), and TRBS07 (Ektomab; targeting GD2 / CD3; Trion Research Gmbh), or a trifunctional antibody selected from mAbs from F-star Biotechnology Ltd. 2 is a trifunctional antibody selected therefrom.
[0155] In some cases, a bispecific antibody is a bispecific mini-antibody. In some examples, a bispecific mini-antibody includes a bivalent Fab2, F(ab)'3 fragment, bis-scFv, (scFv)2, diabody, minibody, triabody, tetrabody, or bispecific T cell engager (BiTE). In some embodiments, a bispecific T cell engager is a fusion protein comprising two single-chain variable fragments (scFvs), the scFvs targeting epitopes of two different antigens. Examples of bispecific miniantibodies include, but are not limited to, DART (Biaffinity Retargeting Platform; MacroGenics), blinatumomab (MT103 or AMG103; targeting CD19 / CD3; Micromet), MT111 (targeting CEA / CD3; Micromet / Amegen), MT112 (BAY2010112; targeting PSMA / CD3; Micromet / Bayer), and MT110 (AMG Examples include 110 (targeting EPCAM / CD3; Amgen / Micromet), MGD006 (targeting CD123 / CD3; MacroGenics), MGD007 (targeting GPA33 / CD3; MacroGenics), BI1034020 (targeting two different epitopes on β-amyloid; Ablynx), ALX0761 (targeting IL17A / IL17F; Ablynx), TF2 (targeting CEA / heptene; Immunomedics), IL-17 / IL-34 bispecific antibody (BMS), AFM13 (targeting CD30 / CD16; Affimed), AFM11 (targeting CD19 / CD3; Affimed), and domain antibodies (dAbs from Domantis / GSK).
[0156] In some embodiments, the binding site is a bispecific mini-antibody. In some examples, the binding site is a bispecific Fab2. In some examples, the binding site is a bispecific F(ab)'3 fragment. In some cases, the binding site is a bispecific bis-scFv. In some cases, the binding site is a bispecific (scFv)2. In some embodiments, the binding site is a bispecific diabody. In some embodiments, the binding site is a bispecific minibody. In some embodiments, the binding site is a bispecific triabody. In other embodiments, the binding site is a bispecific tetrabody. In other embodiments, the binding site is a bispecific T-cell engager (BiTE). In a further embodiment, the binding portion may be DART (Dual Affinity Retargeting Platform; MacroGenics), blinatumomab (MT103 or AMG103; targeting CD19 / CD3; Micromet), MT111 (targeting CEA / CD3; Micromet / Amegen), MT112 (BAY2010112; targeting PSMA / CD3; Micromet / Bayer), MT110 (AMG These are bispecific mini-antibodies selected from 110 (targeting EPCAM / CD3; Amgen / Micromet), MGD006 (targeting CD123 / CD3; MacroGenics), MGD007 (targeting GPA33 / CD3; MacroGenics), BI1034020 (targeting two different epitopes on β-amyloid; Ablynx), ALX0761 (targeting IL17A / IL17F; Ablynx), TF2 (targeting CEA / heptene; Immunomedics), IL-17 / IL-34 bispecific antibody (BMS), AFM13 (targeting CD30 / CD16; Affimed), AFM11 (targeting CD19 / CD3; Affimed), or domain antibodies (dAbs from Domantis / GSK).
[0157] In some embodiments, the binding site is a trispecific antibody. In some examples, the trispecific antibody includes an F(ab)'3 fragment or a triabody. In some examples, the binding site is a trispecific F(ab)'3 fragment. In some cases, the binding site is a triabody. In some embodiments, the binding site is a trispecific antibody, such as that described in Dimas, et al., “Development of a trispecific antibody designed to simultaneously and efficiently target three different antigens on tumor cells,” Mol. Pharmaceutics, 12(9): 3490-3501 (2015).
[0158] In some embodiments, the binding site is an antibody or its antigen-binding fragment that recognizes a cell surface protein. In some examples, the cell surface protein is an antigen expressed by cancer cells. Exemplary cancer antigens include, but are not limited to, α-fetoprotein, ASLG659, B7-H3, BAFF-R, Brevican, CA125 (MUC16), CA15-3, CA19-9, carcinoembryonic antigen (CEA), CA242, CRIPTO (CR, CR1, CRGF, CRIPTO, TDGF1, teratoma-derived growth factor), CTLA-4, CXCR5, E16 (LAT1, SLC7A5), FcRH2 (IFGP4, IRTA4, SPAP1A (SH2 domain-containing phosphatase anchor protein 1a)), SPAP1B, SPAP1C), epidermal growth factor, ETBR, Fc receptor-like protein 1 (FCRH1), GEDA, HLA-DOB (β-subunit of MHC class II molecule (Ia antigen)), human chorionic gonadotropin, ICOS, IL-2 receptor, IL20Rα, immunoglobulin superfamily receptor translocation-related 2 (IRTA2), L6, Lewis Y, Lewis X, MAGE-1, MAGE-2, MAGE-3, MAGE 4, MART1, mesoserine, MDP, MPF (SMR, MSLN), MCP1 (CCL2), macrophage suppressor (MIF), MPG, MSG783, mucin, MUC1-KLH, Napi3b (SLC34A2), nectin-4, neurokine gene product, NCA, placental alkaline phosphatase, prostate-specific membrane antigen (PMSA), prostatic acid phosphatase, PSCA Examples include hlg, p97, purinergic receptor P2X ligand-gated ion channel 5 (P2X5), LY64 (lymphocyte antigen 64 (RP105)), gp100, P21, prostatic 6-transmembrane epithelial antigen (STEAP1, STEAP2, Sema 5b), transferrin receptor, tumor-associated glycoprotein 72 (TAG-72), and TrpM4 (BR22450, FLJ20041, TRPM4, TRPM4B, transient receptor potential cation channel, subfamily M, member 4). In some cases, the binding site is an α-transferrin receptor antibody or its antigen-binding fragment. In some cases, the binding site is an α-human transferrin receptor antibody.In some examples, the binding site is an α-human transferrin receptor antibody, such as that described in PCT / US2019 / 068078, which is incorporated herein by reference.
[0159] In some cases, cell surface proteins include surface markers for differentiated cluster (CD) cells. The following are not limited to CD1, CD2, CD3, CD4, CD5, CD6, CD7, CD8, CD9, CD10, CD11a, CD11b, CD11c, CD11d, CDw12, CD13, CD14, CD15, CD15s, CD16, CDw17, CD18, CD19, CD20, CD21, CD22, CD23, CD24, CD25, CD26, CD27, CD28, CD29, CD30, CD31, CD32, CD33, CD34, CD35, CD36, CD37, CD38, CD39, CD40, CD41, CD42, CD43, CD44, CD45, CD45RO, CD45RA, CD45RB, CD46, CD47, CD48, CD49a, CD49b, CD 49c, CD49d, CD49e, CD49f, CD50, CD51, CD52, CD53, CD54, CD55, CD56, CD57, CD58, CD59, CDw60, CD 61, CD62E, CD62L (L-selectin), CD62P, CD63, CD64, CD65, CD66a, CD66b, CD66c, CD66d, CD66e, CD71, Examples include CD79 (e.g., CD79a, CD79b), CD90, CD95 (Fas), CD103, CD104, CD125 (IL5RA), CD134 (OX40), CD137 (4-1BB), CD152 (CTLA-4), CD221, CD274, CD279 (PD-1), CD319 (SLAMF7), and CD326 (EpCAM).
[0160] In some embodiments, the antibody or its antigen-binding fragment is used to treat saltuzumab (HuMax-EFGr, Genmab), avagovomab (Menarini), abituzumab (Merck), adecatumab (MT201), aracizumab pegol, alemtuzumab (Campath®, MabCampath, or Campath-1H; Leukosite), allomune (BioTransplant), amatoximab (Morphotek, Inc.), anti-VEGF (Genetech), anatamomab / mafenatox, apolizumab (hu1D10), ascrinbakumab (Pfizer Inc.), atezolizumab (MPDL3280A; Genentech / Roche), B43.13 (OvaRex, AltaRex) Novartis Corporation, basiliximab (Simulect®, Novartis), belimumab (Benlysta®, GlaxoSmithKline), bevacizumab (Avastin®, Genentech), blinatumomab (Blincyto, AMG103; Amgen), BEC2 (ImGlone Systems Inc.), carlumab (Janssen Biotech), catumaxomab (Removab, Trion Pharma), CEAcide (Immunomedics), cetuximab (Erbitux®, ImClone), citatuzumab bogatox (VB6-845), thixumumab (IMC-A12, ImClone Systems Inc.), conatumumab (AMG 655, Amgen), dacetuzumab (SGN-40, huS2C6; Seattle Genetics, Inc.)), daratumumab (Darzalex®, Janssen Biotech), detumomab, drozitumab (Genentech), durvalumab (MedImmune), dusigitumab (MedImmune), edrecolomab (MAb17-1A, Panorex, Glaxo Wellcome), elotuzumab (Empliciti®, Bristol-Myers Squibb), emibetuzumab (Eli Lilly), enavatuzumab (Facet Biotech Corp.), enfortumab vedotin (Seattle Genetics, Inc.), enoblituzumab (MGA271, MacroGenics, Inc.), ensituxumab (Neogenix Oncology, Inc.), epratuzumab (LymphoCide, Immunomedics, Inc.), ertumaxomab (Rexomun®, Trion Pharma), etaracizumab (Abegrin, MedImmune), farletuzumab (MORAb-003, Morphotek, Inc), FBTA05 (Lymphomun, Trion Pharma), ficlatuzumab (AVEO Pharmaceuticals), figitumumab (CP-751871, Pfizer), flanvotumab (ImClone Systems), fresolimumab (GC1008, Aanofi-Aventis), futuximab, glaximab, ganitumab (Amgen), girentuximab (Rencarex®, Wilex AG), IMAB362 (Claudiximab, Ganymed Pharmaceuticals AG), imalumab (Baxalta), IMC-1C11 (ImClone Systems), IMC-C225 (Imclone Systems Inc.), imgatuzumab (Genentech / Roche), intetumumab (Centocor, Inc.), ipilimumab (Yervoy®, Bristol-Myers Squibb), iratumumab (Medarex, Inc.), isatuximab (SAR650984, Sanofi-Aventis), labetuzumab (CEA-CIDE, Immunomedics), lexatumumab (ETR2-ST01, Cambridge Antibody Technology), lintuzumab (SGN-33, Seattle Genetics), lucatumumab (Novartis), lumiliximab, Mapatumumab (HGS-ETR1, Human Genome Sciences), Matuzumab (EMD 72000, Merck), Milatuzumab (hLL1, Immunomedics, Inc.), Mitumomab (BEC-2, ImClone Systems), Narnatumab (ImClone Systems), Necitumumab (Portrazza®, Eli Lilly), Nesvacumab (Regeneron Pharmaceuticals), Nimotuzumab (h-R3, BIOMAb EGFR, TheraCIM, Theraloc, or CIMAher; Biotech Pharmaceutical Co.)), nivolumab (Opdivo®, Bristol-Myers Squibb), obinutuzumab (Gazyva or Gazyvaro; Hoffmann-La Roche), ocaratuzumab (AME-133v, LY2469298; Mentrik Biotech, LLC), ofatumumab (Arzerra®, Genmab), onartuzumab (Genentech), ontuxizumab (Morphotek, Inc.), oregovomab (OvaRex®, AltaRex Corp.), otlertuzumab (Emergent BioSolutions), panitumumab (ABX-EGF, Amgen), pankomab (Glycotope GMBH), parsatuzumab (Genentech), patritumab, pembrolizumab (Keytruda®, Merck), pemtumomab (Theragyn, Antisoma), pertuzumab (Perjeta, Genentech), pidilizumab (CT-011, Medivation), polatuzumab vedotin Vedotin (Genentech / Roche), Pritumumab, Racotumomab (Vaxira®, Recombio), Ramucirumab (Cyramza®, ImClone Systems Inc.), Rituximab (Rituxan®, Genentech), Robatumumab (Schering-Plough), Seribantumab (Sanofi / Merrimack Pharmaceuticals, Inc.)), sibrotuzumab, siltuximab (Sylvant®, Janssen Biotech), Smart MI95 (Protein Design Labs, Inc.), Smart ID10 (Protein Design Labs, Inc.), tabalumab (LY2127399, Eli Lilly), taplitumomab paptox, tenatumomab, teprotumumab (Roche), tetulomab, TGN1412 (CD28-SuperMAB or TAB08), tigatuzumab (CD-1008, Daiichi Sankyo), tositumomab, This includes trastuzumab (Herceptin®), tremelimumab (CP-672,206; Pfizer), tucotuzumab celmoleukin (EMD Pharmaceuticals), ublituximab, urelumab (BMS-663513, Bristol-Myers Squibb), volociximab (M200, Biogen Idec), and zatuximab, among others.
[0161] Conjugation Chemistry In some cases, the oligonucleotide is conjugated to a binding site. In some examples, the binding site includes amino acids, peptides, polypeptides, proteins, antibodies, antigens, toxins, hormones, lipids, nucleotides, nucleosides, sugars, carbohydrates, polymers such as poly(ethylene glycol) (PEG) and polypropylene glycol), and all analogues or derivatives of these classes of substances. Further examples of binding sites include steroids such as cholesterol, phospholipids, di- and triacylglycerols, fatty acids, hydrocarbons (e.g., including saturated, unsaturated, or substituted), enzyme substrates, biotin, digoxigenin, and polysaccharides. In some examples, the binding site is an antibody or its antigen-binding fragment. In some examples, the oligonucleotide is further conjugated to a polymer and, optionally, to an endosomal soluble site. In some embodiments, the polymer includes poly(ethylene glycol).
[0162] In some embodiments, the conjugates disclosed herein have a drug-to-antibody ratio (DAR) of about 1, 2, 3, 4, 5, 6, 7, 8, 9, 10, 11 or greater. In some embodiments, the average number of drug molecules conjugated to the antibody forms the average ratio. In some examples, the average ratio is referred to as the average DAR, and the drugs referred to herein are oligonucleotides. In some embodiments, the average number of drug molecules conjugated to the antibody forms the average ratio. In some examples, the average ratio is referred to as the average DAR, and the drugs referred to herein are oligonucleotides containing at least one internucleotide bond having formula (II), (III), (IV), or (V). In some embodiments, the average DAR ratio of oligonucleotide to antibody is about 1, 2, 3, 4, 5, 6, 7, 8, 9, 10, 11, 12, 13, 14, 15, 16 or greater. In some embodiments, the mean DAR ratio of oligonucleotide to antibody is approximately 1–2, approximately 1–3, approximately 1–4, approximately 1–5, approximately 1–6, approximately 1–7, or approximately 1–8. In some embodiments, the mean DAR ratio of oligonucleotide to antibody is approximately 2–3, approximately 2–4, approximately 2–5, approximately 2–6, approximately 2–7, or approximately 2–8. In some embodiments, the mean DAR ratio of oligonucleotide to antibody is approximately 2, approximately 3, or approximately 4. In some embodiments, the conjugate has a DAR of approximately 1:1, 2:1, 3:1, 4:1, 5:1, 6:1, 7:1, 8:1, 9:1, 10:1, or 11:1.
[0163] In some embodiments, nucleotide-nucleotide bonds of formula (II), (III), (IV), or (V) on the guide or passenger strand disclosed herein increase the activity of the conjugate of formula (I) when the DAR of formula (I) is greater than 1 compared to when the DAR of formula (I) is 1. In some embodiments, nucleotide-nucleotide bonds of formula (II) on the guide or passenger strand increase the activity of the conjugate of formula (I) when the DAR of formula (I) is greater than 1 compared to when the DAR of formula (I) is 1. In some embodiments, nucleotide-nucleotide bonds of formula (III) on the guide or passenger strand increase the activity of the conjugate of formula (I) when the DAR of formula (I) is greater than 1 compared to when the DAR of formula (I) is 1. In some embodiments, nucleotide-nucleotide bonds of formula (IV) on the guide or passenger strand increase the activity of the conjugate of formula (I) when the DAR of formula (I) is greater than 1 compared to when the DAR of formula (I) is 1. In some embodiments, internucleotide bonds of formula (V) on the guide or passenger strand increase the activity of the conjugate of formula (I) when the DAR of formula (I) is greater than 1, compared to when the DAR of formula (I) is 1.
[0164] In some embodiments, internucleotide binding of formula (II), (III), (IV), or (V) on the guide or passenger strand disclosed herein increases the activity of the conjugate of formula (I) when the mean DAR of formula (I) is about 2, 3, or 4 compared to when the mean DAR of formula (I) is about 1. In some embodiments, internucleotide binding of formula (II) on the guide or passenger strand increases the activity of the conjugate of formula (I) when the mean DAR of formula (I) is about 2, 3, or 4 compared to when the mean DAR of formula (I) is about 1. In some embodiments, internucleotide binding of formula (III) on the guide or passenger strand increases the activity of the conjugate of formula (I) when the mean DAR of formula (I) is about 2, 3, or 4 compared to when the mean DAR of formula (I) is about 1. In some embodiments, internucleotide binding of formula (IV) on the guide or passenger strand increases the activity of the conjugate of formula (I) when the mean DAR of formula (I) is about 2, 3, or 4 compared to when the mean DAR of formula (I) is about 1. In some embodiments, internucleotide binding of formula (V) on the guide or passenger strand increases the activity of the conjugate of formula (I) when the mean DAR of formula (I) is about 2, 3, or 4 compared to when the mean DAR of formula (I) is about 1.
[0165] In some embodiments, internucleotide binding of formula (II), (III), (IV), or (V) on the guide or passenger strand disclosed herein increases the activity of the conjugate of formula (I) when the mean DAR of formula (I) is about 2 compared to when the mean DAR of formula (I) is about 1. In some embodiments, internucleotide binding of formula (II) on the guide or passenger strand increases the activity of the conjugate of formula (I) when the mean DAR of formula (I) is about 2 compared to when the mean DAR of formula (I) is about 1. In some embodiments, internucleotide binding of formula (III) on the guide or passenger strand increases the activity of the conjugate of formula (I) when the mean DAR of formula (I) is about 2 compared to when the mean DAR of formula (I) is about 1. In some embodiments, internucleotide binding of formula (IV) on the guide or passenger strand increases the activity of the conjugate of formula (I) when the mean DAR of formula (I) is about 2 compared to when the mean DAR of formula (I) is about 1. In some embodiments, internucleotide binding of formula (V) on the guide or passenger strand increases the activity of the conjugate of formula (I) when the mean DAR of formula (I) is about 2 compared to when the mean DAR of formula (I) is about 1.
[0166] In some embodiments, oligonucleotides are conjugated to the binding site by a chemical ligation process. In some examples, oligonucleotides are transformed to the binding site by native ligation. In some examples, conjugation is described in Dawson, et al. “Synthesis of proteins by native chemical ligation,” Science 1994, 266, 776-779; Dawson, et al. “Modulation of Reactivity in Native Chemical Ligation through the Use of Thiol Additives,” J. Am. Chem. Soc. 1997, 119, 4325-4329; Hackeng, et al. “Protein synthesis by native chemical ligation: Expanded scope by using straightforward methodology,” Proc. Natl. Acad. Sci. USA 1999, 96, 10068-10073; or Wu, et al. “Building complex glycopeptides: Development of a This is described in "Construction of Complex Glycopeptides: Development of a Cysteine-Free Native Chemical Ligation Protocol," Angew. Chem. Int. Ed. 2006, 45, 4116-4125, etc. In some examples, the conjugation is as described in U.S. Patent No. 8,936,910. In some embodiments, oligonucleotides are site-specifically or non-specifically conjugated to the binding site via native ligation chemistry.
[0167] In some cases, oligonucleotides are conjugated to the binding site by a site-directed method utilizing "traceless" coupling technology (Philochem). In some cases, the "traceless" coupling technology utilizes the N-terminal 1,2-aminothiol group of the binding site, which then conjugates with an oligonucleotide containing an aldehyde group. (See Casi et al. “Site-specific traceless coupling of potent cytotoxic drugs to recombinant antibodies for pharmacodelivery,” JACS 134(13): 5887-5892 (2012))
[0168] In some cases, oligonucleotides are conjugated to a binding site by a site-specific method utilizing unnatural amino acids incorporated into the binding site. In some cases, the unnatural amino acid includes p-acetylphenylalanine (pAcPhe). In some cases, the keto group of pAcPhe is selectively coupled to the alkoxyamine derivative conjugate site to form an oxime bond. (See Axup et al. “Synthesis of site-specific antibody-drug conjugates using unnatural amino acids,” PNAS 109(40): 16101-16106 (2012))
[0169] In some cases, oligonucleotides are conjugated to the binding site by a site-specific method utilizing an enzyme-catalyzed process. In some cases, the site-specific method utilizes SMARTag® technology (Redwood). In some cases, SMARTag® technology involves the production of a formylglycine (FGly) residue from cysteine by formylglycine-producing enzyme (FGE) via an oxidation process in the presence of an aldehyde tag, followed by the conjugation of FGly to an alkylhydrine-functionalized oligonucleotide by hydrazino-Pictet-Spengler (HIPS) ligation. (See Wu et al. “Site-specific chemical modification of recombinant proteins produced in mammalian cells by using the genetically encoded aldehyde tag,” PNAS 106(9): 3000-3005 (2009); Agarwal, et al. “A Pictet-Spengler ligation for protein chemical modification,” PNAS 110(1): 46-51 (2013))
[0170] In some cases, the enzyme-catalyzed process involves microbial transglutaminase (mTG). In some instances, oligonucleotides are conjugated to the binding site using a process catalyzed by microbial transglutaminase. In some cases, mTG catalyzes the formation of a covalent bond between the amide side chain of glutamine in the recognition sequence and the primary amine of the functionalized oligonucleotide. In some cases, mTG is produced from Streptomyces mobarensi. (See Strop et al. “Location matters: site of conjugation modulates stability and pharmacokinetics of antibody drug conjugates,” Chemistry and Biology 20(2)161-167(2013))
[0171] In some examples, oligonucleotides are conjugated to the binding site by the method described in PCT Publication WO2014 / 140317, which utilizes a sequence-specific transpeptidase. In some examples, oligonucleotides are conjugated to the binding site by the method described in U.S. Patent Publications 2015 / 0105539 and 2015 / 0105540.
[0172] Linker In some embodiments, the binding site and one or more oligonucleotides are conjugated via binding.
[0173] In some embodiments, a binding site and one or more oligonucleotides are conjugated via a linker. In some embodiments, the linker is further conjugated to a conjugate described herein, an oligonucleotide described herein, an oligonucleotide described herein, a binding site described herein, or a combination thereof. The linker may crosslink the oligonucleotide to the binding site. The linker may crosslink the oligonucleotide to a polypeptide. The linker may crosslink the oligonucleotide to an antibody or its antigen-binding fragment.
[0174] In some embodiments, the linker is a C1-C6 alkyl group. In some embodiments, the linker is a C1 alkyl group. In some embodiments, the linker is a C2 alkyl group. In some embodiments, the linker is a C3 alkyl group. In some embodiments, the linker is a C4 alkyl group. In some embodiments, the linker is a C5 alkyl group. In some embodiments, the linker is a 1-C6 alkyl group.
[0175] In some embodiments, the linker comprises a homobifunctional linker. In some embodiments, the linker is a homobifunctional linker that is optionally conjugated to a C1-C6 alkyl group. In some embodiments, the linker is a homobifunctional linker that is optionally conjugated to a C1 alkyl group. In some embodiments, the linker is a homobifunctional linker that is optionally conjugated to a C2 alkyl group. In some embodiments, the linker is a homobifunctional linker that is optionally conjugated to a C3 alkyl group. In some embodiments, the linker is a homobifunctional linker that is optionally conjugated to a C4 alkyl group. In some embodiments, the linker is a homobifunctional linker that is optionally conjugated to a C5 alkyl group. In some embodiments, the linker is a homobifunctional linker that is optionally conjugated to a C6 alkyl group.
[0176] Examples of homobifunctional linkers include, but are not limited to, Lomant's reagents dithiobis(succinimidylpropionate) DSP, 3'3'-dithiobis(sulfosuccinimidylpropionate) (DTSSP), disuccinimidylsverate (DSS), bis(sulfosuccinimidyl)sverate (BS), disuccinimidyl tartrate (DST), and disulfosuccinimidyl tartrate (sulfoDST). ), ethylene glycobis(succinimidyl succinate) (EGS), disuccinimidyl glutarate (DSG), N,N'-disuccinimidyl carbonate (DSC), dimethyl adipimidate (DMA), dimethyl pimelimidate (DMP), dimethyl spelimidate (DMS), dimethyl-3,3'-dithiobispropionimidate (DTBP), 1,4-di-3'-(2'-pyridyldithio) Examples include ropionamide)butane (DPDPB), bismaleimidehexane (BMH), aryl halide-containing compounds such as 1,5-difluoro-2,4-dinitrobenzene or 1,3-difluoro-4,6-dinitrobenzene (DFDNB), 4,4'-difluoro-3,3'-dinitrophenyl sulfone (DFDNPS), bis-[β-(4-azidosalicylamido)ethyl]disulfide (BASED), formaldehyde, glutaraldehyde, 1,4-butanediol diglycidyl ether, adipic acid dihydrazide, carbohydrazide, o-toluidine, 3,3'-dimethylbenzidine, benzidine, α,α'-p-diaminodiphenyl, diiodo-p-xylenesulfonic acid, N,N'-ethylene-bis(iodoacetamide), or N,N'-hexamethylene-bis(iodoacetamide).
[0177] In some embodiments, the linker comprises a heterobifunctional linker. In some embodiments, the heterobifunctional linker is a heterobifunctional linker that is optionally conjugated to a C1-C6 alkyl group. In some embodiments, the linker is a heterobifunctional linker that is optionally conjugated to a C1 alkyl group. In some embodiments, the linker is a heterobifunctional linker that is optionally conjugated to a C2 alkyl group. In some embodiments, the linker is a heterobifunctional linker that is optionally conjugated to a C3 alkyl group. In some embodiments, the linker is a heterobifunctional linker that is optionally conjugated to a C4 alkyl group. In some embodiments, the linker is a heterobifunctional linker that is optionally conjugated to a C5 alkyl group. In some embodiments, the linker is a heterobifunctional linker that is optionally conjugated to a C6 alkyl group.
[0178] In some embodiments, the heterobifunctional linker is succinimidyl-4-(N-maleimidomethyl)cyclohexane-1-carboxylate (sMCC) that is optionally conjugated to a C1-C6 alkyl group. In some embodiments, the heterobifunctional linker is succinimidyl-4-(N-maleimidomethyl)cyclohexane-1-carboxylate (sMCC) that is optionally conjugated to a C1 alkyl group. In some embodiments, the heterobifunctional linker is succinimidyl-4-(N-maleimidomethyl)cyclohexane-1-carboxylate (sMCC) that is optionally conjugated to a C2 alkyl group. In some embodiments, the heterobifunctional linker is succinimidyl-4-(N-maleimidomethyl)cyclohexane-1-carboxylate (sMCC) that is optionally conjugated to a C3 alkyl group. In some embodiments, the heterobifunctional linker is succinimidyl-4-(N-maleimidomethyl)cyclohexane-1-carboxylate (sMCC) optionally conjugated to a C4 alkyl group. In some embodiments, the heterobifunctional linker is succinimidyl-4-(N-maleimidomethyl)cyclohexane-1-carboxylate (sMCC) optionally conjugated to a C5 alkyl group. In some embodiments, the heterobifunctional linker is succinimidyl-4-(N-maleimidomethyl)cyclohexane-1-carboxylate (sMCC) optionally conjugated to a C6 alkyl group.
[0179] Examples of heterobifunctional linkers include, but are not limited to, amine-reactive and sulfhydryl crosslinkers such as N-succinimidyl 3-(2-pyridyldithio)propionate (sPDP), long-chain N-succinimidyl 3-(2-pyridyldithio)propionate (LC-sPDP), and water-soluble long-chain N-succinimidyl 3-(2-pyridyldithio)propionate (sulfo-LC-sPDP), succinimidyloxycarbonyl-α-methyl-α-(2-pyridyldithio)toluene (sMPT), sulfosuccinimidyl-6-[α-methyl-α-(2-pyridyldithio)toluamide]hexanoate (sulfo-LC-sMPT), succinimidyl-4-(N-maleimidomethyl)cyclohexane-1-carboxylate (sMCC), sulfosuccinimidyl-4-(N-maleimidomethyl)cyclohexane-1-carboxylate (sulfo-sMCC), m-maleimidobenzoyl-N-hydroxysuccinimid ester (MBs), m- Reimidobenzoyl-N-hydroxysulfosuccinimide ester (sulfo-MBs), N-succinimidyl (4-iodoacetyl)aminobenzoate (sIAB), sulfosuccinimidyl (4-iodoacetyl)aminobenzoate (sulfo-sIAB), succinimidyl-4-(p-maleimidophenyl)butyrate (sMPB), sulfosuccinimidyl-4-(p-maleimidophenyl)butyrate (sulfo-sMPB), N-(γ-maleimidobutyryloxy)succinimide ester (GMBs), N-(γ-maleimidobutyryloxy)sulfosuccinimide ester (sulfo-GMBs), succinimidyl6-((iodoacetyl)amino)hexanoate (sIAX), succinimidyl 6-[6-(((iodoacetyl)amino)hexanoyl)amino]hexanoate (sIAXX), succinimidyl 4-(((iodoacetyl)amino)methyl)cyclohexane-1-carboxylate (sIAC), succinimidyl 6-((((4-iodoacetyl)amino)methyl)cyclohexane-1-carbonyl)amino)hexanoate (sIACX), p-nitrophenyliodoacetate (NPIA), 4-(4-N-maleimi Carbonyl-reactive and sulfhydryl-reactive crosslinkers such as 4-(N-maleimidomethyl)cyclohexane-1-carboxyl-hydrazide-8 (M2C2H), 3-(2-pyridyldithio)propionylhydrazide (PDPH), N-hydroxysuccinimidyl-4-azidosalicylic acid (NHs-AsA), N-hydroxysulfosuccinimidyl-4-azidosalicylic acid (sulfo-NHs-AsA), sulfosuccinimidyl ru-(4-azidosalicylamide)hexanoate (sulfo-NHs-LC-AsA), sulfosuccinimidyl-2-(ρ-azidosalicylamide)ethyl-1,3'-dithiopropionate (sAsD), N-hydroxysuccinimidyl-4-azidobenzoate (HsAB), N-hydroxysulfosuccinimidyl-4-azidobenzoate (sulfo-HsAB), N-succinimidyl-6-(4'-azido-2'-nitrophenylamino)hexanoate (sANPAH), sulfosuccinimidyl-6-(4'-azido (2'-nitrophenylamino)hexanoate (sulfo-sANPAH), N-5-azido-2-nitrobenzoyloxysuccinimide (ANB-NOs), sulfosuccinimidyl-2-(m-azido-o-nitrobenzoamide)-ethyl-1,3'-dithiopropionate (sAND), N-succinimidyl-4(4-azidophenyl)1,3'-dithiopropionate (sADP), N-sulfosuccinimidyl(4-azidophenyl)-1,3'-dithiopropionate (sulfo-sADP), sulfosuccinimidylSulfhydryl-reactive and photoreactive crosslinkers such as 4-(ρ-azidophenyl)butyrate (sulfo-sAPB), sulfosuccinimidyl 2-(7-azido-4-methylcoumarin-3-acetamido)ethyl-1,3'-dithiopropionate (sAED), sulfosuccinimidyl 7-azido-4-methylcoumarin-3-acetate (sulfo-sAMCA), ρ-nitrophenyldiazopirubate (ρNPDP), ρ-nitrophenyl-2-diazo-3,3,3-trifluoropropionate (PNP-DTP), and 1-(ρ-azidosalicylamide)-4-(iodoacetamido)butane (AsIB), and N-[4-(ρ-azidosalicylamide)butyl]-3'-(2'-pyridyldithio Examples include benzophenone-4-maleimide carbonyl-reactive and photoreactive crosslinkers such as propionamide (APDP), benzophenone-4-iodoacetamide, and ρ-azidobenzoylhydrazide (ABH); carboxylate-reactive and photoreactive crosslinkers such as 4-(ρ-azidosalicylamide)butylamine (AsBA); and arginine-reactive and photoreactive crosslinkers such as ρ-azidophenylglyoxal (APG).
[0180] In some embodiments, the linkers described herein are cleavable or non-cleavable linkers. In some examples, the linker is a cleavable linker. In some examples, the linker is an acidic cleavable linker. In some examples, the linker is a non-cleavable linker; in some examples, the linker contains a C1-C6 alkyl group (e.g., C5, C4, C3, C2, or C1 alkyl group). In some examples, the linker contains a homobifunctional crosslinker, a heterobifunctional crosslinker, etc. In some examples, the linker is a traceless linker (or zero-length linker). In some examples, the linker is a non-polymeric linker. In some cases, the linker is a non-peptide linker, or a linker that does not contain amino acid residues.
[0181] In some examples, the linker contains a reactive functional group. In some cases, the reactive functional group contains a nucleophile that reacts with an electrophilic group present on the bond. Exemplary electrophiles include carbonyl groups such as aldehydes, ketones, carboxylic acids, esters, amides, enones, acyl halides, or acid anhydrides. In some embodiments, the reactive functional group is an aldehyde. Exemplary nucleophiles include hydrazides, oximes, aminos, hydrazines, thiosemicarbazones, hydrazine carboxylates, and allyl hydrazides.
[0182] In some embodiments, the linker comprises a maleimide group. In some examples, the maleimide group is also called a maleimide spacer. In some examples, the maleimide group further comprises caproic acid to form maleimidocaproyl (mc). In some cases, the linker comprises maleimidocaproyl (mc). In some cases, the linker is maleimidocaproyl (mc). In other examples, the maleimide group comprises a maleimidomethyl group such as succinimidyl-4-(N-maleimidomethyl)cyclohexane-1-carboxylate (sMCC) or sulfosuccinimidyl-4-(N-maleimidomethyl)cyclohexane-1-carboxylate (sulfo-sMCC) as described herein.
[0183] In some embodiments, the maleimide group is a self-stabilizing maleimide. In some examples, the self-stabilizing maleimide utilizes diaminopropionic acid (DPR) to incorporate a basic amino group adjacent to the maleimide to provide intramolecular catalytic activity for thiosuccinimide ring hydrolysis, thereby preventing the maleimide from undergoing elimination via the retro-Michael reaction. In some examples, the self-stabilizing maleimide is the maleimide group described in Lyon, et al., “Self-hydrolyzing maleimides improve the stability and pharmacological properties of antibody-drug conjugates,” Nat. Biotechnol. 32(10):1059-1062(2014). In some examples, the linker contains a self-stabilizing maleimide. In some examples, the linker is a self-stabilizing maleimide.
[0184] In some embodiments, the linker comprises one or more maleimide groups, peptide moieties, and / or benzoic acid groups in any combination. In some embodiments, the linker comprises a combination of maleimide groups, peptide moieties, and / or benzoic acid groups. In some examples, the maleimide group is maleimidocaproyl (mc). In some examples, the peptide group is val-cit. In some examples, the benzoic acid group is PABA. In some examples, the linker comprises an mc-val-cit group. In some cases, the linker comprises a val-cit-PABA group. In further cases, the linker comprises an mc-val-cit-PABA group.
[0185] In some embodiments, the linker is a self-destructing linker or a self-destructing linker. In some cases, the linker is a self-destructing linker. In other cases, the linker is a self-destructing linker (e.g., a cyclized self-destructing linker). In some examples, the linker includes the linkers described in U.S. Patent No. 9,089,614 or PCT Publication WO2015038426.
[0186] In some embodiments, the linker is a dendritic linker; in some examples, the dendritic linker includes a branched, polyfunctional linker moiety. In some examples, the dendritic linker is used to increase the molar ratio of the oligonucleotide to the binding moiety. In some examples, the dendritic linker includes a PAMAM dendrimer.
[0187] In some embodiments, the linker is a traceless linker, or a linker that does not leave a linker portion (e.g., an atom or linker group) on the binding portion, oligonucleotide, or conjugate after cleavage. Examples of traceless linkers, but not limited to, include germanium linkers, silicon linkers, sulfur linkers, selenium linkers, nitrogen linkers, phosphorus linkers, boron linkers, chromium linkers, or phenylhydrazide linkers. In some cases, the linker is a traceless aryl-triazene linker as described in Hejesen, et al., “A traceless aryl-triazene linker for DNA-directed chemistry,” Org Biomol Chem 11(15): 2493-2497(2013). In some cases, the linker is a traceless linker as described in Blaney, et al., “Traceless solid-phase organic synthesis,” Chem. Rev. 102: 2607-2024 (2002). In some cases, the linker is a traceless linker as described in U.S. Patent No. 6,821,783.
[0188] In some cases, the linker contains a functional group that causes steric hindrance at the bonding site between the linker and the conjugate. In some cases, the steric hindrance is around the disulfide bond. Exemplary linkers exhibiting steric hindrance include heterobifunctional linkers such as the heterobifunctional linkers described herein. In some cases, linkers exhibiting steric hindrance include SMCC and SPDB.
[0189] In some cases, the linker is an acidic, cleavable linker. In some cases, the acidic, cleavable linker contains a hydrazone bond, which is readily hydrolyzed. In some cases, the acidic, cleavable linker contains a thiomaleamic acid linker. In some cases, the acidic, cleavable linker is a thiomaleamic acid linker, such as the one described in Castaneda, et al, “Acid-cleavable thiomaleamic acid linker for homogeneous antibody-drug conjugation,” Chem. Commun. 49: 8187-8189 (2013).
[0190] In some cases, the linker is the linker described in U.S. Patent Nos. 6,884,869; 7,498,298; 8,288,352; 8,609,105; or 8,697,688; U.S. Patent Application Publication Nos. 2014 / 0127239; 2013 / 028919; 2014 / 286970; 2013 / 0309256; 2015 / 037360; or 2014 / 0294851; or PCT Publication WO2015057699; W02014080251; WO2014197854; W02014145090; or WO2014177042.
[0191] Additional conjugate portion Polymer conjugate portion In some embodiments, the oligonucleotide comprises a polymer. In some embodiments, the polymer comprises poly(ethylene glycol) (PEG). In some embodiments, the oligonucleotide comprises poly(ethylene glycol).
[0192] In some examples, the polymer portion is a natural or synthetic polymer consisting of long chains of branched or unbranched monomers and / or a crosslinked network of two-dimensional or three-dimensional monomers. In some examples, the polymer portion includes polysaccharides, lignin, rubber, or poly(alkylene oxide) (e.g., poly(ethylene glycol)). In some examples, at least one polymer portion C may be, but are not limited to, α-,ω-dihydroxyl polyethylene glycol, biodegradable lactone polymers such as polyacrylic acid, polylactic acid (PLA), poly(glycolic acid) (PGA), polypropylene, polystyrene, polyolefin, polyamide, polycyanoacrylate, polyimide, polyethylene terephthalate (PET, PETG), polyethylene terephthalate (PETE), polytetramethylene glycol (PTG), or polyurethane, as well as mixtures thereof. As used herein, mixture refers to the use of different polymers within the same compound, as well as block copolymers. In some cases, a block copolymer is a polymer in which at least one portion of the polymer is constructed from monomers of another polymer. In some examples, the polymer portion contains poly(alkylene oxide). In some examples, the polymer portion contains PEG. In some examples, the polymer portion contains poly(ethyleneimide) (PEI) or hydroxyethyl starch (HES).
[0193] In some examples, the polymer portion is the PEG portion. In some examples, the PEG portion is conjugated at the 5' end of the oligonucleotide, and the binding portion is conjugated at the 3' end of the oligonucleotide. In some examples, the PEG portion is conjugated at the 3' end of the oligonucleotide, and the binding portion is conjugated at the 5' end of the oligonucleotide. In some examples, the PEG portion is conjugated to an internal site of the oligonucleotide. In some examples, the PEG portion, the binding portion, or a combination thereof, is conjugated to an internal site of the oligonucleotide. In some examples, the conjugation is direct conjugation. In some examples, the conjugation is via natural ligation.
[0194] In some cases, the PEG moiety is conjugated at the 5' end of the oligonucleotide, and the binding moiety is conjugated at the 3' end of the oligonucleotide. In some cases, the PEG moiety is conjugated at the 3' end of the oligonucleotide, and the binding moiety is conjugated at the 5' end of the oligonucleotide. In some cases, the PEG moiety is conjugated to an internal site of the oligonucleotide. In some cases, the PEG moiety, the binding moiety, or a combination thereof, is conjugated to an internal site of the oligonucleotide. In some cases, the conjugation is direct. In some cases, the conjugation is via innate ligation.
[0195] In some embodiments, poly(alkylene oxide) (e.g., PEG) is a polydisperse or monodisperse compound. In some examples, polydisperse materials include a dispersion distribution of materials of different molecular weights, characterized by their average weight (weight-average) size and degree of dispersion. In some examples, monodisperse PEG contains molecules of one size. In some embodiments, C is a polydisperse or monodisperse poly(alkylene oxide) (e.g., PEG), and the indicated molecular weight represents the average molecular weight of poly(alkylene oxide), e.g., PEG molecules.
[0196] In some embodiments, the molecular weight of poly(alkylene oxide) (e.g., PEG) is approximately 200, 300, 400, 500, 600, 700, 800, 900, 1000, 1100, 1200, 1300, 1400, 1450, 1500, 1600, 1700, 1800, 1900, 2000, 2100, 2200, 2300, 2400, 2500, 2600, 27 The values are 00, 2800, 2900, 3000, 3250, 3350, 3500, 3750, 4000, 4250, 4500, 4600, 4750, 5000, 5500, 6000, 6500, 7000, 7500, 8000, 10,000, 12,000, 20,000, 35,000, 40,000, 50,000, 60,000, or 100,000Da.
[0197] In some embodiments, poly(alkylene oxide) (e.g., PEG) is discrete PEG, and discrete PEG is polymer PEG containing a plurality of repeating ethylene oxide units. In some examples, discrete PEG (dPEG) contains 2 to 60, 2 to 50, or 2 to 48 repeating ethylene oxide units. In some examples, dPEG contains about 2, 3, 4, 5, 6, 7, 8, 9, 10, 11, 12, 13, 14, 15, 16, 17, 18, 19, 20, 22, 24, 26, 28, 30, 35, 40, 42, 48, 50 or more repeating ethylene oxide units. In some cases, dPEG contains approximately 2, 3, 4, 5, 6, 7, 8, 9, 10, 11, 12, 13, 14, 15, 16, 17, 18, 19, 20, 21, 22, 23, 24, 25, 26, 27, 28, 29, 30, 31, 32, 33, 34, 35, 36, 37, 38, 39, 40, 42, 44, 46, 48, 50 or more repeating ethylene oxide units. In some cases, dPEG is synthesized in a stepwise manner from pure (e.g., approximately 95%, 98%, 99%, or 99.5%) starting materials as a single molecular weight compound. In some cases, dPEG has a specific molecular weight rather than an average molecular weight. In some cases, the dPEG described herein is dPEG from Quanta Biodesign, LMD.
[0198] In some cases, cMAP is further conjugated to the PEG portion to produce cMAP-PEG copolymers, mPEG-cMAP-PEGm triblock polymers, or cMAP-PEG-cMAP triblock polymers. In some cases, the PEG portion is in the range of approximately 500 Da to approximately 50,000 Da. In some cases, the PEG portion is within the range of approximately 500 Da to approximately 1000 Da, over 1000 Da to approximately 5000 Da, over 5000 Da to approximately 10,000 Da, over 10,000 to approximately 25,000 Da, over 25,000 Da to approximately 50,000 Da, or any combination of two or more of these ranges.
[0199] Endosomal lytic or transmembrane portion In some embodiments, the oligonucleotides disclosed herein are further conjugated with endosomal soluble polypeptides. In some cases, the endosomal soluble polypeptide is a pH-dependent membrane-active peptide. In some examples, the endosomal soluble polypeptide is an amphiphilic polypeptide. In further cases, the endosomal soluble polypeptide is a peptide mime. In some examples, the endosomal soluble polypeptide comprises INF, melittin, meisin, or derivatives thereof. In some examples, the endosomal soluble polypeptide comprises INF or a derivative thereof. In other cases, the endosomal soluble polypeptide comprises melittin or a derivative thereof. In further cases, the endosomal soluble polypeptide comprises meisin or a derivative thereof. In some examples, endosomal lytic polypeptides include Pep-1 (derived from the NLS of Simian virus 40 large antigen and HIV reverse transcriptase), Pvec (derived from VE-cadherin), VT5 (derived from a synthetic peptide), C105Y (derived from 1-antitrypsin), transportan (derived from galanin and mastoparan), TP10 (derived from galanin and mastoparan), MPG (derived from the hydrophobic domain of the fusion sequence of HIV gp41 and SV40 T antigen NLS), and GH625 (HSV (derived from type I glycoprotein gH), CADY (PPTG1 peptide), GALA (synthetic peptide), INF (influenza HA2 fusion peptide), HAZESTAT (influenza HA2 subunit of influenza virus X31 strain fusion peptide), HA2-Penetratin (influenza HA2 subunit of influenza virus X31 strain fusion peptide), HA-K4 (influenza HA2 subunit of influenza virus X31 strain fusion peptide), HA2E4 (influenza HA2 subunit of influenza virus X31 strain fusion peptide), H5WYG (HA2 analog), GALA-INF3-(PEG)6-NH (INF3 fusion peptide), or CM18-TAT11 (cecropin-A-melittin) 2-12 (CM 18 Contains (fusion peptide).
[0200] In some cases, the endosomal lysate portion is Bcl-2 and / or Bcl-x L These include Bak BH3 polypeptides that induce apoptosis through antagonism of suppressor targets such as [specific target names]. In some examples, the endosomal lytic portion contains the Bak BH3 polypeptide described in Albarran, et al., “Efficient intracellular delivery of a pro-apoptotic peptide with a pH-responsive carrier,” Reactive & Functional Polymers 71: 261-265 (2011).
[0201] In some cases, the endosomal lytic portion includes polypeptides described in PCT Publication WO2013 / 166155 or WO2015 / 069587 (e.g., cell-permeable polypeptides).
[0202] In some embodiments, the endosomal soluble portion is a lipid (e.g., a fusion lipid). In some embodiments, the oligonucleotide is further conjugated with the endosomal soluble lipid (e.g., a fusion lipid). Examples of fusionable lipids include 1,2-dioleoyl-sn-3-phosphoethanolamine (DOPE), phosphatidylethanolamine (POPE), palmitoyloleoylphosphatidylcholine (POPC), (6Z,9Z,28Z,31Z)-heptatriaconta-6,9,28,31-tetraen-19-ol (Di-Lin), N-methyl(2,2-di((9Z,12Z)-octadeca-9,12-dienyl)-1,3-dioxolan-4-yl)methaneamine (DLin-k-DMA), and N-methyl-2-(2,2-di((9Z,12Z)-octadeca-9,12-dienyl)-1,3-dioxolan-4-yl)ethaneamine (XTC). In some cases, the endosomal soluble portion is a lipid (e.g., a fusion lipid) as described in PCT Publication WO09 / 126,933.
[0203] In some embodiments, the endosomal soluble moiety is a small molecule. In some embodiments, an oligonucleotide is further conjugated with the endosomal soluble small molecule. Suitable exemplary small molecules as the endosomal soluble moiety include, but are not limited to, quinine, chloroquine, hydroxychloroquine, amodiaquine (camoquine), amopiroquine, primaquine, mefloquine, nivaquine, halophanthrin, quinone imines, or combinations thereof. In some cases, the quinoline endosome-soluble portion is, but is not limited to, 7-chloro-4-(4-diethylamino-1-methylbutyl-amino)quinoline (chloroquine); 7-chloro-4-(4-ethyl-(2-hydroxyethyl)-amino-1-methylbutyl-amino)quinoline (hydroxychloroquine); 7-fluoro-4-(4-diethylamino-1-methylbutyl-amino)quinoline; 4-(4-diethylamino-1-methylbutylamino)quinoline; 7-hydroxy-4-(4-diethylamino-1-methylbutylamino)quinoline; 7-chloro-4-(4-diethylamino-1-butylamino)quinoline (desmethylchloroquine); 7-fluoro-4-(4-diethylamino-1-butylamino)quinoline; 4-(4-diethylamino-1-butylamino)quinoline; 7-hydroxy-4-(4-diethylamino-1-butylamino)quinoline n; 7-chloro-4-(1-carboxy-4-diethylamino-1-butylamino)quinoline; 7-fluoro-4-(1-carboxy-4-diethylamino-1-butylamino)quinoline; 4-(1-carboxy-4-diethylamino-1-butylamino)quinoline; 7-hydroxy-4-(1-carboxy-4-diethylamino-1-butylamino)quinoline; 7-chloro-4-(1-carboxy-4-diethylamino-1-methylbutylamino)quinoline; 7-fluoro-4-(1-carboxy-4-diethylamino-1-methylbutylamino)quinoline; 4-(1-carboxy-4-diethylamino-1-methylbutylamino)quinoline; 7-hydroxy-4-(1-carboxy-4-diethylamino-1-methylbutylamino)quinoline; 7-fluoro-4-(4-ethyl-(2-hydroxyethyl)-amino-1-methylbutylamino)quinoline;4-(4-ethyl-(2-hydroxyethyl)-amino-1-methylbutylamino-)quinoline; 7-hydroxy-4-(4-ethyl-(2-hydroxyethyl)-amino-1-methylbutylamino)quinoline; hydroxychloroquine phosphate; 7-chloro-4-(4-ethyl-(2-hydroxyethyl-1)-amino-1-butylamino)quinoline (desmethylhydroxychloroquine); 7-fluoro-4-(4-ethyl-(2-hydroxyethyl)-amino-1-butylamino)quinoline; 4-(4-ethyl 7-(2-hydroxyethyl)-amino-1-butylamino)quinoline; 7-hydroxy-4-(4-ethyl-(2-hydroxyethyl)-amino-1-butylamino)quinoline; 7-chloro-4-(1-carboxy-4-ethyl-(2-hydroxyethyl)-amino-1-butylamino)quinoline; 7-fluoro-4-(1-carboxy-4-ethyl-(2-hydroxyethyl)-amino-1-butylamino)quinoline; 4-(1-carboxy-4-ethyl-(2-hydroxyethyl)-amino-1-butylamino) Quinoline; 7-Hydroxy-4-(1-Carboxy-4-ethyl-(2-hydroxyethylamino-1-butylamino)quinoline; 7-Chloro-4-(1-Carboxy-4-ethyl-(2-hydroxyethyl)-amino-1-methylbutylamino)quinoline; 7-Fluoro-4-(1-Carboxy-4-ethyl-(2-hydroxyethyl)-amino-1-methylbutylamino)quinoline; 4-(1-Carboxy-4-ethyl-(2-hydroxyethyl)-amino-1-methylbutylamino)quinoline; 7-Hydroxy- 4-(1-carboxy-4-ethyl-(2-hydroxyethyl)-amino-1-methylbutylamino)quinoline; 8-[(4-aminopentyl)amino-6-methoxydihydrochloridequinoline; 1-acetyl-1,2,3,4-tetrahydroquinoline; 8-[(4-aminopentyl)amino]-6-methoxyquinoline dihydrochloride; 1-butyryl-1,2,3,4-tetrahydroquinoline; 3-chloro-4-(4-hydroxy-α,α'-bis(2-methyl-1-pyrrolidinyl)-2,5-xylidinoquinoline, 4-[(4-diethyl-amino)-1-methylbutyl-amino]-6-methoxyquinoline;Examples include 3-fluoro-4-(4-hydroxy-α,α'-bis(2-methyl-1-pyrrolidinyl)-2,5-xylidinoquinoline, 4-[(4-diethylamino)-1-methylbutyl-amino]-6-methoxyquinoline; 4-(4-hydroxy-α,α'-bis(2-methyl-1-pyrrolidinyl)-2,5-xylidinoquinoline; 4-[(4-diethylamino)-1-methylbutyl-amino]-6-methoxyquinoline; 3,4-dihydro-1-(2H)-quinoline carboxyaldehyde; 1,1'-pentamethylenediquinolinium diiode; 8-quinolinol sulfate and amino, aldehyde, carvone, hydroxyl, halogen, keto, sulfhydryl and vinyl derivatives or analogs. In some examples, the endosomal soluble portion is Naisbitt et al (1997, J Pharmacol Exp Therapy). It is a small molecule described in U.S. Patent No. 280:884-893 and U.S. Patent No. 5,736,557.
[0204] In some embodiments, the cell-permeable polypeptide comprises a short, positively charged peptide having 5–30 amino acids. In some embodiments, the cell-permeable polypeptide comprises an amino acid sequence rich in arginine or lysine. In some embodiments, the cell-permeable polypeptide comprises any polypeptide or combination thereof, including Antennapedia penetratin (43–58), HIV-1 TAT protein (48–60), pVEC cadherin (615–632), transportan galanine / mastoparan, MPG HIV-gp41 / SV40 T antigen, Pep-1 HIV-reverse transcriptase / SV40 T antigen, polyarginine, MAP, R6W3, NLS, 8-lysine, ARF (1–22), and azurin-p28.
[0205] method In some embodiments, compositions or pharmaceutical formulations described herein, comprising a conjugate or oligonucleotide described herein, are used for the treatment of or to improve the treatment of a disease or disorder by increasing the stability and / or half-life of the oligonucleotide drug molecule.
[0206] In another embodiment, a method for treating a subject having a disease or illness characterized by protein expression deficiency and / or protein overexpression is disclosed herein, comprising administering oligonucleotides disclosed herein to the subject to modulate the expression of a protein-coding gene, thereby treating the disease or illness characterized by protein expression deficiency and / or protein overexpression.
[0207] In another embodiment, a method for treating a subject having a disease or illness characterized by protein expression deficiency and / or protein overexpression is disclosed herein, comprising administering a conjugate disclosed herein to the subject to modulate the expression of a protein-coding gene, thereby treating the disease or illness characterized by protein expression deficiency and / or protein overexpression.
[0208] In another embodiment, a method for reducing the mRNA level of a gene in a subject by administering a conjugate disclosed herein is disclosed herein.
[0209] In another embodiment, a method for regulating the mRNA expression level of a gene in a subject is disclosed herein, comprising the steps of providing a conjugate described herein and administering the conjugate to a subject, wherein the conjugate reduces the mRNA expression level of the gene in the subject. In some embodiments, the gene is MSTN or SSB.
[0210] In another embodiment, a method for treating myotonic dystrophy in a subject requiring treatment of myotonic dystrophy is disclosed herein, comprising the steps of providing a conjugate described herein and administering the conjugate to the subject, wherein the conjugate mediates RNA interference with a target mRNA in the subject, thereby treating the subject's muscle atrophy or myotonic dystrophy. In some embodiments, the target mRNA is MSTN mRNA or SSB mRNA.
[0211] In some embodiments, the conjugate reduces the gene expression level by at least approximately 20%, 25%, 30%, 35%, 40%, 45%, 50%, 55%, 60%, 65%, 70%, 75%, 80%, 85%, 90%, or 95% compared to the control sample.
[0212] In some embodiments, the conjugate has an increased plasma half-life compared to similar conjugates containing phosphorothioate internucleotide bonds replaced at the positions of modified internucleotide bonds of formula (II), (III), (IV), or (V).
[0213] In another embodiment, a method for increasing the plasma level of a subject by administering the subject to a conjugate disclosed herein is disclosed herein.
[0214] The disease or illness is a neuromuscular disease, muscular dystrophy, muscle atrophy, muscle wasting, hereditary disease, cancer, or cardiovascular disease. In some embodiments, the disease or illness is a neuromuscular disease. In some embodiments, the disease or illness is a muscular dystrophy. In some embodiments, the disease or illness is muscle atrophy. In some embodiments, the disease or illness is muscle wasting. In some embodiments, the disease or illness is a hereditary disease. In some embodiments, the disease or illness is cancer. In some embodiments, the disease or illness is a hereditary disease. In some embodiments, the disease or illness is a cardiovascular disease. In some embodiments, the composition or pharmaceutical preparation described herein is used as an immunotherapy for the treatment of a disease or disorder. In some examples, the immunotherapy is an immuno-oncology therapy.
[0215] In some cases, the subject is a human being.
[0216] Pharmaceutical preparations In some embodiments, pharmaceutical formulations comprising the conjugates or oligonucleotides disclosed herein for therapeutic use are provided herein. In some embodiments, pharmaceutical formulations comprising the conjugates or oligonucleotides disclosed herein for the treatment of cancer are provided herein. In some embodiments, the pharmaceutical formulations described herein are administered to a target by many routes of administration, including, but not limited to, parenteral (e.g., intravenous, subcutaneous, and intramuscular), oral, intranasal, buccal, rectal, or transdermal routes of administration. In some examples, the pharmaceutical compositions described herein are formulated for parenteral (e.g., intravenous, subcutaneous, and intramuscular) administration. In other examples, the pharmaceutical compositions described herein are formulated for oral administration. In yet another example, the pharmaceutical compositions described herein are formulated for intranasal administration.
[0217] In some embodiments, pharmaceutical formulations include, but are not limited to, aqueous liquid dispersants, self-emulsifying dispersants, solid solutions, liposome dispersants, aerosols, solid dosage forms, powders, immediate-release formulations, controlled-release formulations, rapid-release formulations, tablets, capsules, pills, delayed-release formulations, extended-release formulations, pulsed-release formulations, multi-particle formulations (e.g., nanoparticle formulations), and immediate- and controlled-release mixed formulations.
[0218] In some examples, the pharmaceutical formulation includes multi-particle formulations. In some examples, the pharmaceutical formulation includes nanoparticle formulations. In some examples, the nanoparticles include cMAP, cyclodextrin, or lipids. Depending on the case, the nanoparticles include solid lipid nanoparticles, polymer nanoparticles, self-emulsifying nanoparticles, liposomes, microemulsions, or micelle solutions. Further exemplary nanoparticles include, but are not limited to, paramagnetic nanoparticles, superparamagnetic nanoparticles, metallic nanoparticles, fullerene-like materials, inorganic nanotubes, dendrimers (such as those having covalently bonded metal chelates), nanofibers, nanohorns, nanoonions, nanorods, nanoropes, and quantum dots. In some examples, nanoparticles are metallic nanoparticles, such as scandium, titanium, vanadium, chromium, manganese, iron, cobalt, nickel, copper, zinc, yttrium, zirconium, niobium, molybdenum, ruthenium, rhodium, palladium, silver, cadmium, hafnium, tantalum, tungsten, rhenium, osmium, iridium, platinum, gold, gadolinium, aluminum, gallium, indium, tin, thallium, lead, bismuth, magnesium, calcium, strontium, barium, lithium, sodium, potassium, boron, silicon, phosphorus, germanium, arsenic, antimony, and combinations, alloys, or oxides thereof.
[0219] In some examples, nanoparticles include a core or a core and a shell, as in core-shell nanoparticles.
[0220] In some cases, the nanoparticles are further coated with molecules for the attachment of functional elements (e.g., having one or more oligonucleotides, or having one or more oligonucleotides or binding sites as described herein). In some cases, the coating includes chondroitin sulfate, dextran sulfate, carboxymethyl dextran, alginic acid, pectin, carrageenan, fucoidan, agaropectin, porphyran, karaya gum, gellan gum, xanthan gum, hyaluronic acid, glucosamine, galactosamine, chitin (or chitosan), polyglutamic acid, polyaspartic acid, lysozyme, cytochrome C, ribonuclease, trypsinogen, chymotrypsinogen, α-chymotrypsin, polylysine, polyarginine, histone, protamine, ovalbumin, dextrin, or cyclodextrin. In some cases, the nanoparticles include graphene-coated nanoparticles.
[0221] In some cases, the nanoparticles have at least one dimension of less than approximately 500 nm, less than 400 nm, less than 300 nm, less than 200 nm, or less than 100 nm.
[0222] In some examples, nanoparticle formulations include paramagnetic nanoparticles, superparamagnetic nanoparticles, metallic nanoparticles, fullerene-like materials, inorganic nanotubes, dendrimers (such as those having covalently bonded metal chelates), nanofibers, nanohorns, nanoonions, nanorods, nanoropes, or quantum dots. In some examples, conjugates or oligonucleotides containing the binding moieties described herein are directly or indirectly conjugated to nanoparticles. In some examples, at least 1, 5, 10, 15, 20, 30, 40, 50, 60, 70, 80, 90, 100, or more conjugates or oligonucleotides containing the binding moieties described herein are directly or indirectly conjugated to nanoparticles.
[0223] In some embodiments, the pharmaceutical formulation includes a carrier or carrier material selected based on its compatibility with the compositions disclosed herein and the release profile characteristics of the desired dosage form. Exemplary carrier materials include, for example, binders, suspending agents, disintegrants, fillers, surfactants, solubilizers, stabilizers, lubricants, humectants, and diluents. Examples of pharmaceutically compatible carrier materials include, but are not limited to, acacia, gelatin, colloidal silicon dioxide, calcium glycerophosphate, calcium lactate, maltodextrin, glycerin, magnesium silicate, polyvinylpyrrolidone (PVP), cholesterol, cholesterol esters, sodium caseinate, soy lecithin, taurocholic acid, phosphatidylcholine, sodium chloride, calcium triphosphate, dipotassium phosphate, cellulose and cellulose conjugates, sugars, sodium stearoyl lactate, carrageenan, monoglycerides, diglycerides, and pregelatinized starch. For example, see Remington: The Science and Practice of Pharmacy, Nineteenth Ed (Easton, Pa.: Mack Publishing Company, 1995); Hoover, John E., Remington's Pharmaceutical Sciences, Mack Publishing Co., Easton, Pennsylvania 1975; Liberman, HA and Lachman, L., Eds., Pharmaceutical Dosage Forms, Marcel Decker, New York, NY, 1980; and Pharmaceutical Dosage Forms and Drug Delivery Systems, Seventh Ed. (Lippincott Williams & Wilkins 1999).
[0224] In some examples, pharmaceutical formulations further include pH adjusters or buffers, such as acids including acetic acid, boric acid, citric acid, lactic acid, phosphoric acid, and hydrochloric acid; bases including sodium hydroxide, sodium phosphate, borax, sodium citrate, sodium acetate, sodium lactate, and tris-hydroxymethylaminomethane; and buffers including citrate / dextrose, sodium bicarbonate, and ammonium chloride. Such acids, bases, and buffers are included in amounts necessary to maintain the pH of the composition within an acceptable range.
[0225] In some examples, a pharmaceutical formulation contains one or more salts in amounts necessary to bring the molar osmotic concentration of the composition within an acceptable range. Such salts include those having sodium, potassium, or ammonium cations, as well as chloride, citrate, ascorbate, borate, phosphate, bicarbonate, sulfate, thiosulfate, or bisulfite anions. Suitable salts include sodium chloride, potassium chloride, sodium thiosulfate, sodium bisulfite, and ammonium sulfate.
[0226] In some examples, pharmaceutical formulations further include diluents used to stabilize the compound, as they can provide a more stable environment. Salts dissolved in buffers (which may result in pH control or maintenance) are used as diluents in the art, but are not limited to phosphate-buffered saline solutions. In certain examples, the diluent increases the size of the composition to facilitate compression or to create a sufficient bulk for homogeneous mixing for capsule filling. Examples of such compounds include: lactose, starch, mannitol, sorbitol, dextrose, microcrystalline cellulose such as Avicel®; calcium hydrogen phosphate, calcium phosphate dihydrate; tricalcium phosphate, calcium phosphate; anhydrous lactose, spray-dried lactose; pregelatinized starch, compressible sugars such as Di-Pac® (Amstar); mannitol, hydroxypropyl methylcellulose, hydroxypropyl methylcellulose acetate stearate, sucrose-based diluents, powdered sugar; mononucleotide calcium sulfate monohydrate, calcium sulfate dihydrate; calcium lactate trihydrate, dextrates; hydrolyzed cereal solids, amylose; powdered cellulose, calcium carbonate; glycine, kaolin; mannitol, sodium chloride; inositol, bentonite, and the like.
[0227] In some cases, pharmaceutical formulations contain disintegrants or disintegrants to promote the breakdown or disintegration of a substance. The term “breaks down” includes both dissolution and dispersion of the dosage form upon contact with gastrointestinal fluid. Examples of disintegrants include starches such as natural starches like corn starch or potato starch, National 1551 or Amijel®, or pregelatinized starch, sodium starch glycolate such as Promogel® or Explotab®, wood products, cellulose such as methyl crystalline cellulose, e.g., Avicel®, Avicel® PH101, Avicel® PH102, Avicel® PH105, Elcema® P100, Emcocel®, Vivacel®, Ming Tia® and Solka-Floc®, methylcellulose, croscarmellose, or cross-linked sodium carboxymethylcellulose (Ac-Di-Sol®), cross-linked cellulose such as cross-linked carboxymethylcellulose or cross-linked croscarmellose, cross-linked starch such as sodium starch glycolate, cross-linked polymer such as crospovidone, cross-linked polyvinylpyrrolidone, alginates such as alginic acid or alginates such as sodium alginate, clay such as Veegum® HV (magnesium aluminum silicate), agar, guar, locust bean, karaya, pectin, or tragacanth, rubber such as sodium starch glycolate, bentonite, natural sponge, surfactants, resins such as cation exchange resins. Citrus pulp, sodium lauryl sulfate, sodium lauryl sulfate in combined starch are also examples.
[0228] In some examples, pharmaceutical formulations contain fillers such as lactose, calcium carbonate, calcium phosphate, dicalcium phosphate, calcium sulfate, microcrystalline cellulose, cellulose powder, dextrose, dextrate, dextran, starch, pregelatinized starch, sucrose, xylitol, lactitol, mannitol, sorbitol, sodium chloride, and poly(ethylene glycol).
[0229] Lubricants and flow promoters may also be optionally included in the pharmaceutical formulations described herein to prevent, reduce, or inhibit adhesion or friction between materials. Examples of lubricants include hydrocarbons such as sucrose, stearic acid, calcium hydroxide, talc, sodium stearyl fumarate, and mineral oil; hydrogenated vegetable oils such as hydrogenated soybean oil (Sterotex®); higher fatty acids; and alkali metal and alkaline earth metal salts such as aluminum, calcium, magnesium, zinc, stearic acid, sodium stearate, glycerol, talc, wax, Stearowet®, boric acid, sodium benzoate, sodium acetate, sodium chloride, leucine, poly(ethylene glycol) (e.g., PEG-4000) or methoxypoly(ethylene glycol), such as Carbowax®, sodium oleate, sodium benzoate, glyceryl behenate, polyethylene glycol, magnesium lauryl sulfate or sodium lauryl sulfate, colloidal silica such as Syloid®, Cab-O-Sil®, starches such as corn starch, silicone oils, and surfactants.
[0230] Plasticizers include compounds used to reduce the brittleness of microencapsulated materials or film coatings by softening them. Suitable plasticizers include, for example, poly(ethylene glycol) such as PEG300, PEG400, PEG600, PEG1450, PEG3350, and PEG800, as well as stearic acid, propylene glycol, oleic acid, triethylcellulose, and triacetin. Plasticizers can also function as dispersants or wetting agents.
[0231] Examples of solubilizing agents include compounds such as triacetin, triethyl citrate, ethyl oleate, ethyl caprylate, sodium lauryl sulfate, sodium doxate, vitamin E TPGS, dimethylacetamide, N-methylpyrrolidone, N-hydroxyethylpyrrolidone, polyvinylpyrrolidone, hydroxypropyl methylcellulose, hydroxypropyl cyclodextrin, ethanol, n-butanol, isopropyl alcohol, cholesterol, bile salts, poly(ethylene glycol) 200-600, glycoflor, transktol, propylene glycol, and dimethyl isosorbide.
[0232] Examples of stabilizers include various compounds such as antioxidants, buffers, acids, and preservatives.
[0233] The suspending agent is polyvinylpyrrolidone (e.g., polyvinylpyrrolidone K12, polyvinylpyrrolidone K17, polyvinylpyrrolidone K25, or polyvinylpyrrolidone K30), vinylpyrrolidone / vinyl acetate copolymer (S630), poly(ethylene glycol), for example, poly(ethylene glycol) can have a molecular weight of about 300 to about 6000, about 3350 to about 4000, or about 7000 to about 5400, sodium carboxymethylcellulose, methylcellulose, hydroxypropyl methylcellulose, hydroxymethylcellulose acetate stearate, poly(I) Examples of compounds include Rubate 80, hydroxyethylcellulose, sodium alginate, rubber (e.g., tragacanth rubber, acacia rubber, guar rubber, xanthan gum, etc.), sugar, cellulose compounds (e.g., sodium carboxymethylcellulose, methylcellulose, sodium carboxymethylcellulose, hydroxypropyl methylcellulose, hydroxymethylcellulose, etc.), polysorbate-80, sodium alginate, polyoxyethylene hydrogenated sorbitan monolauric acid, polyoxyethylene hydrogenated sorbitan monolauric acid, and povidone.
[0234] Examples of surfactants include sodium lauryl sulfate, sodium doxate, Tween 60 or 80, triacetin, vitamin E TPGS, sorbitan monooleate, polyoxyethylene sorbitan monooleate, polysorbate, polaxomer, bile salts, glyceryl monostearate, copolymers of ethylene oxide and propylene oxide, such as Pluronic® (BASF). Further surfactants include polyoxyethylene fatty acid glycerides and vegetable oils (e.g., polyoxyethylene (60) hydrogenated castor oil); and polyoxyethylene alkyl ethers and alkylphenyl ethers, such as octoxynol 10 and octoxynol 40. Sometimes, surfactants are included to enhance physical stability or for other purposes.
[0235] Examples of viscosity enhancers include methylcellulose, xanthan gum, carboxymethylcellulose, hydroxypropylcellulose, hydroxypropylmethylcellulose, hydroxypropylmethylcellulose acetate stealtholate, hydroxypropylmethylcellulose phthalate, carbomer, polyvinyl alcohol, alginate, acacia, chitosan, and combinations thereof.
[0236] Examples of humectants include compounds such as oleic acid, glyceryl monostearate, sorbitan monooleate, sorbitan monolaurate, triethanolamine oleate, polyoxyethylene sorbitan monooleate, polyoxyethylene sorbitan monolaurate, sodium doxate, sodium oleate, sodium lauryl sulfate, sodium doxate, triacetin, Tween 80, vitamin E TPGS, and ammonium salts.
[0237] Kit / Product In some embodiments, kits and products to be used with one or more compositions and methods described herein are disclosed herein. In some embodiments, kits of conjugates disclosed herein are disclosed herein. In some embodiments, kits of oligonucleotides disclosed herein are disclosed herein. Such kits include partitioned transport devices, packaging, or containers to house one or more containers such as vials, tubes, etc., each container comprising one of the partitioned elements for using the methods described herein. Suitable containers include, for example, bottles, vials, syringes, and test tubes. In other embodiments, the containers are formed from a variety of materials such as glass or plastic.
[0238] Products provided herein include packaging materials. Examples of pharmaceutical packaging materials include, but are not limited to, blister packs, bottles, tubes, bags, containers, bottles, and any packaging materials suitable for the selected formulation and the intended mode of administration and treatment.
[0239] For example, the container includes a conjugate, as disclosed herein. In another example, the container includes an oligonucleotide, as disclosed herein. Such kits optionally include an identification statement or label, or instructions for use in the manner described herein.
[0240] A kit typically includes a label listing the contents and / or instructions for use, and accompanying documentation for the instructions for use. A set of instructions will also typically be included.
[0241] In some examples, the label is on or attached to the container. In one embodiment, the label is considered on the container if the letters, numbers, or other symbols forming the label are attached to, molded into, or engraved on the container itself. The label is attached to the container if it is located, for example, within a receptacle or carrier that holds the container as an accompanying document. In one embodiment, the label is used to indicate that the contents are to be used for a particular therapeutic purpose. The label may also be used to indicate instructions for using the contents in the methods described herein.
[0242] In one embodiment, the pharmaceutical composition is provided in a pack or dispenser device containing one or more unit dosage forms comprising the compounds provided herein. The pack includes, for example, metal or plastic foil such as a blister pack. In a further embodiment, the pack or dispenser device is accompanied by instructions for administration. In another embodiment, the pack or dispenser is accompanied by a notice attached to a container in a form specified by a government agency that controls the manufacture, use or sale of pharmaceuticals, the notice reflecting the government agency's approval of the form of the drug for administration to humans or animals. In embodiments, such a notice is, for example, a label approved by the U.S. Food and Drug Administration with respect to the insertion of a prescription drug or approved product. In one embodiment, a composition comprising the compounds provided herein, formulated using a suitable pharmaceutical carrier, is prepared, placed in a suitable container, and labeled for the treatment of an indicated disease.
[0243] Specific terms Unless otherwise specified, all technical and scientific terms used herein have the same meaning as those generally understood by those skilled in the art in the subject matter. It will be understood that the above general statements and the following detailed statements are typical and descriptive and not limited to any subject matter. In this application, the use of singular forms includes plural forms unless otherwise specified. It should be noted that, as used herein and in the appended claims, the singular forms "a," "an," and "the" include multiple references unless otherwise explicitly indicated. In this application, the use of "or" means "and / or" unless otherwise specified. Furthermore, the use of the term "including" is not limited to other forms such as "include," "includes," and "included."
[0244] As used herein, ranges and quantities can be expressed as "approximately" a specific value or range. "Approximately" also includes exact quantities. Therefore, "approximately 5 μL" means "approximately 5 μL" and "5 μL". Generally, the term "approximately" includes quantities that are expected to be within experimental error.
[0245] Section headings used herein are provided solely for structural purposes and should not be construed as limiting the inventive features described herein.
[0246] As used herein, the terms “individual,” “subject,” and “patient” mean any mammal. In some aspects, mammals are humans. In some aspects, mammals are non-human animals. No term is limited to situations characterized by supervision (e.g., constant or intermittent) of a healthcare worker (e.g., physician, registered nurse, clinical nurse, physician’s assistant, nursing assistant, or hospice staff).
[0247] chemical definition The abbreviations used herein have their own conventional meanings in the fields of chemistry and biology. The chemical structures and formulas described herein are constructed according to the standard rules of chemical bond valency known in the field of chemistry.
[0248] When substituents are identified by their conventional chemical formulas and written from left to right, these equally encompass chemically identical substituents resulting from writing structures from right to left; for example, -CH2O- is equivalent to OCH2-.
[0249] The term "alkyl," unless otherwise specified, means a linear (i.e., unbranched) or branched carbon chain (or carbon) or combination thereof, either by itself or as part of another substituent, which can be fully saturated, monounsaturated, and polyunsaturated, and may include monovalent, divalent, and polyvalent radicals having a specified number of carbon atoms (i.e., C1-C1). 10 (where n means 1 to 10 carbon atoms). Alkyls are uncyclized chains. Examples of saturated hydrocarbon radicals include, but are not limited to, groups such as methyl, ethyl, n-propyl, isopropyl, n-butyl, t-butyl, iso-butyl, sec-butyl, (cyclohexyl)methyl, and congeners and isomers such as n-pentyl, n-hexyl, n-heptyl, n-octyl, etc. Unsaturated alkyl groups are those having one or more double or triple bonds. Examples of unsaturated alkyl groups include, but are not limited to, vinyl, 2-propenyl, clotyl, 2-isopentenyl, 2-(butadienyl), 2,4-pentadienyl, 3-(1,4-pentadienyl), ethynyl, 1- and 3-propynyl, 3-butynyl, and more advanced congeners and isomers. Alkoxys are alkyls that are bonded to the remainder of the molecule via an oxygen linker (-O-).
[0250] The term “alkylene” means, unless otherwise specified, a divalent radical derived from an alkyl group, either by itself or as part of another substituent, such as, but not limited to, -CH2CH2CH2CH2-. Typically, alkyl (or alkylene) groups have 1 to 24 carbon atoms, and such groups, preferably as herein, have 10 or fewer carbon atoms. “Lower alkyl” or “lower alkylene” refers to a short-chain alkyl or alkylene group, usually having 8 or fewer carbon atoms. The term “alkenylene” means, unless otherwise specified, a divalent radical derived from an alkene, either by itself or as part of another substituent.
[0251] The term "heteroalkyl" means, unless otherwise specified, a stable linear or branched chain, or a combination thereof, either by itself or in combination with other substituents, comprising at least one carbon atom and at least one heteroatom (e.g., O, N, P, Si, and S), where the nitrogen and sulfur atoms are optionally oxidized, and the nitrogen heteroatom may optionally be quaternized. The heteroatom (e.g., N, S, Si, or P) may be located at any internal position of the heteroalkyl group or at a position where the alkyl group is bonded to the remainder of the molecule. A heteroalkyl group is an uncylated chain. Examples include, but are not limited to, -CH2-CH2-O-CH3, -CH2-CH2-NH-CH3, -CH2-CH2-N(CH3)-CH3, -CH2-S-CH2-CH3, -CH2-CH2, -S(O)-CH3, -CH2-CH2-S(O)2-CH3, -CH=CH-O-CH3, -Si(CH3)3, -CH2-CH=N-OCH3, -CH=CH-N(CH3)-CH3, -O-CH3, -O-CH2-CH3, and -CN. For example, as in -CH2-NH-OCH3 and -CH2-O-Si(CH3)3, there may be up to two or three heteroatoms in a row. The heteroalkyl portion may contain one heteroatom (e.g., O, N, S, Si, or P). The heteroalkyl moiety may contain two optionally distinct heteroatoms (e.g., O, N, S, Si, or P). The heteroalkyl moiety may contain three optionally distinct heteroatoms (e.g., O, N, S, Si, or P). The heteroalkyl moiety may contain four optionally distinct heteroatoms (e.g., O, N, S, Si, or P). The heteroalkyl moiety may contain five optionally distinct heteroatoms (e.g., O, N, S, Si, or P). The heteroalkyl moiety may contain up to eight optionally distinct heteroatoms (e.g., O, N, S, Si, or P).
[0252] Similarly, the term “heteroalkylene,” when used alone or as part of other substituents, means a divalent group derived from a heteroalkyl group unless otherwise specified, as exemplified by -CH2-CH2-S-CH2-CH2- and -CH2-S-CH2-CH2-NH-CH2-. For heteroalkylene groups, the heteroatom can also occupy one or both of the chain ends (e.g., alkyleneoxy, alkylenedioxy, alkyleneamino, alkylenediamino, etc.). Furthermore, for alkylene and heteroalkylene linking groups, the orientation of the linking group is not indicated by the direction in which the formula of the linking group is written. For example, the formula -C(O)2R'- represents both -C(O)2R'- and -R'C(O)2-. As stated above, heteroalkyl groups as used herein include groups bonded to the remainder of the molecule via heteroatoms, such as -C(O)R', -C(O)NR', -NR'R'', -OR', -SR', and / or -SO2R'. When "heteroalkyl" is enumerated after a list of specific heteroalkyl groups such as -NR'R'', it is understood that the terms heteroalkyl and -NR'R'' are not redundant or mutually exclusive. Rather, specific heteroalkyl groups are enumerated for clarity. Therefore, the term "heteroalkyl" should not be interpreted herein except as referring to specific heteroalkyl groups such as -NR'R''.
[0253] The terms "cycloalkyl" and "heterocycloalkyl," by themselves or in combination with other terms, mean the cyclic versions of "alkyl" and "heteroalkyl," respectively, unless otherwise specified. Cycloalkyls and heterocycloalkyls are not aromatic. In addition, for heterocycloalkyls, the heteroatom can occupy a position where the heterocycle is bonded to the remainder of the molecule. Examples of cycloalkyls include, but are not limited to, cyclopropyl, cyclobutyl, cyclopentyl, cyclohexyl, 1-cyclohexenyl, 3-cyclohexenyl, and cycloheptyl. Examples of heterocycloalkyls include, but are not limited to, 1-(1,2,5,6-tetrahydropyridyl), 1-piperidinyl, 2-piperidinyl, 3-piperidinyl, 4-morpholinyl, 3-morpholinyl, tetrahydrofuran-2-yl, tetrahydrofuran-3-yl, tetrahydrothien-2-yl, tetrahydrothien-3-yl, 1-piperazinyl, and 2-piperazinyl. "Cycloalkylene" and "heterocycloalkylene" refer to divalent radicals derived from cycloalkyl and heterocycloalkyl, respectively, either alone or as part of another substituent. "Cycloalkyl" is also intended to refer to bicyclic and polycyclic hydrocarbon rings, such as bicyclo[2.2.1]heptane and bicyclo[2.2.2]octane.
[0254] The terms "halo" or "halogen" mean, unless otherwise specified, atoms of fluorine, chlorine, bromine, or iodine, either by themselves or as part of another substituent. In addition, terms such as "haloalkyl" are intended to include monohaloalkyl and polyhaloalkyl. For example, the term "halo(C1-C4)alkyl" includes, but is not limited to, fluoromethyl, difluoromethyl, trifluoromethyl, 2,2,2-trifluoroethyl, 4-chlorobutyl, and 3-bromopropyl.
[0255] The term "acyl" is -C(O)R unless otherwise specified, where R is a substituted or unsubstituted alkyl, a substituted or unsubstituted cycloalkyl, a substituted or unsubstituted heteroalkyl, a substituted or unsubstituted heterocycloalkyl, a substituted or unsubstituted aryl, or a substituted or unsubstituted heteroaryl.
[0256] The term "aryl," unless otherwise specified, means a substituent of a polyunsaturated, aromatic hydrocarbon, which may be one or more rings (preferably one to three rings) that are fused together (i.e., a fused ring aryl) or covalently bonded. A fused ring aryl refers to multiple rings fused together, where at least one of the fused rings is an aryl group. The term "heteroaryl" refers to an aryl group (or ring) containing at least one heteroatom such as N, O, or S, where the nitrogen and sulfur atoms are optionally oxidized, and the nitrogen atom is optionally quaternized. Thus, the term "heteroaryl" includes a fused ring heteroaryl group (i.e., multiple rings fused together, where at least one of the fused rings is an aromatic heterocycle). A 5,6-fused ring heteroarylene refers to two rings fused together, where one ring has 5 members and the other ring has 6 members, and at least one of the rings is a heteroaryl ring. Similarly, a 6,6-fusion ring heteroarylene refers to two fused rings, one having 6 members and the other having 6 members, with at least one ring being a heteroaryl ring. A 6,5-fusion ring heteroarylene also refers to two fused rings, one having 6 members and the other having 5 members, with at least one ring being a heteroaryl ring. Heteroaryl groups can be bonded to the remainder of the molecule via carbon or heteroatoms.Non-restrictive examples of aryl and heteroaryl groups include phenyl, naphthyl, pyrrolyl, pyrazolyl, pyridadinyl, triazinyl, pyrimidinyl, imidazolyl, pyrazinyl, prinyl, oxazolyl, isoxazolyl, thiazolyl, furyl, thienyl, pyridyl, pyrimidinyl, benzothiazolyl, benzoxazolyl, benzimidazolyl, benzofuran, isobenzofuranyl, indolyl, isoindolyl, benzothiophenyl, isoquinolyl, quinoxalinyl, quinolyl, 1-naphthyl, 2-naphthyl, 4-biphenyl, 1-pyrrolyl, 2-pyrrolyl, 3-pyrrolyl, 3-pyrzolyl, 3-pyrazolyl, 2-imidazolyl This includes lyl, 4-imidazolyl, pyrazinyl, 2-oxazolyl, 4-oxazolyl, 2-phenyl-4-oxazolyl, 5-oxazolyl, 3-isoxazolyl, 4-isoxazolyl, 5-isoxazolyl, 2-thiazolyl, 4-thiazolyl, 5-thiazolyl, 2-furyl, 3-furyl, 2-thienyl, 3-thienyl, 2-pyridyl, 3-pyridyl, 4-pyridyl, 2-pyrimidinyl, 4-pyrimidinyl, 5-benzothiazolyl, purinyl, 2-benzimidazolyl, 5-indolyl, 1-isoquinolyl, 5-isoquinolyl, 2-quinoxalinyl, 5-quinoxalinyl, 3-quinolyl, and 6-quinolyl. The substituents for each of the above-mentioned aryl and heteroaryl ring systems are selected from the group of acceptable substituents listed below. "Arylene" and "heteroarylene" refer to divalent radicals derived from aryl and heteroaryl groups, respectively, either individually or as part of another substituent. The substituent on the heteroaryl group may be an -O- bonded to a ring heteroatom nitrogen.
[0257] A spiroring is a ring consisting of two or more rings that are bonded together by one atom. The individual rings within a spiroring may be identical or different. The individual rings within a spiroring may be substituted or unsubstituted and may have different substituents than the other individual rings within a set of spirorings. Possible substituents for individual rings within a spiroring are the same substituents for the same ring if they are not part of the spiroring (e.g., substituents for cycloalkyl rings or heterocycloalkyl rings). A spiroring may be a substituted or unsubstituted cycloalkyl, a substituted or unsubstituted cycloalkylene, a substituted or unsubstituted heterocycloalkylene, or a substituted or unsubstituted heterocycloalkylene, and the individual rings within a spiroring may be any of the rings in the preceding list, including all rings of one type (e.g., all rings are substituted heterocycloalkylenes, and each ring may be the same or a different substituted heterocycloalkylene). When referring to spiro ring systems, a heterocyclic spiro ring means a spiro ring in which at least one ring is heterocyclic and each ring is distinct. When referring to spiro ring systems, a substituted spiro ring means one in which at least one ring is substituted and each ring can be arbitrarily distinct.
[0258] symbol
[0259] [ka] The symbol indicates the location where a chemical part of a molecule or chemical formula is bonded to the rest of the chemical formula.
[0260] The term "oxo," as used herein, refers to oxygen double-bonded to a carbon atom.
[0261] Each of the terms mentioned above (e.g., "alkyl," "heteroalkyl," "cycloalkyl," "heterocyclyl," "aryl," and "heteroaryl") includes both substituted and unsubstituted forms of the radicals shown. Preferred substituents for each type of radical are provided below.
[0262] Substituents for alkyl and heteroalkyl radicals (including groups often called alkylene, alkenyl, heteroalkylene, heteroalkenyl, alkynyl, cycloalkyl, heterocycloalkyl, cycloalkenyl, and heterocycloalkenyl) are not limited to but number in the range of 0 to (2m'+1) -OR', =O, =NR', =N-OR', -NR'R'', -SR', -halogen, -SiR'R''R''', -OC(O)R', -C(O)R', -CO2R', -CONR'R'', -OC(O)NR'R'', -NR''C(O)R', -NR' It can be one or more of a variety of groups selected from -C(O)NR''R''', -NR''C(O)2R', -NR-C(NR'R''R''')=NR'''', -NR-C(NR'R'')=NR''', -S(O)R', -S(O)2R', -S(O)2NR'R'', -NRSO2R', -NR'NR''R''', -ONR'R'', -NR'C(O)NR''NR'''R'''', -CN, -NO2, -NR'SO2R'', -NR'C(O)R'', -NR'C(O)-OR'', or -NR'OR'', where m' is the total number of carbon atoms in such radicals. Preferably, R, R', R'', R''', and R'''' each independently refer to hydrogen, a substituted or unsubstituted heteroalkyl group, a substituted or unsubstituted cycloalkyl group, a substituted or unsubstituted heterocycloalkyl group, a substituted or unsubstituted aryl group (e.g., an aryl group substituted with 1-3 halogens), a substituted or unsubstituted heteroaryl group, a substituted or unsubstituted alkyl group, an alkoxy group, or a thioalkoxy group, or an arylalkyl group. If the compounds described herein contain more than one R group, for example, each of the R groups is independently selected as the R', R'', R''', and R'''' groups, respectively, when more than one of these groups are present. When R' and R'' are bonded to the same nitrogen atom, they can combine with the nitrogen atom to form a 4-membered, 5-membered, 6-membered, or 7-membered ring. For example, -NR'R'' includes, but is not limited to, 1-pyrrolidinyl and 4-morpholinyl.From the above discussion of substituents, those skilled in the art will understand that the term “alkyl” is intended to include groups containing carbon atoms bonded to groups other than hydrogen groups, such as haloalkyls (e.g., -CF3 and -CH2CF3) and acyls (e.g., -C(O)CH3, -C(O)CF3, -C(O)CH2OCH3, etc.).
[0263] Similar to the substituents described for alkyl radicals, substituents for aryl and heteroaryl groups are diverse, ranging from 0 to the total number of vacant valencies on the aromatic ring system, for example, -OR', -NR'R'', -SR', -halogen, -SiR'R''R''', -OC(O)R', -C(O)R', -CO2R', -CONR'R'', -OC(O)NR'R'', -NR''C(O)R', -NR'-C(O)NR''R''', -NR''C(O)2R', -NR-C(NR'R''R''')=NR'''', -NR-C(NR'R'')=NR''', -S(O)R', -S(O)2R', -S(O)2NR'R'', -NRSO2R', -NR'NR' R''', -ONR'R'', -NR'C(O)NR''NR'''R'''', -CN, -NO2, -R', -N3, -CH(Ph)2, fluoro(C1-C4) alkoxy, and fluoro(C1-C4) alkyl, -NR'SO2R'', -NR'C(O)R'', -NR'C(O)-OR'', or -NR'OR'', and R', R'', R''', and R'''' are preferably independently selected from hydrogen, substituted or unsubstituted alkyl, substituted or unsubstituted heteroalkyl, substituted or unsubstituted cycloalkyl, substituted or unsubstituted heterocycloalkyl, substituted or unsubstituted aryl, or substituted or unsubstituted heteroaryl. If the compounds described herein contain more than one R group, for example, each of the R groups is independently selected as the R', R'', R''', and R'''' group, respectively, if more than one of these groups are present.
[0264] Substituents for a ring (e.g., cycloalkyl, heterocycloalkyl, aryl, heteroaryl, cycloalkylene, heterocycloalkylene, arylene, or heteroarylene) can be represented as substituents on the ring rather than on specific atoms of the ring (commonly referred to as floating substituents). In such cases, the substituent is bonded to any of the ring atoms (according to the rules of chemical supply value), and a substituent represented as relating to a member of a fusion ring or spiro ring (a floating substituent on one ring) can be a substituent on any of the fusion ring or spiro ring (a floating substituent on multiple rings). If the substituent is bonded to a ring rather than a specific atom (a floating substituent), and the subscript for the substituent is an integer greater than 1, then multiple substituents may be on the same atom, the same ring, different atoms, different fusion rings, or different spiro rings, and each substituent may be arbitrarily different. If the site of the ring's bond to the remainder of the molecule is not limited to one atom (a floating substituent), the bond site may be any atom of the ring, and in the case of a fusion ring or spiro-ring, any atom of either the fusion ring or spiro-ring, but subject to the rules of chemical supply value. If a ring, fusion ring, or spiro-ring contains one or more ring heteroatoms, the ring, fusion ring, or spiro-ring is shown with one or more floating substituents (including, but not limited to, the bond site to the remainder of the molecule), and the floating substituents may be bonded to the heteroatoms. If a ring heteroatom is shown in a structure or formula with floating substituents to be bonded to one or more hydrogens (e.g., two bonds to the ring atom and a nitrogen atom with three bonds to hydrogens), then when the heteroatom is bonded to a floating substituent, the substituent is understood to replace a hydrogen, but subject to the rules of chemical supply value.
[0265] Two or more substituents can be optionally bonded to form aryl, heteroaryl, cycloalkyl, or heterocycloalkyl groups. Such so-called ring-forming substituents are typically, but not always, found to be bonded to a cyclic base structure. In one embodiment, the ring-forming substituent is bonded to an adjacent member of the base structure. For example, two ring-forming substituents bonded to adjacent members of a cyclic base structure form a fusion ring structure. In another embodiment, the ring-forming substituent is bonded to a single member of the base structure. For example, two ring-forming substituents bonded to a single member of a cyclic base structure form a spiro-ring structure. In yet another embodiment, the ring-forming substituent is bonded to a non-adjacent member of the base structure.
[0266] Two of the substituents on adjacent atoms of an aryl ring or heteroaryl ring are of the formula -TC(O)-(CRR'). q A -U- ring is optionally formed, where T and U are independently -NR-, -O-, -CRR'-, or a single bond, and q is an integer from 0 to 3. Alternatively, two of the substituents on adjacent atoms of the aryl or heteroaryl ring are optionally of the formula -A-(CH2) r -B- can be replaced with substituents of the formula -(CRR') s -X'-S(C''R''R''') dThe substituents R, R', R'', and R'''' are preferably independently selected from hydrogen, substituted or unsubstituted alkyl, substituted or unsubstituted heteroalkyl, substituted or unsubstituted cycloalkyl, substituted or unsubstituted heterocycloalkyl, substituted or unsubstituted aryl, and substituted or unsubstituted heteroaryl.
[0267] As used herein, the terms “heteroatom” or “ring heteroatom” are intended to include oxygen (O), nitrogen (N), sulfur (S), phosphorus (P), and silicon (Si).
[0268] When used herein, “substituent” means a group selected from parts (A) and (B) below: (A) Oxo, halogen, -CF3, -CN, -OH, -NH2, -COOH, -CONH2, -NO2, -SH, -SO3H, -SO4H, -SO2NH2, -NHNH2, -ONH2, -NHC=(O)NHNH2, -NHC=(O)NH2, -NHSO2H, -NHC=(O)H, -NHC(O)-OH, -NHOH, -OCF3, -OCHF2, unsubstituted alkyl, unsubstituted heteroalkyl, unsubstituted cycloalkyl, unsubstituted heterocycloalkyl, unsubstituted aryl, unsubstituted heteroaryl, and (B) alkyl, heteroalkyl, cycloalkyl, heterocycloalkyl, aryl, heteroaryl, substituted with at least one substituent selected from (i) and (ii) below: (i) oxo, halogen, -CF3, -CN, -OH, -NH2, -COOH, -CONH2, -NO2, -SH, -SO3H, -SO4H, -SO2NH2, -NHNH2, -ONH2, -NHC=(O)NHNH2, -NHC=(O)NH2, -NHSO2H, -NHC=(O)H, -NHC(O)-OH, -NHOH, -OCF3, -OCHF2, unsubstituted alkyl, unsubstituted heteroalkyl, unsubstituted cycloalkyl, unsubstituted heterocycloalkyl, unsubstituted aryl, unsubstituted heteroaryl, and (ii) alkyl, heteroalkyl, cycloalkyl, heterocycloalkyl, aryl, heteroaryl, substituted with at least one substituent selected from (a) and (b) below: (a) Oxo, halogen, -CF3, -CN, -OH, -NH2, -COOH, -CONH2, -NO2, -SH, -SO3H, -SO4H, -SO2NH2, -NHNH2, -ONH2, -NHC=(O)NHNH2, -NHC=(O)NH2, -NHSO2H, -NHC=(O)H, -NHC(O)-OH, -NHOH, -OCF3, -OCHF2, unsubstituted alkyl, unsubstituted heteroalkyl, unsubstituted cycloalkyl, unsubstituted heterocycloalkyl, unsubstituted aryl, unsubstituted heteroaryl, and (b) Alkyl, heteroalkyl, cycloalkyl, heterocycloalkyl, aryl, heteroaryl, substituted with at least one substituent selected from oxo, halogen, -CF3, -CN, -OH, -NH2, -COOH, -CONH2, -NO2, -SH, -SO3H, -SO4H, -SO2NH2, -NHNH2, -ONH2, -NHC=(O)NHNH2, -NHC=(O)NH2, -NHSO2H, -NHC=(O)H, -NHC(O)-OH, -NHOH, -OCF3, -OCHF2, unsubstituted alkyl, unsubstituted heteroalkyl, unsubstituted cycloalkyl, unsubstituted heterocycloalkyl, unsubstituted aryl, unsubstituted heteroaryl.
[0269] When used herein, “size-limited substituent” or “size-limited substituent group” means a group selected from all of the substituents described above for “substituent,” where each substituted or unsubstituted alkyl is a substituted or unsubstituted C1-C 20 Alkyl, substituted or unsubstituted heteroalkyls are each substituted or unsubstituted 2-20 member heteroalkyls, substituted or unsubstituted cycloalkyls are each substituted or unsubstituted C3-C8 cycloalkyls, substituted or unsubstituted heterocycloalkyls are each substituted or unsubstituted 3-8 member heterocycloalkyls, substituted or unsubstituted aryls are each substituted or unsubstituted C6-C 10 An aryl is, and a substituted or unsubstituted heteroaryl is, respectively, a substituted or unsubstituted 5- to 10-membered heteroaryl.
[0270] When used herein, “lower substituent” or “lower substituent group” means a group selected from all of the substituents described above for “substituent,” where each substituted or unsubstituted alkyl is a substituted or unsubstituted C1-C8 alkyl, each substituted or unsubstituted heteroalkyl is a substituted or unsubstituted 2- to 8-membered heteroalkyl, each substituted or unsubstituted cycloalkyl is a substituted or unsubstituted C3-C7 cycloalkyl, each substituted or unsubstituted heterocycloalkyl is a substituted or unsubstituted 3- to 7-membered heterocycloalkyl, and each substituted or unsubstituted aryl is a substituted or unsubstituted C6-C 10 An aryl is, and a substituted or unsubstituted heteroaryl is, respectively, a substituted or unsubstituted 5- to 9-member heteroaryl.
[0271] In certain embodiments, each substituent described in the compounds herein is substituted with at least one substituent. More specifically, in certain embodiments, each of the substituted alkyl, substituted heteroalkyl, substituted cycloalkyl, substituted heterocycloalkyl, substituted aryl, substituted heteroaryl, substituted alkylene, substituted heteroalkylene, substituted cycloalkylene, substituted heterocycloalkylene, substituted arylene, and / or substituted heteroarylene described in the compounds herein is substituted with at least one substituent. In other embodiments, at least one or all of such groups are substituted with at least one size-limited substituent. In other embodiments, at least one or all of such groups are substituted with at least one lower substituent.
[0272] In other embodiments of the compounds described herein, substituted or unsubstituted alkyl groups are each substituted or unsubstituted C1-C 20 Alkyl, substituted or unsubstituted heteroalkyls are each substituted or unsubstituted 2-20 member heteroalkyls, substituted or unsubstituted cycloalkyls are each substituted or unsubstituted C3-C8 cycloalkyls, substituted or unsubstituted heterocycloalkyls are each substituted or unsubstituted 3-8 member heterocycloalkyls, substituted or unsubstituted aryls are each substituted or unsubstituted C6-C 10 The aryl and / or substituted or unsubstituted heteroaryls are each substituted or unsubstituted 5- to 10-membered heteroaryls. In some embodiments of the compounds herein, the substituted or unsubstituted alkylene is each substituted or unsubstituted C1-C 20 Alkylenes, substituted or unsubstituted heteroalkylenes are each substituted or unsubstituted 2- to 20-membered heteroalkylenes, substituted or unsubstituted cycloalkylenes are each substituted or unsubstituted C3-C8 cycloalkylenes, substituted or unsubstituted heterocycloalkylenes are each substituted or unsubstituted 3- to 8-membered heterocycloalkylenes, substituted or unsubstituted arylenes are each substituted or unsubstituted C6-C 10The arrines are and / or the substituted or unsubstituted heteroarrines are each substituted or unsubstituted 5- to 10-membered heteroarrines.
[0273] In certain embodiments, substituted or unsubstituted alkyls are each substituted or unsubstituted C1-C8 alkyls, substituted or unsubstituted heteroalkyls are each substituted or unsubstituted 2- to 8-membered heteroalkyls, substituted or unsubstituted cycloalkyls are each substituted or unsubstituted C3-C7 cycloalkyls, substituted or unsubstituted heterocycloalkyls are each substituted or unsubstituted 3- to 7-membered heterocycloalkyls, and substituted or unsubstituted aryls are each substituted or unsubstituted C6-C 10 An aryl and / or a substituted or unsubstituted heteroaryl is each a substituted or unsubstituted 5- to 9-membered heteroaryl. In certain embodiments, a substituted or unsubstituted alkylene is each a substituted or unsubstituted C1-C8 alkylene, a substituted or unsubstituted heteroalkylene is each a substituted or unsubstituted 2- to 8-membered heteroalkylene, a substituted or unsubstituted cycloalkylene is each a substituted or unsubstituted C3-C7 cycloalkylene, a substituted or unsubstituted heterocycloalkylene is each a substituted or unsubstituted 3- to 7-membered heterocycloalkylene, and a substituted or unsubstituted arylene is each a substituted or unsubstituted C6-C 10 The compound is an arylene, and / or a substituted or unsubstituted heteroarylene is a substituted or unsubstituted 5- to 9-membered heteroarylene, each. In some embodiments, the compound is a chemical species specified in the following Examples section, figure, or table.
[0274] As used herein, the term "isomer" refers to a compound having the same number and type of atoms, and therefore the same molecular weight, but differing in terms of the structural arrangement or composition of its atoms.
[0275] Unless otherwise specified, the structures shown herein also mean all stereochemical forms of the structure, i.e., the R and S configurations of each chiral center. Therefore, single stereoisomers, as well as enantiomers and diastereomers of the compounds of the present invention, are within the scope of the present invention.
[0276] Unless otherwise specified, the structures described herein are also intended to include compounds that differ only in the presence of one or more isotopically abundant atoms, for example, the substitution of hydrogen with jutherium or tritium, or 13 C- or 14 Apart from carbon substitution by C-enriched carbon, compounds having the structure of the present invention are within the scope of the present invention.
[0277] The compounds of the present invention may also contain isotopes of atoms in an unnatural ratio in one or more of the atoms constituting such compounds. For example, the compound may be, for example 2 H, tritium ( 3 H), Iodine-125 ( 125 I). Or carbon-14 ( 14 They can be radiolabeled with radioactive isotopes such as C). All isotope variants of the compounds of the present invention, whether radioactive or not, are included within the scope of the present invention.
[0278] Throughout this application, it should be noted that alternatives are described for each amino acid position containing, for example, more than one possible amino acid, in a Markush group. In particular, each member of a Markush group must be considered separately, thereby including alternative embodiments, and it is intended that a Markush group should not be read as a single unit.
[0279] The terms "analog" or "analogous" are used according to their simple, ordinary meaning in chemistry and biology, and refer to a chemical compound that is structurally similar to another compound (i.e., a so-called "reference" compound) but differs in composition, for example, in the substitution of one atom by an atom of a different element, or in the presence of a particular functional group, or in the substitution of one functional group by another functional group, or in the absolute stereochemistry of one or more chiral centers of the reference compound. Thus, an analogue is a compound that is similar to or comparable to a reference compound in function and appearance, rather than in structure or origin.
[0280] The terms "a" or "an" mean one or more as used herein. In addition, the phrase "substituted with one (a[n])" means, as used herein, that a particular group may be substituted with one or more or all of the specified substituents. For example, a group such as alkyl or heteroaryl may be "unsubstituted C1-C 20 If the group is "substituted with an alkyl or an unsubstituted 2- to 20-membered heteroalkyl group", then the group is one or more unsubstituted C1-C 20 It may contain alkyl and / or one or more unsubstituted 2- to 20-membered heteroalkyl groups.
[0281] Furthermore, if a portion is substituted with an R substituent, the group may be referred to as "R-substituted." When a portion is R-substituted, it is substituted with at least one R substituent, each R substituent being arbitrarily different. If a particular R group is present in a chemical class description (such as formula (II), (III), (IV), or (V)), a Roman numeral may be used to distinguish each occurrence of that particular R group. For example, multiple R 13 Where a substituent exists, R 13 The substituent is R 13A , R 13B , R 13C , R 13D In some cases, it may be determined as such, and here R 13A , R 13B , R 13C , R 13D Each of these is R 13It is defined within the scope of the definition, and differently as needed.
[0282] The description of the compounds of the present invention is limited by the principles of chemical bonding known to those skilled in the art. Accordingly, where the group can be substituted by one or more substituents, such substitutions are selected to conform to the principles of chemical bonding and to result in compounds that are not inherently unstable and / or are known to those skilled in the art as possibly unstable under ambient conditions such as aqueous, neutral, and various known physiological conditions. For example, heterocycloalkyl or heteroaryl atoms are bonded to the remainder of the molecule via ring heteroatoms in accordance with the principles of chemical bonding known to those skilled in the art, thereby avoiding compounds that are inherently unstable.
[0283] Certain compounds of the present invention may exist in non-solvated forms and in solvated forms, including hydrated forms. Typically, the solvated forms are equivalent to the non-solvated forms and are included within the scope of the present invention. Certain compounds of the present invention may exist in multiple crystalline or amorphous forms. Typically, all physical forms are intended to be suitable for the applications envisioned by the present invention and are intended to be within the scope of the present invention.
[0284] As defined herein, with respect to proteins, the terms “activation,” “to activate,” and “to activate” refer to the conversion of a protein from its initial inactive or inactive state to a biologically active derivative. These terms refer to the activation, sensitization, or upregulation of the amount of signaling, enzyme completion, or protein reduction in disease.
[0285] The term “disease” or “illness” refers to a condition or health state of a patient or subject that can be treated with the compounds or methods provided herein. A disease may be cancer.
[0286] The terms “treating” or “treatment” refer to any sign of success in treating or achieving remission of injury, disease, condition, or illness, including any objective or subjective parameters, such as remission; reducing symptoms or making the injury, condition, or illness more tolerable to the patient; slowing the rate of degeneration or decay; preventing the final point of degeneration from becoming so debilitating; or improving the patient’s physical or mental health. Treatment or improvement of symptoms may be based on objective or subjective parameters, including the results of physical examination, neuropsychiatric examination, and / or psychiatric evaluation. The terms “treating” and their conjugations may include the prevention of injury, condition, disease, or illness. In some aspects, treating is prevention. In other aspects, treating does not include prevention.
[0287] As used in this specification (and as well as well understood in the art), “to treat” or “treatment” includes any approach to obtain a beneficial or desirable outcome in the disease of interest, including clinical outcomes. Beneficial or desirable clinical outcomes may include, but are not limited to, relief or improvement of one or more symptoms or conditions, whether partial or whole, detectable or undetectable; reduction of disease severity; stabilization of disease condition (i.e., no exacerbation); prevention of disease transmission or spread; delay or slowing of disease progression; improvement or relief of disease condition; reduction of disease recurrence; and remission. In other words, as used herein, “treatment” includes any cure, improvement, or prevention of disease. Treatment may prevent the onset of disease; inhibit the spread of disease; reduce the symptoms of disease; completely or partially eliminate the underlying cause of disease; shorten the duration of disease; or a combination of these.
[0288] As used in this specification, “to treat” and “treatment” include prophylactic treatment. A treatment method includes administering a subject to a therapeutically effective dose of the compounds described herein. The administration step may consist of a single dose or a series of doses. The duration of treatment depends on various factors, such as the severity of the condition, the patient’s age, the concentration of the compound, the activity of the composition used for treatment, or a combination thereof. It will also be understood that the effective dose of the agent used for treatment or prevention may be increased or decreased during a particular treatment or prevention plan. Changes in dosage may result and be evident by standard diagnostic assays known in the art. In some cases, long-term administration may be required. For example, the composition is administered to a subject in an amount and duration sufficient to treat the patient.
[0289] The term "prevention" refers to a reduction in the occurrence of disease symptoms in a patient. As mentioned above, prevention can be complete (no detectable symptoms) or partial, such that fewer symptoms are observed than would occur if no treatment were provided. In certain aspects, prevention refers to slowing the progression of a disease, disorder, or condition, or preventing its progression to a harmful or otherwise undesirable condition. Embodiment
[0290] Embodiment 1. Joint and Formula (V)
[0291] [ka] (In the formula, R 4 Each of them is independently hydrogen or C 1-10 Selected from alkyl groups, R 5 Each of these is independently hydrogen, halogen, hydroxyl, alkoxy, or C 1-10 (Selected from alkyl groups) A conjugate comprising an oligonucleotide having at least one internucleotide bond represented by .
[0292] Embodiment 2. The conjugate according to Embodiment 1, wherein the oligonucleotide is an RNA oligonucleotide.
[0293] Embodiment 3. The conjugate according to Embodiment 1 or 2, further comprising at least one modification.
[0294] Embodiment 4. The conjugate according to any one of Embodiments 1 to 3, further comprising at least one 2'-modified nucleotide.
[0295] Embodiment 5. The conjugate according to any one of Embodiments 1 to 4, further comprising at least one 2'-modified nucleotide selected from nucleotides modified with 2'-O-methyl, 2'-O-methoxyethyl (2'-O-MOE), 2'-O-aminopropyl, 2'-deoxy, 2-deoxy-2'-fluoro, 2'-O-aminopropyl (2'-O-AP), 2'-O-dimethylaminoethyl (2'-O-DMAOE), 2'-O-dimethylaminopropyl (2'-O-DMAP), 2'-O-dimethylaminoethyloxyethyl (2'-O-DMAEOE), or 2'-ON-methylacetamide (2'-O-NMA).
[0296] Embodiment 6. The conjugate according to any one of Embodiments 1 to 5, further comprising at least one 2'-modified nucleotide selected from locked nucleic acid (LNA) or ethylene nucleic acid (ENA).
[0297] Embodiment 7. A conjugate according to any one of Embodiments 1 to 6, wherein an oligonucleotide is conjugated at the binding site.
[0298] Embodiment 8. The conjugate according to any one of Embodiments 1 to 7, wherein the binding portion is conjugated to the 3' end of an oligonucleotide.
[0299] Embodiment 9. The conjugate according to any one of Embodiments 1 to 8, wherein the binding portion comprises an antibody or an antigen-binding fragment thereof.
[0300] Embodiment 10. The conjugate according to Embodiment 9, wherein the antibody or its antigen-binding fragment comprises a humanized antibody or its antigen-binding fragment, a chimeric antibody or its antigen-binding fragment, a monoclonal antibody or its antigen-binding fragment, a monovalent Fab', a bivalent Fab2, a single-chain variable fragment (scFv), a diabody, a minibody, a nanobody, a single-domain antibody (sdAb), or a camelid antibody or its antigen-binding fragment.
[0301] Embodiment 11. The conjugate according to any one of Embodiments 1 to 8, wherein the binding portion comprises a peptide or a small molecule.
[0302] Embodiment 12. A conjugate according to any one of Embodiments 1 to 8, wherein the bonding portion includes an aptamer.
[0303] Embodiment 13. A conjugate according to any one of Embodiments 1 to 12, comprising approximately 8 to approximately 50 nucleotides.
[0304] Embodiment 14. A conjugate according to any one of Embodiments 1 to 13, comprising about 10 to about 30 nucleotides.
[0305] Embodiment 15. A conjugate according to any one of Embodiments 1 to 14, comprising about 15 to about 25 nucleotides.
[0306] A conjugate according to any one of Embodiments 1 to 15, comprising the nucleotide of Embodiment 16.10.
[0307] Embodiment 17. Each nucleotide bond is represented by formula (V), a conjugate according to any one of Embodiments 1 to 16.
[0308] Embodiment 18. The conjugate according to Embodiment 1, wherein an NH2-C1-6 alkyl group is conjugated to the 5' end of an oligonucleotide.
[0309] Embodiment 19. A conjugate according to any one of Embodiments 1 to 18, wherein the oligonucleotide is an RNA oligonucleotide; is conjugated at the binding site; is about 10 to about 30 nucleotides; and comprises at least one 2'-modified nucleotide.
[0310] Embodiment 20. The conjugate according to any one of Embodiments 1 to 19, wherein the oligonucleotide hybridizes to at least eight consecutive bases of the target gene.
[0311] Embodiment 21. The conjugate according to any one of Embodiments 1 to 20, wherein the oligonucleotide mediates RNA interference.
[0312] Embodiment 22. The conjugate according to any one of Embodiments 1 to 21, wherein the oligonucleotide is the sense chain.
[0313] Embodiment 23. The conjugate according to Embodiment 22, wherein an oligonucleotide is hybridized with a second oligonucleotide to form a double-stranded polynucleic acid molecule.
[0314] Embodiment 24. The conjugate according to Embodiment 23, wherein the second oligonucleotide is an antisense chain.
[0315] Embodiment 25. The conjugate according to Embodiment 23 or 24, wherein the second oligonucleotide is an RNA oligonucleotide.
[0316] Embodiment 26. The conjugate according to any one of Embodiments 23 to 25, wherein the second oligonucleotide includes at least one modification.
[0317] Embodiment 27. The conjugate according to Embodiment 26, wherein the second oligonucleotide comprises at least one 2'-modified nucleotide.
[0318] Embodiment 28. The conjugate according to Embodiment 26 or 27, wherein the second oligonucleotide comprises at least one 2'-modified nucleotide selected from nucleotides modified with 2'-O-methyl, 2'-O-methoxyethyl (2'-O-MOE), 2'-O-aminopropyl, 2'-deoxy, 2-deoxy-2'-fluoro, 2'-O-aminopropyl (2'-O-AP), 2'-O-dimethylaminoethyl (2'-O-DMAOE), 2'-O-dimethylaminopropyl (2'-O-DMAP), 2'-O-dimethylaminoethyloxyethyl (2'-O-DMAEOE), or 2'-ON-methylacetamide (2'-O-NMA).
[0319] Embodiment 29. The conjugate according to any one of Embodiments 26 to 28, wherein the second oligonucleotide comprises at least one 2'-modified nucleotide selected from locked nucleic acid (LNA) or ethylene nucleic acid (ENA).
[0320] Embodiment 30. A conjugate according to any one of Embodiments 1 to 19 or 22 to 29, wherein the oligonucleotide comprises a polymer.
[0321] Embodiment 31. The conjugate according to Embodiment 30, wherein the oligonucleotide comprises poly(ethylene glycol).
[0322] Embodiment 32. A conjugate according to any one of Embodiments 1-19 or 22-31, wherein the oligonucleotide comprises a first strand and a second strand, the first strand being: a sense strand; an RNA oligonucleotide; conjugated to a binding moiety, polymer, or combination thereof; consisting of about 10 to about 30 nucleotides; comprising at least one 2'-modified nucleotide; and the second strand being: a non-transcription strand; an RNA oligonucleotide; consisting of about 10 to about 30 nucleotides; comprising at least one 2'-modified nucleotide; and comprising at least one modified internucleotide bond.
[0323] Embodiment 33. A method for treating a subject having a disease or illness characterized by abnormal protein expression, comprising the step of administering a conjugate described in any one of Embodiments 1 to 32 to the subject in order to modulate the expression of a gene encoding the protein, thereby treating the disease or illness characterized by abnormal protein expression.
[0324] Embodiment 34. A method for treating a subject having a disease or illness characterized by the overexpression of a protein, comprising the step of administering to the subject a conjugate described in any one of Embodiments 1 to 32 in order to regulate the expression of a gene encoding the protein, thereby treating the disease or illness characterized by the overexpression of the protein.
[0325] Embodiment 35. The method according to Embodiment 33 or 34, wherein the disease or illness is cancer.
[0326] Embodiment 36. The method according to Embodiment 33 or 34, wherein the disease or illness is a neuromuscular disease, muscular dystrophy, muscle atrophy, muscle wasting, hereditary disease, cancer, or cardiovascular disease.
[0327] Embodiment 37. The method according to any one of Embodiments 33 to 36, wherein the subject is a human.
[0328] Embodiment 38. A kit comprising the conjugate described in any one of Embodiments 1 to 32.
[0329] Embodiment 39. A modified oligomer compound comprising a continuous sequence of monomer subunits linked by internucleotide binding groups, wherein at least one of the internucleotide binding groups is of formula (V)
[0330] [ka] (In the formula, R 4 Each of them is independently hydrogen or C 1-10 Selected from alkyl groups, R 5 Each of these is independently hydrogen, halogen, hydroxyl, alkoxy, or C 1-10 (Selected from alkyl groups) A modified oligomeric compound represented by [the specified symbol].
[0331] Embodiment 40. At least one monomer subunit of the monomer subunit is of formula (V*)
[0332] [ka] (In the formula, B is selected independently from the heterocyclic base moiety. R 1 These are independently selected from hydrogen, hydroxyl, halogen, or alkoxy. R 1 and R 2 (These atoms can, optionally, become one with the atom to which they are bonded, forming a C3-C4 carbon ring.) The modified oligomer compound described in Embodiment 39, represented by [the specified figure].
[0333] Embodiment 41. At least two monomer subunits of the contig sequence are of formula (VI)
[0334] [ka] (In the formula, Each of B is independently selected from the heterocyclic base moiety. R 1 Each of these is independently selected from hydrogen, hydroxyl, halogen, and alkoxy. R 2 Each of them is independently hydrogen, R 1 and R 2 They can optionally form a C3-C4 carbon ring by becoming one with the atom to which they are bonded. R 4 Each of them is independently hydrogen or C 1-10Selected from alkyl groups, R 5 Each of these is independently hydrogen, halogen, hydroxyl, alkoxy, or C 1-10 (Selected from alkyl groups) A modified oligomer compound according to Embodiment 39 or 40, bonded by formula (V) as represented by .
[0335] Embodiment 42. The modified oligomer compound according to any one of Embodiments 39 to 41, wherein the modified oligomer compound has at least two internucleotide binding groups represented by formula (V).
[0336] Embodiment 43. The modified oligomer compound according to any one of Embodiments 39 to 42, wherein the modified oligomer compound has at least 10 internucleotide binding groups represented by formula (V).
[0337] Embodiment 44. A modified oligomer compound according to any one of Embodiments 39 to 43, wherein at least two monomer subunits are represented by formula (V*).
[0338] Embodiment 45. A modified oligomer compound according to any one of Embodiments 39 to 44, wherein at least 10 monomer subunits are represented by formula (V*).
[0339] Embodiment 46. A modified oligomer compound according to any one of Embodiments 39 to 45, wherein the modified oligomer compound is conjugated at the binding site.
[0340] Embodiment 47. The modified oligomer compound according to Embodiment 46, wherein the binding portion is conjugated to the 3' end of the oligonucleotide.
[0341] Embodiment 48. A compound of the modified oligomer according to Embodiment 46 or 47, wherein the binding portion comprises an antibody or its antigen-binding fragment.
[0342] Embodiment 49. A modified oligomer compound according to Embodiment 48, wherein the antibody or its antigen-binding fragment comprises a humanized antibody or its antigen-binding fragment, a chimeric antibody or its antigen-binding fragment, a monoclonal antibody or its antigen-binding fragment, a monovalent Fab', a bivalent Fab2, a single-chain variable fragment (scFv), a diabody, a minibody, a nanobody, a single-domain antibody (sdAb), or a camelid antibody or its antigen-binding fragment.
[0343] Embodiment 50. A compound of the modified oligomer described in Embodiment 46 or 47, wherein the binding portion comprises a peptide or small molecule.
[0344] Embodiment 51. A compound of the modified oligomer described in Embodiment 46 or 47, wherein the binding portion includes an aptamer.
[0345] Embodiment 52. A modified oligomeric compound according to any one of Embodiments 39 to 51, comprising about 8 to about 50 nucleotides.
[0346] Embodiment 53. A modified oligomeric compound according to any one of Embodiments 39 to 52, comprising about 10 to about 30 nucleotides.
[0347] Embodiment 54. A modified oligomeric compound according to any one of Embodiments 39 to 53, comprising about 15 to about 25 nucleotides.
[0348] A modified oligomer compound according to any one of Embodiments 39 to 54, comprising the nucleotide of Embodiment 55.20.
[0349] Embodiment 56. A modified oligomer compound according to any one of Embodiments 39 to 55, wherein each internucleotide bond is represented by formula (V).
[0350] Embodiment 57. A modified oligomer compound according to any one of Embodiments 39 to 56, wherein an NH2-C1-6 alkyl group is conjugated to the 5' end of the modified oligomer compound.
[0351] Embodiment 58. A modified oligomer compound according to any one of Embodiments 39 to 57, wherein the modified oligomer compound hybridizes to at least eight consecutive bases of a target gene.
[0352] Embodiment 59. A modified oligomer compound according to any one of Embodiments 39 to 58, wherein the modified oligomer compound mediates RNA interference.
[0353] Embodiment 60. The modified oligomer compound according to any one of Embodiments 39 to 59, wherein the modified oligomer compound is the sense chain.
[0354] Embodiment 61. A modified oligomer compound according to any one of Embodiments 39 to 57, wherein a modified oligomer compound is hybridized with a second modified oligomer compound to form a double-stranded polynucleic acid molecule.
[0355] Embodiment 62. The modified oligomer compound according to Embodiment 61, wherein the second modified oligomer compound is an RNA oligonucleotide.
[0356] Embodiment 63. A compound of the modified oligomer according to Embodiment 61 or 62, wherein the second oligonucleotide is an antisense chain.
[0357] Embodiment 64. The second oligonucleotide comprises a continuous sequence of monomer subunits linked by internucleotide binding groups, wherein at least one of the internucleotide binding groups is of formula (V)
[0358] [ka] (In the formula, R4 Each of them is independently hydrogen or C 1-10 Selected from alkyl groups, R 5 Each of these is independently hydrogen, halogen, hydroxyl, alkoxy, or C 1-10 (Selected from alkyl groups) A compound of the modified oligomer described in Embodiment 61 or 62, represented by [the specified symbol].
[0359] Embodiment 65. At least one monomer subunit of the monomer subunit is of formula (V*)
[0360] [ka] (In the formula, B is selected independently from the heterocyclic base moiety. R 1 These are independently selected from hydrogen, hydroxyl, halogen, or alkoxy. R 2 It is independently selected from hydrogen, R 1 and R 2 (These atoms can, optionally, become one with the atom to which they are bonded, forming a C3-C4 carbon ring.) The modified oligomer compound described in Embodiment 64, represented by [the specified symbol].
[0361] Embodiment 66. At least two monomer subunits of the contig sequence are of formula (V*)
[0362] [ka] (In the formula, Each of B is independently selected from the heterocyclic base moiety. R 1 Each of these is independently selected from hydrogen, hydroxyl, halogen, or alkoxy. R 2 Each is independently selected from hydrogen, R 1 and R2 Each of them, optionally, integrates with the atom to which they are bonded to form a C3-C4 carbon ring. R 4 Each of them is independently hydrogen or C 1-10 Selected from alkyl groups, R 5 Each of these is independently hydrogen, halogen, hydroxyl, alkoxy, or C 1-10 (Selected from alkyl groups) A modified oligomer compound according to Embodiment 65, bonded by formula (V) as represented by .
[0363] Embodiment 67. A modified oligomer compound according to any one of Embodiments 39 to 66, wherein the modified oligomer compound comprises a polymer.
[0364] Embodiment 68. A modified oligomer compound according to any one of Embodiments 39 to 67, wherein the modified oligomer compound contains poly(ethylene glycol).
[0365] Embodiment 69. The modified oligomer compound according to Embodiment 39, wherein the modified oligomer compound comprises a first chain and a second chain, the first chain being: a sense chain; an RNA oligonucleotide; conjugated to a binding moiety, polymer, or combination thereof; comprising about 10 to about 30 nucleotides; comprising at least one internucleotide binding group having formula (V); comprising at least one monomer subunit of formula (V*); and the second chain being: a non-transcription chain; an RNA oligonucleotide; comprising about 10 to about 30 nucleotides; comprising at least one internucleotide binding group having formula (V); comprising at least one monomer subunit of formula (V*).
[0366] Embodiment 70. A method for treating a subject having a disease or illness characterized by abnormal protein expression, comprising the step of administering a modified oligomer compound described in any one of Embodiments 39 to 69 to the subject in order to modulate the expression of a gene encoding the protein, thereby treating the disease or illness characterized by abnormal protein expression.
[0367] Embodiment 71. A method for treating a subject having a disease or illness characterized by protein overexpression, comprising the step of administering a modified oligomer compound described in any one of Embodiments 39 to 69 to the subject in order to regulate the expression of a gene encoding the protein, thereby treating the disease or illness characterized by protein overexpression.
[0368] Embodiment 72. The method according to Embodiment 70 or 71, wherein the disease or illness is cancer.
[0369] Embodiment 73. The method according to Embodiment 70 or 71, wherein the disease or illness is a neuromuscular disease, muscular dystrophy, muscle atrophy, muscle wasting, hereditary disease, cancer, or cardiovascular disease.
[0370] Embodiment 74. The method according to any one of Embodiments 70 to 73, wherein the subject is a human.
[0371] Embodiment 75. A kit comprising a modified oligomer compound as described in any one of Embodiments 39 to 74.
[0372] Embodiment 76. Oligonucleotide, wherein formula (V)
[0373] [ka] (In the formula, R 4 Each of them is independently hydrogen or C 1-10 (Selected from alkyl groups) It includes at least one internucleotide bond represented by, An oligonucleotide containing at least 12 nucleotides.
[0374] Embodiment 77. A double-stranded oligonucleotide comprising a guide strand and a passenger strand, The above guide chain or passenger chain is given by formula (II)
[0375] [ka] (In the formula, R 11 , R 12 , R 13 , and R 14 These are independently -H and -C 1-10 Alkyl, -C 2-10 Alkenyl, -C 2-10 Alkinyl, or -C 6-10 Selected from the alphabet, Optionally, R 12 and R 13 These atoms, together with the atoms to which they are bonded, form a 5- to 8-membered heterocyclic substituent moiety selected from the group consisting of N-pyrrolidinyl, N-piperidinyl, N-azepanyl, N-azocanyl, and imidazolidine. A double-stranded oligonucleotide containing at least one internucleotide bond having the structure of [the specified structure].
[0376] Embodiment 78.R 12 and R 13 However, the double-stranded oligonucleotide according to Embodiment 77 is characterized in that it forms an imidazolidine by becoming one with the atom to which it is bound.
[0377] Embodiment 79. The internucleotide bond is of formula (III)
[0378] [ka] A double-stranded oligonucleotide according to embodiment 77 or 78, having the structure of [the specified structure].
[0379] Embodiment 80.R11 , R 12 , R 13 , and R 14 However, -C 1-10 A double-stranded oligonucleotide according to Embodiment 77, which is alkyl.
[0380] Embodiment 81. The internucleotide bond is of formula (IV)
[0381] [ka] A double-stranded oligonucleotide according to embodiment 78, having the structure of [the specified structure].
[0382] Embodiment 82. A double-stranded oligonucleotide according to any one of Embodiments 77 to 81, wherein at least one modified internucleotide bond of formula (II) is located at the 5' or 3' end of the guide strand.
[0383] Embodiment 83. A double-stranded oligonucleotide according to any one of Embodiments 77 to 81, wherein at least one modified internucleotide bond of formula (II) is located inside the guide chain.
[0384] Embodiment 84. A double-stranded oligonucleotide according to any one of Embodiments 77 to 81, wherein at least one modified internucleotide bond of formula (II) is located in the 3' overhang of the double-stranded oligonucleotide.
[0385] Embodiment 85. A double-stranded oligonucleotide according to any one of Embodiments 77 to 84, wherein at least one modified internucleotide bond of formula (II) is not located at a cleavage site of the passenger strand.
[0386] Embodiment 86. A double-stranded oligonucleotide according to any one of Embodiments 77 to 84, wherein at least one modified internucleotide bond of formula (II) is located at the 5' or 3' end of the passenger strand.
[0387] Embodiment 87. A double-stranded oligonucleotide according to any one of Embodiments 77 to 84, wherein at least one modified internucleotide bond of formula (II) is located in an internal position within the passenger strand. [Examples]
[0388] While preferred embodiments of the Disclosure have been shown and described herein, it will be apparent to those skilled in the art that such embodiments are provided only as examples. Many variations, alterations, and substitutions can be conceived by those skilled in the art without departing from the Disclosure. It should be understood that various alternatives to the embodiments of the Disclosure described herein may be used in the practice of the Disclosure. The following claims define the scope of the Disclosure, and methods and structures within the scope of these claims and their equivalents are intended to be encompassed thereby. These examples are provided for illustrative purposes only and do not limit the scope of the claims provided herein.
[0389] Example 1: Synthesis, purification, and analysis of exemplary DAR2 antibody-oligonucleotide conjugates (AOCs) with PG-modified siRNA. oligonucleotide synthesis Double-stranded 21-mer oligonucleotides with 19-base complementarity to the mouse and human MSTN gene having the guide chain sequence MSTN:UUAUUAUUUGUUCUUUGCCUU (SEQ ID NO: 19) were constructed. The guide and passenger strands were assembled on solid phase using standard phosphoramidite chemistry and purified by HPLC. Base, sugar, and phosphate modifications were used to optimize the efficacy of the double-stranded siRNAs and reduce immunogenicity. Phosphorylguanidine (PG) bonds were introduced at specific positions within the oligonucleotides by using 2-azido-1,3-dimethylimidazolium hexafluorophosphate in the oxidation step. The purified single-stranded siRNAs were double-stranded to obtain the double-stranded siRNAs listed in Table 1.
[0390] [Table 1-1] [Table 1-2] *A capital N without an f indicates a 2'-O-methyl modified nucleotide (e.g., A indicates 2'-O-methyladenosine); a capital Nf with an f indicates a 2'-fluoro modified nucleotide (e.g., Af indicates 2'-fluoroadenosine); and pg indicates a phosphorylguanidine nucleotide bond. vpUq or vpUm indicates a vinylphosphonate modified nucleotide as shown below:
[0391] [ka]
[0392] Anti-transferrin receptor antibody Anti-mouse transferrin receptor antibodies or CD71 mAbs are rat IgG2a subclass monoclonal antibodies that bind to mouse CD71 or mouse transferrin receptor 1 (mTfR1). The antibodies are manufactured and commercially available from BioXcell (catalog number BE0175).
[0393] AOC generation DAR2 AOCs were generated using a standard random cysteine conjugation method. After partially reducing the interchain disulfide bonds of the antibodies with TCEP, they were conjugated with maleimide linker-siRNAs. The reaction mixture was purified using strong anion exchange chromatography (A1) and drug-to-antibody ratios (DAR) equal to 2 (i.e., 2 siRNAs per antibody) were isolated. The collected AOC fractions were concentrated, the buffer was replaced with PBS, and the mixture was filtered using a 0.2 μm filter for sterile filtration. The purity of the AOCs was assessed using strong anion exchange chromatography (A1), size exclusion chromatography, and SDS-PAGE.
[0394] Purification method Strong anion exchange (SAX) method for analyzing conjugates MPA: 10 mM Tris pH 7.2 20% Ethanol
[0395] MPB: 10 mM Tris, 1.5M NaCl, pH 7.2, 20% Ethanol
[0396] Column: Thermo Scientific, ProPac® SAX-10, Bio LC®, 4 x 250 mm
[0397] Flow rate=0.75mL / min
[0398] Table 2 shows the gradient used for purification.
[0399] [Table 2]
[0400] Non-denatured IP-RP method MPA:1% HFIP, 0.2% TEA, 50nM EDTA
[0401] MPB: methanol
[0402] Column: Acquity Premier Oligonucleotide C18 Column 1.7μm 2.1x50mm
[0403] Flow rate: 0.6mL / min
[0404] T=25℃
[0405] Table 3 shows the gradient used for purification.
[0406] [Table 3]
[0407] Strong anion exchange chromatography method 2 Column: Tosoh Bioscience, TSKGel SuperQ-5PW, 21.5mm ID x 15cm, 13um
[0408] Solvent A: 20 mM Tris, pH 8.0; Solvent B: 20 mM Tris, 1.5 M NaCl, pH 8.0;
[0409] Flow rate: 6.0mL / min
[0410] Table 4 shows the gradient used for purification.
[0411] [Table 4]
[0412] Figures 1-12 show the analytical data for DAR2 AOCs containing siRNA modified with P=S and PG binding. Table 5 shows the SAX retention times of DAR2 AOCs.
[0413] [Table 5] Lowercase letters without *f (n) refer to 2'-O-methyl modified nucleotides (e.g., a refers to 2'-O-methyladenosine); uppercase letters with *f (Nf) refer to 2'-fluoro modified nucleotides (e.g., Af refers to 2'-fluoroadenosine); and nPG refers to 2'-O-methyl modified nucleotides containing a phosphorylguanidine internucleotide bond at 3' (e.g., (aPG) refers to 2'-O-methyladenosine with a phosphorylguanidine internucleotide bond at 3'). vpUq or vpUm refer to vinylphosphonate modified nucleotides as shown in Table 1 above.
[0414] Example 2: In vivo activity of DAR2 anti-transferrin receptor 1 mAb conjugated to MSTN siRNA modified with PG nucleotide binding. DAR2 AOC was prepared and characterized as described in Example 1. The siRNA of DAR2 AOC was modified by substituting the phosphorothioate (P=S) bond with a phosphorylguanidine (PG) bond. Figure 22 shows the configuration of two siRNA molecules having phosphorothioate internucleotide bonds and / or phosphorylguanidine (PG) bonds, as well as the location of such internucleotide bonds on the guide strand, passenger strand, or both of the siRNAs of the AOC. DAR2 AOC or conjugate was synthesized by conjugating two siRNAs with an anti-TfR1 antibody as described in Example 1.
[0415] The conjugates were evaluated for their ability to mediate the downregulation of MSTN mRNA in the muscle tissue of wild-type CD-1 mice. Mice were administered intravenously (iv) with a PBS vehicle control and the indicated DAR2 AOC at a constant antibody dose of 7.5 mg / kg. At 14, 28, or 56 days, gastrocnemius muscle tissue was collected and rapidly frozen in liquid nitrogen. mRNA knockdown in the target tissue was determined using a comparative qPCR assay. Total RNA was extracted from the tissue, reverse transcribed, and mRNA levels were quantified using TaqMan qPCR with appropriately designed primers and probes. Results were calculated using the comparative Ct method with PPIB (housekeeping gene) as the internal RNA loading control, and the difference (ΔCt) between the target gene Ct value and the PPIB Ct value was calculated, and then further normalized to the PBS control group by taking a second difference (ΔΔCt).
[0416] result The in vivo activity of DAR2 AOCs with siRNA modified with PG bonds on the passenger strand was evaluated at different doses to assess myostatin mRNA knockdown activity in muscle cells derived from gastrocnemius tissue (Figure 13A). DAR2 AOCs were generated with siRNAs containing either 8PG or 0PG modification patterns (Figure 22). 8PG included siRNAs modified with 8PG bonds at the 5' and 3' ends of the passenger strand, while 0PG, or 8P=S, included two phosphorothieate (P=S) nucleotide internucleotides at the 5' end and two P=S nucleotide internucleotides at the 3' end of the passenger strand. DAR2 AOC siRNAs with the 8PG pattern showed greater MSTN mRNA knockdown compared to DAR2 AOC siRNAs with the 8P=S pattern at day 28. These results demonstrate that the presence of PG binding on the passenger chain and the absence of PS binding observed in 8PG improved the DAR2 AOC activity of siRNA compared to 8P=S, which has PS binding but lacks PG binding.
[0417] The in vivo activity of DAR2 AOCs with siRNAs modified with PG or P=S bonds on the passenger strand was evaluated in a time-dependent manner for myostatin mRNA knockdown in muscle cells derived from gastrocnemius tissue (Figure 13B). On days 14 and 28, siRNAs modified with an 8PG pattern showed downregulation of MSTN mRNA by more than 75%. siRNAs with a passenger strand without any PG bonds (8P=S) were able to downregulate MSTN mRNA by approximately 50%. The presence of an 8PG pattern of internucleotide binding on the passenger strand of the siRNA improved the knockdown activity of DAR2 AOC compared to the DAR2 AOC activity of the 8P=S pattern.
[0418] Further experiments were conducted to evaluate the activity of DAR2 AOCs containing siRNA modified with PG or P=S internucleotide bonds on the passenger strand. All experiments showed that DAR2 conjugates containing siRNA with PG internucleotide bonds on the passenger strand induced greater downregulation of MSTN mRNA levels compared to those without any PG internucleotide bonds (8P=S) (Figure 14A). Analysis of the distribution of mRNA level reductions indicates that the presence of PG internucleotide bonds on the passenger strand enhances the mRNA knockdown activity of DAR2 conjugates (Figure 14B).
[0419] Overall, these results indicate that DAR2 AOCs with two siRNAs modified with PG nucleotide interlinking exhibit better in vivo knockdown activity than DAR2 AOCs with two siRNAs containing phosphorothioate nucleotide interlinking.
[0420] Example 3: In vivo activity of DAR2 anti-transferrin receptor 1 mAb conjugated to MSTN siRNA modified with PG nucleotide binding. DAR2 AOC was prepared and characterized as described in Example 1. The siRNA of DAR2 AOC was modified by substituting phosphorothioate (P=S) bonds with phosphorylguanidine (PG) bonds. Figure 23 shows the configuration of four siRNA molecules with P=S and / or PG bonds, as well as the location of internucleotide bonds on the guide, passenger, or both strands of the siRNA of DAR2 AOC. DAR2 AOC or conjugate was synthesized by conjugating two siRNAs with an anti-TfR1 antibody as described in Example 1.
[0421] Design of in vivo trials A group of wild-type female CD-1 mice (n=4) were treated with a single intra-tail vein (iv) injection of a DAR2 siRNA antibody conjugate. The treatment group received 10 mg / kg (based on mAb weight), and all groups were administered a dose volume of 5.0 mL / kg. Mice were sacrificed 24, 72, or 168 hours after injection. Terminal blood samples were collected via cardiac puncture and processed to produce plasma for PK analysis.
[0422] Stem-loop qPCR assay for siRNA quantification Plasma samples were directly diluted with TE buffer containing 0.1% Triton-X. 50 mg tissue fragments were homogenized in 1 mL of Trizol using a TillueLyser II tissue homogenizer (Qiagen), and then diluted in TE buffer containing 0.1% Triton-X. Standard curves were created by spiked siRNA into plasma or homogenized tissue from untreated animals, and then serially diluted with TE buffer containing 0.1% Triton-X. The antisense (guide) strand of siRNA was reverse transcribed using the TaqMan MicroRNA Reverse Transcription Kit (Applied Biosystems) with 94 nM sequence-specific stem-loop RT primers. cDNA from the RT step was used for real-time PCR using the TaqMan Fast Advanced Master Mix (Applied Biosystems) with 1.5 μM forward primers, 0.75 μM reverse primers, and 0.2 μM probe. Quantitative PCR reactions were performed using a ViiA 7 Real-Time PCR System (Life Technologies) under standard cycle conditions. Ct values were converted to plasma or tissue concentrations using a linear equation derived from the standard curve.
[0423] result Figures 15A and 15B show the time-dependent plasma pharmacokinetics of siRNA at 24, 72, and 168 hours post-injection after a single-dose injection (10 mg / kg mAb) of PG-modified siRNA into mice (Figure 15A), as well as the calculated area under the curve (AUC) of PG-modified siRNA at 168 hours post-injection (Figure 15B). These results indicate that DAR2 AOCs with PG-modified siRNA (4PG DAR2, 18PG DAR2, and 4X4PG DAR2; structure and location of modified nucleotide bonds shown in Figure 23) exhibit higher plasma concentrations and higher AUCs than DAR2 AOCs with unmodified (8P=S) siRNA, at least up to 168 hours post-injection.
[0424] Figure 15A shows that plasma levels of siRNA in DAR2 AOC (18PG) with siRNA having an unmodified guide chain and a passenger chain with the entire backbone modified with PG were similar to the levels of siRNA with four PG bonds (4PG) on the unmodified guide chain and passenger chain. Interestingly, the highest siRNA plasma levels were measured at all time points for DAR2 AOC with siRNA modified with four PG nucleotide interbonds on the guide chain and four PG nucleotide interbonds (4×4PG) on the passenger chain.
[0425] Figure 15B shows the AUC of these RNAs, with or without some PG nucleotide binding, calculated 168 hours after injection. The results show that siRNA modified with a 4x4PG pattern had the highest AUC. Furthermore, siRNA (8P=S) without any PG nucleotide binding on the guide or passenger strand had the lowest AUC. Adding PG binding to the passenger strand of siRNA (4PG and 18PG) with an unmodified guide strand improved the AUC of the modified siRNA. Adding PG binding to both the guide and passenger strands (4x4PG) showed a relatively high AUC.
[0426] In summary, PK data analysis shows that the decreased clearance of DAR2 AOC-modified siRNA, resulting in increased siRNA plasma levels, correlates with the number of PG bonds on the guide strand. The presence of four PG interbonds at the 5' and 3' of the DAR2 AOC guide strand results in the highest retention of siRNA in plasma, while the absence of PG internucleotide bonds results in much lower plasma retention. Thus, these results indicate a reduction in the negative charge on siRNA in DAR2 AOC due to the presence of PG bonds instead of P=S bonds, as demonstrated by the higher levels of circulating siRNA in plasma.
[0427] Example 4: In vivo activity of DAR2 anti-transferrin receptor 1 mAb conjugated to SSB or MSTN siRNA modified with PG nucleotide binding. oligonucleotide synthesis SSB: A 21-mer oligonucleotide double-stranded molecule with 19 nucleotide complements and a 3' dinucleotide overhang was designed for the mouse small RNA-binding exonuclease protective factor La (SSB). The guide / antisense strand sequence (5'~3') was UUACAUUAAAGUCUGUUGUUU (SEQ ID NO: 20). MSTN: A 21-mer oligonucleotide double-stranded molecule with 19 nucleotide complements for the mouse and human MSTN genes with the guide strand sequence UUAUUAUUUGUUCUUUGCCUU (SEQ ID NO: 19). The guide and passenger strands were assembled on solid phase using standard phosphoramidite chemistry and purified by HPLC. Modifications of bases, sugars, and phosphates were used to optimize the double-stranded molecule's ability and reduce immunogenicity. Phosphorylguanidine (PG) bonds were introduced at specific positions within the oligonucleotide by using 2-azido-1,3-dimethylimidazolium hexafluorophosphate in the oxidation step. The purified single-stranded siRNA was double-stranded to obtain the double-stranded siRNA described above.
[0428] The siRNAs were modified on the passenger strand with up to 12 phosphorylguanidine (PG) bonds in the case of SSB siRNAs and up to 15 PG bonds in the case of MSTN siRNAs. DAR2 AOCs or conjugates were synthesized by conjugating two siRNAs to an anti-TfR1 antibody, as described in Example 1.
[0429] The ability of conjugates to mediate the downregulation of SSB mRNA in the muscle tissue of wild-type CD-1 mice was evaluated. Mice were administered intravenously (iv) at 5 mg / kg with a PBS vehicle control and the indicated ASC. After 28 days, gastrocnemius and cardiac tissues were collected and rapidly frozen in liquid nitrogen. mRNA knockdown in target tissues was determined using a comparative qPCR assay. Total RNA was extracted from the tissues, reverse transcribed, and mRNA levels were quantified using TaqMan qPCR with appropriately designed primers and probes. Housekeeping genes (PPIBs) were used as internal RNA loading controls, and results were calculated using a comparative Ct method, where the difference between the target gene Ct value and the PPIB Ct value (ΔCt) was calculated, and then further normalized to the PBS control group by obtaining a second difference (ΔΔCt).
[0430] Stem-loop qPCR assay for siRNA quantification Plasma samples were directly diluted in TE buffer containing 0.1% Triton-X. 50 mg of tissue fragments were homogenized in 1 mL of Trizol using a TillueLyser II tissue homogenizer (Qiagen), and then diluted in TE buffer containing 0.1% Triton-X. Standard curves were created by spiked siRNA into plasma or homogenized tissue from untreated animals, and then serially diluted with TE buffer containing 0.1% Triton-X. The antisense strand of siRNA was reverse transcribed using the TaqMan MicroRNA Reverse Transcription Kit (Applied Biosystems) with 94 nM sequence-specific stem-loop RT primers. cDNA from the RT step was used for real-time PCR using the TaqMan Fast Advanced Master Mix (Applied Biosystems) with 1.5 μM forward primers, 0.75 μM reverse primers, and 0.2 μM probe. Quantitative PCR reactions were performed using a ViiA 7 Real-Time PCR System (Life Technologies) under standard cycle conditions. Ct values were converted to plasma or tissue concentrations using a linear equation derived from the standard curve.
[0431] result The in vivo activity of DAR2 AOCs at increasing concentrations was evaluated for knockdown activity of SSB mRNA levels in muscle cells from gastrocnemius tissue (Figure 16A) and cardiac tissue (Figure 16B) using siRNA modified with 4, 8, and 12 PG bonds on the passenger strand (passenger strand having 2 PG bonds at the 5' and 3' ends, 4 PG bonds at the 5' and 3' ends, or 6 consecutive PG bonds at the 5' and 3' ends) on the passenger strand. DAR2 AOCs with siRNA modified with 4PG, 8PG, and 12PG patterns showed higher knockdown SSB mRNA activity on day 28 compared to DAR2 AOCs with unmodified siRNA (Figures 16A and 16B). DAR2 AOCs with siRNA modified with 12PG showed the most SSB mRNA knockdown in both tissues. Furthermore, plasma studies showed that 6 hours after injection, the levels of 8PG-modified SSB siRNA were significantly higher than those of unmodified (0PG) siRNA (Figure 16C). In addition, plasma studies conducted with MSTN DAR2 AOCs of 0PG, 4PG, 8PG, and 15PG showed that the levels of siRNA modified with increasing PG modification were significantly higher than those of unmodified (0PG) siRNA 6 hours after injection (Figure 16D).
[0432] These results indicate that the presence of at least four PG bonds on the passenger strands of two antibody-conjugated siRNAs enhances DAR2 AOC activity by increasing KD activity and improving the stability of the AOC molecule, as suggested by the increased siRMA plasma concentration.
[0433] In summary, the biological activity of DAR2 AOC was enhanced by having a passenger chain modified with at least four PG bonds. These results also apply to at least two different genes tested, MSTN and SSB, indicating that the enhancement was not gene-specific.
[0434] Example 5: In vivo activity of DAR2 anti-transferrin receptor 1 mAb conjugated to MSTN siRNA modified with PG nucleotide binding. siRNAs were prepared and characterized as described in Example 1. The siRNAs were modified by substituting phosphorothioate bonds (P=S) on the guide or passenger strand with phosphorylguanidine (PG) bonds. Table 6 shows the locations of the phosphorylguanidine (PG)-modified internucleotide bonds on the guide, passenger, or both strands of the siRNA. DAR2 AOCs or conjugates were synthesized by conjugating two siRNAs with an anti-TfR1 antibody, as described in Example 1.
[0435] [Table 6] Lowercase (n) without an *f indicates a 2'-O-methyl modified nucleotide (e.g., a indicates 2'-O-methyladenosine); uppercase (Nf) with an *f indicates a 2'-fluoro modified nucleotide (e.g., Af indicates 2'-fluoroadenosine); and (nPG) indicates a 2'-O-methyl modified nucleotide containing a phosphorylguanidine internucleotide bond at 3' (e.g., (aPG) indicates 2'-O-methyladenosine with a phosphorylguanidine internucleotide bond at 3'). vpUq or vpUm refers to vinylphosphonate modified nucleotides as shown in Table 1 above.
[0436] The conjugates were evaluated for their ability to mediate the downregulation of MSTN mRNA in the muscle tissue of wild-type CD-1 mice. Mice were administered intravenously (iv) with a PBS vehicle control and the indicated DAR2 AOC at a constant antibody dose of 10 mg / kg and a siRNA dose of 2 mg / kg. After 28 days, gastrocnemius muscle tissue was collected and rapidly frozen in liquid nitrogen. mRNA knockdown in the target tissue was determined using a comparative qPCR assay. Total RNA was extracted from the tissue, reverse transcribed, and mRNA levels were quantified using TaqMan qPCR with appropriately designed primers and probes. Housekeeping genes (PPIBs) were used as internal RNA loading controls, and results were calculated using a comparative Ct method, where the difference between the target gene Ct value and the PPIB Ct value (ΔCt) was calculated, and then further normalized to the PBS control group by obtaining a second difference (ΔΔCt).
[0437] result The in vivo activity of DAR2 AOCs with escalating concentrations, which are modified with PG bonds that substitute for P=S bonds on the passenger and guide strands, was evaluated in terms of MSTN mRNA knockdown activity (Figure 17A) and siRNA tissue concentration (Figure 17B) in muscle cells derived from gastrocnemius tissue. Figure 17A shows a bar graph quantifying MSTN mRNA% expression compared to a control for DAR2 AOC treatment. Two siRNAs (R3552 and R3553) with a passenger strand lacking PG internucleotide bonds and a guide strand modified with PG bonds substituting the P=S bond at the 3' end had no effect on DAR2 AOC knockdown activity. However, two siRNAs (R3554 and R3555) with a guide strand lacking PG internucleotide bonds and a passenger strand modified with two PG bonds substituting two P=S bonds on the 5' or 3' end improved DAR2 AOC knockdown activity. siRNA (R3556) with a guide strand lacking PG internucleotide bonds and a passenger strand modified with two PG bonds substituting two P=S bonds on the 5' and 3' ends exhibited the greatest DAR2 AOC knockdown activity. DAR2 AOC siRNA (R3557), which had a guide strand modified with a PG bond substituting a P=S bond on the 3' overhang and a passenger strand modified with two PG bonds substituting two P=S bonds on the 5' and 3' ends, showed low knockdown activity among DAR2 AOC siRNAs. Interestingly, DAR2 AOC siRNA (R3558), which had a guide strand modified with a PG bond substituting a P=S bond on the 3' end and a passenger strand modified with two PG bonds substituting two P=S bonds on the 5' and 3' ends, showed the maximum knockdown activity of DAR2 AOC, almost equal to that of R3556. This is interesting because the difference between R3557 and R3558 is the position of the PG bond on the guide strand. This demonstrates the importance of the position of siRNA modification.
[0438] Figure 17B shows a bar graph quantifying the gastrocnemius muscle tissue concentration after siRNA treatment. DAR2 AOCs with siRNA (3552) having a PG-modified guide chain had the highest siRNA tissue concentration. All other DAR2 AOCs with PG-modified siRNAs (R2492, R3553, R3554, R3555, R3556, R3557, and R3558) had relatively similar siRNA tissue concentrations, with R3558 being the highest in the group. Overall, the presence of PG binding on the siRNA in DAR2 AOCs had only a slight effect on siRNA delivery, as measured by siRNA tissue concentration.
[0439] In summary, all siRNAs on DAR2 AOC were delivered into the tissue, and siRNAs on DAR2 AOC with a guide strand that substituted P=S bonds with PG bonds in the 3' overhang and substituted all four PG-substituted P=S bonds on the passenger strand on DAR2 AOC showed reduced knockdown activity. These results suggest that DAR2 AOCs with siRNAs having P=S bonds in the 3' overhang cannot be substituted with PG bonds on the guide strand.
[0440] Example 6: In vivo activity of DAR2 anti-transferrin receptor 1 mAb conjugated to MSTN siRNA modified with PG nucleotide binding. siRNAs were prepared and characterized as described in Example 1. The siRNAs were modified with 4, 8, 12, or 14 phosphorylguanidine (PG) bonds on the passenger strand. Table 7 shows the positions of the nucleotide-nucleotide bonds modified with phosphorylguanidine (PG) bonds on the siRNA strand and passenger strand. DAR2 AOCs or conjugates were synthesized by conjugating two siRNAs with an anti-TfR1 antibody as described in Example 1.
[0441] [Table 7] Lowercase (n) without an *f indicates a 2'-O-methyl modified nucleotide (e.g., a indicates 2'-O-methyladenosine); uppercase (Nf) with an *f indicates a 2'-fluoro modified nucleotide (e.g., Af indicates 2'-fluoroadenosine); and (nPG) indicates a 2'-O-methyl modified nucleotide containing a phosphorylguanidine internucleotide bond at 3' (e.g., (aPG) indicates 2'-O-methyladenosine with a phosphorylguanidine internucleotide bond at 3'). vpUq or vpUm refers to vinylphosphonate modified nucleotides as shown in Table 1 above.
[0442] The conjugates were evaluated for their ability to mediate the downregulation of MSTN mRNA in the muscle tissue of wild-type CD-1 mice. Mice were administered intravenously (iv) with a constant antibody dose of 7 mg / kg and an siRNA dose of 1.4 mg / kg, along with a PBS vehicle control and a directed DAR2 AOC. After 14 or 28 days, gastrocnemius muscle tissue was collected and rapidly frozen in liquid nitrogen. mRNA knockdown in the target tissue was determined using a comparative qPCR assay. Total RNA was extracted from the tissue, reverse transcribed, and mRNA levels were quantified using TaqMan qPCR with appropriately designed primers and probes. Housekeeping genes (PPIBs) were used as internal RNA loading controls, and results were calculated using a comparative Ct method, where the difference between the target gene Ct value and the PPIB Ct value (ΔCt) was calculated, and then further normalized to the PBS control group by obtaining a second difference (ΔΔCt). result
[0443] The in vivo activity of modified DAR2 AOCs with siRNA modified with 4, 8, 12, or 14PG-linked siRNAs on the passenger strand and an unmodified guide strand (e.g., without PG-intenucleotide linkages) was evaluated on day 14 (left) or day 28 (right) in terms of MSTN mRNA knockdown activity (Figure 18A) and siRNA tissue concentration (Figure 18B) in muscle cells from gastrocnemius tissue. For all siRNAs modified with PG-linked siRNAs on the passenger strand, substitution of the four P=S bonds on the passenger strand with PG-linked siRNAs did not affect the knockdown activity of the DAR2 AOCs.
[0444] Figure 18A shows a bar graph of the percentage of expressed MSTN mRNA compared to the control. Increasing the number of PG bonds on the passenger strand of DAR2 AOC siRNA increased the knockdown activity of the siRNA at day 14 or day 28 compared to unmodified siRNA. Passenger strands of siRNA modified with 8 (R3668) or 12 PG (R3669) bonds had the highest maximal knockdown activity compared to siRNA with 0 PG (R2336), 4 PG (R3662), and 14 PG (R3671).
[0445] Figure 18B shows a bar graph quantifying the gastrocnemius muscle tissue concentration after siRNA treatment. The tissue concentration results reflected the %MSTN mRNA knockdown in Figure 18A. For example, concentrations of 8PG and 12PG were highest after treatment on days 14 and 28, while 14PG siRNA had lower tissue concentrations, which correlated with lower %MSTN mRNA knockdown. Also, on day 14, siRNA levels were much higher than on day 28.
[0446] The results indicate that DAR2 AOCs with siRNA modified with 8 or 12PG linkages provided optimal KD activity and tissue concentration, and the absence of P=S linkages on the passenger strand had no effect on the activity or tissue concentration of the modified siRNA.
[0447] Example 7: In vivo activity of DAR2 anti-transferrin receptor 1 mAb conjugated to MSTN siRNA modified with 8PG nucleotide linkage. siRNA was prepared and characterized as described in Example 1. The siRNA was modified with eight phosphorylguanidine (PG) bonds on the guide or passenger strand. Table 8 shows the positions of the eight PG bonds on the passenger strand of the siRNA. The DAR2 AOC or conjugate was synthesized by conjugating two siRNAs with an anti-TfR1 antibody as described in Example 1.
[0448] [Table 8] *Lowercase n without f refers to a 2'-O-methyl modified nucleotide (e.g., a refers to 2'-O-methyladenosine); uppercase Nf with f refers to a 2'-fluoro modified nucleotide (e.g., Af refers to 2'-fluoroadenosine); and [PG] refers to a phosphorylguanidine nucleotide bond.
[0449] The ability of conjugates to mediate the downregulation of MSTN mRNA in muscle tissue of wild-type CD-1 mice was evaluated. Mice were administered intravenously (iv) with a PBS vehicle control and the indicated DAR2 AOC at a constant antibody dose of 7.5 mg / kg and an siRNA dose of 1.4 mg / kg. After 28 days, gastrocnemius muscle tissue was collected and rapidly frozen in liquid nitrogen. mRNA knockdown in the target tissue was determined using a comparative qPCR assay. Total RNA was extracted from the tissue, reverse transcribed, and mRNA levels were quantified using TaqMan qPCR with appropriately designed primers and probes. Housekeeping genes (PPIBs) were used as internal RNA loading controls, and results were calculated using a comparative Ct method, where the difference between the target gene Ct value and the PPIB Ct value (ΔCt) was calculated, and then further normalized to the PBS control group by obtaining a second difference (ΔΔCt). result
[0450] The in vivo activity of DAR2 AOCs with siRNAs modified with 8 PG bonds on the passenger strand and unmodified guide strand was evaluated for their knockdown activity against MSTN mRNA levels at day 28 in muscle cells derived from gastrocnemius tissue (Figure 19). The position of the 8 PG bonds on the passenger strand varied among the siRNAs. The 8 PG bonds were equally or unequally located on both sides of the cleavage site on the passenger strand. As shown in Figure 19, two siRNAs (R4843 and R4846) with 4 PG bonds on both sides of the cleavage site exhibited increased knockdown activity compared to siRNA (R4845) with 6 PG bonds at the 3' end and 2 PG bonds at the 5' end of the cleavage site. However, the presence of 2 PG bonds at the 3' end and 6 PG bonds at the 5' end of the cleavage site was able to restore some activity in siRNA (R4844). The presence of a single additional PG bond adjacent to the linker on the 5' end of the passenger strand had no significant effect on siRNA activity. Interestingly, the activity of modified siRNA R4845 was similar to that of unmodified siRNA.
[0451] In summary, these results indicate that the activity of modified siRNA depends on the distribution and location of PG bonds to the cleavage site on the passenger strand. The best-performing siRNA in this group was siRNA modified with at least four PG bonds at the 3' and 5' ends of the cleavage site. siRNA modified with six PG bonds at the 3' end of the passenger strand cleavage site showed significantly reduced knockdown activity, while siRNA modified with six PG bonds at the 5' end of the passenger strand cleavage site showed relatively increased activity.
[0452] Example 8: In vivo activity of DAR2 anti-transferrin receptor 1 mAb conjugated to MSTN siRNA modified with up to 15 PG nucleotide interlinks. siRNAs were prepared and characterized as described in Example 1. The siRNAs were modified with up to 15 phosphorylguanidine (PG) bonds on the guide or passenger strand. Table 9 shows the positions of the phosphorylguanidine (PG) bonds on the guide strand of the siRNAs. DAR2 AOCs or conjugates were synthesized by conjugating two siRNAs to an anti-TfR1 antibody, as described in Example 1.
[0453] [Table 9] *Lowercase n without f refers to a 2'-O-methyl modified nucleotide (e.g., a refers to 2'-O-methyladenosine); uppercase Nf with f refers to a 2'-fluoro modified nucleotide (e.g., Af refers to 2'-fluoroadenosine); and [PG] refers to a phosphorylguanidine nucleotide bond.
[0454] The ability of conjugates to mediate the downregulation of MSTN mRNA in muscle tissue of wild-type CD-1 mice was evaluated. Mice were administered intravenously (iv) with a PBS vehicle control and the indicated DAR2 AOC at a constant antibody dose of 7.5 mg / kg and an siRNA dose of 1.4 mg / kg. After 28 days, gastrocnemius muscle tissue was collected and rapidly frozen in liquid nitrogen. mRNA knockdown in the target tissue was determined using a comparative qPCR assay. Total RNA was extracted from the tissue, reverse transcribed, and mRNA levels were quantified using TaqMan qPCR with appropriately designed primers and probes. Housekeeping genes (PPIBs) were used as internal RNA loading controls, and results were calculated using a comparative Ct method, where the difference between the target gene Ct value and the PPIB Ct value (ΔCt) was calculated, and then further normalized to the PBS control group by obtaining a second difference (ΔΔCt). result The in vivo activity of DAR2 AOCs with siRNAs modified with 1–15 PG bonds on the passenger and unmodified guide strands was evaluated in terms of MSTN mRNA level knockdown activity at day 28 in muscle cells derived from gastrocnemius tissue (Figure 20). DAR2 AOCs with siRNAs having PG-modified passenger strands exhibited greater knockdown activity than those with unmodified passenger strands. Passenger strands of siRNAs modified with up to 15 PG bonds showed greater knockdown activity compared to the control siRNA (R4847). The DAR2 AOCs with the most knockdown-active siRNAs had passenger strands modified with 14 PG bonds (R4886 and R4888) or 15 PG bonds (R4847). Interestingly, the presence of a single PG bond at the 5' end adjacent to the linker, combined with other PG bonds on the passenger strand (R4894 or R4896), reduced the knockdown activity of siRNAs not modified with PG at that location.
[0455] These results indicate that DAR2 AOC activity can be increased by the presence of up to 15 PG bonds on the passenger chain. Taken together, the location of PG bonds on the passenger chain influences the biological activity of siRNA conjugated to an antibody.
[0456] Example 9: In vivo activity of DAR2 anti-transferrin receptor 1 mAb conjugated to MSTN siRNA modified by PG nucleotide binding. siRNA was prepared and characterized as described in Example 1. The siRNA was modified on the passenger chain with 4, 6, 8, and 12 phosphorylguanidine (PG) links (the passenger chain had either 2 PG links at the 5' and 3' ends, 3 PG links at the 5' and 3' ends, 4 PG links at the 5' and 3' ends, or 6 PG links at the 5' and 3' ends). The DAR2 AOC or conjugate was synthesized by conjugating two siRNAs with an anti-TfR1 antibody as described in Example 1.
[0457] The conjugates were evaluated for their ability to mediate the downregulation of MSTN mRNA in the muscle tissue of wild-type CD-1 mice. Mice were administered intravenously (iv) with a PBS vehicle control and the indicated DAR2 AOC at a constant antibody dose of 7 mg / kg and an siRNA dose of 1.4 mg / kg. After 14 or 28 days, gastrocnemius muscle tissue was collected and rapidly frozen in liquid nitrogen. mRNA knockdown in the target tissue was determined using a comparative qPCR assay. Total RNA was extracted from the tissue, reverse transcribed, and mRNA levels were quantified using TaqMan qPCR with appropriately designed primers and probes. Housekeeping genes (PPIBs) were used as internal RNA loading controls, and results were calculated using a comparative Ct method, where the difference between the target gene Ct value and the PPIB Ct value (ΔCt) was calculated, and then further normalized to the PBS control group by obtaining a second difference (ΔΔCt).
[0458] result The in vivo activity of DAR2 AOCs, which have siRNAs modified with 0, 4, 6, 8, and 12PG-linked siRNAs on the passenger and unmodified guide strands, was evaluated by their knockdown activity of MSTN mRNA levels in gastrocnemius tissue-derived muscle cells at day 14 or day 28 (Figure 21A) or at day 28 (Figure 21B).
[0459] siRNAs with eight or more PG bonds (8PG and 12PG) on the passenger strand of the DAR2 AOC increased the knockdown activity of siRNA at day 14 or day 28 compared to unmodified siRNA. Passenger strands of siRNA modified with eight PG bonds exhibited the highest knockdown activity among the modified siRNA group at day 14 or day 28 (Figure 21A). The increase in the number of PGs on the passenger strand of modified siRNA correlated with a decrease in MSTN mRNA levels or an increase in knockdown activity by modified siRNA (Figure 21B). At day 28, modified siRNAs with a passenger strand having an 8PG pattern exhibited better knockdown activity than siRNAs modified with 4PG, 6PG, or 12PG patterns.
[0460] Overall, DAR2 AOCs with siRNA modified with 8 prostaglandins on the passenger strand exhibited the highest knockdown activity.
[0461] Example 10 In vivo activity of DAR2 anti-transferrin receptor 1 mAb conjugated to MSTN siRNA modified with PG nucleotide internucleotide binding on both strands. siRNA was prepared and characterized as described in Example 1. The siRNA was modified on a passenger chain having four phosphorylguanidine (PG) bonds and on a guide chain having two PG bonds. The DAR2 AOC or conjugate was synthesized by conjugating two siRNAs to an anti-TfR1 antibody, as described in Example 1.
[0462] The ability of conjugates to mediate the downregulation of MSTN or SSB mRNA in muscle tissue of wild-type CD-1 mice was evaluated. Mice were administered intravenously (iv) with a PBS vehicle control and the indicated DAR2 AOC at a constant antibody dose of mg / kg. After 28 days, gastrocnemius muscle tissue was collected and rapidly frozen in liquid nitrogen. mRNA knockdown in target tissue was determined using a comparative qPCR assay. Total RNA was extracted from the tissue, reverse transcribed, and mRNA levels were quantified using TaqMan qPCR with appropriately designed primers and probes. Housekeeping genes (PPIBs) were used as internal RNA loading controls, and results were calculated using a comparative Ct method, where the difference between the target gene Ct value and the PPIB Ct value (ΔCt) was calculated, and then further normalized to the PBS control group by obtaining a second difference (ΔΔCt).
[0463] While preferred embodiments of the Disclosure have been shown and described herein, it will be apparent to those skilled in the art that such embodiments are provided only as examples. Many variations, alterations, and substitutions can be conceived by those skilled in the art without departing from the Disclosure. It should be understood that various alternatives to the embodiments of the Disclosure described herein may be used in the practice of the Disclosure. The following claims define the scope of the Disclosure, and methods and structures within the scope of these claims and their equivalents are intended to be encompassed thereby.
Claims
1. Equation (I) A-(X-B) n Equation (I) (In the formula, A is the connecting part, B is a double-stranded oligonucleotide containing a guide strand and a passenger strand. X is a linker or connector. n is a number greater than or equal to 2. It is a conjugate of, The guide chain or the passenger chain is defined by formula (II) 【Chemistry 1】 (wherein, R 11 , R 12 , R 13 , and R 14 are each independently selected from -H, -C 1-10 alkyl, -C 2-10 alkenyl, -C 2-10 alkynyl, or -C 6-10 aryl, Optional, R 12 and R 13 These atoms, together with the atoms to which they are bonded, form a 5- to 8-membered heterocyclic substituent moiety selected from the group consisting of N-pyrrolidinyl, N-piperidinyl, N-azepanyl, N-azocanyl, and imidazolidine. A conjugate comprising at least one modified internucleotide bond containing the structure of [the specified structure].
2. R 12 and R 13 The conjugate according to claim 1, wherein they combine with the atoms to which they are bonded to form an imidazolidine.
3. The aforementioned nucleotide bond is given by formula (III) 【Chemistry 2】 A conjugate according to claim 1 or claim 2, having the structure of the present invention.
4. The conjugate according to any one of claims 1 to 3, wherein the internucleotide bond in formula (III) is a phosphorylguanidine (PG) bond.
5. R 11 , R 12 , R 13 , and R 14 However, -C 1-10 The conjugate according to claim 1, wherein it is alkyl.
6. The aforementioned nucleotide bond is given by formula (IV) 【Transformation 3】 The conjugate according to claim 5, having the structure described.
7. The conjugate according to any one of claims 1 to 6, wherein the at least one modified internucleotide bond of formula (II) is located at the 5' or 3' end of the guide chain.
8. The conjugate according to any one of claims 1 to 6, wherein the at least one modified internucleotide bond of formula (II) is located within the guide chain.
9. The conjugate according to any one of claims 1 to 6, wherein the at least one modified internucleotide bond of formula (II) is located in the 3' overhang of the double-stranded oligonucleotide.
10. The conjugate according to any one of claims 1 to 9, wherein the guide chain further comprises at least one phosphorothioate nucleotide bond.
11. The conjugate according to claim 10, wherein the at least one phosphorothioate nucleotide bond and the at least one modified nucleotide bond comprising the structure of formula (II) are adjacent to each other.
12. The conjugate according to any one of claims 1 to 11, wherein the passenger chain comprises at least one modified internucleotide bond of formula (II).
13. The conjugate according to any one of claims 1 to 12, wherein the passenger chain has up to 18 internucleotide bonds of formula (II).
14. The conjugate according to any one of claims 1 to 13, wherein the at least one modified internucleotide bond of formula (II) is not located at a cleavage site of the passenger chain.
15. The conjugate according to any one of claims 1 to 13, wherein the at least one modified internucleotide bond of formula (II) is located at the 5' or 3' end of the passenger strand.
16. The conjugate according to any one of claims 1 to 13, wherein the at least one modified internucleotide bond of formula (II) is located inside the passenger chain.
17. The conjugate according to any one of claims 1 to 16, wherein the double-stranded oligonucleotide further comprises at least one 2'-modified nucleotide or at least one inverted debase moiety.
18. The conjugate according to any one of claims 1 to 13, wherein the passenger chain comprises two modified internucleotide bonds of formula (II) at the 3' end and two modified internucleotide bonds of formula (II) at the 5' end.
19. The conjugate according to any one of claims 1 to 13, wherein the passenger chain comprises four modified internucleotide bonds of formula (II) at the 3' end and four modified internucleotide bonds of formula (II) at the 5' end.
20. The conjugate according to any one of claims 1 to 13, wherein the passenger chain comprises 18 modified internucleotide bonds of formula (II).
21. The conjugate according to any one of claims 1 to 20, wherein the passenger strand comprises two modified internucleotide bonds of formula (II) at its 3' end and two modified internucleotide bonds of formula (II) at its 5' end, and the guide strand comprises two modified internucleotide bonds of formula (II) at its 3' end and two modified internucleotide bonds of formula (II) at its 5' end.
22. The conjugate according to claim 21, wherein at least one 2'-modified nucleotide comprises a nucleotide modified with 2'-O-methyl, 2'-O-methoxyethyl (2'-O-MOE), 2'-O-aminopropyl, 2'-deoxy, 2'-deoxy-2'-fluoro, 2'-O-aminopropyl (2'-O-AP), 2'-O-dimethylaminoethyl (2'-O-DMAOE), 2'-O-dimethylaminopropyl (2'-O-DMAP), 2'-O-dimethylaminoethyloxyethyl (2'-O-DMAEOE), or 2'-O-N-methylacetamide (2'-O-NMA).
23. The conjugate according to claim 21, wherein at least one 2'-modified nucleotide comprises locked nucleic acid (LNA) or ethylene nucleic acid (ENA).
24. The conjugate according to claim 21, wherein at least one inverse debase portion is at least one terminal.
25. The conjugate according to claim 21, wherein at least one 2'-modified nucleotide comprises at least one non-natural nucleotide.
26. The conjugate according to any one of claims 1 to 25, wherein the double-stranded oligonucleotide further comprises a nucleotide modified with a vinyl phosphonate at its 5' end.
27. The conjugate according to any one of claims 1 to 26, wherein the double-stranded oligonucleotide further comprises a modified internucleotide bond selected from alkylphosphonates, triesters, or mesylphospholamidiates.
28. A conjugate according to any one of claims 1 to 27, wherein X is a conjugate.
29. X is C 1 -C 6 A conjugate according to any one of claims 1 to 27, wherein the conjugate is an alkyl group.
30. X is C 1 -C 6 The conjugate according to any one of claims 1 to 27, which is a homobifunctional linker or heterobifunctional linker that is optionally conjugated to an alkyl group.
31. The conjugate according to any one of claims 1 to 27, wherein X is a heterobifunctional linker.
32. The aforementioned heterobifunctional linker is optionally C 1 -C 6 The conjugate according to claim 31, wherein succinimidyl-4-(N-maleimidomethyl)cyclohexane-1-carboxylate (sMCC) is conjugated to an alkyl group.
33. The conjugate according to any one of claims 1 to 27, wherein X is a severable linker.
34. The conjugate according to any one of claims 1 to 27, wherein X is a non-cuttable linker.
35. The conjugate according to any one of claims 1 to 34, wherein the binding portion is selected from the group consisting of polypeptides, proteins, antibodies, or antigen-binding fragments thereof.
36. The conjugate according to any one of claims 1 to 35, wherein the binding portion is an antibody or an antigen-binding fragment thereof.
37. The conjugate according to claim 35 or claim 36, wherein the antibody or its antigen-binding fragment binds to a cell surface receptor.
38. The conjugate according to any one of claims 35 to 37, wherein the antibody or its antigen-binding fragment comprises a humanized antibody or its antigen-binding fragment, a chimeric antibody or its antigen-binding fragment, a monoclonal antibody or its antigen-binding fragment, a monovalent Fab', a bivalent Fab2, a single-chain variable fragment (scFv), a diabody, a minibody, a nanobody, a single-domain antibody (sdAb), or a camelid antibody or its antigen-binding fragment.
39. The conjugate according to any one of claims 1 to 38, wherein the conjugate has a drug-to-antibody ratio (DAR) of approximately 2:1, 3:1, or 4:
1.
40. The conjugate according to any one of claims 1 to 39, wherein the modified internucleotide bond of formula (II) on the guide chain or the passenger chain enhances the activity of the conjugate of formula (I).
41. The conjugate according to any one of claims 1 to 40, wherein the modified internucleotide bond of formula (II) on the guide strand or passenger strand of the siRNA increases the stability of the conjugate of formula (I).
42. A method for adjusting the mRNA expression level of a target gene, a. A step of providing a conjugate according to any one of claims 1 to 41, b. A step of administering the conjugate to the subject, wherein the conjugate reduces the mRNA expression level of the gene in the subject. A method that includes this.
43. The method according to claim 42, wherein the conjugate reduces the expression level of the gene by at least about 20%, 25%, 30%, 35%, 40%, 45%, 50%, 55%, 60%, 65%, 70%, 75%, 80%, 85%, 90%, or 95% compared to a control sample.
44. The method according to claim 42 or 43, wherein the conjugate has an increased plasma half-life compared to a similar conjugate comprising a phosphorothioate internucleotide bond exchanged at the position of the modified internucleotide bond of formula (II).
45. A method for treating muscular atrophy or myotonic dystrophy in a person requiring treatment for muscular atrophy or myotonic dystrophy, a. A step of providing a conjugate according to any one of claims 1 to 41, b. A step of administering the conjugate to the subject, wherein the conjugate mediates RNA interference with target mRNA in the subject, thereby treating muscle atrophy or myotonic dystrophy in the subject. A method that includes this.