Neuron methylation signatures derived from cell-free DNA and methods for using them
A blood-based diagnostic tool using cell-free DNA methylation analysis allows for early detection of neurodegenerative diseases, facilitating timely interventions to prevent neuron cell death.
Patent Information
- Application Number
- JP2026505998
- Authority / Receiving Office
- JP · JP
- Patent Type
- Applications
- Current Assignee / Owner
- Priority Date
- 2024-02-12
- Filing Date
- 2024-08-02
- Publication Date
- 2026-08-25
AI Technical Summary
Current diagnostic methods for neurodegenerative diseases like Alzheimer's and Parkinson's cannot detect the onset of the diseases before symptoms appear, leading to irreversible neuron cell death and limiting the effectiveness of therapeutic interventions.
A blood-based diagnostic tool that amplifies and sequences specific regions of cell-free DNA to analyze methylation signatures, using a Python-derived pipeline to identify neuron-derived DNA and provide pre-symptomatic diagnoses.
Enables early detection of neurodegenerative diseases, allowing for timely therapeutic interventions to prevent or delay disease progression.
Smart Images

Figure 2026528751000001_ABST
Abstract
Description
Technical Field
[0001] Cross - Reference to Related Applications This application is an international application claiming priority based on U.S. Provisional Application No. 63 / 517,324 filed on August 2, 2023, and U.S. Provisional Application No. 63 / 552,528 filed on February 12, 2024, and the entire contents of each are incorporated herein by reference for all purposes.
[0002] Sequence Listing The entire contents of the attached sequence listing are incorporated herein by reference. The attached file named "062097 - 502001WO_SL_ST26.xml" is 8,834 bytes in size and was created on August 2, 2024.
[0003] This specification discloses a blood - based bipartite diagnostic tool designed to diagnose pre - symptomatic neurodegenerative conditions. The first component consists of an assay designed to amplify and sequence a pre - specified region of cell - free DNA. The second component consists of a Python - derived pipeline that analyzes methylation signatures to identify neuron - derived DNA and provides a diagnosis of pre - symptomatic neurodegenerative diseases.
Background Art
[0004] In current standard diagnostic methods for diagnosing neurodegenerative diseases such as Alzheimer's disease and Parkinson's disease, a series of memory tests and physical examinations are used to identify the onset of symptoms related to the disease. When related symptoms are identified, this indicates that neuron cell death has already progressed to an irreversible stage. Currently, there is no known method to diagnose neurodegenerative diseases before the onset of symptoms.
[0005] Regarding treatments for delaying neuron cell death, important therapeutic advancements have been made with research results showing promising effectiveness. However, without a pre - symptomatic diagnosis, treatment cannot be implemented before irreversible neuron cell death occurs.
[0006] This disclosure addresses these and other issues in the technical field. [Overview of the project]
[0007] This technology relates, in general, to a pre-screening method that can identify neurodegenerative diseases before the onset of symptoms. The method of this disclosure can be used to diagnose neurodegenerative diseases before the onset of symptoms, and further, when combined with appropriate treatment, can prevent or delay the onset of the disease in patients.
[0008] In one embodiment, the present disclosure provides a method for treating a subject having or at risk of having a neurodegenerative disease, the method comprising: (i) obtaining cell-free DNA from a blood sample from the subject; (ii) analyzing the methylation pattern of a region of DNA from the cell-free DNA, wherein the region is selected from the regions listed in Tables 2 to 5; (iii) determining the proportion of cell-free DNA derived from neurons; (iv) comparing the proportion of cell-free DNA derived from neurons with a control; and (v) administering a therapeutic agent to treat or prevent the neurodegenerative disease if the proportion of cell-free DNA derived from neurons is greater than that of the control.
[0009] In some embodiments, step (ii) includes analyzing the methylation pattern of the entire DNA amplicon. In some embodiments, the entire amplicon is at least about 50 base pairs (bp) long. In some embodiments, the entire amplicon is about 50 to about 500 base pairs long.
[0010] In some embodiments, the therapeutic agent is administered when the percentage of neuron-derived cell-free DNA is greater than 5%. In some embodiments, the therapeutic agent is administered when the percentage of neuron-derived cell-free DNA is greater than approximately 7%. In some embodiments, the therapeutic agent is administered when the percentage of neuron-derived cell-free DNA is greater than approximately 9%.
[0011] In another aspect, the Disclosure provides a method for treating subjects who have or are at risk of having a neurodegenerative disease, the method comprising: (i) obtaining cell-free DNA from a blood sample from the subject; (ii) analyzing the methylation pattern of a region of DNA from the cell-free DNA, wherein the region is selected from the regions listed in Tables 2 to 5; (iii) determining the proportion of cell-free DNA derived from neurons; and (iv) administering a therapeutic agent for treating or preventing the neurodegenerative disease if the proportion of cell-free DNA derived from neurons is greater than approximately 5%.
[0012] In another aspect, the Disclosure provides a method for analyzing a biological sample of a subject, the method comprising: (i) obtaining cell-free DNA from a blood sample from the subject; (ii) analyzing the methylation pattern of a region of DNA from the cell-free DNA, wherein the region is selected from the regions listed in Tables 2 to 5; (iii) determining the proportion of cell-free DNA derived from neurons; and (iv) comparing the proportion of cell-free DNA derived from neurons with a control.
[0013] In another aspect, the Disclosure provides a method for measuring neuronal cell death in a subject, the method comprising: (i) obtaining cell-free DNA from a blood sample from the subject; (ii) analyzing the methylation pattern of a region of DNA from the cell-free DNA, wherein the region is selected from the regions listed in Tables 2 to 5; (iii) determining the proportion of cell-free DNA derived from neurons; and (iv) comparing the proportion of cell-free DNA derived from neurons with a control.
[0014] In another aspect, the Disclosure provides a method for selecting a patient to be treated with a therapeutic agent for the treatment of a neurodegenerative disease, the method comprising: (i) obtaining cell-free DNA from a blood sample from the subject; (ii) analyzing the methylation pattern of a region of DNA from the cell-free DNA, wherein the region is selected from the regions listed in Tables 2 to 5; (iii) determining the proportion of cell-free DNA derived from neurons; and (iv) comparing the proportion of cell-free DNA derived from neurons with a control, wherein the patient is selected for treatment if the proportion of cell-free DNA derived from neurons is greater than that of the control.
[0015] In some embodiments, step (ii) includes analyzing the methylation pattern of the entire DNA amplicon. In some embodiments, the entire amplicon is at least about 50 base pairs (bp) in length. In some embodiments, the entire amplicon is between about 50 base pairs and about 500 base pairs in length.
[0016] In some embodiments, patients are selected for treatment if the percentage of neuron-derived cell-free DNA is greater than approximately 5%. In some embodiments, patients are selected for treatment if the percentage of neuron-derived cell-free DNA is greater than approximately 7%. In some embodiments, patients are selected for treatment if the percentage of neuron-derived cell-free DNA is greater than approximately 9%.
[0017] In some embodiments, a higher proportion of neuronal cell-free DNA than the control indicates an increased risk of neurodegenerative disease or traumatic brain injury.
[0018] In another aspect, the Disclosure provides a computer product comprising a non-temporary computer-readable medium which stores a set of instructions to be executed when controlling a computer system to analyze a biological sample from a subject containing cell-free DNA to determine the risk of neurodegenerative disease in the subject, the instructions comprising: (i) identifying a first DNA methylation pattern occurring in neurons at a threshold frequency, wherein the first DNA methylation pattern comprises methylation in one or more methylated regions and optionally comprises demethylation in one or more unmethylated regions; (ii) analyzing a methylation pattern of a region of DNA from the cell-free DNA, wherein the region is selected from the regions listed in Tables 2 to 5; (iii) calculating the relative abundance of the one or more methylated regions and optionally the one or more unmethylated regions in the cell-free DNA; and (iv) determining the risk of neurodegenerative disease in the subject by comparing the relative abundance with a control.
[0019] In another aspect, the Disclosure provides a method for determining the effectiveness of a potential treatment for a neurodegenerative disease, the method comprising: (i) obtaining cell-free DNA from blood samples from a number of subjects, the subjects being administered the potential treatment; (ii) analyzing the methylation pattern of a region of DNA from the cell-free DNA, the region being selected from the regions listed in Tables 2-5; (iii) determining the proportion of cell-free DNA derived from neurons; and (iv) comparing the proportion of cell-free DNA derived from neurons to a control, wherein the potential treatment is effective if the proportion of cell-free DNA derived from neurons is smaller than that of the control.
[0020] In some embodiments, steps (i) to (iv) are repeated at least once. In some embodiments, steps (i) to (iv) are repeated weekly.
[0021] In some embodiments, potential treatments include recombinant iduronate 2-sulfatase (IDS) protein, leucine-rich repeat kinase 2 (LRRK2) inhibitors, recombinant progranulin (PGRN) protein, recombinant N-sulfoglucosamine sulfohydrolase (SGSH) protein, recombinant α-L-iduronidase (IDUA) protein, receptor-interacting serine / threonine protein kinase 1 (RIPK1) inhibitors, or eukaryotic translation initiation factor 2B (eIF2B) activators.
[0022] In some embodiments, potential treatments include DNL310 (ETV:IDS), BIIB122 / DNL151, TAK-594 / DNL593, DNL126 (ETV:SGSH), DNL622 (ETV:IDUA), SAR443820 / DNL788, DNL343, or SAR443122 / DNL758.
[0023] In some embodiments, determining the proportion of cell-free DNA derived from neurons involves comparing the methylation pattern of the cell-free DNA with the methylation pattern of neuronal DNA, wherein the methylation pattern of neuronal DNA includes methylation in one or more methylated regions and optionally includes demethylation in one or more unmethylated regions.
[0024] In another aspect, the present disclosure provides a computer-implemented method for analyzing a biological sample, the method comprising: (i) identifying a first DNA methylation pattern that occurs at a frequency above a threshold in neurons, the first DNA methylation pattern including methylation in one or more methylated regions and optionally non-methylation in one or more non-methylated regions; (ii) analyzing the methylation pattern of a region of DNA from cell-free DNA, the region being selected from the regions listed in Tables 2-5; (iii) calculating the relative abundance of the one or more methylated regions and optionally the one or more non-methylated regions in the cell-free DNA; and (iv) determining the risk of neurodegenerative disease in a subject by comparing the relative abundance to a control.
[0025] In some embodiments, step (ii) includes analyzing the methylation pattern of the entire DNA amplicon.
[0026] In some embodiments, the entire amplicon is at least about 50 base pairs (bp) in length. In some embodiments, the entire amplicon is from about 50 base pairs to about 500 base pairs in length.
[0027] In some embodiments, the control is the proportion of neuron-derived cell-free DNA in a blood sample from an untreated subject, the proportion of neuron-derived cell-free DNA in a blood sample from a subject before treatment, or a threshold. In some embodiments, the threshold is that the proportion of neuron-derived cell-free DNA is greater than about 5%. In some embodiments, the threshold is that the proportion of neuron-derived cell-free DNA is greater than about 7%. In some embodiments, the threshold is that the proportion of neuron-derived cell-free DNA is greater than about 9%.
[0028] In some embodiments, the neurodegenerative disease is selected from Alzheimer's disease, Huntington's disease, Parkinson's disease, amyotrophic lateral sclerosis (ALS), ataxia, multiple sclerosis, multiple system atrophy, traumatic brain injury, frontotemporal dementia - progranulin, mucopolysaccharidosis type I (MPS I), mucopolysaccharidosis type II (MPS II; Hunter syndrome), or mucopolysaccharidosis type IIIA (MPS IIIA; Sanfilippo syndrome).
[0029] In some embodiments, the neuron is a motor neuron, spinal motor neuron, sensory neuron, interneuron, dopaminergic neuron, cholinergic neuron, GABAergic neuron, glutamatergic neuron, or cortical neuron. In some embodiments, the neuron is derived from the forebrain, midbrain, or hindbrain. In some embodiments, the neuron is derived from the frontal lobe, temporal lobe, parietal lobe, occipital lobe, cerebellum, or brainstem.
[0030] In some embodiments, analyzing the methylation pattern includes converting 5-methylcytosine in cell-free DNA to another nucleotide. In some embodiments, the conversion includes bisulfite conversion or enzymatic conversion.
[0031] In some embodiments, the subject has mild cognitive impairment. In some embodiments, the subject is over 45 years old. In some embodiments, selecting a subject over 45 years old is included. In some embodiments, the subject does not have symptoms of a neurodegenerative disease. In some embodiments, selecting a subject having mild cognitive impairment is included.
[0032] In another aspect, the Disclosure provides a method for treating a subject having mild traumatic brain injury, the method comprising: (i) selecting a subject at risk of mild traumatic brain injury; (ii) obtaining cell-free DNA from a blood sample from the subject; (iii) analyzing the methylation pattern of a region of DNA derived from the cell-free DNA (the region being selected from the regions listed in Tables 2 to 5); (iv) determining the proportion of neuronal cell-free DNA; (v) comparing the proportion of neuronal cell-free DNA with a control; and (vi) treating the subject for mild traumatic brain injury if the proportion of neuronal cell-free DNA exceeds that of the control.
[0033] In some embodiments, treating the subject involves administering a therapeutic agent that treats one or more symptoms of mild traumatic brain injury. In some embodiments, steps (ii) to (v) are further repeated at a time point after treatment. In some embodiments, treatment is discontinued if the percentage of neuronal cell-free DNA at that time point is less than or equal to the control. In some embodiments, treatment is continued if the percentage of neuronal cell-free DNA at that time point is greater than the control.
[0034] In another aspect, the disclosure provides a kit comprising a first plurality of oligonucleotides, each oligonucleotide of the first plurality of oligonucleotides being hybridizable to a region that is preferentially methylated in neuronal cells.
[0035] In some embodiments, the system further includes a second plurality of oligonucleotides, each of which is hybridizable to a region that is preferentially demethylated in neuronal cells.
[0036] In some embodiments, the kit is for determining the effectiveness of a potential treatment for a neurodegenerative disease or condition. In some embodiments, the neurodegenerative disease or condition is selected from Alzheimer's disease, Huntington's disease, Parkinson's disease, amyotrophic lateral sclerosis (ALS), ataxia, multiple sclerosis, multiple system atrophy, concussion, frontotemporal dementia - granulin, mucopolysaccharidosis type I (MPS I), mucopolysaccharidosis type II (MPS II; Hunter syndrome), or mucopolysaccharidosis type IIIA (MPS IIIA; Sanfilippo syndrome). In some embodiments, the neurons are motor neurons, spinal motor neurons, sensory neurons, interneurons, dopaminergic neurons, cholinergic neurons, GABAergic neurons, glutamatergic neurons, or cortical neurons. In some embodiments, the neurons originate from the forebrain, midbrain, or hindbrain. In some embodiments, the neurons originate from the frontal lobe, temporal lobe, parietal lobe, occipital lobe, cerebellum, or brainstem.
[0037] In some embodiments, the plurality of oligonucleotides comprises one or more oligonucleotides having one of the nucleotide sequences of SEQ ID NOs: 3 to 6.
[0038] In another aspect, the Disclosure provides a method for detecting cell-free DNA of neuron origin in a blood sample, the method comprising (i) obtaining cell-free DNA from a blood sample from a human subject, and (ii) detecting whether or not cell-free DNA of neuron origin is present in the blood sample by methylation analysis, which includes sequencing of the entire DNA amplicon.
[0039] In some embodiments, the entire amplicon is at least about 50 base pairs (bp) in length. In some embodiments, the entire amplicon is between about 50 base pairs and about 500 base pairs in length.
[0040] In some embodiments, the entire amplicon was prepared using one or more primers containing one of the sequences of SEQ ID NOs: 3-6. In some embodiments, the entire amplicon was prepared using one or more primers targeting a region selected from the regions listed in Table 1.
[0041] In some embodiments, the entire amplicon was fabricated using one or more primers targeting regions selected from those listed in Table 2. In some embodiments, the entire amplicon was fabricated using one or more primers targeting regions selected from those listed in Table 3. In some embodiments, the entire amplicon was fabricated using one or more primers targeting regions selected from those listed in Table 4. In some embodiments, the entire amplicon was fabricated using one or more primers targeting regions selected from those listed in Table 5.
[0042] In another aspect, the Disclosure provides a method for determining the methylation status of an amplicon, the method comprising: (i) obtaining cell-free DNA from a blood sample from a human subject; (ii) converting 5-methylcytosine in the cell-free DNA to another nucleotide to generate converted cell-free DNA; (iii) amplifying the converted cell-free DNA to generate an amplicon; and (iv) sequencing the amplicon, the entire amplicon being approximately 50 to 500 base pairs in length.
[0043] In some embodiments, the entire amplicon was fabricated using one or more primers containing one of the sequences of sequence numbers 3-6. In some embodiments, the entire amplicon was fabricated using one or more primers targeting a region selected from the regions listed in Table 1. In some embodiments, the entire amplicon was fabricated using one or more primers targeting a region selected from the regions listed in Table 2. In some embodiments, the entire amplicon was fabricated using one or more primers targeting a region selected from the regions listed in Table 3. In some embodiments, the entire amplicon was fabricated using one or more primers targeting a region selected from the regions listed in Table 4. In some embodiments, the entire amplicon was fabricated using one or more primers targeting a region selected from the regions listed in Table 5. [Brief explanation of the drawing]
[0044] [Figure 1] Figure 1 shows a heatmap displaying the distribution of 37,455 differential methylation regions (DMRs) between purified neurons and plasma samples. The heatmap shows the methylation patterns in these DMRs, with red indicating higher methylation levels and blue indicating lower methylation levels. Each row corresponds to a specific DMR, and each column represents a sample. The clear clustering of samples based on methylation patterns highlights the significant phenotypic differences between plasma and purified neurons. [Figure 2A] This shows an analysis of 957 sites exhibiting differential methylation patterns. The bar graph shows 957 sites where the difference in methylation rates between cortical neurons and plasma is 0.6 or greater. [Figure 2B] This report presents the analysis of 957 sites exhibiting differential methylation patterns. It shows the delta representation of the methylation difference between cortical neurons and plasma at selected locations. Positive values indicate higher methylation in neurons, while negative values indicate lower methylation. [Figure 3A]This panel shows the methylation patterns of seven sequenced loci in neuronal and plasma samples. Each panel shows the mean methylation rate (y-axis) for individual CpGs (x-axis). Neuronal DNA shows complete demethylation, while plasma DNA shows near-complete methylation. [Figure 3B] This panel shows the methylation patterns of seven sequenced loci in neuronal and plasma samples. Each panel shows the mean methylation rate (y-axis) for individual CpGs (x-axis). Neuronal DNA shows complete demethylation, while plasma DNA shows near-complete methylation. [Figure 3C] This panel shows the methylation patterns of seven sequenced loci in neuronal and plasma samples. Each panel shows the mean methylation rate (y-axis) for individual CpGs (x-axis). Neuronal DNA shows complete demethylation, while plasma DNA shows near-complete methylation. [Figure 3D] This panel shows the methylation patterns of seven sequenced loci in neuronal and plasma samples. Each panel shows the mean methylation rate (y-axis) for individual CpGs (x-axis). Neuronal DNA shows complete demethylation, while plasma DNA shows near-complete methylation. [Figure 3E] This panel shows the methylation patterns of seven sequenced loci in neuronal and plasma samples. Each panel shows the mean methylation rate (y-axis) for individual CpGs (x-axis). Neuronal DNA shows complete demethylation, while plasma DNA shows near-complete methylation. [Figure 3F] This panel shows the methylation patterns of seven sequenced loci in neuronal and plasma samples. Each panel shows the mean methylation rate (y-axis) for individual CpGs (x-axis). Neuronal DNA shows complete demethylation, while plasma DNA shows near-complete methylation. [Figure 3G]This panel shows the methylation patterns of seven sequenced loci in neuronal and plasma samples. Each panel shows the mean methylation rate (y-axis) for individual CpGs (x-axis). Neuronal DNA shows complete demethylation, while plasma DNA shows near-complete methylation. [Figure 4] This figure shows the calculated proportion of neuron-derived DNA in plasma samples. By using a conservative 5% cutoff for the proportion of neuron-derived cell-free DNA (cfDNA), this plot shows the distribution of samples based on neuron-derived cfDNA levels. The x-axis represents individual samples, and the y-axis represents the proportion of neuron-derived cell-free DNA (cfDNA). This figure shows that the proportions accurately identified patients diagnosed with Alzheimer's disease (AD) and distinguished between healthy controls and individuals with mild cognitive impairment (MCI) who subsequently progressed to AD. [Figure 5] This heatmap displays the distribution of 12,443 differential methylation regions (DMRs) that distinguish cortical neurons, glutamatergic neurons (Glut), GABAergic neurons (GABA), spinal motor neurons (Sp.Motor), dopaminergic neurons (DA), and plasma. The heatmap shows the methylation patterns in these DMRs, with red indicating higher methylation levels and blue indicating lower methylation levels. Each row corresponds to a specific DMR, and each column represents a group of samples derived from the same tissue type. The clear clustering of samples based on methylation patterns highlights the significant phenotypic differences between each cell type. [Figure 6A] This section presents an analysis of differential methylation patterns in GABAergic neurons. Figure 6A shows the analysis of 449 sites exhibiting differential methylation patterns. The bar graph indicates sites where the difference in methylation rates between GABAergic neurons and plasma containing other neuronal subtypes is 0.5 or greater. [Figure 6B]This section presents an analysis of differential methylation patterns in glutamatergic neurons. Figure 6B shows the analysis of 212 sites exhibiting differential methylation patterns. The bar graph indicates sites where the difference in methylation rate between glutamatergic neurons and plasma containing other neuronal subtypes is 0.5 or greater. [Figure 6C] This section presents an analysis of differential methylation patterns in dopaminergic neurons. Figure 6C shows an analysis of 1,522 sites exhibiting differential methylation patterns. The bar graph indicates sites where the difference in methylation rates between dopaminergic neurons and plasma samples containing other neuronal subtypes is 0.5 or greater. [Figure 6D] This section presents an analysis of differential methylation patterns in spinal motor neurons. Figure 6D shows an analysis of 1,600 sites exhibiting differential methylation patterns. The bar graph indicates sites where the difference in methylation rate between spinal motor neurons and plasma combined with other neuronal subtypes is 0.5 or greater. [Modes for carrying out the invention]
[0045] Those skilled in the art will be able to see how the disclosure can be implemented in various alternative embodiments and uses by reading this specification. However, not all of the various embodiments of the invention are described herein. It will be understood that the embodiments presented herein are illustrative and not intended to be limiting. Accordingly, this detailed description of the various alternative embodiments described herein should not be construed as limiting the scope or breadth of the disclosure herein.
[0046] Prior to the disclosure and description of this technology, it is understood that the embodiments described below are not limited to specific compositions, methods for preparing such compositions, or uses thereof, and that these may naturally vary. It is also understood that the terms used herein are for the purpose of describing specific embodiments and are not intended to be limiting.
[0047] Detailed explanations are divided into multiple sections for the reader's convenience only, and disclosures in any section may be combined with those in other sections. Titles or subtitles may be used in the specification for the reader's convenience, but these are not intended to affect the scope of this disclosure.
[0048] definition Unless otherwise defined, all technical and scientific terms used herein have the same meanings as those commonly understood by those skilled in the art in which this disclosure pertains. In this specification and the following claims, several terms are referenced as having the following meanings:
[0049] The terms used herein are for the purpose of describing specific embodiments and are not intended to limit them. Where used herein, the singular forms "a," "an," and "the" are intended to include the plural forms unless the context clearly indicates a different meaning.
[0050] "Optional" or "optionally" means both the cases in which the event or situation described thereafter may or may not occur, and includes both the cases in which the event or situation occurs and the cases in which it does not occur.
[0051] The term "approximately" used before a numerical specification (e.g., temperature, time, quantity, concentration, etc., including ranges thereof) indicates an approximation that may vary by (+) or (-) 10%, 5%, 1%, or any sub-range or sub-value between them. Preferably, when used in relation to quantity, the term "approximately" means that the quantity may vary within a range of ±10%.
[0052] "Comprising" or "comprises" means that a composition or method includes the elements described, and is not intended to exclude other elements. "Essentially consisting of" means, when used to define a composition or method, to exclude other elements that are essential to the described purpose in that combination. Thus, a composition essentially consisting of the elements defined herein does not exclude other materials or steps that do not substantially affect the basic and novel properties of the claimed invention. "Consists of" means to exclude elements and substantial method steps that exceed trace amounts of other components. Embodiments defined by each of these transitional terms are within the scope of this disclosure.
[0053] As used herein, "cell-free DNA" refers to short DNA fragments released into the bloodstream by cell death.
[0054] As used herein, the term “neuron” refers to any neuron or nerve cell type. In non-limiting examples, a neuron may be a motor neuron, spinal motor neuron, dopaminergic neuron, cortical neuron, sensory neuron, interneuron, or medium-sized spiny neuron.
[0055] method Due to the inherent difficulties surrounding biopsies taken from brain tissue, other tissues must be used when diagnosing diseases within the brain. In previous studies using DNA methylation signatures as a potential diagnostic tool for neurodegenerative diseases, attempts have been made to use cerebrospinal fluid (CSF) as the primary liquid biopsy. CSF is collected using lumbar puncture, a painful and expensive process that requires a medical license and carries numerous potential health risks to the patient. The advantage of the method disclosed lies in its relative simplicity, low cost, and low patient risk, making it a standard liquid biopsy in medical practice, and its applicability to blood samples.
[0056] This disclosure relates to a blood-based, two-part diagnostic tool designed to diagnose neurodegenerative diseases or conditions before symptom onset. The first component consists of an assay designed to amplify and sequence pre-identified regions of cell-free DNA. The second component consists of a computer-implemented analysis (e.g., Python-based) that analyzes methylation signatures to identify neuron-derived DNA and provides a diagnosis of neurodegenerative diseases or conditions before symptom onset.
[0057] Using a standard protocol for blood-based cell-free DNA extraction, the DNA is then bisulfite-converted and amplified at pre-selected regions of the genome using PCR. The assay used for PCR amplification is specifically designed to target and amplify pre-selected regions of the bisulfite-converted DNA. These pre-selected regions contain methylation signatures specific to neuronal cells, which allows for easy identification of neuron-derived DNA from DNA of all other cell types that may be found in blood cell-free DNA. After amplification, the regions are sequenced using DNA sequencing.
[0058] Next, the methylation signature of each single read is analyzed. This is done using pre-established methylation "blueprints" for neuronal cells and whole blood cells. The computer implementation analysis according to the present disclosure compares each read to these "blueprints" and predicts which cell type each read originates from. Once neuronal-derived DNA is identified, the analysis predicts a neurodegenerative disease or condition before symptom onset. This is done by first analyzing the amount of neuronal-derived cell-free DNA present in the blood, and then comparing the methylation signature to the methylation "blueprints" of patients with neurodegenerative diseases or conditions. The combination of these two methods ultimately provides a diagnosis of whether or not a patient has a neurodegenerative disease or condition before symptom onset.
[0059] Cell types, such as neurons, possess unique methylation patterns ("blueprints") that can be used to distinguish them from other cell types. Furthermore, methylation patterns also help to differentiate individual neuronal types from others, for example, making it possible to distinguish between motor neurons and dopaminergic neurons. Cell-free DNA, such as that found in the blood, is a result of cell death throughout the body. We have found that by analyzing cell-free DNA for neuron-derived methylation patterns, it is possible to predict the presence of neurodegenerative diseases or conditions in subjects.
[0060] This method can be used to detect neurodegenerative diseases or conditions before the onset of symptoms or in the early stages when symptoms are mild. The method can also be used to determine the occurrence, severity, and / or duration (e.g., recovery) of traumatic brain injury, such as a concussion. Furthermore, the method can be used to distinguish between different types of neurodegenerative diseases or conditions. In a further embodiment, the method can also be used to evaluate the effectiveness of therapeutic agents for the treatment of neurodegenerative diseases or conditions.
[0061] In one embodiment, a method is provided for treating a subject who has or is at risk of having a neurodegenerative disease or condition. In this embodiment, the method is (i) Obtain cell-free DNA from blood samples from the subject, (ii) Analyzing the methylation pattern of a DNA region from cell-free DNA, wherein the region is selected from the regions listed in Tables 2-5. (iii) Determine the proportion of cell-free DNA derived from neurons, (iv) To compare the proportion of cell-free DNA derived from the neuron with that of a control, (v) If the proportion of cell-free DNA derived from the neuron is greater than that of the control, administer a therapeutic agent for treating or preventing the neurodegenerative disease or condition.
[0062] In the embodiment, step (ii) includes analyzing the methylation pattern of the entire DNA amplicon. In the embodiment, the entire amplicon is at least about 50 base pairs (bp) in length.
[0063] In the embodiment, the entire amplicon is approximately 50 to approximately 500 base pairs long. In the embodiment, the entire amplicon is approximately 60 to approximately 500 base pairs long. In the embodiment, the entire amplicon is approximately 70 to approximately 500 base pairs long. In the embodiment, the entire amplicon is approximately 80 to approximately 500 base pairs long. In the embodiment, the entire amplicon is approximately 90 to approximately 500 base pairs long. In the embodiment, the entire amplicon is approximately 100 to approximately 500 base pairs long. In the embodiment, the entire amplicon is approximately 150 to approximately 500 base pairs long. In the embodiment, the entire amplicon is approximately 200 to approximately 500 base pairs long. In the embodiment, the entire amplicon is approximately 250 to approximately 500 base pairs long. In the embodiment, the entire amplicon is approximately 300 to approximately 500 base pairs long. In the embodiment, the entire amplicon is approximately 350 to 500 base pairs long. In the embodiment, the entire amplicon is approximately 400 to 500 base pairs long. In the embodiment, the entire amplicon is approximately 450 to 500 base pairs long.
[0064] In the embodiment, the entire amplicon is approximately 50 to approximately 450 base pairs long. In the embodiment, the entire amplicon is approximately 50 to approximately 400 base pairs long. In the embodiment, the entire amplicon is approximately 50 to approximately 350 base pairs long. In the embodiment, the entire amplicon is approximately 50 to approximately 300 base pairs long. In the embodiment, the entire amplicon is approximately 50 to approximately 250 base pairs long. In the embodiment, the entire amplicon is approximately 50 to approximately 200 base pairs long. In the embodiment, the entire amplicon is approximately 50 to approximately 150 base pairs long. In the embodiment, the entire amplicon is approximately 50 to approximately 100 base pairs long. In the embodiment, the entire amplicon is approximately 50 to approximately 90 base pairs long. In the embodiment, the entire amplicon is approximately 50 to approximately 80 base pairs long. In the embodiment, the entire amplicon is approximately 50 to approximately 70 base pairs long. In the embodiment, the entire amplicon is approximately 50 to 60 base pairs long. The length of the entire amplicon is any value or subrange within the enumerated range and may include endpoints.
[0065] In some aspects, the disclosure relates to a method for treating subjects who have or are at risk of having a neurodegenerative disease, and the method is (i) Obtain cell-free DNA from blood samples from the subject, (ii) Analyzing the methylation pattern of a DNA region from cell-free DNA, wherein the region is selected from the regions listed in Tables 2-5. (iii) Determine the proportion of cell-free DNA derived from neurons, (iv) administering a therapeutic agent to treat or prevent the neurodegenerative disease or condition when the proportion of neuronal cell-free DNA is greater than approximately 5%.
[0066] In the embodiment, the therapeutic agent is administered when the percentage of neuron-derived cell-free DNA is approximately 3% to approximately 99%. In the embodiment, the therapeutic agent is administered when the percentage of neuron-derived cell-free DNA is approximately 3% to approximately 90%. In the embodiment, the therapeutic agent is administered when the percentage of neuron-derived cell-free DNA is approximately 3% to approximately 80%. In the embodiment, the therapeutic agent is administered when the percentage of neuron-derived cell-free DNA is approximately 3% to approximately 70%. In the embodiment, the therapeutic agent is administered when the percentage of neuron-derived cell-free DNA is approximately 3% to approximately 60%. In the embodiment, the therapeutic agent is administered when the percentage of neuron-derived cell-free DNA is approximately 3% to approximately 50%. In the embodiment, the therapeutic agent is administered when the percentage of neuron-derived cell-free DNA is approximately 3% to approximately 40%. In the embodiment, the therapeutic agent is administered when the percentage of neuron-derived cell-free DNA is approximately 3% to approximately 30%. In the embodiment, the therapeutic agent is administered according to the percentage of cell-free DNA. The percentage of neuron-derived DNA is approximately 3% to 20%.
[0067] In the embodiment, the therapeutic agent is administered when the proportion of neuron-derived cell-free DNA is greater than approximately 2%. In the embodiment, the therapeutic agent is administered when the proportion of neuron-derived cell-free DNA is greater than approximately 3%. In the embodiment, the therapeutic agent is administered when the proportion of neuron-derived cell-free DNA is greater than approximately 4%. In the embodiment, the therapeutic agent is administered when the proportion of neuron-derived cell-free DNA is greater than 5%. In the embodiment, the therapeutic agent is administered when the proportion of neuron-derived cell-free DNA is greater than approximately 6%. In the embodiment, the therapeutic agent is administered when the proportion of neuron-derived cell-free DNA is greater than approximately 7%. In the embodiment, the therapeutic agent is administered when the proportion of neuron-derived cell-free DNA is greater than approximately 8%. In the embodiment, the therapeutic agent is administered when the proportion of neuron-derived cell-free DNA is greater than approximately 9%. In the embodiment, the therapeutic agent is administered when the proportion of neuron-derived cell-free DNA is greater than approximately 10%. In the embodiment, the therapeutic agent is administered when the proportion of neuron-derived cell-free DNA is greater than approximately 11%. In the embodiment, the therapeutic agent is administered when the proportion of neuron-derived cell-free DNA is greater than approximately 12%. In the embodiment, the therapeutic agent is administered when the proportion of neuron-derived cell-free DNA is greater than approximately 13%. In the embodiment, the therapeutic agent is administered when the proportion of neuron-derived cell-free DNA is greater than approximately 14%. In the embodiment, the therapeutic agent is administered when the proportion of neuron-derived cell-free DNA is greater than approximately 15%. In the embodiment, the therapeutic agent is administered when the proportion of neuron-derived cell-free DNA is greater than approximately 20%.
[0068] In one embodiment, the method relates to a method for selecting patients to be treated with therapeutic agents for treating neurodegenerative diseases or conditions, the method being: (i) Obtain cell-free DNA from a blood sample from the subject, (ii) Analyzing the methylation pattern of a DNA region from cell-free DNA, wherein the region is selected from the regions listed in Tables 2-5. (iii) Determine the proportion of cell-free DNA derived from neurons, (iv) Comparing the proportion of neuronal cell-free DNA with a control, Here, if the proportion of cell-free DNA derived from neurons is greater than that of the control, the subject is selected for treatment.
[0069] In the embodiments, subjects are selected for treatment when the percentage of neuron-derived cell-free DNA is approximately 3% to approximately 99%. In the embodiments, subjects are selected for treatment when the percentage of neuron-derived cell-free DNA is approximately 3% to approximately 90%. In the embodiments, subjects are selected for treatment when the percentage of neuron-derived cell-free DNA is approximately 3% to approximately 80%. In the embodiments, subjects are selected for treatment when the percentage of neuron-derived cell-free DNA is approximately 3% to approximately 70%. In the embodiments, subjects are selected for treatment when the percentage of neuron-derived cell-free DNA is approximately 3% to approximately 60%. In the embodiments, subjects are selected for treatment when the percentage of neuron-derived cell-free DNA is approximately 3% to approximately 50%. In the embodiments, subjects are selected for treatment when the percentage of neuron-derived cell-free DNA is approximately 3% to approximately 40%. In the embodiments, subjects are selected for treatment when the percentage of neuron-derived cell-free DNA is approximately 3% to approximately 30%. In the embodiments, patients are selected for treatment based on the percentage of cell-free DNA. Approximately 3% to 20% of the DNA originates from neurons.
[0070] In the embodiment, the subject is selected for treatment when the proportion of neuron-derived cell-free DNA is greater than approximately 3%. In the embodiment, the subject is selected for treatment when the proportion of neuron-derived cell-free DNA is greater than approximately 5%. In the embodiment, the subject is selected for treatment when the proportion of neuron-derived cell-free DNA is greater than approximately 6%. In the embodiment, the subject is selected for treatment when the proportion of neuron-derived cell-free DNA is greater than approximately 7%. In the embodiment, the subject is selected for treatment when the proportion of neuron-derived cell-free DNA is greater than approximately 8%. In the embodiment, the subject is selected for treatment when the proportion of neuron-derived cell-free DNA is greater than approximately 9%. In the embodiment, the therapeutic agent is administered when the proportion of neuron-derived cell-free DNA is greater than approximately 10%. In the embodiment, the subject is selected for treatment when the proportion of neuron-derived cell-free DNA is greater than approximately 11%. In the embodiment, the subject is selected for treatment when the proportion of neuron-derived cell-free DNA is greater than approximately 12%. In the embodiment, the subject is selected for treatment when the proportion of neuron-derived cell-free DNA is greater than approximately 13%. In one embodiment, a subject is selected for treatment if the proportion of neuron-derived cell-free DNA is greater than approximately 14%. In another embodiment, a subject is selected for treatment if the proportion of neuron-derived cell-free DNA is greater than approximately 15%. In yet another embodiment, a subject is selected for treatment if the proportion of neuron-derived cell-free DNA is greater than approximately 20%.
[0071] In this embodiment, a higher proportion of neuronal cell-free DNA than the control indicates an increased risk of neurodegenerative disease or traumatic brain injury.
[0072] In some embodiments, this disclosure relates to a method for analyzing a biological sample of a subject. In embodiments, the subject has or is at risk of having a neurodegenerative disease or condition. In embodiments, the method is (i) Obtain cell-free DNA from a blood sample from the subject, (ii) Analyzing the methylation pattern of a DNA region from cell-free DNA, wherein the region is selected from the regions listed in Tables 2-5. (iii) Determine the proportion of cell-free DNA derived from neurons, (iv) Comparing the proportion of cell-free DNA derived from the neuron with a control.
[0073] In one embodiment, the Disclosure relates to a computer product including a non-temporary computer-readable medium, which stores a set of instructions to be executed when controlling a computer system to analyze a biological sample from a subject to determine the risk of neurodegenerative disease in the subject, wherein the biological sample includes cell-free DNA. In an embodiment, the instructions are: (i) Identifying a first DNA methylation pattern that occurs in neurons at a frequency exceeding a threshold, wherein the first DNA methylation pattern includes methylation in one or more methylated regions and optionally includes demethylation in one or more unmethylated regions. (ii) Analyze the second DNA methylation pattern of cell-free DNA, (iii) Calculate the relative abundance of the one or more methylated regions and optionally the one or more unmethylated regions in cell-free DNA, (iv) including determining the risk of neurodegenerative disease or condition in a subject by comparing the relative abundance with a control.
[0074] In one embodiment, the present disclosure relates to a computer-implemented method for analyzing a biological sample, the method being (i) Identifying a first DNA methylation pattern that occurs in neurons at a frequency exceeding a threshold, wherein the first DNA methylation pattern comprises methylation in one or more methylation regions and optionally comprises demethylation in one or more unmethylation regions. (ii) Analyze the second DNA methylation pattern of cell-free DNA, (iii) Calculate the relative abundance of one or more methylated regions and optionally one or more unmethylated regions in cell-free DNA, (iv) including determining the risk of neurodegenerative disease or condition in a subject by comparing the relative abundance with a control.
[0075] In the embodiments, a percentage of neuron-derived cell-free DNA ranging from approximately 3% to approximately 99% indicates an increased risk of neurodegenerative disease or traumatic brain injury. In the embodiments, a percentage of neuron-derived cell-free DNA ranging from approximately 3% to approximately 90% indicates an increased risk of neurodegenerative disease or traumatic brain injury. In the embodiments, a percentage of neuron-derived cell-free DNA ranging from approximately 3% to approximately 80% indicates an increased risk of neurodegenerative disease or traumatic brain injury. In the embodiments, a percentage of neuron-derived cell-free DNA ranging from approximately 3% to approximately 70% indicates an increased risk of neurodegenerative disease or traumatic brain injury. In the embodiments, a percentage of neuron-derived cell-free DNA ranging from approximately 3% to approximately 60% indicates an increased risk of neurodegenerative disease or traumatic brain injury. In the embodiments, a percentage of neuron-derived cell-free DNA ranging from approximately 3% to approximately 50% indicates an increased risk of neurodegenerative disease or traumatic brain injury. In the embodiments, a percentage of neuron-derived cell-free DNA of approximately 3% to 40% indicates an increased risk of neurodegenerative disease or traumatic brain injury. In the embodiments, a percentage of neuron-derived cell-free DNA of approximately 3% to 30% indicates an increased risk of neurodegenerative disease or traumatic brain injury. In the embodiments, a percentage of neuron-derived cell-free DNA of approximately 3% to 20% indicates an increased risk of neurodegenerative disease or traumatic brain injury.
[0076] In the embodiments, a percentage of neuron-derived cell-free DNA greater than approximately 3% indicates an increased risk of neurodegenerative disease or traumatic brain injury. In the embodiments, a percentage of neuron-derived cell-free DNA greater than approximately 4% indicates an increased risk of neurodegenerative disease or traumatic brain injury. In the embodiments, a percentage of neuron-derived cell-free DNA greater than approximately 5% indicates an increased risk of neurodegenerative disease or traumatic brain injury. In the embodiments, a percentage of neuron-derived cell-free DNA greater than approximately 6% indicates an increased risk of neurodegenerative disease or traumatic brain injury. In the embodiments, a percentage of neuron-derived cell-free DNA greater than approximately 7% indicates an increased risk of neurodegenerative disease or traumatic brain injury. In the embodiments, a percentage of neuron-derived cell-free DNA greater than approximately 8% indicates an increased risk of neurodegenerative disease or traumatic brain injury. In the embodiments, a percentage of neuron-derived cell-free DNA greater than approximately 9% indicates an increased risk of neurodegenerative disease or traumatic brain injury. In the embodiments, a percentage of neuron-derived cell-free DNA greater than approximately 10% indicates an increased risk of neurodegenerative disease or traumatic brain injury. In the embodiments, a percentage of neuron-derived cell-free DNA greater than approximately 11% indicates an increased risk of neurodegenerative disease or traumatic brain injury. In the embodiments, a percentage of neuron-derived cell-free DNA greater than approximately 12% indicates an increased risk of neurodegenerative disease or traumatic brain injury. In the embodiments, a percentage of neuron-derived cell-free DNA greater than approximately 13% indicates an increased risk of neurodegenerative disease or traumatic brain injury. In the embodiments, a percentage of neuron-derived cell-free DNA greater than approximately 14% indicates an increased risk of neurodegenerative disease or traumatic brain injury. In the embodiments, a percentage of neuron-derived cell-free DNA greater than approximately 15% indicates an increased risk of neurodegenerative disease or traumatic brain injury. In the embodiments, a percentage of neuron-derived cell-free DNA greater than approximately 20% indicates an increased risk of neurodegenerative disease or traumatic brain injury.
[0077] In the embodiment, determining the proportion of cell-free DNA derived from neurons involves comparing the methylation pattern of the cell-free DNA with the methylation pattern of neuronal DNA, where the methylation pattern of neuronal DNA includes methylation in one or more methylated regions. In the embodiment, the methylation pattern of neuronal DNA does not include methylation in one or more unmethylated regions.
[0078] After sequencing and data processing, the methylation status of each molecule may be evaluated.
[0079] In some embodiments, a sample-derived sequence is aligned to a reference DNA sequence. In some embodiments, the reference DNA sequence includes the human genome. In some embodiments, the reference DNA sequence includes a portion of the human genome. In some embodiments, the reference DNA sequence includes a region amplified by PCR. In some embodiments, the reference DNA sequence includes a portion of the PCR product. After alignment, locations identified as having different methylation states across tissues may be analyzed to measure the relative frequency of base calls at the locations and determine the estimated methylation ratio in the pool. In some embodiments, the methylation ratio at each location may be analyzed in conjunction with other locations to determine the overall methylation state of the sequenced DNA molecule.
[0080] In some embodiments, a sequence derived from a sample is searched to identify a specific base sequence of length N within a sequenced DNA molecule, where N is 2, 3, 4, 5, 6, 7, 8, 9, 10, 11, 12, 13, 14, 15, 16, 17, 18, 19, or 20 bases. In some embodiments, the base sequence is adjacent to the base being evaluated. In some embodiments, the base sequence encompasses the base being evaluated. In some embodiments, two or more versions of the sequence are used to represent the methylated and unmethylated states of the DNA sequence.
[0081] In some embodiments, a sequence derived from a sample is input to a machine learning algorithm. In some embodiments, the machine learning algorithm includes a neural network. In some embodiments, the machine learning algorithm includes a multilayer perceptron. In some embodiments, the machine learning algorithm includes a convolutional neural network. In some embodiments, the machine learning algorithm uses a base-called DNA sequence as input. In some embodiments, the DNA sequence is split into k-mers, where k is 2, 3, 4, 5, 6, 7, 8, 9, 10, 11, 12, 13, 14, 15, 16, 17, 18, 19, or 20 base lengths. For example, in one embodiment, sequencing data is split into overlapping hexamers (k=6). These hexamers are counted and input to a multilayer perceptron containing 4096 input neurons (one input neuron corresponding to each of all possible hexamer sequences), a hidden layer with 8 neurons, and one output neuron that classifies reads as methylated or unmethylated. The model was trained using 100,000 reads selected from purified tissue samples consisting only of methylated or unmethylated DNA at the examined loci. Cross-validation using 20% of the data showed a final precision of 99.8% and a loss of 0.01.
[0082] The control may be any suitable control. In the embodiment, the control is the percentage of neuronal cell-free DNA in a blood sample from an untreated subject. In the embodiment, the control is the percentage of neuronal cell-free DNA in a blood sample from a healthy subject. In the embodiment, the control is a blood sample from the subject(s) before treatment. In the embodiment, the control is a threshold. In the embodiment, the threshold is that the percentage of neuronal cell-free DNA is greater than approximately 3%. In the embodiment, the threshold is that the percentage of neuronal cell-free DNA is greater than approximately 4%. In the embodiment, the threshold is that the percentage of neuronal cell-free DNA is greater than approximately 5%. In the embodiment, the threshold is that the percentage of neuronal cell-free DNA is greater than approximately 6%. In the embodiment, the threshold is that the percentage of neuronal cell-free DNA is greater than approximately 7%. In the embodiment, the threshold is that the percentage of neuronal cell-free DNA is greater than approximately 8%. In the embodiment, the threshold is that the percentage of neuronal cell-free DNA is greater than approximately 9%. In the embodiment, the threshold is that the percentage of neuronal cell-free DNA is greater than approximately 10%. In the embodiment, the threshold is that the proportion of cell-free DNA derived from neurons is greater than approximately 11%. In the embodiment, the threshold is that the proportion of cell-free DNA derived from neurons is greater than approximately 12%. In the embodiment, the threshold is that the proportion of cell-free DNA derived from neurons is greater than approximately 13%. In the embodiment, the threshold is that the proportion of cell-free DNA derived from neurons is greater than approximately 14%. In the embodiment, the threshold is that the proportion of cell-free DNA derived from neurons is greater than approximately 15%. In the embodiment, the threshold is that the proportion of cell-free DNA derived from neurons is greater than approximately 20%.
[0083] In this embodiment, the neurodegenerative disease is Alzheimer's disease. In this embodiment, the neurodegenerative disease is Huntington's disease. In this embodiment, the neurodegenerative disease is Parkinson's disease. In this embodiment, the neurodegenerative disease is amyotrophic lateral sclerosis (ALS). In this embodiment, the neurodegenerative disease is ataxia. In this embodiment, the neurodegenerative disease is multiple sclerosis. In this embodiment, the neurodegenerative disease or condition is multiple system atrophy. In this embodiment, the neurodegenerative condition is mild traumatic brain injury. In this embodiment, the neurodegenerative condition is concussion. In this embodiment, the neurodegenerative condition is frontotemporal dementia - granulin. In this embodiment, the neurodegenerative condition is mucopolysaccharidosis type I (MPS I). In this embodiment, the neurodegenerative condition is mucopolysaccharidosis type II (MPS II; Hunter syndrome). In this embodiment, the neurodegenerative condition is mucopolysaccharidosis type IIIA (MPS IIIA; Sanfilippo syndrome). One or more of these diseases or conditions may be explicitly excluded.
[0084] Neurons may be any neuronal type or a combination thereof. In an embodiment, the neuron is a motor neuron. In an embodiment, the neuron is a spinal motor neuron. In an embodiment, the neuron is a sensory neuron. In an embodiment, the neuron is an interneuron. In an embodiment, the neuron is a dopaminergic neuron. In an embodiment, the neuron is a GABAergic neuron. In an embodiment, the neuron is a glutamatergic neuron. In an embodiment, the neuron is a cortical neuron.
[0085] In the embodiment, the neurons originate from the forebrain. In the embodiment, the neurons originate from the midbrain. In the embodiment, the neurons originate from the hindbrain. In the embodiment, the neurons originate from the frontal lobe. In the embodiment, the neurons originate from the temporal lobe. In the embodiment, the neurons originate from the parietal lobe. In the embodiment, the neurons originate from the occipital lobe. In the embodiment, the neurons originate from the cerebellum. In the embodiment, the neurons originate from the brainstem.
[0086] In the embodiments, analyzing the methylation pattern of DNA involves determining the methylation state of a region of DNA. In the embodiments, the DNA is chromosomal DNA. In the embodiments, the region is a region that is preferentially (more likely) methylated in neurons or neuronal types compared to one or more other cell types. In the embodiments, the region is a region that is preferentially (more likely) demethylated in neurons or neuronal types compared to one or more other cell types.
[0087] In the embodiment, the methylation status of one or more regions listed in Table 1 is analyzed. In the embodiment, the methylation status of one or more subregions within one or more regions listed in Table 1 is analyzed. In the embodiment, the methylation status of chr3:42190679,42191148 is analyzed. In the embodiment, the methylation status of chr19_3507867_3507868 is analyzed. In the embodiment, an increase in the percentage of cell-free DNA with methylation in one or more regions (or one or more subregions within one or more regions listed in Table 1) (compared to the control) indicates an increased risk of Alzheimer's disease. In the embodiment, an increase in the percentage of cell-free DNA with unmethylation in one or more regions (or one or more subregions within one or more regions listed in Table 1) (compared to the control) indicates an increased risk of Alzheimer's disease. [Table 1-1] [Table 1-2] [Table 1-3] [Table 1-4] [Table 1-5] [Table 1-6] [Table 1-7]
[0088] In the embodiments, the methylation status of one or more regions listed in Table 2 is analyzed. In the embodiments, the methylation status of one or more subregions within one or more regions listed in Table 2 is analyzed. In the embodiments, an increase in the percentage of cell-free DNA with methylation in one or more regions (or one or more subregions within one or more regions listed in Table 2) (compared to the control) indicates an increased risk of neurodegenerative disease. In the embodiments, an increase in the percentage of cell-free DNA with unmethylation in one or more regions (or one or more subregions within one or more regions listed in Table 2) (compared to the control) indicates an increased risk of neurodegenerative disease. In the embodiments, the neurodegenerative disease is Alzheimer's disease or dementia. [Table 2-1] [Table 2-2] [Table 2-3] [Table 2-4] [Table 2-5] [Table 2-6] [Table 2-7] [Table 2-8] [Table 2-9] Table 2-10 Table 2-11 Table 2-12 Table 2-13 Table 2-14 Table 2-15 Table 2-16 Table 2-17 Table 2-18 Table 2-19 Table 2-20 Table 2-21 Table 2-22 Table 2-23 Table 2-24 Table 2-25 Table 2-26 [Table 2-27] [Table 2-28] [Table 2-29] [Table 2-30] [Table 2-31] [Table 2-32] [Table 2-33]
[0089] In the embodiment, the methylation status of one or more regions listed in Table 3 is analyzed. In the embodiment, the methylation status of one or more subregions within one or more regions listed in Table 3 is analyzed. In the embodiment, an increase in the percentage of cell-free DNA with methylation in one or more regions (or one or more subregions within one or more regions listed in Table 3) (compared to the control) indicates an increased risk of neurodegenerative disease. In the embodiment, an increase in the percentage of cell-free DNA with unmethylation in one or more regions (or one or more subregions within one or more regions listed in Table 3) (compared to the control) indicates an increased risk of neurodegenerative disease. In the embodiment, the neurodegenerative disease is Huntington's disease. [Table 3-1] [Table 3-2] [Table 3-3] [Table 3-4] [Table 3-5] [Table 3-6] [Table 3-7] [Table 3-8] [Table 3-9] [Table 3-10] [Table 3-11] [Table 3-12] [Table 3-13] [Table 3-14]
[0090] In the embodiments, the methylation status of one or more regions listed in Table 4 is analyzed. In the embodiments, the methylation status of one or more subregions within one or more regions listed in Table 4 is analyzed. In the embodiments, an increase in the percentage of cell-free DNA with methylation in one or more regions (or one or more subregions within one or more regions listed in Table 4) (compared to the control) indicates an increased risk of Parkinson's disease. In the embodiments, an increase in the percentage of cell-free DNA with unmethylation in one or more regions (or one or more subregions within one or more regions listed in Table 4) (compared to the control) indicates an increased risk of Parkinson's disease. Table 4-1 Table 4-2 Table 4-3 Table 4-4 Table 4-5 Table 4-6 Table 4-7 Table 4-8 Table 4-9 Table 4-10 Table 4-11 Table 4-12 Table 4-13 Table 4-14
[0091] In the embodiments, the methylation status of one or more regions listed in Table 5 is analyzed. In the embodiments, the methylation status of one or more subregions within one or more regions listed in Table 5 is analyzed. In the embodiments, an increase in the percentage of cell-free DNA with methylation in one or more regions (or one or more subregions within one or more regions listed in Table 5) (compared to the control) indicates an increased risk of amyotrophic lateral sclerosis (ALS). In the embodiments, an increase in the percentage of cell-free DNA with unmethylation in one or more regions (or one or more subregions within one or more regions listed in Table 5) (compared to the control) indicates an increased risk of ALS. [Table 5-1] [Table 5-2] [Table 5-3] [Table 5-4] [Table 5-5] [Table 5-6] [Table 5-7] [Table 5-8] [Table 5-9] [Table 5-10] [Table 5-11] [Table 5-12] [Table 5-13] [Table 5-14]
[0092] Any method for analyzing the DNA methylation pattern may be used. For example, in the embodiment, analyzing the methylation pattern includes bisulfite sequencing.
[0093] In this embodiment, DNA is sequenced using long-read sequencing.
[0094] In the embodiment, the subject does not have symptoms of a neurodegenerative disease or condition. In the embodiment, the subject has symptoms of a neurodegenerative disease or condition. In the embodiment, the subject has mild symptoms of a neurodegenerative disease or condition. In the embodiment, the subject has early symptoms of a neurodegenerative disease or condition. In the embodiment, the subject has mild cognitive impairment.
[0095] In embodiments, the methods described herein may be used for pre-symptomatic diagnosis of neurodegenerative diseases. For example, subjects may be examined during a clinical visit, such as an annual health checkup for individuals aged 45 to 70 years.
[0096] In embodiments, the method includes selecting subjects having symptoms of a neurodegenerative disease or condition. In embodiments, the method includes selecting subjects having mild symptoms of a neurodegenerative disease or condition. In embodiments, the method includes selecting subjects having early symptoms of a neurodegenerative disease or condition. In embodiments, the method includes selecting subjects having mild cognitive impairment.
[0097] In one embodiment, a method is provided for treating a subject with mild traumatic brain injury, the method being: (i) Select subjects who are at risk of mild traumatic brain injury, (ii) Obtain cell-free DNA from a blood sample from the subject, (iii) Analyzing the methylation pattern of a DNA region from the cell-free DNA, wherein the region is selected from the regions listed in Tables 2 to 5. (iv) Determine the proportion of cell-free DNA derived from neurons, (v) The proportion of cell-free DNA derived from the neuron is compared with the control, (vi) A method is provided which includes treating a subject for mild traumatic brain injury if the proportion of cell-free DNA derived from the neuron is greater than that of the control.
[0098] In embodiments, treating the subject includes administering a therapeutic agent that treats one or more symptoms of mild traumatic brain injury. In embodiments, treating the subject includes physical and / or mental rest. In embodiments, treating the subject includes ceasing one or more activities such as sports.
[0099] In embodiments, the method further includes repeating steps (ii) to (v) at a time point after treatment. In embodiments, the treatment is discontinued if the percentage of neuron-derived cell-free DNA at time point is less than or equal to the control. In embodiments, the treatment is continued if the percentage of neuron-derived cell-free DNA at time point is greater than the control.
[0100] In one embodiment, a method is provided for monitoring subjects who have or are suspected of having mild traumatic brain injury, the method being: (i) Select subjects who are at risk of mild traumatic brain injury, (ii) Obtain cell-free DNA from a blood sample from the subject, (iii) Analyzing the methylation pattern of a DNA region from the cell-free DNA, wherein the region is selected from the regions listed in Tables 2 to 5. (iv) A method is provided that includes determining the proportion of cell-free DNA derived from neurons.
[0101] In the embodiment, the method includes comparing the proportion of neuronal cell-free DNA with that of a control. In the embodiment, if the proportion of neuronal cell-free DNA is greater than that of the control, the subject is determined to have mild traumatic brain injury.
[0102] In the embodiments, the subjects are monitored over time. In the embodiments, the method includes repeating steps (ii) to (iv) at least once. In the embodiments, the method includes monitoring the subjects until the percentage of neuron-derived cell-free DNA falls below the control level.
[0103] In the embodiment, a percentage of neuronal cell-free DNA below the control level indicates that mild traumatic brain injury (mTBI) has resolved. In the embodiment, the control is the initial percentage of neuronal cell-free DNA in the subject (e.g., from the initial determination step). In the embodiment, a percentage of neuronal cell-free DNA below the control level indicates that the subject's brain has recovered from mild traumatic brain injury (mTBI). In the embodiment, a percentage of neuronal cell-free DNA below the control level indicates a reduction in brain swelling.
[0104] In the embodiment, steps (ii) to (iv) are repeated daily. In the embodiment, steps (ii) to (iv) are repeated every two days. In the embodiment, steps (ii) to (iv) are repeated every three days. In the embodiment, steps (ii) to (iv) are repeated every four days. In the embodiment, steps (ii) to (iv) are repeated every five days. In the embodiment, steps (ii) to (iv) are repeated every six days. In the embodiment, steps (ii) to (iv) are repeated weekly. In the embodiment, steps (ii) to (iv) are repeated every two weeks. In the embodiment, steps (ii) to (iv) are repeated at least once a week. In the embodiment, steps (ii) to (iv) are repeated at least twice a week. In the embodiment, steps (ii) to (iv) are repeated at least three times a week. In the embodiment, steps (ii) to (iv) are repeated at least four times a week. In the embodiment, steps (ii) to (iv) are repeated at least five times a week. In this embodiment, steps (ii) to (iv) are repeated at least six times a week.
[0105] Additional methods The methods, compositions, and kits described herein may be used to monitor the efficacy of a therapeutic agent or a potential therapeutic agent. For example, the efficacy of a potential therapeutic agent may be monitored during a clinical trial. In another example, the efficacy of a therapeutic agent may be monitored in a subject.
[0106] Currently, there are over 176 drugs in clinical trials for neurodegenerative diseases. While not theoretically bound, monitoring drug efficacy by monitoring current neuronal DNA levels in the blood could potentially significantly accelerate clinical trials. The test may be performed regularly (e.g., weekly or monthly) to evaluate the drug's efficacy in reducing neuronal DNA levels in the blood over time.
[0107] In some aspects, the Disclosure relates to a method for determining the effectiveness of a potential treatment for a neurodegenerative disease or condition, the method being: (i) Obtaining cell-free DNA from blood samples from multiple subjects, wherein the subjects have been administered the potential treatment, (ii) Analyzing the methylation pattern of a DNA region from the cell-free DNA, wherein the region is selected from the regions listed in Tables 2 to 5. (iii) Determine the percentage of cell-free DNA derived from neurons for each subject, (iv) Comparing the proportion of neuronal cell-free DNA for each subject to the control, This invention relates to a method in which a potential treatment is effective when the proportion of neuronal cell-free DNA is smaller than that of the control.
[0108] In the embodiment, the average percentage of neuronal cell-free DNA is determined by averaging the percentage of neuronal cell-free DNA for each subject. In the embodiment, the average percentage of neuronal cell-free DNA is compared to a control. In the embodiment, a potential treatment is effective if the average percentage of neuronal cell-free DNA is lower than that of the control.
[0109] In some aspects, the Disclosure relates to a method for determining the effectiveness of treatment for a neurodegenerative disease or condition, the method being: (i) Obtain cell-free DNA from blood samples from subjects who have been administered the treatment, (ii) Analyzing the methylation pattern of a DNA region from the cell-free DNA, wherein the region is selected from the regions listed in Tables 2 to 5. (iii) Determine the proportion of cell-free DNA derived from neurons, (iv) Comparing the proportion of neuronal cell-free DNA with a control, The treatment is effective when the proportion of neuronal-derived cell-free DNA is lower than that of the control group.
[0110] In the embodiment, steps (ii) to (iv) are repeated daily. In the embodiment, steps (ii) to (iv) are repeated every two days. In the embodiment, steps (ii) to (iv) are repeated every three days. In the embodiment, steps (ii) to (iv) are repeated every four days. In the embodiment, steps (ii) to (iv) are repeated every five days. In the embodiment, steps (ii) to (iv) are repeated every six days. In the embodiment, steps (ii) to (iv) are repeated weekly. In the embodiment, steps (ii) to (iv) are repeated every two weeks. In the embodiment, steps (ii) to (iv) are repeated at least once a week. In the embodiment, steps (ii) to (iv) are repeated at least twice a week. In the embodiment, steps (ii) to (iv) are repeated at least three times a week. In the embodiment, steps (ii) to (iv) are repeated at least four times a week. In the embodiment, steps (ii) to (iv) are repeated at least five times a week. In the embodiment, steps (ii) to (iv) are repeated at least six times a week. In the embodiment, steps (ii) to (iv) are repeated at least once a month. In the embodiment, steps (ii) to (iv) are repeated at least twice a month. In the embodiment, steps (ii) to (iv) are repeated at least three times a month. In the embodiment, steps (ii) to (iv) are repeated at least four times a month. In the embodiment, steps (ii) to (iv) are repeated at least five times a month. In the embodiment, steps (ii) to (iv) are repeated at least six times a month. In the embodiment, steps (ii) to (iv) are repeated at least seven times a month. In the embodiment, steps (ii) to (iv) are repeated at least eight times a month.
[0111] In embodiments, potential treatments include recombinant iduronate 2-sulfatase (IDS) protein, leucine-rich repeat kinase 2 (LRRK2) inhibitor, recombinant progranulin (PGRN) protein, recombinant N-sulfoglucosamine sulfohydrolase (SGSH) protein, recombinant α-L-iduronidase (IDUA) protein, receptor-interacting serine / threonine kinase 1 (RIPK1) inhibitor, or eukaryotic translation initiation factor 2B (eIF2B) activator. In embodiments, potential treatments include recombinant iduronate 2-sulfatase (IDS) protein. In embodiments, potential treatments include leucine-rich repeat kinase 2 (LRRK2) inhibitors. In embodiments, potential treatments include recombinant progranulin (PGRN) protein. In embodiments, potential treatments include recombinant N-sulfoglucosamine sulfohydrolase (SGSH) protein. In embodiments, potential treatments include recombinant α-L-iduronidase (IDUA) recombinant protein. In some embodiments, the potential treatment includes a receptor-interacting serine / threonine kinase 1 (RIPK1) inhibitor. In some embodiments, the potential treatment includes a eukaryotic translation initiation factor 2B (eIF2B) activator.
[0112] In the embodiment, the potential treatment includes DNL310(ETV:IDS), BIIB122 / DNL151, TAK-594 / DNL593, DNL126(ETV:SGSH), DNL622(ETV:IDUA), SAR443820 / DNL788, DNL343, or SAR443122 / DNL758. In the embodiment, the potential treatment includes DNL310(ETV:IDS). In the embodiment, the potential treatment includes BIIB122 / DNL151. In the embodiment, the potential treatment includes TAK-594 / DNL593. In the embodiment, the potential treatment includes DNL126(ETV:SGSH). In the embodiment, the potential treatment includes DNL622(ETV:IDUA). In the embodiment, the potential treatment includes SAR443820 / DNL788. In the embodiment, the potential treatment includes DNL343. In the embodiment, the potential treatment includes SAR443122 / DNL758.
[0113] The methods, compositions, and kits described herein may be used to validate healthy control samples. Many institutions and companies purchase control samples from tissue banks for research or clinical trials. Statistically, one in nine of these controls has an undetected presymptomatic neurodegenerative disease. Control samples can be tested for presymptomatic diseases to confirm that they are indeed healthy controls.
[0114] In one aspect, the present disclosure relates to a method for verifying a control sample, the method being (i) Obtain cell-free DNA from a control sample or from the subject from which the control sample was collected, (ii) Analyzing the methylation pattern of a DNA region from the cell-free DNA, wherein the region is selected from the regions listed in Tables 2 to 5. (iii) A method comprising determining the proportion of cell-free DNA derived from neurons.
[0115] In the embodiment, the method further includes comparing the proportion of neuronal cell-free DNA with that of a control. In the embodiment, the control sample is validated if the proportion of neuronal cell-free DNA is lower than that of the control.
[0116] The control may be any suitable control. In the embodiment, the control is the percentage of neuronal cell-free DNA in blood samples from an untreated (or placebo-treated) subject or multiple subjects. In the embodiment, the control is the percentage of neuronal cell-free DNA in blood samples from a healthy subject or multiple healthy subjects. In the embodiment, the control is a blood sample from a subject(s) before treatment. In the embodiment, the control is a threshold. In the embodiment, the threshold is that the percentage of neuronal cell-free DNA is greater than approximately 3%. In the embodiment, the threshold is that the percentage of neuronal cell-free DNA is greater than approximately 4%. In the embodiment, the threshold is that the percentage of neuronal cell-free DNA is greater than approximately 5%. In the embodiment, the threshold is that the percentage of neuronal cell-free DNA is greater than approximately 6%. In the embodiment, the threshold is that the percentage of neuronal cell-free DNA is greater than approximately 7%. In the embodiment, the threshold is that the percentage of neuronal cell-free DNA is greater than approximately 8%. In the embodiment, the threshold is that the percentage of neuronal cell-free DNA is greater than approximately 9%. In the embodiment, the threshold is that the proportion of cell-free DNA derived from neurons is greater than approximately 10%. In the embodiment, the threshold is that the proportion of cell-free DNA derived from neurons is greater than approximately 11%. In the embodiment, the threshold is that the proportion of cell-free DNA derived from neurons is greater than approximately 12%. In the embodiment, the threshold is that the proportion of cell-free DNA derived from neurons is greater than approximately 13%. In the embodiment, the threshold is that the proportion of cell-free DNA derived from neurons is greater than approximately 14%. In the embodiment, the threshold is that the proportion of cell-free DNA derived from neurons is greater than approximately 15%. In the embodiment, the threshold is that the proportion of cell-free DNA derived from neurons is greater than approximately 20%.
[0117] Parkinson's disease In embodiments, the methods described herein may be used to determine whether a subject has Parkinson's disease. In embodiments, the methods described herein may be used to determine whether a subject is at risk of Parkinson's disease. In embodiments, the methods described herein may be used to monitor the effectiveness of treatment or potential treatment for Parkinson's disease.
[0118] Parkinson's disease (PD) is one of the most common chronic progressive neurodegenerative diseases in older adults. Globally, the incidence of PD is reported to be 1-2% of individuals over 65 years of age. The disease also affects many younger people. Patients with Parkinson's disease suffer from motor impairments such as bradykinesia, resting tremor, muscle rigidity, postural disturbances, and gait disturbances (including freezing of gait (FOG) and frequent falls). In addition to motor impairments, patients often present with non-motor impairments such as cognitive impairment, sleep disturbances, and depression. The most prominent signs and symptoms of Parkinson's disease occur when nerve cells are damaged and / or die in the basal ganglia, the brain region that controls movement. The motor symptoms of Parkinson's disease (PD) are caused by the death of dopaminergic neurons in the substantia nigra pars compacta (SNc).
[0119] Currently, levodopa (e.g., INBRIJA) is the primary treatment for Parkinson's disease. Levodopa can be administered in combination with carbidopa (e.g., SINEMET, SINEMET-CR, PARCOPA, RYTARY), which can prevent or reduce some of the side effects of levodopa therapy (e.g., nausea, vomiting, hypotension, and restlessness), and further reduce the amount of levodopa needed to improve symptoms. Other therapeutic agents that may be prescribed to treat the symptoms of Parkinson's disease include: dopamine agonists (e.g., pramipexole (Mirapex, MIRAPEX)). ER), rotigotine (NEUPRO, ELDEPRYL), apomorphine (Apokyn, KYNMOBI), ropinirole (REQUIP), pyribezil, bromocriptine, abergoline, rislid, pergolide); enzyme inhibitors to increase dopamine levels by reducing the action of enzymes that break down dopamine in the brain (e.g., MAO-B inhibitors (e.g., selegiline (ZELAPAR), rasagiline (AZILECT), safinamide (Xadago)); COMT inhibitors (e.g., E Other concomitant treatments include entacapone (Comtan), opicapon (Ongentys), tolcapone (TASMAR); amantadine (SYMMETREL, GOCOVRI, OSMOLEX) to reduce involuntary movements; anticholinergics (e.g., benztropine (COGENTIN), trihexyphenidyl (ARTANE)) to reduce tremors and muscle rigidity; adenosine receptor antagonists (A2A receptor antagonists) (e.g., istradefylline (NOURIANZ)); and pimavanserin (NUPLAZID). Other concomitant treatments include carbidopa-levodopa-entacapone (DUOPA, STALEVO).
[0120] In the embodiment, the proportion of cell-free DNA derived from Parkinson's disease-affected neurons is determined. In the embodiment, Parkinson's disease-affected neurons include dopaminergic neurons. In the embodiment, the entire amplicon is prepared using one or more primers targeting a region selected from the regions listed in Table 4.
[0121] In the embodiments, one or more therapeutic agents are administered to subjects with increased neuronal cell-free DNA for the treatment of Parkinson's disease. In the embodiments, the subjects are administered levodopa. In the embodiments, the subjects are administered carbidopa. In the embodiments, the subjects are administered a dopamine agonist. In the embodiments, the subjects are administered pramipexole. In the embodiments, the subjects are administered rotigotine. In the embodiments, the subjects are administered apomorphine. In the embodiments, the subjects are administered ropinirole. In the embodiments, the subjects are administered pyribezil. In the embodiments, the subjects are administered bromocriptine. In the embodiments, the subjects are administered abergoline. In the embodiments, the subjects are administered lislide. In the embodiments, the subjects are administered pergolide. In the embodiments, the subjects are administered an enzyme inhibitor. In the embodiments, the subjects are administered an MAO-B inhibitor. In the embodiments, the subjects are administered selegiline. In the embodiments, the subjects are administered rasagiline. In the embodiment, the subject is administered safinamide. In the embodiment, the subject is administered an OMT inhibitor. In the embodiment, the subject is administered entacapone. In the embodiment, the subject is administered opicapone. In the embodiment, the subject is administered tolcapone. In the embodiment, the subject is administered amantadine. In the embodiment, the subject is administered an anticholinergic drug. In the embodiment, the subject is administered benztropine. In the embodiment, the subject is administered trihexyphenidyl. In the embodiment, the subject is administered an adenosine receptor antagonist (A2A receptor antagonist). In the embodiment, the subject is administered istradefylline. In the embodiment, the subject is administered pimavanserin. In the embodiment, the subject is administered carbidopa and levodopa. In the embodiment, the subject is administered carbidopa, levodopa and entacapone. In the embodiment, one or more drugs are explicitly excluded.
[0122] Alzheimer's disease In embodiments, the method described herein may be used to determine whether a subject has Alzheimer's disease. In embodiments, the method described herein may be used to determine whether a subject is at risk of Alzheimer's disease. In embodiments, the method described herein may be used to monitor the effectiveness of treatment or potential treatment for Alzheimer's disease.
[0123] Alzheimer's disease is a chronic neurodegenerative disease that destroys brain cells and causes a decline in brain function over time. Common symptoms of Alzheimer's disease include memory loss, speech disorders, and impulsive or unpredictable behavior. The main features of the disease are the presence of plaques and neurofibrillary tangles in the brain, as well as the loss of connections between neurons in the brain. Alzheimer's disease accounts for approximately 60-80% of dementia cases in the United States.
[0124] Although there is no known cure for Alzheimer's disease, various medications can be prescribed to reduce or slow the progression of cognitive symptoms. For this purpose, several cholinesterase inhibitors, including donepezil (Aricept), galantamine (RAZADYNE), and rivastigmine (EXELON), have been approved by the FDA. Other treatments include memantine (NAMENDA), aducanumab, and lecanemab (lecanemab-irmb; LEQEMBI).
[0125] In the embodiment, the proportion of cell-free DNA derived from neurons affected by Alzheimer's disease is determined. In the embodiment, neurons affected by Alzheimer's disease include cortico-glutamatergic neurons. In the embodiment, the entire amplicon is prepared using one or more primers targeting a region selected from the regions listed in Table 1 or 2.
[0126] In one embodiment, the subject is administered a cholinesterase inhibitor. In another embodiment, the subject is administered donepezil. In another embodiment, the subject is administered galantamine. In another embodiment, the subject is administered rivastigmine. In another embodiment, the subject is administered memantine. In another embodiment, the subject is administered aducanumab. In another embodiment, the subject is administered recanemab.
[0127] Additional therapeutic agents for the treatment of Alzheimer's disease are in clinical trials. These include, but are not limited to: aducanumab; AGB101 (low-dose levetiracetam); atuzaginstat (COR388); AVP-786; AXS-05; brarcamecin (ANAVEX2-73); BPDO-1603; brexpiprazole; caffeine; donanemab; donanemab and aducanumab; donepezil; escitalopram; gantenerumab; gantenerumab and solanezumab; Guanfacine; GV-971; Hydralazine; Icosapent ethyl (IPE); Losartan, amlodipine and atorvastatin; Metformin; Nabilon; NE3107; Nilotinib BE; Octohydroaminoacridine succinate; Omega-3 (DHA + EPA); Semaglutide; Symfilam (PTI-125); Solanezumab; Tricaprylin; TRx0237; Valyltramiprosate (ALZ-801). These include, but are not limited to, the following: ABvac40; ACI-35; AD-35; AL002; Allopregnanolone; APH-1105; Baricitinib; Bepranemab; BCG vaccine; BPN14770; Bromocriptine; Briostatin 1; BXCL-501; Canakinumab; CORT108297; Crenezumab; CST-2032; Curcumin; CY6463; DAOIB; Dapagliflozin; Daratumumab; Dasatinib and quercetin; deferipron; DHA; dronabinol; E2814; ednerpic (T-817MA); elaita (CT1812); ExPlas (exercise plasma); phosgonimeton (ATH-1017); brain shuttle guntenerumab (RO7126209); GB301; grape seed extract; GV1001; nasal insulin; nasal insulin and empagliflozin; IONIS MAPTRx (BIIB080); JNJ-63733657; Lamivudine (3TC); Lenalidomide; Levetiracetam; L-Serine; Lupron (Leuprorelin acetate sustained-release preparation); LY3372689; Memantine; Metabolic cofactor supplementation; MIB-626; Montelukast; MW150; Neframapimod (VX-745); Nicotinamide; Nicotine transdermal patch; Obisetrapib; Omega-3 PUFA; Pepinemab (VX15); Posifen; Prazosin; PU-AD;Rapamycin (sirolimus); Salglamostim; Semolinemab (RO7105705); Senicapox; Sobatertide (PMZ-1620); Symphyllam (PTI-125); Suvorexant; T3D-959; TB006; Telmisartan and Perindopril; Tdap vaccine; THC-free CBD oil; Thiethylperazine (TEP); Troriluzole (BHV4157); Rose Cyclovir; Baloglutamstat (PQ912); VGH-AD1; Zanamem; Nourishing Serum Brain Pills; AAV-Htert; ACU193; ASN51; BEY2153; BMS-984923; BDPP (Bioactive Dietary Polyphenol Preparation); Contraloid Acetate; COR588; Dabigatran; Edicotinib (JNJ-40346527); Efavirenz; Emtricitabine; IGC AD1;Lu AF87908;LX1001;LY3372993;MK-1942 and donepezil;NNI-362;REM0046127;Salsalate;SHR-1707;TB006;Telmisartan;Trehalose;Tricapril (AC-1202);Vorinostat;VT301;XPro1595. Additional treatments during the study include: Allogeneic human MSCs;SNK01 (autologous natural killer cells);Allogeneic adipose-derived MSCs - exosomes;CB-AC-02 (placental-derived MSCs);Human umbilical cord blood-derived MSCs (NEUROSTEM);Allogeneic human MSCs;AstroStem (autologous adipose-derived MSCs). In embodiments, subjects are administered one or more of the listed agents. In embodiments, one or more agents are explicitly excluded.
[0128] Huntington's disease In embodiments, the methods described herein may be used to monitor disease progression in subjects diagnosed with Huntington's disease. In embodiments, the methods described herein may be used to monitor the effectiveness of treatment or potential treatment for Huntington's disease.
[0129] Huntington's disease is a genetic disorder that causes progressive degeneration of nerve cells in the brain. Huntington's disease typically causes motor impairment, cognitive impairment, and mental disorders.
[0130] Currently, there are no treatments to stop or slow the progression of Huntington's disease. Patients may be prescribed antidepressants (e.g., selective serotonin reuptake inhibitors), antipsychotics, neuroleptics (olanzapine, tetrabenazine, aripiprazole), and exercise therapy to alleviate the effects of symptoms. Experimental treatments include, but are not limited to, valbenazine, deutetrabenazine, bevantrol hydrochloride, pridopidine, tominersen, WVE-003, and ANX-005.
[0131] In the embodiment, the proportion of cell-free DNA derived from neurons affected by Huntington's disease is determined. In the embodiment, neurons affected by Huntington's disease include GABAergic neurons. In the embodiment, the entire amplicon is prepared using one or more primers targeting a region selected from the regions listed in Table 3.
[0132] In the embodiment, the subject is administered an antidepressant. In the embodiment, the subject is administered an antipsychotic. In the embodiment, the subject is administered a neuroleptic. In the embodiment, the subject is administered olanzapine. In the embodiment, the subject is administered tetrabenazine. In the embodiment, the subject is administered aripiprazole. In the embodiment, the subject undergoes exercise therapy. In the embodiment, the subject is administered valbenazine. In the embodiment, the subject is administered deutetrabenazine. In the embodiment, the subject is administered bevantrol hydrochloride. In the embodiment, the subject is administered pridopidine. In the embodiment, the subject is administered tominersen. In the embodiment, the subject is administered WVE-003. In the embodiment, the subject is administered ANX-005.
[0133] Amyotrophic lateral sclerosis (ALS) In embodiments, the methods described herein may be used to determine whether a subject has amyotrophic lateral sclerosis (ALS). In embodiments, the methods described herein may be used to determine whether a subject is at risk of amyotrophic lateral sclerosis (ALS). In embodiments, the methods described herein may be used to monitor the effectiveness of treatment or potential treatment for amyotrophic lateral sclerosis (ALS).
[0134] ALS is a progressive neurological disease that affects nerve cells in the brain and spinal cord, causing loss of control of muscles. In embodiments, ALS affects motor neurons in the brain and spinal motor neurons in the spinal cord. Symptoms may include difficulty walking or performing normal daily activities, stumbling and falling, weakness of the legs, feet or ankles, weakness or clumsiness of the hands, dysarthria or dysphagia, muscle spasms and fasciculations in the arms, shoulders and tongue, inappropriate crying, laughing or yawning, and / or cognitive and behavioral changes.
[0135] Medications approved for the treatment of ALS include riluzole (RILUTEK, EXSERVAN, Tiglutik kit), edaravone (RADICAVA), and sodium phenylbutyrate and taurursodeoxycholic acid (RELYVRIO). Dextromethorphan hydrobromide and quinidine sulfate (NUEDEXTA) may be prescribed for the treatment of pseudobulbar palsy affect (PBA), characterized by frequent, involuntary, and often sudden episodes of crying and / or laughing, which may be exaggerated and / or inconsistent with the person's actual feelings.
[0136] In the embodiment, the proportion of cell-free DNA derived from ALS-affected neurons is determined. In the embodiment, ALS-affected neurons include motor neurons and spinal motor neurons. In the embodiment, the entire amplicon is prepared using one or more primers targeting a region selected from the regions listed in Table 5.
[0137] In one embodiment, the subject is administered riluzole. In another embodiment, the subject is administered edaravone. In yet another embodiment, the subject is administered sodium phenylbutyrate and taurursodeoxycholic acid. In yet another embodiment, the subject is administered dextromethorphan. In yet another embodiment, the subject is administered quinidine sulfate.
[0138] ataxia In embodiments, the method described herein may be used to determine whether a subject has ataxia. In embodiments, the method described herein may be used to determine whether a subject is at risk of ataxia. In embodiments, the method described herein may be used to monitor the effectiveness of treatment for or potential treatment for ataxia.
[0139] Ataxia is a disorder of coordination that can cause unsteady gait, difficulty with fine motor skills, and visual impairment and, in some cases, speech difficulties. Ataxia may be a symptom of other health problems, such as nutritional deficiencies or genetic disorders.
[0140] Multiple sclerosis (MS) In embodiments, the methods described herein may be used to determine whether a subject has multiple sclerosis (MS). In embodiments, the methods described herein may be used to determine whether a subject is at risk of developing multiple sclerosis (MS). In embodiments, the methods described herein may be used to monitor the effectiveness of treatment or potential treatment for multiple sclerosis (MS).
[0141] MS is caused by the immune system attacking the myelin sheath that protects nerve fibers. Ultimately, this disease can lead to permanent damage or deterioration of nerve fibers. Treatments include corticosteroids (e.g., glucocorticoids such as prednisone and methylprednisolone), adrenocorticotropic hormone (ACTH), plasmapheresis, interferon-beta preparations (AVONEX®, REBIF® (interferon-beta-1A), Betaseron®, EXTAVIA® (interferon-beta-1b), PLEGRIDY® (pegylated interferon-beta-1a)), glatiramer acetate (COPAXONE, Glatopa), and monoclonal antibodies (ofatumumab (KESIMPTA)). This includes ARZERRA), rituximab, alemtuzumab (LEMTRADA®), ocrelizumab (OCREVUS), natalizumab (TYSABRI), teriflunomide (AUBAGIO), monomethylfumarate (Bafiertam®), dimethylfumarate (TECFIDERA), dyloxymethylfumarate (VUMERITY), fingolimod (GILENYA), cladribine (MAVENCLAD), siponimod (MAYZENT), ponesimod (PONVORY), ozanimod (ZEPOSIA), and mitoxantrone.
[0142] In this embodiment, the proportion of cell-free DNA derived from neurons affected by MS is determined.
[0143] In the embodiment, the subject is administered a corticosteroid. In the embodiment, the corticosteroid is a glucocorticoid. In the embodiment, the subject is administered prednisone. In the embodiment, the subject is administered methylprednisolone. In the embodiment, the subject is administered ACTH. In the embodiment, the subject undergoes plasma exchange therapy. In the embodiment, the subject is administered an interferon-beta preparation. In the embodiment, the subject is administered interferon-beta-1a. In the embodiment, the subject is administered interferon-beta-1b. In the embodiment, the subject is administered pegylated interferon-beta-1a. In the embodiment, the subject is administered glatiramer acetate. In the embodiment, the subject is administered a monoclonal antibody. In the embodiment, the subject is administered ofatumumab. In the embodiment, the subject is administered rituximab. In the embodiment, the subject is administered alemtuzumab. In the embodiment, the subject is administered ocrelizumab. In the embodiment, the subject is administered natalizumab. In one embodiment, the subject is administered teriflunomide. In another embodiment, the subject is administered monomethyl fumarate. In another embodiment, the subject is administered dimethyl fumarate. In another embodiment, the subject is administered dyroxymethyl fumarate. In another embodiment, the subject is administered fingolimod. In another embodiment, the subject is administered cladribine. In another embodiment, the subject is administered siponimod. In another embodiment, the subject is administered siponimod. In another embodiment, the subject is administered ozanimod. In another embodiment, the subject is administered mitoxantrone.
[0144] Multiple system atrophy (MSA) In embodiments, the methods described herein may be used to determine whether a subject has multiple system atrophy (MSA). In embodiments, the methods described herein may be used to determine whether a subject is at risk of developing multiple system atrophy (MSA). In embodiments, the methods described herein may be used to monitor the effectiveness of treatment or potential treatment for multiple system atrophy (MSA).
[0145] Multiple system atrophy (MSA) is a rare degenerative neurological disorder that affects autonomic nervous system function (e.g., blood pressure) and motor control. MSA has two types, Parkinsonian and cerebellar, depending on the symptoms. Symptoms of the Parkinsonian type may include muscle rigidity, difficulty flexing the limbs, bradykinesia, tremors, fainting of the voice, and problems with balance and posture. Symptoms of the cerebellar type may include ataxia, impaired motor and coordination, dysarthria, visual impairment, dysphagia, and changes in speech.
[0146] There is no known cure for MSA. Symptoms can be managed with medications to raise blood pressure and medications to alleviate Parkinson's disease-like symptoms (see Treatment for Parkinson's disease).
[0147] In this embodiment, the proportion of cell-free DNA derived from affected neurons is determined in the MSA.
[0148] Mild traumatic brain injury and other brain injuries In embodiments, the methods described herein may be used to determine whether a subject has mild traumatic brain injury (mTBI). In embodiments, the methods described herein may be used to determine the severity of mTBI. In embodiments, the methods described herein may be used to monitor a subject's recovery from mTBI. In embodiments, the methods described herein may be used to monitor the effectiveness of treatment or potential treatment for mild traumatic brain injury (mTBI).
[0149] In embodiments, the method described herein may be used to determine whether a subject has brain injury. In embodiments, the method described herein may be used to determine the severity of brain injury. In embodiments, the method described herein may be used to monitor a subject's recovery from brain injury. In embodiments, the method described herein may be used to monitor the effectiveness of treatment or potential treatment for brain injury. In embodiments, brain injury includes brain swelling. In embodiments, a decrease in cfDNA indicates a decrease in brain swelling.
[0150] Mild traumatic brain injury (mTBI) refers to brain trauma, including concussions, which can cause long-term brain damage or impairment. This most often results from direct contact with the head, but can also occur from indirect injuries (e.g., whiplash or violent head shaking). Individuals who have experienced a brain injury once are at higher risk of a second brain injury and are more susceptible to subsequent injuries. Damage from successive mTBIs is recognized as cumulative.
[0151] Long-term damage resulting from mTBI includes cognitive and motor skill impairments such as psychomotor delay, increased variability in performance due to decreased concentration and attention, and general executive dysfunction, as well as sleep disturbances and emotional / behavioral changes. Common examples of the long-term effects of mTBI are seen in soldiers, boxers, football players, and soccer players. There is ample documentation of individuals who begin to manifest cumulative brain damage as loss of one or more cognitive and / or motor skills long after the onset of mTBI.
[0152] In the embodiment, the proportion of cell-free DNA derived from neurons affected by mTBI is determined. In the embodiment, neurons affected by mTBI include glutamatergic neurons, GABAergic neurons, dopaminergic neurons, motor neurons, or spinal motor neurons. In the embodiment, the full-length amplicon is prepared using one or more primers targeting a region selected from the regions listed in Tables 1-5.
[0153] There are no approved treatments for mild traumatic brain injury (e.g., concussion). Generally, patients are prescribed physical and mental rest, and analgesics (e.g., anti-inflammatory analgesics) may also be prescribed. Currently, ghrelin is in clinical trials for the treatment of concussions. In embodiments, the subject is administered analgesics. In embodiments, the subject is administered anti-inflammatory analgesics. In embodiments, the subject is administered ghrelin.
[0154] The examples and embodiments described in this specification are for illustrative purposes only, and various modifications or changes may be suggested to those skilled in the art in light of these, and it is understood that such modifications or changes are within the spirit and scope of this application and the scope of the appended claims. All publications, patents, and patent applications cited in this specification are hereby incorporated by reference in their entirety for all purposes.
Example
[0155] Those skilled in the art will understand that the examples described in this specification are for illustrative purposes only and that the present disclosure is not limited by such examples.
[0156] Example 1: Methylation analysis of cfDNA cfDNA was extracted from the plasma of human patients using the QIAamp MinElute ccfDNA Mini Kit (Catalog number: 55204) with some modifications according to the manufacturer's instructions. Briefly, the magnetic beads were warmed to 37 degrees Celsius before use. The plasma was incubated with proteinase K, magnetic beads, and buffer under shaking for about 20 minutes, and then centrifuged twice at 200×g for 30 seconds each time to remove the supernatant. The beads were resuspended in the elution buffer and incubated at room temperature under shaking for 10 minutes. After removing the supernatant and adding buffer, the mixture was passed through a MinElute column to elute cfDNA from the column.
[0157] Thereafter, cfDNA was subjected to bisulfite conversion (EZ DNA Methylation-Lightning Kit, Zymo Research; Catalog number: 69506) or enzymatic conversion (NEBNext Methyl-Seq Conversion Module, New England Biolabs; Catalog number: D5002) to convert methylated bases.
[0158] Following bisulfite conversion, the region of interest was amplified. In summary, bisulfite-converted cfDNA (2 μl), forward primers, reverse primers, ZymoTaq Premix (25 μl, Zymo Research), and RNAse / DNAse-free water were mixed and reacted by thermal cycling under the following conditions. One cycle consists of 10 minutes at 95°C; Repeat the following for 38 cycles: 30 seconds at 95°C, 40 seconds at 55°C, and 40 seconds at 72°C; One cycle at 72°C for 7 minutes, then incubate at 4°C.
[0159] After amplification, libraries were prepared using the samples and then sequenced (Nanopore SQK-NBD114.96 Kit). One modification was made to the protocol: AmpureXP beads were used at a concentration of 1.0X instead of the recommended 0.4X to better target highly fragmented reads. The prepared libraries were then sequenced for 72 hours on a MinION MK1C Nanopore sequencer according to the flow cell loading protocol included with the SQK-NBD114.96 Kit.
[0160] For Alzheimer's disease, amplification of chr3:42190679 and 42191148 was targeted. This region was selected because a significant difference in methylation was observed between purified neurons and plasma. The mean signal in plasma had a methylation beta value of 0.9, while the mean signal in purified neuronal DNA had a methylation beta value of 0.04. These values indicate that the entire neuronal molecule in this region is completely demethylated. Amplification of chr19:3507867~3507868 was also targeted.
[0161] The actual nucleotide sequence of this region is as follows: CTGACGTCACCCTCTAGGCGTCTGGATAGGACGATCCTGGCTACTCCCATTCAGGGCTGCTGTCCAGTGCTGCTTTATTGGCAGTGCTGCCAGGGTCTCCGTTAGCTCTCTGCAAATTGCCTTCCTTTCTGCTCCTCCTACTCCCTCCTTCCCCCATAGAATTTTTCTTTTCATTGCCCACTTTACTGTTTTGGCTCCAGACTGTCGTTAAGAATGTACAGCCTAATTCTGGTGTGTT TCGGGATATTCTTCTGTCCAGTATTCTGGAAGGGCGGGGAGGCATGGCAGCGTTTTACTTGACGTTGATGGTGCTGTGAAGTCCATTCTTTCCTCTGCAAGACTACTGACTATGCAGAAATTTATCGAAGCG GATTATTATGAACTAGACTGGTATTATGAAGAATGCTCGGATGGTAATTATGGCCCCTGCAAAACAGAGCCGGGATGTATAGGGGTATTGTCTCCTTCTG (chr3:42190679~42191148) (SEQ ID NO: 1).The sequence of this region after bisulfite conversion is as follows: TTGACGTTATTTTTTAGGCGTTTGGATAGGACGATTTTGGTTATTTTTATTTAGGGTTGTTGTTTAGTGTTGTTTTATTGGTAGTGTTGTTAGGGTTTTCGTTAGTTTTTTGTAAATTGTTTTTTTTTTGTTTTTTTTTTTTTTTTTTATAGAATTTTTTTTTTTTTTTTTTGTTTTTTTTTTTTTTTGTTTTTTTTGGTTTTAGATTGTCGTTAAGAATGTATAGTTTAATTTTGGTGT GTTTCGGGATATTTTTTTGTTTAGTATTTGGAAGGGCGGGGAGGTATGGTAGCGTTTTATTTGACGTTGATGGTGTTGTGAAGTTTATTTTTTTTTTTGTAAGATTATTGATTATGTAGAAATTTATCGAA GCGGATTATTATGAATTAGATTGGTATTATGAAGAATGTTCGGATGGTAATTATGGTTTTGTAAAATAGAGTCGGGATGTATAGGGGTATTGTTTTTTTG (chr3:42190679~42191148) (SEQ ID NO: 2). These were amplified using TTTTATTGTTTTGGTTTTAGATTGT(chr3:42190859~42190884)(SEQ ID NO:3) and GTTGATGGTGTTGTGAAGTTTATTT(chr3:42190979~42191004)(SEQ ID NO:4) as forward primers, and AAATAAACTTCACAACACCATCAAC(chr3:42190859~42190884)(SEQ ID NO:5) and ACAATCTAAAACCAAAACAATAAAA(chr3:42190979~42191004)(SEQ ID NO:6) as reverse primers. The primers for chr19:3507867~3507868 are GGTATTATTTAGGTTTGGTTTT (forward) (SEQ ID NO: 7) and TACCTTTAAATAAATATCTACTCCCTTAAC (reverse) (SEQ ID NO: 8).
[0162] All samples were sequenced on a MinION MK1C instrument using version 14 flow cells. Prior to sequencing, the viability of all flow cell pores was verified to ensure optimal performance. Reads with a quality score of less than 9 were marked as failures, and reads shorter than 200 bp were also excluded from analysis. The ASTQ files obtained from each sample were analyzed using the microseq package in R. To focus on fully amplified molecules and avoid fragmented reads, only reads representing fully amplified molecules were used in subsequent analyses. Bisulfite conversion errors were checked by manually verifying each read for any instances where ¹C was not in the CG context. Reads containing unconverted ¹C outside the CG context were excluded from analysis. Subsequently, whole-molecule analysis was performed for each read from each sample by calculating the average methylation rate of the entire molecule. Based on the methylation level, reads were classified as blood-derived DNA (total molecular methylation rate > 0.75), neuron-derived DNA (total molecular methylation rate = 0), or unknown reads (total molecular methylation rate 0-0.75). The proportion of neuron-derived DNA was calculated for each sample by dividing the number of neuron-derived reads by the total number of reads in the sample.
[0163] Example 2: Results of cfDNA methylation analysis A total of 37,455 differential methylation regions (DMRs) were identified between purified neuronal and plasma samples, demonstrating significant phenotypic differences (p-value ≤ 0.0001). To visualize the distribution of these DMRs, a heatmap was created to highlight the clear contrast between plasma and purified neurons (Figure 1). Further narrowing down the identified DMRs revealed that 957 sites showed an absolute mean difference of 0.6 or greater in methylation beta values (Figures 2A-2B). From this subset, the top 25 target sites were selected, and primers were specifically designed for each site.
[0164] Electrophoretic gels were used to verify the successful amplification of the designed primers. Of the 25 primers tested, seven showed appropriate amplification and were deemed suitable for further analysis (Figure 3A-3G). Subsequently, sequencing was performed at all seven selected sites using aliquots of four plasma and four purified cortical neuron samples.
[0165] Of the sequenced sites, two showed significant differential methylation across the entire molecule between cortical neurons and plasma. Specifically, neuron-derived DNA reads were completely demethylated at all CpG sites, while plasma-derived DNA was almost completely methylated at these CpG sites. These highly differentially methylated sites were identified as the most promising biomarkers and were used for comprehensive analysis of plasma samples in the acquired dataset.
[0166] The results showed that by using a conservative cutoff value of 5% for the percentage of neuronal cell-free DNA (cfDNA) in plasma, patients diagnosed with Alzheimer's disease could be identified with 100% accuracy (Figure 4). In the control group of younger patients, the levels of neuronal cell-free DNA (cfDNA) were low or negligible, indicating the absence of neurodegeneration.
[0167] Notably, all patients initially diagnosed with mild cognitive impairment (MCI) who subsequently progressed to Alzheimer's disease showed elevated levels of neuronal cfDNA (>5% of total cfDNA). Among MCI patients who were not diagnosed with Alzheimer's disease within 5 years, 75% had normal or low levels of neuronal cfDNA, and 25% had elevated levels.
[0168] In the elderly healthy donor group, approximately 90% had normal levels of neuron-derived cfDNA, while approximately 10% had elevated levels. Statistical analysis comparing the two technical replication groups showed no significant difference, confirming the reproducibility and reliability of the experimental procedure.
[0169] This study presents a novel approach to detecting neurodegeneration-related changes in neuronal cell-free DNA (cfDNA) in plasma. By analyzing differential methylation regions (DMRs) between purified cortical neuron samples and plasma samples, a robust biomarker capable of accurately distinguishing between neuronal and non-neuronal cfDNA was identified. The use of cfDNA as a non-invasive biomarker offers several advantages compared to protein-based assays commonly used in the diagnosis of neurodegenerative diseases.
[0170] First, using cfDNA allows for simpler and less invasive sample collection compared to cerebrospinal fluid or tissue biopsy. Since plasma samples are easily obtained, this diagnostic approach is more accessible and less burdensome for patients. Furthermore, cfDNA analysis reflects cumulative changes in various cell types, including neurons, providing a broader representation of molecular changes occurring in the brain.
[0171] In this study, numerous DMRs (37,455) were initially identified between purified neuronal and plasma samples, showing significant phenotypic differences. To enhance the practicality of this diagnostic approach, the selection was further narrowed to 957 sites with significant mean methylation differences. From this subset, the top 25 target sites were selected and validated through primer design and amplification. The successful amplification of 7 out of 25 primers suggests the potential to utilize specific sites as potential biomarkers.
[0172] Example 3: Analysis of cfDNA methylation in Parkinson's disease Differential methylation regions (DMRs) are identified between purified dopaminergic neuron samples and plasma samples. A heatmap is created to visualize the distribution of these DMRs, highlighting the clear contrast between plasma and purified dopaminergic neurons. Top target sites showing an absolute mean difference of 0.6 or greater in methylation beta values are selected, and site-specific primers are designed for each site.
[0173] To verify the successful amplification of the designed primers, an electrophoresis gel is used to determine which primers are amplified appropriately. Among the sequenced sites, those showing significant differential methylation across the molecule between dopaminergic neurons and plasma are selected. These highly differentially methylated sites are identified as the most promising biomarkers and used for comprehensive analysis of plasma samples in the acquired dataset.
[0174] The results show that by using 5% as a conservative cut-off value for the proportion of cell-free DNA (cfDNA) derived from dopaminergic neurons in plasma, patients diagnosed with neurodegenerative diseases such as Parkinson's disease can be identified with 100% accuracy. In contrast, the young control group has low or negligible levels of cell-free DNA (cfDNA) derived from dopaminergic neurons, indicating the absence of neurodegeneration.
[0175] Example 4: Methylation analysis of cfDNA in ALS Differentially methylated regions (DMRs) are identified between purified motor neuron or spinal cord motor neuron samples and plasma samples. To visualize the distribution of these DMRs, a heatmap is created, highlighting a clear contrast between plasma and purified motor neurons. Top target sites showing an absolute mean difference of 0.6 or more in methylation beta values are selected, and primers specific to each site are designed.
[0176] To verify the successful amplification of the designed primers, an electrophoresis gel is used to determine which primers are amplified appropriately. Among the sequenced sites, those showing significant differential methylation across the molecule between motor neurons and plasma are selected. Specifically, DNA reads from motor neurons are completely unmethylated at all CpG sites, while plasma-derived DNA is almost completely methylated at these CpG sites. These highly differentially methylated sites are identified as the most promising biomarkers and used for comprehensive analysis of plasma samples in the acquired dataset.
[0177] The results demonstrate that using a conservative cutoff value of 5% for the percentage of motor neuron-derived cell-free DNA (cfDNA) in plasma allows for 100% accurate identification of patients diagnosed with neurodegenerative diseases, such as ALS. In contrast, the younger control group had low or negligible levels of motor neuron-derived cell-free DNA (cfDNA), indicating the absence of neurodegeneration.
[0178] Example 5: Analysis of cfDNA methylation in cortical glutamatergic neurons Differential methylation regions (DMRs) are identified between purified cortical glutamatergic neuron samples and plasma samples. A heatmap is created to visualize the distribution of these DMRs, highlighting the clear contrast between plasma and purified cortical glutamatergic neurons. Top target sites showing an absolute mean difference of 0.6 or greater in methylation beta values are selected, and site-specific primers are designed for each site.
[0179] To verify the successful amplification of the designed primers, electrophoretic gels are used to determine which primers are amplified appropriately. From the sequenced sites, those showing significant differential methylation across the entire molecule between cortical glutamatergic neurons and plasma are selected. These highly differentially methylated sites are identified as the most promising biomarkers and used for comprehensive analysis of plasma samples in the acquired dataset.
[0180] The results demonstrate that using a conservative cutoff value of 5% for the percentage of cortical glutamatergic neuron-derived cell-free DNA (cfDNA) in plasma allows for 100% accurate identification of patients diagnosed with neurodegenerative diseases, such as Alzheimer's disease and dementia. In contrast, the younger control group had low or negligible levels of cortical glutamatergic neuron-derived cell-free DNA (cfDNA), indicating the absence of neurodegeneration.
[0181] Example 6: Analysis of cfDNA methylation in cortical GABAergic neurons Differential methylation regions (DMRs) are identified between purified cortical GABAergic neuron samples and plasma samples. A heatmap is created to visualize the distribution of these DMRs, highlighting the clear contrast between plasma and purified cortical GABAergic neurons. Top target sites showing an absolute mean difference of 0.6 or greater in methylation beta values are selected, and site-specific primers are designed for each site.
[0182] To verify the successful amplification of the designed primers, electrophoretic gels are used to determine which primers are amplified appropriately. From the sequenced sites, those showing significant differential methylation across the entire molecule between cortical GABAergic neurons and plasma are selected. These highly differentially methylated sites are identified as the most promising biomarkers and used for comprehensive analysis of plasma samples in the acquired dataset.
[0183] The results demonstrate that by using a conservative cutoff value of 5% for the percentage of cortical GABAergic neuron-derived cell-free DNA (cfDNA) in plasma, patients diagnosed with neurodegenerative diseases, such as Huntington's disease, can be identified with 100% accuracy. In contrast, the young control group had low or negligible levels of cortical GABAergic neuron-derived cell-free DNA (cfDNA), indicating the absence of neurodegeneration.
[0184] Example 7: Results of methylation analysis of cfDNA obtained from patients with neurodegenerative diseases Extensive analysis of methylation patterns was performed across 295 patients, including healthy donors and patients diagnosed with Parkinson's disease, ALS, Alzheimer's disease, and mild cognitive impairment. Each patient underwent whole-genome sequencing using Oxford nanopore sequencing to ensure comprehensive coverage of methylation patterns.
[0185] For each patient sample, a dataframe was created containing sequencing reads specific to previously identified differential methylation regions (DMRs) unique to cortical neurons (Figure 6A-6B), dopaminergic neurons (Figure 6C), and spinal motor neurons (Figure 6D). These reads were then categorized as cortical, spinal, dopaminergic, hematologic, or unknown using a machine learning model.
[0186] The classified reads were quantified, and the proportion of each neuronal subtype was calculated. These proportions were then correlated with each disease state. Elevated levels of dopaminergic neuron-derived cfDNA correlated with Parkinson's disease, elevated levels of spinal motor neurons correlated with ALS, and cortical neurons correlated with Alzheimer's disease. These results not only provide a detailed characterization of the neuronal subtype distribution associated with neurodegenerative diseases but also enable the differentiation of disease types with a single blood sample.
Claims
1. A method for treating subjects who have or are at risk of having neurodegenerative diseases, wherein the method is (i) Obtain cell-free DNA from a blood sample from the subject, (ii) Analyzing the methylation pattern of a region of DNA from the cell-free DNA, wherein the region is selected from the regions listed in Tables 2 to 5, (iii) Determine the proportion of cell-free DNA derived from neurons, (iv) Comparing the proportion of cell-free DNA derived from the aforementioned neurons with that of a control, (v) The method comprising administering a therapeutic agent for treating or preventing the neurodegenerative disease when the proportion of cell-free DNA derived from the neuron is greater than that of the control.
2. The method according to claim 1, wherein step (ii) comprises analyzing the methylation pattern of the entire DNA amplicon.
3. The method according to claim 2, wherein the entire amplicon has a length of at least about 50 base pairs (bp).
4. The method according to claim 3, wherein the entire amplicon has a length of about 50 base pairs to about 500 base pairs.
5. The method according to any one of claims 1 to 4, wherein the therapeutic agent is administered when the proportion of cell-free DNA derived from the neurons is greater than approximately 5%.
6. The method according to any one of claims 1 to 4, wherein the therapeutic agent is administered when the proportion of cell-free DNA derived from the neurons is greater than approximately 7%.
7. The method according to any one of claims 1 to 4, wherein the therapeutic agent is administered when the proportion of cell-free DNA derived from the neurons is greater than approximately 9%.
8. A method for treating subjects who have or are at risk of having neurodegenerative diseases, wherein the method is (i) Obtain cell-free DNA from a blood sample from the subject, (ii) Analyzing the methylation pattern of a region of DNA from the cell-free DNA, wherein the region is selected from the regions listed in Tables 2 to 5, (iii) Determine the proportion of cell-free DNA derived from neurons, (iv) The method comprising administering a therapeutic agent for treating or preventing the neurodegenerative disease when the proportion of cell-free DNA derived from the neurons is greater than about 5%.
9. A method for analyzing a target biological sample, wherein the method is: (i) Obtain cell-free DNA from a blood sample from the subject, (ii) Analyzing the methylation pattern of a region of DNA from the cell-free DNA, wherein the region is selected from the regions listed in Tables 2 to 5, (iii) Determine the proportion of cell-free DNA derived from neurons, (iv) The method comprising comparing the proportion of cell-free DNA derived from the neurons with a control.
10. A method for measuring neuronal cell death in a subject, wherein the method is (i) Obtain cell-free DNA from a blood sample from the subject, (ii) Analyzing the methylation pattern of a region of DNA from the cell-free DNA, wherein the region is selected from the regions listed in Tables 2 to 5, (iii) Determine the proportion of cell-free DNA derived from neurons, (iv) The method comprising comparing the proportion of cell-free DNA derived from the neurons with a control.
11. A method for selecting patients to be treated with therapeutic agents for the treatment of neurodegenerative diseases, wherein the method is: (i) Obtain cell-free DNA from a blood sample from the subject, (ii) Analyzing the methylation pattern of a region of DNA from the cell-free DNA, wherein the region is selected from the regions listed in Tables 2 to 5, (iii) Determine the proportion of cell-free DNA derived from neurons, (iv) Comparing the proportion of cell-free DNA derived from the neurons with a control, The method wherein the patient is selected for treatment if the proportion of cell-free DNA derived from the neuron is greater than that of the control.
12. The method according to any one of claims 8 to 11, wherein step (ii) comprises analyzing the methylation pattern of the entire DNA amplicon.
13. The method according to claim 12, wherein the entire amplicon has a length of at least about 50 base pairs (bp).
14. The method according to claim 13, wherein the entire amplicon has a length of about 50 base pairs to about 500 base pairs.
15. The method according to any one of claims 10 to 14, wherein the patient is selected for treatment if the proportion of cell-free DNA derived from the neuron is greater than approximately 5%.
16. The method according to claim 15, wherein the patient is selected for treatment if the proportion of cell-free DNA derived from the neuron is greater than approximately 7%.
17. The method according to claim 15, wherein the patient is selected for treatment if the proportion of cell-free DNA derived from the neuron is greater than approximately 9%.
18. The method according to any one of claims 1 to 17, wherein a higher proportion of cell-free DNA derived from the neurons than the control indicates an increased risk of neurodegenerative disease or traumatic brain injury.
19. A computer product comprising a non-temporary computer-readable medium, wherein the non-temporary computer-readable medium stores a plurality of instructions to be executed when controlling a computer system to analyze a biological sample from a subject to determine the risk of neurodegenerative disease in the subject, wherein the biological sample comprises cell-free DNA, and the instructions are: (i) Identifying a first DNA methylation pattern that occurs in neurons at a frequency exceeding a threshold, wherein the first DNA methylation pattern includes methylation in one or more methylation regions and optionally includes demethylation in one or more unmethylation regions. (i) Analyzing the methylation pattern of a region of DNA from the cell-free DNA, wherein the region is selected from the regions listed in Tables 2 to 5, (iii) Calculate the relative abundance of the one or more methylated regions and optionally the one or more unmethylated regions in the cell-free DNA, (iv) The computer product comprising determining the risk of neurodegenerative disease in the subject by comparing the relative abundance with a control.
20. A method for determining the effectiveness of potential treatments for neurodegenerative diseases, wherein the method is: (i) Obtaining cell-free DNA from blood samples from multiple subjects, wherein the subjects have been administered the potential treatment, and the acquisition of such DNA (ii) Analyzing the methylation pattern of a region of DNA from the cell-free DNA, wherein the region is selected from the regions listed in Tables 2 to 5, (iii) Determine the proportion of cell-free DNA derived from neurons, (iv) Comparing the proportion of cell-free DNA derived from the neurons with a control, The method wherein the potential treatment is effective when the proportion of cell-free DNA derived from the neurons is smaller than that of the control.
21. The method according to claim 20, wherein steps (i) to (iv) are repeated at least once.
22. The method according to claim 21, wherein steps (i) to (iv) are repeated weekly.
23. The method according to any one of claims 20 to 22, wherein the potential treatment comprises recombinant iduronate 2-sulfatase (IDS) protein, leucine-rich repeat kinase 2 (LRRK2) inhibitor, recombinant progranulin (PGRN) protein, recombinant N-sulfoglucosamine sulfohydrolase (SGSH) protein, recombinant α-L-iduronidase (IDUA) protein, receptor-interacting serine / threonine protein kinase 1 (RIPK1) inhibitor, or eukaryotic translation initiation factor 2B (eIF2B) activator.
24. The method according to any one of claims 20 to 23, wherein the potential treatment includes DNL310 (ETV:IDS), BIIB122 / DNL151, TAK-594 / DNL593, DNL126 (ETV:SGSH), DNL622 (ETV:IDUA), SAR443820 / DNL788, DNL343, or SAR443122 / DNL758.
25. The method according to any one of the claims, wherein determining the proportion of cell-free DNA derived from neurons includes comparing the methylation pattern of the cell-free DNA with the DNA methylation pattern of neurons, the DNA methylation pattern of neurons includes methylation in one or more methylation regions and optionally includes demethylation in one or more unmethylation regions.
26. A computer implementation method for analyzing biological samples, wherein the method is: (i) Identifying a first DNA methylation pattern that occurs in neurons at a frequency exceeding a threshold, wherein the first DNA methylation pattern includes methylation in one or more methylation regions and optionally includes demethylation in one or more unmethylation regions. (ii) Analyzing the methylation pattern of a region of DNA from cell-free DNA, wherein the region is selected from the regions listed in Tables 2 to 5, (iii) Calculate the relative abundance of the one or more methylated regions and optionally the one or more unmethylated regions in the cell-free DNA, (iv) The computer implementation method, comprising determining the risk of neurodegenerative disease in a subject by comparing the relative abundance with a control.
27. The method according to any one of claims 20 to 26, wherein step (ii) comprises analyzing the methylation pattern of the entire DNA amplicon.
28. The method according to claim 27, wherein the entire amplicon has a length of at least about 50 base pairs (bp).
29. The method according to claim 28, wherein the entire amplicon has a length of about 50 base pairs to about 500 base pairs.
30. The method according to any one of the above claims, wherein the control is the proportion of neuronal cell-free DNA in a blood sample from an untreated subject, the proportion of neuronal cell-free DNA in a blood sample from the subject before treatment, or a threshold.
31. The method according to claim 30, wherein the threshold is a percentage greater than approximately 5% of the cell-free DNA derived from the neuron.
32. The method according to claim 30, wherein the threshold is a percentage greater than approximately 7% of the neuron-derived cell-free DNA.
33. The method according to claim 30, wherein the threshold is a percentage greater than approximately 9% of the neuron-derived cell-free DNA.
34. The method according to any one of the above claims, wherein the neurodegenerative disease is selected from Huntington's disease, Parkinson's disease, amyotrophic lateral sclerosis (ALS), ataxia, multiple sclerosis, multiple system atrophy, concussion, frontotemporal dementia - granulin, mucopolysaccharidosis type I (MPS I), mucopolysaccharidosis type II (MPS II; Hunter syndrome), or mucopolysaccharidosis type IIIA (MPS IIIA; Sanfilippo syndrome).
35. The method according to any one of the above claims, wherein the neuron is a motor neuron, a spinal motor neuron, a sensory neuron, an interneuron, a dopaminergic neuron, a cholinergic neuron, a GABAergic neuron, a glutamatergic neuron, or a cortical neuron.
36. The method according to any one of the above claims, wherein the neuron originates from the forebrain, midbrain, or hindbrain.
37. The method according to any one of the above claims, wherein the neuron originates from the frontal lobe, temporal lobe, parietal lobe, occipital lobe, cerebellum, or brainstem.
38. The method according to any one of the above claims, wherein analyzing the methylation pattern comprises converting 5-methylcytosine in the cell-free DNA to a different nucleotide.
39. The method according to claim 38, wherein the conversion includes bisulfite conversion or enzymatic conversion.
40. The method according to any one of the above claims, wherein the subject has mild cognitive impairment.
41. The method according to any one of the above claims, wherein the subject is over 45 years of age.
42. The method according to any one of the above claims, comprising selecting a subject who is over 45 years of age.
43. The method according to claim 42, wherein the subject does not have symptoms of the neurodegenerative disease.
44. The method according to any one of the above claims, comprising selecting a subject having mild cognitive impairment.
45. A method for treating a subject with mild traumatic brain injury, wherein the method is: (i) Select subjects at risk of mild traumatic brain injury, (ii) Obtain cell-free DNA from a blood sample from the subject, (iii) Analyzing the methylation pattern of a region of DNA from the cell-free DNA, wherein the region is selected from the regions listed in Tables 2 to 5, (iv) To determine the proportion of cell-free DNA derived from neurons, (v) Comparing the proportion of cell-free DNA derived from the neurons with that of a control, (vi) The method comprising treating the subject for mild traumatic brain injury if the proportion of cell-free DNA derived from the neuron is greater than that of the control.
46. The method according to claim 45, wherein treating the subject includes administering a therapeutic agent for treating one or more symptoms of mild traumatic brain injury.
47. The method according to claim 45 or 46, further comprising repeating steps (ii) to (v) at a point after treatment.
48. The method according to claim 47, wherein the treatment is discontinued if the proportion of cell-free DNA derived from the neurons at the aforementioned time point is less than or equal to the control.
49. The method according to claim 48, wherein the treatment is continued if the proportion of cell-free DNA derived from the neuron at the aforementioned time point is greater than that of the control.
50. A kit comprising a plurality of first oligonucleotides, wherein each of the plurality of first oligonucleotides is hybridizable to a region that is preferentially methylated in a neuron, and the region is selected from the regions listed in Tables 2 to 5.
51. The kit according to claim 50, further comprising a second plurality of oligonucleotides, each of which is hybridizable to a region in a neuron that is preferentially unmethylated.
52. A kit according to claim 50 or 51 for determining the effectiveness of a potential treatment for a neurodegenerative disease or condition.
53. The kit according to claim 52, wherein the neurodegenerative disease or condition is selected from Huntington's disease, Parkinson's disease, amyotrophic lateral sclerosis (ALS), ataxia, multiple sclerosis, multiple system atrophy, concussion, frontotemporal dementia - granulin, mucopolysaccharidosis type I (MPS I), mucopolysaccharidosis type II (MPS II; Hunter syndrome), or mucopolysaccharidosis type IIIA (MPS IIIA; Sanfilippo syndrome).
54. The kit according to any one of claims 50 to 53, wherein the neuron is a motor neuron, a spinal motor neuron, a sensory neuron, an interneuron, a dopaminergic neuron, a cholinergic neuron, a GABAergic neuron, a glutamatergic neuron, or a cortical neuron.
55. The kit according to any one of claims 50 to 54, wherein the neurons are derived from the forebrain, midbrain, or hindbrain.
56. The kit according to any one of claims 50 to 55, wherein the neurons originate from the frontal lobe, temporal lobe, parietal lobe, occipital lobe, cerebellum, or brainstem.
57. The kit according to any one of claims 50 to 56, wherein the potential treatment comprises recombinant iduronate 2-sulfatase (IDS) protein, leucine-rich repeat kinase 2 (LRRK2) inhibitor, recombinant progranulin (PGRN) protein, recombinant N-sulfoglucosamine sulfohydrolase (SGSH) protein, recombinant α-L-iduronidase (IDUA) protein, receptor-interacting serine / threonine protein kinase 1 (RIPK1) inhibitor, or eukaryotic translation initiation factor 2B (eIF2B) activator.
58. The kit according to any one of claims 50 to 57, wherein the potential treatment includes DNL310 (ETV:IDS), BIIB122 / DNL151, TAK-594 / DNL593, DNL126 (ETV:SGSH), DNL622 (ETV:IDUA), SAR443820 / DNL788, DNL343, or SAR443122 / DNL758.
59. A method for detecting cell-free DNA derived from neurons in a blood sample, wherein the method is: (i) Obtaining cell-free DNA from blood samples from human subjects, (ii) detecting whether or not cell-free DNA derived from the neuron is present in the blood sample by methylation analysis, which includes subjecting the cell-free DNA from the blood sample to sequencing of the entire DNA amplicon, The method wherein the entire amplicon is prepared using one or more primers that target a region selected from the regions listed in Tables 2 to 5.
60. The method according to claim 59, wherein the entire amplicon has a length of at least about 50 base pairs (bp).
61. The method according to claim 60, wherein the entire amplicon has a length of about 50 base pairs to about 500 base pairs.
62. A method for determining the methylation state of an amplicon, wherein the method is: (i) Obtaining cell-free DNA from blood samples from human subjects, (ii) Converting 5-methylcytosine in the cell-free DNA to a different nucleotide, thereby producing the converted cell-free DNA, (iii) Amplifying the converted cell-free DNA and thereby producing an amplicon, (iv) including sequencing the amplicon, The method wherein the amplicon is approximately 50 to 500 base pairs in length and is prepared using one or more primers that target a region selected from the regions listed in Tables 2 to 5.