Methods for detecting mycobacteria

JP2026529056APending Publication Date: 2026-08-27ザ ロイヤル ヴェティリナリー カレッジ
View PDF 0 Cites 0 Cited by

Patent Information

Application Number
JP2026501704
Authority / Receiving Office
JP · JP
Patent Type
Applications
Current Assignee / Owner
Priority Date
2023-07-10
Filing Date
2024-07-10
Publication Date
2026-08-27

Smart Images

  • Figure 2026529056000045
    Figure 2026529056000045
  • Figure 2026529056000046
    Figure 2026529056000046
  • Figure 2026529056000047
    Figure 2026529056000047
Patent Text Reader

Abstract

This disclosure relates to a method for detecting the presence or absence of mycobacteria in a sample, and to a method for diagnosing the presence or absence of a mycobacterial infection in a subject. This disclosure also relates to a solvent containing a bacteriophage capable of lysing viable mycobacteria, and to the use of the solvent in the method of this disclosure.
Need to check novelty before this filing date? Find Prior Art

Description

[Technical Field]

[0001] Technical field This disclosure relates to a method for detecting the presence or absence of mycobacteria in a sample, and to a method for diagnosing the presence or absence of a mycobacterial infection in a subject. This disclosure also relates to a solvent containing a bacteriophage capable of lysing viable mycobacteria, and to the use of the solvent in the method of this disclosure.

[0002] Background technology Members of the Mycobacterium genus are responsible for a variety of bacterial infections in humans and animals. For example, tuberculosis (TB) is caused by Mycobacterium tuberculosis complex (MTBC) bacteria. Although the disease is treatable in principle, an estimated 1.4 million people die from TB each year. There is a strong economic impetus for improving disease control, because without significant improvements, a loss of US$983 billion is projected between 2015 and 2030, with the greatest economic losses expected in low- and middle-income countries. Given the scale of this problem, the World Health Organization (WHO) is calling for the development of new and improved diagnostic methods.

[0003] Mycobacterium bovis, a member of the MTBC family, causes bovine tuberculosis (bTB). Bovine tuberculosis is a zoonotic disease that primarily affects the lungs and is a serious problem for agriculture in the United Kingdom (excluding Scotland) and the Republic of Ireland. This chronic disease led to the slaughter of more than 25,000 cattle in England in 2021. It is reported that control measures in England cost taxpayers approximately £70 million and farmers £50 million annually.

[0004] Johne's disease (JD), caused by Mycobacterium avium subsp. paratuberculosis (MAP), is a cause of chronic wasting in infected animals. The disease is prevalent in commercial ruminant herds worldwide. The associated clinical features are estimated to cost dairy farmers up to £26 per cow per year. This is a significant economic concern, given that farmers operate on tight profit margins.

[0005] Effective diagnosis is fundamental to controlling these infections. The welfare and economic importance of TB, bTB, and JD necessitates affordable, sensitive, specific, user-friendly, rapid, robust, instrument-free, and end-user-friendly diagnostics. Diagnostics encompassing these criteria are essential to meeting the goals outlined in the END TB strategy and the roadmap for zoonotic tuberculosis.

[0006] Unfortunately, mycobacteria can be difficult to detect in samples. Therefore, diagnosing mycobacterial infections is challenging. This difficulty may stem from the unique biological characteristics of mycobacteria. Firstly, mycobacteria have thick cell walls, making them difficult to lyse. Failure to lyse hinders access to intracellular molecular biomarkers. Thus, the difficulty in lysis limits the usefulness of diagnostic tests that rely on the detection of intracellular components. Secondly, some mycobacteria grow very slowly. Rapidly growing mycobacteria can form visible colonies on solid media within 7 days, while slow-growing mycobacteria take several weeks to colonize. Since slow-growing mycobacteria are typically the most clinically relevant types, the usefulness of diagnostic tests based on mycobacterial culture is limited. Thirdly, conventional tuberculin skin tests used on cattle are time-consuming and labor-intensive, requiring multiple visits to a given farm and individual. Therefore, improved methods are needed to detect mycobacteria and diagnose mycobacterial infections.

[0007] Summary of Disclosures The present disclosure provides a method for detecting the presence or absence of mycobacteria in a sample, comprising: (a) contacting the sample with a lysing agent comprising one or more bacteriophages each bound to a solid support, wherein if viable mycobacteria are present in the sample, the viable mycobacteria are lysed by the lysing agent and the nucleic acid of the mycobacteria is released; (b) performing an isothermal amplification method for amplifying the nucleic acid of the mycobacteria, thereby obtaining an amplification product; and (c) detecting the presence or absence of the amplification product, wherein the presence of the amplification product indicates the presence of mycobacteria in the sample, and the absence of the amplification product indicates the absence of mycobacteria in the sample.

[0008] The present disclosure also provides - a method for diagnosing the presence or absence of mycobacterial infection in a subject, comprising detecting the presence or absence of mycobacteria in a sample obtained from the subject using the detection method described herein, wherein the presence of mycobacteria in the sample indicates the presence of mycobacterial infection in the subject, and the absence of mycobacteria in the sample indicates the absence of mycobacterial infection in the subject; - a lysing agent capable of lysing viable mycobacteria, comprising two or more different bacteriophage species each bound to a solid support; and - a kit comprising the lysing agent described herein. The present disclosure further provides BRIEF DESCRIPTION OF THE DRAWINGS

[0009] [Figure 1]This figure shows a comparison of LAMP readings. (A) The limit of detection (LOD) of endpoint PCR (top panel, "Endpoint") is compared with the LOD of LAMP using gel electrophoresis (top center panel, "LAMP") and colorimetric detection (bottom center panel, "Colorimetric-LAMP"), and real-time fluorescence detection (bottom panel, "Real-time LAMP") is shown for MAP using IS900 (left), MTBC using IS6110 (center), and Mycobacterium bovine (M. bovis) using RD4 (right). The colorimetric-LAMP images are visualized visually, and the values ​​shown in the images represent hue (○). (B) This is an alternative representation of the data in (A), showing the results of colorimetric detection (bottom center panel, "Colorimetric-LAMP") and real-time fluorescence detection (bottom panel, "Real-time LAMP") in binary format. [Figure 2] This figure shows the effects of DNA sample washing and concentration on qPCR. (A) MAP, (B) Mycobacterium bovine (M. bovis) BCG. Error bars represent the average of three replicates. [Figure 3] This diagram shows the workflow of Actifage®-LAMP. (A) Schematic workflow of Actifage®-LAMP. Three blood processing steps were tested, each with an average time of 1 hour. Next, bacteriophages were added and incubated for 3.5 hours. LAMP lasts for 45 minutes, allowing detection by various methods. Yes / no determination by color change, fluorescence, and lateral flow dipstick is all possible. (B) Molecular mechanism of LAMP. Six primers targeting the Mycobacterium tuberculosis complex (MTBC) gene IS6110 and the Mycobacterium avium subsp. paratuberculosis gene IS900 (not shown). (C) Example of color change (orange to yellow) using SYBR Green 1. (D) Schematic diagram showing the transition from Actifage® (state level 3) to Actifage®-LAMP (regional level 2). [Figure 4]This figure shows the binding of phages to beads. Phage D29 (A), TM4 (B), and D29+TM4 (C) binding are shown. The supernatant was titrated before and after binding to the beads, and again after each subsequent phage-bead washing step. Error bars represent the standard deviation of three iterations. [Figure 5] This figure shows confirmation of phage-bead binding. It shows phage-bead plaques of D29 (A), D29+TM4 (B), and TM4 (C). The arrows indicate the D29 plaque (right) and TM4 plaque (left) selected for PCR. Confirmation PCR (D) lanes are shown: 100bp DNA ladder (far left); D29-positive control (1); D29-negative control (2); D29 plaque with D29 primer (3); TM4 plaque with D29 primer (4); TM4-positive control (5); TM4-negative control (6); TM4 plaque with TM4 primer (7); D29 plaque with TM4 primer (8). [Figure 6] This figure shows the optimization of mycobacteria capture using phage beads. qPCR of residual MAP detected in the supernatant after phage magnetic capture. Capture parameters were modified: (A) mixing direction, (B) capture time, (C) type of phage bound to the beads. Error bars represent the standard deviation of three replicates. [Figure 7] This figure shows the capture efficiency of phage beads. It shows the percentage difference in pfu / ml count of the supernatant before and after phage magnetic capture. Culture media (white bars) or blood (gray bars) supplemented with MAP (top) and Mycobacterium bovine (BCG) (bottom) were captured with phage beads coated with D29 (left), D29+TM4 (center), and TM4 (right). Error bars represent the standard deviation of three replicates. [Figure 8]This figure shows the lysis of whole blood for the detection of mycobacteria. (A) Whole blood, (B) Light microscope image of whole blood diluted 1:1 with ultrapure water after adding Mycobacterium bovine (M. bovis). (C) PhMS-LAMP detection of Mycobacterium bovine (M. bovis) added to whole blood diluted with ultrapure water at the indicated H2O:blood ratio, or whole blood diluted with chaotropic buffer (CM) at the indicated CM:blood ratio. H2O 1:1 (green line, i.e., 4th line from the top at 50 minutes), H2O 1:5 (light blue line, i.e., 6th line from the top at 50 minutes), H2O 1:10 (dark blue line, i.e., 1st line from the top at 50 minutes), CM 1:1 (red line, i.e., 5th line from the top at 50 minutes), CM 1:5 (orange line, i.e., 2nd line from the top at 50 minutes), CM 1:10 (yellow line, i.e., 3rd line from the top at 50 minutes), non-template control (pink line, i.e., last line from the top at 50 minutes). [Figure 9] This figure compares PhMS and Actifage® qPCR. It shows qPCR data obtained from DNA lysates processed using PhMS and Actifage® assays. (A) Mycobacterium bovine (M. bovis); (B) MAP. Error bars represent the standard deviation of three replicates. [Figure 10] This figure shows a comparison of PhMS (TM4 / D29+TM4) and Actifage® qPCR. (A) MAP, TM4; (B) MAP, D29+TM4; (C) Mycobacterium bovine (M. bovis) BCG, TM4; (D) Mycobacterium bovine (M. bovis) BCG, D29+TM4. [Figure 11] This figure shows the effect of removing magnetic separation and adding filtration on the detection time of serially diluted MAP cells. Black circles represent PhMS without the initial magnetic separation and enrichment steps. Black squares represent PhMS with magnetic separation and filtration steps. Black triangles represent the phage-LAMP assay control without filtration or magnetic separation. The experiment was performed in three consecutive trials. Error bars indicate the standard deviation. [Figure 12]This figure shows the detection time of KatG LAMP in DNA extracted from BCG and isoniazid-resistant mutants. The experiment was performed in three replicates. The line represents the average detection time over the three replicates. [Figure 13] This figure shows the detection times for PhMS-LAMP in serially diluted MAP cells in cerebrospinal fluid (CFS). Black squares indicate detection in CSF, and black circles indicate detection in culture medium and lysis buffer. The line shows the average detection time over three replicates. [Figure 14] This figure shows the detection time of PhMS-LAMP in serially diluted MAP cells in sputum. Black squares indicate detection in sputum, and black circles indicate detection in culture medium and lysis buffer. The line shows the average detection time over three replicates. [Figure 15] This figure shows the detection time of PhMS-LAMP in serially diluted MAP cells in urine. Black squares indicate detection in urine, and black circles indicate detection in culture medium and lysis buffer. The line shows the average detection time over three replicates. [Figure 16] This figure shows the detection times for PhMS-LAMP in serially diluted BCG cells in cerebrospinal fluid (CFS). Black squares indicate detection in CSF, and black circles indicate detection in culture medium and lysis buffer. The line shows the average detection time over three replicates. [Figure 17] This figure shows the detection time of PhMS-LAMP in serially diluted BCG cells in sputum. Black squares indicate detection in sputum, and black circles indicate detection in culture medium and lysis buffer. The line shows the average detection time over three replicates. [Figure 18] This figure shows the detection time of PhMS-LAMP in serially diluted BCG cells in urine. Black squares indicate detection in urine, and black circles indicate detection in culture medium and lysis buffer. The line shows the average detection time over three replicates. [Figure 19] This figure shows the LAMP detection times for serially diluted MAP cells using wet master mix (MM) and lyophilized MM. Black circles correspond to wet LAMP MM, and black squares correspond to lyophilized MM. The experiment was performed in three consecutive sets. Error bars indicate the standard deviation. [Figure 20]This figure shows the average number of viable phages detected in beads treated with and without a virucidal agent. The experiment was performed in three consecutive sets. Error bars indicate the standard deviation. [Figure 21] This figure shows the average number of viable BCG cells detected before and after magnetic separation (MS) and after phage lysis (end of assay). The experiment was performed in three consecutive steps. Error bars indicate the standard deviation. Asterisks (*) indicate statistical significance (p<0.05) as assessed by ANOVA. [Figure 22] This figure shows the average number of thermally inactivated BCG cells detected before and after magnetic separation (MS) and after phage lysis (end of assay), in units of plaque-forming units per milliliter (PFU / ml). The experiment was performed in three sequences. Error bars indicate the standard deviation. [Figure 23] This figure shows the average number of viable BCG cells detected in the supernatant before and after magnetic separation (MS) using phage-free beads. The experiment was performed in three consecutive steps. Error bars indicate the standard deviation.

[0010] Explanation of the sequence list Nucleic acid sequence of sequence number 1-IS6110 Nucleic acid sequence of sequence number 2-IS900 Nucleic acid sequence of sequence number 3-IS2404 Nucleic acid sequence of Sequence ID No. 4-RD4 (Rv1506c-Rv1516c of Mycobacterium tuberculosis) Nucleic acid sequence of the F3 primer for sequence number 5-IS6110. Nucleic acid sequence of the B3 primer for sequence number 6-IS6110. Nucleic acid sequence of the FIP primer for sequence number 7-IS6110. Nucleic acid sequence of the BP primer for sequence number 8-IS6110. Nucleic acid sequence of the LF primer for sequence number 9-IS6110. Nucleic acid sequence of the LR primer for sequence number 10-IS6110. Nucleic acid sequence of the F3 primer for sequence number 11-IS900. Nucleic acid sequence of the B3 primer for sequence number 12-IS900. Nucleic acid sequence of the FIP primer for sequence number 13-IS900. Nucleic acid sequence of the BP primer for sequence number 14-IS900. Nucleic acid sequence of the LF primer for sequence number 15-IS900. Nucleic acid sequence of the LR primer for sequence number 16-IS900. Nucleic acid sequence of F3 primer for deletion of sequence number 17-RD4. Nucleic acid sequence of B3 primer for deletion of SEQ ID NO: 18-RD4. Nucleic acid sequence of FIP primer for deletion of SEQ ID NO: 19-RD4. Nucleic acid sequences of BP primers for deletion of SEQ ID NO: 20-RD4. Nucleic acid sequences of LF primers for deletion of SEQ ID NO: 21-RD4. Nucleic acid sequences of LR primers for deletion of SEQ ID NO: 22-RD4. Sequence ID 23 - Nucleic acid sequence of FIP primer for differentiating INH resistance. Nucleic acid sequence of BIP primer for differentiating SEQ ID NO: 24-INH resistance. Nucleic acid sequence of F3 primer for differentiating SEQ ID NO: 25-INH resistance. Nucleic acid sequence of B3 primer for differentiating SEQ ID NO: 26-INH resistance. Sequence ID 27 - Nucleic acid sequence of an FLP primer for differentiating INH resistance. Nucleic acid sequence of BLP primer for differentiating SEQ ID NO: 28-INH resistance. [Modes for carrying out the invention]

[0011] Detailed explanation It should be understood that the various applications of the disclosed methods, products, and uses can be adapted to specific needs in the art. It should also be understood that the terminology used herein is intended solely to describe specific embodiments of this disclosure and is not intended to limit them.

[0012] General definition Unless otherwise defined, technical and scientific terms used herein have the same meanings as those generally understood by those skilled in the art to which this disclosure pertains.

[0013] As used herein and in the appended claims, the singular forms "a," "an," and "the" encompass multiple referents unless the content clearly indicates otherwise. Thus, for example, a reference to "cells" encompasses "multiple cells," a reference to "bacteriophages" encompasses "multiple bacteriophages," a reference to "mycobacterial nucleic acids" encompasses two or more such mycobacterial nucleic acids, and a reference to "clinical diseases" encompasses "multiple clinical diseases."

[0014] Generally, the term "contains" is intended to mean that it includes but is not limited to. For example, the phrase "a solvent capable of lysing viable mycobacteria, containing two or more bacteriophage species, each bound to a solid support" should be interpreted as meaning that the solvent contains two or more bacteriophage species, each bound to a solid support, but the solvent may contain additional components.

[0015] In some aspects of this disclosure, the word “contains” is replaced by the phrase “consisting of.” The term “consisting of” is intended to be restrictive. For example, the phrase “a composition comprising guanidinium thiocyanate” should be understood to mean that the composition contains guanidinium thiocyanate and does not contain any additional components.

[0016] The terms "protein" and "polypeptide" are used interchangeably herein and are intended to refer to polymer chains of amino acids of any length.

[0017] The terms “bacteriophage” and “phage” are used interchangeably herein and are intended to refer to viruses that infect bacteria and replicate within them.

[0018] For the purposes of this disclosure, in order to determine the identity percentage of two sequences (e.g., two polynucleotide sequences), the sequences are aligned for optimal comparison purposes (e.g., a gap can be introduced in the first sequence for optimal alignment with the second sequence). Next, the nucleotide residues at nucleotide positions are compared. If a position in the first sequence is occupied by the same nucleotide residue as the corresponding position in the second sequence, then the nucleotides are identical at that position. The identity percentage between the two sequences is a function of the number of identical positions shared between the sequences (i.e., identity % = number of identical positions / total number of positions in the reference sequence × 100).

[0019] Typically, sequence comparisons are performed against the length of a reference sequence. For example, if a user wants to determine whether a given ("test") sequence has a certain percentage of identity with sequence number X, then sequence number X is the reference sequence. For instance, to evaluate whether a sequence is at least 80% identical to sequence number X (an example of a reference sequence), a person skilled in the art would perform an alignment against the length of sequence number X and identify how many positions in the test sequence are identical to the positions of sequence number X. If at least 80% of these positions are identical, then the test sequence is at least 80% identical to sequence number X. If the sequence is shorter than sequence number X, gaps or missing positions should be considered non-identical positions.

[0020] Those skilled in the art are aware of the various computer programs available for determining homology or identity between two sequences. For example, the comparison of sequences and the determination of the percentage of identity between two sequences can be achieved using mathematical algorithms.

[0021] Method for detecting the presence or absence of mycobacteria This disclosure provides a method for detecting the presence or absence of mycobacteria in a sample. In this method, viable mycobacteria are lysed using a solubilant containing a bacteriophage bound to a solid support, releasing the mycobacterial nucleic acid. The mycobacterial nucleic acid is then amplified using an isothermal amplification method. The presence or absence of mycobacteria in the sample is indicated by detecting the presence or absence of the amplification product. The method of this disclosure offers several advantages over prior art methods for detecting mycobacteria in a sample.

[0022] More specifically, many prior art methods involve amplifying mycobacterial nucleic acids using polymerase chain reaction (PCR). It is known in the art that PCR involves thermal cycling at a temperature that can dissolve mycobacteria, including unviable ones. If unviable mycobacteria remain in a nucleic acid sample on which PCR has been performed (such as a sample obtained by dissolving viable mycobacteria), these unviable mycobacteria are dissolved at the temperature achieved during thermal cycling. In this case, nucleic acids from the unviable bacteria are released into the sample and are available for subsequent amplification by thermal cycling. The amplification product of PCR then contains amplified nucleic acids from the unviable mycobacteria. Therefore, unless unviable mycobacteria are removed from the sample before PCR, it is not possible to determine only the presence or absence of viable mycobacteria using PCR-based methods. This requires an additional step of washing and concentrating the nucleic acids released from viable bacteria before PCR.

[0023] In contrast, the method of this disclosure uses a solubilator designed to selectively lyse viable mycobacteria. Therefore, mycobacterial nucleic acids are released only from viable mycobacteria. Using an isothermal method for amplification of such nucleic acids avoids the thermal lysis of unviable mycobacteria. Thus, the amplification product does not contain amplified nucleic acids from unviable mycobacteria. The amplification product contains only amplified nucleic acids from viable mycobacteria. In this way, the method of this disclosure can be used to determine only the presence or absence of viable mycobacteria without the need to remove unviable mycobacteria from the sample before amplification. No additional steps are required to wash and concentrate nucleic acids released from viable bacteria before amplification. Therefore, this method is simpler and faster to perform than PCR-based methods in the prior art. Furthermore, since the method of this disclosure does not require a special thermal cycler, it can be easily performed in the field. These advantages do not come at the expense of sensitivity or specificity. Therefore, the method of this disclosure can be used for highly sensitive and specific testing suitable for low-income and middle-income countries. Its use may be veterinary / agricultural.

[0024] Accordingly, a method for detecting the presence or absence of mycobacteria in a sample is disclosed herein. This method includes (a) contacting a sample with a solvent containing one or more bacteriophages, each bound to a solid support, such that if viable mycobacteria are present in the sample, the viable mycobacteria are dissolved in the solvent and the nucleic acids of the mycobacteria are released; (b) performing an isothermal amplification method to amplify the nucleic acids of the mycobacteria, thereby obtaining an amplification product; and (c) detecting the presence or absence of the amplification product, wherein the presence of the amplification product indicates the presence of mycobacteria in the sample, and the absence of the amplification product indicates the absence of mycobacteria in the sample.

[0025] Conventional culture-based detection methods are notoriously slow, sometimes taking several days or weeks as described above, whereas the methods of this disclosure may be completed in less than 10 hours. For example, the methods of this disclosure can be completed in less than 9 hours, less than 8 hours, less than 7 hours, less than 6 hours, less than 5 hours, less than 4 hours, or less than 3 hours, and optionally, the methods of this disclosure can be completed in 3 to 8 hours, for example, 4 to 7 hours or 5 to 6 hours. Typically, the methods of this disclosure can be completed in less than 6 hours.

[0026] The method described herein may be used to distinguish between treatment-resistant mycobacteria (i.e., treatment-resistant mycobacteria) and non-treatment-resistant mycobacteria (i.e., non-treatment-resistant mycobacteria) in a sample, the treatment being, in some cases, is a treatment using isoniazid. Isoniazid is an antibiotic used for the treatment of tuberculosis and for the prevention of tuberculosis reactivation. Some mycobacterial strains are resistant to isoniazid. Isoniazid resistance may be driven by mutations in the katG gene, which encodes catalase-peroxidase that converts isoniazid into its active form. Therefore, a method for distinguishing between isoniazid-resistant mycobacteria and non-isoniazid-resistant mycobacteria would be useful in determining the presence or absence of isoniazid-resistant mycobacteria in a sample.

[0027] Mycobacteria Mycobacteria detected by this method include (i) one or more Mycobacterium tuberculosis complex (MTBC) species (e.g., Mycobacterium tuberculosis and / or Mycobacterium bovis), (ii) one or more Mycobacterium avium complex (MAC) species (e.g., Mycobacterium avium subspecies paratuberculosis (MAP)), (iii) Mycobacterium smegmatis, (iv) Mycobacterium ulcerans, and (v) Mycobacterium leprae. (i) leprae; and / or (vi) one or more non-tuberculosis mycobacteria (NTMs) (e.g., Mycobacterium abscessus complex, Mycobacterium kansasii, and / or Mycobacterium marinum).For example、マイコバクテリアは、(i);(ii);(iii);(iV);(V);(Vi);(i)、(ii);(i)、(iii);(i)、(iV);(i)、(V);(i)、(Vi);(ii)、(iii);(ii)、(iV);(ii)、(V); (ii)、(Vi);(iii)、(iV);(iii)、(V);(iii)、(Vi);(iV)、(V);(iV)、(Vi);(V)、(Vi);(i)、(ii)、(iii);(i)、(ii)、(iV);(i)、(ii)、(V);(i)、(ii) )、(Vi);(i)、(iii)、(iV);(i)、(iii)、(V);(i)、(iii)、(Vi);(i)、(iV)、(V);(i)、(iV)、(Vi);(i)、(V)、(Vi);(ii)、(iii)、(iV);(ii)、(iii)、 (V);(ii)、(iii)、(Vi);(ii)、(iV)、(V);(ii)、(iV)、(Vi);(ii)、(V)、(Vi);(iii)、(iV)、(V);(iii)、(iV)、(Vi);(iii)、(V)、(Vi);(iV)、(V)、( Vi);(i)、(ii)、(iii)、(iV);(i)、(ii)、(iii)、(V);(i)、(ii)、(iii)、(Vi);(i)、(ii)、(iV)、(V);(i)、(ii)、(iV)、(Vi);(i)、(ii)、(V)、(Vi); (i)、(iii)、(iV)、(V);(i)、(iii)、(iV)、(Vi);(i)、(iii)、(V)、(Vi);(i)、(iV)、(V)、(Vi);(ii)、(iii)、(iV)、(V);(ii)、(iii)、(iV)、(Vi);(i) i)、(iii)、(V)、(Vi);(ii)、(iV)、(V)、(Vi);(iii)、(iV)、(V)、(Vi);(i)、(ii)、(iii)、(iV)、(V)、(Vi);(i)、(ii)、(iii)、(V)、(Vi);(i)、(ii)、(iV)、(V)、(Vi);(i)、(iii)、(iV)、(V)、(Vi);(ii)、(iii)、(iV)、(V)、(Vi);(ii)、(iii)、(iV)、(V)、(Vi);or (i)、(ii)、(iii)、(iV)、(V)、(Vi)。

[0028] sample This method detects the presence or absence of mycobacteria in a sample. In step (a), the sample is brought into contact with the above-mentioned solvent.

[0029] The sample may be a sample taken from a subject. For example, the sample may be an ex vivo sample. Therefore, this method can be performed ex vivo or in vitro. The sample may be a research sample or a clinical sample, or any other sample not intended for consumption as food.

[0030] The subject can be any subject capable of harboring mycobacteria. For example, the subject can be a human or a non-human animal. Non-human animals are typically mammals. Non-human mammals can be, for example, livestock. Non-human mammals can be ruminants such as cattle, sheep, or goats. Non-human mammals can be wild animals such as badgers or deer. Non-human mammals can be other types of animals such as companion animals (e.g., dogs, cats, horses, rabbits) or laboratory animals (e.g., rodents such as mice, rats, or guinea pigs).

[0031] The sample may be a body fluid sample. For example, the sample may be a blood (e.g., whole blood), milk, cerebrospinal fluid, semen, synovial fluid, amniotic fluid, sputum, saliva, lymph, or urine sample. The sample may be a blood (e.g., whole blood), cerebrospinal fluid, semen, synovial fluid, amniotic fluid, sputum, saliva, lymph, or urine sample. The sample may be a blood (e.g., whole blood), cerebrospinal fluid, sputum, or urine sample. The sample may be a sample from a body fluid sample, such as a blood (e.g., whole blood), milk, cerebrospinal fluid, semen, synovial fluid, amniotic fluid, sputum, saliva, lymph, or urine sample. The sample may be a sample from a blood (e.g., whole blood), cerebrospinal fluid, semen, synovial fluid, amniotic fluid, sputum, saliva, lymph, or urine sample. The sample may be a sample from a blood (e.g., whole blood), cerebrospinal fluid, sputum, or urine sample. In other cases, the sample may be a stool sample or a breath sample. The sample may be a sample from a stool sample or a breath sample. In any case, a sample "from" a particular type of sample may refer to a sample that has been processed in some way after collection and before step (a). Processing may include, for example, purification or isolation of eukaryotic cells contained in the unprocessed sample. Processing may further include concentration of a dilution of the purified or isolated eukaryotic cells. In the case of a viscous sample (e.g., sputum) or a solid sample (e.g., stool), processing may include maceration and / or suspension in a suitable fluid such as physiological saline. For example, conventional methods for detecting mycobacteria from sputum typically involve homogenization by using or vortexing N-acetyl-L-cysteine ​​(NALC). However, we have surprisingly found that mycobacteria can be detected in unhomogenized sputum samples using the method of the present disclosure (see Example 7).

[0032] If a sample is a milk sample or a sample from a milk sample, the milk sample can be obtained from one or more subjects. That is, the milk sample may be an individual milk sample (i.e., a sample obtained from a single individual) or a milk sample collected from multiple individuals. For example, a collected milk sample may be taken from two or more, five or more, ten or more, twenty or more, fifty or more, one hundred or more, one fifty or more, two hundred or more individuals. The milk sample may also be, for example, a bulk milk tank sample. In the context of this disclosure, the term “bulk milk tank sample” refers to a collected milk sample obtained from a container that receives and holds milk produced by multiple animals raised for that milk. The animals may be, for example, dairy cows, dairy goats, or dairy sheep. These animals are usually raised on a single farm for the purpose of producing milk. In any case, the milk may be in a form not intended for direct human consumption. In other words, the milk may not be in a form intended for human consumption without further processing. Further processing may be required to make milk suitable for human consumption, such as reducing the presence of viable pathogens. This further processing may include pasteurization. The milk may not be pasteurized.

[0033] The sample may be, for example, a tissue sample. The sample may be, for example, a fine-needle aspiration, a tissue swab, or a biopsy. In any case, the sample may be taken from a site suspected of containing mycobacteria. The sample may include, for example, lung tissue. The sample may include, for example, intestinal tissue such as tissue from the esophagus, stomach, duodenum, jejunum, ileum, cecum, appendix, colon, rectum, or perianal region. The sample may include, for example, skin. The sample may be, for example, from a tissue sample. A sample "from" a tissue sample may refer to a tissue sample that has been processed in some way after collection and before step (a). Processing may include, for example, maceration of a solid tissue sample and / or suspension of tissue particles in a suitable fluid such as saline.

[0034] Alternatively, the sample may be a food sample. The food sample may be of animal origin. For example, the food sample may include meat, eggs, milk, or other dairy products such as cheese or yogurt. The milk or dairy product may be in a form intended for direct human consumption. In other words, the milk or dairy product may have been processed to improve its suitability for human consumption. Processing may, for example, reduce the presence of viable pathogens in the milk or dairy product. Processing may include, for example, pasteurization. The milk or dairy product may be pasteurized.

[0035] Alternatively, the sample may be an environmental sample. Environmental samples may include domestic water, surface water, river water, domestic water, water treatment plant water, aerosols, soil, or precipitates.

[0036] Process In the methods of this disclosure, step (a) is typically performed before step (b), and step (b) is typically performed before step (c). However, the possibility of combining one or more of these steps is also envisioned. That is, one or more steps may be performed together in a single reaction. For example, steps (a) and (b) may be performed together, and then step (c) may be performed separately. Step (a) may be performed separately before steps (b) and (c) are performed together. Steps (a), (b), and (c) may be performed together.

[0037] The following describes steps (a), (b), and (c) in detail.

[0038] Eukaryotic cell lysis The sample may contain eukaryotic cells. Since mycobacteria are intracellular, they may be present inside eukaryotic cells. Eukaryotic cells in the sample may be infected with mycobacteria. The eukaryotic cells may consist of one or more different cell types. Eukaryotic cells may be mammalian cells such as blood cells, endothelial cells, or epithelial cells. Blood cells may be red blood cells or white blood cells, such as neutrophils, macrophages, or lymphocytes.

[0039] For the solvent in step (a) to access the mycobacteria in the sample, it may be necessary to lyse eukaryotic cells so that the mycobacteria are released. Therefore, this method may include selective lysing of eukaryotic cells present in the sample. Selective lysing of eukaryotic cells may be performed before and / or during step (a).

[0040] In the context of this disclosure, selective lysis of eukaryotic cells may refer to the lysis of eukaryotic cells without the lysis of mycobacteria. If eukaryotic cells are infected with mycobacteria, selective lysis involves lysis of the infected eukaryotic cells without compromising the integrity of the mycobacteria.

[0041] Methods for lysing eukaryotic cells without compromising the integrity of mycobacteria are known in the art. For example, eukaryotic cells can be selectively lysed by contacting the sample with H2O (e.g., ddH2O), a composition containing guanidinium thiocyanate, a composition containing saponins, a composition containing sodium cholate, phosphate-buffered saline (PBS), and / or a mycobacterial growth medium. For example, the sample can be contacted with ddH2O in a 1:1 ratio. If the selective lysis of eukaryotic cells is performed before and / or during step (a), the composition used to lyse the eukaryotic cells can be formulated together with the solvent used to lyse mycobacteria. That is, the solvent may be contained in H2O (e.g., ddH2O), a composition containing guanidinium thiocyanate, a composition containing saponins, a composition containing sodium cholate, phosphate-buffered saline (PBS), or a mycobacterial growth medium.

[0042] Process (a) Step (a) involves contacting the sample with a solvent containing one or more bacteriophages, each bound to a solid support, wherein if viable mycobacteria are present in the sample, the viable mycobacteria are dissolved by the solvent and the mycobacterial nucleic acids are released.

[0043] Contact The sample is contacted with the lysing agent. In the context of step (a), "contact" can be interpreted to mean that the sample and the lysing agent are physically in the same place, for example, within a single reaction vessel. In other words, the sample and the lysing agent may be mixed. The sample and the lysing agent may be incubated together.

[0044] The contact can be carried out for an appropriate period. The appropriate period is a period that enables the lysis of viable mycobacteria and the release of mycobacterial nucleic acids if viable mycobacteria are present in the sample. For example, the contact can be carried out for a period of up to 1 hour, up to 2 hours, up to 3 hours, up to 4 hours, up to 5 hours, or up to 6 hours. The contact may be carried out for, for example, 0.5 hour to 7 hours, such as 1 hour to 6 hours, 2 hours to 5 hours, or 3 hours to 4 hours. For example, the contact may be carried out for a period of about 3.5 hours.

[0045] Lysing agent The lysing agent contains one or more bacteriophages each bound to a solid support. The lysing agent may contain, for example, 2 or more, or 10 or more, or 100 or more, or 1000 or more, or 10,000 or more, or 100,000 or more, or 1,000,000, or 10,000,000 or more, or 100,000,000 or more bacteriophages each bound to a solid support. The bacteriophage may be, for example, 10 0 ~10 10 pfu / ml, such as 10 1 ~10 9 、10 2 ~10 8 、10 3 ~10 7 、or 10 4 ~10 6 pfu / ml and may be present in the lysing agent at a concentration of.

[0046] Each of the bacteriophages is bound to a solid support. In other words, each of the bacteriophages may be attached to the solid support. The attachment may be temporary, or preferably permanent. The purpose of the solid support is to capture mycobacteria bound to the bacteriophages attached to the solid support, and to allow the solid support and the captured mycobacteria to be separated from the sample. Thus, the solvent can capture mycobacteria on the solid support through the interaction between each of the bacteriophages and the mycobacteria. As described in the section on bacteriophages below, the mycobacteria may be viable mycobacteria. The interaction may involve the bacteriophage binding to the mycobacteria or viable mycobacteria. In particular, the bacteriophage may bind to the surface of mycobacterial cells or viable mycobacterial cells.

[0047] Bacteriophages and solid supports will be described in detail below.

[0048] Bacteriophage One or more bacteriophages may contain two or more different bacteriophage species. In other words, one or more bacteriophages may contain two or more individual bacteriophages, each belonging to a different bacteriophage species. For example, one or more bacteriophages may contain three or more, four or more, five or more, six or more, seven or more, eight or more, nine or more, or ten or more different bacteriophage species. In other words, one or more bacteriophages may contain three or more, four or more, five or more, six or more, seven or more, eight or more, nine or more, or ten or more individual bacteriophages, each belonging to a different bacteriophage species. One or more bacteriophages may include, for example, different bacteriophage species such as 1-10, 2-9, 3-8, 4-7, 1-5, 1-6, 5-10, or 6-10. In other words, one or more bacteriophages may include individual bacteriophages such as 1-10, 2-9, 3-8, 4-7, 1-5, 1-6, 5-10, or 6-10, each belonging to a different bacteriophage species. In one embodiment described herein, one or more bacteriophages include two different bacteriophage species (i.e., two individual bacteriophages, each belonging to a different bacteriophage species).

[0049] One or more bacteriophages may have the ability to lyse mycobacteria. For example, one or more bacteriophages may have the ability to lyse viable mycobacteria or to selectively lyse mycobacteria. Each of the one or more bacteriophages may have the ability to lyse mycobacteria. For example, each of the one or more bacteriophages may have the ability to lyse viable mycobacteria or to selectively lyse viable mycobacteria. In this regard, "selectively lyse viable mycobacteria" may be interpreted as lyse viable mycobacteria without lyse inviolable mycobacteria, or lyse viable mycobacteria preferentially over lyse inviolable mycobacteria. Bacteriophages capable of selectively lysing viable mycobacteria can effectively lyse viable mycobacteria at more than twice the rate of inviolable mycobacteria (e.g., more than 5 times, 10 times, 20 times, 50 times, or 100 times more). Inviolable mycobacteria can be considered to be mycobacteria that are unable to grow or mycobacteria that have died.

[0050] For mycobacteria to be lysed, bacteriophages must be able to bind to mycobacteria. Therefore, one or more bacteriophages may have the ability to bind to mycobacteria. Each of the one or more bacteriophages may have the ability to bind to mycobacteria. In other words, one or more bacteriophages may have the ability to adhere to the surface of mycobacterial cells, or each may have the ability to adhere. Typically, bacteriophages bind only to viable hosts. Therefore, one or more bacteriophages may have the ability to selectively bind to viable mycobacteria (i.e., bind to viable mycobacteria but not to unviable ones), or each may have this ability. A given bacteriophage may have the ability to bind to one or more species of mycobacteria. For example, a given bacteriophage may have the ability to bind to two or more, three or more, four or more, five or more, six or more, seven or more, eight or more, nine or more, or ten or more mycobacterial species.

[0051] The ability of bacteriophages to lyse mycobacteria may be related, for example, to the ability of bacteriophages to infect and / or replicate in mycobacteria. For example, lysation may be a result of successful infection of mycobacteria by a bacteriophage. Lysation may also be a result of successful bacteriophage replication in mycobacteria. Successful infection and / or replication may only be possible in viable mycobacteria.

[0052] Therefore, one or more bacteriophages may include bacteriophage species that can infect and / or replicate in mycobacteria. That is, one or more bacteriophages may include bacteriophage species that (i) can infect mycobacteria, (ii) can replicate in mycobacteria, or (iii) can infect and replicate in mycobacteria. A bacteriophage species may have the ability to infect and / or replicate in one mycobacterial species. A bacteriophage species may have the ability to infect and / or replicate in two or more mycobacterial species. A bacteriophage species may have the ability to infect and / or replicate in a wide range of mycobacterial species, such as three or more, four or more, five or more, six or more, seven or more, eight or more, nine or more, or ten or more mycobacterial species. By using bacteriophage species that can infect and / or replicate in two or more different mycobacterial species, the presence or absence of two or more different mycobacterial species can be detected simultaneously.

[0053] One or more bacteriophages may comprise two or more bacteriophage species, each capable of replicating in at least one mycobacterial species. The use of such combinations of bacteriophage species provides an alternative means for simultaneously detecting the presence or absence of two or more different mycobacterial species.

[0054] One or more bacteriophages may include bacteriophage species that are unable to infect and / or replicate in non-mycobacterial cells.

[0055] Bacteriophage species capable of lysing mycobacteria (e.g., lysing viable mycobacteria, or selectively lysing viable mycobacteria) are known in the art. One or more bacteriophages may include any such bacteriophage species. Furthermore, suitable bacteriophage species can be identified by phage hunting. Phage hunting is a mechanism for identifying bacteriophage species with one or more desired characteristics from bacteriophages abundant in the environment. An exemplary protocol for hunting bacteriophage species capable of lysing mycobacteria is as follows. - Samples collected from soil, water, mud, or cattle feces were placed in sterile 15 ml centrifuge tubes. Transfer approximately 10 g or 10 ml of the solution to a sterile 50 ml centrifuge tube containing 40 ml of 7H9 medium supplemented with OADC (10%) and CaCl2 (2 mM). - Actively proliferating M. smegmatis (approximately 105 cfu / ml) -1 Add ) to the mixture and mix. - Incubate overnight at 37°C while shaking. Centrifuge at -1000 × g for 10 minutes. - Sterilize the supernatant with a filter (0.45 μm) and transfer it to a clean 50 ml centrifuge tube. -Melted 7H10 agar medium (1:1) and 1 ml of M. smegmatis (10 8 cfu.ml -1 The sample is plated using [a specific method / tool]. Allow to stand and solidify, then incubate at 37°C for up to 48 hours. Select plaques and place them in fresh 7H9 medium supplemented with OADC (10%) and CaCl2 (2 mM) to obtain a stock of bacteriophages.

[0056] One or more bacteriophages may include bacteriophage species isolated according to this exemplary protocol.

[0057] One or more bacteriophages may contain, for example, one or more of D29 (accession number: AF022214) and TM4 (accession number: AF068845). One or more bacteriophages may contain D29. One or more bacteriophages may contain TM4. One or more bacteriophages may contain D29 and TM4. D29 and TM4 are thought to bind to different sites on the surface of mycobacterial cells. As shown in the example, solubilants containing both D29 and TM4 were improved compared to solubilants containing only D29 or only TM4.

[0058] Alternatively or additionally, one or more bacteriophages may include, for example, one or more of (i) B1, (ii) Bxz2 (accession number AY129332), (iii) L5 (accession number Z18946), and (iv) PG2. For example, one or more bacteriophages may include (i); (ii); (iii); (iv); (i) and (ii); (i) and (iii); (i) and (iv); (ii) and (iii); (ii) and (iv); (iii) and (iv); (i), (ii) and (iii); (i), (ii) and (iv); (ii), (iii) and (iv); or (i), (ii), (iii) and (iv) instead of or in addition to D29 and / or TM4. B1, Bxz2, L5, and PG2 are understood to have similar properties to D29 and TM4.

[0059] solid support Each of the one or more bacteriophages contained in the solvent binds to a solid support. As described above, the purpose of the solid support is to capture mycobacteria bound to the attached bacteriophage. As will be described in more detail below, the solid support and the captured mycobacteria can then be separated from the sample. In other words, the solid support allows for the separation of mycobacteria (e.g., viable mycobacteria) from the sample. Thus, a complex containing bacteriophages, a solid support, and mycobacteria can be formed.

[0060] Therefore, the solid support can be any solid part that can be separated from the sample. Separation can be achieved, for example, based on the physical or chemical properties of the solid support.

[0061] The solid support may be, for example, beads. The beads may be, for example, magnetic beads or paramagnetic beads. In this case, a magnetic field may be applied to the sample to separate the solid support and the bound bacteriophage from the sample. Thus, separation may be achieved by or include the application of a magnetic field. Separation may be achieved by or include magnetic separation. Separation based on magnetic beads (or paramagnetic beads) is known in the art.

[0062] The beads may be, for example, non-magnetic beads. In this case, separation can be achieved by non-magnetic means. For example, the beads may be labeled with a binding molecule. Separation can be achieved by bringing the binding molecule into contact with the corresponding binding partner. The binding partner may be immobilized on a second solid support, such as a column, so that the mycobacteria bound to the beads are retained in the column and other components of the sample are eluted. The binding molecule may include, for example, biotin and the binding partner streptavidin. The binding molecule may include, for example, an antibody or antibody fragment and its corresponding ligand, which is the binding partner.

[0063] Alternatively, the separation of non-magnetic beads may be based on size. For example, when a sample is brought into contact with a filter, the beads and bound mycobacteria are retained in the filter, while other components of the sample pass through. Thus, separation can be achieved by filtration, or may include filtration.

[0064] Alternatively, the separation of non-magnetic beads may be based on mass. When the sample is centrifuged, the beads and bound mycobacteria will precipitate, but the other components of the sample will remain in the supernatant, which can be discarded.

[0065] In any case, the beads may have diameters up to 10 nm, 20 nm, 30 nm, 40 nm, 50 nm, 60 nm, 70 nm, 80 nm, 90 nm, 1 μm, 2 μm, 3 μm, 4 μm, 5 μm, or 6 μm. For example, the beads may have diameters of 10 nm to 90 nm, e.g., 20 nm to 80 nm, 30 nm to 70 nm, 40 nm to 60 nm, or 20 nm to 30 nm. The beads may also have diameters of 10 nm to 6 μm, e.g., 20 nm to 5 μm, 30 nm to 4 μm, 40 nm to 3 μm, 50 nm to 2 μm, 60 nm to 1 μm, 70 nm to 500 nm, or 80 nm to 100 nm. When filter-based separation is employed, the filter size can be selected based on the bead size. For example, if the bead diameter is 1 μm or larger, the appropriate filter pore size may be 0.1 μm to 0.9 μm. In this case, the filter pore size may be 0.22 μm.

[0066] Bacteriophages can be bound to solid supports. Methods for binding bacteriophages to solid supports without affecting their infectivity are known in the art. Binding may be by chemical groups, such as tosyl groups. Binding may be covalent, for example. Binding may be by a pair of binding partners. For example, a bacteriophage may be decorated with a first member of a pair, and the solid support may be decorated with a second member of a pair. This pair may include, for example, biotin and streptavidin.

[0067] When bound to mycobacteria, the solvent can be detected. The solvent may be labeled to aid in the detection of the solvent bound to mycobacteria. The label may be a fluorophore, an enzyme (e.g., horseradish peroxidase), gold beads, a radioisotope, or a tag (e.g., a specific synthetic peptide epitope, synthetic oligonucleotide, or lantanide). The solvent may be labeled using any suitable fluorophore. For example, the fluorophore may be green fluorescent protein, rhodamine, eosin, Oregon Green, or Texas Red. When one or more different solvents are used in the manner disclosed herein (e.g., when two different solvents are used), each solvent may be labeled differently. For example, each solvent may be labeled with a fluorophore of a different color (e.g., red fluorophore and green fluorophore) so that the binding of each solvent to mycobacteria can be distinguished and / or co-localization of solvents can be detected.

[0068] As described above, one or more bacteriophages in the solvent are each bound to a solid support. Each bacteriophage may be bound to a different or distinct solid support. In this case, each solid support may be the same. For example, each solid support may be a paramagnetic bead. Alternatively, the solid supports may differ in their identity. For example, some bacteriophages may be bound to paramagnetic beads, and some bacteriophages may be bound to nonmagnetic beads. Each bacteriophage may belong to the same species, or to two or more different species. Therefore, the solvent may contain two or more different bacteriophage species bound to different solid supports.

[0069] Alternatively, two or more bacteriophages can be bound to the same solid support. That is, a single solid support (e.g., a bead or paramagnetic bead) can be attached to two or more bacteriophages. The two or more bound bacteriophages may all be of the same species. The two or more bound bacteriophages may all be of different species. If there are three or more bound bacteriophages, some of the bound bacteriophages may be of the same species, and others may be of different species. Therefore, the solvent may contain two or more different bacteriophage species bound to the same solid support.

[0070] Release of nucleic acids by mycobacteria As explained above, the bacteriophages contained in the lysis agent bind to mycobacteria and, after infection, lyse mycobacteria (including viable mycobacteria). The mechanism of bacteriophage lysis is known in the art and involves, for example, the production of proteins that cause damage to the cytoplasmic membrane of the host cell. Such damage provides a pathway for phage endolysin to be released into the cell wall, where it causes cleavage and cell rupture.

[0071] This rupture of the host cell inevitably releases host cell components into the surrounding substrate. Thus, the lysis of mycobacterial cells present in the sample by bacteriophages triggers the release of mycobacterial components, including genetic material. Therefore, nucleic acids from one or more mycobacteria are released.

[0072] As demonstrated in the example, mycobacteria are typically dissolved approximately 3.5 hours after contact with the solvent. That is, one or more bacteriophages typically release mycobacterial nucleic acids within approximately 3.5 hours of initial contact with the mycobacteria. Therefore, mycobacterial nucleic acids are typically released approximately 3.5 hours after the sample comes into contact with the solvent. However, routine adjustments may be made so that mycobacterial nucleic acids are released up to 1 hour, 2 hours, 3 hours, 4 hours, 5 hours, or 6 hours after contact with the solvent, for example, within a period of 0.5 to 7 hours after contact with the solvent, e.g., 1 to 6 hours, 2 to 5 hours, or 3 to 4 hours. Contact can be interpreted as the initial contact between the mycobacteria and the solvent. Contact with the solvent is typically maintained throughout the specified period because the bacteriophage portion of the solvent binds to the mycobacteria.

[0073] Mycobacteria nucleic acids may include DNA. For example, mycobacteria nucleic acids may include genomic nucleic acids such as genomic DNA. Mycobacteria nucleic acids may include RNA. Mycobacteria nucleic acids may include, for example, rRNA or mRNA. Mycobacteria nucleic acids may include both DNA and RNA.

[0074] The nucleic acid sequences of mycobacteria may be characteristic of mycobacteria or a given mycobacterial species. That is, the nucleic acid sequences of mycobacteria may be found in mycobacteria or a particular species of mycobacteria, but not in other organisms. Mycobacterial nucleic acids may contain, for example, insert sequences, and possibly mycobacterial insert sequences. For example, mycobacterial nucleic acids may contain, for example, IS6110 (SEQ ID NO: 1), or sequences that have at least 60%, at least 70%, at least 80%, at least 90%, at least 95%, at least 98%, or at least 99% identity with SEQ ID NO: 1. IS6110 is an insert sequence found within members of MTBC. Mycobacterial nucleic acids may contain, for example, IS900 (SEQ ID NO: 2), or sequences that have at least 60%, at least 70%, at least 80%, at least 90%, at least 95%, at least 98%, or at least 99% identity with SEQ ID NO: 2. IS900 is an insertion sequence found in Mycobacterium avium subsp. Paratuberculosis. Mycobacterial nucleic acids may contain, for example, IS2404 (SEQ ID NO: 3), or sequences that have at least 60%, at least 70%, at least 80%, at least 90%, at least 95%, at least 98%, or at least 99% identity to SEQ ID NO: 3. IS2404 is an insertion sequence found in Mycobacterium ulcerans.

[0075] Mycobacterial nucleic acids may contain, for example, a deletion or absence of RD4 (deletion region 4). RD4 encompasses Rv1506c-Rv1516c of Mycobacterium tuberculosis H37Rv and may play a role in mycobacterial pathogenicity. RD4 is deleted in certain other mycobacteria, such as Mycobacterium bovis. The deleted sequence is shown in (Sequence ID 4). Mycobacterial nucleic acids may delete sequences that are at least 60%, at least 70%, at least 80%, at least 90%, at least 95%, at least 98%, or at least 99% identical to Sequence ID 4. Therefore, mycobacterial nucleic acids may contain deletions of sequences that are at least 60%, at least 70%, at least 80%, at least 90%, at least 95%, at least 98%, or at least 99% identical to Sequence ID 4. Deletions or absences of sequences having at least 60%, at least 70%, at least 80%, at least 90%, at least 95%, at least 98%, or at least 99% identity to SEQ ID NO: 5 can be detected, for example, using a primer designed to span the region where the sequence would normally be present. Exemplary primers are provided in SEQ ID NOs: 17 to 22. Further exemplary primers are provided in SEQ ID NOs: 23 to 28. In particular, isoniazid resistance can be detected using primers containing the sequences of SEQ ID NOs: 23 to 28. Therefore, primers containing the sequences of SEQ ID NOs: 23 to 28 can be used in the method for distinguishing between treatment-resistant and non-treatment-resistant mycobacteria described herein.

[0076] The nucleic acids of mycobacteria may encode, for example, a 16S rRNA sequence, or a sequence having at least 60%, at least 70%, at least 80%, at least 90%, at least 95%, at least 98%, or at least 99% identity to a 16S rRNA sequence. The 16S rRNA sequence may be a 16S rRNA sequence of mycobacteria.

[0077] Mycobacterial nucleic acids may, for example, encode signature DNA sequences specific to mycobacteria. That is, mycobacterial nucleic acids may encode DNA sequences found in mycobacteria but not in other microorganisms. Alternatively, mycobacterial nucleic acids may encode sequences that have at least 60%, at least 70%, at least 80%, at least 90%, at least 95%, at least 98%, or at least 99% identity to a signature DNA sequence. Signature DNA sequences include, for example, DNA sequences contained in the HSPX gene that encodes α-crystallin.

[0078] Isolation of mycobacteria from samples As described above, the solid support portion of the solvent used in step (a) allows mycobacteria present in the sample and bound to the bacteriophage portion to be captured. After capture on the solid support, the solid support and the captured mycobacteria can be separated from the sample. Such separation can be performed, for example, before the release of mycobacterial nucleic acids. This allows control over the environment in which the mycobacterial nucleic acids are released. For example, the separated solid support and captured mycobacteria can be placed in a reaction mixture of the operator's choice (e.g., a buffer), and the mycobacterial nucleic acids can ultimately be released into the reaction mixture rather than the original sample. In this way, undesirable components of the sample are excluded from the reaction mixture in which the isothermal amplification method is performed in step (b). Such components may include debris (e.g., eukaryotic cell debris or feces, depending on the type of sample) and / or molecules (e.g., proteins, lipids, or carbohydrates), which can have a detrimental effect on the efficiency of the isothermal amplification method and / or the resulting efficiency.

[0079] Therefore, the solvent can capture mycobacteria (such as viable mycobacteria) on the solid support by interaction between one or more bacteriophages and viable mycobacteria, as described above. Step (a) may further include separating the solid support and the captured viable mycobacteria from the sample before the release of the mycobacterial nucleic acids.

[0080] As explained above, mycobacterial nucleic acids are typically released approximately 3.5 hours after the initial contact between the mycobacteria in the sample and the solvent (e.g., 2-5 hours, 2.5-4.5 hours, or 3-4 hours). Therefore, the solid support and captured viable mycobacteria may be separated from the sample before this point. For example, the solid support and captured viable mycobacteria may be separated from the sample less than 3.5 hours after the initial contact between the mycobacteria in the sample and the solvent (e.g., approximately 3 hours, 2.5 hours, 2 hours, 1.5 hours, 1 hour, or 0.5 hours). The solid support and captured viable mycobacteria may be separated from the sample 0.5-3.5 hours after the initial contact between the mycobacteria in the sample and the solvent (e.g., 1-3 hours, or 1.5-2 hours). Preferably, the solid support and the captured viable mycobacteria can be separated from the sample within about 3 hours (e.g., within about 2.5 hours, 2 hours, 1.5 hours, 1 hour, or 0.5 hours) after the initial contact between the mycobacteria in the sample and the solvent.

[0081] Potential mechanisms for separation are described in the "Solid Supports" section above. For example, the solid support may be magnetic beads or paramagnetic beads, in which case separation can be achieved by applying a magnetic field. In particular, the beads and captured mycobacteria can be separated from the sample by immobilizing the beads by applying an external magnetic field and removing the sample (e.g., in a washing step). The captured viable mycobacteria can then be released from the beads by adding an elution buffer and removing the magnetic field.

[0082] The solid support may be non-magnetic beads, such as labeled beads. In this case, the labeled beads and captured mycobacteria can be separated from the sample by immobilizing the labeled beads with a surface-binding molecule that binds to the label and removing the sample (e.g., in a washing step). For example, biotinylated beads and captured mycobacteria can be separated from the sample by immobilizing the biotinylated beads with a surface-binding streptavidin and removing the sample (e.g., in a washing step).

[0083] The solid support and captured mycobacteria can be separated from the sample based on mass, for example by centrifugation. Methods for separating and / or concentrating phage-bead-conjugated mycobacteria using mass-based separation techniques are known in the art. Alternatively, the solid support and captured mycobacteria can be separated from the sample by filtration. Methods for separating and / or concentrating phage-bead-conjugated mycobacteria using size-based separation techniques are known in the art.

[0084] Steps to isolate and / or concentrate the nucleic acids of released mycobacteria. The methods disclosed herein may include an optional step of separating and / or concentrating any mycobacterial nucleic acids released between step (a) and step (b). This may be performed, for example, to provide further information about the sample or the subject from which the sample was obtained. However, it is important to note that the step of separating and / or concentrating mycobacterial nucleic acids released between step (a) and step (b) is not essential to the method of detecting the presence or absence of mycobacteria in the sample. As described above, this is one of the advantages of the methods disclosed herein over prior art detection methods.

[0085] This optional step may include, for example, removing undissolved mycobacteria. For example, this may include using an antibody as a capture agent to bind to undissolved, typically unviable mycobacteria. Undissolved mycobacteria may also be removed by centrifugation, filtration, or barrier methods. Undissolved mycobacteria may also be removed by binding viable and unviable mycobacteria to a substrate before adding a solvent, adding the solvent to dissolve the viable bound mycobacteria, and then removing the substrate and the bound, typically unviable mycobacteria. The substrate may be a chromatography column, magnetic beads, or other material coated with polypeptides that specifically bind to mycobacteria.

[0086] After removing undissolved mycobacteria, the presence or absence of non-viable mycobacteria in the sample can be determined. Methods for doing so are known in the art. This may be useful in determining whether a subject has been exposed to mycobacteria but a mycobacterial infection has not been established, and / or whether the sample is contaminated with non-viable mycobacteria.

[0087] Alternatively, the method may not include the step of separating and / or concentrating the mycobacterial nucleic acids released between step (a) and step (b), as described above.

[0088] Process (b) Step (b) includes amplifying the nucleic acid of mycobacteria by performing the isothermal amplification method (b) to provide an amplification product. As described above, the nucleic acid of mycobacteria may include a DNA sequence and / or an RNA sequence. If the nucleic acid of mycobacteria includes RNA, a reverse transcription step can be performed before or during step (b) to provide DNA complementary to the RNA for amplification. Methods for reverse transcription of RNA molecules are known in the art.

[0089] As described above, nucleic acids from multiple mycobacteria may be released. Step (b) may include performing an isothermal amplification method to amplify the nucleic acids from multiple different mycobacteria released in step (a), thereby generating multiple different amplification products. For example, nucleic acids from two or more, three or more, four or more, five or more, six or more, seven or more, eight or more, nine or more, or ten or more different mycobacteria may be amplified using the isothermal method. Two or more, three or more, four or more, five or more, six or more, seven or more, eight or more, nine or more, or ten or more different amplification products may be generated. By amplifying nucleic acids from multiple different mycobacteria, each characteristic of a different mycobacterial species, the method may be able to detect a wider range of mycobacterial species. Amplifying nucleic acids from multiple different mycobacteria, each characteristic of a mycobacterial species, may increase the specificity of the method for detecting mycobacterial species.

[0090] The advantage of using an isothermal amplification method is that, operating at a single temperature, it eliminates the need for specialized, often large, detection equipment required for PCR-based methods. Furthermore, using an isothermal method for amplification avoids the thermal lysis of unviable mycobacteria. Therefore, the amplification product does not contain amplified nucleic acids derived from unviable mycobacteria. The amplification product contains only amplified nucleic acids derived from viable mycobacteria. Thus, the method of this disclosure can be used to determine only the presence or absence of viable mycobacteria without the need to remove unviable mycobacteria from the sample before amplification. There is no need for the additional step of washing and concentrating nucleic acids released from viable bacteria before amplification. Therefore, this method is simpler and faster to perform than PCR-based methods in the prior art. Furthermore, this method may be carried out in a single reaction vessel (e.g., a single test tube, a single microcentrifuge tube, or a single well in a multiwell plate). Therefore, this method can be used for high-throughput screening and is particularly advantageous when it is necessary to test a large number of samples (e.g., when it is necessary to test multiple subjects for the presence or absence of mycobacterial infection).

[0091] Isothermal amplification methods may include loop-mediated isothermal amplification (LAMP) or recombinase polymerase amplification (RPA). Both LAMP and RPA are known in the art. LAMP is a promising nucleic acid amplification test that has been reported to be more resistant to inhibition by sample components, such as blood components, than conventional PCR-based methods. Therefore, as shown in the examples, LAMP-based methods do not require upstream sample preparation required in PCR-based methods before nucleic acid amplification. Similar advantages may also apply to RPA.

[0092] Isothermal amplification methods amplify mycobacterial nucleic acids using primers. Each primer is complementary to the target primer binding site within the mycobacterial nucleic acid. Primer design for isothermal amplification is commonplace in the art.

[0093] For example, an isothermal amplification method (e.g., LAMP) may involve the use of a primer set comprising a forward outer primer (F3), a reverse outer primer (B3), a forward inner primer (FIP), and a backward inner primer (BIP). The primer set may further include a loop forward primer (LF) and / or a loop backward primer (LR). The use of LF and LR may improve the reaction rate.

[0094] Nucleic acids of mycobacteria containing IS6110 can be amplified using a primer set comprising, for example, AGACCTCACCTATGTGTCGA (SEQ ID NO: 5) as F3, TCGCTGAACCGGATCGA (SEQ ID NO: 6) as B3, ATGGAGGTGGCCATCGTGGAAG-CCTACGTGGCCTTTGTCAC (SEQ ID NO: 7) as FIP, and AAGCCATCTGGACCCGCCAA-CCCCTATCGTATGGTGGAT (SEQ ID NO: 8) as BIP. The primer set may further include AGGATCCTGCGAGCGTAG (SEQ ID NO: 9) as LF, and / or AAGAAGGCGTACTCGACCTG (SEQ ID NO: 10) as LR.

[0095] Nucleic acids of mycobacteria containing IS900 can be amplified using a primer set comprising, for example, CGCAACGCCGATACCGT (SEQ ID NO: 11) as F3, CCCAGGATGACGCCGAA (SEQ ID NO: 12) as B3, CATCACCTCCTTGGCC-AGGCCCGCTAACGCCCAACAC (SEQ ID NO: 13) as FIP, and GCGACACCGACGCGATGAT-TCCGGGCATGCTCAGGA (SEQ ID NO: 14) as BIP. The primer set may further include AGTGGCCGCCAGTTGTTG (SEQ ID NO: 15) as LF and / or ACCGCCACGCCGAAATC (SEQ ID NO: 16) as LR.

[0096] Nucleic acids of mycobacteria containing RD4 deletion can be amplified using a primer set that includes, for example, GCCGCTCCCAAAAATTACCA (SEQ ID NO: 17) as F3; GACGCTACTACGGCACGG (SEQ ID NO: 18) as B3; AGGCCACTCCAAGAGTGTTGCG-TGACGCCTTCCTAACCAGA (SEQ ID NO: 19) as FIP; and GCGCGGGCGTACCGGATAT-GCGCCCCGTAGCGTTA (SEQ ID NO: 20) as BIP. The primer set may further include CTTCTGCACGACTACGGCT (SEQ ID NO: 21) as LF, and / or AGCCATTTTTCAGCAATTTCTCAG (SEQ ID NO: 22) as LR.

[0097] Primers may be modified. In other words, one or more primers may contain chemically modified DNA or RNA sequences. For example, primers may be phosphorothioated. In particular, FIP and / or BIP may be phosphorothioated. Primers may be fluorescently labeled. The fluorescent label may be quenched in its unbound state and fluoresce when the primer is included in the amplification product.

[0098] In isothermal amplification methods, other reagents may also be used. Examples of unspecified sets of reagents are provided in the examples.

[0099] For example, isothermal amplification methods use DNA polymerase. Any suitable DNA polymerase may be used in the methods described herein.

[0100] DNA polymerase can be a eukaryotic polymerase. Examples of eukaryotic polymerases that can be used may include pol-α, pol-β, pol-δ, pol-ε or their functional variants, analogs, homologs, or derivatives, and any combination thereof. The DNA polymerase is typically Bst DNA polymerase, and more typically Bst 2.0 DNA polymerase. Bst 2.0 DNA polymerase does not initiate nucleic acid amplification until approximately 40°C. This characteristic reduces the likelihood of false-positive results.

[0101] DNA polymerase can be a prokaryotic polymerase. Examples of prokaryotic polymerases that can be used include Bacillus stearothermophilus (Bst) DNA polymerase, BcaBEST DNA polymerase (TaKaRa), E. coli DNA polymerase I Klenow fragment, E. coli DNA polymerase I, E. coli DNA polymerase II, E. coli DNA polymerase III, E. coli DNA polymerase IV, E. coli DNA polymerase V, Bacillus stearothennophilus polymerase I large fragment, Bacillus subtilis Pol I large fragment (Bsu polymerase), Listeria monocytogenes DNA polymerase I, and Staphylococcus aureus. Examples include aureus)DNA polymerase 1 (Sau), or any functional variant, analogue, homolog, or derivative thereof, or any combination thereof.

[0102] DNA polymerases can be bacteriophage polymerases. Examples of bacteriophage polymerases that may be used in the methods described herein include Phi-29 DNA polymerase, T7 DNA polymerase, bacteriophage T4 gp43 DNA polymerase, or any functional variants, analogs, homologs or derivatives thereof, or any combination thereof.

[0103] DNA polymerases may possess strand displacement properties, typically high strand displacement activity.

[0104] DNA polymerases can catalyze DNA synthesis by using the free 3'-hydroxyl group of the entry strand to incorporate new nucleotides. Some polymerases can catalyze synthesis using the 3'-hydroxyl group of the entry strand, and simultaneously replace the other strand while synthesis occurs. For example, E. coli polymerase II or III can be used to extend the entry D-loop. Furthermore, E. coli polymerase V, which is commonly used in E. coli SOS lesion target mutations, can be used. All of these polymerases can be made highly processable through interactions and cooperation with β-dimer clamps and single-stranded DNA-binding proteins (SSBs) and other components. Other polymerases from prokaryotes, viruses, and eukaryotes can also be used to extend the entry strand.

[0105] Many DNA polymerases possess 3'-5' exonuclease activity, and some also possess 5'-3' exonuclease activity. 3'-5' exonuclease activity enhances the fidelity of replication reactions. Therefore, DNA polymerases with 3'-5' exonuclease activity can be used.

[0106] In some cases, using a DNA polymerase with 3'-5' exonuclease activity and / or 5'-3' exonuclease activity can be undesirable because one DNA strand is gradually digested as the polymerase advances rather than substituting. When a polymerase with 3'-5' exonuclease activity is used, free oligonucleotides may also undergo end-dependent degradation. Mispriming can also be caused by oligonucleotides that are shortened by the polymerase's 3'-5' exonuclease activity, leading to increased reaction noise. Therefore, a DNA polymerase may not have 3'-5' exonuclease activity and / or 5'-3' exonuclease activity.

[0107] Isothermal amplification methods also utilize dNTPs such as dATP, dGTP, dCTP, and dTTP, as well as their derivatives and analogs. In the synthesis of leading and lagging strands, RPA, ATP, GTP, CTP, and UTP may also be used for RNA primer synthesis. Mixtures of dNTPs and ddNTPs (e.g., ddATP, ddTTP, ddGTP, and ddGTP, as well as their derivatives and analogs) may be used.

[0108] Chemicals that destabilize DNA helices (i.e., DNA destabilizers) can potentially improve isothermal amplification efficiency. Suitable chemicals can be selected by those skilled in the art. For example, betaine (N,N,N-trimethylglycine) or L-proline, which reduce base stacking, can not only stimulate the overall reaction rate but also increase target selectivity, significantly reducing the amplification of off-target sequences.

[0109] Isothermal amplification methods may use buffer solutions. For example, the (RT-)LAMP reaction may involve Tris-HCl buffer, Tris-acetic acid buffer, or a combination thereof. The buffer solution may contain potassium acetate. Reducing agents such as DTT may also be used.

[0110] In RT-LAMP, the starting template is RNA, such as a bacterial RNA transcript. Using reverse transcriptase, cDNA can be generated from the RNA template as the first step. The cDNA provides a template for amplification. Any suitable reverse transcriptase may be used in the kits, devices, or methods described herein.

[0111] In many cases, it may be useful to use a reverse transcriptase having a similar operating temperature to the DNA polymerase used, for example, so that the method described herein can be carried out at a single reaction temperature. As described above, by performing the isothermal amplification method, nucleic acids of two or more, three or more, four or more, five or more, six or more, seven or more, eight or more, nine or more, or ten or more different mycobacteria can be amplified. Thus, two or more, three or more, four or more, five or more, six or more, seven or more, eight or more, nine or more, or ten or more different amplification products can be produced. Each of two or more nucleic acid sequences can be amplified simultaneously using the isothermal amplification method by including a primer set for each of the nucleic acids of different mycobacteria.

[0112] Process (c) Step (c) includes detecting the presence or absence of an amplification product, the presence of an amplification product indicating the presence of mycobacteria in the sample, and the absence of an amplification product indicating the absence of mycobacteria in the sample.

[0113] Known mechanisms can be used to detect the presence or absence of amplification products. Mechanisms that make the readings visible to the naked eye may be particularly advantageous as they minimize the equipment required to perform the method and facilitate field use. For example, detection may involve the use of nucleic acid stains that produce a colorimetric reaction. The presence of a colorimetric reaction may indicate the presence of amplification products, and therefore the presence of mycobacteria in the sample. The absence of a colorimetric reaction may indicate the absence of amplification products, and therefore the absence of mycobacteria in the sample. Exemplary nucleic acid stains that produce colorimetric reactions include SYBR Green 1, EvaGreen, calcein, and hydroxynaptol blue.

[0114] In another example, detection may involve the use of a reagent that produces a change in turbidity. An increase in turbidity compared to the turbidity of a negative control may indicate the presence of an amplification product, and therefore the presence of mycobacteria in the sample. No increase in turbidity compared to the turbidity of a negative control may indicate the absence of an amplification product, and therefore the absence of mycobacteria in the sample. Turbidity can be assessed visually.

[0115] In another example, detection may involve the use of nucleic acid stains that produce a fluorescent reaction. The presence of fluorescence may indicate the presence of amplification products, and therefore mycobacteria, in the sample. The absence of fluorescence may indicate the absence of amplification products, and therefore mycobacteria, in the sample.

[0116] In further examples, detection may involve gel electrophoresis of the amplification product. The presence of a DNA fragment of a specific known size may indicate the presence of an amplification product, and therefore the presence of mycobacteria in the sample. The absence of a DNA fragment of a specific known size may indicate the absence of an amplification product, and therefore the absence of mycobacteria in the sample.

[0117] The presence of amplification products may, in some cases, indicate one or more characteristics of mycobacteria present in the sample. Such characteristics may include mycobacterial species, strain, lineage, treatment resistance (e.g., drug resistance, e.g., isoniazid resistance), and / or pathogenicity. Whether such characteristics are indicated by the presence of amplification products is determined by the selection of primers used for isothermal amplification. Primers that result in amplification of species-specific nucleic acid sequences allow, for example, the presence of amplification products to indicate the species of mycobacteria present in the sample. Primers that result in amplification of strain-specific nucleic acid sequences allow, for example, the presence of amplification products to indicate the strain of mycobacteria present in the sample. Primers that result in amplification of lineage-specific nucleic acid sequences allow, for example, the presence of amplification products to indicate the lineage of mycobacteria present in the sample. Primers that result in amplification of nucleic acid sequences that provide markers of drug resistance allow, for example, the presence of amplification products to indicate drug resistance (e.g., isoniazid resistance) of mycobacteria present in the sample. Primers that result in amplification of nucleic acid sequences that provide markers of pathogenicity allow, for example, the presence of amplification products to indicate the pathogenicity of mycobacteria present in the sample. As mentioned above, RD4 can be a marker of pathogenicity.

[0118] Method for diagnosing the presence or absence of mycobacterial infection The methods disclosed herein for detecting the presence or absence of mycobacteria in a sample may be used to diagnose the presence or absence of mycobacterial infection in a subject. Accordingly, this disclosure provides a method for diagnosing the presence or absence of mycobacterial infection in a subject, which includes detecting the presence or absence of mycobacteria in a sample obtained from a subject using the methods disclosed herein for detecting the presence or absence of mycobacteria in a sample, wherein the presence of mycobacteria in the sample indicates the presence of mycobacterial infection in the subject, and the absence of mycobacteria in the sample indicates the absence of mycobacterial infection in the subject. In other words, the present disclosure provides a method for diagnosing the presence or absence of mycobacteria infection in a subject, comprising detecting the presence or absence of mycobacteria in a sample obtained from the subject, wherein the presence or absence of mycobacteria in the sample is detected by (a) contacting the sample with a solvent comprising one or more bacteriophages conjugated to solid supports, wherein if viable mycobacteria are present in the sample, the viable mycobacteria are dissolved in the solvent and the mycobacterial nucleic acids are released; (b) performing an isothermal amplification method to amplify the mycobacterial nucleic acids to obtain an amplification product; and (c) detecting the presence or absence of the amplification product, wherein the presence of the amplification product indicates the presence of mycobacteria in the sample, and the absence of the amplification product indicates the absence of mycobacteria in the sample, wherein the presence of mycobacteria in the sample indicates the presence of mycobacterial infection in the subject, and the absence of mycobacteria in the sample indicates the absence of mycobacterial infection in the subject.

[0119] Any of the characteristics described above in relation to methods for detecting the presence or absence of mycobacteria in a sample can also be applied to methods for diagnosing the presence or absence of mycobacterial infection in a subject.

[0120] The subject can be any subject capable of harboring mycobacteria. For example, the subject can be a human or a non-human animal. Non-human animals are typically mammals. Non-human mammals can be, for example, livestock. Non-human mammals can be ruminants such as cattle, sheep, or goats. Non-human mammals can be wild animals such as badgers or deer. Non-human mammals can be other types of animals such as companion animals (e.g., dogs, cats, horses, rabbits) or laboratory animals (e.g., rodents such as mice, rats, or guinea pigs).

[0121] The sample may be a body fluid sample. For example, the sample may be a blood (e.g., whole blood), milk, cerebrospinal fluid, semen, synovial fluid, amniotic fluid, sputum, saliva, lymph, or urine sample. The sample may be a blood (e.g., whole blood), cerebrospinal fluid, semen, synovial fluid, amniotic fluid, sputum, saliva, lymph, or urine sample. The sample may be a blood (e.g., whole blood), cerebrospinal fluid, sputum, or urine sample. The sample may be a sample from a body fluid sample, such as a blood (e.g., whole blood), milk, cerebrospinal fluid, semen, synovial fluid, amniotic fluid, sputum, saliva, lymph, or urine sample. The sample may be a sample from a blood (e.g., whole blood), cerebrospinal fluid, semen, synovial fluid, amniotic fluid, sputum, saliva, lymph, or urine sample. The sample may be a sample from a blood (e.g., whole blood), cerebrospinal fluid, sputum, or urine sample. In other cases, the sample may be a stool sample or a breath sample. The sample may be a sample from a stool sample or a breath sample. In any case, a sample "from" a particular type of sample may refer to a sample that has been processed in some way after collection and before step (a). Processing may include, for example, purification or isolation of eukaryotic cells contained in the unprocessed sample. Processing may further include concentration of a dilution of the purified or isolated eukaryotic cells. In the case of a viscous sample (e.g., sputum) or a solid sample (e.g., stool), processing may include maceration and / or suspension in a suitable fluid such as physiological saline. For example, conventional methods for detecting mycobacteria from sputum typically involve homogenization by using or vortexing N-acetyl-L-cysteine ​​(NALC). However, we have surprisingly found that mycobacteria can be detected in unhomogenized sputum samples using the method of the present disclosure (see Example 7).

[0122] If the sample is a milk sample or a sample from a milk sample, the milk sample can be obtained from one or more subjects. That is, the milk sample may be an individual milk sample (i.e., a sample obtained from a single individual) or a milk sample collected from multiple individuals. For example, the collected milk sample may be taken from two or more, five or more, ten or more, twenty or more, fifty or more, one hundred or more, one fifty or more, or two hundred or more individuals. In this case, the method can diagnose the presence or absence of mycobacterial infection in a group of subjects, such as a population. The milk sample may be, for example, a bulk milk tank sample. In the context of this disclosure, the term “bulk milk tank sample” refers to a collected milk sample obtained from a container that receives and holds milk produced by multiple animals raised for that milk. The animals may be, for example, dairy cows, dairy goats, or dairy sheep. These animals are usually raised on a single farm for the purpose of producing milk. In any case, the milk may be in a form not intended for direct consumption by humans. In other words, milk may not be in a form intended for human consumption without further processing. Further processing may be necessary to make milk suitable for human consumption, such as reducing the presence of viable pathogens. Further processing may include pasteurization. Milk may not be pasteurized.

[0123] The sample may be, for example, a tissue sample. The sample may be, for example, a fine-needle aspiration, a tissue swab, or a biopsy. In any case, the sample may be taken from a site suspected of containing mycobacteria. The sample may include, for example, lung tissue. The sample may include, for example, intestinal tissue such as tissue from the esophagus, stomach, duodenum, jejunum, ileum, cecum, appendix, colon, rectum, or perianal region. The sample may include, for example, skin. The sample may be, for example, from a tissue sample. A sample "from" a tissue sample may refer to a tissue sample that has been processed in some way after collection and before step (a). Processing may include, for example, maceration of a solid tissue sample and / or suspension of tissue particles in a suitable fluid such as saline.

[0124] Mycobacteria whose presence or absence is detected by this method may include any of those described above in relation to methods for detecting the presence or absence of mycobacteria in a sample. Mycobacterial infection may include (i) infection by one or more Mycobacterium tuberculosis complex (MTBC) species (e.g., Mycobacterium tuberculosis and / or Mycobacterium bovis). (ii) one or more Mycobacterium avium complex (MAC) species (e.g., Mycobacterium avium subspecies paratuberculosis (MAP)); (iii) Mycobacterium smegmatis; (iv) Mycobacterium ulcerans; (v) Mycobacterium leprae; and / or (vi) one or more non-Tuberculosis mycobacteria (NTM) (e.g., Mycobacterium abscessus complex species group, Mycobacterium kansasii and / or Mycobacterium marinum).For example、マイコバクテリア infectionは、(i);(ii);(iii);(iV);(V);(Vi);(i)、(ii);(i)、(iii);(i)、(iV);(i)、(V);(i)、(Vi);(ii)、(iii);(ii)、(iV);(ii)、(V) ;(ii)、(Vi);(iii)、(iV);(iii)、(V);(iii)、(Vi);(iV)、(V);(iV)、(Vi);(V)、(Vi);(i)、(ii)、(iii);(i)、(ii)、(iV);(i)、(ii)、(V);(i)、(ii) )、(Vi);(i)、(iii)、(iV);(i)、(iii)、(V);(i)、(iii)、(Vi);(i)、(iV)、(V);(i)、(iV)、(Vi);(i)、(V)、(Vi);(ii)、(iii)、(iV);(ii)、(iii)、( V);(ii)、(iii)、(Vi);(ii)、(iV)、(V);(ii)、(iV)、(Vi);(ii)、(V)、(Vi);(iii)、(iV)、(V);(iii)、(iV)、(Vi);(iii)、(V)、(Vi);(iV)、(V)、(Vi) );(i)、(ii)、(iii)、(iV);(i)、(ii)、(iii)、(V);(i)、(ii)、(iii)、(Vi);(i)、(ii)、(iV)、(V);(i)、(ii)、(iV)、(Vi);(i)、(ii)、(V)、(Vi);(i) 、(iii)、(iV)、(V);(i)、(iii)、(iV)、(Vi);(i)、(iii)、(V)、(Vi);(i)、(iV)、(V)、(Vi);(ii)、(iii)、(iV)、(V);(ii)、(iii)、(iV)、(Vi);(ii)、( iii)、(V)、(Vi);(ii)、(iV)、(V)、(Vi);(iii)、(iV)、(V)、(Vi);(i)、(ii)、(iii)、(iV)、(V);(i)、(ii)、(iii)、(iV)、(Vi);(i)、(ii)、(iii)、(V) )、(Vi);(i)、(ii)、(iV)、(V)、(Vi);(i)、(iii)、(iV)、(V)、(Vi);(ii)、(iii)、(iV)、(V)、(Vi); or (i)、(ii)、(iii)、(iV)、(V)、(Vi) may contain infection。

[0125] Mycobacterial infection may cause or be suspected of causing disease in the subject. This disease could be any disease in which mycobacteria contribute to the pathogenesis. Numerous such diseases are known in the art. For example, in humans, mycobacteria are associated with tuberculosis, Crohn's disease, ulcerative colitis, irritable bowel syndrome, psoriasis, thyroiditis, sarcoidosis, Parkinson's disease, multiple sclerosis, type 1 diabetes, arthritis, ankylosing spondylitis, Buruli ulcer, leprosy, nontuberculous mycobacterial (NTM) infection, cystic fibrosis, focal granuloma, and ascending lymphangitis (e.g., similar to sporotrichosis). The subject may have or be suspected of having one of these diseases. In animals such as ruminants, mycobacteria are associated with tuberculosis and Johne's disease, among others. The subject may have or be suspected of having one of these two diseases. Therefore, methods for diagnosing the presence or absence of mycobacterial infection in a subject may be methods for diagnosing tuberculosis, Crohn's disease, ulcerative colitis, irritable bowel syndrome, psoriasis, thyroiditis, sarcoidosis, Parkinson's disease, multiple sclerosis, type 1 diabetes, arthritis, ankylosing spondylitis, Buruli ulcer, leprosy, nontuberculous mycobacterial (NTM) infection, cystic fibrosis, focal granuloma, ascending lymphangitis (e.g., similar to sporotrichosis), or Johne's disease.

[0126] If this method indicates the presence of mycobacterial infection in a subject, appropriate measures may be taken. For example, treatment for the mycobacterial infection may be administered. Treatment may be prophylactic or therapeutic. Such treatments for mycobacterial infections are known in the art. Treatment may include, for example, oral antibiotics such as isoniazid, clarithromycin, azithromycin, rifampin, rifabutin, ethambutol, streptomycin and / or amikacin. Treatment may include, for example, mycobacterial vaccines (e.g., TB vaccine, bTB vaccine or MAP vaccine). If this method indicates the presence of mycobacterial infection in an animal subject, the subject may be isolated or disposed of, for example, as part of a program to control the spread of mycobacterial infection.

[0127] Mycobacterial infections are known to be present even in subjects without clinical signs. That is, mycobacterial infections can exist without causing active disease. Mycobacterial infections can be, for example, latent. Mycobacterial infections can be, for example, asymptomatic. Methods for diagnosing the presence or absence of mycobacterial infection in subjects can be used to diagnose the presence or absence of mycobacterial infection in the absence of clinical disease. Subjects determined to have a mycobacterial infection in the absence of clinical disease may be treated prophylactically to prevent the development of clinical disease and / or monitored for the development of clinical signs. By implementing early treatment in this way, the outcomes of the infection may be improved.

[0128] Methods for diagnosing the presence or absence of mycobacterial infection in a subject may be used to monitor the course of infection in the subject. For example, this method may be used to monitor the infection's response to treatment.

[0129] A method for diagnosing the presence or absence of mycobacterial infection in a subject may include determining one or more characteristics of the mycobacteria present in the sample. One or more characteristics may include resistance to treatments such as isoniazid therapy. Determining the presence or absence of isoniazid-resistant mycobacteria in the sample may be helpful in determining the treatment method. For example, if a subject is diagnosed with a mycobacterial infection and a sample taken from the subject is determined to contain viable isoniazid-resistant mycobacteria, the subject may be administered a treatment that does not include isoniazid. Alternatively, if a sample taken from the subject is determined not to contain viable isoniazid-resistant mycobacteria, the subject may be administered isoniazid. Determining the presence or absence of isoniazid-resistant mycobacteria in the sample may also be useful for monitoring the infection's response to isoniazid therapy.

[0130] Solvent This disclosure further provides a solvent capable of lysing viable mycobacteria, comprising two or more different bacteriophage species, each bound to a solid support. As demonstrated in the examples, such solvents are highly efficient at selectively lysing viable mycobacteria. In particular, solvents comprising two or more different bacteriophage species exhibit improved lysis compared to solvents comprising only one bacteriophage species.

[0131] Bacteriophages and solid supports are described in detail above in relation to the solvents used in the methods of this disclosure. Any of the features disclosed above in relation to the solvents used in the methods of this disclosure may be applied to the solvents of this disclosure.

[0132] The solvent may contain two or more different bacteriophage species bound to the same solid support. In this case, one solid support (e.g., a bead) is bound to at least two bacteriophages, each being a different species.

[0133] The solvent may comprise two or more different bacteriophage species bound to different solid supports. That is, the solvent may comprise (i) a first bacteriophage species bound to a first solid support, and (ii) a second bacteriophage species bound to a second solid support. The first and second solid supports may be of the same type or species. For example, both the first and second solid supports may be beads, magnetic beads, paramagnetic beads, nonmagnetic beads, or labeled nonmagnetic beads. The first and second solid supports may be of different types or species. For example, the first and second solid supports may each be different portions selected from beads, magnetic beads, paramagnetic beads, nonmagnetic beads, or labeled nonmagnetic beads.

[0134] Each of two or more bacteriophage species may have the ability to lyse viable mycobacteria. Bacteriophages capable of lysing viable mycobacteria are described above. In a preferred embodiment of this disclosure, the two or more bacteriophage species may include D29 and / or TM4. The two or more bacteriophage species may include D29. The two or more bacteriophage species may include TM4. Preferably, the two or more bacteriophage species may include D29 and TM4.

[0135] Usage and Kit The solvents of this disclosure may be used in the methods of this disclosure. Accordingly, this disclosure provides the use of the solvents of this disclosure in the methods of this disclosure.

[0136] This disclosure further provides kits for carrying out the methods of this disclosure, including the solubilants of this disclosure. The kits may optionally include one or more additional components. One or more additional components may be any reagents described herein, in any suitable combination at any concentration described herein. One or more additional components may include one or more reagents for carrying out isothermal amplification methods such as LAMP or RPA, such as primers, DNA polymerase, dNTPs, DNA destabilizers and / or buffer components described herein. If the kit is for carrying out the methods of this disclosure that require reverse transcription, the kit may include reverse transcriptases described herein. One or more additional components may include one or more reagents for detecting amplification products, such as nucleic acid stains described herein.

[0137] The solvent and / or one or more additional components of the kit may be in a dry state. Drying offers the advantage of not requiring refrigeration to maintain the activity of the solvent or the one or more additional components. For example, in a dry state, the solvent and / or one or more additional components of the kit can be stored at room temperature. This is particularly useful in field environments where access to refrigeration equipment is limited.

[0138] One or more additional components of the solvent and / or kit can be dried by any suitable method. One or more additional components of the solvent and / or kit can be vacuum-dried. One or more additional components of the solvent and / or kit can be freeze-dried (i.e., lyophilized). Suitable methods for vacuum drying or lyophilization are known in the art.

[0139] The solvent and / or one or more additional components of the kit may be dried on the bottom of the tube or on beads or any other suitable type of solid support. Before use, the dried components of the kit may be reconstituted with a buffer solution or water, depending on the composition of the dried components. The target nucleic acid or template nucleic acid, or the sample, as described herein may then be added. Alternatively, the reconstituted solution may contain the target nucleic acid or template nucleic acid or the sample. The reconstituted reaction product may be incubated for an appropriate period and at an appropriate temperature as described herein. The amplified product, if present, may then be detected as described herein.

[0140] Stabilizers such as dextran, lactose, or trehalose sugars may be included in the dried mixture to improve drying performance and shelf life. Bovine serum albumin may also be included. If desired, the dried reagent may be stored before use (e.g., up to 2 weeks, 3 weeks, 1 month, 6 months, 1 year, 2 years, or 3 years or more before use).

[0141] The dried components can be redissolved in water, typically DNase and / or RNase-free water, or other suitable buffer solution as determined by those skilled in the art. The pH of the redissolved reagent can be adjusted before use.

[0142] The solvent and one or more components of the kit may be combined as a reagent mixture, for example, in or on the same solid support, such as a reaction tube. The solvent and / or one or more additional components of the kit may be provided in appropriate amounts so that the appropriate reagent concentration is achieved when reconstituted.

[0143] One or more additional components in the kit may include instructions for use.

[0144] This kit can be used in the method of the present invention.

[0145] Any of the features described above in relation to the methods or solvents of this disclosure may apply to the use and kits of this disclosure.

[0146] example The following examples are provided to illustrate the present invention and are not intended to limit it.

[0147] Example 1 Materials and methods Strains and cultures The experimental strain of mycobacteria used in this study was M. smegmatis (mc 2 155) The strains were Mycobacterium bovis BCG (Pasteur), Mycobacterium avium subsp. paratuberculosis (MAP) strain (ATCC 19698), and MAP goat strain (clinical isolate). Both Mycobacterium bovis and MAP were maintained in liquid culture on Middlebrook 7H9 medium (Sigma-Aldrich, USA) and solid culture on 7H10 (Sigma-Aldrich, USA) agar medium, both supplemented with OADC (PBD Biotech Ltd., UK). Mycobactin-J (2 μg / μl; IDVet, France) was also added to the MAP growth medium. All liquid cultures were incubated at 37°C with shaking (200 rpm). Bacteriophage D29 (Actifage Reagent) was supplied in the Actifage kit (PBD Biotech Ltd., UK) and used to infect mycobacteria.

[0148] Mycobacteria counting To determine the concentration of mycobacteria in the liquid culture, the counting method was performed according to Swift et al., 2016 (doi:10.1080 / 21505594.2016.1191729). In short, the cultured mycobacteria were counted using D29 bacteriophage (approximately 10 8 The bacteriophages were mixed with pfu / ml (PBD Biotech Ltd., UK) and incubated at 37°C for 1 hour to infect mycobacteria by binding the bacteriophages. The extracellular bacteriophages were inactivated at ambient temperature for 5 minutes using a virucidal agent (ferrous ammonium sulfate, 10 mM; PBD Biotech Ltd., UK). The virucidal agent was diluted and neutralized in 5 ml of Actifage medium, and then plated onto 7H10 agar (final concentration 0.75% w / v). The number of mycobacterial cells was determined by counting plaques on the M. smegmatis reporter flora (recorded as pfu / ml).

[0149] Isolation of bacteria from blood To isolate bacteria from blood, nucleated cells were separated from red blood cells using the hemagglutinator HetaSep®. The HetaSep® reagent was mixed with blood in a 1:5 ratio and centrifuged (100 × g; 1 min). The sample was left on a bench at ambient temperature for 10 minutes. The plasma layer was carefully removed and placed in 5 ml of PBS, then centrifuged (200 × g; 10 min). The supernatant was removed, and the pellet was suspended in 1 ml of sterile water. The sample was then centrifuged (13000 × g; 3 min) and used in the Actifage® assay.

[0150] Actifage® assay First, peripheral blood mononuclear cells were extracted from the sample using MolYsis® Basic 5. Next, the Actifage® assay was performed according to Swift et al., 2020 (doi:10.1111 / 1751-7915.13518). Briefly, the processed sample was suspended in 100 μl of Actifage reagent and incubated at 37°C for 3.5 hours. After incubation, the lysate was centrifuged in a Rapid tube (13,000 × g; 3 min). Next, the filtrate was washed and concentrated (Monarch® PCR & DNA Cleanup Kit (5 μg), New England Biotech), and then the DNA was eluted using 10 μl (double-loaded) of molecular-grade water (55°C) instead of elution buffer. The eluted DNA was used as template DNA for nucleic acid amplification.

[0151] LAMP optimization The DNA used in the optimization reaction was from MAP or Mycobacterium bovis (BCG), and after counting it, 10 5 / 5μl to 10 0 The DNA was serially diluted down to 5 μl per cell and subjected to crude DNA extraction (boiling at 95°C for 10 minutes). These DNA lysates were used as templates in all optimization reactions.

[0152] To optimize each LAMP assay, an effect matrix was investigated. This included determining the optimal reaction temperature using a temperature gradient (60–67.5°C) before optimizing the loop-forward primer concentration and loop-reverse primer concentration (0.8, 1.4, and 2.4 μM). The effects of primer sets with and without phosphorothioate-treated forward inner primer (F1c) and backward inner primer (B1c) regions were also examined (Table 1), as well as the effects of LAMP enhancers such as guanidine hydrochloride (40 μM; Thermo Fisher Scientific), urea (3.6 μM; Thermo Fisher Scientific), and DMSO (2%; Thermo Fisher Scientific). [Table 1]

[0153] Analytical sensitivity testing The optimized LAMP reaction limit of detection (LOD) is determined by first counting the cultured mycobacteria, then 10 0 The LOD was determined by serial dilution to the final concentration of cells / 5 μl. These dilutions were subjected to crude DNA extraction (95°C for 10 minutes) and used as templates for optimized MTBC, MAP, and Mycobacterium bovine (M. bovis) LAMP assays. These LOD experiments were repeated three times. The LOD of the optimized LAMP reaction was compared to the LOD of endpoint PCR targeting the same genetic elements. The same crude DNA was used in both comparison reactions.

[0154] Actifage®-LAMP LOD counts mycobacteria and serially dilutes them to 10 0 The concentration was determined by adjusting it to cells / ml. These dilutions were treated with the Actifage® assay, and 5 μl of unpurified lysate was used as a template for the optimized MTBC, MAP, and Mycobacterium bovine (M. bovis) LAMP assays. Next, the DNA lysate was washed and concentrated (New England Biotech, USA), and 5 μl of purified filtrate was used as a template for the optimized MTBC, MAP, and Mycobacterium bovine (M. bovis) LAMP assays. The Actifage®-LAMP LOD experiment was repeated three times. A template-free negative control was performed after each run.

[0155] Use of Activage®-LAMP in the blood Blood spike experiments were conducted using defibrillated sheep blood (Oxoid Ltd, UK). 5 ml of blood was mixed with culture of MAP or Mycobacterium bovine (BCG) to a final concentration of 10. 4 Assuming cells / ml, approximately 10 0The blood was serially diluted to cells / ml. Hematologic cells were lysed using MolYsis® Basic 5. The lysed blood was then treated with the Actifage® assay, and the DNA lysate was detected using LAMP.

[0156] Analytical specificity testing Non-target bacteria were tested using each LAMP assay to evaluate their specificity. For each bacterial species, one colony was collected and crude DNA was extracted (boiled at 95°C for 10 minutes). Next, 5 μl of DNA was used as a template and tested using MTBC, MAP, and Mycobacterium bovine (M. bovis) LAMP assays.

[0157] Visualization of LAMP products Fluorescence was measured in real time, and melting curve analysis was performed using the built-in Genie® II software (OptiGene Limited, UK). For the color reaction, 0.5 μl of 1000X SYBR Green 1 (Sigma-Aldrich) was added to the tube cap before amplification, and the mixture was shaken after amplification. Relative color was quantified by measuring the hue value using the Hue Value-Saturation (HSV) model with the free Android app Color Grab® (Loomatix Ltd). Images for analysis were taken using a Moto G5 Android smartphone (Motorola, USA). Next, gel electrophoresis was performed using 10 μl of the product on a 2% TAE gel containing 0.01% GelRed (Sigma-Aldrich, USA), followed by confirmation of amplification by UV transmission illumination.

[0158] PCR reaction DNA samples (5 μl) from phage lysates were used as templates for signature sequence amplification. MTBC members were identified by IS6110-specific qPCR, as described in Eisenach et al., 1990 (doi:10.1093 / infdis / 161.5.977). MAPs were identified by IS900-specific qPCR, as described in Slana et al., 2009 (doi:10.1016 / j.prevetmed.2009.02.020). All qPCR reactions were performed using QuantiFast® SYBR Green Master Mix (Qiagen).

[0159] statistical analysis LAMP fluorescence was analyzed using Genie® Explorer V2.0.7.11 (OptiGene Limited). Statistical analyses, including Pearson's correlation coefficient and Cohen's kappa coefficient, were performed using GraphPad Prism V9.0.0 (GraphPad Software, USA). qPCR results were analyzed using Bio-Rad CFX Maestro V2.3 (Bio-Rad Laboratories).

[0160] result Optimization of the LAMP assay Three separate LAMP assays targeting MTBC, Mycobacterium bovine (M. bovis) (RD4), and MAP were optimized. The optimal amplification temperatures were found to be 66, 65, and 67.5°C, respectively (Table 2). [Table 2]

[0161] After optimization with reaction accelerators (Table 3), all assays were 10 0 Cells / ml could be detected, and the cutoff times were determined to be 45, 80, and 45 minutes, respectively. [Table 3]

[0162] How to interpret LAMP assay results The LAMP assay can be read using various methods. Gel electrophoresis, real-time fluorescence, and colorimetric detection were evaluated. Gel electrophoresis produced typical laddering of the LAMP-amplified DNA product. Using real-time fluorescence, accumulation of the fluorescence signal (FAM) was generated at each dilution and measured using a fluorometer. Using colorimetric detection, a color change from green to orange was observed in the presence of all dilutions of mycobacterial DNA. The limit of detection (LOD) was the same for all methods (Figure 1), but quantification was not possible with the colorimetric method. Compared to published MTBC, RD4, and MAP PCR primer sets, the LAMP reaction was 1000-fold, 1000-fold, and 10,000-fold more sensitive, respectively (Figure 1). Colorimetric reading was selected as the most appropriate, and a positive or negative output was adopted.

[0163] Analytical LAMP specificity The optimized LAMP assay was tested with DNA from non-target bacterial species to determine its analytical specificity. The results in Table 4 show that there was no non-target amplification in the MTBC, MAP, or Mycobacterium bovine (M. bovis) assays. [Table 4]

[0164] Use of Actifage® without washing and concentrating DNA samples To develop the Actifage®-LAMP assay, we first investigated the effects of the washing and concentration steps. There was a strong positive correlation between the ct value of the crude product and the "washed and concentrated" Mycobacterium bovis (M. bovis) BCG sample (r 2 =0.96, 99% CI=0.5~0.99). This trend was consistent with the corresponding values ​​obtained for MAP samples (r 2(=0.99, 99% CI=0.69~0.99). After removing the washing and concentration steps, the ct threshold and analytical sensitivity remained unchanged.

[0165] Comparison of qPCR and LAMP Actifage® endpoints After removing the washing and concentration steps from the Actifage® assay, the effect of changing the endpoint from qPCR to LAMP was evaluated. A perfect correlation was observed when comparing the MTBC LOD of the two methods (κ=1, 95% CI=1~1). This trend was consistent with MAP samples. Changing to the LAMP endpoint did not affect the LOD. However, LAMP allows for faster detection times, while qPCR can be used quantitatively.

[0166] Testing of Actifage®-LAMP in artificially inoculated blood. To evaluate the performance of the assays in clinically relevant sample types, mycobacteria were added to blood and processed using the Actifage®-LAMP assay. MTBC, RD4, and MAP assays were performed on 100% blood samples each. 1 Cells / ml could be detected. In all LAMP assays, the addition of blood increased TOD and decreased LOD by a factor of ten. Due to the increase in TOD, the assay cutoff time was extended by 15 minutes. When used with blood samples, the cutoff times for the MTBC, RD4, and MAP assays were 60, 90, and 60 minutes, respectively.

[0167] Actifage(registered trademark)-LAMP clinical evaluation Clinical blood samples were collected from individuals suspected of having tuberculosis and their close contacts in a low-tuberculosis-burden environment. Each sample underwent an interferon-gamma-release assay (IGRA) reference test and was then treated with the Actifage®-LAMP assay. The inventors were not informed of the IGRA status until data analysis. Of the 19 samples tested, 8 (42.1%) were positive and 11 (57.9%) were negative for IGRA, while 6 (31.6%) were positive and 13 (68.4%) were negative for Actifage®-LAMP. There was moderate agreement between the two methods (κ=0.49, 75%).

[0168] Consideration LAMP optimization The LAMP enhancer showed findings that contradicted previous studies showing a reduction in amplification temperature. It has been reported that urea and phosphorothioate modification of primers lowers the amplification temperature. However, this was not observed in our experiments, which is likely due to the long amplification time used. Alternatively, the high GC content of MTBC and MAP F1c and B1c primers may affect the stability of the fold-back hairpin structure.

[0169] The inclusion of DMSO improved both detection time and the limit of detection (LOD). Since LAMP is still in its early stages of development, less is known about its chemical effects on amplification compared to PCR. Nevertheless, DMSO is known to affect PCR by making it thermally unstable, thereby destabilizing the DNA structure and lowering the denaturation temperature. While the reason why DMSO improved detection time is unclear, the inventors surmise that the same mechanism applies to LAMP.

[0170] Guanidine hydrochloride has been reported to improve detection time. We found that it acted as an inhibitor in MTBC and MAP assays, but improved detection time in the RD4 assay without affecting analytical sensitivity or specificity. The increased length of RD4 FIP and BIP primers (compared to MTBC and MAP), presumably due to improved base pairing between the primer and the target sequence, may explain this effect.

[0171] LAMP Development The specificity of this assay stems from two aspects. First, the D29 bacteriophage infects and lyses only mycobacterial hosts. Therefore, only small amounts of non-mycobacterial DNA should be present. Second, we have shown that the LAMP assay amplifies only the target insertion sequence (Table 5). The specificity was not examined in the initial report of the MAP LAMP assay by Trangoni et al., 2015 (doi:10.1590 / S1517-838246220131206). Here, the specificity of MAP LAMP is demonstrated. Furthermore, the range of bacterial species for which MTBC LAMP is known not to produce false positives has been expanded beyond that initially reported by Aryan et al., 2010 (doi:10.1016 / j.micres.2009.05.001).

[0172] When tested with artificially inoculated blood, the detection time (for a positive LAMP result) was prolonged. This suggests that certain components in the blood inhibit the LAMP assay. While this is a common finding in PCR, it has not been reported frequently in LAMP reactions. Although LAMP has been reported to be resistant to inhibition, it is not immune to its effects.

[0173] Different LAMP readings were investigated (Figure 1). Although all readings had the same analytical sensitivity, the inventors decided to employ a colorimetric reading. In fact, a workflow with as few instruments as possible is preferred. The use of SYBR green dye, added at the end of the LAMP assay, is well established in the art. However, the need to open the reaction vessel at the end of the assay introduces the possibility of cross-contamination. To avoid this limitation, the inventors utilized a method in which the dye is added to the reaction vessel cap before the reaction begins and mixed by shaking at the end.

[0174] Actifage (registered trademark) - LAMP The first step in integrating the optimized LAMP assay into the Actifage® assay was to eliminate the washing and concentration steps. There was no difference between the crude sample and the "washed and concentrated" sample (Figure 2). This is thought to be because the sample was inoculated into the culture medium. By using the LAMP endpoint, we were able to eliminate the washing and concentration steps without potentially reducing sensitivity due to inhibition by other components in the sample.

[0175] Using colorimetric LAMP instead of qPCR improves TOD, but there is a trade-off: it cannot be used quantitatively. However, portable LAMP amplifiers are now attracting significant attention. These technologies bring Actifage® assays closer to end users and allow for effective combination with colorimetric output.

[0176] Clinical evaluation of Actifage(registered trademark)-LAMP For novel LAMP assays, it is crucial to demonstrate their applicability with clinically relevant samples. We have demonstrated not only the NAAT endpoint but also complete upstream sample preparation, thus demonstrating the complete diagnostic and usefulness of the test in real-world situations.

[0177] The assay was validated as a proof of concept using clinical samples. Cohen's kappa analysis showed moderate agreement with IGRA. The difference in agreement may be due to the sample cohort including the index case and its close contacts. IGRA is an immunological test and detects exposure rather than infection, while Actifage®-LAMP directly detects circulating viable mycobacteria.

[0178] Actifage (registered trademark) - Examination of the LAMP method The WHO is seeking new molecular diagnostic methods that can be used near point of care from samples other than sputum. The Actifage®-LAMP assay meets this requirement. By detecting mycobacteria from blood, it becomes possible to diagnose extrapulmonary tuberculosis, which is often missed with current diagnostic methods.

[0179] The detection speed of Actifage®-LAMP is limited by the 3.5-hour incubation period during the Actifage® process. This is unavoidable due to the D29 replication cycle. The 5.5-hour detection time of Actifage®-LAMP does not hinder application in district-level laboratories and allows for results to be delivered within one business day.

[0180] The cost of Actifage®-LAMP is estimated at US$12.45 per test (Table 6), which is higher than the US$5 per human tuberculosis test recommended by the WHO and is expected to decrease further with the commercialization of the technology. The price does not include infrastructure costs, but this cost is expected to be low as the reaction can be carried out in a heat block or water bath, while the colorimetric output eliminates the need for expensive detection equipment. [Table 5]

[0181] Table 7 shows the current state of tuberculosis testing and how Actifage®-LAMP contributes to this mosaic. [Table 6]

[0182] Using LAMP as an endpoint instead of qPCR offers several advantages: shorter detection times, no need for continuous power, inexpensive and portable equipment, easier interpretation of color readings than cq values, and no washing or concentration steps. These advantages do not come at the expense of sensitivity or specificity, and bring the method closer to point-of-care implementation, making it more applicable in low- and middle-income countries. Actiphage®-LAMP now meets more ASSURED criteria than comparable qPCR-based methods.

[0183] Example 2 Materials and methods Strains and cultures The experimental strain of mycobacteria used in this study was M. smegmatis (mc 2155) The strains were Mycobacterium bovis BCG (Pasteur), Mycobacterium avium subsp. paratuberculosis (MAP) strain (ATCC 19698), and MAP goat strain (clinical isolate). Both Mycobacterium bovis and MAP were maintained in liquid culture on Middlebrook 7H9 medium (Sigma-Aldrich) and solid culture on 7H10 (Sigma-Aldrich) agar, supplemented with OADC (PBD Biotech Ltd.). For long-term storage, MAP was grown on Herrold egg yolk slant (BD), and Mycobacterium bovis was grown on Lowenstein-Jensen medium slant (BD). All liquid cultures were incubated at 37°C with shaking (200 rpm). Mycobactin J (2 μg / μl; IDVet) was added to the liquid culture of MAP. The cultures were identified as members of MAP or the Mycobacterium tuberculosis complex by endpoint PCR targeting the IS900 or IS6110 gene elements, respectively. Mycobacteria were infected using bacteriophage D29 (PBD Biotech Ltd). For phage assays, Middlebrook 7H9 medium was modified with 2 mM CaCl2 and OADC to produce 7H9(+). Non-mycobacterial strains used in specificity testing (see "Analytical Specificity" section) were grown on BHI agar (Sigma-Aldrich).

[0184] Mycobacteria counting To determine the concentration of mycobacteria in the liquid culture, the counting method was performed according to Swift et al., 2016 (doi:10.1080 / 21505594.2016.1191729). In short, the cultured mycobacteria were counted using D29 bacteriophage (approximately 10 8The bacteriophages were mixed with pfu / ml and incubated at 37°C for 1 hour to bind to and infect mycobacteria. The extracellular bacteriophages were inactivated with a virucidal agent (ferrous ammonium sulfate, 10 mM; PBD Biotech Ltd) for 5 minutes, and the sample was prepared for approximately 10 minutes. 9 Mycobacteria were mixed with 5 ml of molten 7H10 agar. The number of mycobacterial cells was determined by counting the plaques on an M. smegmatis reporter lawn (recorded as pfu / ml).

[0185] Phage titer Titer analysis was performed to determine the pfu / ml of the liquid phage stock. The phage stock was serially diluted along a 10-fold gradient of 7H9(+). The dilutions were mixed with 5 ml of 7H9(+), 1 ml of M. smegmatis (reporter organism), and 6 ml of 7H10. The phage log was calculated by counting the number of plaques on the reporter organism.

[0186] Isolation of bacteria from blood To isolate bacteria from blood, a dissection method based on MolYsis® Basic 5 (Molzym GmbH & Co. KG) was used. Briefly, whole blood (maximum 5 ml) was mixed with buffer CM (2 ml) and vortexed for 15 seconds. The sample was left on a bench at ambient temperature for 5 minutes. Buffer DU (2 ml) and MolDNase (10 μl) were added to the sample and vortexed for 15 seconds. The sample was incubated on a bench at ambient temperature for 15 minutes, then centrifuged (9500 × g; 10 min). The supernatant was removed, and the pellet was resuspended in 1 ml of Actifage medium. The sample was then centrifuged (13000 × g; 3 min) and used in the Actifage® assay.

[0187] Ultrapure water was also used to lyse blood cells. 5 ml of ultrapure water was added to sheep whole blood (maximum 5 ml; oxyid) and vortexed for 15 seconds. The samples were left on a bench for 5 minutes before use in the PhMS-LAMP assay.

[0188] Actifage® assay The Actifage® assay was performed according to Swift et al., 2020 (doi:10.1111 / 1751-7915.13518). Prior to the assay, PBMCs were extracted using MolYsis® Basic 5. Briefly, the processed samples were suspended in 100 μl of Actifage reagent (100 μl) and incubated at 37°C for 3.5 hours. After incubation, the lysate was centrifuged in a Rapid tube (13,000 × g; 3 min). Next, the filtrate was washed and concentrated (Monarch® PCR & DNA Cleanup Kit (5 μg), New England Biotech), and the DNA was eluted using 10 μl (double-loaded) molecular-grade water (55°C) instead of elution buffer. The eluted DNA was used as template DNA for nucleic acid amplification.

[0189] Bacteriophage binding to paramagnetic beads 150 mg of 1 μm BcMag® tosyl-activated magnetic beads (Bioclone) were resuspended in 1.5 ml of isopropanol (99.9%, Sigma-Aldrich) to prepare a 100 mg / ml bead stock solution. Next, 10 mg (100 μl) of the resuspended beads were washed with 1 ml of 0.1 M sodium bicarbonate (Sigma-Aldrich) buffer (pH 9.5), vortexed briefly, and placed on a magnetic separator for 3 minutes, after which the supernatant was removed. The washing process was repeated three times. The washed beads were then mixed with approximately 100 ml of water. 8The beads were resuspended in pfm / ml phage (diluted with sodium bicarbonate at pH 9.5). This was continuously mixed in a Stuart rotator mixer (Cole-Parmer) at 37°C and 30-40 rpm for 12 hours. Next, the beads were washed three times with sodium bicarbonate without vortexing during washing. Then, the beads were resuspended in 1 ml of PBS at pH 7.4 and incubated at room temperature for 1 hour. Finally, the prepared beads were stored at 4°C.

[0190] Optimization of phage magnetic trapping We designed experiments to optimize the capture of mycobacteria by phage beads. Three different types of phage beads were tested: D29, TM4, and a combination (D29+TM4). In addition to these various preparations, mixing methods, particularly vertical mixing (Stuart rotator mixer, 40 rpm) and horizontal mixing (orbital mixer, 200 rpm), were tested. Simultaneously, mixing lengths of 30 and 45 minutes were tested. First, 15 μl of phage beads was added to 1 ml of mycobacteria at counting concentration and incubated at 37°C under test conditions. The supernatant was then removed and crude DNA was extracted (boiled at 95°C for 10 minutes). This DNA lysate was later used for qPCR detection.

[0191] Phage magnetic capture efficiency The capture efficiency of mycobacteria by phage beads was evaluated. Mycobacteria at known concentrations were mixed with 7H9(+) or sheep whole blood (pre-dissolved in ultrapure water) for 10 minutes. 1 The solution was diluted to a concentration of cells / ml. Next, 15 μl of phage beads was added to each dilution, and the mixture was incubated at 37°C under conditions that were found to be optimal in optimization experiments. The supernatant was then extracted and counted.

[0192] Analysis sensitivity The limit of detection (LOD) for PhMS-qPCR and PhMS-LAMP is determined by first counting the cultured mycobacteria, then 10 0The concentration was determined by serial dilution to the final concentration of cells / 5 μl. These dilutions were processed through a PhMS assay, and the DNA lysates were amplified using qPCR or LAMP.

[0193] Loop-mediated isothermal amplification DNA samples from PhMS lysate (5 μl) were used as templates for signature sequence amplification, as described in Example 1. Members of the MTBC were identified by IS6110-specific LAMP, as described in Aryan et al., 2010 (doi:10.1016 / j.micres.2009.05.001). MAPs were identified by IS900-specific LAMP, as described in Trangoni et al., 2015 (doi:10.1590 / S1517-838246220131206). Bovine tuberculosis (M. bovis) was identified by RD4-specific LAMP, as described in Kapalamula et al., 2021 (doi:10.1371 / journal.pntd.0008996).

[0194] PCR reaction DNA samples (5 μl) from phage lysates were used as templates for signature sequence amplification. MTBC members were identified by IS6110-specific qPCR, as described in Eisenach et al., 1990 (doi:10.1093 / infdis / 161.5.977). MAPs were identified by IS900-specific qPCR, as described in Slana et al., 2009 (doi:10.1016 / j.prevetmed.2009.02.020). All qPCR reactions were performed using QuantiFast® SYBR Green Master Mix (Qiagen).

[0195] statistical analysis LAMP fluorescence was analyzed using Genie® Explorer V2.0.7.11 (OptiGene Limited, UK).

[0196] The qPCR results were analyzed using Bio-Rad CFX Maestro V 2.3 (Bio-Rad Laboratories, USA).

[0197] All statistical tests were performed using GraphPad Prism V9.0.0 (GraphPad Software, USA).

[0198] Results: Development of phage magnetic separation Bacteriophage attachment to beads Bacteriophage binding to tosyl-activated magnetic beads was achieved with high efficiency (Figure 4). TM4 phage bound with the highest efficiency, with 99.99% (SD ± 0.006) of incubated phages binding to the magnetic beads. Similar efficiencies were observed with the D29 and TM4 phage combination (99.99% (SD ± 0.005)) and with the D29 phage alone (99.96% (SD ± 0.057)). Throughout the experiment, TM4 bound with higher efficiency than D29. When using TM4 phage in combination with other phages, all extracellular phages were removed by subsequent washing. However, free D29 phages were present in the phage-bead supernatant (6.75 × 10⁶). 2 The phage remained at an average concentration of pfu / ml. In D29, TM4, and D29+TM4 phage beads, the average phage ratio per bead was 3:1.

[0199] Phage binding to the beads was confirmed (Figure 5). After seeding the phage-beads onto agar, the morphology of the plaques was compared (comparison by size; large D29 plaques vs. TM4 pinprick plaques). This analysis confirmed typical D29 and TM4 plaques, which were then confirmed by plaque PCR of D29 (360 bp product) and TM4 (440 bp product). Plaques formed by the combined beads were positive for both TM4 and D29 by PCR.

[0200] Optimization of mycobacteria capture The key to successful phage magnetic separation is the initial capture of mycobacteria. A series of experiments were designed to optimize mycobacterial capture by phage beads (Figure 6). These results indicate that the direction of mixing is the most important factor. In fact, the difference in capture between horizontal and vertical mixing was statistically significant (p=0.027). While using vertical mixing, subsequent optimization experiments did not affect the success of mycobacterial capture. Therefore, when performing phage magnetic separation, phage beads were mixed vertically with the sample for 30 minutes.

[0201] After optimizing the capture of mycobacteria by phage beads, the capture efficiency of these phage beads was evaluated (Figure 7). This evaluation showed that the proportion of mycobacteria captured by phage beads increased as the mycobacterial concentration decreased. This effect was consistent for Mycobacterium bovine (M. bovis) BCG and MAP, as well as in culture media and artificially added whole blood. Furthermore, when the capture of phage beads was evaluated with artificially added whole blood, the capture efficiency increased. This trend was observed for both Mycobacterium bovine (M. bovis) BCG and MAP. D29+TM4 phage beads captured more MAP and Mycobacterium bovine (M. bovis) BCG than either of their individual counterparts. In fact, there was a statistically significant difference between the capture level and the type (including combinations) of phages bound to the magnetic beads (p=0.022).

[0202] D29 phage beads were able to capture, on average, 36.78% (SD ± 4.62) of MAP in the culture medium, 82.45% (SD ± 13.63) of MAP in artificially added whole blood, 61.08% (SD ± 14.34) of Mycobacterium bovis (BCG) in the culture medium, and 66.15% (SD ± 7.28) of Mycobacterium bovis (BCG) in artificially added whole blood. TM4 phage beads were able to capture, on average, 30.39% (SD ± 7.86) of MAP in the culture medium and 49.38% (SD ± 7.12) of Mycobacterium bovis (BCG) in the culture medium. D29+TM4 phage beads captured 55.94% (SD ± 16.17) of MAP in the culture medium and 72.91% (SD ± 6.06) of Mycobacterium bovis (BCG) in the culture medium, on average.

[0203] Results: Development of PhMS-LAMP whole blood lysis To develop PhMS as a complete diagnostic method, a sample preparation step prior to phage magnetic capture was necessary to extract mycobacteria from circulating peripheral blood mononuclear cells. The solubility of blood lysis buffers was investigated (Figure 8). It was found that a 5:1 ratio of blood to chaotropic buffer (MolYsis® Basic 5) and a 1:1 ratio of blood to ultrapure water showed equivalent solubility in whole blood. The 1:1 blood-to-ultrapure water ratio was used in the final workflow.

[0204] Comparison of PhMS and Actifage® qPCR To evaluate the capture and lysis capabilities of PhMS, this method was compared with Actifage®, a modern phage-based diagnostic method (Figure 9). The two methods were shown to be equivalent. In fact, when tested using Mycobacterium bovine (M. bovis), (r 2 =0.99, 99% CI=0.40~1.00, p=0.0025) and when tested using MAP (r 2= 0.98, 95% CI = -0.34 to 0.99, p = 0.01), there was a strong positive correlation between PhMS and Actifage®. Both methods were able to detect 10 0 cells / 5 μl of Mycobacterium bovis (M. bovis) and MAP.

[0205] Analytical sensitivity of PhMS-qPCR and PhMS-LAMP To investigate the applicability of different detection endpoints, the detection limits of LAMP and qPCR were compared. These experiments showed that LAMP and qPCR were equivalent when the medium was processed through the PhMS assay. However, when artificially added whole blood was processed with the PhMS assay, unlike LAMP which was able to reliably detect up to 10 1 cells / 5 μl, qPCR was unable to detect any concentration of mycobacteria.

[0206] Analytical specificity of PhMS-LAMP To examine the analytical specificity of the PhMS-LAMP assay, various non-target species and non-mycobacterial species were processed with the assay (Table 8). No non-target species were detected using any of the MTBC, MAP or RD4 PhMS-LAMP assays.

Table 7

Table 8

[0207] Discussion Development of phage magnetic separation The development of the PhMS-LAMP assay began with evaluating the binding of phages to tosyl-activated paramagnetic beads. The inventors theorized that the observed high binding efficiency was due to the large, smooth capsid heads of D29 and TM4, which present highly available amine groups, thereby enabling covalent bonding. Furthermore, the phage titer in the initial binding step was lower than that of many other approaches in the prior art, thus achieving a very high binding efficiency. The inventors aimed to demonstrate that the capture and lysis of mycobacteria were due to the phage-bead complex and not to free phages in the supernatant of the phage-bead preparation. This was demonstrated by a series of washing steps and a low supernatant titer at the end of the preparation.

[0208] The type of phage on each bead was identified, and for the first time, it was demonstrated that two different phage types can bind to the same magnetic bead. In this case as well, it is possible that a low-titer phage was used in the binding process to make room for binding sites for other phage types.

[0209] The importance of sample mixing was highlighted through the optimization of capture. Vertical mixing increased the likelihood of phage-bead and mycobacteria interaction, resulting in improved capture rates. Furthermore, higher kinetic energy transferred to the sample may increase the likelihood of successful phage attachment to its host receptor.

[0210] Example 3 - Comparison of qPCR and LAMP endpoints against PhMS Materials and methods 5 ml of defibrillated sheep blood (Oxoid Ltd, UK) was dissolved using the above aqueous solubility protocol. 10 ml of Mycobacterium bovine (M. bovis) BCG and MAP cultures were then mixed. 4 from 10 0 Cells were serially diluted 10-fold to 5 μl and added to the lysed blood samples. PhMS was added to all blood samples, as well as to bacterial growth medium 7H9(+). 4 from 10 0The same procedure was performed on separate sets of Mycobacterium bovine (M. bovis) BCG and MAP cultures, serially diluted 10-fold down to 5 μl cells / 5 μl. No cleanup or concentration steps were performed on the PhMS lysates. The PhMS lysates were used as templates for qPCR and LAMP reactions. Next, detection times and detection limits were compared.

[0211] Results and Discussion The detection time and detection limit of qPCR and LAMP were compared using whole blood samples. Tables 10 and 11 show the inhibitory effects of whole blood on qPCR and LAMP when detecting Mycobacterium bovis (BCG) and Mycobacterium paratuberculosis (MAP), respectively. [Table 9] [Table 10]

[0212] In the culture medium, both qPCR and LAMP were present at 10 0 We were able to detect Mycobacterium bovine (BCG) and MAP at concentrations down to 5 μl per cell. LAMP showed decreased sensitivity, but it was able to detect Mycobacterium bovine (BCG) and MAP in the added blood sample at 10 1 Cells could be consistently detected down to 5 μl. However, qPCR could not detect Mycobacterium bovis (BCG) and MAP in the added blood sample. This is because nucleic acid amplification inhibitors present in the blood sample inhibited qPCR. LAMP is more resistant to this inhibition.

[0213] Example 4 - Effect of removing magnetic separation from PhMS-LAMP and adding filtration Materials and methods 1 ml of MAP culture 4 from 10 0The cells were serially diluted 10-fold to 5 μl and incubated with 15 μl of D29 and TM4 phage beads at 37°C for 3.5 hours. The samples were exposed to a magnet for 3 minutes. 5 μl of the supernatant was used as a template for LAMP.

[0214] 1 ml of MAP culture 4 from 10 0 After serial diluting the cells 10-fold down to 5 μl, the samples were incubated with 15 μl of D29 and TM4 phage beads at 37°C for 3.5 hours. The samples were loaded into Actifage® filter tubes (pore size 0.22 μm) and centrifuged at 13,000 × g for 3 minutes. The filtrate was used as a template for LAMP. Another 10-fold serial dilution of MAP was treated with phage-LAMP as described above and used as a control.

[0215] Results and Discussion Phage-LAMP and PhMS (without magnetic separation) both yielded 10 0 Cells / ml could be detected, but PhMS (with filtration) showed a maximum of 10 1 We were able to detect cells / ml (Figure 11). This decrease in sensitivity was due to DNA capture in the filter column.

[0216] Example 5 - Detection of MTBC and MAP from clinical samples using PhMS-LAMP Materials and methods Blood samples were collected in 10 ml lithium heparinized blood tubes (BD, USA). 3 ml of blood was processed using the water lysis protocol described above. PhMS was performed using 45 μl of D29 and TM4 phage beads. 5 μl of the lysis solution was used as a template for the IS6110 LAMP reaction (for human samples) or the IS900 LAMP reaction (for bovine samples).

[0217] Results and Discussion The PhMS-LAMP assay detected viable MTBCs in 70% (7 / 10 people) of tuberculosis contacts who had recently been exposed to Mycobacterium tuberculosis (M. tuberculosis) (Table 12).

Table 11

[0218] The PhMS-LAMP assay detected viable MAP from bovine samples (Table 13). Samples were collected from 8 cattle considered to be Johne's disease positive based on the results of the red ELISA, 10 cattle considered to be at risk based on the results of the amber ELISA, and 12 cattle considered to be negative based on the results of the green ELISA. The PhMS-LAMP assay detected viable MAP in 10 samples. Specifically, 5 out of 8 cattle with ELISA-red were confirmed positive, 5 out of 10 cattle with ELISA-amber were confirmed positive, and no MAP positives were confirmed in the ELISA-green cattle. The 3 ELISA-red cattle and 5 ELISA-amber cattle that were not confirmed MAP positive may actually have had residual antibodies generated from previous MAP infections rather than a live MAP infection. This may explain why these cattle were tested ELISA-red or ELISA-amber but did not yield positive results in the PhMS-LAMP assay.

Table 12

[0219] These results indicate that mycobacteria can be detected from clinical samples using the PhMS-LAMP workflow.

[0220] Example 6 - Distinguishing between INH-resistant Mycobacterium tuberculosis (M. tb) and susceptible Mycobacterium tuberculosis (M. tb) Materials and Methods Mycobacterium bovis was processed with the PhMS assay using D29 and TM4 phage-beads. 5 μl of 10 3 individual Mycobacterium bovis (M. bovis) PhMS lysates or 5 μl of 10 3The genome copy of one isoniazid-resistant H37Rv Mycobacterium tuberculosis (M.tb) strain TMC 303 (ATCC® No. 35822) was used as a template for the publicly available isoniazid-resistant LAMP assay (Altattan et al., 2024 (doi:10.1038 / s41598-024-55289-x)). The LAMP assay included 1.6 μM FIP / BIP (SEQ ID NOs. 23 and 24), 0.2 μM F3 / B3 (SEQ ID NOs. 25 and 26), 0.6 μM FLP / BLP (SEQ ID NOs. 27 and 28), 1× LAMP fluorescent dye (New England Biolabs, USA), and 1× WarmStart® Multi-Purpose LAMP / RT-LAMP 2X Master Mix (containing UDG) (New England Biolabs, USA). The reaction volume of 25 μl was completed with molecular-grade water. The LAMP assay was heated at 65°C for 60 minutes, and fluorescence measurements were acquired every 15 seconds using Genie® II (OptiGene Limited, UK).

[0221] Results and Discussion The KatG LAMP assay was used to distinguish the wild-type KatG gene (possessed by BCG) from the isoniazid-resistant mutant gene (possessed by Mycobacterium tuberculosis (M. tb) 303) (Figure 12). The difference in average detection time indicates which gene target was detected (wild-type vs. mutant). The results demonstrate that using an alternative LAMP endpoint after a PhMS assay can inform sample characteristics such as isoniazid resistance.

[0222] Example 7 - Detection of Mycobacteria added to Cerebrospinal Fluid, Sputum, or Urine using PhMS-LAMP Materials and methods MAP Eukaryotic cells were lysed by treating 3 ml of artificial cerebrospinal fluid (CSF), sputum, or urine (Biochemazone, California) with sodium saponincholate. MAP cultures were then processed. 4 from 10 0The samples were serially diluted 10-fold to cells / ml and added to the artificial samples. PhMS (using D29 and TM4 phage beads) was performed on all artificial samples and a separate set of MAP cultures. The MAP cultures were 10 times in bacterial growth medium 7H9(+) treated with sodium saponincholate. 4 from 10 0 The cells were serially diluted 10-fold down to the desired cell / ml. 5 μl of PhMS lysis solution was used in the IS900 LAMP assay.

[0223] Mycobacterium bovis (bovine type tuberculosis) Eukaryotic cells were lysed by treating 3 ml of artificial CSF, sputum, or urine (Biochemazone, California) with sodium saponincholate. BCG cultures of Mycobacterium bovis (M. bovis) were then 10 3 from 10 0 The samples were serially diluted 10-fold to cells / ml and added to the artificial samples. PhMS (using D29 and TM4 phage beads) was performed on all artificial samples and a separate set of Mycobacterium bovine (M. bovis) BCG cultures. The Mycobacterium bovine (M. bovis) BCG cultures were 10 times in bacterial growth medium 7H9(+) treated with sodium saponincholate. 3 from 10 0 The cells were serially diluted 10-fold down to the desired cell / ml. 5 μl of PhMS lysis solution was used in the IS6110 LAMP assay.

[0224] Results and Discussion MAP Compared to the culture medium and lysis buffer controls, CSF delayed the detection time but did not affect the assay sensitivity (Figure 13). Compared to the culture medium and lysis buffer controls, sputum had little effect on the mean detection time and did not affect the sensitivity of the PhMS-LAMP assay (Figure 14). Similarly, urine shortened the detection time but did not affect the sensitivity (Figure 15).

[0225] Mycobacterium bovis (bovine type tuberculosis) CSF and urine had little effect on detection time (Figures 16 and 18). However, sputum increased detection time but did not affect sensitivity (Figure 17). 10 0 Mycobacterium bovis (BCG) cells / ml were detected in CSF, urine, and sputum, but not in culture media or saponin lysis buffer controls. This is likely due to the lysis buffer damaging or destroying mycobacterial cells, and this effect was mitigated by the complex matrix present in the sample types tested. CSF, sputum, and urine likely acted as buffers that prevented the damage to mycobacteria caused by the lysis buffer.

[0226] CSF is an important sample type in tuberculous meningitis, a symptom of tuberculosis that has traditionally been difficult to detect. Sputum is frequently used to detect pulmonary tuberculosis, and this study demonstrates the feasibility of using the PhMS-LAMP assay for detecting CSF and mycobacteria in sputum. Urine is a sample type used only in frontline tuberculosis testing, and there are few commercially available assays targeting this sample type. Demonstrating the applicability of urine as a sample type will expand the use cases of the PhMS-LAMP assay.

[0227] Example 8 - Detection of MAP using PhMS and freeze-dried LAMP reaction Materials and methods 10 μl of lyophilized beads were prepared using 1 × WarmStart® Multi-Purpose LAMP / RT-LAMP 2X Master Mix (containing UDG) (New England Biolabs, USA), 1 × LAMP fluorescent dye (New England Biolabs, USA), 1 × IS900 primer master mix (FIP / BIP 1.6 μM, F3 / B3 0.16 μM, FLP / BLP 0.8 μM), and 10 × trehalose (1 M) 37.8% w / v ml, and the volume was supplemented with molecular-grade water. MAP cultures were then 10 4 from 10 0The samples were serially diluted 10-fold to cells / ml and treated with PhMS. 5 μl of PhMS lysis solution was used as a template. Before adding the template, the lyophilized beads were resuspended in 20 μl of molecular-grade water. Then, the template DNA was added before performing the LAMP reaction.

[0228] Results and Discussion In areas where mycobacteria testing is required, securing a cold chain for transporting assay reagents is typically difficult. To enable the PhMS-LAMP assay to be used closer to point-of-care sites, we successfully freeze-dried the LAMP assay.

[0229] An increase in detection time and a decrease in sensitivity were observed (Figure 19). However, the lyophilization procedure allows the LAMP reagent to be stored at room temperature or above without affecting assay performance.

[0230] Example 9 - Confirmation of phage survival rate in phage-bead complexes Materials and methods D29 phage beads were exposed to ferrous ammonium sulfate (a known virucidal agent) for 5 minutes, and their titer was measured. The plaque-forming units / ml (pfu / ml) were compared to the titer of D29 phage beads that were not treated with the virucidal agent.

[0231] Results and Discussion The decrease in pfu / ml indicates that viable phages were inactivated by the antiviral agent (Figure 20). These data confirm that the phages bound to the magnetic beads used in the above experiment were viable and were the cause of the lysis.

[0232] Example 10 - The ability of PhMS to dissolve mycobacteria Materials and methods 10 3BCG cells / ml of Mycobacterium bovis were incubated with D29 phage beads at 37°C for 30 minutes. The supernatant was then titrated (pre-MS). Next, the sample was exposed to a magnet for 3 minutes, and the supernatant was removed. The magnetic beads were resuspended in 50 μl of 7H9(+), and the supernatant was titrated (post-MS). The sample was incubated at 37°C for 3 hours, exposed to a magnet for 3 minutes, and the supernatant was titrated (end of assay).

[0233] Results and Discussion The ability of phage beads to lyse mycobacteria was investigated. In the phage life cycle, progeny phage production occurs before host lysis. The increase in phage in the supernatant at the end of the assay indicates the production and release of progeny phage (Figure 21).

[0234] Example 11 - Capture and insolubility of thermally inactivated BCG by phage beads Materials and methods 10 3 BCG cells / ml of Mycobacterium bovis were heated at 95°C for 10 minutes. Next, D29 phage beads were added and incubated at 37°C for 30 minutes. The supernatant was then titrated (pre-MS). Next, the sample was exposed to a magnet for 3 minutes and the supernatant was removed. The magnetic beads were resuspended in 50 μl of 7H9(+) and the supernatant was titrated (post-MS). The sample was incubated at 37°C for 3 hours, exposed to a magnet for 3 minutes, and the supernatant was titrated (end of assay).

[0235] Results and Discussion As shown in Figure 22, mycobacteria need to be able to survive in order to infect with the phage-bead lysis agent and produce progeny phages.

[0236] Example 12 - Unbound magnetic beads cannot capture BCG. Materials and methods 10 3PhMS assays were performed using Mycobacterium bovis (BCG) cells / ml with magnetic beads that were not bound to phages. The number of BCG cells in the supernatant was counted before and after magnetic separation.

[0237] Results and Discussion No decrease in free mycobacteria was observed before and after magnetic separation (Figure 23). This indicates that phages are necessary to capture mycobacteria.

[0238] Sequence List Sequence ID 1

number

number

number

number

number

number

number

number

number

number

number

number

number

number

number

number

number

number

number

number

number

number

number

number

number

number

number

number

number

number

number

number

Claims

1. Methods for detecting the presence or absence of mycobacteria in a sample, including the following: (a) The sample is brought into contact with a solvent containing one or more bacteriophages bound to a solid support; provided that if viable mycobacteria are present in the sample, the viable mycobacteria are dissolved in the solvent and the nucleic acids of the mycobacteria are released; (b) to carry out an isothermal amplification method for amplifying the nucleic acid of the mycobacteria and thereby obtain an amplification product; and (c) Detecting the presence or absence of the amplification product; the presence of the amplification product indicates the presence of mycobacteria in the sample, and the absence of the amplification product indicates the absence of mycobacteria in the sample.

2. A method for diagnosing the presence or absence of mycobacterial infection in a subject, comprising detecting the presence or absence of mycobacteria in a sample obtained from the subject using the method described in claim 1, However, the presence of mycobacteria in the sample indicates the presence of mycobacterial infection in the subject, and the absence of mycobacteria in the sample indicates the absence of mycobacterial infection in the subject.

3. The method according to claim 1 or 2, wherein eukaryotic cells present in the sample are selectively lysed before or during step (a).

4. The eukaryotic cells then H 2 The method according to claim 3, wherein the substance is selectively dissolved by contact with a composition containing o, guanidinium thiocyanate, a composition containing saponin, a composition containing sodium cholate, phosphate-buffered saline (PBS), or a mycobacterial growth medium.

5. The method according to any one of claims 1 to 4, wherein the dissolving agent captures the viable mycobacteria on the solid support by interaction between the one or more bacteriophages and the viable mycobacteria.

6. The method according to claim 5, wherein step (a) comprises separating the solid support and the captured viable mycobacteria from the sample before the release of the nucleic acids of the mycobacteria.

7. The method according to claim 6, wherein the solid support is a bead, and optionally the bead is a magnetic bead or a paramagnetic bead, and separation is achieved by applying a magnetic field or including the application of a magnetic field.

8. The method according to claim 6, wherein separation is achieved by filtration or includes filtration, and the solid support is optionally beads.

9. The method according to any one of claims 1 to 8, wherein there is no step of separating and / or concentrating the nucleic acids of the released mycobacteria between step (a) and step (b).

10. The one or more bacteriophages mentioned above include two or more different bacteriophage species, and the solvent may include (i) Two or more different bacteriophage species bound to the same solid support; and / or (ii) Two or more different bacteriophage species bound to different solid supports The method according to any one of claims 1 to 9, including the method described in any one of claims 1 to 9.

11. The method according to any one of claims 1 to 10, wherein the one or more bacteriophages can lyse viable mycobacteria, and optionally the one or more bacteriophages include D29 and / or TM4.

12. The method according to any one of claims 1 to 11, wherein the isothermal amplification method comprises loop-mediated isothermal amplification (LAMP) or recombinase polymerase amplification (RPA).

13. The method according to any one of claims 1 to 12, wherein the presence or absence of the amplification product is detected in step (c) using a nucleic acid staining agent that causes a colorimetric reaction, and optionally the nucleic acid staining agent comprises SYBR Green 1, EvaGreen, calcein and / or hydroxynaphthol blue.

14. The method according to any one of claims 1 to 13, wherein the presence of the amplification product further indicates one or more characteristics of the mycobacteria present in the sample.

15. The method according to any one of claims 1 to 14, wherein one or more of the aforementioned properties include resistance to treatment such as isoniazid resistance.

16. The method according to any one of claims 1 to 15, wherein the mycobacteria comprises the following. (i) one or more species of Mycobacterium tuberculosis complex (MTBC), optionally Mycobacterium tuberculosis and / or Mycobacterium bovis; (ii) One or more Mycobacterium avium complex (MAC) species, optionally Mycobacterium avium subspecies paratuberculosis; (iii) Mycobacterium smegmatis; (iv) Mycobacterium ulcerans; (v) Mycobacterium leprae; and / or (vi) one or more non-tuberculous mycobacteria (NTM), optionally Mycobacterium abscessus complex, Mycobacterium kansasii, and / or Mycobacterium marinum.

17. The nucleic acid of the mycobacteria is (i) Insertion array, optionally IS6110, IS900, or IS2404; (ii) Deletion of the RD4 sequence; or (iii) 16S rRNA sequence The method according to any one of claims 1 to 16, including the method described in any one of claims 1 to 16.

18. The method according to any one of claims 1 to 17, wherein the sample is an animal sample or a human sample.

19. The method according to any one of claims 1 to 18 is as follows: (i) The sample is a body fluid, optionally blood, milk, cerebrospinal fluid, semen, synovial fluid, amniotic fluid, sputum, saliva, lymph, or urine, or derived from such body fluid, and optionally the sample is a bulk milk tank sample; (ii) The sample is a fecal sample or derived from a fecal sample; or (iii) The sample is a breath sample or derived from a breath sample; or (iii) The sample is a tissue sample; optionally, (1) the sample is a fine-needle aspiration, a tissue swab or a biopsy, and / or (2) the tissue is lung.

20. The method according to claim 19, wherein the sample is blood, cerebrospinal fluid, sputum, or urine, or derived therefrom.

21. The method according to any one of claims 2 to 20, wherein the subject is a human, and optionally the human is suffering from or suspected to be suffering from tuberculosis, Crohn's disease, ulcerative colitis, irritable bowel syndrome, psoriasis, thyroiditis, sarcoidosis, Parkinson's disease, multiple sclerosis, type 1 diabetes, arthritis, ankylosing spondylitis, Buruli ulcer, leprosy, nontuberculous mycobacterial (NTM) infection, cystic fibrosis, focal granuloma and / or ascending lymphangitis, and optionally the ascending lymphangitis resembles sporotrichumosis.

22. The method according to any one of claims 2 to 20, wherein the subject is an animal, and optionally a ruminant such as a cow, sheep, or goat.

23. The method according to claim 22, wherein the animal is suffering from or suspected to be suffering from tuberculosis or Johne's disease.

24. A solvent comprising two or more different bacteriophage species, each bound to a solid support, capable of lysing viable mycobacteria.

25. The solvent according to claim 24, comprising (i) two or more different bacteriophage species bound to the same solid support, and / or (ii) two or more different bacteriophage species bound to different solid supports.

26. The solvent according to claim 24 or 25, wherein each of the two or more bacteriophage species can dissolve viable mycobacteria, and optionally, the two or more bacteriophage species include D29 and / or TM4.

27. The dissolving agent according to any one of claims 24 to 26, wherein the solid support is beads, optionally magnetic beads, or paramagnetic beads.

28. A kit comprising the solvent according to any one of claims 24 to 27.

29. The kit according to claim 28, wherein the kit further comprises one or more additional components, the one or more additional components comprising: (i) Primer; (ii) DNA polymerase; (iii) Reverse transcriptase; (iv) Nucleic acid staining agents; (v) Deoxyribonucleotide triphosphate; (vi) DNA destabilizers; and / or (vii) Buffer.

30. The kit according to claim 28 or 29, wherein the kit further includes instructions for carrying out the method described in any one of claims 1 to 23 using the kit.

31. The kit according to any one of claims 28 to 30, wherein the solvent or the one or more additional components are dried.

32. The kit according to claim 31, wherein the solvent or the one or more additional components are freeze-dried.

33. The kit according to any one of claims 29 to 32, wherein the solvent and the one or more additional components are combined as a reagent mixture.

34. Use of the solvent according to any one of claims 24 to 27, or the kit according to any one of claims 28 to 33, in the method according to any one of claims 1 to 23.