Conjugated polyethyleneimine compounds and compositions, and their use for the treatment of atherosclerosis, cardiovascular disease, and pulmonary disease.

Abstract

This specification provides lipid-conjugate polyethyleneimine (PEI) compounds of formula (I) that are useful for forming delivery systems such as lipid nanoparticles for delivering active substances (e.g., nucleic acid molecules) to cells (e.g., endothelial cells). This specification also provides methods for treating atherosclerosis, cardiovascular disease, pulmonary hypertension (e.g., pulmonary arterial hypertension or secondary pulmonary hypertension), lung cancer, lung metastases, chronic obstructive pulmonary disease (COPD), bronchiolitis obliterans, bronchiolitis obliterans with organizing pneumonia (BOOP), pulmonary fibrosis, or fibrous lung disease, comprising administering a pharmaceutical composition comprising a lipid-conjugate polyethyleneimine (PEI) compound of formula (I), an active substance, and a pharmaceutically acceptable excipient to a target.

Description

[Technical Field]

[0001] 1. Priority This application claims priority to U.S. Patent Applications No. 63 / 497,336, No. 63 / 497,341, and No. 63 / 497,345, filed on April 20, 2023, each of which is incorporated herein by reference in whole.

[0002] 2. Sequence Listing This application includes a computer-readable sequence listing in XML file format filed with this application, the entire contents of which are incorporated herein by reference. The sequence listing XML file filed with this application is named "14766-001-228_SEQLISTING.xml", was created on 18 April 2024, and is 55,462 bytes in size.

[0003] 3. Field This specification provides lipid-conjugate polyethyleneimine (PEI) compounds of formula (I) that are useful for forming delivery systems, such as lipid nanoparticles, for delivering active substances (e.g., nucleic acid molecules) to cells (e.g., endothelial cells). This specification also provides a method for treating atherosclerosis, cardiovascular disease, pulmonary hypertension (e.g., pulmonary arterial hypertension or secondary pulmonary hypertension), lung cancer, lung metastasis, chronic obstructive pulmonary disease (COPD), bronchiolitis obliterans, bronchiolitis obliterans with organizing pneumonia (BOOP), pulmonary fibrosis, or fibrous lung disease, comprising administering a pharmaceutical composition comprising a lipid-conjugate polyethyleneimine (PEI) compound of formula (I), an active substance, and a pharmaceutically acceptable excipient to a target. In specific embodiments, the active substance is an siRNA directed to transforming growth factor beta receptor 1 (TGFβR1) or transforming growth factor beta receptor 2 (TGFβR2). 4. [Background technology]

[0004] Lipid nanoparticles (LNPs) are one of the most clinically advanced nonviral delivery media for carrying RNA therapeutics. While nanoparticles capable of being taken up by reticuloendothelial system (RES) organs such as the liver and spleen are common, potent and safe targeting of non-phagocytic cells, such as hepatocytes in the liver, has been a long-standing challenge. This challenge has been addressed by ONPATTRO® and other LNPs utilizing similar scientific principles. See, for example, Jadhav, V. et al. Nature Biotechnology, 2024, 42, 394-405. These advances have opened pathways for potent and safe delivery of nucleic acids systemically to hepatocytes in the liver and locally to muscle cells and immune cells via intramuscular pathways. However, targeting non-hepatic cell populations with siRNA LNPs remains challenging, particularly outside of RES organs. Overcoming this limitation in biodistribution is crucial for the eventual clinical application of siRNA-based therapeutics for non-hepatic cell populations.

[0005] Recent studies have highlighted the importance of endothelial cells in the pathogenesis of chronic inflammation-related diseases such as atherosclerosis and pulmonary hypertension (PH). See, for example, Chen, PY et al. Nat Metab 1, 912-926 (2019). Consequently, LNPs capable of delivering active ingredients to endothelial cells are needed. 5. [Overview of the project]

[0006] In one embodiment, the compound of formula (I) is used herein: [ka] or a salt thereof, in the formula R 1 and R 2 A compound or a salt thereof is provided, as defined herein or elsewhere.

[0007] In one embodiment, as used herein, a compound of formula (I) or a salt thereof, wherein each R1 is, independently, hydrogen or a group of formula (i) [Chemical formula] and each R 2 is, independently, hydrogen or a group of formula (i), R 3 is, independently, substituted or unsubstituted alkyl, substituted or unsubstituted alkenyl, substituted or unsubstituted alkynyl, substituted or unsubstituted heteroalkyl, substituted or unsubstituted heteroalkenyl, substituted or unsubstituted heteroalkynyl, substituted or unsubstituted carbocyclic, substituted or unsubstituted heterocyclic, substituted or unsubstituted aryl, substituted or unsubstituted heteroaryl, or a hydrophilic polymer, provided that at least one R 1 or at least one R 2 is a group of formula (i), a compound or a salt thereof is provided.

[0008] In some embodiments, 4 to 12 of R 1 and R 2 are groups of formula (i). In some embodiments, 9 of R 1 and R 2 are groups of formula (i). In some embodiments, 6 of R 1 and 3 of R 2 are groups of formula (i). In some embodiments, 8 of R 1 and R 2 are groups of formula (i). In some embodiments, 6 of R 1 and 2 of R 2 are groups of formula (i). In some embodiments, 7 of R 1 and R 2 are groups of formula (i). In some embodiments, 6 of R 1 and 1 of R 2 are groups of formula (i). In some embodiments, 6 of R 1 and R 2 are groups of formula (i). In some embodiments,1 Six of these are the bases of equation (i). In some embodiments, R 1 and R 2 Five of these are the base of equation (i). In some embodiments, R 1 Five of these are the base of equation (i). In some embodiments, R 1 and R 2 Four of these are the base of equation (i). In some embodiments, R 1 Four of these are bases of formula (i). In some embodiments, the bases of formula (i) are bases of formula (ia). [ka]

[0009] In some embodiments, R 3 Each of these is independently a substituted or unsubstituted alkyl, a substituted or unsubstituted alkenyl, or a substituted or unsubstituted heteroalkyl. In some embodiments, R 3 Each of them is independently a substituted or unsubstituted alkyl. In some embodiments, R 3 Each of these can be independently substituted or not substituted C8~C 50 It is alkyl. In some embodiments, R 3 Each of these can be independently substituted or non-substituted C 10 ~C 18 It is alkyl. In some embodiments, R 3 Each of these can be independently substituted or non-substituted C 13 It is alkyl. In some embodiments, R 3 Each of these is non-substitutable. In some embodiments, R 3 Each of these independently, -(CH2) n CH3 is an integer between 10 and 18. In some embodiments, R 3 Each of these independently, -(CH2) 12 It is CH3.

[0010] In some embodiments, the compound is one of the compounds listed in Table 3. In some embodiments, the compound is [ka] That is the case.

[0011] In some embodiments, the compound is [ka] That is the case.

[0012] In some embodiments, the compounds have a purity of about 99%, about 95%, about 90%, about 85%, about 80%, about 75%, about 70%, about 65%, about 60%, about 55%, or about 50%. In some embodiments, the compounds have a purity of about 99%, about 95%, about 90%, or about 85%.

[0013] In another embodiment, the Specified herein provides pharmaceutical compositions comprising the compounds of the Disclosure and pharmaceutically acceptable excipients. In some embodiments, the pharmaceutical composition comprises about 20 weight percent, about 25 weight percent, about 30 weight percent, about 35 weight percent, about 40 weight percent, about 45 weight percent, about 50 weight percent, about 55 weight percent, about 60 weight percent, about 65 weight percent, about 70 weight percent, about 75 weight percent, and about 80 weight percent of the compounds described herein. In some embodiments, the pharmaceutical composition comprises about 70 weight percent, about 80 weight percent, or about 90 weight percent of the compounds described herein.

[0014] In some embodiments, the compound is in the form of particles. In some embodiments, the particles are nanoparticles or fine particles. In some embodiments, the particles are micelles, liposomes, or lipoplexes. In some embodiments, the particles encapsulate the active substance. In some embodiments, the nanoparticles further comprise lipid poly(ethylene glycol). In some embodiments, the mass ratio of compound:lipid poly(ethylene glycol):nucleic acid is about 7:1.2:1.5.

[0015] In one embodiment, the pharmaceutical composition further comprises an active substance. In one embodiment, the active substance is an organic molecule, an inorganic molecule, a nucleic acid, a protein, a polypeptide, a polynucleotide, a targeting agent, an isotope-labeled compound, a vaccine, or an immunoassay. In one embodiment, the active substance is a polynucleotide comprising DNA or RNA. In one embodiment, the RNA is coding RNA. In one embodiment, the RNA is non-coding RNA. In one embodiment, the RNA is mRNA, RNAi, ssRNA, dsRNA, siRNA, shRNA, miRNA, or antisense RNA. In some embodiments, the polynucleotide and compound are not covalently bonded. In one embodiment, the polynucleotide and compound associate with each other (e.g., by ionic bonds, hydrophobic bonds, hydrogen bonds, electrostatic interactions, van der Waals interactions, or other interactions). In some embodiments, the pharmaceutical composition comprises an active substance described in Section 7.5.2 or the Examples section (e.g., Example 3 or Example 8). In some embodiments, the active substance comprises an antibody or its antigen-binding fragment that binds to transforming growth factor β receptor 1 (TGFβR1) or transforming growth factor β receptor 2 (TGFβR2). In some embodiments, the activator comprises a polynucleotide encoding an antibody or antigen-binding fragment thereof that binds to TGFβR1 or TGFβR2. In some embodiments, the activator comprises a TGFβR1 decoy. In some embodiments, the activator comprises a TGFβR2 decoy. In some embodiments, the activator comprises a polynucleotide encoding a TGFβR1 decoy. In some embodiments, the activator comprises a polynucleotide encoding a TGFβR2 decoy. In some embodiments, the activator comprises siRNA or another inhibitory RNA that targets TGFβR1 or TGFβR2. In some embodiments, the activator comprises a lung cancer antigen. In some embodiments, the activator comprises siRNA or another inhibitory RNA that targets TGFβR1 or TGFβR2. In some embodiments, the siRNA is transforming growth factor beta receptor 1 ("TGFβR1") siRNA.In some embodiments, the TGFβR1 siRNA comprises SEQ ID NOs: 7 and 8. In some embodiments, the inhibitory RNA is mRNA, RNAi, shRNA, or antisense RNA. In some embodiments, the polynucleotide comprises DNA or RNA.

[0016] In some embodiments, the compound is not covalently bonded to a polynucleotide, siRNA, or another inhibitory RNA.

[0017] In some embodiments, the Specified Provisions provide nanoparticles comprising the compounds of the Disclosure and nucleic acids, proteins, or polypeptides. In one embodiment, the nucleic acid is DNA or RNA. In one embodiment, the RNA is mRNA, RNAi, ssRNA, dsRNA, siRNA, shRNA, miRNA, or antisense RNA. In one embodiment, the nanoparticles further comprise lipid poly(ethylene glycol). In one embodiment, the mass ratio of compound:lipid poly(ethylene glycol):nucleic acid is about 7:1.2:1.5.

[0018] In another embodiment, this specification provides a method for delivering an active substance to target cells, tissues, or organs, comprising contacting the target cells, tissues, or organs with a pharmaceutical composition or nanoparticles described herein. In one embodiment, the cells are endothelial cells. In one embodiment, the tissue or organ includes endothelial cells. In a specific embodiment, this specification provides a method for delivering an active substance to endothelial cells, comprising administering the pharmaceutical composition or nanoparticles described herein to a target. In a specific embodiment, the composition or nanoparticles are administered intravenously to the target.

[0019] In another aspect, this specification provides a method for treating endothelium-dependent disorders, comprising: (i) a compound of formula (I) to an object requiring treatment (e.g., a human) [ka] A method is provided comprising administering (ii) a pharmaceutical composition comprising a salt thereof, an active substance, and a pharmaceutically acceptable excipient, or (ii) nanoparticles comprising a compound of formula (I) or a salt thereof, and an active substance. In specific embodiments, the method comprises intravenous (iv) administration of the pharmaceutical composition or nanoparticles.

[0020] In another aspect, the Specified Method for Treating Atherosclerosis, Cardiovascular Disease, Pulmonary Hypertension (e.g., pulmonary arterial hypertension or secondary pulmonary hypertension), Lung Cancer, Lung Metastasis, Chronic Obstructive Pulmonary Disease (COPD), Obstructive Bronchiolitis, Obstructive Bronchiolitis with Organizing Pneumonia (BOOP), Pulmonary Fibrosis, or Fibrous Lung Disease, comprising: (i) a compound of formula (I) to a subject requiring treatment (e.g., a human) [ka] A method is provided comprising administering (ii) a pharmaceutical composition comprising a salt thereof, an active substance, and a pharmaceutically acceptable excipient, or (ii) nanoparticles comprising a compound of formula (I) or a salt thereof, and an active substance. In specific embodiments, the method comprises intravenous (iv) administration of the pharmaceutical composition or nanoparticles.

[0021] In some embodiments, the activator comprises an antibody or antigen-binding fragment thereof that binds to transforming growth factor beta receptor 1 (TGFβR1) or transforming growth factor beta receptor 2 (TGFβR2). In some embodiments, the activator comprises a polynucleotide encoding an antibody or antigen-binding fragment thereof that binds to TGFβR1 or TGFβR2. In some embodiments, the activator comprises a TGFβR1 decoy. In some embodiments, the activator comprises a TGFβR2 decoy. In some embodiments, the activator comprises a polynucleotide encoding a TGFβR1 decoy. In some embodiments, the activator comprises a polynucleotide encoding a TGFβR2 decoy. In some embodiments, the activator comprises siRNA or another inhibitory RNA that targets TGFβR1 or TGFβR2. In some embodiments, the activator comprises a lung cancer antigen. In some embodiments, the activator comprises siRNA or another inhibitory RNA that targets TGFβR1 or TGFβR2. In some embodiments, the siRNA is transforming growth factor beta receptor 1 ("TGFβR1") siRNA. In some embodiments, the TGFβR1 siRNA comprises SEQ ID NOs: 7 and 8. In some embodiments, the inhibitory RNA is mRNA, RNAi, shRNA, or antisense RNA. In some embodiments, the polynucleotide comprises DNA or RNA.

[0022] In some embodiments, the compound is not covalently bonded to a polynucleotide, siRNA, or another inhibitory RNA.

[0023] In some embodiments, this method is for treating pulmonary hypertension (e.g., pulmonary arterial hypertension or secondary pulmonary hypertension). In some embodiments, the pulmonary hypertension is pulmonary arterial hypertension. In some embodiments, the pulmonary hypertension is secondary pulmonary hypertension.

[0024] In some embodiments, the method is for treating lung cancer. In some embodiments, lung cancer is bronchogenic carcinoma, non-small cell lung cancer (NSCLC), adenocarcinoma, squamous cell carcinoma, large cell carcinoma, small cell lung cancer (SCLC), pulmonary carcinoid tumor, adenoid cystic carcinoma, lymphoma, or sarcoma.

[0025] In some embodiments, the method is for treating lung metastases. In some embodiments, lung metastases are metastases from breast cancer, colon cancer, rectal cancer, head cancer, cervical cancer, kidney cancer, testicular cancer, uterine cancer, or lymphoma.

[0026] In some embodiments, this method is for treating COPD. In some embodiments, this method is for treating bronchiolitis obliterans. In some embodiments, this method is for treating bronchiolitis obliterans with organizing pneumonia (BOOP). In some embodiments, this method is for treating pulmonary fibrosis. In some embodiments, this method is for treating fibrous lung disease.

[0027] In some embodiments, the method is for treating atherosclerosis. In some embodiments, the method is for treating cardiovascular diseases. In some embodiments, cardiovascular diseases include coronary artery disease, stroke, heart failure, hypertensive heart disease, rheumatic heart disease, cardiomyopathy, arrhythmia, congenital heart disease, valvular heart disease, carditis, aortic aneurysm, peripheral artery disease, thromboembolism, or venous thrombosis.

[0028] In another embodiment, the Specified Provisions provide a double-stranded RNA (dsRNA) oligonucleotide or a double-stranded RNA-like (dsRNA-like) oligonucleotide that is directed towards transforming growth factor beta receptor 1 (TGFβR1), comprising an antisense strand and a sense strand. In some embodiments, the Specified Provisions provide a double-stranded RNA oligonucleotide or a double-stranded RNA-like oligonucleotide that is directed towards transforming growth factor beta receptor 1 (TGFβR1), comprising an antisense strand and a sense strand, wherein the sense strand comprises the nucleotide sequence of SEQ ID NO: 7. In some embodiments, the Specified Provisions provide a double-stranded RNA oligonucleotide or a double-stranded RNA-like oligonucleotide that is directed towards transforming growth factor beta receptor 1 (TGFβR1), comprising an antisense strand and a sense strand, wherein the antisense strand comprises the nucleotide sequence of SEQ ID NO: 8.

[0029] The sense and antisense strands of a dsRNA or dsRNA-like (e.g., chemically modified RNA) oligonucleotide may be the same length or different lengths. The sense and antisense strands of a dsRNA or dsRNA-like (e.g., chemically modified RNA) oligonucleotide may each be 19 to 30 nucleotides long. In specific embodiments, the sense and antisense strands of a dsRNA or dsRNA-like oligonucleotide are each 30 nucleotides or less in length. In some embodiments, the sense and antisense strands of a dsRNA or dsRNA-like oligonucleotide are independently 19 to 30 nucleotides long. In some embodiments, the sense and antisense strands of a dsRNA or dsRNA-like oligonucleotide are independently 19 to 25 nucleotides long. In some embodiments, the sense and antisense strands of a dsRNA or dsRNA-like oligonucleotide are independently 20 to 25 nucleotides long. In a particular embodiment, the sense and antisense strands of a dsRNA or dsRNA-like oligonucleotide are independently 19 to 21 nucleotides long.

[0030] The double-stranded region formed by the hybridization of the antisense and sense strands of a dsRNA or dsRNA-like oligonucleotide can be the full length of both strands. For example, the antisense strand of a dsRNA or dsRNA-like oligonucleotide may be 19 nucleotides long, and the sense strand may be 19 nucleotides long, and the double-stranded region formed by the hybridization of these strands is 19 nucleotides. In specific embodiments, the double-stranded region of the dsRNA or dsRNA-like oligonucleotide is long enough to function as a substrate for the Dicer enzyme. In some embodiments, the double-stranded region of the dsRNA or dsRNA-like oligonucleotide is 15 to 30 base pairs long. For example, the double-stranded regions of dsRNA or dsRNA-like oligonucleotides are 15-29, 15-28, 15-27, 15-26, 15-25, 15-24, 15-23, 15-22, 15-21, 15-20, 15-19, 15-18, 15-17, 18-30, 18-29, 18-28, 18-27, 18-26, 18-25, 18-24, 18-23, 18-22, 18-21, 18-20, 19-30, The base pair lengths may be 19-29, 19-28, 19-27, 19-26, 19-25, 19-24, 19-23, 19-22, 19-21, 19-20, 20-30, 20-29, 20-28, 20-27, 20-26, 20-25, 20-24, 20-23, 20-22, 20-21, 21-30, 21-29, 21-28, 21-27, 21-26, 21-25, 21-24, 21-23, or 21-22. Ranges and values ​​between the ranges and values ​​listed above are also intended to be part of this disclosure. In some embodiments, the dsRNA or dsRNA-like oligonucleotide includes a double-stranded region longer than 30 base pairs and is processed into a functional double helix of, for example, 15–30 base pairs that targets TGFβR1 for cleavage. In some embodiments, the dsRNA or dsRNA-like oligonucleotide does not include a double-stranded region longer than 30 base pairs that is cleaved or otherwise processed to produce a functional double helix of, for example, 15–30 base pairs that targets TGFβR1 for cleavage.In some embodiments, the dsRNA or dRNA-like oligonucleotide is siRNA. In some embodiments, the dsRNA or dsRNA-like oligonucleotide is blunt-ended. In some embodiments, the sense strand or antisense strand of the dsRNA or dsRNA-like oligonucleotide includes an overhang. The overhang may be at the 5' end, 3' end, or both the 5' and 3' ends of either the sense strand or the antisense strand of the dsRNA or dsRNA-like oligonucleotide. In some embodiments, the sense strand and antisense strand of the dsRNA or dsRNA-like oligonucleotide include an overhang. The sense strand overhang may be at the 5' end of the sense strand, and the antisense strand overhang may be at the 3' end of the antisense strand. Alternatively, the sense strand overhang may be at the 3' end of the sense strand, and the antisense strand overhang may be at the 5' end of the antisense strand. In certain embodiments, the overhangs of the dsRNA or dsRNA-like oligonucleotide strand consist of 1-5 nucleotides, 1-4 nucleotides, 1-3 nucleotides, or 1-2 nucleotides. In some embodiments, the overhangs of the dsRNA or dsRNA-like oligonucleotide strand consist of 2-5 nucleotides, 2-4 nucleotides, 2-3 nucleotides, 3-4 nucleotides, 3-4 nucleotides, or 4-5 nucleotides.

[0031] In some embodiments, this specification provides a double-stranded RNA oligonucleotide or double-stranded RNA-like oligonucleotide that is directed towards transforming growth factor β receptor 1 (TGFβR1), comprising an antisense strand and a sense strand, wherein the sense strand comprises the nucleotide sequence of SEQ ID NO: 7, and the antisense strand comprises the nucleotide sequence of SEQ ID NO: 8.

[0032] In some embodiments, this specification provides an siRNA directed towards transforming growth factor β receptor 1 (TGFβR1), comprising an antisense strand and a sense strand, wherein the sense strand comprises the nucleotide sequence of SEQ ID NO: 7. In some embodiments, this specification provides an siRNA directed towards transforming growth factor β receptor 1 (TGFβR1), comprising an antisense strand and a sense strand, wherein the antisense strand comprises the nucleotide sequence of SEQ ID NO: 8.

[0033] The sense and antisense strands of an siRNA may be the same length or different lengths. The sense and antisense strands of an siRNA may each be 19 to 30 nucleotides long. In specific embodiments, the sense and antisense strands of an siRNA are each 30 nucleotides or less in length. In some embodiments, the sense and antisense strands of an siRNA are independently 19 to 30 nucleotides long. In some embodiments, the sense and antisense strands of an siRNA are independently 19 to 25 nucleotides long. In some embodiments, the sense and antisense strands of an siRNA are independently 20 to 25 nucleotides long. In some embodiments, the sense and antisense strands of an siRNA are independently 19 to 21 nucleotides long.

[0034] The double-stranded region formed by the hybridization of the antisense and sense strands of siRNA can be the full length of both strands. For example, the antisense strand of siRNA may be 19 nucleotides long, and the sense strand of siRNA may be 19 nucleotides long, and the double-stranded region formed by the hybridization of these strands is 19 nucleotides long. In specific embodiments, the double-stranded region of siRNA is long enough to function as a substrate for the Dicer enzyme. In some embodiments, the siRNA is 15 to 30 base pairs long. For example, the double-stranded regions of siRNA are 15-29, 15-28, 15-27, 15-26, 15-25, 15-24, 15-23, 15-22, 15-21, 15-20, 15-19, 15-18, 15-17, 18-30, 18-29, 18-28, 18-27, 18-26, 18-25, 18-24, 18-23, 18-22, 18-21, 18-20, 19-30, 19-29, 19- The base pair lengths may be 28, 19-27, 19-26, 19-25, 19-24, 19-23, 19-22, 19-21, 19-20, 20-30, 20-29, 20-28, 20-27, 20-26, 20-25, 20-24, 20-23, 20-22, 20-21, 21-30, 21-29, 21-28, 21-27, 21-26, 21-25, 21-24, 21-23, or 21-22. Ranges and values ​​between the ranges and values ​​listed above are also intended to be part of this disclosure. In some embodiments, the siRNA includes a double-stranded region longer than 30 base pairs and is processed into a functional double helix of, for example, 15-30 base pairs, targeting TGFβR1 for cleavage. In some embodiments, the siRNA does not contain a double-stranded region exceeding 30 base pairs that is cleaved or otherwise processed to produce a functional double helix of, for example, 15–30 base pairs that targets a target sequence for cleavage. In some embodiments, the siRNA is blunt-ended. In some embodiments, the sense or antisense strand of the siRNA includes an overhang. The overhang may be at the 5' end, 3' end, or both the 5' and 3' ends of either the sense or antisense strand of the siRNA.In some embodiments, the sense and antisense strands of the siRNA include overhangs. The sense strand overhang may be at the 5' end of the sense strand, and the antisense strand overhang may be at the 3' end of the antisense strand. Alternatively, the sense strand overhang may be at the 3' end of the sense strand, and the antisense strand overhang may be at the 5' end of the antisense strand. In certain embodiments, the overhangs of the siRNA strands consist of 1-5 nucleotides, 1-4 nucleotides, 1-3 nucleotides, or 1-2 nucleotides. In some embodiments, the overhangs of the siRNA strands consist of 2-5 nucleotides, 2-4 nucleotides, 2-3 nucleotides, 3-4 nucleotides, 3-4 nucleotides, or 4-5 nucleotides.

[0035] In some embodiments, this specification provides an siRNA directed to transforming growth factor β receptor 1 (TGFβR1), comprising an antisense strand and a sense strand, wherein the sense strand comprises the nucleotide sequence of SEQ ID NO: 7, and the antisense strand comprises the nucleotide sequence of SEQ ID NO: 8. In some embodiments, this specification provides an siRNA as described in Example 3 or Example 8 below.

[0036] In another embodiment, this specification provides compositions comprising dsRNA or dsRNA-like oligonucleotides as described herein. In some embodiments, this specification provides compositions (e.g., pharmaceutical compositions) comprising dsRNA or dsRNA-like oligonucleotides as described herein. In some embodiments, this specification provides compositions (e.g., pharmaceutical compositions) comprising siRNA as described herein. In some embodiments, the composition is a pharmaceutical composition and comprises a pharmaceutically acceptable carrier, excipient, or diluent. In some embodiments, the carrier is lipid nanoparticles or liposomes.

[0037] dsRNA or dsRNA-like oligonucleotides described herein, or compositions described herein containing such oligonucleotides, may be used in vitro or ex vivo to control TGFβR1 expression. For example, dsRNA or dsRNA-like oligonucleotides may be used to control (e.g., downregulate) TGFβR1 RNA and / or TGFβR1 protein. siRNAs described herein may be used in vitro or ex vivo to control TGFβR1 expression. For example, siRNAs may be used to control (e.g., downregulate) TGFβR1 RNA and / or TGFβR1 protein. In some embodiments, methods are provided herein for downregulating TGFβR1 expression in cells in cell culture or tissue samples in culture, comprising contacting the cell or tissue sample with a composition described herein. In some embodiments, TGFβR1 expression is downregulated at the RNA level. In some embodiments, TGFβR1 expression is downregulated at both the RNA and protein levels. TGFβR1 expression at the RNA level can be evaluated by RT-PCR or Northern blotting. TGFβR1 expression at the protein level can be evaluated by immunoassays such as ELISA, Western blotting, or FACS analysis.

[0038] In some embodiments, contact between cells (e.g., endothelial cells) or tissue samples (e.g., heart and / or lung samples) and the compositions disclosed herein (e.g., compositions comprising TGFβR1 siRNA, or nanoparticles described herein encapsulating TGFβR1 siRNA) reduces TGFβR1 (e.g., human TGFβR1) gene expression by at least 50%, at least 55%, or at least 60% compared to a control (e.g., negative control). In some embodiments, contact between cells (e.g., endothelial cells) or tissue samples (e.g., heart and / or lung samples) and the compositions disclosed herein (e.g., compositions comprising TGFβR1 siRNA, or nanoparticles described herein encapsulating TGFβR1 siRNA) reduces TGFβR1 (e.g., human TGFβR1) gene expression by at least 65%, at least 70%, or at least 75% compared to a control (e.g., negative control). In some embodiments, contact between cells (e.g., endothelial cells) or tissue samples (e.g., heart and / or lung samples) and the compositions disclosed herein (e.g., compositions comprising TGFβR1 siRNA, or nanoparticles described herein encapsulating TGFβR1 siRNA) reduces TGFβR1 (e.g., human TGFβR1) gene expression by at least 80% or at least 85% compared to a control (e.g., negative control). In some embodiments, contact between cells (e.g., endothelial cells) or tissue samples (e.g., heart and / or lung samples) and the compositions disclosed herein (e.g., compositions comprising TGFβR1 siRNA, or nanoparticles described herein encapsulating TGFβR1 siRNA) reduces TGFβR1 (e.g., human TGFβR1) gene expression by at least 90% or at least 95% compared to a control (e.g., negative control).In some embodiments, the control is a negative control, such as a buffer or siRNA that does not control the expression or activity of the TGFβR1 gene, and is brought into contact with the same type of cells (e.g., endothelial cells) or tissue sample as the composition disclosed herein (e.g., a composition comprising TGFβR1 siRNA or nanoparticles described herein for encapsulating TGFβR1 siRNA). In some embodiments, the control is the same type of cells (e.g., endothelial cells) or tissue sample before contact with the composition disclosed herein (e.g., a composition comprising TGFβR1 siRNA or nanoparticles described herein for encapsulating TGFβR1 siRNA).

[0039] In another embodiment, this specification provides a method for treating endothelium-dependent disorders, comprising administering a composition described herein, comprising a dsRNA oligonucleotide or a dsRNA-like oligonucleotide, to a subject requiring treatment (e.g., a human). In some embodiments, this specification provides a method for treating endothelium-dependent disorders, comprising administering a composition described herein, comprising an siRNA described herein, to a subject requiring treatment (e.g., a human).

[0040] In some embodiments, TGFβR1 siRNA comprising the nucleotide sequences described in SEQ ID NOs: 7 and 8 is provided herein. In some embodiments, a pharmaceutical composition comprising TGFβR1 siRNA and a pharmaceutically acceptable carrier, diluent, or excipient is provided herein. In some embodiments, a method for reducing TGFβR1 RNA in cells is provided herein, comprising contacting the cells with TGFβR1 siRNA or a pharmaceutical composition comprising TGFβR1 siRNA. In some embodiments, the cells are endothelial cells. In some embodiments, a method for reducing TGFβR1 RNA in cells, tissues, or organs of interest is provided herein, comprising intravenous administration of TGFβR1 siRNA or a pharmaceutical composition comprising TGFβR1 siRNA to the subject. In some embodiments, the subject is human. In some embodiments, the use of TGFβR1 siRNA or a pharmaceutical composition in the manufacture of a drug for reducing TGFβR1 RNA in cells, tissues, or organs is provided herein. In some embodiments, a TGFβR1 siRNA or pharmaceutical composition for use in a method of reducing TGFβR1 RNA in cells, tissues, or organs, wherein the method comprises administering the TGFβR1 siRNA or pharmaceutical composition to a subject. In some embodiments, the subject is human.

[0041] In another aspect, the Specified provides a method for treating atherosclerosis, cardiovascular disease, pulmonary hypertension (e.g., pulmonary arterial hypertension or secondary pulmonary hypertension), lung cancer, lung metastases, chronic obstructive pulmonary disease (COPD), bronchiolitis obliterans, bronchiolitis obliterans with organizing pneumonia (BOOP), pulmonary fibrosis, or fibrous lung disease, comprising administering to a subject in need of treatment (e.g., a human) a composition described herein comprising a dsRNA oligonucleotide or a dsRNA-like oligonucleotide. In some embodiments, the Specified provides a method for treating atherosclerosis, cardiovascular disease, pulmonary hypertension (e.g., pulmonary arterial hypertension or secondary pulmonary hypertension), lung cancer, lung metastases, chronic obstructive pulmonary disease (COPD), bronchiolitis obliterans, bronchiolitis obliterans with organizing pneumonia (BOOP), pulmonary fibrosis, or fibrous lung disease, the method comprising administering a composition described herein, comprising an siRNA described herein, to a subject in need of treatment (e.g., a human).

[0042] In some embodiments, a method for treating pulmonary hypertension (e.g., pulmonary arterial hypertension or secondary pulmonary hypertension) is provided, comprising administering a composition described herein, comprising a dsRNA oligonucleotide or a dsRNA-like oligonucleotide, to a subject (e.g., a human) requiring treatment. In some embodiments, the Specified provides a method for treating pulmonary hypertension (e.g., pulmonary arterial hypertension or secondary pulmonary hypertension) is provided, comprising administering a composition described herein, comprising a siRNA described herein, to a subject (e.g., a human) requiring treatment. In some embodiments, the pulmonary hypertension is pulmonary arterial hypertension. In some embodiments, the pulmonary hypertension is secondary pulmonary hypertension.

[0043] In some embodiments, the Specified provides a method for treating atherosclerosis, comprising administering a composition described herein, comprising a dsRNA oligonucleotide or a dsRNA-like oligonucleotide, to a subject requiring treatment (e.g., a human). In some embodiments, the Specified provides a method for treating atherosclerosis, comprising administering a composition described herein, comprising an siRNA described herein, to a subject requiring treatment (e.g., a human).

[0044] In some embodiments, the Specified provides a method for treating cardiovascular conditions, comprising administering a composition described herein, comprising a dsRNA oligonucleotide or a dsRNA-like oligonucleotide, to a subject requiring treatment (e.g., a human). In some embodiments, the Specified provides a method for treating cardiovascular diseases, comprising administering a composition described herein, comprising an siRNA described herein, to a subject requiring treatment (e.g., a human). In some embodiments, cardiovascular diseases include coronary artery disease, stroke, heart failure, hypertensive heart disease, rheumatic heart disease, cardiomyopathy, arrhythmia, congenital heart disease, valvular heart disease, carditis, aortic aneurysm, peripheral artery disease, thromboembolism, or venous thrombosis.

[0045] In some embodiments, this specification provides a method for treating lung cancer, comprising administering a composition described herein, comprising a dsRNA oligonucleotide or a dsRNA-like oligonucleotide, to a subject (e.g., a human) in need of treatment. In some embodiments, this specification provides a method for treating lung cancer, comprising administering a composition described herein, comprising an siRNA described herein, to a subject (e.g., a human) in need of treatment.

[0046] In some embodiments, lung cancer is bronchogenic carcinoma, non-small cell lung cancer (NSCLC), adenocarcinoma, squamous cell carcinoma, large cell carcinoma, small cell lung cancer (SCLC), pulmonary carcinoid tumor, adenoid cystic carcinoma, lymphoma, or sarcoma.

[0047] In some embodiments, the Specified provides a method for treating lung metastases, comprising administering a composition described herein, comprising a dsRNA oligonucleotide or a dsRNA-like oligonucleotide, to a subject (e.g., a human) requiring treatment. In some embodiments, the Specified provides a method for treating lung metastases, comprising administering a composition described herein, comprising an siRNA described herein, to a subject (e.g., a human) requiring treatment. In some embodiments, the lung metastases are metastases from breast cancer, colon cancer, rectal cancer, head cancer, cervical cancer, kidney cancer, testicular cancer, uterine cancer, or lymphoma.

[0048] In some embodiments, this specification provides a method for treating COPD, comprising administering a composition described herein, comprising a dsRNA oligonucleotide or a dsRNA-like oligonucleotide, to a subject requiring treatment (e.g., a human). In some embodiments, this specification provides a method for treating COPD, comprising administering a composition described herein, comprising an siRNA described herein, to a subject requiring treatment (e.g., a human).

[0049] In some embodiments, the Specified provides a method for treating bronchiolitis obliterans, comprising administering a composition described herein, comprising a dsRNA oligonucleotide or a dsRNA-like oligonucleotide, to a subject requiring treatment (e.g., a human). In some embodiments, the Specified provides a method for treating bronchiolitis obliterans, comprising administering a composition described herein, comprising an siRNA described herein, to a subject requiring treatment (e.g., a human).

[0050] In some embodiments, the Specified provides a method for treating bronchiolitis obliterans with organizing pneumonia (BOOP), comprising administering a composition described herein, comprising a dsRNA oligonucleotide or a dsRNA-like oligonucleotide, to a subject requiring treatment (e.g., a human). In some embodiments, the Specified provides a method for treating bronchiolitis obliterans with organizing pneumonia (BOOP), comprising administering a composition described herein, comprising an siRNA described herein, to a subject requiring treatment (e.g., a human).

[0051] In some embodiments, the Specified provides a method for treating pulmonary fibrosis, comprising administering a composition described herein, comprising a dsRNA oligonucleotide or a dsRNA-like oligonucleotide, to a subject requiring treatment (e.g., a human). In some embodiments, the Specified provides a method for treating pulmonary fibrosis, comprising administering a composition described herein, comprising an siRNA described herein, to a subject requiring treatment (e.g., a human).

[0052] In some embodiments, this specification provides a method for treating fibrous lung disease, comprising administering a composition described herein, comprising a dsRNA oligonucleotide or a dsRNA-like oligonucleotide, to a subject requiring treatment (e.g., a human). In some embodiments, this specification provides a method for treating fibrous lung disease, comprising administering a composition described herein, comprising an siRNA described herein, to a subject requiring treatment (e.g., a human).

[0053] In another aspect, this specification provides a method for preparing the compounds of the present disclosure, wherein the compound of formula (II) [ka] The epoxide of formula (III) [ka] A method is provided which includes carrying out the reaction in the presence of a solvent.

[0054] In one embodiment, the Specified Use of Nanoparticles Provided herein is provided for delivering nucleic acids, proteins, or polypeptides to cells (e.g., endothelial cells). In one embodiment, the Specified Use of Nanoparticles Provided herein is provided for delivering RNA molecules (e.g., siRNA) to cells (e.g., endothelial cells). 6. [Brief explanation of the drawing]

[0055] [Figure 1] The TLC plate of the fraction obtained from the purification of compound 1 is shown.

[0056] [Figure 2] A typical 1H NMR spectrum of compound 1 is shown.

[0057] [Figure 3A] The synthesis scheme for 7C1 is shown. [Figure 3B] This shows the thin-layer chromatography (TLC) of 7C1. [Figure 3C] The mass spectrometry of 7C1 is shown.

[0058] [Figure 4A] The psiCHECK2-IRES-let-7 8X structure is shown. The psiCheck2 plasmid contains the let-7 seed sequence eight times in tandem and is linked to the sea urchin luciferase sequence. Firefly luciferase was used as an internal control. Increased let-7 activity leads to decreased bioluminescence in sea urchins.

[0059] [Figure 4B]This shows the luciferase activity of 293T cell lines transfected with let-7 miRNA nanoparticles formulated using various fractions obtained from the preparation of compound 1.

[0060] [Figure 5] A shows the endothelial cell isolation scheme for in vivo cell uptake experiments by qRT-PCR. B shows the mRNA levels of transforming growth factor β receptor 1 ("TGFβR1" or "Tgfbr1") in isolated mouse cardiac and pulmonary endothelial cells 48 hours after intravenous injection of compound 9, compound 1, and reference 7C1 (BP = derived from branched PEI) at a dose of 0.5 mg / kg. β-actin was used to normalize the sample loading amount.

[0061] [Figure 6] A shows a schematic diagram of the experimental design of the compound 9-siTgfbr1 treatment for improving hypoxia-induced pulmonary hypertension. B shows summary plots of RVBP (right ventricular blood pressure) in hypoxic and hypoxia + compound 9-siTgfbr1 treated mice.

[0062] [Figure 7A-1] A typical 1H NMR spectrum of compound 9 is shown. [Figure 7A-2] A typical 1H NMR spectrum of compound 9 is shown. [Figure 7B] The mass spectrometry of compound 9 is shown.

[0063] [Figure 8A-1] A typical 1H NMR spectrum of compound 8 is shown. [Figure 8A-2] A typical 1H NMR spectrum of compound 8 is shown. [Figure 8B] The mass spectrometry of compound 8 is shown.

[0064] [Figure 9A-1] A typical 1H NMR spectrum of compound 7 is shown. [Figure 9A-2] A typical 1H NMR spectrum of compound 7 is shown. [Figure 9B] The mass spectrometry of compound 7 is shown.

[0065] [Figure 10A-1] The synthesis and chemical structure of tertiary amine cationic lipids are shown. [Figure 10A-2] The synthesis and chemical structure of tertiary amine cationic lipids are shown. [Figure 10A-3] The synthesis and chemical structure of tertiary amine cationic lipids are shown. [Figure 10A-4] The synthesis and chemical structure of tertiary amine cationic lipids are shown. [Figure 10A-5] The synthesis and chemical structure of tertiary amine cationic lipids are shown. [Figure 10A-6] The synthesis and chemical structure of tertiary amine cationic lipids are shown. [Figure 10A-7] The synthesis and chemical structure of tertiary amine cationic lipids are shown. [Figure 10B] The components of the corresponding LNPs are shown. The hydrodynamic particle size distribution of LNPs evaluated by DLS is expressed as a volume percentage.

[0066] [Figure 11A] The following shows characterization data for LNP formulations containing the indicated compounds. [Figure 11B] The Tgfbr1 mRNA levels in bEnd3.1 cells 48 hours after treatment with various doses of lipid-siTgfbr1 are shown. β-actin was used to normalize the sample load. The data are shown from left to right, in the order of compound 5, compound 6, compound 7, compound 8, compound 9, and compound 1. [Figure 11C] This shows TGFβR1 protein levels in bEnd3.1 cells 96 hours after treatment with various doses of lipid-siTgfbr1. HSP90 was used to normalize the sample load. [Figure 11D] This Western blot shows the time-dependent effect of lipid treatment on TGFβ1-mediated p-Smad2 and p-Smad3 activity in cultured bEnd3.1 cells.

[0067] [Figure 12] This paper presents an analysis of the biological fate of compound 1LNP in different mouse organs. Endothelial cell reporter mice were used in this study. After administering tamoxifen to 6-week-old Cdh5-CreERT2;mT / mG adult mice, endothelial cells could be visualized by GFP fluorescence, and non-endothelial cells by RFP fluorescence. A shows the quantitative results of the organ-specific in vivo distribution of LNP containing siLuciferase Alexa647. The mean fluorescence intensity was used to reflect the amount of nanoparticle uptake per cell. The histogram bars represent the mean Alexa647 signal intensity above the threshold ± standard error of measurement (SEM). Higher signal intensity indicates greater uptake of Alexa647-labeled compound 1LNP by the given organ. The bars, from left to right, represent background control, endothelial cells (EC), and non-EC for each given organ. B shows the quantitative results of the transfection percentages of GFP+ endothelial cells and RFP+ non-endothelial cells after intravenous injection of compound 1 / Alexa647 LNP. The bars, from left to right, represent EC and non-EC for each given organ.

[0068] [Figure 13A] This document outlines the experimental procedure for evaluating compound 1LNP in in vivo targeting of lung endothelial cells. [Figure 13B] This presents the FACS gating strategy. [Figure 13C] This shows the qRT-PCR analysis of Tgfbr1 gene expression in FACS-sorted GFP+ lung endothelial cells. [Figure 13D] This shows the Western blot analysis of TGFβR1 protein expression in FACS-sorted GFP+ lung endothelial cells.

[0069] [Figure 14A]The left image shows the experimental setup for evaluating in vivo siRNA delivery of a control to hypoxic lung endothelial cells, and the right image shows qRT-PCR analysis of Tgfbr1 gene expression in FACS-sorted GFP+ lung endothelial cells. Control animals were exposed to normal oxygen (20% oxygen). [Figure 14B] The image shows the experimental setup for intravenous injection of compound / siTgfbr1 LNP to evaluate in vivo siRNA delivery of LNP to hypoxic pulmonary endothelial cells (left), qRT-PCR analysis of Tgfbr1 gene expression in FACS-sorted GFP+ pulmonary endothelial cells (center), and Western blot analysis of TGFβR1 protein expression in FACS-sorted GFP+ pulmonary endothelial cells. Control animals were exposed to hypoxia (10% oxygen).

[0070] [Figure 15] The design of the prophylactic and therapeutic trials for compound 1 / siTgfbr1 is shown.

[0071] [Figure 16A] This report presents the analysis of compound 1 / Tgfbr1 LNP in a hypoxia-induced mouse hypertension model. Representative right ventricular blood pressure measurements are shown in normoxic, hypoxic, and hypoxia-treated mice with compound 1-siTgfbr1 LNP. [Figure 16B] This report presents the analysis of compound 1 / Tgfbr1 LNP in a hypoxia-induced mouse hypertension model. It also shows a quantitative analysis of right ventricular hypertrophy. [Figure 16C] This report presents an analysis of compound 1 / Tgfbr1 LNPs in a hypoxia-induced mouse hypertension model. The absolute number of fully muscularized pulmonary arterioles (less than 50 μm in diameter) is also shown. [Figure 16D] This report shows the analysis of compound 1 / Tgfbr1 LNP in a hypoxia-induced mouse hypertension model. It also shows the histological analysis of lung tissue containing p-Smad2.

[0072] [Figure 17A-1]This panel shows the effect of TGFβR1 siRNA LNP on IL-4 levels. The bars in the panel, from left to right, represent vehicle, 0.0625 mg / kg, 0.125 mg / kg, 0.25 mg / kg, 0.5 mg / kg, and 1 mg / kg. Animals injected with either the vehicle or test compound 1 / TGFβR1 siRNA LNP were analyzed for the presence of IL-4 in their plasma. Samples were obtained before administration, at 15 minutes, 6 hours, and on days 1, 2, 7, and 14. BDL: below detection limit. [Figure 17A-2] This panel shows the effect of TGFβR1 siRNA LNP on IL-4 levels. The bars in the panel, from left to right, represent vehicle, 0.0625 mg / kg, 0.125 mg / kg, 0.25 mg / kg, 0.5 mg / kg, and 1 mg / kg. Animals injected with either the vehicle or test compound 1 / TGFβR1 siRNA LNP were analyzed for the presence of IL-4 in their plasma. Samples were obtained before administration, at 15 minutes, 6 hours, and on days 1, 2, 7, and 14. BDL: below detection limit. [Figure 17B-1] This panel shows the effect of TGFβR1 siRNA LNP on IL-6 levels. The bars in the panel, from left to right, represent vehicle, 0.0625 mg / kg, 0.125 mg / kg, 0.25 mg / kg, 0.5 mg / kg, and 1 mg / kg. Animals injected with either the vehicle or test compound 1 / TGFβR1 siRNA LNP were analyzed for the presence of IL-6 in their plasma. Samples were obtained before administration, at 15 minutes, 6 hours, and on days 1, 2, 7, and 14. BDL: below detection limit. [Figure 17B-2] This panel shows the effect of TGFβR1 siRNA LNP on IL-6 levels. The bars in the panel, from left to right, represent vehicle, 0.0625 mg / kg, 0.125 mg / kg, 0.25 mg / kg, 0.5 mg / kg, and 1 mg / kg. Animals injected with either the vehicle or test compound 1 / TGFβR1 siRNA LNP were analyzed for the presence of IL-6 in their plasma. Samples were obtained before administration, at 15 minutes, 6 hours, and on days 1, 2, 7, and 14. BDL: below detection limit. [Figure 17C-1]This panel shows the effect of TGFβR1 siRNA LNP on IL-1β levels. The bars in the panel, from left to right, represent vehicle, 0.0625 mg / kg, 0.125 mg / kg, 0.25 mg / kg, 0.5 mg / kg, and 1 mg / kg. Animals injected with either the vehicle or test compound 1 / TGFβR1 siRNA LNP were analyzed for the presence of IL-1β in their plasma. Samples were obtained before administration, at 15 minutes, 6 hours, and on days 1, 2, 7, and 14. BDL: Below detection limit. [Figure 17C-2] This panel shows the effect of TGFβR1 siRNA LNP on IL-1β levels. The bars in the panel, from left to right, represent vehicle, 0.0625 mg / kg, 0.125 mg / kg, 0.25 mg / kg, 0.5 mg / kg, and 1 mg / kg. Animals injected with either the vehicle or test compound 1 / TGFβR1 siRNA LNP were analyzed for the presence of IL-1β in their plasma. Samples were obtained before administration, at 15 minutes, 6 hours, and on days 1, 2, 7, and 14. BDL: Below detection limit.

[0073] [Figure 18] The in vivo evaluation of siTGFβR1 on days 2 and 14 is shown. A shows the TGFBR1 mRNA levels in lung endothelial cells 2 days after treatment with escalating doses of compound 1 / TGFβR1 siRNA LNP. B shows the TGFBR1 mRNA levels in lung endothelial cells 14 days after treatment with escalating doses of compound 1 / TGFβR1 siRNA LNP. ACTB and CDH5 were used to normalize the sample load. All data are shown as mean ± SEM. 7. [Modes for carrying out the invention]

[0074] 7.1 General Technology The techniques and procedures described or referenced herein include those that are generally well understood by those skilled in the art and / or commonly employed using conventional methodologies, such as the widely used methodologies described in Sambrook et al., Molecular Cloning: A Laboratory Manual (3rd ed. 2001); Current Protocols in Molecular Biology (Ausubel et al. eds., 2003).

[0075] 7.2 Terminology Unless otherwise specified, all technical and scientific terms used herein have the same meaning as those generally understood by those skilled in the art. For the purpose of interpreting this specification, the following definitions of terms apply, and wherever appropriate, a singular term is also included in its plural form, and vice versa. All patents, applications, published applications and other publications are incorporated herein by reference in their entirety. In the event of any conflict between the description of any term used herein and any document incorporated herein by reference, the description of the term below shall prevail.

[0076] As used herein, unless otherwise specified, the term “lipids” refers to a group of organic compounds, including but not limited to esters of fatty acids, that are generally poorly soluble in water but soluble in many nonpolar organic solvents. While lipids are generally poorly soluble in water, certain types of lipids (e.g., lipids modified with polar groups, e.g., DMG-PEG2000) have limited water solubility and can dissolve in water under certain conditions. Known types of lipids include biomolecules such as fatty acids, waxes, sterols, fat-soluble vitamins, monoglycerides, diglycerides, triglycerides, and phospholipids. Lipids can be divided into at least three classes: (1) “simple lipids” including fats and oils and waxes; (2) “complex lipids” including phospholipids and glycolipids (e.g., DMPE-PEG2000); and (3) “derivative lipids” such as steroids. Furthermore, as used herein, lipids also encompass lipidoid compounds. The term "lipidoid compound," also simply called "lipidoid," refers to lipid-like compounds (for example, amphiphilic compounds that have lipid-like physical properties).

[0077] The terms “lipid nanoparticles” or “LNPs” refer to particles having at least one dimension on the order of nanometers (nm) (e.g., 1–100 nm) and containing one or more lipid molecules. LNPs provided herein may further contain at least one non-lipid payload molecule (e.g., one or more nucleic acid molecules). In some embodiments, the LNPs include a non-lipid payload molecule partially or completely encapsulated within a lipid shell. In particular, in some embodiments, the payload is a negatively charged molecule (e.g., mRNA), and the lipid component of the LNP includes at least one cationic lipid. While not bound by theory, cationic lipids are thought to be able to interact with negatively charged payload molecules, facilitating the incorporation and / or encapsulation of the payload into the LNP during LNP formation. Other lipids that may form part of the LNPs provided herein include, but are not limited to, neutral and charged lipids, e.g., steroids, polymer-conjugated lipids, and various zwitterionic lipids. In certain embodiments, the LNPs provided herein include one or more compounds of formula (I) described herein.

[0078] The term "cationic lipid" refers to a lipid that is positively charged at any pH value or hydrogen ion activity in its environment, or that can become positively charged in response to the pH value or hydrogen ion activity of its environment (e.g., the environment of use). Therefore, the term "cationic" encompasses both "permanently cationic" and "cationizable." In certain embodiments, the positive charge in a cationic lipid is due to the presence of a quaternary nitrogen atom. In certain embodiments, the cationic lipid includes a zwitterionic lipid that is positively charged in its intended environment of use (e.g., at physiological pH). In certain embodiments, the cationic lipid is one or more lipids of formula (I) described herein.

[0079] The term "polymer-conjugated lipid" refers to a molecule that contains both a lipid and a polymer portion. An example of a polymer-conjugated lipid is PEG-lipids, where the polymer portion contains polyethylene glycol.

[0080] The term "neutral lipid" encompasses any lipid molecule that exists in an uncharged or neutral zwitterionic form within a selected pH value or range. In some embodiments, the selected useful pH value or range corresponds to the pH conditions in the intended use environment of the lipid, e.g., physiological pH. Examples of neutral lipids that may be used in connection with this disclosure include, but are not limited to, phosphotidylcholines, e.g., 1,2-distearoyl-sn-glycero-3-phosphocholine (DSPC), 1,2-dipalmitoyl-sn-glycero-3-phosphocholine (DPPC), 1,2-dimyristoyl-sn-glycero-3-phosphocholine (DMPC), 1-palmitoyl-2-oleoyl-sn-glycero-3-phosphocholine (POPC), 1,2-dioleoyl-sn-glycero-3-phosphocholine (DOPC), phosphatidylethanolamines, e.g., 1,2-dioleoyl-sn-glycero-3-phosphoethanolamine (DOPE), 2-((2,3-bis(oleoyloxy)propyl)dimethylammonio)ethylhydrogenphosphate (DOCP), sphingomyelin (SM), ceramides, steroids, e.g., sterols and their derivatives. The neutral lipids provided herein may be synthetic, or derived (isolated or modified) from natural sources or compounds.

[0081] As used herein, unless otherwise specified, the term “alkyl” refers to a saturated linear or branched hydrocarbon chain radical consisting only of carbon and hydrogen atoms. In one embodiment, an alkyl group is, for example, 1 to 50 carbon atoms (C1 to C2). 50 Alkyl), 8 to 50 carbon atoms (C8 to C 50 Alkyl), 8-20 carbon atoms (C8-C 20 Alkyl), 10-18 carbon atoms (C10 ~C 18 Alkyl), 10-15 carbon atoms (C 10 ~C 15 Alkyl), or 13 carbon atoms (C 13 The molecule contains an alkyl group, which is attached to the rest of the molecule by a single bond. Examples of alkyl groups include, but are not limited to, methyl, ethyl, n-propyl, 1-methylethyl (isopropyl), n-butyl, n-pentyl, 1,1-dimethylethyl (t-butyl), 3-methylhexyl, and 2-methylhexyl. Unless otherwise specified, alkyl groups are substituted at will.

[0082] As used herein, unless otherwise specified, the term “alkenyl” refers to a linear or branched hydrocarbon chain radical consisting only of carbon atoms and hydrogen atoms, containing one or more carbon-carbon double bonds. The term “alkenyl” also includes groups having “cis” and “trans” configurations, or “E” and “Z” configurations, as understood by those skilled in the art. In one embodiment, an alkenyl group is, for example, 2 to 50 carbon atoms (C2 to C2). 50 Alkenyl), 2 to 40 carbon atoms (C2-C2) 40 Alkenyl), 2-30 carbon atoms (C2-C2) 30 Alkenyl), 2 to 20 carbon atoms (C2~C 20 Alkenyl), 4-20 carbon atoms (C4-C 20 Alkenyl), 8-20 carbon atoms (C8-C8) 20 Alkenyl), 8-16 carbon atoms (C8-C8) 16 Alkenyl), 6-20 carbon atoms (C6-C6) 20 Alkenyl), 6-16 carbon atoms (C6-C6) 16 It contains an alkenyl group, which is attached to the rest of the molecule by a single bond. Examples of alkenyl groups include, but are not limited to, ethenyl, prop-1-enyl, buto-1-enyl, pento-1-enyl, and penta-1,4-dienyl. Unless otherwise specified, the alkenyl group may be substituted at will.

[0083] As used herein, unless otherwise specified, the term "alkynyl" refers to a linear or branched hydrocarbon chain radical consisting only of carbon and hydrogen atoms and containing one or more carbon-carbon triple bonds. In one embodiment, the alkynyl group is, for example, 2 to 50 carbon atoms (C2 to C2). 50 Alkynyl), 2 to 40 carbon atoms (C2 to C2) 40 Alkynyl), 2-30 carbon atoms (C2-C2) 30 Alkynyl), 2 to 20 carbon atoms (C2 to C2) 20 Alkynyl), 2 to 24 carbon atoms (C2 to C2) 24 Alkynyl), 4 to 20 carbon atoms (C4~C 20 Alkynyl), 8-20 carbon atoms (C8-C8) 20 Alkynyl), 8-16 carbon atoms (C8-C8) 16 Alkynyl), 6-20 carbon atoms (C6-C6) 20 Alkynyl, or 6-16 carbon atoms (C6-C6) 16 It contains an alkynyl group, which is attached to the rest of the molecule by a single bond. Examples of alkynyl groups include, but are not limited to, ethynyl, propynyl, butynyl, and pentynyl. Unless otherwise specified, the alkynyl group can be optionally substituted.

[0084] Where used herein, unless otherwise specified, the term “heteroalkenyl” as used herein refers to an alkenyl group as defined herein, further comprising one or more (e.g., 1 to 25) heteroatoms (e.g., oxygen, sulfur, nitrogen, boron, silicon, phosphorus) in the parent chain. In certain embodiments, the heteroalkenyl group is an unsubstituted C2-50 heteroalkenyl. In certain embodiments, the heteroalkenyl group is a substituted C 2~50 It is a heteroalkenyl.

[0085] Where used herein, unless otherwise specified, the term “heteroalkynyl” as used herein means an alkynyl group as defined herein, which further includes one or more (e.g., 1 to 25) heteroatoms (e.g., oxygen, sulfur, nitrogen, boron, silicon, phosphorus) in the parent chain. In certain embodiments, the heteroalkynyl group is an unsubstituted C 2~50 It is a heteroalkynyl. In certain embodiments, the heteroalkynyl group is a substituted C 2~50 It is a heteroalkynyl.

[0086] As used herein, unless otherwise specified, the term "carbocykrill" refers to a ring having 3 to 10 carbon atoms ("C"). 3~10 A "carbocyclyl" refers to a radical of a non-aromatic cyclic hydrocarbon group that does not contain heteroatoms in its non-aromatic ring system. In some embodiments, the carbocyclyl group has 3 to 8 ring carbon atoms ("C"). 3~8 Carbocyclyl). In some embodiments, the carbocyclyl group has 3 to 6 ring carbon atoms ("C"). 3~6 Carbocyclyl). In some embodiments, the carbocyclyl group has 5 to 10 ring carbon atoms ("C"). 5~10 Carbocyclyl). Exemplary C 3~6 Examples of carbocyclyl groups include, but are not limited to, cyclopropyl (C3), cyclopropenyl (C3), cyclobutyl (C4), cyclobutenyl (C4), cyclopentyl (C5), cyclopentenyl (C5), cyclohexyl (C6), cyclohexenyl (C6), and cyclohexadienyl (C6). 3~8 The carbocyclyl group is not limited to the aforementioned C 3~6 Examples of carbocyclyl groups include cycloheptyl (C7), cycloheptenyl (C7), cycloheptadienyl (C7), cycloheptatrieenyl (C7), cyclooctyl (C8), cyclooctenyl (C8), bicyclo[2.2.1]heptanyl (C7), and bicyclo[2.2.2]octanyl (C8). 3~10 The carbocyclyl group is not limited to the aforementioned C 3~8In addition to the carbocyclic group, cyclononyl (C9), cyclononenyl (C9), cyclodecyl (C 10 ), cyclodecenyl (C 10 ), octahydro-1H-indenyl (C9), decahydronaphthalenyl (C 10 ), spiro[4.5]decanyl (C 10 ) and the like can be mentioned. As illustrated by the foregoing examples, in certain embodiments, the carbocyclic group can be either monocyclic (“monocyclic carbocyclic”) or polycyclic (e.g., a fused ring system, a bridged ring system, or a spiro ring system, e.g., a bicyclic system (“bicyclic carbocyclic”) or a tricyclic system (“tricyclic carbocyclic”)), and can be saturated or can contain one or more carbon-carbon double or triple bonds. “Carbocyclic” also includes a ring system in which the carbocyclic ring defined above is fused to one or more aryl or heteroaryl groups. In this case, the point of attachment is on the carbocyclic ring, and in such cases, the number of carbon atoms continues to indicate the number of carbons in the carbocyclic ring system. Unless otherwise specified, each of the carbocyclic groups is independently either unsubstituted (“unsubstituted carbocyclic”) or substituted with one or more substituents (“substituted carbocyclic”). In certain embodiments, the carbocyclic group is an unsubstituted C 3~10 carbocyclic. In certain embodiments, the carbocyclic group is a substituted C 3~10 carbocyclic.

[0087] In some embodiments, “carbocyclic” is a monocyclic saturated carbocyclic group having 3 to 10 ring carbon atoms (“C 3~10 cycloalkyl”). In some embodiments, the cycloalkyl group has 3 to 8 ring carbon atoms (“C 3~8 cycloalkyl”). In some embodiments, the cycloalkyl group has 3 to 6 ring carbon atoms (“C 3~6 cycloalkyl”). In some embodiments, the cycloalkyl group has 5 to 6 ring carbon atoms (“C 5~6 cycloalkyl”). In some embodiments, the cycloalkyl group has 5 to 10 ring carbon atoms (“C 5~6 cycloalkyl”). In some embodiments, the cycloalkyl group has 5 to 10 ring carbon atoms (“C5~10 "cycloalkyl"). C 5~6 Examples of cycloalkyl groups include cyclopentyl (C5) and cyclohexyl (C6). C 3~8 Examples of cycloalkyl groups include the aforementioned C 3~6 In addition to the cycloalkyl groups, cyclopropyl (C3) and cyclobutyl (C4) are also included. C 3~8 Examples of cycloalkyl groups include the aforementioned C 3~6 In addition to the cycloalkyl groups, cycloheptyl (C7) and cyclooctyl (C8) are also included. Unless otherwise specified, each of the cycloalkyl groups is independently unsubstituted ("unsubstituted cycloalkyl") or substituted with one or more substituents ("substituted cycloalkyl"). In certain embodiments, the cycloalkyl group is unsubstituted C 3~10 cycloalkyl. In certain embodiments, the cycloalkyl group is substituted C 3~10 cycloalkyl.

[0088] As used herein, unless otherwise specified, the term "heterocyclyl" refers to a monocyclic or polycyclic moiety of a non-aromatic radical containing one or more (e.g., one, one or two, 1 - 3, or 1 - 4) heteroatoms independently selected from nitrogen, oxygen, phosphorus, and sulfur. The heterocyclyl may be attached to the main structure by any heteroatom or carbon atom. The heterocyclyl group may be monocyclic, bicyclic, tricyclic, tetracyclic, or other polycyclic ring systems, and the polycyclic ring system may be a fused ring system, a bridged ring system, or a spiro ring system. The heterocyclyl polycyclic ring system may contain one or more heteroatoms in one or more rings. The heterocyclyl group may be saturated or partially unsaturated. A saturated heterocycloalkyl group may be referred to as "heterocycloalkyl". A partially unsaturated heterocycloalkyl group may be referred to as "heterocycloalkenyl" when the heterocyclyl contains at least one double bond, and "heterocycloalkynyl" when the heterocyclyl contains at least one triple bond. In one embodiment, the heterocyclyl has, for example, 3 - 18 ring atoms (3 - 18 member heterocyclyl), 4 - 18 ring atoms (4 - 18 member heterocyclyl), 5 - 18 ring atoms (3 - 18 member heterocyclyl), 4 - 8 ring atoms (4 - 8 member heterocyclyl), or 5 - 8 ring atoms (5 - 8 member heterocyclyl). When numerical ranges such as "3 - 18" appear herein, they always refer to each integer within the given range. For example, "3 - 18 ring atoms" means that the heterocyclyl group can consist of 3 ring atoms, 4 ring atoms, 5 ring atoms, 6 ring atoms, 7 ring atoms, 8 ring atoms, 9 ring atoms, 10 ring atoms, etc., up to 18 ring atoms. Examples of heterocyclyl groups include, but are not limited to, imidazolyl, imidazolidinyl, oxazolyl, oxazolidinyl, thiazolyl, thiazolidinyl, pyrazolidinyl, pyrazolyl, isoxazolidinyl, isoxazolyl, isothiazolidinyl, isothiazolyl, morpholinyl, pyrrolyl, pyrrolidinyl, furyl, tetrahydrofuryl, thiophenyl, pyridinyl, piperidinyl, quinolyl, and isoquinolyl. Unless otherwise specified, the heterocyclyl group is optionally substituted.

[0089] As used herein, unless otherwise specified, the term “aryl” refers to a monocyclic aromatic group and / or a polycyclic monovalent aromatic group comprising at least one aromatic hydrocarbon ring. In certain embodiments, the aryl group comprises 6 to 18 ring carbon atoms (C6 to C6). 18 Aryl), 6-14 ring carbon atoms (C6-C 14 Aryl), or 6-10 ring carbon atoms (C6-C 10 The term "aryl" also refers to a bicyclic, tricyclic, or other polycyclic hydrocarbon ring in which at least one of the rings is aromatic and the other ring may be saturated, partially unsaturated, or aromatic, such as dihydronaphthyl, indenyl, indanyl, or tetrahydronaphthyl (tetralinyl). Unless otherwise specified, the aryl group may be optionally substituted.

[0090] As used herein, unless otherwise specified, the term “heteroaryl” refers to a monocyclic and / or polycyclic aromatic group comprising at least one aromatic ring, the at least one aromatic ring comprising one or more heteroatoms (e.g., 1, 1 or 2, 1 to 3, or 1 to 4) independently selected from O, S, and N. The heteroaryl may be bonded to the main structure by any heteroatom or carbon atom. In certain embodiments, the heteroaryl has 5 to 20, 5 to 15, or 5 to 10 ring atoms. The term “heteroaryl” also refers to a bicyclic, tricyclic, or other polycyclic ring in which at least one ring is aromatic and the other rings may be saturated, partially unsaturated, or aromatic, the at least one aromatic ring comprising one or more heteroatoms independently selected from O, S, and N. Examples of monocyclic heteroaryl groups include, but are not limited to, pyrrolyl, pyrazolyl, pyrazolinyl, imidazolyl, oxazolyl, isoxazolyl, thiazolyl, thiadiazolyl, isothiazolyl, furanyl, thienyl, oxadiazolyl, pyridyl, pyrazinyl, pyrimidinyl, pyridadinyl, and triazinyl. Examples of bicyclic heteroaryl groups include, but are not limited to, indolyl, benzothiazolyl, benzoxazolyl, benzothienyl, quinolinyl, tetrahydroisoquinolinyl, isoquinolinyl, benzimidazolyl, benzopyranyl, indolidinyl, benzofuranyl, isobenzofuranyl, chromonyl, coumalinyl, sinnolinyl, quinoxalinyl, indazolyl, purinyl, pyrrolopyridinyl, flupyridinyl, thienopyridinyl, dihydroisoindolyl, and tetrahydroquinolinyl. Examples of tricyclic heteroaryl groups include, but are not limited to, carbazolyl, benzoindolyl, phenanthrolinyl, acridinyl, phenanthridine, and xanthenyl. Unless otherwise specified, heteroaryl groups are substituted at will.

[0091] Where a group described herein is referred to as “substituted,” it may be substituted with any suitable substituent(s). Specific examples of substituents include those described in the exemplary compounds and embodiments provided herein, as well as halogen atoms such as F, Cl, Br, or I, cyano, oxo (=O), hydroxyl (-OH), alkyl, alkenyl, alkynyl, cycloalkyl, aryl, -(C=O)OR', -O(C=O)R', -C(=O)R', -OR', and -S(O). x R', -S-SR', -C(=O)SR', -SC(=O)R', -NR'R', -NR'C(=O)R', -C(=O)NR'R', -NR'C(=O)NR'R', -OC(=O)NR'R', -NR'C(=O)OR', -NR'S(O) x NR'R', -NR'S(O) x R', and -S(O) x Examples include NR'R', but are not limited to these. In the formula, R' represents H, C1~C independently. 15 It is alkyl or cycloalkyl, and x is 0, 1, or 2. In some embodiments, the substituents are C1-C 12 In other embodiments, the substituent is an alkyl group. In other embodiments, the substituent is a cycloalkyl group. In other embodiments, the substituent is a halo group such as a fluoro group. In other embodiments, the substituent is an oxo group. In other embodiments, the substituent is a hydroxyl group. In other embodiments, the substituent is an alkoxy group (-OR'). In other embodiments, the substituent is a carboxyl group. In other embodiments, the substituent is an amino group (-NR'R').

[0092] Where used herein, unless otherwise specified, the terms “optional” or “optionally substituted” (e.g., optionally substituted) mean that the event or situation described thereafter may or may not occur, and that the description includes both cases where the event or situation occurs and where it does not. For example, “optionally substituted alkyl” means that the alkyl radical may or may not be substituted, and that the description includes both substituted and unsubstituted alkyl radicals.

[0093] As used herein, unless otherwise specified, the term “pharmaceutically acceptable salt” includes both acid addition salts and base addition salts.

[0094] Examples of pharmaceutically acceptable acid addition salts include, but are not limited to, acetic acid, 2,2-dichloroacetic acid, adipic acid, alginic acid, ascorbic acid, aspartic acid, benzenesulfonic acid, benzoic acid, 4-acetamidobenzoic acid, camphoric acid, camphor-10-sulfonic acid, capric acid, caproic acid, caprylic acid, carbonate, cinnamic acid, citric acid, cyclamic acid, dodecyl sulfate, ethane-1,2-disulfonic acid, ethanesulfonic acid, 2-hydroxyethanesulfonic acid, formic acid, fumaric acid, galactaric acid, gentisic acid, glucoheptonic acid, gluconic acid, glucuronic acid, glutamic acid, glutaric acid, 2- Examples of organic acids include, but are not limited to, oxo-glutaric acid, glycerophosphate, glycolic acid, hippuric acid, isobutyric acid, lactic acid, lactobionic acid, lauric acid, maleic acid, malic acid, malonic acid, mandelic acid, methanesulfonic acid, mucinic acid, naphthalene-1,5-disulfonic acid, naphthalene-2-sulfonic acid, 1-hydroxy-2-naphthoic acid, nicotinic acid, oleic acid, orotic acid, oxalic acid, palmitic acid, pamoic acid, propionic acid, pyroglutamic acid, pyruvic acid, salicylic acid, 4-aminosalicylic acid, sebacic acid, stearic acid, succinic acid, tartaric acid, thiocyanic acid, p-toluenesulfonic acid, trifluoroacetic acid, and undecylenic acid.

[0095] Examples of pharmaceutically acceptable base addition salts include, but are not limited to, salts prepared by the addition of inorganic or organic bases to free acid compounds. Examples of salts derived from inorganic bases include, but are not limited to, sodium, potassium, lithium, ammonium, calcium, magnesium, iron, zinc, copper, manganese, and aluminum salts. In one embodiment, the inorganic salts are ammonium salts, sodium salts, potassium salts, calcium salts, and magnesium salts. Examples of salts derived from organic bases include, but are not limited to, salts of primary, secondary, and tertiary amines, substituted amines including naturally substituted amines, cyclic amines, and basic ion exchange resins such as ammonia, isopropylamine, trimethylamine, diethylamine, triethylamine, tripropylamine, diethanolamine, ethanolamine, deanol, 2-dimethylaminoethanol, 2-diethylaminoethanol, dicyclohexylamine, lysine, arginine, histidine, caffeine, procaine, hydravamin, choline, betaine, benetamine, benzathine, ethylenediamine, glucosamine, methylglucamine, theobromine, triethanolamine, tromethamine, purine, piperazine, piperidine, N-ethylpiperidine, and polyamine resins. In one embodiment, the organic base is isopropylamine, diethylamine, ethanolamine, trimethylamine, dicyclohexylamine, choline, and caffeine.

[0096] The compounds provided herein may contain one or more chiral centers, and thus may result in enantiomers, diastereomers, and other stereoisomeric forms. These may be defined from the viewpoint of absolute stereochemistry as (R)- or (S)-, or in the case of amino acids, (D)- or (L)-. Unless otherwise specified, the compounds provided herein include all such possible isomers, as well as their racemic and optically pure forms. Optically active (+) and (-), (R)- and (S)-, or (D)- and (L)- isomers may be prepared using chiral synthons or chiral reagents, or may be resolved using conventional techniques such as chromatography and fractional crystallization. Conventional techniques for the preparation / isolation of individual enantiomers include chiral synthesis from suitable optically pure precursors, or resolution of racemics (or racemics of salts or derivatives) using, for example, chiral high-pressure liquid chromatography (HPLC). Where a compound described herein contains an olefinic double bond or other geometrically asymmetric centers, unless otherwise specified, it is intended that the compound includes both E and Z geometric isomers. Similarly, all tautomer forms are also intended to be included.

[0097] As used herein, unless otherwise specified, the term “isomer” refers to different compounds having the same molecular formula. “Stereoisomers” are isomers that differ only in the manner of the spatial arrangement of their atoms. “Atropisomers” are stereoisomers that arise from the hindrance of rotation around a single bond. “Enantiomers” are a pair of stereoisomers that are mirror images of each other and cannot be superimposed. A mixture of a pair of enantiomers in any ratio may be known as a “racemic” mixture. “Diastereoisomers” are stereoisomers that have at least two asymmetric atoms but are not mirror images of each other.

[0098] "Stereoisomers" may also include E and Z isomers, or mixtures thereof, as well as cis and trans isomers, or mixtures thereof. In certain embodiments, the compounds described herein are isolated as either the E or Z isomer. In other embodiments, the compounds described herein are mixtures of the E and Z isomers.

[0099] A "tautomer" refers to an isomer of a compound that exists in equilibrium with it. The concentration of the isomer depends on the environment in which the compound is found, and may differ depending on whether the compound is a solid or in an organic solution or aqueous solution.

[0100] It should also be noted that the compounds described herein may contain atomic isotopes in non-natural proportions in one or more atoms. For example, such compounds may contain tritium ( 3 H), Iodine-125( 125 I), Sulfur-35( 35 S) or carbon-14 ( 14 It may be radioactively labeled with radioactive isotopes such as C, or deuterium ( 2 H), carbon-13 ( 13 C) or nitrogen-15 15They may be rich in isotopes such as N). As used herein, “isotopologs” refers to isotope-rich compounds. The term “isotopologs” refers to atoms that have isotope compositions other than the natural isotope composition of that atom. “Isotopologs” may also refer to compounds that contain at least one atom that has isotope compositions other than the natural isotope composition of that atom. The term “isotope composition” refers to the amount of each isotope present in a given atom. Radiolabeled compounds and isotope-rich compounds are useful, for example, as research reagents (e.g., reagents for binding assays) and diagnostic agents (e.g., in vivo imaging). Any isotopic variants of the compounds described herein, whether radioactive or not, are intended to be included within the scope of the embodiments provided herein. In some embodiments, isotopologs of the compounds described herein are provided, for example, isotopologs rich in deuterium, carbon-13, and / or nitrogen-15. As used herein, “deuterated” means that at least one hydrogen (H) is rich in deuterium (D or 2 This refers to a compound in which a (represented by H) is replaced, i.e., the compound is rich in deuterium at at least one position.

[0101] Please note that if there is a discrepancy between the illustrated structure and its name, the emphasis will be placed on the illustrated structure.

[0102] As used herein, unless otherwise specified, the term “pharmaceutically acceptable carrier, diluent, or excipient” includes, but is not limited to, any adjuvants, carriers, excipients, lubricants, sweeteners, diluents, preservatives, colorants, flavor enhancers, surfactants, humectants, dispersants, suspending agents, stabilizers, isotonic agents, solvents, or emulsifiers that are approved by the U.S. Food and Drug Administration as acceptable for use in humans or domesticated animals.

[0103] The terms “polynucleotide” and “nucleic acid” are used interchangeably herein and refer to polymers of nucleotides of any length, including, for example, DNA and RNA. Nucleotides can be deoxyribonucleotides, ribonucleotides, modified nucleotides or bases, and / or analogs thereof, or any substrate that can be incorporated into the polymer by DNA or RNA polymerase or by synthetic reactions. Polynucleotides may include modified nucleotides such as methylated nucleotides and their analogs. Polynucleotides may include natural or synthetic nucleic acid bases. Nucleic acids may be in single-stranded or double-stranded form. Where used herein, unless otherwise specified, “nucleic acid” also includes nucleic acid mimetic compounds such as locked nucleic acid (LNA), peptide nucleic acid (PNA), and morpholino. Where used herein, “oligonucleotide” refers to short synthetic polynucleotides, which are generally less than about 200 nucleotides in length, though not necessarily so. The terms “oligonucleotide” and “polynucleotide” are not mutually exclusive. The above description of polynucleotides is equally and completely applicable to oligonucleotides. In one embodiment, the polynucleotide is isolated.

[0104] In some embodiments, the polynucleotide has a mass of about 1 kilodalton (kDa) to about 50 kDa. In some embodiments, the polynucleotide has a mass of about 1 kDa to 10 kDa. In some embodiments, the polynucleotide has a mass of about 10 kDa to 20 kDa. In some embodiments, the polynucleotide has a mass of about 10 kDa to about 25 kDa. In some embodiments, the polynucleotide has a mass of about 15 kDa to about 50 kDa. In some embodiments, the polynucleotide has a mass of about 20 kDa to about 50 kDa. In some embodiments, the polynucleotide has a mass of about 25 kDa to about 50 kDa. In some embodiments, the polynucleotide has a mass of about 30 kDa to about 50 kDa. In some embodiments, the polynucleotide has a mass of about 40 kDa to about 50 kDa. In some embodiments, the polynucleotide has a mass of about 1 kDa, about 5 kDa, about 10 kDa, about 15 kDa, about 20 kDa, about 25 kDa, about 30 kDa, about 35 kDa, about 40 kDa, about 45 kDa, or about 50 kDa. In some embodiments, the polynucleotide has a mass of less than about 50 kDa. In some embodiments, the polynucleotide has a mass of less than about 45 kDa, less than about 40 kDa, less than about 35 kDa, less than about 30 kDa, less than about 25 kDa, less than about 20 kDa, less than about 15 kDa, less than about 10 kDa, or less than about 5 kDa.

[0105] In some embodiments, the polynucleotide contains at least 15 nucleotides or at least 15 base pairs. In some embodiments, the polynucleotide contains at least 20 nucleotides or at least 20 base pairs. In some embodiments, the polynucleotide contains at least 25 nucleotides or at least 25 base pairs. In some embodiments, the polynucleotide contains 15 to 30 nucleotides or 15 to 30 base pairs. In some embodiments, the polynucleotide contains 25 to 50 nucleotides or 25 to 50 base pairs. In some embodiments, the polynucleotide contains 25 to 100 nucleotides or 25 to 100 base pairs.

[0106] In some embodiments, the polynucleotide is 10 to 1 kilobase (kb) long. In some embodiments, the polynucleotide is 10 to 10 kilobase (kb) long. In some embodiments, the polynucleotide is 1 to 50 kb long. In some embodiments, the polynucleotide is less than 50 kb long.

[0107] In some embodiments, the polynucleotide is 10 base pairs to 1 kilobase (kb) pair long. In some embodiments, the polynucleotide is 10 base pairs to 10 kb pair long. In some embodiments, the polynucleotide is 1 kb pair to 50 kb base pair long. In some embodiments, the polynucleotide is less than 50 kb base pair long.

[0108] "Isolated nucleic acids" are nucleic acids substantially isolated from other RNA or DNA sequences (e.g., genomic DNA sequences) and proteins or complexes such as ribosomes and polymerases that naturally accompany native sequences, e.g., RNA, DNA, or mixed nucleic acids. "Isolated" nucleic acid molecules are molecules isolated from other nucleic acid molecules present in the natural source of the nucleic acid molecule. Furthermore, "isolated" nucleic acid molecules, such as mRNA molecules, siRNA, or cDNA molecules, may substantially contain no other cellular material or culture medium if produced by recombinant techniques, and may substantially contain no chemical precursors or other chemicals if chemically synthesized. Nucleic acids substantially free of cellular material include nucleic acid preparations containing approximately 30%, 20%, 10%, or less than 5% (by dry weight) of other nucleic acids. The term "substantially free of culture medium" includes nucleic acid preparations in which culture medium constitutes approximately 50%, 20%, 10%, or less than 5% of the preparation's volume. The term "substantially free of chemical precursors or other chemicals" includes preparations in which nucleic acids have been isolated from chemical precursors or other chemicals involved in the synthesis of nucleic acids. In specific embodiments, such preparations of nucleic acids contain less than 50%, 30%, 20%, 10%, and 5% (dry weight) of chemical precursors or compounds other than the nucleic acid of interest. In specific embodiments, one or more nucleic acid molecules encoding the antigens described herein are isolated or purified. This term encompasses nucleic acid sequences taken from their naturally occurring environments and includes recombinant or cloned DNA or RNA isolates and chemically synthesized analogs or analogs biologically synthesized by heterologous systems. Substantially pure molecules may include molecules in isolated forms.

[0109] The term "coding nucleic acid" or its grammatical synonyms are understood by those skilled in the art and include (a) a nucleic acid molecule in its native state that is transcribed to produce mRNA and then translated into a peptide and / or polypeptide, or a nucleic acid molecule when it has been manipulated by methods well known to those skilled in the art, and (b) the mRNA molecule itself. One skilled in the art will recognize that the antisense strand is the complementary strand of such a nucleic acid molecule and that the coding sequence can be deduced therefrom. The term "coding region" is understood by those skilled in the art and generally refers to the portion within a coding nucleic acid sequence that is translated into a peptide or polypeptide. The term "untranslated region" or "UTR" is understood by those skilled in the art and generally refers to the portion of a coding nucleic acid that is not translated into a peptide or polypeptide. Depending on the orientation of the UTR with respect to the coding region of the nucleic acid molecule, the UTR is called the 5'-UTR when it is located at the 5' end of the coding region and the 3'-UTR when it is located at the 3' end of the coding region.

[0110] As used herein, the term "mRNA" is understood by those skilled in the art and includes a messenger RNA molecule that contains one or more open reading frames (ORFs) that can be translated by the cell or organism in which the mRNA is provided to produce one or more peptide or protein products. The region containing one or more ORFs is generally referred to as the coding region of the mRNA molecule. In certain embodiments, the mRNA molecule further includes one or more untranslated regions (UTRs).

[0111] In some embodiments, the mRNA is a monocistronic mRNA containing only one ORF. In some embodiments, the monocistronic mRNA encodes a peptide or protein containing at least one epitope of a selected antigen (e.g., a pathogenic antigen or tumor-associated antigen). In some embodiments, the mRNA is a multicistronic mRNA containing two or more ORFs. In some embodiments, the multicistronic mRNA encodes two or more peptides or proteins, which may be the same or different from each other. In some embodiments, each peptide or protein encoded by the multicistronic mRNA contains at least one epitope of a selected antigen. In some embodiments, different peptides or proteins encoded by the multicistronic mRNA each contain at least one epitope of a different antigen. In any embodiment described herein, at least one epitope may be at least two, at least three, at least four, at least five, at least six, at least seven, at least eight, at least nine, or at least ten epitopes of the antigen. For example, the multicistronic mRNA may contain 2 to 10 epitopes.

[0112] The term "nucleic acid bases" encompasses purines and pyrimidines, including the naturally occurring compounds adenine, thymine, guanine, cytosine, uracil, inosine, and their natural or synthetic analogs or derivatives.

[0113] As used herein, the term "peptide" refers to a polymer containing 2 to 50 amino acid residues linked by one or more covalent peptide bonds. These terms apply to naturally occurring amino acid polymers as well as amino acid polymers in which one or more amino acid residues are unnatural amino acids (e.g., amino acid analogs or unnatural amino acids). In some embodiments, the peptide has a mass of about 1 kilodalton (kDa) to about 10 kDa. In some embodiments, the peptide has a mass of about 5 kDa to about 10 kDa. In some embodiments, the peptide has a mass of about 2 kDa to about 8 kDa. In some embodiments, the peptide has a mass of about 1 kDa to about 5 kDa. In some embodiments, the peptide has a mass of about 1 kDa, about 2 kDa, about 3 kDa, about 4 kDa, or about 5 kDa. In some embodiments, the peptide has a mass of about 6 kDa, about 7 kDa, about 8 kDa, about 9 kDa, or about 10 kDa. In some embodiments, the peptide is negatively supercharged. In some embodiments, the peptide has a mass of about 1 kilodalton (kDa) to about 10 kDa and is negatively supercharged.

[0114] The terms “polypeptide” and “protein” are used interchangeably herein and refer to polymers of more than 50 amino acid residues linked by covalent peptide bonds. That is, the description of polypeptides applies equally to the description of proteins, and vice versa. These terms apply to naturally occurring amino acid polymers as well as amino acid polymers in which one or more amino acid residues are non-natural amino acids (e.g., amino acid analogs). As used herein, these terms encompass amino acid chains of any length, including full-length proteins (e.g., antigens).

[0115] In some embodiments, the polypeptide has a mass of about 10 kilodaltons (kDa) to about 50 kDa. In some embodiments, the polypeptide has a mass of about 15 kDa to about 50 kDa. In some embodiments, the polypeptide has a mass of about 20 kDa to about 50 kDa. In some embodiments, the polypeptide has a mass of about 25 kDa to about 50 kDa. In some embodiments, the polypeptide has a mass of about 30 kDa to about 50 kDa. In some embodiments, the polypeptide has a mass of about 40 kDa to about 50 kDa. In some embodiments, the polypeptide has a mass of about 10 kDa to about 25 kDa. In some embodiments, the polypeptide has a mass of about 10 kDa, about 20 kDa, about 30 kDa, about 40 kDa, or about 50 kDa. In some embodiments, the polypeptide has a mass of less than about 50 kDa. In some embodiments, the polypeptide has a mass of less than about 45 kDa, less than about 40 kDa, less than about 35 kDa, less than about 30 kDa, less than about 25 kDa, less than about 20 kDa, or less than about 15 kDa. In some embodiments, the polypeptide is negatively supercharged. In some embodiments, the polypeptide has a mass of less than about 50 kDa and is negatively supercharged. In some embodiments, the polypeptide has a mass of about 1 kDa to about 50 kDa and is negatively supercharged.

[0116] The terms “antibody,” “immunoglobulin,” or “Ig” are used interchangeably herein and in their broadest sense, specifically encompassing, for example, monoclonal antibodies (including agonists, antagonists, neutralizing antibodies, full-length or intact monoclonal antibodies), antibody compositions having polyepitope or monoepitope specificity, polyclonal or monovalent antibodies, multivalent antibodies, multispecific antibodies formed from at least two intact antibodies (e.g., bispecific antibodies, only if they exhibit the desired biological activity), single-chain antibodies, single-domain antibodies (e.g., VHH) and their fragments (e.g., domain antibodies). Antibodies may be human, humanized, chimeric, and / or affinity-mature antibodies, as well as antibodies from other species, such as mice, rabbits, and llamas. The term "antibody" is intended to include B cell polypeptide products within immunoglobulin class polypeptides, which are capable of binding to specific molecular antigens and consist of two identical pairs of polypeptide chains, each pair having one heavy chain (approximately 50–70 kDa) and one light chain (approximately 25 kDa), with each amino-terminus of each chain containing a variable region of approximately 100–130 or more amino acids, and each carboxy-terminus of each chain containing a constant region. See, for example, Antibody Engineering (Borrebaeck ed., 2d ed. 1995) and Kuby, Immunology (3d ed. 1997). Antibodies also include, but are not limited to, synthetic antibodies, recombinant antibodies, single-domain antibodies or their humanized variants, including those derived from camelid species (e.g., llamas or alpacas), intrabodies, anti-idiotype (anti-Id) antibodies, and any of the functional fragments described above (e.g., antigen-binding fragments), where the fragment refers to a portion of the antibody heavy chain or light chain polypeptide that retains some or all of the binding activity of the antibody from which the fragment originates. Non-exclusive examples of functional fragments (e.g., antigen-binding fragments) include single-chain Fv(scFv) (e.g., including monospecific, bispecific, etc.), Fab fragments, F(ab') fragments, F(ab)2 fragments, F(ab')2 fragments, disulfide-bonded Fv(dsFv), Fd fragments, Fv fragments, diabodies, triabodies, tetrabodies, and minibodies.In particular, the antibodies provided herein include immunoglobulin molecules and molecules containing immunologically active portions of immunoglobulin molecules, such as antigen-binding domains or antigen-binding sites that bind to antigens (e.g., one or more CDRs of an antibody). Such antibody fragments can be found, for example, in Harlow and Lane, Antibodies: A Laboratory Manual (1989); Mol. Biology and Biotechnology: A Comprehensive Desk Reference (Myers ed., 1995); Huston et al., 1993, Cell Biophysics 22:189-224; Pluckthun and Skerra, 1989, Meth. Enzymol. 178:497-515; and Day, Advanced Immunochemistry (2nd ed. 1990). The antibody or its antigen-binding fragment may be of any class of immunoglobulin molecule (e.g., IgG, IgE, IgM, IgD, and IgA) or any subclass (e.g., IgG1, IgG2, IgG3, IgG4, IgA1, and IgA2). In some embodiments, the antibody is a monoclonal antibody. In some embodiments, the antibody is an anti-TGFβR1 antibody or an anti-TGFβR2 antibody. In some embodiments, the functional fragment of the antibody is a functional fragment of an anti-TGFβR1 antibody or an anti-TGFβR2 antibody. In some embodiments, the antigen-binding fragment of the antibody is an antigen-binding fragment of an anti-TGFβR1 antibody or an anti-TGFβR2 antibody.

[0117] In some embodiments, the antibody has a mass of about 10 kilodaltons (kDa) to about 50 kDa. In some embodiments, the antibody has a mass of about 15 kDa to about 50 kDa. In some embodiments, the antibody has a mass of about 20 kDa to about 50 kDa. In some embodiments, the antibody has a mass of about 25 kDa to about 50 kDa. In some embodiments, the antibody has a mass of about 30 kDa to about 50 kDa. In some embodiments, the antibody has a mass of about 40 kDa to about 50 kDa. In some embodiments, the antibody has a mass of about 10 kDa to about 25 kDa. In some embodiments, the antibody has a mass of about 10 kDa, about 20 kDa, about 30 kDa, about 40 kDa, or about 50 kDa. In some embodiments, the antibody has a mass of less than about 50 kDa. In some embodiments, the antibody has a mass of less than approximately 45 kDa, less than approximately 40 kDa, less than approximately 35 kDa, less than approximately 30 kDa, less than approximately 25 kDa, less than approximately 20 kDa, or less than approximately 15 kDa. In some embodiments, the antibody has a mass of less than approximately 50 kDa. In some embodiments, the antibody is negatively supercharged. In some embodiments, the antibody has a mass of less than approximately 50 kDa and is negatively supercharged. In some embodiments, the antibody has a mass of approximately 1 kDa to approximately 50 kDa and is negatively supercharged.

[0118] In some embodiments, the antigen-binding fragment has a mass of about 10 kilodaltons (kDa) to about 50 kDa. In some embodiments, the antigen-binding fragment has a mass of about 15 kDa to about 50 kDa. In some embodiments, the antigen-binding fragment has a mass of about 20 kDa to about 50 kDa. In some embodiments, the antigen-binding fragment has a mass of about 25 kDa to about 50 kDa. In some embodiments, the antigen-binding fragment has a mass of about 30 kDa to about 50 kDa. In some embodiments, the antigen-binding fragment has a mass of about 40 kDa to about 50 kDa. In some embodiments, the antigen-binding fragment has a mass of about 10 kDa to about 25 kDa. In some embodiments, the antigen-binding fragment has a mass of about 10 kDa, about 20 kDa, about 30 kDa, about 40 kDa, or about 50 kDa. In some embodiments, the antigen-binding fragment has a mass of less than about 50 kDa. In some embodiments, the antigen-binding fragment has a mass of less than about 45 kDa, less than about 40 kDa, less than about 35 kDa, less than about 30 kDa, less than about 25 kDa, less than about 20 kDa, or less than about 15 kDa. In some embodiments, the antigen-binding fragment has a mass of less than about 50 kDa. In some embodiments, the antigen-binding fragment is negatively supercharged. In some embodiments, the antigen-binding fragment has a mass of less than about 50 kDa and is negatively supercharged. In some embodiments, the antigen-binding fragment has a mass of about 1 kDa to about 50 kDa and is negatively supercharged.

[0119] As used herein, the term “monoclonal antibody” refers to an antibody obtained from a homogeneous or substantially homogeneous population of antibodies. The term “monoclonal” is not limited to a specific method for producing the antibody. Generally, a population of monoclonal antibodies can be produced by cells, cell populations, or cell lines.

[0120] The term "antigen" refers to a substance that can be recognized by the immune system of a target (including the adaptive immune system). In specific embodiments, an antigen can trigger an immune response (including an antigen-specific immune response) after contact with the target. In certain embodiments, the antigen is a molecule (e.g., a protein) associated with disease cells, such as cells infected with a pathogen or neoplastic cells. In certain embodiments, the antigen is a molecule (e.g., a protein) associated with disease cells associated with atherosclerosis, cardiovascular disease, pulmonary hypertension (e.g., pulmonary arterial hypertension or secondary pulmonary hypertension), lung cancer, lung metastasis, chronic obstructive pulmonary disease (COPD), bronchiolitis obliterans, bronchiolitis obliterans with organizing pneumonia (BOOP), or pulmonary fibrosis or fibrous lung disease. In some embodiments, the antigen has a mass of about 10 kilodaltons (kDa) to about 50 kDa. In some embodiments, the antigen has a mass of about 15 kDa to about 50 kDa. In some embodiments, the antigen has a mass of about 20 kDa to about 50 kDa. In some embodiments, the antigen has a mass of about 25 kDa to about 50 kDa. In some embodiments, the antigen has a mass of about 30 kDa to about 50 kDa. In some embodiments, the antigen has a mass of about 40 kDa to about 50 kDa. In some embodiments, the antigen has a mass of about 10 kDa to about 25 kDa. In some embodiments, the antigen has a mass of about 10 kDa, about 20 kDa, about 30 kDa, about 40 kDa, or about 50 kDa. In some embodiments, the antigen has a mass of less than about 50 kDa. In some embodiments, the antigen has a mass of less than about 45 kDa, less than about 40 kDa, less than about 35 kDa, less than about 30 kDa, less than about 25 kDa, less than about 20 kDa, or less than about 15 kDa. In some embodiments, the antigen is negatively supercharged. In some embodiments, the antigen has a mass of less than about 50 kDa and is negatively supercharged. In some embodiments, the antigen has a mass of about 1 kDa to about 50 kDa and is negatively supercharged.

[0121] In the context of peptides or polypeptides, the term “fragment” as used herein refers to a peptide or polypeptide containing an amino acid sequence less than the full length. Such fragments may arise, for example, from cleavage at the amino terminus, cleavage at the carboxy terminus, and / or internal deletion of residues from an amino acid sequence. Fragments may also arise, for example, from alternative RNA splicing or from in vivo protease activity. In some embodiments, the polypeptide fragment contains an amino acid sequence of at least 5 consecutive amino acid residues, at least 10 consecutive amino acid residues, at least 15 consecutive amino acid residues, at least 20 consecutive amino acid residues, at least 25 consecutive amino acid residues, at least 30 consecutive amino acid residues, at least 40 consecutive amino acid residues, at least 50 consecutive amino acid residues, at least 60 consecutive amino acid residues, at least 70 consecutive amino acid residues, at least 80 consecutive amino acid residues, at least 90 consecutive amino acid residues, at least 100 consecutive amino acid residues, at least 125 consecutive amino acid residues, at least 150 consecutive amino acid residues, at least 175 consecutive amino acid residues, at least 200 consecutive amino acid residues, at least 250 consecutive amino acid residues, at least 300 consecutive amino acid residues, at least 350 consecutive amino acid residues, or at least 400 consecutive amino acid residues. In some embodiments, the polypeptide fragment includes an amino acid sequence of at least 450 consecutive amino acid residues, at least 500 consecutive amino acid residues, at least 550 consecutive amino acid residues, at least 600 consecutive amino acid residues, at least 650 consecutive amino acid residues, at least 700 consecutive amino acid residues, at least 750 consecutive amino acid residues, at least 800 consecutive amino acid residues, at least 850 consecutive amino acid residues, at least 900 consecutive amino acid residues, or at least 950 consecutive amino acid residues of the polypeptide amino acid sequence.For example, a polypeptide fragment may contain 10 to 100, 10 to 500, 100 to 500, or 200 to 500 consecutive amino acid residues of the polypeptide's amino acid sequence. In another example, a polypeptide fragment may contain 500 to 800, or 700 to 950 consecutive amino acid residues of the polypeptide's amino acid sequence. In specific embodiments, the peptide or polypeptide fragment retains at least one, at least two, at least three, or more functions of the peptide or polypeptide.

[0122] In some embodiments, the polypeptide fragment has a mass of about 10 kilodaltons (kDa) to about 50 kDa. In some embodiments, the polypeptide fragment has a mass of about 15 kDa to about 50 kDa. In some embodiments, the polypeptide fragment has a mass of about 20 kDa to about 50 kDa. In some embodiments, the polypeptide fragment has a mass of about 25 kDa to about 50 kDa. In some embodiments, the polypeptide fragment has a mass of about 30 kDa to about 50 kDa. In some embodiments, the polypeptide fragment has a mass of about 40 kDa to about 50 kDa. In some embodiments, the polypeptide fragment has a mass of about 10 kDa to about 25 kDa. In some embodiments, the polypeptide fragment has a mass of about 10 kDa, about 20 kDa, about 30 kDa, about 40 kDa, or about 50 kDa. In some embodiments, the polypeptide fragment has a mass of less than about 50 kDa. In some embodiments, polypeptide fragments have a mass of less than about 45 kDa, less than about 40 kDa, less than about 35 kDa, less than about 30 kDa, less than about 25 kDa, less than about 20 kDa, or less than about 15 kDa. In some embodiments, polypeptide fragments are negatively supercharged. In some embodiments, polypeptide fragments have a mass of less than about 50 kDa and are negatively supercharged. In some embodiments, polypeptide fragments have a mass of about 1 kDa to about 50 kDa and are negatively supercharged.

[0123] The term "epitope" is understood by those skilled in the art and generally refers to a site on the surface of an antigen molecule to which a single antibody molecule binds, for example, a local region on the antigen surface that can bind to one or more antigen-binding regions of an antibody and has antigenic or immunogenic activity in animals such as mammals (e.g., humans) and can induce an immune response. An immunogenic epitope is a part of a polypeptide that induces an antibody response in an animal. An antigenic epitope is a part of a polypeptide to which an antibody binds, as determined by any method well known in the art, including immunoassays. Antigen epitopes do not necessarily have to be immunogenic. Epitopes often consist of a group of chemically active surface groups of molecules, such as amino acids or sugar side chains, and have specific three-dimensional structural properties and specific charge properties. Antibody epitopes may be linear epitopes or conformational epitopes. Linear epitopes are formed by a continuous sequence of amino acids in a protein. Structural epitopes are formed by amino acids that are discontinuous in the protein sequence but assemble when the protein folds into its three-dimensional structure. Inducible epitopes are formed when the protein's three-dimensional structure is in a modified structure, such as after activation or binding of another protein or ligand. In some embodiments, epitopes are three-dimensional surface features of a polypeptide. In some embodiments, epitopes are linear features of a polypeptide. Generally, antigens have several or many different epitopes and can react with many different antibodies. In some embodiments, the epitope is the TGFβR1 or TGFβR2 epitope.

[0124] In the context of administration to a patient, the terms “administer” or “give” refer to the act of physically delivering an extracorporeal substance (e.g., the lipid nanoparticle compositions described herein) to a patient by injection or other means, such as by mucosal, intradermal, intravenous, intramuscular delivery, and / or other physical delivery methods described herein or known in the art. When treating atherosclerosis, cardiovascular disease, pulmonary hypertension (e.g., pulmonary arterial hypertension or secondary pulmonary hypertension), lung cancer, lung metastases, chronic obstructive pulmonary disease (COPD), bronchiolitis obliterans, bronchiolitis obliterans with organizing pneumonia (BOOP), pulmonary fibrosis, or fibrous lung disease, or symptoms thereof, the administration of the substance is typically performed after the onset of the disease or condition, or symptoms thereof. In cases of atherosclerosis, cardiovascular disease, pulmonary hypertension (e.g., pulmonary arterial hypertension or secondary pulmonary hypertension), lung cancer, lung metastases, chronic obstructive pulmonary disease (COPD), bronchiolitis obliterans, bronchiolitis obliterans with organizing pneumonia (BOOP), pulmonary fibrosis, or fibrous lung disease, or when the symptoms thereof are prevented, the substance is typically administered before the onset of the disease or condition, or the symptoms thereof.

[0125] As used herein, the term “target” may refer to a specific polynucleotide, peptide, or protein of interest. For example, a target RNA is the RNA of interest. In another example, a target protein is the protein of interest. In yet another example, a target gene is the gene of interest.

[0126] As used herein, “targeted delivery” or the verb form “target / target” refers to the process of facilitating the delivery of a delivered active ingredient (e.g., a therapeutic payload molecule in a lipid nanoparticle composition described herein) to reach a specific organ, tissue, cell, and / or intracellular compartment (referred to as the target site) more often than to other organs, tissues, cells, or intracellular compartments (referred to as the non-target site). Targeted delivery can be detected using methods known in the art. For example, it can be detected after systemic administration by comparing the concentration of the delivered active ingredient in the target cell population with the concentration of the delivered active ingredient in the non-target cell population. In specific embodiments, the compositions described herein result in targeted delivery to endothelial cells. In some embodiments, administration of the compositions described herein to a target results in delivery to endothelial cells being at least 2, 3, 4, 5, 6, 7, 8, or 9 times higher than delivery to non-endothelial cells (see, for example, Example 8). In some embodiments, administration of the compositions described herein to a subject results in targeted delivery to one or more (e.g., two, three, or four) or all of the endothelial cells of the subject's spleen, liver, lungs, aortic endothelium, and heart (see, for example, Example 8). In some embodiments, administration of the compositions described herein to a subject results in targeted delivery to the endothelial cells of the subject's spleen, liver, lungs, aortic endothelium, and heart (see, for example, Example 8). In some embodiments, administration of the compositions described herein to a subject results in targeted delivery to the endothelial cells of the subject's lungs, aortic endothelium, and heart (see, for example, Example 8). In specific embodiments, the particles described herein (e.g., nanoparticles) result in targeted delivery to endothelial cells. In specific embodiments, administration of the particles described herein (e.g., nanoparticles) to a subject results in delivery to endothelial cells being at least 2, at least 3, at least 4, at least 5, at least 6, at least 7, at least 8, or at least 9 times higher than delivery to non-endothelial cells.In specific embodiments, administration of the particles described herein (e.g., nanoparticles) to a target results in targeted delivery to tissues and / or organs (e.g., heart or lungs) containing endothelial cells. In some embodiments, administration of the particles described herein (e.g., nanoparticles) to a target results in targeted delivery to one or more (e.g., two, three, or four) or all of the endothelial cells of the spleen, liver, lungs, aortic endothelium, and heart of the target (see, for example, Example 8). In some embodiments, the particles described herein (e.g., nanoparticles) result in targeted delivery to the endothelial cells of the spleen, liver, lungs, aortic endothelium, and heart of the target (see, for example, Example 8). In some embodiments, administration of the particles(s) described herein (e.g., nanoparticles(s)) to a target results in delivery of at least 50%, at least 60%, at least 70%, at least 80%, or at least 90% of the particles(s) delivered to one or more of the endothelial cells of the liver, lungs, heart, and aorta of the target (see, for example, Example 8). In some embodiments, administration of the particles(s) described herein (e.g., nanoparticles(s)) to a subject results in at least 50%, at least 60%, at least 70%, at least 80%, or at least 90% of the particles(s) being delivered to the endothelial cells of the subject's liver, lungs, heart, and aorta (see, for example, Example 8). In some embodiments, administration of the particles(s) described herein for use in the delivery of active agents to endothelial cells reduces systemic side effects that may damage normal tissues and organs (see, for example, Example 8). In some embodiments, administration of the particles(s) described herein for use in the delivery of active agents to endothelial cells (e.g., siRNA or miRNA) reduces or avoids the toxicity of systemic administration of such active agents (see, for example, Example 8).

[0127] An "effective dose" is generally an amount sufficient to reduce the severity and / or frequency of one or more symptoms, reduce the number of symptoms, prevent the onset of one or more symptoms, and / or improve or repair damage resulting from or associated with endothelium-dependent disorders. An "effective dose" is generally an amount sufficient to reduce the severity and / or frequency of one or more symptoms, reduce the number of symptoms, prevent the onset of one or more symptoms, and / or improve or repair damage resulting from or associated with atherosclerosis, cardiovascular disease, pulmonary hypertension (e.g., pulmonary arterial hypertension or secondary pulmonary hypertension), lung cancer, lung metastases, chronic obstructive pulmonary disease (COPD), bronchiolitis obliterans, bronchiolitis obliterans with organizing pneumonia (BOOP), pulmonary fibrosis, or fibrous lung disease. In some embodiments, an effective dose of TGFβR1 siRNA includes the concentrations disclosed in the following Examples section.

[0128] The term “adverse reactions” encompasses undesirable and / or harmful effects of particles (e.g., LNPs), active agents, or combinations of particles (e.g., LNPs) and active agents. Undesirable effects are not necessarily harmful. Harmful effects may be harmful, unpleasant, or dangerous. Examples of adverse reactions include diarrhea, cough, gastroenteritis, wheezing, nausea, vomiting, loss of appetite, abdominal cramps, fever, pain, weight loss, dehydration, hair loss, dyspnea, insomnia, dizziness, mucositis, nerve and muscle effects, fatigue, dry mouth, loss of appetite, rash or swelling at the injection site, flu-like symptoms such as fever, chills and fatigue, gastrointestinal problems, and allergic reactions. There are many other undesirable effects that patients may experience, and these are known in the art. Many of these are described in Physician's Desk Reference (68th ed. 2014).

[0129] The terms “subject” and “patient” may be used interchangeably herein. Where used herein, in some embodiments, the subject is a mammal such as a non-primate (e.g., cattle, pigs, horses, cats, dogs, rats, etc.) or a primate (e.g., monkeys and humans). In specific embodiments, the subject is a human. In some embodiments, the mammal is a human or a non-human subject. In some embodiments, the non-primate is livestock or a pet (e.g., cattle, pigs, horses, cats, dogs, goats, sheep, donkeys, etc.). In some embodiments, the subject is diagnosed with an endothelium-dependent disorder. In some embodiments, the subject is diagnosed with atherosclerosis, cardiovascular disease, pulmonary hypertension (e.g., pulmonary arterial hypertension or secondary pulmonary hypertension), lung cancer, lung metastases, chronic obstructive pulmonary disease (COPD), bronchiolitis obliterans, bronchiolitis obliterans with organizing pneumonia (BOOP), pulmonary fibrosis, or fibrous lung disease. In some embodiments, the subjects are experiencing or have experienced one or more symptoms of endothelium-dependent disorders. In some embodiments, the subjects are experiencing or have experienced one or more symptoms of atherosclerosis, cardiovascular disease, pulmonary hypertension (e.g., pulmonary arterial hypertension or secondary pulmonary hypertension), lung cancer, lung metastases, chronic obstructive pulmonary disease (COPD), bronchiolitis obliterans, bronchiolitis obliterans with organizing pneumonia (BOOP), pulmonary fibrosis, or fibrous lung disease.

[0130] Cardiovascular disease (CVD) is a group of disorders of the heart and blood vessels. Cardiovascular diseases include, but are not limited to, (i) coronary heart disease (diseases of the blood vessels that supply blood to the myocardium), (ii) cerebrovascular disease (diseases of the blood vessels that supply blood to the brain), (iii) peripheral artery disease (diseases of the blood vessels that supply blood to the upper and lower extremities), (iv) rheumatic heart disease (damage to the myocardium and heart valves due to rheumatic fever caused by streptococcus), (v) congenital heart disease (birth defects caused by malformations of the heart structure at birth that affect the normal development and function of the heart), and (vi) deep vein thrombosis and pulmonary embolism (thrombi of the veins of the lower extremities that can break off and travel to the heart and lungs). In some embodiments, cardiovascular disease also includes heart attack and stroke, which are usually acute events caused primarily by occlusions that block blood flow to the heart or brain. Examples of cardiovascular diseases include arteriovenous malformations (AVMs), aneurysms, atherosclerosis, cardiac fibrosis, retinal vascular remodeling (retinopathy), and valvular heart disease.

[0131] Pulmonary hypertension, or PH, is a disease syndrome characterized by high blood pressure affecting the arteries of the lungs and the right side of the heart. PH may be of unknown cause (e.g., idiopathic) (e.g., primary pulmonary hypertension) or it may be secondary to another disease, disorder, or condition (e.g., caused by it) (e.g., secondary pulmonary hypertension).

[0132] Pulmonary hypertension, or PH, is characterized by a mean pulmonary artery pressure (mPAP) greater than 20 mmHg. In some embodiments, PH is characterized by a mean pulmonary artery pressure (mPAP) greater than 21 mmHg. In some embodiments, PH is characterized by a mean pulmonary artery pressure (mPAP) greater than 22 mmHg. In some embodiments, PH is characterized by a mean pulmonary artery pressure (mPAP) greater than 23 mmHg. In some embodiments, PH is characterized by a mean pulmonary artery pressure (mPAP) greater than 24 mmHg. In some embodiments, PH is characterized by a mean pulmonary artery pressure (mPAP) greater than 25 mmHg. In some embodiments, PH is characterized by a pulmonary artery wedge pressure (PAWP) of 15 mmHg or more, and / or volume plethysmography (PVR) of 3 Wood units or more. Generally, there are five types of PH groups, which can be further divided into smaller groups. The five types of hypertension include pulmonary arterial hypertension ("PAH"), pulmonary hypertension due to left heart disease, pulmonary hypertension due to lung disease, pulmonary hypertension due to pulmonary thrombosis, and blood and other disorders that lead to pulmonary hypertension. See, for example, Mandras et al., Concise Review For Clinicians 95(9) p1978-1988. PAH can be idiopathic, hereditary, drug and toxin-induced, or may be associated with various conditions such as connective tissue disease, HIV infection, portal hypertension, and congenital heart disease. Ibid. Secondary pulmonary hypertension is generally caused by underlying diseases or risk factors, including underlying heart and lung diseases.

[0133] As used herein, the term “TGFβR1 polynucleotide” refers to a polynucleotide encoding a protein called transforming growth factor beta receptor 1. TGFβR1 polynucleotides may be human or non-human (e.g., non-human primates such as dogs, cats, pigs, or horses). An example of a human TFGβR1 polynucleotide sequence is provided in GenBank accession number BC071181.1, which is reproduced below as Sequence ID No. 9. (Sequence ID 9) Further examples of polynucleotide sequences encoding human TGFβR1 include the nucleotide sequences provided in Table 1 below. In some embodiments, the polynucleotide encodes a TGFβR1 isoform. In some embodiments, the polynucleotide includes the transcript sequence found in GenBank gene ID number 7046. In some embodiments, the polynucleotide encodes the mature form of human TGFβR1.

[0134] TGFβR1 is also known as TGFBR1, TGFR1, ALK-5, ACVRLK4, TBR-I, 53kD activin A receptor type II-like protein kinase, serine / threonine protein kinase receptor R4, transforming growth factor beta receptor I, activin receptor-like kinase 5, TGF-beta type 1 receptor, TGFR-1, ESS1, MSSE, SKR4, LDS1A, AAT5, and LDS1. TGFβR1 is a receptor for TGF-beta cytokines (e.g., TGFβ1, TGFβ2, and TGFβ3) and transmits TGF-beta signals from the cell surface to the cytoplasm. For example, a heterodimer receptor complex composed of TGFβR1 and TGFβR2 molecules bound to a TGF-beta cytokine dimer leads to phosphorylation and activation of TGFβR1 by TGFβR2. SMAD2 is phosphorylated by active TGFβR1, and phosphorylated SMAD2 interacts with SMAD4 to form the SMAD2-SMAD4 complex, which translocates to the nucleus and regulates the transcription of TGF-beta-regulated genes. TGFβR1 can be human or non-human (e.g., non-human primates such as dogs, cats, pigs, and horses). Generally, immature forms of human TGFβR1 contain a signal peptide, an extracellular domain, a transmembrane domain, and a putative cytoplasmic protein kinase domain. An example of the amino acid sequence of human TGFβR1 can be found in GenBank number NP_004603.1, which is reproduced below, with the signal peptide (amino acid residues 1-33) underlined. See also UniProt accession number P36897 for more information on human TGFβR1. [ka] Further examples of TGFβR1 amino acid sequences are provided in Table 1 below. In some embodiments, TGFβR1 is an immature form. In some embodiments, TGFβR1 is a mature form of TGFβR2 that does not have a signal peptide. In some embodiments, TGFβR1 is an isoform. [Table 1]

[0135] As used herein, the term “TGFβR2 polynucleotide” refers to a polynucleotide encoding a protein called transforming growth factor β receptor 2. TGFβR2 is a receptor for TGF-beta cytokines (e.g., TGFβ1, TGFβ2, and TGFβ3). The heterodimer receptor complex, composed of TGFβR1 and TGFβR2 molecules bound to a TGF-beta cytokine dimer, results in phosphorylation of TGFβR1 by TGFβR2. TGFβR2 polynucleotides can be human or non-human (e.g., non-human primates, dogs, cats, pigs, horses, etc.). An example of human TGFβR2 polynucleotide is found in GenBank accession number NM_001024847.3, which is reproduced below. [ka] Further examples of polynucleotide sequences encoding human TGFβR2 include the nucleotide sequences provided in Table 2 below. In some embodiments, the polynucleotide encodes a TGFβR2 isoform. In some embodiments, the polynucleotide comprises the sequence of the transcript found in GenBank gene ID number 7048. In some embodiments, the polynucleotide encodes a mature form of human TGFβR2.

[0136] TGFβR2 is also known as TGFBR2, TGFR2, transforming growth factor, beta receptor II, TGFR-2, AAT3, FAA3, LDS1B, LDS2, LDS2B, MFS2, RIIC, TAAD2, TGFbeta-RII, transforming growth factor beta receptor 2, TBR-ii, or TBRIII. TGFβR2 can be human or non-human (e.g., non-human primates such as dogs, cats, pigs, and horses). TGFβR2 is a receptor for TGF-beta cytokines (e.g., TGFβ1, TGFβ2, and TGFβ3) and transmits TGF-beta signals from the cell surface to the cytoplasm. For example, a heterodimer receptor complex composed of TGFβR1 and TGFβR2 molecules bound to a TGF-beta cytokine dimer results in phosphorylation and activation of TGFβR1 by TGFβR2. Generally, immature human TGFβR2 contains a signal peptide, extracellular domain, transmembrane domain, and putative cytoplasmic domain. An example of the amino acid sequence of human TGFβR2 can be found in UniProt / Swiss Prot accession number P37173, which is reproduced below, with the signal peptide underlined. See also UniProt ID. 19939 for more information on human TGFβR2. [ka] Further examples of TGFβR2 amino acid sequences are provided in Table 2 below. In some embodiments, TGFβR2 is an immature form. In some embodiments, TGFβR2 is a mature form of TGFβR2 that does not have a signal peptide. In some embodiments, TGFβR2 is an isoform. [Table 2]

[0137] As used herein, and unless otherwise indicated, the terms “about” or “approximately” mean an acceptable error in relation to a particular value as determined by those skilled in the art, which depends in part on the method of measuring or determining such value. In some embodiments, the terms “about” or “approximately” mean within one, two, three, or four standard deviations of an enumerated number or range, including the enumerated number or range. In some embodiments, the terms “about” or “approximately” mean within or less than 20%, 15%, 10%, 9%, 8%, 7%, 6%, 5%, 4%, 3%, 2%, 1%, 0.5%, 0.05% of a given value or range, including the enumerated number or range.

[0138] As used herein, the singular terms "a," "an," and "the" refer to multiple objects unless the context clearly indicates otherwise.

[0139] As used herein, the terms “comprise(s),” “includes,” “comprising,” and “including” may be used interchangeably. The terms “comprise(s),” “includes,” “comprising,” and “including” should be interpreted as identifying the presence of the features or components mentioned, but not as excluding the presence or addition of one or more features or components, or groups thereof. Furthermore, the terms “comprise(s),” “includes,” “comprising,” and “including” are intended to include examples that are encompassed by the term “consisting of.” Therefore, the term “consisting of” can be used in place of the terms “comprise(s),” “includes,” “comprising,” and “including” to provide more specific embodiments.

[0140] As used herein, the connecting term "and / or" between multiple enumerated elements is understood to encompass both individual options and combined options. For example, when two elements are connected by "and / or," the first option refers to the applicability of the first element without the second element. The second option refers to the applicability of the second element without the first element. The third option refers to the applicability of both the first and second elements. Any one of these options is understood to fall within the scope of that meaning and therefore satisfies the requirements of the term "and / or" as used herein. The simultaneous applicability of two or more of the options is also understood to fall within the scope of that meaning and therefore satisfies the requirements of the term "and / or."

[0141] Where used herein, the term "consists of," or variations such as "consist of" or "consisting of" used throughout this specification and the claims, indicates the inclusion of any enumerated integer or set of integers, but that no additional integers or sets of integers may be added to the specified method, structure, or composition.

[0142] Numerous embodiments of the present invention are described. Needless to say, it is understood that various modifications can be made without departing from the spirit and scope of the invention. Accordingly, the experimental section and the description of the examples are intended to illustrate, but not to limit, the scope of the invention as described in the claims.

[0143] 7.3 Compounds In one embodiment, as used herein, a compound of formula (I) [ka] or a pharmaceutically acceptable salt thereof, in the formula, each R 1 These are independently hydrogen or the base of formula (i) [ka] And, Each R 2 is independently a hydrogen or a group of formula (i), R 3 These are independently substituted or unsubstituted alkyls, substituted or unsubstituted alkenyls, substituted or unsubstituted alkynyls, substituted or unsubstituted heteroalkyls, substituted or unsubstituted heteroalkenyls, substituted or unsubstituted heteroalkynyls, substituted or unsubstituted carbocyryls, substituted or unsubstituted heterocyclyls, substituted or unsubstituted aryls, substituted or unsubstituted heteroaryls, or hydrophilic polymers. However, at least one R 1 or at least one R 2 However, the compound or a pharmaceutically acceptable salt thereof, which is the base of formula (i), is provided.

[0144] In one embodiment, R 1 and R 2 Of these, 4 to 12 are the base of equation (i). In one embodiment, R 1 and R 2 Of these, 4 to 11 are the bases of formula (i). In one embodiment, R 1 and R 2 Nine of these are the base of equation (i). In one embodiment, R 1 Six of them, and R 2 Three of these are the base of equation (i). In one embodiment, R 1 and R 2 Eight of these are the base of equation (i). In one embodiment, R 1 Six of them, and R 2 Two of these are the base of equation (i). In one embodiment, R 1 and R 2 Seven of these are the base of equation (i). In one embodiment, R 1 Six of them, and R 2 One of them is the base of equation (i). In one embodiment, R 1 and R 2 Six of these are the base of equation (i). In one embodiment, R 1Six of these are the base of equation (i). In one embodiment, R 1 and R 2 Five of these are the base of equation (i). In one embodiment, R 1 Five of these are the base of equation (i). In one embodiment, R 1 and R 2 Four of these are the base of equation (i). In one embodiment, R 1 Four of these are the bases of equation (i).

[0145] When used in this specification, R 3 If the group is depicted, for example, as dividing the carbon-carbon bond of the group in formula (i), then R 3 It is understood that either carbon can be substituted.

[0146] In one embodiment, the base of formula (i) represents the base of formula (ia) or the base of formula (ib). [ka]

[0147] In one embodiment, the base of formula (i) is the base of formula (ia). [ka]

[0148] In one embodiment, the base of formula (i) is the base of formula (ia-1) or (ia-2). [ka]

[0149] In one embodiment, the base of formula (i) is the base of formula (ib). [ka]

[0150] In one embodiment, the base of formula (i) is the base of formula (ib-1) or (ib-2). [ka]

[0151] In one embodiment, R 3 Each of these is independently a substituted or unsubstituted alkyl, a substituted or unsubstituted alkenyl, or a substituted or unsubstituted heteroalkyl.

[0152] In one embodiment, R 3 Each of them is independently a substituted or unsubstituted alkyl. In some embodiments, R 3 Each of these can be independently substituted or not substituted C8~C 50 It is alkyl. In some embodiments, R 3 Each of these can be independently substituted or non-substituted C 10 ~C 18 It is alkyl. In one embodiment, alkyl is C 10 It is alkyl. In one embodiment, alkyl is C 11 It is alkyl. In one embodiment, alkyl is C 12 It is alkyl. In one embodiment, alkyl is C 13 It is alkyl. In one embodiment, alkyl is C 14 It is alkyl. In one embodiment, alkyl is C 15 It is alkyl. In one embodiment, alkyl is C 16 It is alkyl. In one embodiment, alkyl is C 17 It is alkyl. In one embodiment, alkyl is C 18 It is alkyl.

[0153] In one embodiment, R 3 Each of these is non-substitutable. In some embodiments, R 3 Each of these independently, -(CH2) n CH3 is an integer between 10 and 18. In some embodiments, R 3 Each of these is independently -(CH2)7CH3. In some embodiments, R 3Each of these is independently -(CH2)8CH3. In some embodiments, R 3 Each of these is independently -(CH2)9CH3. In some embodiments, R 3 Each of these independently, -(CH2) 10 In some embodiments, R 3 Each of these independently, -(CH2) 11 In some embodiments, R 3 Each of these independently, -(CH2) 12 In some embodiments, R 3 Each of these independently, -(CH2) 12 In some embodiments, R 3 Each of these independently, -(CH2) 14 In some embodiments, R 3 Each of these independently, -(CH2) 15 In some embodiments, R 3 Each of these independently, -(CH2) 16 In some embodiments, R 3 Each of these independently, -(CH2) 17 It is CH3.

[0154] In one embodiment, R 3 Each of them is a substituted alkyl. In a particular embodiment, R 3 Each of these is substituted with one or more fluorine substituents. In some embodiments, R 3 Each of these independently, -(CF2) n CF3 is an integer between 10 and 18. In some embodiments, R 3 Each of these independently, -(CF2) 12 It is CF3.

[0155] In one embodiment, R 3 Each of these is independently a substituted or unsubstituted alkenyl. In some embodiments, R 3Each of these can be independently substituted or not substituted C8~C 50 It is an alkenyl. In some embodiments, R 3 Each of these can be independently substituted or non-substituted C 10 ~C 18 It is an alkenyl. In some embodiments, R 3 Each of these can be independently substituted or non-substituted C 13 It is an alkenyl. In some embodiments, R 3 Each of these is independently a non-substituted C 13 The alkenyl is an alkenyl. In some embodiments, the alkenyl is a polyunsaturated fatty acid derivative. In some embodiments, the polyunsaturated fatty acid derivative includes myristoleic acid, palmitoleic acid, sapienic acid, oleic acid, linoleic acid, alpha-linolenic acid, arachinodonic acid, eicosapentaenoic acid, erucic acid, or docosahexaenoic acid.

[0156] In some embodiments, R in the formula 3 C8~C 50 Alkyl or C8-C 50 Defined as an alkenyl group, such a group implies the inclusion of a lipophilic group (also called a "lipid tail"). Lipophilic groups include a group of molecules such as fats, waxes, oils, and fatty acids. The lipid tails present on these lipid groups can be saturated or unsaturated, depending on whether the lipid tail contains a double bond or not. Lipid tails can also have varying lengths, often being of medium length (i.e., having a tail of 7 to 12 carbon atoms, for example, C 7~12 Alkyl or C 7~12 Alkenyls), long ones (i.e., having more than 12 carbon tails and up to 22 carbons, for example, C 13~22 Alkyl or C 13~22 Alkenyls), or very long ones (i.e., having a tail of more than 22 carbon atoms, for example, C 23~30 Alkyl or C 23~30 It is classified as an alkenyl.

[0157] In one embodiment, R 3Each of these is independently a substituted or unsubstituted alkynyl. In some embodiments, R 3 Each of these can be independently substituted or not substituted C8~C 50 In some embodiments, R 3 Each of these can be independently substituted or non-substituted C 10 ~C 18 In some embodiments, R 3 Each of these can be independently substituted or non-substituted C 13 In some embodiments, R 3 Each of these is independently a non-substituted C 13 It is alkinyl.

[0158] In one embodiment, R 3 Each of them is independently a substituted or unsubstituted heteroalkyl. In some embodiments, R 3 Each of these can be independently substituted or not substituted C8~C 50 It is heteroalkyl. In some embodiments, R 3 Each of these can be independently substituted or non-substituted C 10 ~C 18 It is heteroalkyl. In some embodiments, R 3 Each of these can be independently substituted or non-substituted C 13 It is heteroalkyl. In some embodiments, R 3 Each of these is independently a non-substituted C 13 It is heteroalkyl. In some embodiments, R 3 Each of these independently, -(CH2) n OCH3 is an integer between 10 and 18. In some embodiments, R 3 Each of them independently forms -CH2O(CH2) n CH3 is an integer between 8 and 18. In some embodiments, R 3 Each of these independently, -(CH2) 12 In some embodiments, R 3 Each of them is independently -CH2O(CH2)9CH3.

[0159] In one embodiment, R 3 Each of these is independently a substituted or unsubstituted heteroalkenyl. In some embodiments, R 3 Each of these can be independently substituted or not substituted C8~C 50 It is a heteroalkenyl. In some embodiments, R 3 Each of these can be independently substituted or non-substituted C 10 ~C 18 It is a heteroalkenyl. In some embodiments, R 3 Each of these can be independently substituted or non-substituted C 13 It is a heteroalkenyl. In some embodiments, R 3 Each of these is an unsubstituted C 13 It is a heteroalkenyl.

[0160] In one embodiment, each of R3 is independently a substituted or unsubstituted heteroalkynyl. In some embodiments, each of R3 is independently a substituted or unsubstituted C8-C50 heteroalkynyl. In some embodiments, each of R3 is independently a substituted or unsubstituted C10-C18 heteroalkynyl. In some embodiments, each of R3 is independently a substituted or unsubstituted C13 heteroalkynyl. In some embodiments, each of R3 is unsubstituted C 13 It is a heteroalkynyl.

[0161] In one embodiment, R 3 Each of these is independently a substituted or unsubstituted carbocyclyl. In one embodiment, R 3 Each of these is a substituted carbocyclyl. In one embodiment, R 3 Each of these is an unsubstituted carbocyclyl.

[0162] In one embodiment, R 3 Each of these is independently a substituted or unsubstituted heterocyclyl. In one embodiment, R 3 Each of these is a substituted heterocyclyl. In one embodiment, R 3Each of these is an unsubstituted heterocyclyl.

[0163] In one embodiment, R 3 Each of them is independently a substituted or unsubstituted aryl. In one embodiment, R 3 Each of these is a substitution aryl. In one embodiment, R 3 Each of these is an unsubstituted aryl.

[0164] In one embodiment, R 3 Each of them is independently a substituted or unsubstituted heteroaryl. In one embodiment, R 3 Each of these is a substituted heteroaryl. In one embodiment, R 3 Each of them is an unsubstituted heteroaryl.

[0165] In one embodiment, R 3 Each of these is a hydrophilic polymer. As used herein, “polymer” means a compound composed of at least three (e.g., at least 10, 20, 30, 40, 50, 60, 70, 80, 90, 100, etc.) covalently bonded repeating structural units. In a broader sense, “hydrophilic polymer” is a polymer as defined herein, further comprising at least one hydrogen-bondable group (e.g., oxygen, nitrogen, and / or sulfur atom) in the repeating structural unit. Hydrophilic polymers are preferably biocompatible (i.e., non-toxic). Exemplary hydrophilic polymers include, but are not limited to, polypeptides (e.g., poly-L-lysine), cellulose polymers (e.g., hydroxyethylcellulose, ethylcellulose, carboxymethylcellulose, methylcellulose, hydroxypropylmethylcellulose (HPMC)), dextran polymers, polymaleic acid polymers, poly(acrylic acid) polymers, poly(vinyl alcohol) polymers, polyvinylpyrrolidone (PVP) polymers, and polyethylene glycol (PEG) polymers.

[0166] In one embodiment, the hydrophilic polymer is a polyethylene glycol polymer, for example, a polyethylene glycol polymer of formula (ii): [ka] In the formula, R 4 v is a hydrogen atom, an acyl, a silyl, a hydroxyl protecting group, a substituted or unsubstituted alkyl group, a substituted or unsubstituted alkenyl group, a substituted or unsubstituted alkynyl group, a substituted or unsubstituted heteroalkyl group, a substituted or unsubstituted heteroalkenyl group, a substituted or unsubstituted heteroalkynyl group, a substituted or unsubstituted carbocyclyl group, a substituted or unsubstituted heterocyclyl group, a substituted or unsubstituted aryl group, or a substituted or unsubstituted heteroaryl group, and v is an integer between 3 and 600 (including both ends).

[0167] In a particular embodiment, R 4 is hydrogen. In a particular embodiment, R 4 is an acyl. In a particular embodiment, R 4 R is a hydroxyl protecting group. In certain embodiments, R 4 R is a substituted or unsubstituted alkyl group. In certain embodiments, R 4 is a substituted alkyl group. In a particular embodiment, R 4 is an unsubstituted alkyl group. In a particular embodiment, R 4 is -CH3 ("polyethylene glycol monomethyl ether" polymer). In certain embodiments, R 4 is a substituted or unsubstituted alkenyl. In certain embodiments, R 4 is a substituted or unsubstituted alkynyl. In a particular embodiment, R 4 R is a substituted or unsubstituted heteroalkyl. In certain embodiments, R 4 is a substituted or unsubstituted heteroalkenyl. In certain embodiments, R 4 is a substituted or unsubstituted heteroalkyl. In certain embodiments, R 4 is a substituted or unsubstituted carbocyclyl. In certain embodiments, R 4is a substituted or unsubstituted heterocyclyl. In certain embodiments, R 4 R is a substituted or non-substituted aryl. In a particular embodiment, R 4 These are substituted or unsubstituted heteroaryl compounds.

[0168] In a particular embodiment, v is an integer between 3 and 300, 3 and 200, 3 and 100, 3 and 90, 3 and 80, 3 and 70, 3 and 60, 3 and 50, 5 and 50, 10 and 50, 15 and 50, 20 and 50, 20 and 40, 20 and 40, 20 and 30, 20 and 25, 30 and 50, and 40 and 50 (including both ends). PEG 600 This corresponds to approximately 13.2 v on average. PEG 1000 This corresponds to a v of approximately 22.7 on average, and in the formula, R 4 It is -OCH3. PEG 2000 This corresponds to a v of approximately 45.4 on average.

[0169] In certain embodiments, the number-average molar mass (Mn) of the polyethylene glycol polymer is 10,000 or less. In certain embodiments, the number-average molar mass (Mn) of the polyethylene glycol polymer is 10,000 or less, 9,000 or less, 8,000 or less, 7,000 or less, 6,000 or less, 5,000 or less, 4,000 or less, 3,000 or less, or 2,000 or less. In certain embodiments, the number-average molar mass (Mn) of the polyethylene glycol polymer is about 100 to about 10,000 (including both ends), for example, about 100 to about 5,000, about 100 to about 4,000, about 100 to about 3,000, about 100 to about 2,500, about 100 to about 2,000, about 100 to about 1,500, about 100 to about 1,000, about 100 to about 900, about 100 to about 800, about 100 to about 700. , approximately 100 to approximately 600, approximately 100 to approximately 500, approximately 100 to approximately 400, approximately 100 to approximately 300, approximately 100 to approximately 200, approximately 100 to approximately 1500, approximately 2500 to approximately 10000, approximately 2500 to approximately 9000, approximately 2500 to approximately 8000, approximately 2500 to approximately 7000, approximately 2500 to approximately 6000, approximately 2500 to approximately 5000, approximately 2500 to approximately 4000, or approximately 2500 to approximately 3000 (including both ends). In certain embodiments, the number-average molar mass (Mn) of the polyethylene glycol polymer is 1000 (PEG 1000 In certain embodiments, the number-average molar mass (Mn) of the polyethylene glycol polymer is 2000 (PEG). 2000 ).

[0170] In one embodiment of formula (I), the base of formula (i) is the base of formula (ia). [ka]

[0171] In one embodiment, R 1 and R 2 Of these, 4 to 11 are bases of formula (ia). In one embodiment, R 1 and R 2 Nine of these are bases of formula (ia). In one embodiment, R 1 Six of them, and R 2Three of these are the base of formula (ia). In one embodiment, R 1 and R 2 Eight of these are bases of formula (ia). In one embodiment, R 1 Six of them, and R 2 Two of these are the base of formula (ia). In one embodiment, R 1 and R 2 Seven of these are bases of formula (ia). In one embodiment, R 1 Six of them, and R 2 One of them is the base of formula (ia). In one embodiment, R 1 and R 2 Six of these are the base of equation (i). In one embodiment, R 1 Six of these are bases of formula (ia). In one embodiment, R 1 and R 2 Five of these are bases of formula (ia). In one embodiment, R 1 Five of these are bases of formula (ia). In one embodiment, R 1 and R 2 Four of these are bases of formula (ia). In one embodiment, R 1 Four of these are bases of equation (ia).

[0172] In one embodiment, R 1 Six of them, and R 2 Three of these are bases of equation (ia), and R 3 Each of them is independently a substituted or unsubstituted alkyl. In one embodiment, R 3 Each of them is an unsubstituted alkyl. In one embodiment, R 3 Each of these is an unsubstituted C 13 It is alkyl. In one embodiment, R 3 Each of these is n-tridecane.

[0173] In one embodiment, R 1 Six of them, and R 2 Two of these are bases of equation (ia), and R 3 Each of them is independently a substituted or unsubstituted alkyl. In one embodiment, R 3Each of them is an unsubstituted alkyl. In one embodiment, R 3 Each of these is an unsubstituted C 13 It is alkyl. In one embodiment, R 3 Each of these is n-tridecane.

[0174] In one embodiment, R 1 Six of them, and R 2 One of them is a base of equation (ia), R 3 Each of them is independently a substituted or unsubstituted alkyl. In one embodiment, R 3 Each of them is an unsubstituted alkyl. In one embodiment, R 3 Each of these is an unsubstituted C 13 It is alkyl. In one embodiment, R 3 Each of these is n-tridecane.

[0175] In one embodiment, R 1 Six of these are bases of equation (ia), and R 3 Each of them is independently a substituted or unsubstituted alkyl. In one embodiment, R 3 Each of them is an unsubstituted alkyl. In one embodiment, R 3 Each of these is an unsubstituted C 13 It is alkyl. In one embodiment, R 3 Each of these is n-tridecane.

[0176] In one embodiment, R 1 Five of these are bases of equation (ia), and R 3 Each of them is independently a substituted or unsubstituted alkyl. In one embodiment, R 3 Each of them is an unsubstituted alkyl. In one embodiment, R 3 Each of these is an unsubstituted C 13 It is alkyl. In one embodiment, R 3 Each of these is n-tridecane.

[0177] In one embodiment, R 1 Four of these are bases of equation (ia), and R 3Each of them is independently a substituted or unsubstituted alkyl. In one embodiment, R 3 Each of them is an unsubstituted alkyl. In one embodiment, R 3 Each of these is an unsubstituted C 13 It is alkyl. In one embodiment, R 3 Each of these is n-tridecane.

[0178] In one embodiment, the compound is one of the compounds listed in Table 3, or a pharmaceutically acceptable salt thereof. [Table 3] TIFF2026522770000029.tif184165TIFF2026522770000030.tif171165

[0179] In some embodiments, this specification also refers to polyethyleneimine compounds of formula (I) [wherein at least one R 1 or R 2 A polyethyleneimine compound of formula (I) [wherein each R is not H] (for example, the compounds shown in Table 3) for use in the manufacture of 1 and R 2 However, H is (that is, N) 1 ,N 1 -Bis(2-aminoethyl)-N 2 ,N 2 -Bis(2-(bis(2-aminoethyl)amino)ethyl)ethane-1,2-diamine) is provided.

[0180] In some embodiments, one or more of the compounds described herein have fewer cationic groups and / or lower toxicity than high molecular weight polyethyleneimine species (see, e.g., Example 8). In some embodiments, one or more of the compounds described herein are more homogeneous than higher molecular weight polyethyleneimine species (see, e.g., Example 8). In some embodiments, one or more of the compounds described herein have fewer cationic groups and / or lower toxicity than 7C1 (Dahlman et al., Nat Nanotechnol 9, 648-655 (2014)). In some embodiments, one or more of the compounds described herein are more homogeneous than 7C1 (Dahlman et al., Nat Nanotechnol 9, 648-655 (2014)).

[0181] In some embodiments, the compounds provided herein are those described in the following Examples section (e.g., Example 1 or Example 8). In some embodiments, the compounds provided herein are produced by the methods described in the following Examples section (e.g., Example 1 or Example 8).

[0182] It should be understood that any embodiment of the compounds provided herein, and any specific substituents and / or variables in the compounds provided herein, can independently be combined with other embodiments and / or substituents and / or variables of the compounds to form embodiments not specifically described above. Furthermore, if a list of substituents and / or variables is enumerated for any particular group or variable, it should be understood that individual substituents and / or variables may be removed from a particular embodiment and / or claim, and the remaining list of substituents and / or variables is considered to be within the scope of the embodiments provided herein.

[0183] In this specification, it should be understood that combinations of substituents and / or variables in the given formulas are permissible only if such contributions result in a stable compound.

[0184] 7.4 Method for preparing compounds In this specification, polyethyleneimine compounds of formula (I) [wherein at least one R 1 or R 2 For producing polyethyleneimine compounds of formula (I) [wherein each R is not H] (for example, the compounds shown in Table 3), 1 and R 2 However, H is (that is, N) 1 ,N 1 -Bis(2-aminoethyl)-N 2 ,N 2 -The use of bis(2-(bis(2-aminoethyl)amino)ethyl)ethane-1,2-diamine) is provided.

[0185] The compounds of formula (I) and Table 3 can be prepared using conventional organic synthesis and commercially available starting materials. For example, but not limited to, the compounds of formula (I) and Table 3 can be prepared as outlined in Scheme 1 below and in the examples described herein. It should be noted that those skilled in the art will know how to modify the procedures described in the exemplary schemes and examples to arrive at the desired products. In some embodiments, the compounds of formula (I) and Table 3 are prepared using clearly defined low molecular weight starting materials, which is advantageous for the identification and isolation of the most potent and tolerable compounds, as well as for the scale-up, characterization, and production of the compounds (see, e.g., Example 8). In some embodiments, by using the clearly defined low molecular weight starting materials in the methods described herein, the maximum number of tertiary amines for lipidization is fixed and / or controlled, resulting in a more clearly defined and controlled mixture of lipid products which can be purified to isolate the optimized product (see, e.g., Example 8). In some embodiments, the methods for producing the compounds described herein result in lipid products with reduced heterogeneity and / or improved consistency compared to product mixtures obtained using clearly defined and / or high molecular weight polyethyleneimine starting materials (see, for example, Example 8). Scheme 1 [ka]

[0186] When the amino group of the polyethyleneimine polymer nucleophilically attacks the carbon atom with the least steric hindrance in the epoxide, the group of formula (ia) in Scheme 2 is obtained (pathway a). On the other hand, when the amino group attacks the carbon atom with greater steric hindrance in the epoxide, the group of formula (ib) in Scheme 2 is obtained (pathway b).

[0187] The compounds of the present invention may include a mixture of products bonded to the compounds of the present invention, resulting from pathways (a) and (b), depending on the preference or absence of the addition mode. The formula representing this binary bond may include a mixture of compounds. The binary group R shown in formula (i) 3 This encompasses all intended addition modes shown in Scheme 2. Scheme 2 [ka]

[0188] In certain embodiments, the conjugation reaction shown in Scheme 2 results in a mixture containing more groups conjugated to the group of formula (ia) than to the group of formula (ib), for example, the reaction mixture containing more than 50%, more than 60%, more than 70%, more than 80%, more than 90%, more than 95%, more than 99%, about 60% to about 100%, about 70% to about 100%, about 80% to about 100%, about 90% to about 100%, about 95% to about 100%, or about 99% to about 100% of the conjugated group bonded to the group of formula (ia).

[0189] In certain embodiments, the reaction mixture contains only conjugate groups bonded to the base of formula (ia).

[0190] In one embodiment, the compound of formula (I) is isolated. In one embodiment, the compound of formula (I) has a purity of about 99%, about 95%, about 90%, about 85%, about 80%, about 75%, about 70%, about 65%, about 60%, about 55%, or about 50%. In one embodiment, the compound of formula (I) is composed of each R in the formula. 1 and R 2 However, independently, it is hydrogen or the base of formula (ia), having a purity of about 99%, about 95%, about 90%, about 85%, about 80%, about 75%, about 70%, about 65%, about 60%, about 55%, or about 50%.

[0191] In some embodiments, the epoxide is chiral, i.e., has (R) or (S) stereochemistry. In such embodiments, the conjugation reaction illustrated in Scheme 2 provides a chiral conjugated polyethyleneimine polymer. Chiral compounds can be characterized by various methods well known in the art, for example, chemically modifying an optically active compound with a chiral derivatizer and then obtaining optical rotation and / or performing NMR analysis are useful methods for evaluating the chirality of a polymer. [ka]

[0192] In some embodiments where the epoxide is chiral, the conjugation reaction illustrated in Scheme 2 results in a mixture containing more groups conjugated to the (R)-(ia) group than to the (S)-(ia) group, for example, the reaction mixture containing more than 50%, more than 60%, more than 70%, more than 80%, more than 90%, more than 95%, more than 99%, about 60% to about 100%, about 70% to about 100%, about 80% to about 100%, about 90% to about 100%, about 95% to about 100%, or about 99% to about 100% of the conjugated group bonded to the (R)-(ia) group.

[0193] In certain embodiments, the reaction mixture contains only the conjugate group bonded to the group of formula (R)-(ia).

[0194] In some embodiments where the epoxide is chiral, the conjugation reaction illustrated in Scheme 2 results in a mixture containing more groups conjugated to the (S)-(ia) group than to the (R)-(ia) group, for example, the reaction mixture containing more than 50%, more than 60%, more than 70%, more than 80%, more than 90%, more than 95%, more than 99%, about 60% to about 100%, about 70% to about 100%, about 80% to about 100%, about 90% to about 100%, about 95% to about 100%, or about 99% to about 100% of the conjugated group bonded to the (S)-(ia) group.

[0195] In certain embodiments, the reaction mixture contains only conjugate groups bonded to the (S)-(ia) group.

[0196] In a particular embodiment in which one epoxide is used in a conjugation reaction, R 3 Each of these is the same in the compound of formula (I). For example, in a particular embodiment, R 3 Each of them is the same, and in the formula, R 3 R is a substituted or unsubstituted alkyl group. In certain embodiments, R 3 Each of them is the same, and in the formula, R 3 is an unsubstituted alkyl group. In a particular embodiment, R 3 Each of them is the same, and in the formula, R 3 -C8H 17 -C9H 19 , -C 10 H 21 , -C 11 H 23 , -C 12 H 25 , -C 13 H 27 , -C 14 H 29 , -C 15 H 31 , -C 16 H 33 , -C 17 H 35 , -C 18 H 37 , -C 19 H 39 , and -C 20 H 41 Selected from the group consisting of R 3 Each of them is the same, and in the formula, R 3 -C8H 17 -C9H 19 , -C 10 H 21 , -C 11 H 23 , -C 12 H 25 , -C 13 H 27 , -C 14 H 29 , -C15 H 31 , and -C 16 H 33 It is selected from the group consisting of the following.

[0197] 7.5 Particles In one embodiment, the compounds described herein may be used to form a delivery device. The compounds described herein have several properties that make them particularly suitable for the preparation of delivery devices. Such properties include: 1) the ability of the compound to form a complex with an unstable working substance and “protect” it; 2) the ability to buffer the pH within the endosome; 3) the ability to act as a “proton sponge” and induce endosomal lysis; and 4) the ability to neutralize the charge of a negatively charged working substance.

[0198] In some embodiments, the compounds described herein are used to form one or more particles containing an active substance to be delivered. In some embodiments, the particles are a colloidal dispersion (e.g., a colloidal suspension) of the particles described herein (e.g., colloids) dispersed in a dispersion medium (e.g., a liquid). The compounds described herein can be used to encapsulate active substances including, but not limited to, organic molecules (e.g., cholesterol), inorganic molecules, nucleic acids, proteins, peptides, polynucleotides, targeting agents, isotopically labeled organic or inorganic molecules, vaccines, immunoassays, etc. Other exemplary active substances are described in more detail herein. The particles may include other materials such as polymers (e.g., synthetic polymers (e.g., PEG, PLGA), natural polymers (e.g., phospholipids)). In some embodiments, the compounds described herein are mixed with one or more active substances (e.g., cholesterol) and / or one or more other materials (e.g., polymers). For example, the compounds described herein may be mixed with a certain amount of active substance and a certain amount of polymer, or with a certain amount of active substance alone, to produce particles or a group of particles.

[0199] In some embodiments, particles (e.g., nanoparticles) containing the compound according to formula (I) described herein promote endosomal escape in vivo. In some embodiments, particles (e.g., nanoparticles) containing the compounds listed in Table 3 promote endosomal escape in vivo. In some embodiments, the compound is compound 1. In some embodiments, the compound is compound 9. In some embodiments, the compound is compound 8. In some embodiments, the compound is compound 7. In some embodiments, the compound is compound 6. In some embodiments, the compound is compound 5.

[0200] In some embodiments, the diameter of a single particle or the average diameter of multiple particles is in the range of approximately 1 nm to approximately 150 nm. In some embodiments, the diameter of a single particle or the average diameter of multiple particles is in the range of approximately 1 nm to approximately 140 nm. In some embodiments, the diameter of a single particle or the average diameter of multiple particles is in the range of approximately 1 nm to approximately 130 nm. In some embodiments, the diameter of a single particle or the average diameter of multiple particles is in the range of approximately 1 nm to approximately 120 nm. In some embodiments, the diameter of a single particle or the average diameter of multiple particles is in the range of approximately 1 nm to approximately 110 nm. In some embodiments, the diameter of a single particle or the average diameter of multiple particles is in the range of approximately 1 nm to approximately 100 nm. In some embodiments, the diameter of a single particle or the average diameter of multiple particles is in the range of approximately 1 nm to approximately 10 nm. In some embodiments, the diameter of a single particle or the average diameter of multiple particles is in the range of approximately 10 nm to approximately 50 nm. In some embodiments, the diameter of a single particle or the average diameter of multiple particles is in the range of approximately 10 nm to approximately 100 nm. In some embodiments, the diameter of a single particle or the average diameter of multiple particles is in the range of approximately 25 nm to approximately 70 nm. In some embodiments, the diameter of a single particle or the average diameter of multiple particles is in the range of approximately 35 nm to approximately 60 nm. In some embodiments, the diameter of a single particle or the average diameter of multiple particles is in the range of approximately 40 nm to approximately 50 nm. In some embodiments, the diameter of a single particle or the average diameter of multiple particles is in the range of approximately 50 nm to approximately 150 nm. In some embodiments, the diameter of a single particle or the average diameter of multiple particles is in the range of approximately 50 nm to approximately 140 nm. In some embodiments, the diameter of a single particle or the average diameter of multiple particles is in the range of approximately 50 nm to approximately 130 nm. In some embodiments, the diameter of a single particle or the average diameter of multiple particles is in the range of approximately 50 nm to approximately 120 nm. In some embodiments, the diameter of a single particle or the average diameter of multiple particles is in the range of approximately 50 nm to approximately 110 nm. In some embodiments, the diameter of a single particle or the average diameter of multiple particles is in the range of approximately 50 nm to approximately 100 nm.In some embodiments, the diameter of a single particle or the average diameter of multiple particles is in the range of about 1 nm to about 5 nm. In some embodiments, the diameter of a single particle or the average diameter of multiple particles is about 10 nm, about 11 nm, about 12 nm, about 13 nm, about 14 nm, about 15 nm, about 16 nm, about 17 nm, about 18 nm, about 19 nm, or about 20 nm. In specific embodiments, the diameter of a single particle or the average diameter of multiple particles is about 21 nm, about 22 nm, about 23 nm, about 24 nm, about 25 nm, about 26 nm, about 27 nm, about 28 nm, about 29 nm, or about 30 nm. In some embodiments, the diameter of a single particle or the average diameter of multiple particles is about 31 nm, about 32 nm, about 33 nm, about 34 nm, about 35 nm, about 36 nm, about 37 nm, about 38 nm, about 39 nm, or about 40 nm. In some embodiments, the diameter of one particle or the average diameter of multiple particles is approximately 41 nm, approximately 42 nm, approximately 43 nm, approximately 44 nm, approximately 45 nm, approximately 46 nm, approximately 47 nm, approximately 48 nm, approximately 49 nm, or approximately 50 nm. In some embodiments, the diameter of one particle or the average diameter of multiple particles is approximately 51 nm, approximately 52 nm, approximately 53 nm, approximately 54 nm, approximately 55 nm, approximately 56 nm, approximately 57 nm, approximately 58 nm, approximately 59 nm, or approximately 60 nm. In some embodiments, the diameter of one particle or the average diameter of multiple particles is approximately 61 nm, approximately 62 nm, approximately 63 nm, approximately 64 nm, approximately 65 nm, approximately 66 nm, approximately 67 nm, approximately 68 nm, approximately 69 nm, or approximately 70 nm. In some embodiments, the diameter of one particle or the average diameter of multiple particles is approximately 71 nm, approximately 72 nm, approximately 73 nm, approximately 74 nm, approximately 75 nm, approximately 76 nm, approximately 77 nm, approximately 78 nm, approximately 79 nm, or approximately 80 nm. In some embodiments, the diameter of one particle or the average diameter of multiple particles is approximately 81 nm, approximately 82 nm, approximately 83 nm, approximately 84 nm, approximately 85 nm, approximately 86 nm, approximately 88 nm, approximately 88 nm, approximately 89 nm, or approximately 90 nm. In some embodiments, the diameter of one particle or the average diameter of multiple particles is approximately 91 nm, approximately 92 nm, approximately 93 nm, approximately 94 nm, approximately 95 nm, approximately 96 nm, approximately 97 nm, approximately 98 nm, approximately 99 nm, or approximately 100 nm.In some embodiments, the diameter of one particle or the average diameter of multiple particles is approximately 110 nm, approximately 111 nm, approximately 112 nm, approximately 113 nm, approximately 114 nm, approximately 115 nm, approximately 116 nm, approximately 117 nm, approximately 118 nm, or approximately 119 nm. In some embodiments, the diameter of one particle or the average diameter of multiple particles is approximately 120 nm, approximately 121 nm, approximately 122 nm, approximately 123 nm, approximately 124 nm, approximately 125 nm, approximately 126 nm, approximately 127 nm, approximately 128 nm, or approximately 129 nm. In some embodiments, the diameter of one particle or the average diameter of multiple particles is approximately 130 nm, approximately 131 nm, approximately 132 nm, approximately 133 nm, approximately 134 nm, approximately 135 nm, approximately 136 nm, approximately 137 nm, approximately 138 nm, or approximately 139 nm. In some embodiments, the diameter of a single particle or the average diameter of multiple particles is approximately the same as the size shown in Figure 11A. The particle size can be evaluated using a Malvern Zetasizer or as described in the following sections of examples (e.g., Example 8).

[0201] The particles or combinations of particles described herein can be prepared using any method known in the art. These methods include, but are not limited to, spray drying, single emulsion and double emulsion solvent evaporation, solvent extraction, phase separation, simple and complex coacervation, and other particle preparation methods well known to those skilled in the art. In some embodiments, the particle preparation method includes double emulsion solvent evaporation and / or spray drying. The conditions used when preparing the particles may be modified to yield particles of a desired size or properties (e.g., hydrophobic, hydrophilic, external morphology, "stickiness", shape, etc.). The method of preparing the particles and the conditions used (e.g., solvent, temperature, concentration, airflow rate, etc.) may also depend on the composition of the encapsulated active material and / or matrix.

[0202] Methods developed for producing particles for delivering encapsulated active substances are described in the literature (e.g., Doubrow, M., Ed., “Microcapsules and Nanoparticles in Medicine and Pharmacy,” CRC Press, Boca Raton, 1992; Mathiowitz and Langer, J. Controlled Release 5:13-22, 1987; Mathiowitz et al., Reactive Polymers 6:275-283, 1987; Mathiowitz et al., J. Appl. Polymer Sci. 35:755-774, 1988 (each of these is incorporated herein by reference)). In specific embodiments, nanoparticles (e.g., lipid nanoparticles) are produced as described in Example 2 below. In specific embodiments, nanoparticles (e.g., lipid nanoparticles) are produced as described in Example 8 below.

[0203] If a plurality of particles prepared by any of the above methods have an average size range outside the desired range, the desired particles can be selected based on size, for example, by using a sieve. The particles described herein may be coated. In certain embodiments, the particles are coated with a targeting agent. In some embodiments, the particles are not coated with a targeting agent. In some embodiments, the particles are coated to achieve desired surface properties (e.g., a specific charge).

[0204] In one embodiment, the particles described herein are nanoparticles. In some embodiments, the plurality of particles described herein are plurality of nanoparticles. In some embodiments, the plurality of nanoparticles are a colloidal dispersion of the nanoparticles described herein. The properties of a nanoparticle or plurality of nanoparticles may differ depending on their components. For example, a nanoparticle containing cholesterol as a structural lipid may have different properties than a nanoparticle containing a different structural lipid. Similarly, the properties of a nanoparticle may differ depending on the absolute or relative amount of its components. For example, a nanoparticle containing a high mole fraction of phospholipids may have different properties than a nanoparticle containing a low mole fraction of phospholipids. The properties may also differ depending on the method and conditions of preparation of the nanoparticles.

[0205] The nanoparticles or groups of nanoparticles described herein can be characterized by a variety of methods. For example, microscopy (e.g., transmission electron microscopy or scanning electron microscopy) can be used to examine the morphology and size distribution of the nanoparticles. Dynamic light scattering or potentiometric measurements (e.g., potentiometric titration) can be used to measure the zeta potential of the nanoparticles. Dynamic light scattering can also be used to determine the particle size. In addition, instruments such as the Zetasizer Nano ZS (Malvem Instruments Ltd, Malvem, and Worcestershire, UK) can be used to measure several properties of the nanoparticles, including particle size, polydispersity index, and zeta potential.

[0206] The nanoparticles or a group of nanoparticles described herein may each have a size or average size between tens of nanometers and hundreds of nanoparticles. In some embodiments, the size of the nanoparticles or the average size of a group of nanoparticles is between approximately 10 nm and approximately 150 nm, for example, approximately 10 nm, approximately 15 nm, approximately 20 nm, approximately 25 nm, approximately 30 nm, approximately 35 nm, approximately 40 nm, approximately 45 nm, approximately 50 nm, approximately 55 nm, approximately 60 nm, approximately 65 nm, approximately 70 nm, approximately 75 nm, approximately 80 nm, approximately 85 nm, approximately 90 nm, approximately 95 nm, approximately 100 nm, approximately 105 nm, approximately 110 nm, approximately 115 nm, approximately 120 nm, approximately 125 nm, approximately 130 nm, approximately 135 nm, approximately 140 nm, approximately 145 nm, or approximately 150 nm. In some embodiments, the size of the nanoparticles or the average size of a group of nanoparticles is approximately 10 nm to approximately 100 nm, approximately 35 nm to approximately 70 nm, approximately 50 nm to approximately 100 nm, approximately 50 nm to approximately 90 nm, approximately 50 nm to approximately 80 nm, approximately 50 nm to approximately 70 nm, approximately 50 nm to approximately 60 nm, approximately 60 nm to approximately 100 nm, approximately 60 nm to approximately 90 nm, approximately 60 nm to approximately 80 nm, approximately 60 nm to approximately 70 nm, approximately 70 nm to approximately 100 nm, approximately 70 nm to approximately 90 nm, approximately 70 nm to approximately 80 nm, approximately 80 nm to approximately 100 nm, approximately 80 nm to approximately 90 nm, or approximately 90 nm to approximately 100 nm. In some embodiments, the size of the nanoparticles or the average size of a group of nanoparticles is approximately 100 nm to approximately 150 nm. In some embodiments, the size of the nanoparticles or the average size of a group of nanoparticles is approximately 120 nm to approximately 150 nm. In some embodiments, the size of the nanoparticles or the average size of multiple nanoparticles is approximately 130 nm to approximately 150 nm. In some embodiments, the size of the nanoparticles or the average size of multiple nanoparticles is approximately 140 nm to approximately 150 nm. In some embodiments, the size of the nanoparticles or the average size of multiple nanoparticles is approximately 70 nm to approximately 100 nm. In some embodiments, the size of the nanoparticles or the average size of multiple nanoparticles is approximately 35 nm to approximately 60 nm. In some embodiments, the size of the nanoparticles or the average size of multiple nanoparticles is approximately 70 nm. In some embodiments, the size of the nanoparticles or the average size of multiple nanoparticles is approximately 80 nm.In some embodiments, the size of the nanoparticles or the average size of multiple nanoparticles is about 100 nm. In some embodiments, the size of the nanoparticles or the average size of multiple nanoparticles is the size of the particles or the average size of multiple particles described herein. In some embodiments, the size of the nanoparticles or the average size of multiple nanoparticles is approximately the same as the size shown in Figure 11A. The size of the nanoparticles can be evaluated using a Malvern Zetasizer or as described in the following sections of examples (e.g., Example 8).

[0207] Multiple nanoparticles described herein may be relatively uniform. The polydispersity index (PDI) can be used to indicate the uniformity of multiple nanoparticles, for example, the particle size distribution of the nanoparticles. A small polydispersity index (e.g., less than 0.3) usually indicates a narrow particle size distribution. The polydispersity index (PDI) can be evaluated using a Malvern Zetasizer or as described in the following Examples section (e.g., Example 8). Multiple nanoparticles described herein may have a polydispersity index of about 0 to about 0.25, for example, 0.01, 0.02, 0.03, 0.04, 0.05, 0.06, 0.07, 0.08, 0.09, 0.10, 0.11, 0.12, 0.13, 0.14, 0.15, 0.16, 0.17, 0.18, 0.19, 0.20, 0.21, 0.22, 0.23, 0.24, or 0.25. In some embodiments, the polydispersity index of multiple nanoparticles is about 0.05 to about 0.11. In some embodiments, the polydispersity index of multiple nanoparticles is about 0.10 to about 0.20. In some embodiments, the polydispersity index of the multiple nanoparticles is approximately 0.05, approximately 0.06, approximately 0.07, approximately 0.08, approximately 0.09, approximately 0.10, or approximately 0.11. In some embodiments, more than 50% of the nanoparticles in the multiple nanoparticles have substantially the same PDI, size distribution, size shape, surface properties, and / or internal structure. In some embodiments, more than 60% of the nanoparticles in the multiple nanoparticles have substantially the same PDI, size distribution, size shape, surface properties, and / or internal structure. In some embodiments, more than 70% of the nanoparticles in the multiple nanoparticles have substantially the same PDI, size distribution, size shape, surface properties, and / or internal structure. In some embodiments, more than 80% of the nanoparticles in the multiple nanoparticles have substantially the same PDI, size distribution, size shape, surface properties, and / or internal structure. In some embodiments, more than 90% of the nanoparticles in the multiple nanoparticles have substantially the same PDI, size distribution, size shape, surface properties, and / or internal structure.

[0208] The encapsulation efficiency of the active substance described herein represents the amount of the active substance encapsulated in the nanoparticles after preparation, or otherwise associated with the nanoparticles, compared to the initial amount provided. A high encapsulation efficiency (e.g., close to 100%) is desirable. The encapsulation efficiency can be measured, for example, by comparing the amount of active substance in a solution containing nanoparticles before and after the nanoparticles are destroyed with one or more organic solvents or surfactants. Fluorescence may be used to measure the amount of free active substance (e.g., RNA) in the solution. For the nanoparticles described herein, the encapsulation efficiency of the active substance may be at least 50%, e.g., 50%, 55%, 60%, 65%, 70%, 75%, 80%, 85%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99%, or 100%. In some embodiments, the encapsulation efficiency is at least 70%. In some embodiments, the encapsulation efficiency is at least 75%. In some embodiments, the encapsulation efficiency is at least 80%. In some embodiments, the encapsulation efficiency is at least 85%. In some embodiments, the encapsulation efficiency is at least 90%.

[0209] In some embodiments, the concentration of the active substance encapsulated in the nanoparticles described herein is approximately 1 μg / mL to 350 μg / mL when quantified, for example, by ULC. In some embodiments, the concentration of the active substance encapsulated in the nanoparticles described herein is approximately 50 μg / mL to 350 μg / mL when quantified, for example, by ULC. In some embodiments, the concentration of the active substance encapsulated in the nanoparticles described herein is approximately 100 μg / mL to 350 μg / mL when quantified, for example, by ULC. In some embodiments, the concentration of the active substance encapsulated in the nanoparticles described herein is approximately 200 μg / mL to 350 μg / mL when quantified, for example, by ULC. In some embodiments, the concentration of the active substance encapsulated in the nanoparticles described herein is approximately 300 μg / mL to 350 μg / mL when quantified, for example, by ULC. In some embodiments, the concentration of the active substance encapsulated in the nanoparticles described herein is approximately the same as the concentration shown in Figure 11A. In some embodiments, the active ingredient is a polynucleotide (e.g., siRNA, miRNA, or mRNA). In some embodiments, the active ingredient is TGFβR1 siRNA.

[0210] The zeta potential of a nanoparticle or a group of nanoparticles can be used to indicate the electrokinetic potential of the nanoparticle interface. The zeta potential can be evaluated using a Malvern Zetasizer or as described in the Examples section below (e.g., Example 8). For example, the zeta potential can explain the surface charge of a nanoparticle. Generally, nanoparticles with relatively low charge (positive or negative) are desirable, as species with higher charges may cause undesirable interactions with cells, tissues, and other elements in the body. In some embodiments, the zeta potential of the nanoparticles is approximately -10mV to approximately +20mV, approximately -10mV to approximately +15mV, approximately -10mV to approximately +10mV, approximately -10mV to approximately +5mV, approximately -10mV to approximately 0mV, approximately -10mV to approximately -5mV, approximately -5mV to approximately +20mV, approximately -5mV to approximately +15mV, approximately -5mV to approximately +10mV, approximately -5mV to approximately +5mV, approximately -5mV to approximately 0mV, approximately 0mV to approximately +20mV, approximately 0mV to approximately +15mV, approximately 0mV to approximately +10mV, approximately 0mV to approximately +5mV, approximately +5mV to approximately +20mV, approximately +5mV to approximately +15mV, or approximately +5mV to approximately +10mV. In some embodiments, the zeta potential of the nanoparticles is approximately -14mV to approximately 3.5mV. In some embodiments, the zeta potential of the nanoparticles is approximately -13.9mV, approximately -9mV, approximately -6.8mV, approximately -3.8mV, approximately -2.2mV, or approximately 3.5mV. In some embodiments, the zeta potential of the nanoparticles is the zeta potential shown in Figure 11A.

[0211] In some embodiments, the nanoparticles or a group of nanoparticles have an apparent acid dissociation constant (pKa) of 5 to 8. In some embodiments, the nanoparticles or a group of nanoparticles have an apparent acid dissociation constant (pKa) of 7.0 to 7.5. In some embodiments, the nanoparticles or a group of nanoparticles have an apparent acid dissociation constant (pKa) of 6 to 7. In some embodiments, the nanoparticles or a group of nanoparticles have an apparent acid dissociation constant (pKa) of 5, 5.5, 6, 6.5, 7, 7.5, or 8. The apparent pKa can be measured by techniques known to those skilled in the art. For example, the apparent pKa can be measured using acid-base titration and 2-(p-toluidino)-6-naphthalenesulfonic acid (TNS) fluorescence spectroscopy.

[0212] In some embodiments, the nanoparticles described herein include a lipid component comprising at least one lipid, such as a compound according to formula (I) described herein. In some embodiments, the nanoparticles include a lipid component which is one of the compounds described herein. The nanoparticles may also include one or more other lipid or non-lipid components described herein.

[0213] In some embodiments, the nanoparticles described herein comprise a lipid component, a compound according to formula (I) described herein, and a PEG lipid (e.g., PEG lipid DMPE-PEG 2000). In some embodiments, the nanoparticles described herein comprise a lipid component, a compound according to formula (I) described herein, and a PEG lipid DMPE-PEG 2000. In some embodiments, the nanoparticles described herein comprise cholesterol and / or phospholipids. In some embodiments, the nanoparticles described herein do not comprise cholesterol and / or phospholipids.

[0214] In some embodiments, the nanoparticles described herein include a lipid component, a compound listed in Table 3, and a PEG lipid (e.g., PEG lipid DMPE-PEG 2000). In some embodiments, the nanoparticles described herein include a lipid component, a compound listed in Table 3, and a PEG lipid DMPE-PEG 2000. In some embodiments, the nanoparticles described herein include cholesterol and / or phospholipids. In some embodiments, the nanoparticles described herein do not include cholesterol and / or phospholipids. In some embodiments, the compound is compound 1. In some embodiments, the compound is compound 9. In some embodiments, the compound is compound 8. In some embodiments, the compound is compound 7. In some embodiments, the compound is compound 6. In some embodiments, the compound is compound 5.

[0215] In one embodiment, the compounds described herein may also be used to prepare micelles or liposomes. Furthermore, the active substances described herein may be contained within micelles or liposomes. Micelles and liposomes are particularly useful for delivering hydrophobic active substances, such as hydrophobic molecules. When micelles or liposomes form complexes with polynucleotides (e.g., encapsulate or coat them), they are called “lipoplexes.” Many techniques for preparing micelles, liposomes, and lipoplexes are known in the art, and any method can be used in conjunction with the compounds described herein to produce micelles and liposomes.

[0216] In certain embodiments, liposomes are formed by spontaneous assembly. In other embodiments, liposomes are formed when a lipid film or lipid cake is hydrated, and the lipid crystalline bilayer laminate fluidizes and swells. The hydrated lipid sheet peels off during stirring and self-closes to form large multilayer vesicles (LMVs). This prevents water from interacting with the hydrocarbon core at the edges of the bilayer. Once these particles are formed, particle size reduction can be regulated by inputting acoustic energy (sonication) or mechanical energy (extrusion). See Walde, P., “Preparation of Vesicles (Liposomes),” In Encyclopedia of Nanoscience and Nanotechnology; Nalwa, HSEd. American Scientific Publishers: Los Angeles, 2004; Vol. 9, pp. 43-79; and Szoka et al., “Comparative Properties and Methods of Preparation of Lipid Vesicles (Liposomes),” Ann. Rev. Biophys. Bioeng. 9: 467-508, 1980 (each of these is incorporated herein). The preparation of liposomes involves preparing the compounds described herein for hydration, hydrating the compounds with stirring, and sizing the vesicles to achieve a uniform distribution of liposomes. The compounds are first dissolved in an organic solvent to ensure a homogeneous mixture. The solvent is then removed to form a polymer-derived thin film. This polymer-derived thin film is completely dried by placing the vial or flask on a vacuum pump overnight to remove any residual organic solvent. Hydration of the polymer-derived thin film is achieved by adding an aqueous medium and stirring the mixture. When the LMV suspension is broken using acoustic energy, small single-walled vesicles (SUVs) with diameters typically ranging from 15 to 50 nm are produced. Lipid extrusion is a technique that obtains particles with a diameter close to the pore size of a polycarbonate filter used by passing a lipid / polymer suspension under pressure through a polycarbonate filter with a specified pore size.Extrusion through a filter with 100 nm pores typically yields large monolayer polymer-derived vesicles (LUYs) with an average diameter of 120–140 nm.

[0217] In some embodiments (e.g., liposomes containing RNAi molecules), the liposomes are prepared by lipid extrusion (e.g., as described herein).

[0218] Certain compounds described herein can spontaneously self-assemble around certain molecules, such as DNA and RNA, to form liposomes. In some embodiments, the use of liposomes is the delivery of polynucleotides. The use of conjugated lipomers allows for simple assembly of liposomes without the need for additional steps or equipment such as extruders. Other methods for preparing liposomes and micelles are described in the following scientific papers. Dahlman et al., “In vivo endothelial siRNA delivery using polymeric nanoparticles with low molecular weight” Nat. Nanotechnol. 9(8):648-655, 2014; Narang et al., “Cationic Lipids with Increased DNA Binding Affinity for Nonviral Gene transfer in Dividing and Nondividing Cells” Bioconjugate Chem.16:156-68,2005;Hofland et al.,“Formation of stable cationic lipids / DNA complexes for gene transfer”Proc.Natl.Acad.Sci.USA 93:7305-7309,July 1996;Byk et al.,“Synthesis,Activity,and Structure-Activity Relationship Studies of Novel Cationic Lipids for DNA Transfer”J.Med.Chem.41(2):224-235,1998;Wu et al., “Cationic Lipid Polymerization as a Novel Approach for Constructing New DNA Delivery Agents”Bioconjugate Chem.12:251-57,2001;Lukyanov et al.,“Micelles from lipid derivatives of water-soluble polymers as delivery systems for poorly soluble drugs” Advanced Drug Delivery Reviews 56:1273-1289,2004; Tranchant et al., “Physicochemical optimization of plasmid delivery by cationic lipids” J.Gene Med.6:S24-S35,2004; van Balen et al., “Liposome / Water Lipophilicity: Methods, Information Content, and Pharmaceutical Applications” Medicinal Research Rev.24(3):299-324,2004 (each of these is incorporated herein by reference).

[0219] In some embodiments, the nanoparticles are those described in the Examples section below. In some embodiments, the nanoparticles described herein contain a compound of formula (I) and have one or more of the properties of the nanoparticles described in the Examples section below. In specific embodiments, the nanoparticles described herein contain a compound of formula (I) and are less toxic than 7C1 nanoparticles (see, for example, Example 4 below). In one embodiment, the nanoparticles described herein contain a compound of formula (I) and have fewer side effects than, for example, 7C1 nanoparticles. In specific embodiments, the nanoparticles described herein contain a compound of formula (I) and target endothelial cells (see, for example, Example 8 below). In some embodiments, the nanoparticles described herein contain a compound of formula (I) and have an acceptable safety profile up to at least 3 mg / kg in mice and up to 2 mg / kg in non-human primates (NHPs) as tested (see, for example, Example 8 below). In some embodiments, the nanoparticles described herein contain a compound of formula (I), are well-tolerated, target endothelial cells, and maintain efficacy in NHPs after 2 weeks (see, for example, Example 8 below). In some embodiments, the nanoparticles described herein contain the compound of formula (I), exhibit little to no toxicity, and target endothelial cells. In some embodiments, the nanoparticles described herein contain the compound of formula (I), exhibit no toxicity, target endothelial cells, and maintain efficacy in NHP for 2 weeks (see, for example, Example 8 below). In some embodiments, the nanoparticles described herein contain the compound of formula (I), cause no side effects, target endothelial cells, and maintain efficacy in NHP for 2 weeks (see, for example, Example 8 below).

[0220] 7.5.1 Polymer-conjugated lipids In some embodiments, the nanoparticles include a lipid component comprising one or more polymer-conjugate lipids (e.g., PEGylated lipids (PEG lipids)). While not bound by theory, it is believed that polymer-conjugate lipid components in nanoparticles can improve colloidal stability and / or reduce protein absorption of the nanoparticles. While not bound by theory, it is believed that polymer-conjugate lipid components in nanoparticles can prevent aggregation of nanoparticles, extend the circulation time of nanoparticles in the blood, and / or improve colloidal stability. In some embodiments, the polymer-conjugate lipids are cationic lipids. Exemplary cationic lipids that can be used in connection with this disclosure include, but are not limited to, PEG-modified phosphatidylethanolamine, PEG-modified phosphatidic acid, PEG-modified ceramide, PEG-modified dialkylamine, PEG-modified diacylglycerol, PEG-modified dialkylglycerol, and mixtures thereof. For example, PEG lipids may be PEG-c-DOMG, PEG-DMG, PEG-DLPE, PEG-DMPE, PEG-DPPC, PEG-DSPE, Ceramide-PEG2000, or Chol-PEG2000. In one embodiment, the PEG lipid is 1,2-dimiristoyl-sn-glycero-3-phosphoethanolamine-N-[methoxy(polyethylene glycol)-2000] (DMPE-PEG2000). In a specific embodiment, the PEG lipid is the PEG lipid described in the Examples section (for example, Example 1 or Example 8).

[0221] In one embodiment, the polymer conjugate lipid is a PEGylated lipid. In some embodiments, the PEGylated diacylglycerol (PEG-DAG) is 1-(monomethoxy-polyethylene glycol)-2,3-dimyristoylglycerol (PEG-DMG), PEGylated phosphatidylethanolamine (PEG-PE), PEG succinate diacylglycerol (PEG-S-DAG) (e.g., 4-O-(2',3'-di(tetradecanoyloxy)propyl-1-O-(ω-methoxy(polyethoxy)ethyl)butanediate (PEG-S-DMG)), PEGylated ceramide (PEG-cer), or PEG dialkoxypropyl carbamate (e.g., ω-methoxy(polyethoxy)ethyl-N-(2,3-di(tetradecanoxy)propyl)carbamate or 2,3-di(tetradecanoxy)propyl-N-(ω-methoxy(polyethoxy)ethyl)carbamate).

[0222] In some embodiments, pegylated lipids (e.g., DMPE-PEG2000) prevent aggregation of nanoparticles. In some embodiments, pegylated lipids (e.g., DMPE-PEG2000) extend the circulation time of nanoparticles in the blood. In some embodiments, pegylated lipids (e.g., DMPE-PEG2000) improve colloidal stability. In some embodiments, pegylated lipids (e.g., DMPE-PEG2000) prevent aggregation of nanoparticles, extend the circulation time of nanoparticles in the blood, and improve colloidal stability.

[0223] In one embodiment, the polymer conjugate lipid is present at a concentration ranging from about 0.25 to about 2.5 mg / mL. In another embodiment, the polymer conjugate lipid is present at a concentration ranging from about 1.0 to about 2.5 mg / mL. In yet another embodiment, the polymer conjugate lipid is present at a concentration of about 0.3 mg / mL. In some embodiments, the polymer conjugate lipid is present at concentrations as described in the following Examples section (e.g., Example 2 or Example 8).

[0224] In one embodiment, the molar ratio of the lipid compound described herein (e.g., the compound of formula (I)) to the polymer conjugate lipid described herein is in the range of about 10:1 to about 3:1. In one embodiment, the molar ratio of the lipid compound described herein (e.g., the compound of formula (I)) to the polymer conjugate lipid described herein is about 10:1, about 9:1, about 8:1, about 7:1, about 6:1, about 5:1, about 4:1, or about 3:1. In one embodiment, the molar ratio of the lipid compound described herein (e.g., the compound of formula (I)) to the polymer conjugate lipid described herein is about 6:1. In some embodiments, the molar ratio of the lipid compound described herein (e.g., the compound of formula (I)) to the polymer conjugate lipid described herein has the molar ratio described in the following Examples section (e.g., Example 2 or Example 8).

[0225] In one embodiment, the weight ratio of the lipid compound described herein (e.g., the compound of formula (I)) to the polymer conjugate lipid described herein is in the range of about 10:1 to about 1:5. In one embodiment, the weight ratio of the lipid compound described herein (e.g., the compound of formula (I)) to the polymer conjugate lipid described herein is in the range of about 6:1 to about 1:2. In one embodiment, the weight ratio of the lipid compound described herein (e.g., the compound of formula (I)) to the polymer conjugate lipid described herein is about 10:1, about 9:1, about 8:1, about 7:1, about 6:1, about 5:1, about 4:1, about 3:1, about 2:1, about 1:1, or about 1:2. In one embodiment, the weight ratio of the lipid compound described herein (e.g., the compound of formula (I)) to the polymer conjugate lipid described herein is about 6:1. In one embodiment, the weight ratio of the lipid compound described herein (e.g., the compound of formula (I)) to the polymer conjugate lipid described herein is about 7:1.2. In some embodiments, the weight ratio of the lipid compound described herein (e.g., the compound of formula (I)) to the polymer conjugate lipid described herein is the weight ratio described in the following Examples section (e.g., Example 2 or Example 8).

[0226] 7.5.2 Agents In some embodiments, the active substance delivered to a cell(s) or target by particles (e.g., nanoparticles) or a plurality of particles (e.g., a plurality of nanoparticles) as described herein may be any substance capable of producing physical, chemical, or biological effects. In some embodiments, the delivered active substance is a therapeutic agent, a preventive agent, or a diagnostic agent. Any chemical compound administered to a target may be delivered using the complexes, particles (e.g., nanoparticles), micelles, or liposomes described herein. The active substance may be an organic molecule (e.g., cholesterol, drugs), an inorganic molecule, a nucleic acid, a protein, a peptide, a polynucleotide, a targeting agent, an isotope-labeled organic or inorganic molecule, a vaccine, an immunoassayer, and the like. In certain embodiments, a mixture of the active substances described herein may be delivered by particles (e.g., nanoparticles) or a plurality of particles (e.g., a plurality of nanoparticles) as described herein.

[0227] In some embodiments, the active substance is an organic molecule having pharmaceutically active properties, such as a drug or therapeutic agent. In some embodiments, the active substance includes a drug. In some embodiments, the active substance is a substance used to treat a disease, disorder, or condition.

[0228] In some embodiments, an active agent delivered to a cell(s) (e.g., endothelial cells(s)) or target by particles (e.g., nanoparticles) or a plurality of particles (e.g., a plurality of nanoparticles) described herein can modulate (e.g., downregulate or upregulate) the activity of one or more target proteins. In some embodiments, an active agent delivered to a cell(s) (e.g., endothelial cells(s)) or target by particles (e.g., nanoparticles) or a plurality of particles (e.g., a plurality of nanoparticles) described herein can modulate (e.g., downregulate or upregulate) signaling mediated by a target protein. In some embodiments, the active agent downregulates signaling induced by a target protein. In some embodiments, the active agent prevents the binding of a target protein to its receptor or ligand. In some embodiments, the active agent modulates (e.g., downregulates or upregulates) the gene expression of a target. The active agent may modulate (e.g., downregulate or upregulate) gene expression at the RNA level and / or protein level.

[0229] In some embodiments, an active agent delivered to a cell(s) (e.g., endothelial cells(s)) or target by particles (e.g., nanoparticles) or multiple particles (e.g., multiple nanoparticles) described herein can modulate (e.g., downregulate) the activity of one or more TGFβR1 or TGFβR2. In some embodiments, an active agent delivered to a cell(s) (e.g., endothelial cells(s)) or target by particles (e.g., nanoparticles) or multiple particles (e.g., multiple nanoparticles) described herein can modulate (e.g., downregulate) TGFβ-mediated signaling. In some embodiments, the active agent downregulates TGFβ signaling induced by the binding of TGFβ1, TGFβ2, and TGFβ3 to TGFβR1 and / or TGFβR2. In some embodiments, the active agent prevents TGFβR1 or TGFβR2 from binding to TGFβ cytokines, e.g., TGFβ1, TGFβ2, or TGFβ3. In some embodiments, the active agent downregulates TGFβR1 and / or TGFβR2 gene expression. The active agent can downregulate TGFβR1 or TGFβR2 gene expression at the RNA level and / or protein level. In some embodiments, the active agent delivered to a cell(s) or target by particles (e.g., nanoparticles) or a plurality of particles (e.g., a plurality of nanoparticles) as described herein is a lung cancer antigen, or an antibody or fragment thereof that binds to a lung cancer antigen. In some embodiments, a mixture of the active agents described herein may be delivered by particles (e.g., nanoparticles) or a plurality of particles (e.g., a plurality of nanoparticles) as described herein.

[0230] In some embodiments, the active substance has a mass of about 10 kilodaltons (kDa) to about 50 kDa. In some embodiments, the active substance has a mass of about 15 kDa to about 50 kDa. In some embodiments, the active substance has a mass of about 20 kDa to about 50 kDa. In some embodiments, the active substance has a mass of about 25 kDa to about 50 kDa. In some embodiments, the active substance has a mass of about 30 kDa to about 50 kDa. In some embodiments, the active substance has a mass of about 40 kDa to about 50 kDa. In some embodiments, the active substance has a mass of about 10 kDa to about 25 kDa. In some embodiments, the active substance has a mass of about 1 kDa, about 2 kDa, about 3 kDa, about 4 kDa, or about 5 kDa. In some embodiments, the active substance has a mass of about 6 kDa, about 7 kDa, about 8 kDa, or about 9 kDa. In some embodiments, the active substance has a mass of about 10 kDa, about 20 kDa, about 30 kDa, about 40 kDa, or about 50 kDa. In some embodiments, the active substance has a mass of less than about 50 kDa. In some embodiments, the active substance has a mass of less than about 45 kDa, less than about 40 kDa, less than about 35 kDa, less than about 30 kDa, less than about 25 kDa, less than about 20 kDa, or less than about 15 kDa. In some embodiments, the active substance has a mass of less than about 50 kDa. In some embodiments, the active substance is negatively supercharged. In some embodiments, the active substance has a mass of less than about 50 kDa and is negatively supercharged. In some embodiments, the active substance has a mass of about 1 kDa to about 50 kDa and is negatively supercharged.

[0231] In some embodiments, negatively supercharged active materials (e.g., active materials including peptides, proteins, or fragments thereof) are characterized by negatively charged amino acid side chains at solvent-exposed residues, which typically result from amino acid substitution of non-negative amino acids (e.g., polar non-negative amino acids) at their solvent-exposed surface with negatively charged side chains (e.g., native or unnatural negatively charged side chains). For example, regarding approaches for generating negatively supercharged proteins, peptides, or fragments thereof, see Thompson et al., Methods in Enzymology, 2012, 503:293-319. In specific embodiments, negatively supercharged peptides, proteins, or fragments thereof preserve much of the original function of their original amino acid sequence (e.g., retain the activity of their original amino acid sequence). The AvNAPSA value (average number of neighboring atoms per side-chain atom) of an amino acid residue in a peptide, protein, or fragment thereof is a value that measures the solvent accessibility or burial of an amino acid side chain at the atomic level, and can be calculated from a three-dimensional model of the amino acid sequence (e.g., using Rosetta software). A 10 Å cutoff can be used to determine neighboring atoms. AvNAPSA values ​​between 50 and 150 are typical of surface residues, while AvNAPSA values ​​greater than 150 are typical of core residues (e.g., buried from the solvent). In some embodiments, a negatively supercharged peptide, protein, or fragment thereof includes one or more amino acid substitutions in which a solvent-exposed amino acid is replaced with a negatively charged amino acid (e.g., a negatively charged amino acid side chain). In some embodiments, a negatively supercharged peptide, protein, or fragment thereof includes one or more amino acid substitutions in which a hydrophilic amino acid is replaced with a negatively charged amino acid (e.g., a negatively charged amino acid side chain). In some embodiments, a negatively supercharged peptide, protein, or fragment thereof includes one or more amino acid substitutions in which an amino acid having a side chain that is not buried in the solvent is replaced with a negatively charged amino acid (e.g., a negatively charged amino acid side chain).In some embodiments, a negatively supercharged peptide, protein, or fragment thereof includes one or more amino acid substitutions in which a polar non-negative amino acid is substituted with a negatively charged amino acid (e.g., a negatively charged amino acid side chain). In some embodiments, a negatively supercharged peptide, protein, or fragment thereof includes one or more amino acid substitutions in which an amino acid with an AvNAPSA value less than 150 (e.g., less than 125, less than 100, less than 75, or less than 50) is substituted with a negatively charged amino acid (e.g., a negatively charged amino acid side chain).

[0232] In some embodiments, the one or more amino acids to be substituted (e.g., being exposed to the solvent, hydrophilic, not buried in the solvent, non-negative polarity, and / or having an AvNAPSA value less than 150) are selected from arginine (Arg), lysine (Lys), asparagine (Asn), glutamine (Gln), histidine (His), serine (Ser), or threonine (Thr). In some embodiments, the negatively charged amino acid is selected from aspartic acid (Asp), glutamic acid (Glu), or a negatively charged non-natural amino acid (e.g., a negatively charged amino acid side chain, e.g., aspartic acid, glutamic acid, or a negatively charged non-natural amino acid side chain). In some embodiments, a negatively supercharged peptide, protein, or fragment thereof comprises the substitution of one or more arginine (Arg), lysine (Lys), asparagine (Asn), glutamine (Gln), histidine (His), serine (Ser), or threonine (Thr) with aspartic acid (Asp), glutamic acid (Glu), or a negatively charged non-natural amino acid. In specific embodiments, a negatively supercharged peptide, protein, or fragment thereof comprises the substitution of one or more arginine (Arg), lysine (Lys), or glutamine (Gln) with glutamic acid (Glu), aspartic acid (Asp), glutamic acid (Glu), or a negatively charged non-natural amino acid (e.g., a negatively charged amino acid side chain such as aspartic acid or glutamic acid, or a negatively charged non-natural amino acid side chain). In specific embodiments, a negatively supercharged peptide, protein, or fragment thereof includes the substitution of one or more asparagine (Asn) molecules with aspartic acid (Asp). In some embodiments, the amino acid substitution is an amino acid replacement substitution (e.g., the length of the supercharged sequence does not change compared to the original sequence). In some embodiments, the amino acid substitution includes replacing one or more amino acids with amino acid sequences of different lengths (e.g., the length of the supercharged sequence is shorter or longer than the original sequence).

[0233] In some embodiments, the active agent comprises an antibody(s) (e.g., a monoclonal antibody) or its antigen-binding fragment. In some embodiments, the active agent is a functional antibody fragment (e.g., an antigen-binding fragment). In some embodiments, the active agent comprises an antigen-binding fragment (e.g., a Fab fragment). In some embodiments, the antibody or its antigen-binding fragment specifically binds to a target associated with a disease, disorder, or condition. In some embodiments, the antibody or its antigen-binding fragment specifically binds to a target associated with a disease, disorder, or condition.

[0234] In some embodiments, the active substance comprises an antibody(s) (e.g., a monoclonal antibody) or its antigen-binding fragment. In some embodiments, the antibody or its antigen-binding fragment binds to TGFβR1 or TGFβR2. In some embodiments, the antibody or its antigen-binding fragment specifically binds to TGFβR1 or TGFβR2. In some embodiments, the antibody or its antigen-binding fragment binds to human TGFβR1 or human TGFβR2. In some embodiments, the antibody or its antigen-binding fragment specifically binds to human TGFβR1 or human TGFβR2. In some embodiments, the antibody or its antigen-binding fragment is human or humanized.

[0235] In some embodiments, an antibody or its antigen-binding fragment inhibits the binding of TGFβR1 (e.g., human TGFβR1) or TGFβR2 (e.g., human TGFβR2) to TGFβ cytokines (e.g., TGFβ1, TGFβ2, and / or TGFβ3). In some embodiments, an antibody or its antigen-binding fragment competes with TGFβR1 (e.g., human TGFβR1) or TGFβR2 (e.g., human TGFβR2) for binding to TGFβ cytokines (e.g., TGFβ1, TGFβ2, and / or TGFβ3). Antibodies that bind to TGFβR1 (e.g., human TGFβR1) or TGFβR2 (e.g., human TGFβR2) are known to those skilled in the art.

[0236] In some embodiments, the antibody or antigen-binding fragment that binds to TGFβR1 is selected from antibody clone numbers AFB19414, 4H5-6E6-7H2, 3G1-C4-E10, or MBS catalog numbers MBS8584437, MBS9241182, MBS8541252, or MBS8309778.

[0237] In some embodiments, the antibody or antigen-binding fragment that binds to TGFβR2 is selected from antibody clone numbers 2C10-2G4-6C8, ABT-TGFR2, 2F11, or MBS catalog numbers MBS1563955, MBS8541457, MBS179443, MBS8309979, MBS3019813, MBS3019814, or MBS8584638.

[0238] Terms such as “specific binding,” “specifically binding to,” or “specific to” mean binding that is measurably different from nonspecific interactions. Specific binding can be determined, for example, by comparing the binding of a molecule to the binding of a control molecule, which is a similarly structured molecule that generally does not possess binding activity. For example, specific binding can be determined by competition with a control molecule similar to the target, such as an excess of unlabeled targets. In this case, specific binding is indicated if the binding of the labeled target to the probe is competitively inhibited by the excess of unlabeled targets. An antibody or its antigen-binding fragment that specifically binds to an antigen can be identified, for example, by immunoassays, Octet®, Biacore®, or other techniques known to those skilled in the art. In some embodiments, an antibody or its antigen-binding fragment specifically binds to an antigen if it binds to the antigen with a higher affinity than any cross-reactive antigen determined using experimental techniques such as radioimmunoassays (RIA) and enzyme-linked immunosorbent assays (ELISA). Typically, a specific or selective reaction is at least twice the background signal or noise, and may be more than 10 times the background. For considerations regarding binding specificity, see, for example, Fundamental Immunology 332-36 (Paul ed., 2d ed. 1989). In some embodiments, the degree of binding of an antibody or its antigen-binding fragment to a “non-target” protein is less than approximately 10% of the binding of the antibody or its antigen-binding fragment to its particular target antigen, as determined, for example, by fluorescence-activated cell sorting (FACS) analysis or RIA.

[0239] "Binding affinity" generally refers to the strength of the sum of non-covalent interactions between a single binding site of a molecule (e.g., a binding protein such as an antibody) and its binding partner (e.g., an antigen). Unless otherwise indicated, as used herein, "binding affinity" refers to the intrinsic binding affinity that reflects the 1:1 interaction between members of a binding pair (e.g., an antibody and an antigen). The affinity of a binding molecule X for its binding partner Y is generally expressed by the equilibrium dissociation constant (K). D) can be expressed as. Affinity can be measured by common methods known in the art, including the methods described herein. Low affinity antibodies generally tend to bind slowly to antigens and dissociate easily, while high affinity antibodies generally tend to bind rapidly to antigens and maintain binding for longer periods. Various methods for measuring binding affinity are known in the art, and any of them can be used for the purposes of this disclosure. Specific exemplary embodiments include: In one embodiment, "K D " or "K D The value can be measured by an assay known in the art, such as a binding assay. D This can be measured, for example, by RIA performed using the Fab version of the antibody of interest and its antigen (Chen et al., 1999, J. Mol Biol 293:865-81). D or K D The values ​​may also be measured by using biolayer interferometry (BLI) or surface plasmon resonance (SPR) assays, for example by Octet® using the Octet® Red96 system, or by Biacore® using the Biacore® TM-2000 or Biacore® TM-3000 system. "On rate" or "association rate" or "association rate" or "kon" may also be determined using the same biolayer interferometry (BLI) or surface plasmon resonance (SPR) techniques described above, for example by using the Octet® Red96, Biacore® TM-2000, or Biacore® TM-3000 systems.

[0240] In some embodiments, the antibody or its antigen-binding fragment binds to lung cancer antigens. For example, the antibody or its antigen-binding fragment may bind to lung cancer antigens or lung metastasis antigens, such as MAGE-A3, MAGE-A4, membrane-bound glycoprotein (MUC-1), and EGF, GD2, and mesothelin (see below for other examples of lung cancer antigens). In some embodiments, the antibody or its antigen-binding fragment binds to lung cancer tumor-associated antigens and / or lung cancer tumor-specific antigens. In some embodiments, the antibody or its antigen-binding fragment binds to lung cancer neoantigens. In some embodiments, the antibody or its antigen-binding fragment specifically binds to lung cancer tumor-associated antigens and / or tumor-specific antigens. In some embodiments, the antibody or its antigen-binding fragment binds to lung metastases.

[0241] In some embodiments, the active substance comprises a peptide or protein, or a fragment thereof. In some embodiments, the active substance comprises a peptide or protein fragment associated with a disease, disorder, or condition.

[0242] In some embodiments, the activator competes with the ligand for binding to the receptor. In some embodiments, the activator competes with the receptor for binding to the ligand. In some embodiments, the activator is a decoy of a peptide or protein associated with a disease, disorder, or condition.

[0243] In some embodiments, the active substance includes an antigen (e.g., cancer antigen, bacterial antigen, viral antigen, fungal antigen, protozoan antigen, or parasitic antigen). In some embodiments, the active substance includes a tumor-associated antigen (TAA) or tumor-specific antigen. In some embodiments, the active substance includes a neoantigen.

[0244] In some embodiments, the active agent comprises a peptide or protein or a fragment thereof. In some embodiments, the active agent comprises a protein containing a fragment of TGFβR1 (e.g., human TGFβR1) or TGFβR2 (e.g., human TGFβR2), e.g., a TGF-beta binding fragment of TGFβR1 or TGFβR2 that competes with TGFβR1 or TGFβR2 for binding to TGF-beta cytokines (e.g., TGFβ1, TGFβ2, or TGFβ3). In some embodiments, the active agent is a decoy TGFβR1 (e.g., human TGFβR1 decoy) or a decoy TGFβR2 (e.g., human TGFβR2 decoy). TGFβR1 and TGFβR2 decoys are known in the art. See, for example, International Patent Application Publication WO2018 / 138003 and U.S. Patent Application Publication 2019 / 0352373 (these are incorporated herein in their entirety); Bollard et al. 2002, Blood 99(9):3179-318; Russo et al. 2009, Int J Biochem Cell Biol 41:472-476; Penafuerte et al. 2011, J Immunol. 186(12):6933-6944; and Zhang et al. 2013, Gene Therapy 20, 575-580.

[0245] In some embodiments, the active agent includes an antigen. In some embodiments, the active agent includes two or more antigens (e.g., 2, 3, 4, 5, or more antigens). In some embodiments, the active agent includes a neoantigen. In some embodiments, the antigen includes two or more neoantigens (e.g., 2, 3, 4, 5, or more antigens). In some embodiments, the active agent includes an epitope. In some embodiments, the active agent includes two or more epitopes. In some embodiments, the active agent includes an epitope of TGFβR1 or TGFβR2 (e.g., human TGFβR1 or human TGFβR2). In some embodiments, the active agent includes two or more epitopes of TGFβR1 or TGFβR2 (e.g., human TGFβR1 or human TGFβR2).

[0246] In some embodiments, the active agent includes a kinase. For example, the active agent may be a kinase that modulates the TGFβR1 and / or TGFβR2 signaling pathway. In some embodiments, the active agent includes a phosphatase. For example, the active agent may be a phosphatase that modulates the TGFβR1 and / or TGFβR2 signaling pathway.

[0247] In some embodiments, the activator (e.g., a protein or peptide) modulates the phosphorylation of TGFβR1 and / or TGFβR2 or downstream signaling molecules. In some embodiments, the activator (e.g., a protein or peptide) modulates the binding of TGFβR1 and / or TGFβR2 to TGF-beta cytokines. In some embodiments, the activator (e.g., a protein or peptide) modulates the activation of TGFβR1 and / or TGFβR2 or downstream signaling molecules.

[0248] In some embodiments, the active substance comprises a tumor-associated antigen of lung cancer or a tumor-specific antigen of lung cancer. In some embodiments, the active substance comprises an epitope of a tumor-associated antigen of lung cancer or a tumor-specific antigen of lung cancer. In some embodiments, the active substance comprises a lung metastasis antigen.

[0249] In some embodiments, tumor-associated antigens and / or tumor-specific antigens for lung cancer are selected from human epidermal growth factor receptor 2 (HER2), carcinoembryonic antigen (CEA), mucin 1 (MUC1), melanoma-associated antigen 1 (MAGE1), melanoma-associated antigen 3 (MAGE3), melanoma-associated antigen 4 (MAGE4), melanoma-preferential expression antigen (PRAME), human telomerase reverse transcriptase (hTERT), survivin, 6-transmembrane epithelial antigen (STEAP1), SRY-box 2 (SOX2), New York esophageal squamous cell carcinoma-1 (NY-ESO-1), topoisomerase IIα (TOP2A), actin-associated protein 3 (ACTR3), ribosomal protein S6 kinase A5 (RPS6KA5), PC4 and SFRS1 interacting protein 1 (PSIP1), disialoganglioside GD2 (GD2), or mesothelin.

[0250] In some embodiments, the active substance comprises a polynucleotide. The polynucleotide may comprise RNA, DNA, or hybrids thereof. In some embodiments, the polynucleotide is single-stranded or double-stranded. In some embodiments, the polynucleotide comprises mRNA or cDNA. In some embodiments, the polynucleotide comprises an RNAi inducer, RNAi agent, siRNA, shRNA, miRNA, or antisense RNA. In some embodiments, the polynucleotide comprises a ribozyme, catalytic DNA, RNA that induces triple helix formation, or an aptamer. In specific embodiments, the active substance comprises an RNA molecule. In some embodiments, the RNA molecule comprises a shorter, agomyl, antagomil, antisense RNA, ribozyme, small interfering RNA (siRNA), asymmetric interfering RNA (aiRNA), microRNA (miRNA), Dicer-substrate RNA, small hairpin RNA (shRNA), transfer RNA (tRNA), messenger RNA (mRNA), circular RNA (circRNA), or other forms of RNA molecules known in the art. In some embodiments, the polynucleotide is an inhibitory RNA such as small interfering RNA (siRNA), asymmetric interfering RNA (aiRNA), microRNA (miRNA), Dicer-substrate RNA, antisense oligonucleotide, or small hairpin RNA (shRNA), which targets TGFβR1 RNA or TGFβR2 RNA. In specific embodiments, the RNA molecule includes miRNA (e.g., the miRNA described in Example 3 below). In specific embodiments, the RNA molecule includes siRNA (e.g., the siRNA described in Example 3 or Example 8 below). In some embodiments, the polynucleotide is circular. In some embodiments, the polynucleotide is part of a vector (e.g., a plasmid or viral vector).

[0251] In some embodiments, the active agent comprises a double-stranded (ds)RNA or dsRNA-like (e.g., chemically modified RNA) oligonucleotide molecule directed to a target sequence RNA, wherein the dsRNA or dsRNA-like oligonucleotide molecule includes both a sense strand and an antisense strand. In specific embodiments, the dsRNA or dsRNA-like oligonucleotide molecule mediates the degradation of messenger RNA (mRNA) and / or the inhibition of mRNA translation in a sequence-specific manner. In some embodiments, the dsRNA or dsRNA-like oligonucleotide reduces or knocks down the target RNA. In some embodiments, the dsRNA or dsRNA-like oligonucleotide molecule reduces or knocks down the target protein. In specific embodiments, the dsRNA or dsRNA-like oligonucleotide molecule reduces or knocks down the expression of a target gene via the RNA-induced silencing complex (RISC) pathway. The sense strand and antisense strand of the dsRNA or dsRNA-like (e.g., chemically modified RNA) oligonucleotide molecule may be of the same length or of different lengths. The sense and antisense strands of a dsRNA agent, dsRNA, RNA, or dsRNA-like (e.g., chemically modified RNA) oligonucleotide molecule may each be 19 to 30 nucleotides long. In specific embodiments, the sense and antisense strands of a dsRNA or dsRNA-like oligonucleotide molecule are each 30 nucleotides or less in length. In some embodiments, the sense and antisense strands of a dsRNA or dsRNA-like oligonucleotide molecule are independently 19 to 30 nucleotides long. In some embodiments, the sense and antisense strands of a dsRNA or dsRNA-like oligonucleotide molecule are independently 20 to 30 nucleotides long. In some embodiments, the sense and antisense strands of a dsRNA or dsRNA-like oligonucleotide molecule are independently 21 to 30 nucleotides long. In some embodiments, the sense and antisense strands of a dsRNA or dsRNA-like oligonucleotide molecule are independently 19 to 25 nucleotides long.In some embodiments, the sense and antisense strands of the dsRNA or dsRNA-like oligonucleotide molecule are each independently 20 to 25 nucleotides long. In certain embodiments, the sense and antisense strands of the dsRNA or dsRNA-like oligonucleotide molecule are each independently 21 to 25 nucleotides long. In some embodiments, the dsRNA or ds-RNA-like oligonucleotide is siRNA.

[0252] In some embodiments, the active agent comprises a double-stranded (ds)RNA or dsRNA-like (e.g., chemically modified RNA) oligonucleotide molecule directed to a target sequence of TGFβR1 RNA, wherein the dsRNA or dsRNA-like oligonucleotide molecule comprises both a sense strand and an antisense strand. In specific embodiments, the dsRNA or dsRNA-like oligonucleotide molecule mediates the degradation of messenger RNA (mRNA) and / or the inhibition of mRNA translation in a sequence-specific manner. In some embodiments, the dsRNA or dsRNA-like oligonucleotide reduces or knocks down TGFβR1 RNA. In some embodiments, the dsRNA or dsRNA-like oligonucleotide molecule reduces or knocks down TGFβR1 RNA and TGFβR1 protein. In specific embodiments, the dsRNA or dsRNA-like oligonucleotide molecule reduces or knocks down TGFβR1 gene expression via the RNA-induced silencing complex (RISC) pathway. The sense strand and antisense strand of the dsRNA or dsRNA-like (e.g., chemically modified RNA) oligonucleotide molecule may be of the same length or of different lengths. The sense and antisense strands of a dsRNA agent, dsRNA, RNA, or dsRNA-like (e.g., chemically modified RNA) oligonucleotide molecule may each be 19 to 30 nucleotides long. In specific embodiments, the sense and antisense strands of a dsRNA or dsRNA-like oligonucleotide molecule are each 30 nucleotides or less in length. In some embodiments, the sense and antisense strands of a dsRNA or dsRNA-like oligonucleotide molecule are independently 19 to 30 nucleotides long. In some embodiments, the sense and antisense strands of a dsRNA or dsRNA-like oligonucleotide molecule are independently 20 to 30 nucleotides long. In some embodiments, the sense and antisense strands of a dsRNA or dsRNA-like oligonucleotide molecule are independently 21 to 30 nucleotides long. In some embodiments, the sense and antisense strands of a dsRNA or dsRNA-like oligonucleotide molecule are independently 19 to 25 nucleotides long.In some embodiments, the sense and antisense strands of the dsRNA or dsRNA-like oligonucleotide molecule are each independently 20 to 25 nucleotides long. In certain embodiments, the sense and antisense strands of the dsRNA or dsRNA-like oligonucleotide molecule are each independently 21 to 25 nucleotides long. In some embodiments, the dsRNA or ds-RNA-like oligonucleotide is siRNA.

[0253] In some embodiments, the active agent comprises a double-stranded (ds)RNA or dsRNA-like (e.g., chemically modified RNA) oligonucleotide molecule directed to a target sequence of TGFβR2 RNA, wherein the dsRNA or dsRNA-like oligonucleotide molecule comprises both a sense strand and an antisense strand. In specific embodiments, the dsRNA or dsRNA-like oligonucleotide molecule mediates the degradation of messenger RNA (mRNA) and / or the inhibition of mRNA translation in a sequence-specific manner. In some embodiments, the dsRNA or dsRNA-like oligonucleotide reduces or knocks down TGFβR2 RNA. In some embodiments, the dsRNA or dsRNA-like oligonucleotide molecule reduces or knocks down TGFβR2 RNA and TGFβR2 protein. In specific embodiments, the dsRNA or dsRNA-like oligonucleotide molecule reduces or knocks down TGFβR2 gene expression via the RNA-induced silencing complex (RISC) pathway. The sense strand and antisense strand of the dsRNA or dsRNA-like (e.g., chemically modified RNA) oligonucleotide molecule may be of the same length or of different lengths. The sense and antisense strands of a dsRNA agent, dsRNA, RNA, or dsRNA-like (e.g., chemically modified RNA) oligonucleotide molecule may each be 19 to 30 nucleotides long. In specific embodiments, the sense and antisense strands of a dsRNA or dsRNA-like oligonucleotide molecule are each 30 nucleotides or less in length. In some embodiments, the sense and antisense strands of a dsRNA or dsRNA-like oligonucleotide molecule are independently 19 to 30 nucleotides long. In some embodiments, the sense and antisense strands of a dsRNA or dsRNA-like oligonucleotide molecule are independently 20 to 30 nucleotides long. In some embodiments, the sense and antisense strands of a dsRNA or dsRNA-like oligonucleotide molecule are independently 21 to 30 nucleotides long. In some embodiments, the sense and antisense strands of a dsRNA or dsRNA-like oligonucleotide molecule are independently 19 to 25 nucleotides long.In some embodiments, the sense and antisense strands of the dsRNA or dsRNA-like oligonucleotide molecule are each independently 20 to 25 nucleotides long. In certain embodiments, the sense and antisense strands of the dsRNA or dsRNA-like oligonucleotide molecule are each independently 21 to 25 nucleotides long. In some embodiments, the dsRNA or ds-RNA-like oligonucleotide is siRNA.

[0254] The double-stranded region formed by the hybridization of the antisense and sense strands of a dsRNA or dsRNA-like oligonucleotide molecule can be the full length of both strands. For example, the antisense strand of a dsRNA or dsRNA-like oligonucleotide molecule may be 19 nucleotides long, and the sense strand may be 19 nucleotides long, and the double-stranded region formed by the hybridization of these strands is 19 nucleotides. In specific embodiments, the double-stranded region of a dsRNA or dsRNA-like oligonucleotide molecule is long enough to function as a substrate for the Dicer enzyme. In certain embodiments, the double-stranded region of a dsRNA or dsRNA-like oligonucleotide molecule is 15 to 30 base pairs long. For example, the double-stranded regions of the dsRNA or dsRNA-like oligonucleotide molecules described herein are 15-29, 15-28, 15-27, 15-26, 15-25, 15-24, 15-23, 15-22, 15-21, 15-20, 15-19, 15-18, 15-17, 18-30, 18-29, 18-28, 18-27, 18-26, 18-25, 18-24, 18-23, 18-22, 18-21, 18-20, The base pair lengths may be 19-30, 19-29, 19-28, 19-27, 19-26, 19-25, 19-24, 19-23, 19-22, 19-21, 19-20, 20-30, 20-29, 20-28, 20-27, 20-26, 20-25, 20-24, 20-23, 20-22, 20-21, 21-30, 21-29, 21-28, 21-27, 21-26, 21-25, 21-24, 21-23, or 21-22. Ranges and values ​​between the ranges and values ​​listed above are also intended to be part of this disclosure. In some embodiments, the dsRNA or dsRNA-like oligonucleotide molecule includes a double-stranded region longer than 30 base pairs and is processed into a functional double helix of, for example, 15-30 base pairs, with a target sequence as the target for cleavage. In some embodiments, the dsRNA or dsRNA-like oligonucleotide molecule described herein is an siRNA.In specific embodiments, the dsRNA or dsRNA-like oligonucleotide molecule is not naturally occurring (e.g., not a naturally occurring siRNA). In some embodiments, the dsRNA or dsRNA-like oligonucleotide molecule does not contain a double-stranded region exceeding 30 base pairs that is cleaved or otherwise processed to produce a functional double helix of, for example, 15–30 base pairs that targets a target sequence for cleavage. In some embodiments, the dsRNA or dsRNA-like oligonucleotide molecule has a blunt end. In some embodiments, the sense strand or antisense strand of the dsRNA or dsRNA-like oligonucleotide molecule includes an overhang. The overhang may be at the 5' end, 3' end, or both the 5' and 3' ends of either the sense strand or antisense strand of the dsRNA or dsRNA-like oligonucleotide molecule. In some embodiments, the sense strand and antisense strand of the dsRNA or dsRNA-like oligonucleotide molecule include overhangs. The sense strand overhang may be at the 5' end of the sense strand, and the antisense strand overhang may be at the 3' end of the antisense strand. Alternatively, the sense strand overhang may be at the 3' end of the sense strand, and the antisense strand overhang may be at the 5' end of the antisense strand. In certain embodiments, the strand overhang of the dsRNA or dsRNA-like oligonucleotide molecule consists of 1-5 nucleotides, 1-4 nucleotides, 1-3 nucleotides, or 1-2 nucleotides. In some embodiments, the strand overhang of the dsRNA or dsRNA-like oligonucleotide molecule consists of 2-5 nucleotides, 2-4 nucleotides, 2-3 nucleotides, 3-4 nucleotides, 3-4 nucleotides, or 4-5 nucleotides.

[0255] In some embodiments, the antisense strand of a dsRNA or dsRNA-like oligonucleotide molecule hybridizes to a specific region of the target RNA. For example, the antisense strand of a dsRNA or dsRNA-like oligonucleotide molecule hybridizes to a specific exon region of the target RNA. In another example, the antisense strand of a dsRNA or dsRNA-like molecule hybridizes to an untranslated region of the target RNA.

[0256] In some embodiments, the antisense strand of a dsRNA or dsRNA-like oligonucleotide molecule hybridizes to a specific region of TGFβR1 RNA or TGFβR2 RNA. For example, the antisense strand of a dsRNA or dsRNA-like oligonucleotide molecule hybridizes to a specific exon region of TGFβR1 RNA or TGFβR2 RNA. In another example, the antisense strand of a dsRNA or dsRNA-like molecule hybridizes to an untranslated region of TGFβR1 RNA or TGFβR2 RNA. In some embodiments, TGFβR1 RNA or TGFβR2 RNA is a transcript from Table 1 or Table 2 above.

[0257] As used herein, “target sequence” refers to a contiguous portion of the nucleotide sequence of an RNA molecule formed during the transcription of a target gene, e.g., a TGFβR1 gene (e.g., a human TGFβR1 gene) or a TGFβR2 gene (e.g., a human TGFβR2 gene) (including mRNA (e.g., TGFβR1 or TGFβR2 mRNA) which is the product of RNA processing of the primary transcript resulting from alternative splicing). In some embodiments, the contiguous portion of the nucleotide sequence is at least long enough to function as a substrate for RNAi-induced cleavage at or near that portion of the nucleotide sequence of the mRNA molecule formed during the transcription of a target gene, e.g., a TGFβR1 gene (e.g., a human TGFβR1 gene) or a TGFβR2 gene (e.g., a human TGFβR2 gene). In specific embodiments, the target sequence is about 15 to 30 nucleotides long. For example, the target sequence may be approximately 15-30 nucleotides long, 15-25, 15-24, 15-23, 15-22, 15-21, 15-20, 15-19, 15-18, 18-30, 18-25, 18-24, 18-23, 18-22, 18-21, 18-20, 19-30, 19-25, 19-24, 19-23, 19-22, 19-21, 19-20, 20-30, 20-25, 20-24, 20-23, 20-22, 20-21, 21-30, 21-25, 21-24, 21-23, or 21-22 nucleotides long. In some embodiments, the target sequence is 19-25 nucleotides long. In some embodiments, the target sequence is 21 to 23 nucleotides long. Ranges and values ​​intermediate to the ranges and values ​​listed above are also intended to be part of this disclosure. In specific embodiments, the target sequence includes human TGFβR1 or human TGFβR2.

[0258] In specific embodiments, the active agent includes siRNA targeting TGFβR1 (e.g., human TGFβR1), such as the siRNA described in Example 3 or 8 below. In some embodiments, the active agent includes siRNA mouse TGFβR1 of Example 3 or Example 8, comprising the sense strand of SEQ ID NO: 5 and the antisense strand of SEQ ID NO: 6. In specific embodiments, the active agent includes siRNA human TGFβR1 of Example 3 or Example 8, comprising the sense strand of SEQ ID NO: 7 and the antisense strand of SEQ ID NO: 8. While we do not wish to be bound by theory, since TGFβR1 is expressed at very low levels in normal human endothelial cells and is upregulated in endothelium-dependent disorders, active agents containing siRNA targeting TGFβR1 are useful in methods for treating endothelium-dependent disorders. While we do not wish to be bound by theory, since TGFβR1 is a causative gene for pulmonary hypertension (PH), active agents containing siRNA targeting TGFβR1 are useful in methods for treating PH. In certain embodiments, targeted delivery of an active agent containing TGFβR1-targeted siRNA minimizes or avoids systemic inhibition of TGFβ signaling and associated systemic pro-inflammatory effects. In some embodiments, targeted delivery of an active agent containing TGFβR1-targeted siRNA reduces systemic side effects that may damage normal tissues and organs. In some embodiments, targeted delivery of an active agent containing TGFβR1-targeted siRNA reduces or avoids the toxicity of overall TGFβ inhibition.

[0259] In some embodiments, the active agent includes an siRNA targeting mouse TGFβR1 RNA called S1 in Lai et al., J Environ Pathol Toxicol Oncol. 2009;28(2):109-119 ((GAAGCGGACUACUAUGCUAUU (sense, 5'-3'; SEQ ID NO: 13) and UUCUUCGCCUGAUGAUACGAU-P (antisense, 3'-5'; SEQ ID NO: 14)). In some embodiments, the active agent includes an siRNA targeting mouse TGFβR1 RNA called S2 in Lai et al., J Environ Pathol Toxicol Oncol. 2009;28(2):109-119 ((AGGCGGUGCUCGCUUUGUAUU (sense, 5'-3'; SEQ ID NO: 15) and UUUCCGCCACGAGCGAAACAU-P (antisense, 3'-5'; SEQ ID NO: 16)). In some embodiments, the active agent includes an siRNA targeting mouse TGFβR1 RNA called S2 in Lai et al., J The active ingredient includes an siRNA targeting mouse TGFβR1 RNA called S3 in Environ Pathol Toxicol Oncol. 2009;28(2):109-119 ((ACAACGCCAUCUAUGAGAAUU (sense, 5'-3'; SEQ ID NO: 17) and UUTGUUGCGGUAGAUAGUCUU-P (antisense, 3'-5'; SEQ ID NO: 18)). In some embodiments, the active ingredient includes an siRNA targeting mouse TGFβR1 RNA called S3 in Lai et al., J Environ Pathol Toxicol Oncol. 2009;28(2):109-119 ((GAAACGGAAGCGCAUCGAAUU (sense, 5'-3'; SEQ ID NO: 19) and UUCUUUGCCUUCGCGUAGCUU-P (antisense, 3'-5'; SEQ ID NO: 20)).

[0260] In specific embodiments, the active ingredient includes siRNA or shRNA from Santa Cruz Biotechnology catalog number sc-40222.

[0261] In specific embodiments, the active ingredient includes siRNA directed towards TGFβR2 (e.g., human TGFβR2). In some embodiments, the active ingredient includes siRNA or shRNA from Santa Cruz Biotechnology catalog number sc-36657.

[0262] In some embodiments, the active ingredient comprises a clustered, regularly interspaced, short palindromic repeat (CRISPR) system.

[0263] In some embodiments, the active agent is a diagnostic or detectable agent (e.g., a fluorescent agent, a radioactive agent, or a chemical agent). In some embodiments, the diagnostic or detectable agent is a protein (e.g., a fluorescent protein, a radioactive protein, or an enzyme). In some embodiments, the diagnostic or detectable agent is targeted by a detectable reagent (e.g., a fluorescent antibody, a radioactive antibody, or an enzyme that binds to the diagnostic or detectable agent). In some embodiments, the diagnostic or detectable agent includes gases; metals; commercially available imaging agents used in positron emission tomography (PET), computed tomography (CT), single-photon emission computed tomography, X-ray, fluoroscopy, or magnetic resonance imaging (MRI); or contrast agents. In some embodiments, the diagnostic or detectable agent is suitable for use in MRI (e.g., MRI contrast agents such as gadolinium chelate, iron, magnesium, manganese, copper, or chromium). In some embodiments, the diagnostic or detectable agent is suitable for CAT and X-ray imaging (e.g., iodine-based materials).

[0264] In some embodiments, the diagnostic or detectable agent has a mass of about 10 kilodaltons (kDa) to about 50 kDa. In some embodiments, the diagnostic or detectable agent has a mass of about 15 kDa to about 50 kDa. In some embodiments, the diagnostic or detectable agent has a mass of about 20 kDa to about 50 kDa. In some embodiments, the diagnostic or detectable agent has a mass of about 25 kDa to about 50 kDa. In some embodiments, the diagnostic or detectable agent has a mass of about 30 kDa to about 50 kDa. In some embodiments, the diagnostic or detectable agent has a mass of about 40 kDa to about 50 kDa. In some embodiments, the diagnostic or detectable agent has a mass of about 10 kDa to about 25 kDa. In some embodiments, the diagnostic or detectable agent has a mass of about 10 kDa, about 20 kDa, about 30 kDa, about 40 kDa, or about 50 kDa. In some embodiments, the diagnostic or detectable agent has a mass of less than about 50 kDa. In some embodiments, the diagnostic or detectable agent has a mass of less than about 45 kDa, less than about 40 kDa, less than about 35 kDa, less than about 30 kDa, less than about 25 kDa, less than about 20 kDa, or less than about 15 kDa. In some embodiments, the diagnostic or detectable agent has a mass of less than about 50 kDa. In some embodiments, the diagnostic or detectable agent is negatively supercharged. In some embodiments, the diagnostic or detectable agent has a mass of less than about 50 kDa and is negatively supercharged. In some embodiments, the diagnostic or detectable agent has a mass of about 1 kDa to about 50 kDa and is negatively supercharged.

[0265] In some embodiments, the active ingredient includes antibiotics, nutritional supplements, or vaccines. In some embodiments, the vaccine includes passive or active immunity. In some embodiments, the vaccine includes isolated proteins or peptides, inactivated organisms or viruses, dead organisms or viruses, genetically modified organisms or viruses, or cell extracts. In some embodiments, the active ingredient includes antigens of bacteria, fungi, protozoa, or parasites. These antigens may be in the form of whole-killed organisms, peptides, proteins, glycoproteins, carbohydrates, or combinations thereof.

[0266] In some embodiments, the active substance delivered may be a mixture of the active substances described herein.

[0267] In some embodiments, the compounds described herein, and the complexes, liposomes, micelles, and particles (e.g., nanoparticles) prepared therefrom, may be modified to include a targeting agent, as it is often desirable to target specific cells, cell aggregates, or tissues. Various targeting agents are known in the art for directing pharmaceutical compositions to specific cells (see, for example, Cotten et al., Methods Enzym. 217:618, 1993, incorporated herein by reference). The targeting agent may be present throughout the particle or only on the surface. The targeting agent may be a protein, peptide, carbohydrate, glycoprotein, lipid, small molecule, nucleic acid, etc. The targeting agent may be used to target specific cells or tissues, or to promote endocytosis or phagocytosis of the particle. Examples of targeting agents include, but are not limited to, antibodies, antibody fragments (e.g., functional antibody fragments), antibody antigen-binding fragments, low-density lipoproteins (LDL), transferrin, asialycoproteins, carbohydrates, receptor ligands, sialic acids, and aptamers. If the targeting agent is present throughout the particle, it may be included in the mixture used to form the particle. If the targeting agent is present only on the surface, it can covalently bond to or associate with the particle formed using standard chemical techniques (e.g., by ionic bonds, hydrophobic bonds, hydrogen bonds, electrostatic interactions, van der Waals interactions, or other interactions). In some embodiments, the particles described herein (e.g., nanoparticles) do not contain a targeting agent.

[0268] The payload of particles (e.g., nanoparticles) described herein may be any active substance described herein. In some embodiments, the active substance as a payload comprises one or more peptides, proteins, or fragments thereof (e.g., negatively supercharged peptides, proteins, or fragments thereof). The peptides, proteins, or fragments thereof may be those described herein. For example, the peptides, proteins, or fragments thereof may be antigens, antibodies, decoys, kinases, or phosphatases.

[0269] In some embodiments, the active agent comprises one or more polynucleotides (e.g., siRNA, miRNA, mRNA, or other types of RNA or DNA molecules) as a payload. In some embodiments, one or more polynucleotides (e.g., siRNA, miRNA, mRNA, or other types of RNA or DNA molecules) are conjugated or linked (directly or indirectly) to a targeting agent. The compounds disclosed herein are particularly useful in the administration of polynucleotides. For example, the compound of formula (I) has a tertiary amine, which is sterically hindered but is capable of interacting with polynucleotides (e.g., DNA, RNA, synthetic analogs of DNA and / or RNA, DNA / RNA hybrids, etc.). The polynucleotide or its derivative is brought into contact with the compounds disclosed herein under conditions suitable for the formation of a polynucleotide / lipomer complex.

[0270] While not bound by theory, the interaction between the lipomer compounds disclosed herein (e.g., the compound of formula (I)) and polynucleotides is thought to at least partially prevent the degradation of the polynucleotides. By neutralizing the charge on the polynucleotide backbone, neutral or slightly positively charged complexes can also more easily pass through the hydrophobic membranes of cells (e.g., cytoplasmic membrane, lysosomal membrane, endosomal membrane, nuclear membrane). In certain embodiments, the complex is slightly positively charged. In certain embodiments, the complex has a positive potential, and more preferably, its zeta potential is 0 to +30.

[0271] The lipomer compounds disclosed herein (e.g., compounds of formula (I)) are preferably provided at least partially as salts (i.e., protonated) to form complexes with negatively charged polynucleotides. In certain embodiments, the resulting polynucleotide / lipomer complexes form particles useful for the delivery of polynucleotides to cells. In certain embodiments, multiple lipomers may associate with polynucleotide molecules. For example, the complex may comprise 1 to 100 lipomers, 1 to 1000 lipomers, 10 to 1000 lipomers, or 100 to 10,000 lipomers.

[0272] In some embodiments, the composite may form particles. The size of the particles formed varies depending on the payload being delivered (e.g., the active substance and / or compound used). In some embodiments, the diameter of one particle or the average diameter of multiple particles is in the range of 10 to 150 nm. In certain embodiments, the diameter of one particle or the average diameter of multiple particles is in the range of 10 to 100 nm. In certain embodiments, the diameter of one particle or the average diameter of multiple particles is in the range of about 25 nm to about 70 nm. In certain embodiments, the diameter of one particle or the average diameter of multiple particles is in the range of about 35 nm to about 60 nm. In certain embodiments, the diameter of one particle or the average diameter of multiple particles is in the range of about 40 nm to about 50 nm. In certain embodiments, the diameter of one particle or the average diameter of multiple particles is in the range of about 50 nm to about 100 nm. In certain embodiments, the diameter of one particle or the average diameter of multiple particles is in the range of about 1 nm to about 5 nm. In some embodiments, the diameter of one particle or the average diameter of multiple particles is approximately 10 nm, approximately 11 nm, approximately 12 nm, approximately 13 nm, approximately 14 nm, approximately 15 nm, approximately 16 nm, approximately 17 nm, approximately 18 nm, approximately 19 nm, or approximately 20 nm. In specific embodiments, the diameter of one particle or the average diameter of multiple particles is approximately 21 nm, approximately 22 nm, approximately 23 nm, approximately 24 nm, approximately 25 nm, approximately 26 nm, approximately 27 nm, approximately 28 nm, approximately 29 nm, or approximately 30 nm. In some embodiments, the diameter of one particle or the average diameter of multiple particles is approximately 31 nm, approximately 32 nm, approximately 33 nm, approximately 34 nm, approximately 35 nm, approximately 36 nm, approximately 37 nm, approximately 38 nm, approximately 39 nm, or approximately 40 nm. In some embodiments, the diameter of one particle or the average diameter of multiple particles is approximately 41 nm, approximately 42 nm, approximately 43 nm, approximately 44 nm, approximately 45 nm, approximately 46 nm, approximately 47 nm, approximately 48 nm, approximately 49 nm, or approximately 50 nm. In some embodiments, the diameter of one particle or the average diameter of multiple particles is approximately 51 nm, approximately 52 nm, approximately 53 nm, approximately 54 nm, approximately 55 nm, approximately 56 nm, approximately 57 nm, approximately 58 nm, approximately 59 nm, or approximately 60 nm.In some embodiments, the diameter of one particle or the average diameter of multiple particles is approximately 61 nm, approximately 62 nm, approximately 63 nm, approximately 64 nm, approximately 65 nm, approximately 66 nm, approximately 67 nm, approximately 68 nm, approximately 69 nm, or approximately 70 nm. In some embodiments, the diameter of one particle or the average diameter of multiple particles is approximately 71 nm, approximately 72 nm, approximately 73 nm, approximately 74 nm, approximately 75 nm, approximately 76 nm, approximately 77 nm, approximately 78 nm, approximately 79 nm, or approximately 80 nm. In some embodiments, the diameter of one particle or the average diameter of multiple particles is approximately 81 nm, approximately 82 nm, approximately 83 nm, approximately 84 nm, approximately 85 nm, approximately 86 nm, approximately 88 nm, approximately 88 nm, approximately 89 nm, or approximately 90 nm. In some embodiments, the diameter of one particle or the average diameter of multiple particles is approximately 91 nm, 92 nm, 93 nm, 94 nm, 95 nm, 96 nm, 97 nm, 98 nm, 99 nm, or 100 nm. In some embodiments, the diameter of one particle or the average diameter of multiple particles is approximately 110 nm, 130 nm, 140 nm, or 150 nm. In some embodiments, the diameter of one particle or the average diameter of multiple particles is approximately the same as the size shown in Figure 11A.

[0273] The particles can associate with the targeting agent as described below. The thin film structure is precisely designed and controllable with an accuracy of 1 nm, within the range of 1 to 100 nm, and its molecular composition is clearly understood.

[0274] Polynucleotides may be complexed with the lipomer of the present invention (for example, the compound of formula (I)), encapsulated therein, or included in a composition containing the lipomer of the present invention.

[0275] Exemplary forms of polynucleotides that may be included as payloads include, but are not limited to, one or more of the following: deoxyribonucleic acid (DNA), ribonucleic acid (RNA) including messenger mRNA (mRNA), their hybrids, RNAi inducers, RNAi agents, siRNA, shRNA, miRNA, antisense RNA, ribozymes, catalytic DNA, RNA that induces triple helix formation, aptamers, vectors, etc. In some embodiments, the payload includes RNA. RNA molecules that may be included as payloads include, but are not limited to, shortmers, agomyl, antagomil, antisense, ribozymes, small interfering RNA (siRNA), asymmetric interfering RNA (aiRNA), microRNA (miRNA), Dicer-substrate RNA (dsRNA), small hairpin RNA (shRNA), transfer RNA (tRNA), messenger RNA (mRNA), circular RNA (circRNA), and other forms of RNA molecules known in the art. In some embodiments, the RNA is mRNA.

[0276] In some embodiments, the polynucleotide is an antisense RNA. In some embodiments, the polynucleotide is an antisense RNA that targets TGFβR1 (e.g., human TGFβR1) RNA or TGFβR2 (e.g., human TGFβR2) RNA.

[0277] In some embodiments, dsRNA, siRNA, shRNA, miRNA, mRNA, and / or antisense RNA can be designed and / or predicted using one or more of the numerous available algorithms. To give a few examples, algorithms found in the following resources: Alnylum Online, Dharmacon Online, OligoEngine Online, Molecula Online, Ambion Online, BioPredsi Online, RNAi Web Online, Chang Bioscience Online, Invitrogen Online, LentiWeb Online, GenScript Online, Protocol Online; Reynolds et al., 2004, Nat. Biotechnol., 22:326; Naito et al., 2006, Nucleic acids Res., 34:W448; Li et al., 2007, RNA, 13:1765; Yiu et al., 2005, Bioinformatics, 21:144; and Jia et al., 2006, BMC Bioinformatics, 7:271 (each of these incorporated herein by reference) can be used to design and / or predict dsRNA, siRNA, shRNA, miRNA, and / or mRNA.

[0278] In some embodiments, the polynucleotides that may be included as a payload include siRNA molecules. In particular, in some embodiments, siRNA molecules can selectively interfere with the expression of a gene of interest (e.g., a target gene) and downregulate its expression. In some embodiments, siRNA molecules mediate the degradation of messenger RNA (mRNA) and / or the inhibition of mRNA translation in a sequence-specific manner. In some embodiments, siRNA molecules reduce or knock down target RNA. In some embodiments, siRNA molecules reduce or knock down target protein. In some embodiments, siRNA molecules reduce or knock down TGFβR2 RNA. In some embodiments, the siRNA payload selectively silences genes associated with a specific disease, disorder, or condition when an siRNA-containing particle (e.g., nanoparticle) composition is administered to a target that requires it. In some embodiments, the siRNA molecule includes a sequence complementary to the mRNA sequence encoding the protein product of interest (e.g., a target protein). In particular, in some embodiments, siRNA molecules can selectively interfere with and downregulate the expression of the TGFβR1 gene (e.g., the human TGFβR1 gene) or the TGFβR2 gene (e.g., the human TGFβR2 gene). In some embodiments, siRNA molecules mediate the degradation of messenger RNA (mRNA) and / or the inhibition of mRNA translation in a sequence-specific manner. In some embodiments, siRNA molecules reduce or knock down TGFβR1 RNA. In some embodiments, siRNA molecules reduce or knock down both TGFβR1 RNA and TGFβR1 protein. In some embodiments, siRNA molecules reduce or knock down both TGFβR2 RNA and TGFβR2 protein.In some embodiments, the siRNA payload selectively silences the expression of a TGFβR1 gene (e.g., human TGFβR1 gene) or a TGFβR2 gene (e.g., human TGFβR2 gene) when the siRNA-containing nanoparticle composition is administered to a target requiring it. In some embodiments, the siRNA molecule contains a sequence complementary to the mRNA sequence encoding the protein product of interest. In some embodiments, the siRNA is as described in Example 3 or Example 8.

[0279] In some embodiments, the polynucleotide that may be included as a payload includes an shRNA molecule. In some embodiments, the polynucleotide that may be included as a payload includes an shRNA molecule that targets TGFβR1 RNA (e.g., human TGFβR1 RNA) or TGFβR2 RNA (e.g., human TGFβR2 RNA), or a vector encoding said shRNA molecule. In some embodiments, when the payload is administered to target cells, it produces shRNA within the target cells. Constructs and mechanisms related to shRNA are well known in the art.

[0280] In some embodiments, the polynucleotide that may be included as a payload includes an mRNA molecule. In particular, in some embodiments, the mRNA molecule encodes a polypeptide of interest, including any naturally occurring polypeptide, a non-naturally occurring polypeptide, or a otherwise modified polypeptide. The polypeptide encoded by mRNA may be of any size and may have any secondary structure or activity. In some embodiments, the polypeptide encoded by the mRNA payload may have beneficial (e.g., therapeutic) effects when expressed in cells. In some embodiments, the polypeptide is an antibody or a fragment thereof (e.g., Fab). In some embodiments, the polynucleotide that may be included as a payload includes an mRNA molecule encoding a protein containing a fragment of TGFβR1 (e.g., human TGFβR1) or a fragment of TGFβR2 (e.g., human TGFβR2). In some embodiments, the polynucleotide that may be included as a payload includes an mRNA molecule encoding an antigen described herein. In some embodiments, the polynucleotide that may be included as a payload includes an mRNA molecule encoding an antibody or an antigen-binding fragment thereof. In some embodiments, the peptide or protein is a naturally occurring or non-naturally occurring or otherwise modified peptide or protein. In some embodiments, the peptide or protein encoded by the mRNA payload may have a therapeutic effect when expressed in cells.

[0281] In some embodiments, the nucleic acid molecule of this disclosure includes an mRNA molecule. In specific embodiments, the nucleic acid molecule includes at least one coding region (e.g., an open reading frame (ORF)) encoding the peptide or protein of interest. In some embodiments, the peptide or protein is an antigen. In some embodiments, the peptide or protein is an antibody or its antigen-binding fragment (e.g., Fab). In some embodiments, the peptide or protein includes a fragment of TGFβR1 (e.g., human TGFβR1) or a fragment of TGFβR2 (e.g., human TGFβR2). In some embodiments, the fragment of TGFβR1 (e.g., human TGFβR1) or TGFβR2 (e.g., human TGFβR2) includes the extracellular domain of TGFβR1 or TGFβR2, or a fragment of TGFβR1 or TGFβR2 that binds to a TGFβ cytokine (e.g., TGFβ1, TGFβ2, or TGFβ3), respectively. In some embodiments, the peptide or protein includes a TGFβR1 decoy (e.g., a human TGFβR1 decoy) or a TGFβR2 decoy (e.g., a human TGFβR2 decoy). In some embodiments, the nucleic acid molecule further includes at least one untranslated region (UTR). In certain embodiments, the untranslated region (UTR) is located upstream (5' end) of the coding region and is referred to herein as the 5'-UTR. In certain embodiments, the untranslated region (UTR) is located downstream (3' end) of the coding region and is referred to herein as the 3'-UTR. In certain embodiments, the nucleic acid molecule includes both the 5'-UTR and the 3'-UTR. In some embodiments, the 5'-UTR includes a 5'-Cap structure. In some embodiments, the nucleic acid molecule includes a Kozak sequence (e.g., in the 5'-UTR). In some embodiments, the nucleic acid molecule includes a poly-A region (e.g., in the 3'-UTR). In some embodiments, the nucleic acid molecule includes a polyadenylation signal (e.g., at the 3'-UTR). In some embodiments, the nucleic acid molecule includes a stabilization region (e.g., at the 3'-UTR). In some embodiments, the nucleic acid molecule includes a secondary structure. In some embodiments, the secondary structure is a stem-loop.In some embodiments, the nucleic acid molecule includes a stem-loop sequence (e.g., in the 5'-UTR and / or in the 3'-UTR). In some embodiments, the nucleic acid molecule includes one or more intron regions that can be excised during splicing. In specific embodiments, the nucleic acid molecule includes one or more regions selected from the 5'-UTR and the coding region. In specific embodiments, the nucleic acid molecule includes one or more regions selected from the coding region and the 3'-UTR. In specific embodiments, the nucleic acid molecule includes one or more regions selected from the 5'-UTR, the coding region, and the 3'-UTR.

[0282] In some embodiments, the nucleic acid molecules of the Disclosure include at least one coding region. In some embodiments, the coding region is an open reading frame (ORF) encoding a single peptide or protein. In some embodiments, the coding region includes at least two ORFs, each encoding a peptide or protein. In these embodiments, where the coding region includes multiple ORFs, the encoded peptides and / or proteins may be the same or different from each other. In some embodiments, the multiple ORFs within the coding region are separated by a non-coding sequence. In specific embodiments, the non-coding sequence separating two ORFs includes an intra-sequence ribosome entry site (IRES).

[0283] While not bound by theory, it is thought that an intra-sequence ribosome entry site (IRES) can act as either a single ribosome binding site or function as one of several ribosome binding sites of mRNA. An mRNA molecule containing multiple functional ribosome binding sites may encode several peptides or polypeptides that are independently translated by ribosomes (e.g., multicistronic mRNA). Therefore, in some embodiments, the nucleic acid molecule (e.g., mRNA) of this disclosure contains one or more intra-sequence ribosome entry sites (IRES).

[0284] In various embodiments, the nucleic acid molecules of the Disclosure encode at least 1, 2, 3, 4, 5, 6, 7, 8, 9, 10, or more than 10 peptides or proteins. The peptides and proteins encoded by the nucleic acid molecules may be the same or different. In some embodiments, the nucleic acid molecules of the Disclosure encode dipeptides (e.g., camosine and anserine). In some embodiments, the nucleic acid molecules encode tripeptides. In some embodiments, the nucleic acid molecules encode tetrapeptides. In some embodiments, the nucleic acid molecules encode pentapeptides. In some embodiments, the nucleic acid molecules encode hexapeptides. In some embodiments, the nucleic acid molecules encode heptapeptides. In some embodiments, the nucleic acid molecules encode octapeptides. In some embodiments, the nucleic acid molecules encode nonapeptides. In some embodiments, the nucleic acid molecules encode decapeptides.

[0285] In some embodiments, the nucleic acid molecule encodes a peptide or polypeptide having at least about 15 amino acids. In some embodiments, the nucleic acid molecule encodes a peptide or polypeptide having at least about 50 amino acids. In some embodiments, the nucleic acid molecule encodes a peptide or polypeptide having at least about 100 amino acids. In some embodiments, the nucleic acid molecule encodes a peptide or polypeptide having at least about 150 amino acids. In some embodiments, the nucleic acid molecule encodes a peptide or polypeptide having at least about 300 amino acids. In some embodiments, the nucleic acid molecule encodes a peptide or polypeptide having 15 to 50, 50 to 100, 100 to 200, or 200 to 500 amino acids.

[0286] In some embodiments, the nucleic acid molecule of the Disclosure is at least about 15 nucleotides (nt) long. In some embodiments, the nucleic acid molecule of the Disclosure is at least about 20 nucleotides (nt) long. In some embodiments, the nucleic acid molecule of the Disclosure is at least about 30 nucleotides (nt) long. In some embodiments, the nucleic acid molecule is at least about 35 nt long. In some embodiments, the nucleic acid molecule is at least about 40 nt long. In some embodiments, the nucleic acid molecule is at least about 45 nt long. In some embodiments, the nucleic acid molecule is at least about 50 nt long. In some embodiments, the nucleic acid molecule is at least about 55 nt long. In some embodiments, the nucleic acid molecule is at least about 60 nt long. In some embodiments, the nucleic acid molecule is at least about 65 nt long. In some embodiments, the nucleic acid molecule is at least about 70 nt long. In some embodiments, the nucleic acid molecule is at least about 75 nt long. In some embodiments, the nucleic acid molecule is at least about 80 nt long. In some embodiments, the nucleic acid molecule is at least about 85 nt long. In some embodiments, the nucleic acid molecule is at least about 90 nt long. In some embodiments, the nucleic acid molecule is at least about 95 nt long. In some embodiments, the nucleic acid molecule is at least about 100 nt long. In some embodiments, the nucleic acid molecule is at least about 120 nt long. In some embodiments, the nucleic acid molecule is at least about 140 nt long. In some embodiments, the nucleic acid molecule is at least about 160 nt long. In some embodiments, the nucleic acid molecule is at least about 180 nt long. In some embodiments, the nucleic acid molecule is 10-100 nt long, 10-50 nt long, 50-100 nt long, or 100-180 nt long. In some embodiments, the nucleic acid molecule is 1000-2000 nt long, 2000-5000 nt long, or 5000-10000 nt long.

[0287] In some embodiments, the nucleic acid molecule contains at least 15 base pairs. In some embodiments, the nucleic acid molecule contains at least 20 base pairs. In some embodiments, the nucleic acid molecule contains at least 25 base pairs. In some embodiments, the nucleic acid molecule is 15 base pairs to 200 base pairs long. In some embodiments, the nucleic acid molecule is 25 base pairs to 50 base pairs long. In some embodiments, the nucleic acid molecule is 50 base pairs to 200 base pairs long. In some embodiments, the nucleic acid molecule is 100 base pairs to 200 base pairs long.

[0288] In some embodiments, the nucleic acid molecule has a mass of about 1 kilodalton (kDa) to about 50 kDa. In some embodiments, the nucleic acid molecule has a mass of about 1 kDa to 10 kDa. In some embodiments, the nucleic acid molecule has a mass of about 10 kDa to 20 kDa. In some embodiments, the nucleic acid molecule has a mass of about 10 kDa to about 25 kDa. In some embodiments, the nucleic acid molecule has a mass of about 15 kDa to about 50 kDa. In some embodiments, the nucleic acid molecule has a mass of about 20 kDa to about 50 kDa. In some embodiments, the nucleic acid molecule has a mass of about 25 kDa to about 50 kDa. In some embodiments, the nucleic acid molecule has a mass of about 30 kDa to about 50 kDa. In some embodiments, the nucleic acid molecule has a mass of about 40 kDa to about 50 kDa. In some embodiments, the nucleic acid molecule has a mass of about 1 kDa, about 5 kDa, about 10 kDa, about 15 kDa, about 20 kDa, about 25 kDa, about 30 kDa, about 35 kDa, about 40 kDa, about 45 kDa, or about 50 kDa. In some embodiments, the nucleic acid molecule has a mass of less than about 50 kDa. In some embodiments, the nucleic acid molecule has a mass of less than about 45 kDa, less than about 40 kDa, less than about 35 kDa, less than about 30 kDa, less than about 25 kDa, less than about 20 kDa, less than about 15 kDa, less than about 10 kDa, or less than about 5 kDa.

[0289] In some embodiments, the payload includes a nucleic acid molecule (e.g., mRNA) encoding an antigen described herein. In some embodiments, the payload includes a nucleic acid molecule, or its antigenic fragment or epitope, encoding a tumor-associated antigen (TAA) or tumor-specific antigen characteristic of lung cancer. In some embodiments, the payload includes a nucleic acid molecule encoding an antigen of lung metastasis. When administered to a subject, the payload enables the expression of the encoded TAA, tumor-specific antigen, or lung metastasis antigen (or their antigenic fragment or epitope), thereby inducing immunity in the subject against newly generated cells expressing the TAA, tumor-specific antigen, or lung metastasis antigen.

[0290] The delivered polynucleotides contain sequences encoding antigenic peptides or proteins. Particles containing these polynucleotides (e.g., nanoparticles) can be delivered to an individual to induce an immunological response sufficient to reduce the likelihood of subsequent infection and / or alleviate symptoms associated with such infection. The polynucleotides of these vaccines can be combined with interleukins, interferons, cytokines, and adjuvants, such as cholera toxin, alum, and Freund's adjuvant. Polynucleotides encoding antigens described herein or antigens described herein can be combined with adjuvants such as cholera toxin, alum, and Freund's adjuvant. Numerous adjuvant compounds are known, and a useful overview of many such compounds has been compiled by the National Institutes of Health (see Allison Dev. Biol.Stand.92:3-11,1998; Unkeless et al., Annu.Rev.Immunol.6:251-281,1998; and Phillips et al., Vaccine 10:151-158,1992 (each of which is incorporated herein by reference)).

[0291] Antigenic proteins or peptides encoded by polynucleotides may originate from bacteria, viruses, fungi, protists, or parasites.

[0292] 7.6 Nanoparticles In one embodiment, the particles described herein are nanoparticles. In one embodiment, the nanoparticles described herein may comprise at least one lipid component and one or more additional components, such as active agents (e.g., prophylactic and / or therapeutic agents). Nanoparticles may be designed for one or more specific applications or targets. The elements of the nanoparticles may be selected based on a specific application or target and / or on the efficacy, toxicity, cost, ease of use, availability, or other characteristics of one or more elements. Similarly, a particular formulation of nanoparticles may be selected for a particular application or target, for example, according to the efficacy and toxicity of a particular combination of elements.

[0293] The lipid components of the nanoparticle composition may include, for example, lipids according to one of the formulas (I) described herein, and phospholipids (e.g., phospholipid-PEG conjugates).

[0294] In one embodiment, the Specified Provisions provide nanoparticles comprising a cationic or ionized lipid compound, an active agent (e.g., a preventive or therapeutic agent), and one or more excipients. In one embodiment, the cationic or ionized lipid compound comprises a compound according to formula (I) as described herein, and optionally one or more additional lipid compounds. In one embodiment, the one or more excipients are selected from neutral lipids, steroids, and polymer-conjugated lipids. In one embodiment, the one or more excipients are polymer-conjugated lipids. In one embodiment, the one or more excipients are lipid poly(ethylene glycol). In one embodiment, the active agent is encapsulated within the lipid nanoparticles or associates with the lipid nanoparticles. In one embodiment, the nanoparticles do not contain cholesterol or phospholipids other than polymer-conjugated phospholipids. In one embodiment, the nanoparticles comprise a cationic or ionized lipid compound, an active agent (e.g., a preventive or therapeutic agent), and polymer-conjugated lipids. In one embodiment, the nanoparticles comprise a cationic or ionized lipid compound, an active agent (e.g., a preventive or therapeutic agent), and polymer-conjugated lipids. In one embodiment, the nanoparticles comprise a compound according to formula (I) described herein, an active agent (e.g., a preventive or therapeutic agent), and a lipid poly(ethylene glycol). In one embodiment, the nanoparticles consist of a compound according to formula (I) described herein, an active agent (e.g., a preventive or therapeutic agent), and a lipid poly(ethylene glycol). In one embodiment, the nanoparticles comprise a compound according to formula (I) described herein, an active agent (e.g., a preventive or therapeutic agent), and DMPE-PEG2000. In one embodiment, the nanoparticles comprise a compound according to formula (I) described herein, an active agent (e.g., a preventive or therapeutic agent), and DMPE-PEG2000. In one embodiment, the nanoparticles consist of a compound according to formula (I) described herein, an active agent (e.g., a preventive or therapeutic agent), and DMPE-PEG2000. In one embodiment, the nanoparticles consist of a compound according to formula (I) described herein, an active agent (e.g., a preventive or therapeutic agent), and DMPE-PEG2000. In some embodiments, the compound is compound 1.In some embodiments, the compound is compound 9. In some embodiments, the compound is compound 8. In some embodiments, the compound is compound 7. In some embodiments, the compound is compound 6. In some embodiments, the compound is compound 5. In one embodiment, the nanoparticles comprise compound 1, an active substance (e.g., a preventive or therapeutic agent), and DMPE-PEG2000. In one embodiment, the nanoparticles consist of compound 1, an active substance (e.g., a preventive or therapeutic agent), and DMPE-PEG2000.

[0295] In one embodiment, as used herein, nanoparticles are, i) Compounds according to formula (I) in concentrations of 0.5 to 3 mg / ml, ii) Polymer-conjugated lipids, iii) an active substance (e.g., a preventive or therapeutic agent), Nanoparticles containing the following are provided.

[0296] In one embodiment, the nitrogen:phosphate ratio (i.e., the ratio of amino groups present in the lipomer to phosphate groups present in the polynucleotide) is approximately 10:1 to approximately 50:1. In certain embodiments, the nitrogen:phosphate ratio is approximately 10:1 to approximately 45:1, approximately 15:1 to approximately 45:1, or approximately 20:1 to approximately 40:1. Increasing the nitrogen:phosphate ratio has been shown to have a positive effect on genetic material delivery by increasing nucleic acid binding and a negative effect on delivery by increasing toxicity (see, for example, Incani et al., Soft Matter (2010) 6:2124-2138).

[0297] In one embodiment, the ratio of the active substance (e.g., prophylactic or therapeutic agent) to the lipid in the LNP (i.e., N / P [where N is the number of moles of cationic lipid and P is the number of moles of phosphate present as part of the nucleic acid backbone]) is in the range of 2:1 to 30:1, for example, 3:1 to 22:1. In one embodiment, N / P is in the range of 2.5:1 to 20:1 or 2:1 to 15:1. In one embodiment, N / P is in the range of 3:1 to 10:1. Exemplary N / P ranges include about 2.5:1, about 3:1, about 5:1, about 10:1, and about 15:1.

[0298] In one embodiment, the weight ratio of the compound of formula (I) to the polymer conjugate lipid is in the range of about 10:1 to about 1:5. In one embodiment, the weight ratio of the compound of formula (I) to the polymer conjugate lipid is in the range of about 6:1 to about 1:2. In one embodiment, the weight ratio of the compound of formula (I) to the polymer conjugate lipid is about 10:1, about 9:1, about 8:1, about 7:1, about 6:1, about 5:1, about 4:1, about 3:1, about 2:1, about 1:1, or about 1:2. In one embodiment, the weight ratio of the compound of formula (I) to the polymer conjugate lipid is about 6:1. In one embodiment, the weight ratio of the compound of formula (I) to the polymer conjugate lipid is about 7:1.2.

[0299] In one embodiment, the cationic lipid may be any of several lipid species that carry a net positive charge at a selected pH, such as physiological pH. Exemplary cationic lipids are described below. In one embodiment, the cationic lipid has a pKa greater than 5.0. In one embodiment, the cationic lipid has a pKa greater than 5.25. In one embodiment, the cationic lipid has a pKa greater than 5.3. In one embodiment, the cationic lipid has a pKa greater than 6.0. In one embodiment, the cationic lipid has a pKa greater than 6.25. In one embodiment, the cationic lipid has a pKa greater than 6.5. In one embodiment, the cationic lipid has a pKa greater than 6.1, 6.2, 6.3, 6.35, 6.4, 6.45, 6.55, 6.6, 6.65, or 6.7.

[0300] In one embodiment, the polymer conjugate lipid is lipid poly(ethylene glycol). In one specific embodiment, the lipid poly(ethylene glycol) is DMPE-PEG. In one specific embodiment, the lipid poly(ethylene glycol) is DMPE-PEG2000.

[0301] In one embodiment, the compound in the nanoparticle formulation is about 0.5 to 7 mg / ml, and the lipid poly(ethylene glycol) is about 0.05 to 2.0 mg / ml. In one embodiment, the RNA in the nanoparticle formulation is about 0.01 to 0.5 mg / ml. In one specific embodiment, the compound in the nanoparticle formulation is about 1.75 mg / ml, the lipid poly(ethylene glycol) is about 0.3 mg / ml, and the RNA is about 0.375 mg / ml. In such an embodiment, the lipid poly(ethylene glycol) is DMPE-PEG2000. In such an embodiment, the RNA is siRNA.

[0302] In some embodiments, the lipid nanoparticles have an average diameter in the range of 10–100 nm, 35–100 nm, or 30–65 nm. In some embodiments, the lipid nanoparticles have an average diameter of about 10 nm, about 20 nm, about 30 nm, about 40 nm, or about 50 nm. In some embodiments, the lipid nanoparticles have an average diameter of about 60 nm, about 70 nm, about 80 nm, about 90 nm, or about 100 nm. In some embodiments, the lipid nanoparticles have an average diameter of about 110 nm, about 120 nm, about 130 nm, about 140 nm, or about 150 nm.

[0303] Nanoparticles may be designed for one or more specific applications or targets. For example, nanoparticles may be designed to deliver active agents such as RNA (e.g., prophylactic and / or therapeutic agents) to specific cells, tissues, organs, or systems or groups thereof within the mammalian body. The physiological and chemical properties of nanoparticles can be modified to enhance selectivity for specific bodily targets. For example, particle size may be adjusted based on the fenestration size of various organs. The delivery pathway of nanoparticles may be selected to deliver active agents such as RNA (e.g., prophylactic and / or therapeutic agents) to specific cells, tissues, organs, or systems or groups thereof within the mammalian body. For example, the nanoparticles described herein may be administered intravenously to a target to target endothelial cells and tissues or organs containing endothelial cells. The active agents contained in the nanoparticles may also be selected based on the desired delivery target(s). For example, the active agent (e.g., prophylactic and / or therapeutic agent) may be selected to treat atherosclerosis, cardiovascular disease, pulmonary hypertension (e.g., pulmonary arterial hypertension or secondary pulmonary hypertension), lung cancer, lung metastases, chronic obstructive pulmonary disease (COPD), bronchiolitis obliterans, bronchiolitis obliterans with organizing pneumonia (BOOP), pulmonary fibrosis, or fibrous lung disease, and / or to be delivered to specific cells, tissues, organs, or systems or groups thereof (e.g., local or specific delivery). In certain embodiments, the nanoparticles may comprise mRNA encoding a polypeptide of interest that can be translated within a cell to produce the polypeptide of interest. Such nanoparticles may be designed to be delivered specifically to a particular organ. In some embodiments, the nanoparticles may be designed to be specific to the lungs of mammals. In some embodiments, the nanoparticles may be designed to be specific to the hearts of mammals. In certain embodiments, the nanoparticles may be designed to be delivered specifically to the liver of mammals.

[0304] The amount of active substances (e.g., therapeutic and / or prophylactic agents) in nanoparticles may vary depending on their size, composition, desired target and / or application, other properties of the nanoparticles, and the properties of the active substances. For example, the amount of useful RNA in nanoparticles may vary depending on the size, sequence, and other properties of the RNA. The relative amounts of active substances (e.g., therapeutic and / or prophylactic agents) and other elements (e.g., lipids) in nanoparticles may also vary. In some embodiments, the wt / wt ratio of the lipid component to the active substance (e.g., a preventive and / or therapeutic agent) in the nanoparticle composition may be about 2:1 to about 60:1, for example, 2:1, 3:1, 4:1, 5:1, 6:1, 7:1, 8:1, 9:1, 10:1, 11:1, 12:1, 13:1, 14:1, 15:1, 16:1, 17:1, 18:1, 19:1, 20:1, 25:1, 30:1, 35:1, 40:1, 45:1, 50:1, and 60:1. For example, the wt / wt ratio of the lipid component to the active substance (e.g., a therapeutic and / or preventive agent) may be about 10:1 to about 40:1. In certain embodiments, the wt / wt ratio is about 20:1. In certain embodiments, the wt / wt ratio is about 3:1. In certain embodiments, the wt / wt ratio is approximately 4:1. In certain embodiments, the wt / wt ratio is approximately 4.7:1. In certain embodiments, the wt / wt ratio is approximately 5:1. The amount of active substance (e.g., preventive and / or therapeutic agent) in the nanoparticles can be measured, for example, using absorption spectroscopy (e.g., ultraviolet-visible spectroscopy).

[0305] In some embodiments, the nanoparticles contain one or more RNAs, and the one or more RNAs, lipids, and their amounts may be selected to have a specific N:P ratio. The N:P ratio of the composition refers to the molar ratio of nitrogen atoms in one or more lipids to the number of phosphate groups in RNA. In some embodiments, a lower N:P ratio is selected. The one or more RNAs, lipids, and their amounts may be selected to have an N:P ratio of about 2:1 to about 30:1, for example 2:1, 3:1, 4:1, 5:1, 6:1, 7:1, 8:1, 9:1, 10:1, 12:1, 14:1, 16:1, 18:1, 20:1, 22:1, 24:1, 26:1, 28:1, or 30:1. In certain embodiments, the N:P ratio may be about 2:1 to about 8:1. In other embodiments, the N:P ratio is about 5:1 to about 8:1. For example, the N:P ratio could be approximately 3.0:1, 3.4:1, 3.47:1, 3.5:1, 6.0:1, 6.5:1, or 7.0:1.

[0306] In some embodiments, the nanoparticles described in Example 2 or Example 8 are provided herein.

[0307] In some embodiments, the Specified Method for Producing Nanoparticles is also provided, comprising contacting a solution containing a compound described herein (see, for example, Section 7.3) or a salt thereof with a solution containing lipid poly(ethylene glycol) to obtain a lipid mix solution. In some embodiments, the Specified Method for Producing Nanoparticles is also provided, comprising (i) contacting a solution containing a compound described herein (see, for example, Section 7.3) or a salt thereof with a solution containing lipid poly(ethylene glycol) to obtain a lipid mix solution, and (ii) contacting the lipid mix solution with a solution containing an active ingredient. In some embodiments, lipid poly(ethylene glycol) is lipid poly(ethylene glycol) described herein (see, for example, Section 7.5.1) or a salt thereof. In some embodiments, lipid poly(ethylene glycol) is DMPE-PEG2000 or a salt thereof. In some embodiments, lipid poly(ethylene glycol) is an ammonium salt of DMPE-PEG2000. In some embodiments, the lipid mix solution has a compound:lipid poly(ethylene glycol) mass ratio corresponding to the compound:lipid poly(ethylene glycol) mass ratio of the nanoparticles described in Section 7.6. In some embodiments, the lipid mix solution has a compound:lipid poly(ethylene glycol) mass ratio of about 7:1.2. In some embodiments, the active substance is an active substance described herein (see, for example, Section 7.5.2).In some embodiments, the active agent is (i) an antibody or antigen-binding fragment thereof that binds to transforming growth factor beta receptor 1 (TGFβR1) or transforming growth factor beta receptor 2 (TGFβR2), (ii) a polynucleotide encoding an antibody or antigen-binding fragment thereof that binds to TGFβR1 or TGFβR2, (iii) a TGFβR1 decoy, (iv) a TGFβR2 decoy, (v) a polynucleotide encoding a TGFβR1 decoy, (vi) a polynucleotide encoding a TGFβR2 decoy, (vii) an siRNA or another inhibitory RNA that targets TGFβR1 or TGFβR2, or (viii) a TGFβR1 or TGFβR2 antigen. In some embodiments, the active agent includes a TGFβR1 siRNA comprising the nucleotide sequences described in SEQ ID NOs: 7 and 8. In some embodiments, the method is a method for producing nanoparticles as described in the examples, for example, Example 2 or Example 8.

[0308] 7.7 Composition In one embodiment, the compounds disclosed herein may be components of compositions that may be useful in a variety of medical and non-medical applications. For example, a pharmaceutical composition containing the compounds disclosed herein may be useful for delivering an effective amount of the active substance described herein to a target that needs it. A nutritional supplement composition containing the compounds disclosed herein may be useful for delivering an effective amount of a nutritional supplement, such as a dietary supplement, to a target that needs it. A cosmetic composition containing the compounds disclosed herein may be formulated as a cream, ointment, balm, paste, film, or liquid, and may be useful for the application of cosmetics, hair products, and materials useful for personal hygiene. Compositions containing the compounds disclosed herein may be useful in non-medical applications, such as as a food ingredient, for fire extinguishing, for surface disinfection, or for oil removal, such as emulsions or emulsifiers.

[0309] In another embodiment, the compounds disclosed herein may be components of a composition for treating endothelium-dependent disorders. For example, a pharmaceutical composition comprising the compounds disclosed herein may be useful for delivering an effective amount of the active ingredient described herein to a subject diagnosed with an endothelium-dependent disorder.

[0310] In another embodiment, the compounds disclosed herein may be components of compositions for treating atherosclerosis, cardiovascular disease, pulmonary hypertension (e.g., pulmonary arterial hypertension or secondary pulmonary hypertension), lung cancer, lung metastases, chronic obstructive pulmonary disease (COPD), bronchiolitis obliterans, bronchiolitis obliterans with organizing pneumonia (BOOP), pulmonary fibrosis, or fibrous lung disease. For example, a pharmaceutical composition comprising the compounds disclosed herein may be useful for delivering an effective amount of the active ingredient described herein to a subject diagnosed with atherosclerosis, cardiovascular disease, pulmonary hypertension (e.g., pulmonary arterial hypertension or secondary pulmonary hypertension), lung cancer, lung metastases, chronic obstructive pulmonary disease (COPD), bronchiolitis obliterans, bronchiolitis obliterans with organizing pneumonia (BOOP), pulmonary fibrosis, or fibrous lung disease.

[0311] In some embodiments, the compounds disclosed herein are useful as compositions (e.g., pharmaceutical or cosmetic compositions) for delivering an effective amount of the active substance described herein to a target requiring it, or as excipients. For example, cosmetic compositions may further use the compounds disclosed herein as excipients rather than as a delivery system encapsulating the active substance to be delivered. In some embodiments, the composition is a pharmaceutical composition. In some embodiments, the composition is a cosmetic composition. In one embodiment, a pharmaceutical composition is provided comprising the compound of formula (I) and a pharmaceutically acceptable excipient.

[0312] In some embodiments, the composition further comprises an active substance as described herein. In some embodiments, the active substance comprises a small molecule, an organometallic compound, a nucleic acid, a protein, a peptide, a polynucleotide, a metal, a targeting agent, an isotope-labeled compound, a drug, a vaccine, or an immunoassay. In some embodiments, the active substance comprises a protein, a peptide, or a polynucleotide. In some embodiments, the active substance comprises a polynucleotide. In some embodiments, the polynucleotide is DNA or RNA. In some embodiments, the RNA is ssRNA, dsRNA, siRNA, shRNA, miRNA, mRNA, or antisense RNA. In some embodiments, the active substance has a mass of about 10 kilodaltons (kDa) to about 50 kDa. In some embodiments, the active substance has a mass of about 15 kDa to about 50 kDa. In some embodiments, the active substance has a mass of about 20 kDa to about 50 kDa. In some embodiments, the active substance has a mass of about 25 kDa to about 50 kDa. In some embodiments, the active substance has a mass of about 30 kDa to about 50 kDa. In some embodiments, the active substance has a mass of about 40 kDa to about 50 kDa. In some embodiments, the active substance has a mass of about 10 kDa to about 25 kDa. In some embodiments, the active substance has a mass of about 10 kDa, about 20 kDa, about 30 kDa, about 40 kDa, or about 50 kDa. In some embodiments, the active substance has a mass of less than about 50 kDa. In some embodiments, the active substance has a mass of less than about 45 kDa, less than about 40 kDa, less than about 35 kDa, less than about 30 kDa, less than about 25 kDa, less than about 20 kDa, or less than about 15 kDa. In some embodiments, the active substance is negatively supercharged. In some embodiments, the active substance has a mass of less than about 50 kDa and is negatively supercharged. In some embodiments, the active substance has a mass of about 10 kDa to about 50 kDa and is negatively supercharged.

[0313] In some embodiments, the polynucleotide and the compounds disclosed herein (e.g., the compound of formula (I)) are not covalently bonded.

[0314] In some embodiments, the compounds disclosed herein (e.g., compounds of formula (I)) are in the form of particles. In some embodiments, the particles are nanoparticles. In some embodiments, the compounds disclosed herein (e.g., compounds of formula (I)) are in the form of liposomes or micelles. In certain embodiments, it should be understood that these compounds self-assemble to provide particles, micelles, or liposomes. In some embodiments, the particles, liposomes, or micelles encapsulate active substances. The active substances delivered by the particles, liposomes, or micelles may be in the form of gases, liquids, or solids. The compounds disclosed herein can be combined with polymers (synthetic or natural), surfactants, cholesterol, carbohydrates, proteins, lipids, etc., to form particles. These particles can be combined with excipients to form pharmaceutical and cosmetic compositions. These particles can be combined with excipients to form pharmaceutical compositions.

[0315] Once the complexes, micelles, liposomes, or particles are prepared, they can be combined with one or more excipients to form compositions suitable for administration to animals, including humans.

[0316] As those skilled in the art will understand, excipients may be selected based on the following routes of administration, the active substance to be delivered, the time elapsed since the delivery of the active substance, etc.

[0317] As used herein, the term “excipient” means a non-toxic, inert solid, semi-solid, or liquid filler, diluent, encapsulating material, or any type of pharmaceutical aid. Some examples of materials that can serve as excipients include, but are not limited to, sugars such as lactose, glucose, and sucrose; starches such as corn starch and potato starch; cellulose, and its derivatives such as sodium carboxymethylcellulose, ethylcellulose, and cellulose acetate; powdered tragacanth; malt; gelatin; talc; excipients such as cocoa butter and suppository waxes; oils such as peanut oil, cottonseed oil, safflower oil, sesame oil, olive oil, corn oil, and soybean oil; glycols such as propylene glycol; esters such as ethyl oleate and ethyl laurate; agar; Tween Cleansing agents such as 80; buffering agents such as magnesium hydroxide and aluminum hydroxide; alginic acid; pyrogenic substance removal water; isotonic saline; Ringer's solution; ethyl alcohol; and phosphate buffer, as well as other non-toxic, suitable lubricants such as sodium lauryl sulfate and magnesium stearate. Furthermore, colorants, release agents, coating agents, sweeteners, flavoring agents and fragrances, preservatives, and antioxidants may also be present in the composition at the discretion of the formulation. The compositions described herein may be administered to humans and / or animals orally, rectally, parenterally, intracisterna magna, vaginally, intranasally, intraperitoneally, topically (as powder, cream, ointment, or drops), buccally, or as an oral or nasal spray. In specific embodiments, the compositions described herein are administered intravenously to humans and / or animals.

[0318] In some embodiments, the pharmaceutical composition comprises compounds disclosed herein. In some embodiments, the pharmaceutical composition comprises compounds disclosed herein in amounts of about 20 weight percent, about 25 weight percent, about 30 weight percent, about 35 weight percent, about 40 weight percent, about 45 weight percent, about 50 weight percent, about 55 weight percent, about 60 weight percent, about 65 weight percent, about 70 weight percent, about 75 weight percent, and about 80 weight percent.

[0319] Nanoparticles and / or pharmaceutical compositions comprising one or more nanoparticles can be administered to any subject, including subjects that can benefit from the therapeutic effects provided by the delivery of the active ingredients described herein to one or more specific cells, tissues, organs or systems, or groups thereof, such as the endothelial cells of the tissue described in Example 8 (e.g., endothelial cells of the heart or lungs). While the descriptions of nanoparticles and pharmaceutical compositions provided herein primarily concern compositions suitable for administration to humans, it will be understood by those skilled in the art that such compositions are generally suitable for administration to any other mammals as well. It is well understood that compositions suitable for administration to humans can be modified to be suitable for administration to various animals, and such modifications can be designed and / or carried out by a veterinary pharmacologist of ordinary skill through ordinary experiments (if any). Subjects to which the compositions are intended to be administered include, but are not limited to, humans, other primates, and other mammals, such as commercially relevant mammals, including cattle, pigs, horses, sheep, cats, dogs, mice and / or rats.

[0320] Pharmaceutical compositions may be prepared by any method known or to be developed in the field of pharmacology. Generally, such preparation methods involve associating an active ingredient with excipients and / or one or more other auxiliary components, and then, if desired or necessary, dividing, shaping, and / or packaging the product into desired single or multi-dose units.

[0321] The pharmaceutical compositions described herein may be prepared, packaged, and / or sold in bulk as single unit doses and / or as multiple single unit doses. As used herein, “unit dose” refers to a specific amount of a pharmaceutical composition containing a predetermined amount of active ingredient. The amount of active ingredient is generally equal to the dose of the active ingredient that would be administered to a subject, and / or a convenient fraction of such dose, for example, half or one-third of such dose.

[0322] Pharmaceutical compositions can be prepared in various forms suitable for various routes and methods of administration. For example, pharmaceutical compositions can be prepared in liquid dosage forms (e.g., emulsions, microemulsions, nanoemulsions, solutions, suspensions, syrups, and elixirs), injectable forms, solid dosage forms (e.g., capsules, tablets, pills, powders, and granules), dosage forms for topical and / or transdermal administration (e.g., ointments, pastes, creams, lotions, gels, powders, solutions, sprays, inhalants, and patches), suspensions, powders, and other forms. In a specific embodiment, the pharmaceutical composition is prepared for intravenous administration.

[0323] In some parenteral administration embodiments, the composition is mixed with a solubilizer such as Cremophor®, alcohol, oil, modified oil, glycol, polysorbate, cyclodextrin, polymer, and / or combination thereof.

[0324] Injectable formulations, such as sterile aqueous or oily suspensions for injection, can be formulated according to known techniques using suitable dispersants, wetting agents, and / or suspending agents. Sterile injectable formulations can also be sterile injectable solutions, suspensions, and / or emulsions in non-toxic, parenterally acceptable diluents and / or solvents, such as solutions in 1,3-butanediol. Acceptable vehicles and solvents that can be used include water, Ringer's solution (USP), and isotonic sodium chloride solution. Sterile fixatives are conventionally used as solvents or suspension media. For this purpose, any non-irritating fixative, including synthetic monoglycerides or diglycerides, can be used. Fatty acids, such as oleic acid, can be used in the preparation of injectable formulations.

[0325] Injectable formulations can be sterilized, for example, by filtration through a filter that retains bacteria, and / or by incorporating a sterilizing agent in the form of a sterile solid composition that can be dissolved or dispersed in sterile water or other sterile injectable medium before use.

[0326] Dosage forms for topical or transdermal administration of pharmaceutical compositions include ointments, pastes, creams, lotions, gels, powders, solutions, sprays, inhalants, or patches. The particles are mixed under sterile conditions with a pharmaceutically acceptable carrier and, if necessary, any required preservatives or buffers. Ophthalmic formulations, ear drops, and eye drops are also intended to be within the scope of this disclosure.

[0327] In addition to the particles described herein, ointments, pastes, creams and gels may contain excipients such as animal and vegetable fats, oils, waxes, paraffin, starch, tragacanth, cellulose derivatives, polyethylene glycol, silicone, bentonite, silicic acid, talc and zinc oxide, or mixtures thereof.

[0328] The powders and sprays may contain, in addition to the particles described herein, excipients such as lactose, talc, silicic acid, aluminum hydroxide, calcium silicate, and polyamide powder, or mixtures thereof. The sprays may further contain conventional propellants such as chlorofluorohydrocarbons.

[0329] Transdermal patches offer the additional advantage of providing controlled delivery of compounds to the body. Such dosage forms can be prepared by dissolving or dispersing particles (e.g., nanoparticles) in a suitable medium. Absorption enhancers may also be used to increase the flux of the compound through the skin. The rate can be controlled by providing a rate-controlled membrane or by dispersing the particles in a polymer matrix or gel.

[0330] 7.8 How to use In another embodiment, this specification provides methods for using compounds disclosed herein (e.g., compounds of formula (I)) for the delivery of an active substance to, for example, cells (e.g., endothelial cells), tissues, or organs of interest. In some embodiments, this specification provides methods for delivering an active substance to cells, tissues, or organs of interest, comprising contacting a population of cells (e.g., a population of endothelial cells), tissues, or organs of interest with a composition disclosed herein or particles disclosed herein (e.g., nanoparticles) containing the active substance. In some embodiments, this specification provides methods for delivering an active substance to a population of cells of interest, comprising contacting a population of cells of interest with a composition disclosed herein or particles disclosed herein (e.g., nanoparticles) containing the active substance. Contact between the active substance, composition, or particles (e.g., nanoparticles) and cells(s), tissues, or organs may be carried out in vitro or ex vivo. Alternatively, contact between the active substance, composition, or particles (e.g., nanoparticles) and cells(s), tissues, or organs may be carried out in vivo.

[0331] In some embodiments, this specification provides a method for delivering an active substance to cells (e.g., endothelial cells) or organs of a subject (e.g., a human or non-human mammalian subject), comprising administering a composition or particles (e.g., nanoparticles) disclosed herein, comprising the active substance, to the subject. The delivery of the active substance may be used to test for a disease, disorder, or condition and / or to understand a biological pathway(s). In some embodiments, the delivered active substance has a beneficial (e.g., prophylactic and / or therapeutic) effect.

[0332] In some embodiments, this specification provides a method for delivering a drug to target cells (e.g., endothelial cells), tissues, or organs, comprising contacting the target cell population, tissue, or organ with a composition or particles (e.g., nanoparticles) described herein that contain the drug. In some embodiments, this specification provides a method for delivering a drug to target cell populations (e.g., endothelial cell populations), comprising contacting the target cell population with a composition or particles (e.g., nanoparticles) described herein that contain the drug. Contact between the composition or particles (e.g., nanoparticles) and cells(s), tissues, or organs can be carried out in vitro or ex vivo. Alternatively, contact between the composition or particles (e.g., nanoparticles) and cells(s), tissues, or organs can be carried out in vivo. In some embodiments, this specification provides a method for delivering a drug to cells or organs of a target (e.g., human or non-human mammalian target), comprising administering a composition or particles (e.g., nanoparticles) described herein that contain the drug to the target. Drug delivery may be used to test for a disease, disorder, or condition, and / or to understand a biological pathway. In some embodiments, the delivered drug has a beneficial (e.g., prophylactic and / or therapeutic) effect.

[0333] In some embodiments, the Specified provides a method for delivering a diagnostic agent or other detectable agent to a target cell population (e.g., endothelial cells), tissue, or organ for imaging or detection purposes, comprising contacting the target cell population, tissue, or organ with a composition or particles (e.g., nanoparticles) described herein that contain the diagnostic agent or other detectable agent. In some embodiments, the Specified provides a method for delivering a diagnostic agent or other detectable agent to a target cell population (e.g., endothelial cell population) for imaging or detection purposes, comprising contacting the target cell population with a composition or particles (e.g., nanoparticles) described herein that contain the diagnostic agent or other detectable agent. Contact between the composition or particles (e.g., nanoparticles) and the cell(s), tissue, or organ can be carried out in vitro or ex vivo. Alternatively, contact between the composition or particles (e.g., nanoparticles) and the cell(s), tissue, or organ can be carried out in vivo. In some embodiments, the Specified provides a method for delivering a diagnostic agent or other detectable agent to cells or organs of a subject (e.g., a human or non-human mammalian subject) for imaging or detection purposes, the method comprising administering a composition or particles (e.g., nanoparticles) described herein, comprising the diagnostic agent or other detectable agent, to the subject. In some embodiments, the composition or particles are delivered intravenously.

[0334] In some embodiments, this specification provides a method for delivering an active substance to target endothelial cells, comprising contacting the endothelial cells, or a target tissue or organ containing endothelial cells (e.g., the lungs and / or the heart), with a composition or particles (e.g., nanoparticles) described herein that contain the active substance. In some embodiments, this specification provides a method for delivering an active substance to a target population of endothelial cells, comprising contacting the target population of endothelial cells with a composition or particles (e.g., nanoparticles) described herein that contain the active substance. The endothelial cells may originate from one or more of the liver, lungs, heart, aorta, spleen, pancreas, kidneys, intestines, and brain. In some embodiments, the endothelial cells originate from the lungs, heart, and / or aorta. Contact between the composition or particles (e.g., nanoparticles) and cells(s), tissues, or organs may be carried out in vitro or ex vivo. Alternatively, contact between the composition or particles (e.g., nanoparticles) and cells(s), tissues, or organs may be carried out in vivo.

[0335] In some embodiments, methods are provided herein for delivering an active substance (e.g., nucleic acid) described herein to target endothelial cells, comprising administering a composition or particles (e.g., nanoparticles) described herein containing the active substance to the target. In some embodiments, methods are provided herein for delivering an active substance (e.g., nucleic acid) described herein to a target population of endothelial cells, comprising administering a composition or particles (e.g., nanoparticles) described herein containing the active substance to the target. In some embodiments, methods are provided herein for delivering an active substance (e.g., nucleic acid) described herein to a tissue or organ (e.g., heart and / or lung) containing target endothelial cells, comprising administering a composition or particles (e.g., nanoparticles) described herein containing the active substance to the target. In some embodiments, endothelial cells are present in one or more or all of the liver, lungs, heart, and aorta. In some embodiments, endothelial cells are present in the liver, lungs, heart, and aorta. In some embodiments, endothelial cells originate from the lungs, heart, and / or aorta. In some embodiments, endothelial cells are present in one or more of the endothelium of the spleen, liver, lungs, and aorta, and the heart. In some embodiments, endothelial cells are present in one or more of the endothelium of the spleen, liver, lungs, and aorta, and the heart. In some embodiments, endothelial cells are present in one or more of the pancreas, kidneys, intestines, and brain. In specific embodiments, the composition or particles are administered intravenously to the subject.

[0336] In some embodiments, the Specified Public Service provides a method for delivering an antigen to a target to induce an immune response (e.g., a cellular response and / or a humoral response) to the antigen, the method comprising administering a composition or particles (e.g., nanoparticles) described herein, comprising a drug, to the target. In some embodiments, the delivery of the antigen to the target induces an antibody that can be used in vitro, ex vivo, or in vivo, for example, to detect the antigen. In some embodiments, the composition or particles are administered intravenously to the target.

[0337] In some embodiments, the Specified provides a method for delivering a vaccine to a subject, comprising administering a composition or particles (e.g., nanoparticles) described herein, which include the vaccine, to the subject. In some embodiments, the composition or particles are administered intravenously to the subject.

[0338] In some embodiments, metho...

Claims

1. Compound of formula (I) 【Chemistry 1】 or a salt thereof, in the formula, Each R １ These are independently hydrogen or the base of formula (i) 【Chemistry 2】 And, Each R ２ is independently a hydrogen or a group of formula (i), R ３ These are independently substituted or unsubstituted alkyls, substituted or unsubstituted alkenyls, substituted or unsubstituted alkynyls, substituted or unsubstituted heteroalkyls, substituted or unsubstituted heteroalkenyls, substituted or unsubstituted heteroalkynyls, substituted or unsubstituted carbocyclyls, substituted or unsubstituted heterocyclyls, substituted or unsubstituted aryls, substituted or unsubstituted heteroaryls, or hydrophilic polymers. However, at least one R １ or at least one R ２ However, the compound or a salt thereof that is the base of formula (i).

2. R １ and R ２ The compound according to claim 1, wherein 4 to 12 of these are groups of formula (i).

3. R １ and R ２ Among them, 9 are the groups of formula (i), the compound according to claim 2.

4. R １ Six of them, and R ２ The compound according to claim 3, wherein three of them are groups of formula (i).

5. R １ and R ２ The compound according to claim 2, wherein eight of them are groups of formula (i).

6. R １ Six of them, and R ２ The compound according to claim 5, wherein two of them are groups of formula (i).

7. R １ and R ２ The compound according to claim 2, wherein seven of them are groups of formula (i).

8. R １ Six of them, and R ２ The compound according to claim 7, wherein one of them is a group of formula (i).

9. R １ and R ２ The compound according to claim 2, wherein six of them are groups of formula (i).

10. R １ The compound according to claim 9, wherein six of them are groups of formula (i).

11. R １ and R ２ The compound according to claim 2, wherein five of them are groups of formula (i).

12. R １ The compound according to claim 11, wherein five of them are groups of formula (i).

13. R １ and R ２ The compound according to claim 2, wherein four of them are groups of formula (i).

14. R １ The compound according to claim 13, wherein four of them are groups of formula (i).

15. The base of formula (i) above is the base of formula (i-a) 【Transformation 3】 The compound according to any one of claims 1 to 14.

16. R ３ The compound according to any one of claims 1 to 15, wherein each of them is independently a substituted or unsubstituted alkyl, a substituted or unsubstituted alkenyl, or a substituted or unsubstituted heteroalkyl.

17. R ３ The compound according to claim 16, wherein each of them is independently a substituted or unsubstituted alkyl group.

18. R ３ Each of these independently determines whether C is substituted or not. ８ ~C ５０ The compound according to claim 17, wherein it is alkyl.

19. R ３ Each of these independently determines whether C is substituted or not. １０ ~C １８ The compound according to claim 18, wherein it is alkyl.

20. R ３ Each of these independently determines whether C is substituted or not. １３ The compound according to claim 19, wherein it is alkyl.

21. R ３ The compound according to any one of claims 1 to 20, wherein each of the members is unsubstituted.

22. R ３ Each of them independently, - (CH ２ ) ｎ CH ３ The compound according to claim 21, wherein n is an integer from 10 to 18.

23. R ３ Each of them independently, - (CH ２ ) １２ CH ３ The compound according to claim 22.

24. The compound according to claim 1, which is a compound in Table 3. 【Request Item 25】 【Chemistry 4】 The compound according to claim 24. 【Request Item 26】 【Chemistry 5】 The compound according to claim 24. 【Request Item 27】 【Chemistry 6】 The compound according to claim 24.

28. The compound according to any one of claims 1 to 27, having a purity of approximately 99%, approximately 95%, approximately 90%, approximately 85%, approximately 80%, approximately 75%, approximately 70%, approximately 65%, approximately 60%, approximately 55%, or approximately 50%.

29. A pharmaceutical composition comprising a compound according to any one of claims 1 to 28 and a pharmaceutically acceptable excipient.

30. The pharmaceutical composition according to claim 29, comprising about 20% by weight, about 25% by weight, about 30% by weight, about 35% by weight, about 40% by weight, about 45% by weight, about 50% by weight, about 55% by weight, about 60% by weight, about 65% by weight, about 70% by weight, about 75% by weight, and about 80% by weight of the compound according to any one of claims 1 to 28.

31. The pharmaceutical composition according to claim 29 or 30, further comprising an active substance.

32. The pharmaceutical composition according to claim 31, wherein the active substance is an organic molecule, an inorganic molecule, a nucleic acid, a protein, a polypeptide, a polynucleotide, a targeting agent, an isotope-labeled compound, a vaccine, or an immunosuppressant.

33. The pharmaceutical composition according to claim 32, wherein the active substance is a polynucleotide containing DNA or RNA.

34. The pharmaceutical composition according to claim 33, wherein the RNA is coding RNA.

35. The pharmaceutical composition according to claim 33, wherein the RNA is a non-coding RNA.

36. The pharmaceutical composition according to claim 33, wherein the RNA is mRNA, RNAi, dsRNA, siRNA, shRNA, miRNA, or antisense RNA.

37. The pharmaceutical composition according to any one of claims 33 to 36, wherein the polynucleotide and the compound are not covalently bonded.

38. The pharmaceutical composition according to any one of claims 29 to 37, wherein the compound is in the form of particles.

39. The pharmaceutical composition according to claim 38, wherein the particles are nanoparticles.

40. The pharmaceutical composition according to claim 39, wherein the nanoparticles further comprise lipid poly(ethylene glycol).

41. The pharmaceutical composition according to claim 40, wherein the lipid poly(ethylene glycol) comprises DMPE-PEG2000.

42. The pharmaceutical composition according to claim 40 or 41, wherein the mass ratio of the compound:the lipid poly(ethylene glycol):the nucleic acid is approximately 7:1.2:1.

5.

43. The pharmaceutical composition according to claim 38, wherein the particles are micelles, liposomes, or lipoplexes.

44. The pharmaceutical composition according to any one of claims 38 to 43, wherein the particles encapsulate the active substance.

45. Nanoparticles comprising a compound according to any one of claims 1 to 28 and a nucleic acid, protein, or polypeptide.

46. The nanoparticles according to claim 45, further comprising lipid poly(ethylene glycol).

47. The nanoparticles according to claim 46, wherein the lipid poly(ethylene glycol) comprises DMPE-PEG2000.

48. The nanoparticle according to claim 46 or 47, wherein the mass ratio of the compound:the lipid poly(ethylene glycol):the nucleic acid is approximately 7:1.2:1.

5.

49. The nanoparticle according to any one of claims 45 to 48, wherein the nucleic acid is DNA or RNA.

50. The nanoparticle according to claim 49, wherein the RNA is mRNA, RNAi, dsRNA, siRNA, shRNA, miRNA, or antisense RNA.

51. The nanoparticle according to claim 50, wherein the siRNA comprises transforming growth factor beta receptor 1 ("TGFβR1") siRNA.

52. The nanoparticle according to claim 51, wherein the TGFβR1 siRNA comprises the nucleotide sequences of SEQ ID NOs. 7 and 8.

53. A pharmaceutical composition comprising nanoparticles according to claim 51 or 52 and a pharmaceutically acceptable diluent or excipient.

54. A method for delivering an active substance to target cells, tissues, or organs, comprising contacting the target cell population, tissue, or organ with a pharmaceutical composition according to any one of claims 29 to 44 or nanoparticles according to any one of claims 45 to 52.

55. The method according to claim 54, wherein the cells are endothelial cells.

56. The method according to claim 54, wherein the tissue or organ includes endothelial cells.

57. A method for delivering an active substance to endothelial cells, or tissues or organs containing endothelial cells, comprising intravenous administration of a pharmaceutical composition according to any one of claims 29 to 44 or nanoparticles according to any one of claims 45 to 52.

58. A method for delivering TGFβR1 siRNA to endothelial cells, or tissues or organs containing endothelial cells, comprising intravenous administration of nanoparticles according to claim 51 or 52, or the pharmaceutical composition according to claim 53.

59. A method for preparing the compound according to any one of claims 1 to 28, the compound of formula (II) 【Transformation 7】 The epoxide of formula (III) 【Transformation 8】 The method comprising carrying out the reaction in the presence of a solvent.

60. A method for treating pulmonary hypertension, wherein the subject requiring treatment is given (i) a pharmaceutical composition comprising a compound or salt thereof according to any one of claims 1 to 28, an active substance, and a pharmaceutically acceptable excipient, or (ii) The method comprises intravenous administration of a compound or salt thereof according to any one of claims 1 to 28, and nanoparticles containing the active substance, The method wherein the active substance comprises (i) an antibody or antigen-binding fragment thereof that binds to transforming growth factor beta receptor 1 (TGFβR1) or transforming growth factor beta receptor 2 (TGFβR2), (ii) a polynucleotide encoding an antibody or antigen-binding fragment thereof that binds to TGFβR1 or TGFβR2, (iii) a TGFβR1 decoy, (iv) a TGFβR2 decoy, (v) a polynucleotide encoding a TGFβR1 decoy, (vi) a polynucleotide encoding a TGFβR2 decoy, (vii) a siRNA or another inhibitory RNA that targets TGFβR1 or TGFβR2, or (viiii) a TGFβR1 or TGFβR2 antigen.

61. A method for treating atherosclerosis or cardiovascular disease, wherein the subject requiring treatment is given (i) a pharmaceutical composition comprising a compound or salt thereof according to any one of claims 1 to 28, an active substance, and a pharmaceutically acceptable excipient, or (ii) The method comprises intravenous administration of a compound or salt thereof according to any one of claims 1 to 28, and nanoparticles containing the active substance, The method wherein the active substance comprises (i) an antibody or antigen-binding fragment thereof that binds to transforming growth factor beta receptor 1 (TGFβR1) or transforming growth factor beta receptor 2 (TGFβR2), (ii) a polynucleotide encoding an antibody or antigen-binding fragment thereof that binds to TGFβR1 or TGFβR2, (iii) a TGFβR1 decoy, (iv) a TGFβR2 decoy, (v) a polynucleotide encoding a TGFβR1 decoy, (vi) a polynucleotide encoding a TGFβR2 decoy, (vii) a siRNA or another inhibitory RNA that targets TGFβR1 or TGFβR2, or (viiii) a TGFβR1 or TGFβR2 antigen.

62. The method according to claim 60, wherein the pulmonary hypertension is pulmonary arterial hypertension.

63. The method according to claim 60, wherein the pulmonary hypertension is secondary pulmonary hypertension.

64. The method according to claim 61, wherein the cardiovascular disease is coronary artery disease, stroke, heart failure, hypertensive heart disease, rheumatic heart disease, cardiomyopathy, arrhythmia, congenital heart disease, valvular heart disease, carditis, aortic aneurysm, peripheral artery disease, thromboembolism, or venous thrombosis.

65. The method according to any one of claims 60 to 64, wherein the pharmaceutical composition contains about 20 weight percent, about 25 weight percent, about 30 weight percent, about 35 weight percent, about 40 weight percent, about 45 weight percent, about 50 weight percent, about 55 weight percent, about 60 weight percent, about 65 weight percent, about 70 weight percent, about 75 weight percent, and about 80 weight percent of the compound described in any one of claims 1 to 27.

66. The method according to any one of claims 60 to 65, wherein the compound is in the form of particles.

67. The method according to claim 66, wherein the particles are nanoparticles or fine particles.

68. The method according to claim 66, wherein the particles are micelles, liposomes, or lipoplexes.

69. The method according to any one of claims 60 to 65 or 67, wherein the nanoparticles further comprise lipid poly(ethylene glycol).

70. The method according to claim 69, wherein the mass ratio of the compound:the lipid poly(ethylene glycol):the nucleic acid is approximately 7:1.2:1.

5.

71. The method according to claim 69 or 70, wherein the lipid poly(ethylene glycol) comprises DMPE-PEG2000.

72. The method according to any one of claims 66 to 71, wherein the particles encapsulate the active substance.

73. The method according to any one of claims 60 to 72, wherein the active substance comprises a siRNA or another inhibitory RNA that targets TGFβR1 or TGFβR2.

74. The method according to claim 73, wherein the siRNA is transforming growth factor beta receptor 1 ("TGFβR1") siRNA.

75. The method according to claim 74, wherein the TGFβR1 siRNA comprises the nucleotide sequences of SEQ ID NOs: 7 and 8.

76. The method according to claim 73, wherein the inhibitory RNA is mRNA, RNAi, shRNA, or antisense RNA.

77. The method according to any one of claims 60 to 72, wherein the polynucleotide comprises DNA or RNA.

78. The method according to any one of claims 60 to 76, wherein the polynucleotide, the siRNA, or the other inhibitory RNA is not covalently bonded to the compound.

79. The method according to any one of claims 60 to 78, wherein the subject is a human.

80. Use of a pharmaceutical composition according to any one of claims 29 to 44 or 53 or nanoparticles according to any one of claims 45 to 52 in the manufacture of a pharmaceutical for delivering an active substance to target cells, tissues, or organs.

81. The use according to claim 80, wherein the cells are endothelial cells.

82. The use according to claim 80, wherein the tissue or organ comprises endothelial cells.

83. A pharmaceutical composition according to any one of claims 29 to 44 or 53, or a nanoparticle according to any one of claims 45 to 52, for use in delivering an active substance to target cells, tissues, or organs.

84. The pharmaceutical composition or nanoparticles according to claim 83, wherein the cells are endothelial cells.

85. The pharmaceutical composition or nanoparticles according to claim 83, wherein the tissue or organ comprises endothelial cells.

86. Use of the nanoparticles according to claim 51 or 52, or the pharmaceutical composition according to claim 53, in the manufacture of a pharmaceutical product for use in the treatment of pulmonary hypertension, atherosclerosis, or cardiovascular disease.

87. A nanoparticle according to claim 51 or 52, or a pharmaceutical composition according to claim 53, for use in a method of treating pulmonary hypertension, atherosclerosis, or cardiovascular disease, wherein the method comprises intravenous administration of the nanoparticle or the pharmaceutical composition.

88. The nanoparticle or pharmaceutical composition according to claim 87, wherein the subject is a human.

89. TGFβR1 siRNA containing the nucleotide sequences described in SEQ ID NOs: 7 and 8.

90. A pharmaceutical composition comprising the TGFβR1 siRNA described in claim 89 and a pharmaceutically acceptable carrier, diluent, or excipient.

91. A method for reducing TGFβR1 RNA in cells, comprising contacting the cells with the TGFβR1 siRNA described in claim 89 or the pharmaceutical composition described in claim 90.

92. The method according to claim 91, wherein the cells are endothelial cells.

93. A method for reducing TGFβR1 RNA in target cells, tissues, or organs, comprising administering the TGFβR1 siRNA described in claim 89 or the pharmaceutical composition described in claim 90 to the target.

94. The method according to claim 93, wherein the subject is a human.

95. Use of the TGFβR1 siRNA according to claim 89 or the pharmaceutical composition according to claim 90 in the manufacture of a pharmaceutical for reducing TGFβR1 RNA in cells, tissues, or organs.

96. A TGFβR1 siRNA according to claim 89 or a pharmaceutical composition according to claim 90 for use in a method for reducing TGFβR1 RNA in cells, tissues, or organs, wherein the method comprises administering the TGFβR1 siRNA or the pharmaceutical composition to a target.

97. The TGFβR1 siRNA or pharmaceutical composition according to claim 96, wherein the subject is human.

98. A method for producing nanoparticles, comprising contacting a solution containing a compound or a salt thereof according to any one of claims 1 to 28 with a solution containing a lipid poly(ethylene glycol) to obtain a lipid mix solution.

99. A method for producing nanoparticles, comprising: (i) contacting a solution containing a compound or a salt thereof according to any one of claims 1 to 28 with a solution containing a lipid poly(ethylene glycol) to obtain a lipid mix solution; and (ii) contacting the lipid mix solution with a solution containing an active substance.

100. The method according to claim 98 or 99, wherein the lipid poly(ethylene glycol) is DMPE-PEG2000 or a salt thereof.

101. The method according to claim 100, wherein the lipid poly(ethylene glycol) is an ammonium salt of DMPE-PEG2000.

102. The method according to any one of claims 98 to 101, wherein the lipid mix solution has a mass ratio of the compound to the lipid poly(ethylene glycol) of about 7:1.

2.

103. The method according to any one of claims 98 to 102, wherein the active substance is (i) an antibody or antigen-binding fragment thereof that binds to transforming growth factor beta receptor 1 (TGFβR1) or transforming growth factor beta receptor 2 (TGFβR2), (ii) a polynucleotide encoding an antibody or antigen-binding fragment thereof that binds to TGFβR1 or TGFβR2, (iii) a TGFβR1 decoy, (iv) a TGFβR2 decoy, (v) a polynucleotide encoding a TGFβR1 decoy, (vi) a polynucleotide encoding a TGFβR2 decoy, (vii) a siRNA or another inhibitory RNA that targets TGFβR1 or TGFβR2, or (viiii) a TGFβR1 or TGFβR2 antigen.

104. The method according to any one of claims 98 to 102, wherein the active substance comprises TGFβR1 siRNA containing the nucleotide sequences described in SEQ ID NOs: 7 and 8.

Images