Combined molecules

Abstract

This disclosure provides transgenic non-human animal cells useful for producing human heavy chain-only antibodies (HCAbs). Also disclosed are methods for generating human HCAbs specific to a desired antigen, and methods for generating pharmaceutical compositions containing antibodies specific to a desired antigen.

Description

Technical Field

[0001] The present disclosure relates to the production of antibodies with only complete human heavy chains in non-human animal cells.

Background Art

[0002] The antigen-binding region of natural human immunoglobulins is composed of two variable domains (heavy chain variable (VH) domain and light chain variable (VL) domain), which pair together to form the Fv region. The Fv region has an antigen-binding site provided by the variable amino acid sequences of six loops (complementary determining regions (CDRs)). The VH domain contains HCDR1, HCDR2, and HCDR3 interspersed with framework regions (FRs), and the VL domain contains LCDR1, LCDR2, and LCDR3 interspersed with FRs. One or more CDRs of the VH domain and / or VL domain bind to the antigen. The HCDR3 of the VH domain often plays a major role in antigen binding, but other CDRs of both domains can contribute and often do. Even when the antigen binds only to or mainly to the CDRs of the VH domain, the presence of the VL domain in the Fv can stabilize the VH in a functional binding conformation.

[0003] Antibody variable domains are generated in vivo through combinatorial rearrangement of gene segments at the immunoglobulin (Ig) locus within B lymphocyte lineage cells, thereby providing a repertoire of encoded amino acid sequences capable of binding to diverse immunogenic stimuli faced by the immune system. In humans, the Ig heavy chain locus contains approximately 41 functional V gene segments, 27 functional D gene segments, and 6 functional J gene segments, depending on the haplotype. Nucleic acids encoding the VH domain are generated through VDJ gene segment recombination. The V gene segments encode the N-terminal region of the polypeptide chain, including FR1, HCDR1, FR2, HCDR2, FR3, and the HCDR3 origin, while the D gene segments are contained within HCDR3, and the J gene segments provide the end and C-terminal framework region FR4 of HCDR3. The highly mutable nature of the HCDR3 sequence in the antibody repertoire reflects the combinatorial diversity generated by rearrangements of many different V, D, and J segments.

[0004] Humans possess two Ig light chain loci, kappa(k) and lambda(λ). Depending on the haplotype, the human Ig light chain loci contain approximately 40 functional Vk segments, 5 functional Jk segments, 29 functional Vλ segments, and 4 functional Jλ segments. Recombination of the two gene segments V and J at either the kappa(k) or lambda(λ) locus generates nucleic acids encoding the VL domain. The V gene segment encodes FR1, LCDR1, FR2, LCDR2, FR3, and the first portion of LCDR3, while the J gene segment forms the second portion of LCDR3 and FR4. In addition to combinatorial diversity arising from VDJ and VJ recombination, and VH / VL pair formation, further antibody sequence diversity is generated by conjugational mutations at the junction of gene segments and by in vivo processes of somatic hypermutation in response to antigen binding.

[0005] International Publication No. 90 / 05144 (MRC) disclosed that when the VH domain is isolated from a complete antibody containing heavy and light chains, it can bind to the antigen in a 1:1 ratio with a binding constant equal to that of the complete antibody molecule.

[0006] Camelids (the animal family including camels and llamas) naturally produce antibodies that bind to antigens via an unpaired VH domain in the absence of a VL. These antibodies completely lack an immunoglobulin light chain and are bivalent binders composed of a homodimeric heavy chain containing an antigen-binding single VH or "VHH" domain, a hinge region, and a dimerized constant region containing CH2 and CH3 domains. While homologous to the heavy chain of classical mammalian antibodies, these "heavy chain antibodies" ("HCAb") lack the first domain (CH1) of the constant region, which is spliced ​​out during mRNA processing (International Publication No. 94 / 04678, Casterman & Hamers; International Publication No. 96 / 34103, Hamers & Muyldermans).

[0007] Similar mutations occur in a pathological condition in humans known as heavy chain disease. Immunoglobulin heavy chains containing VH, CH2, and CH3 domains but lacking the CH1 domain are expressed. In patients with this disease, heavy chains have been found to accumulate instead of pairing with light chains to form normal antibodies.

[0008] Cartilaginous fish such as sharks also possess antibodies composed of heavy chains and lacking any light chains. These antibodies are called IgNARs (novel immunoglobulin antigen receptors) and have been used as a source for single-domain antibodies called VNAR fragments.

[0009] Researchers have been working to develop single variable domain antibodies into pharmaceuticals. These molecules, known as domain antibodies (dAbs), are physiologically active as monomers and, due to their small size and inherent stability, are well-suited for integration into larger molecules, resulting in drugs with extended serum half-lives and / or enhanced other pharmacological activities. Antigen-binding molecules containing a single variable domain of an antibody include immunoconjugates (e.g., dAb-toxins) and chimeric antigen receptors (CARs). For this purpose, antibody single variable domain binders have been cloned and expressed in recombinant systems, and in vitro libraries of such binders have been prepared for selection and screening using systems such as phage display.

[0010] Experimental animals such as mice have been genetically engineered to express heavy chain antibodies as an additional source of single antigen-binding variable domains. This can begin by knocking out (deleting or inactivating) the animal's endogenous Ig light chain locus (International Publication No. 92 / 03918, Genpharm; International Publication No. 03 / 000737, The Babraham Institute). Subsequently, the heavy chain alone is expressed and homodimerized. However, the CH1 domain of the heavy chain is inherently irregular and adopts a typical immunoglobulin fold only when interacting with its cognitive partner, the Ck or Cλ domain of the light chain. Expression of Ig heavy chains has been reported to be unproductive due to misfolding and aggregation of the CH1 domain.

[0011] Nevertheless, in light chain-deficient mice, several functional HCAbs are spontaneously produced through variations in the class switch mechanism. In class switching, the nucleic acid encoding VH is normally conjugated to the nucleic acid encoding the CH1-CH2-CH3 constant region, but in the abnormal mechanism, VH is conjugated only to CH2-CH3. The resulting HCAbs, like HCAbs in camelids, lack the CH1 domain and can be expressed and selected for antigen binding. However, functional HCAbs are produced by this method only with low efficiency because the normal class switch mechanism is dominant and produces a complete Ig heavy chain containing CH1.

[0012] Therefore, mouse strains used to generate heavy-chain antibodies have been engineered to have a genetic deletion of the CH1 domain of the immunoglobulin heavy chain and a knockout of the light chain. Such mice produce antibodies containing a dimeric heavy chain and lacking a light chain, with each heavy chain having a variable (VH) domain as well as constant regions CH2 and CH3. The constant regions dimerize to form an Fc region, while the two VH domains are available for bivalent antigen binding. After immunization of mice with a target antigen, antigen-specific heavy-chain antibodies can be produced, selected, affinity-matured in vivo, and isolated. The nucleic acids encoding the VH domains can then be selectively expressed and cloned by recombination, if it is desired to provide a polypeptide containing the VH domains in association with a larger molecule such as a CAR or other product for therapeutic or diagnostic use.

[0013] Erasmus Universiteit Rotterdam has described a transgenic mouse whose genome contains exons derived from the camelid VHH domain or “camelized” VH domain, and a heavy chain constant region gene that does not express the functional CH1 domain (International Publication No. 02 / 085944, International Publication No. 02 / 085945, International Publication No. 2006 / 008548, International Publication No. 2010 / 109165). “Camelized” VH is a human (or other non-camelid) VH sequence mutated to resemble camelid VHH. In this transgenic mouse, the heavy chain gene is engineered to exclude the functional CH1 domain. As reported in International Publication No. 02 / 085944, the absence of CH1 prevented the heavy chain antibody from associating with the light chain to form a “conventional” antibody because CH1 was the natural partner for the light chain constant domain. International Publication No. 2006 / 008548 reported that normal B cell maturation and antibody production in mice depend on the complete absence of the CH1 sequence from each heavy chain constant region located at the transgenic locus. International Publication No. 2004 / 049794 (The Babraham Institute) describes the production of HCAb from the YAC transgene in mice, in which the CH1 domain of the heavy chain is excised by splicing during mRNA processing. Next, the resulting mice were crossed with mice in which the endogenous heavy chain and light chain genes were knocked out to create mice that expressed only the desired HCAb.

[0014] Unfortunately, mice with only heavy chains lacking a CH1 deletion in the Ig heavy chain do not have a normal B cell population. Mice in which the DNA encoding the CH1 domain was deleted from both the μ and γ heavy chain constant region genes produced CH1-deficient IgM heavy chains (CH1Δμ) and CH1-deficient IgG heavy chains (CH1Δγ), but the proportion of immature B cells in these mice increased and differentiation into follicular zone B cells and marginal zone B cells was impaired (Janssens et al., PNAS (2006) 103(41):15130-15135).

[0015] Human VH domains are desired for human administration for various reasons. Human VH domains exhibit improved stability, are smaller in size compared to full-length antibodies, and enable the creation of antibodies directed at a broader range of targets, including epitopes that conventional antibodies cannot target. Furthermore, human VH domains have fewer associated immunogenic side effects in patients compared to the administration of non-human polypeptides such as camelid VHH. Transgenic mice expressing human antibody heavy chains are a source of human VH domains that undergo in vivo selection for antigen binding. However, human antibodies naturally contain both heavy and light chains, and only a subset of the heavy chain variable region can produce functional heavy chain antibodies in the absence of the light chain. Therefore, human VH domains derived from heavy chain antibodies produced in heavy chain-only mice lack the sequence diversity of VH domains derived from full immunoglobulin. The limitation of the human VH domain repertoire in such mice is further complicated when the human Ig heavy chain gene is introduced at random insertion points in the mouse genome. This is because ectopic transgenic loci are shorter than those in humans (thought to result from limitations in N addition during VDJ recombination) and undergo limited hypermutation, producing VH domains with already low VH domain diversity due to the presence of HCDR3 sequences. This appears to be an inherent limitation of known random insertion transgenic platforms for human antibody production. The latter problem can be addressed by incorporating human immunoglobulin genes at endogenous immunoglobulin loci in the host animal, rather than at random locations in the genome (Lee et al., Nature Biotech (2014) 32(43):356-363).

[0016] Recombination and somatic hypermutation at native loci in such mice can generate broader sequence diversity, allowing the less soluble VH domain to evolve in vivo into one with improved biophysical properties (solubility, etc.).

[0017] International Publication No. 2011 / 072204 (Regeneron Pharmaceuticals) described a mouse that expresses a heavy chain antibody containing a human VH domain and a mouse constant region lacking the CH1 domain. This mouse is said to have a germline deletion of the CH1-coding sequence in the endogenous Ig constant region gene, and is unable to express IgG mRNA containing the CH1 domain-coding sequence. However, the mouse retained the ability to express normal functional IgM antibodies because the CH1 domain of the IgM isotype constant domain was not deleted.

[0018] International Publication No. 2013 / 171505 (Kymab Limited) describes mice engineered to express normal IgM antibodies and CH1-deficient IgG antibodies, where a step-specific class switch from IgM to IgG in lymphocytes is accompanied by inactivation of the endogenous Ig light chain locus and genetic deletion of CH1 from the IgG constant region, resulting in IgG antibody expression by the cells in the absence of light chain expression. This modification allows the development of the antibody and B cell compartment to proceed through a preferred quadruple (H2L2, i.e., antibody containing two heavy chains and two light chains) endogenous IgM step, followed by a subsequent IgG step that selects only heavy chain-only (H2) antibodies from a good pool of heavy chain VDJ recombinations provided by the previous quadruple IgM step. This subsequent step essentially eliminates the possibility of quadruple antibodies.

[0019] International Publication No. 2018 / 039180 (Teneobio Inc.) reported that HCAbs with a lower tendency to aggregate can be prepared by substituting a native amino acid residue at the first position of FR4 of the HCAb with another amino acid residue, thereby disrupting a surface-exposed hydrophobic patch that would otherwise be embedded within the VH-VL interface in normal Fv. Exposure to the hydrophobic patch was identified as a causative factor in undesirable heavy chain aggregation in the absence of light chains and in VH-VL domain pair formation in the presence of light chains. Rats were genetically engineered to express HCAbs containing the identified VH residue mutations, and heavy chain homodimerization was performed by inactivating the endogenous light chain locus.

[0020] Xu et al (Nature (2021) 595:278-282) disclose mice containing VHH genes derived from alpacas, dromedary camels, and camels, which contain CH1 deletions in Cμ and Cγ1 and retain the mouse constant region, in order to produce nanobodies useful for neutralizing SARS-CoV-2 variants.

[0021] International Publication No. 2022 / 126113 (Trianni Inc.) describes mice engineered to produce IgG-type HCAb by incorporating a transgenic Cγ gene segment upstream (5' to 3' orientation) of an endogenous Cμ gene segment within the constant region locus of the endogenous immunoglobulin heavy chain, wherein the Cγ gene segment contains a deletion of at least a portion of the CH1 domain.

[0022] European Patent Application Publication No. 3770261 A1 (Chongqing Jinmaibo Biotec. Co.) discloses using transgenic host animals to produce humanized single domain antibodies. According to this disclosure, all IgM sequences and all IgG regulatory control sequences are derived from the host animal, and the CH1 sequence of IgM is deleted. The IgG Cγ sequence is a human sequence, and the CH1 sequence of IgG is deleted. The inventors disclose that the use of host animal genes is essential to ensure proper B cell development in transgenic animals to ensure normal B cell development.

[0023] In this technology, a new approach for producing HCAb is still needed.

Summary of the Invention

Means for Solving the Problems

[0024] A first aspect of this disclosure provides a non-human animal cell comprising a plurality of human IgH V gene segments, one or more human IgH D gene segments, and one or more human IgH J gene segments upstream of all or part of the human heavy constant (C) region, forming an antibody heavy chain locus of the human heavy VDJC region: i) The human heavy VDJC DNA is inserted upstream, downstream, or at the endogenous non-human animal IgH locus of the endogenous non-human animal IgH locus; ii) The human heavy chain constant region includes Cδ, Cε, Cγ2, Cγ3, and / or Cα gene segments each encoding a CH1 domain, includes Cμ and Cγ1 gene segments, and the Cμ CH1 domain and the Cγ1 CH1 domain are inactivated; iii) There is substantially no light chain expression and substantially no non-human heavy chain expression.

[0025] A second aspect of this disclosure provides a non-human animal comprising a plurality of cells according to the first aspect, which can express an antibody repertoire of only IgM and IgG heavy chains.

[0026] A third aspect of the present disclosure is a method for generating an antibody consisting of only a human heavy chain specific for a desired antigen, comprising immunizing a non-human animal according to the second aspect of the present disclosure with the desired antigen, and recovering an antibody or its coding nucleic acid from the animal, or recovering cells producing the antibody.

[0027] A fourth aspect of the present disclosure is a method for generating a pharmaceutical composition comprising an antibody specific for a desired antigen and a pharmaceutically acceptable carrier or other excipient, comprising immunizing a non-human animal according to the second aspect of the present disclosure with the desired antigen, recovering the antibody, and formulating the antibody together with a pharmaceutically acceptable carrier or other excipient. BRIEF DESCRIPTION OF THE DRAWINGS

[0028] [Figure 1] Provide an overview of the process for humanizing the IgH constant region on chromosome 12 in embryonic stem cells (mESCs) of transgenic mice according to the present disclosure by recombinase-mediated cassette exchange (RMCE). [Figure 2] Provide an overview of the mouse Ig heavy chain locus on chromosome 12, which contains a set of 41 V gene segments, a set of D gene segments, and a set of 6 J gene segments, which are large fragments of the human Ig heavy chain locus (in the order of 5' to 3'), upstream of the gene encoding the set of heavy chain constant regions of Cμ~Cα. [Figure 3] Illustrate a 200 kb deletion of the endogenous mouse lambda locus to create a lambda knockout. [Figure 4] Provide an overview of a method for manipulating the mouse Ig heavy chain locus according to the present disclosure, which requires a first deletion of CH1 in Cμ and a second deletion of CH1 in Cγ1 thereafter. [Figure 5] Show a strategy for achieving CC1-3 Cμ CH1 deletion. [Figure 6] Show a strategy for creating an allele with a partial deletion of Cγ1 CH1. [Figure 7]This paper presents a strategy for generating alleles with complete deletions of Cγ1 CH1 and CH1-hinged introns. [Figure 8] The Vega2-28 Cγ1 locus (8a), the Vega2-31 Cγ1 locus (8b), and the Vega2-32 Cγ1 locus (8c) are given as examples. [Figure 9-1] The IgG titers of transgenic mice in response to immunization with recombinant protein antigen (immunogen A) are shown. The transgenic mice have anti-immunogen A specific IgG titers, as evidenced by the increased signaling from SB to TB (Figures 9A and 9B), which are target-specific, as both PB controls and parental cell line controls are negative (Figures 9C and 9D). [Figure 9-2] Same as above. [Figure 10] This describes the IgG titer of transgenic mice in response to immunization with an antigen presented as mRNA-LNP (immunogen B). The transgenic mice of this disclosure have an anti-immunogen B specific IgG titer, as evidenced by the increased signaling from BL1 to BL2 and TB, which is target-specific as it is negative for the D0 control. [Figure 11-1] Histograms are shown, generated by comparing sequencing datasets from immunized transgenic mice with similar sequencing datasets from naive mice. The number of germline nucleotide mutations was quantified by identifying the V segment in each dataset. Figure 11A shows the IgM sequences from naive transgenic mice (n=8,519); Figure 11B shows the IgM sequences from transgenic mice immunized with immunogen A (n=9,934); Figure 11C shows the IgG sequences from naive transgenic mice (n=576); and Figure 11D shows the IgG sequences from transgenic mice immunized with immunogen A (n=1,472). [Figure 11-2] Same as above. [Figure 12]The distribution of LIBRA-Seq scores segmented by isotype is shown. IgG antibodies are associated with a shift to higher LIBRA-Seq scores compared to IgM antibodies. [Figure 13] The affinity of only 63 heavy chain antibody clones obtained from the transgenic non-human animal platform of this disclosure is illustrated. [Modes for carrying out the invention]

[0029] In a first aspect, the disclosure relates to non-human animal cells that include a plurality of human IgH V gene segments, one or more human IgH D gene segments, and one or more human IgH J gene segments upstream of all or part of the human heavy constant (C) region, and that include an antibody heavy chain locus forming a human heavy VDJC region: i) Human heavy VDJC DNA is inserted upstream, downstream, or at the endogenous non-human animal IgH locus; ii) The human heavy chain constant region includes the Cδ, Cε, Cγ2, Cγ3, and / or Cα gene segments, each encoding a CH1 domain, and the Cμ and Cγ1 gene segments, wherein the Cμ CH1 domain and the Cγ1 CH1 domain are inactivated; iii) There is virtually no expression of light chains and virtually no expression of non-human heavy chains.

[0030] As used herein, the terms “human heavy VDJC DNA,” “human heavy VDJC DNA,” “human heavy VDJC region,” or “human heavy VDJC” refer to the DNA encoding the V (variable), D (diversity), and J (conjugation) gene segments (also referred to as “segments”), and the C (stationary) gene (also referred to as “stationary region”).

[0031] As used herein, the term "locus" refers to a specific location on a chromosome where a gene, a gene segment, or a gene region containing multiple gene segments is located.

[0032] As used herein, the terms "VDJ region" or "V(D)J region" refer to DNA encoding the V, D, and J gene segments in the heavy chain, and the V and J gene segments in the light chain. In one embodiment, the cells are homozygous for the antibody heavy chain gene locus.

[0033] As used herein, “endogenous” means that a gene, region (e.g., a variable region or a constant region), or locus is a gene, region, or locus that is normally found in vertebrates or cells (as opposed to exogenous genes, regions, or loci that are not normally found in such vertebrates or cells, e.g., human sequences). For example, an endogenous constant region may be encoded by the wild-type genome of a non-human vertebrate or cell. Thus, in the example where the vertebrate is a mouse, the endogenous constant region would be a mouse constant region.

[0034] Human heavy VDJC DNA can be inserted upstream, downstream, or at the endogenous non-human animal IgH locus; in other words, human heavy VDJC DNA can be inserted at any location within the chromosome, including the endogenous non-human animal IgH locus.

[0035] As used herein, the term "substantially absent" means that the antibody chain (e.g., kappa or lambda light chain, or non-human heavy chain V, D, J, or C segment) is essentially not expressed at all (e.g., less than 10, 5, 4, 3, 2, 1, or 0.5%, or 0%) (e.g., endogenous light chain is not expressed, and non-human heavy chain is not expressed). In certain embodiments, neither kappa nor lambda light chains are expressed. This can be determined, for example, at the antibody chain (protein) level by evaluating the antibody repertoire produced by non-human animals, or at the nucleotide level by evaluating the mRNA transcript of the antibody chain locus using, for example, RACE. In some embodiments, in the non-human animal cells of the present invention, there is no expression of any light chains and no expression of any non-human heavy chains.

[0036] Non-human animal cells according to this disclosure produce advantageous full-human heavy-chain-only antibodies (HCAb) in several ways, as described in more detail below. These non-human animal cells can produce antibodies of both IgM and IgG isotypes. (Complete or partial) inactivation of the CH1 domain in Cμ and Cγ1 allows for the preservation of the IgM-to-IgG class switch and enables a natural affinity maturation process, resulting in greater diversity of full-human antibodies. Furthermore, the presence of populations of only IgM and IgG heavy chains in non-human animals allows for the distinction between somatically hypermutated and non-hypermutated populations. It is possible to select only the IgG population that is more likely to have high binding affinity to a given antigen of interest. Moreover, the absence of any light chain sequences in HCAb overcomes the problem of residual pairing of light chains with, for example, ΔCH1 IgM / ΔCH1 IgG heavy chains or other isotypes during B cell proliferation and somatic mutation. Transgenic non-human animals according to this disclosure can produce fully human serum antibodies, i.e., human polyclonal serum in response to immunization. This can be directly analyzed by assays designed to examine the human IgG1 response.

[0037] Antibody, variable domain, and specific antigen binding As used herein, the term "antibody" includes monoclonal antibodies (such as full-length antibodies having an immunoglobulin Fc region), antibody compositions having polyepitope specificity, multispecific antibodies (e.g., bispecific antibodies), single-chain molecules, and antibody fragments.

[0038] The terms “antibody,” “heavy chain-only antibody (HCAb),” and “H2 antibody” are used interchangeably herein. To avoid misunderstanding, all antibodies relating to this disclosure are heavy chain-only antibodies (HCAb) that do not contain a functional light chain variable region or a functional light chain constant region.

[0039] The antibodies and polypeptide domains described herein are fully human antibodies directly produced from transgenic non-human animals whose genomes have been engineered to contain human variable region gene segments and human constant region genes. Therefore, the antibodies of the present invention are human antibodies comprising multiple human heavy chain variable regions and human heavy chain constant regions. The human heavy chain constant regions are modified to inactivate the CH1 region in the Cμ and Cγ gene segments.

[0040] The antibody variable domain provides a binding site for the antigen. Recognition between an antibody and its cognitive antigen can be called specific binding, in contrast to nonspecific binding, where an antibody or other polypeptide binds to a non-target molecule via relatively low affinity interactions. Antigen binding of the variable domain is mediated by contact between the antigen and one or more residues in the CDR (HCDR or LCDR). One or more FR residues of the variable domain can also come into contact with the antigen. The region of the antigen to which the antibody binds is called the epitope. The region of the antibody that binds to the antigen is called the paratope.

[0041] A variable domain or binding site that "specifically binds" or is "specific" to a particular antigen or epitope may bind to that particular antigen or epitope without substantially binding to other antigens or epitopes. For example, binding to an antigen or epitope is specific when the antibody binds at a KD of 1 mM or less, e.g., 100 mM or less, 10 pM or less, 1 pM or less, 100 nM or less, e.g., 10 nM or less, 1 nM or less, 500 pM or less, 100 pM or less, or 10 pM or less. Binding affinity (K DThe affinity can be determined using standard procedures known to those skilled in the art, such as affinity determination using binding and / or surface plasmon resonance (SPR) in ELISA (e.g., BIAcore®, Proteon®, or KinExA® solution-phase affinity analyzer (Sapidyne Instruments, Idaho) capable of detecting fM affinity). In one embodiment, the SPR is performed at 25°C. In another embodiment, the SPR is performed at 37°C. In one example, the SPR is performed at physiological pH, e.g., about pH 7 or pH 7.6 (e.g., using Hepes buffered saline (also known as HBS-EP) at pH 7.6). In one embodiment, the SPR is performed at physiological salt levels, e.g., 150 mM NaCl. In one example, the SPR is performed at detergent levels of 0.05% by volume or less in the presence of, for example, 0.05% P20 (polysorbate 20; e.g., Tween-20®) and 3 mM EDTA. SPR can be performed at 25°C or 37°C in a pH 7.6 buffer, 150 mM NaCl, 0.05% detergent (e.g., P20), and 3 mM EDTA. The buffer may contain 10 mM Hepes. In one example, SPR is performed at 25°C or 37°C in HBS-EP. HBS-EP is available from Teknova Inc (California; catalog number H8022).

[0042] bispecific antibody HCAb is useful in bispecific or multispecific antigen-binding forms. Such forms may include first and second variable domains, where the first variable domain specifically binds to a first antigen or epitope, and the second variable domain specifically binds to a second antigen or epitope. The first and second variable domains may have different amino acid sequences to bind to different first and second antigens / epitopes, respectively. The different epitopes may be one antigen or epitopes of different antigens. For example, the first variable domain may specifically bind to antigen A (but not to antigen B), and the second variable domain may specifically bind to antigen B (but not to antigen A).

[0043] Providing an antigen-binding site within a variable domain expressible as part of a single polypeptide chain has advantages because it allows for the creation of bispecific antibodies through the association (e.g., after co-expression) of two such polypeptides containing different variable domains (and therefore different antigen-binding sites). This contrasts with the more complex creation of typical quadruple-chain bispecific antibodies, which involve two different heavy-light chain pairs and thus four different polypeptide chains.

[0044] IgH variable region manipulation Non-human animal genomes can be engineered to contain multiple human heavy chain V gene segments, one or more human heavy chain D gene segments, and one or more human heavy chain J gene segments for the expression of a human VH domain. Non-human animal genomes may contain the complete set of all human heavy chain V, D, and J gene segments. The V, D, and J gene segments can be rearranged. A human VDJ region can be inserted upstream of a constant region to produce a VH domain operably linked to the constant region. As discussed below, the constant region is the human constant region.

[0045] Recombination of the V(D)J gene segment creates combinatorial diversity in each variable domain. By including a complete set of human heavy chain gene segments, the complete combinatorial diversity of human variable domains can be incorporated into the transgenic animal platform. Affinity maturation of these variable domains then proceeds through a natural in vivo process of somatic hypermutation and selection, providing a broad and diverse sequence repertoire in which antigen-specific variable domains with desired properties can be identified and their sequences recovered.

[0046] Methods for producing transgenic animals having genomes containing all or part of human immunoglobulin loci are well known in the art. Such animals have been used to discover and produce several antibodies containing human variable domains that are currently marketed as pharmaceuticals. Methods for manipulating non-human animal genomes to contain human immunoglobulin gene segments are described, for example, in International Publication No. 2011 / 004192 (Genome Research Limited), which is incorporated herein by reference. Examples of transgenic non-human animals include the transgenic mice described in International Publication No. 2011 / 004192, VelociMouse®, OmniMouse®, Omnirat®, XenoMouse®, HuMab mouse®, and Memo Mouse®.

[0047] In one embodiment, the non-human animal is a chicken or a rodent. In one embodiment, the non-human animal is a rodent, preferably a mouse or a rat. Preferably, the transgenic non-human animal is a transgenic chicken or a transgenic rodent. In one embodiment, the transgenic non-human animal is a transgenic rodent, preferably a transgenic mouse or a transgenic rat.

[0048] In one embodiment, the inserted human DNA comprises at least 50%, for example, at least 60%, at least 70%, at least 80%, at least 90%, at least 95%, at least 99%, preferably all of the human heavy chain variable (V) genes.

[0049] In one embodiment, the inserted human DNA comprises at least 50% of the human heavy chain diversity (D) genes, for example, at least 60%, at least 70%, at least 80%, at least 90%, at least 95%, at least 99%, preferably all of the human D genes.

[0050] In one embodiment, the inserted human DNA comprises at least 50% of human heavy chain junction (J) genes, for example, at least 60%, at least 70%, at least 80%, at least 90%, at least 95%, at least 99%, preferably all human J genes.

[0051] The inserted human gene may originate from the same or different individuals, may be synthesized, or may represent a human consensus sequence.

[0052] In one embodiment, the human heavy chain locus inserted into a non-human mammal contains the complete repertoire of human V, D, and J gene segments. This inserted total human heavy chain genetic material is referred herein as the “human IgH VDJ region” or “human heavy VDJ region” and comprises human genome-derived DNA encoding all exons that encode the human V, D, and J portions, and preferably associated introns as well.

[0053] In one embodiment, the inserted human IgH VDJ region includes, in germline arrangement, all of the human-derived V, D, and J gene segments, as well as intervening sequences.

[0054] In contrast to random insertion, in situ targeting of human immunoglobulin locus DNA against endogenous immunoglobulin loci in non-human animals promotes appropriate and precise regulation of the immune response. Therefore, the transgenic animals of the present invention can exhibit a robust immune response, including somatic hypermutation and affinity maturation of antibody variable domains, after exposure to an immunogenic composition containing the target antigen.

[0055] In one embodiment, 800–1000 kb of the human IgH VDJ region is inserted into a non-human mammalian IgH locus, and in one embodiment, a 940, 950, or 960 kb fragment is inserted. Preferably, the bases 105,400,051–106,368,585 derived from human chromosome 14 are included (all coordinates refer to NCBI36 for the human genome and to ENSEMBL Release 54 and NCBIM37 for the mouse strain C57BL / 6J for the mouse genome).

[0056] In one embodiment, the inserted IgH human fragment consists of bases 105,400,051 to 106,368,585 derived from chromosome 14. In one embodiment, the inserted human heavy-chain DNA, for example, DNA consisting of bases 105,400,051 to 106,368,585 derived from chromosome 14, is inserted into mouse chromosome 12 between the end of the mouse J4 gene segment and the Eμ region, preferably between coordinates 114,667,091 and 114,665,190, preferably at coordinate 114,667,091.

[0057] According to this disclosure, there is substantially no expression of non-human heavy chains. In one embodiment, there is no expression of any non-human heavy chain V, D, or J gene segment. An exemplary methodology for inactivating endogenous VDJ sequences is provided in Example 1 below.

[0058] In one embodiment, the endogenous non-human animal heavy chain V, D, and J gene segments are inactivated to render them dysfunctional. This can be achieved by introducing loss-of-function mutations, complete or partial deletions, or inactivating mutations. In a preferred embodiment, the endogenous non-human animal heavy chain V, D, and J gene segments are inactivated by introducing a complete deletion. In another preferred embodiment, the endogenous non-human animal heavy chain V, D, and J gene segments are inactivated by introducing a partial deletion.

[0059] In one embodiment, inactivation is achieved by selectively inserting one or more site-specific recombinase sites into the genome by inverting all or part of a non-human animal VDJ gene segment, and then using the sites for recombinase-mediated excision or inversion of all or part of a non-human animal Ig locus. In one embodiment, a double inversion may be used for a more localized inversion, in which the VDJ gene segment is first moved away from the endogenous locus and then placed in the correct orientation. In one embodiment, a single loxP site is used to invert a non-human animal VDJ gene segment relative to a centromere locus or telomere locus.

[0060] In one embodiment, one or more inverted endogenous heavy chain J gene segments are partially or completely deleted.

[0061] In an alternative embodiment, the endogenous heavy chain VDJ region is inactivated by complete or partial deletion of the endogenous heavy chain V and / or J gene segments.

[0062] IgH steady-state region operation In addition to the heavy chain variable region, the genome of a non-human animal encodes the heavy chain constant region of the antibodies described herein. A locus containing a variable region gene segment further includes a constant region gene, e.g., a heavy chain constant region containing the CH1, CH2, and / or CH3 domains, and a hinge region positioned between CH1 and CH2 for adding flexibility. According to this disclosure, the constant region is a fully human IgH constant region; that is, the domains are of human origin, and all constant region sequences, including interdomain region sequences (e.g., hinge region sequences) and regulatory sequences (e.g., 5' enhancer sequence, switch region sequence, polyA, TM1 and TM2 sequences, 3' locus regulatory region (LCRT) sequence), are fully human sequences.

[0063] Non-human animal genomes may be manipulated to contain the complete repertoire of human constant region genes: IgM, IgD, IgG1, IgG2, IgG3, IgG4, IgE, IgA1, and IgA2, for example, by inserting fragments of human genomic DNA containing these genes.

[0064] Furthermore, intergenetic and regulatory elements of human immunoglobulin loci, including enhancers, are also preferably included.

[0065] In one embodiment, the inserted human heavy chain DNA is a complete human heavy chain VDJC region containing all intergenetic and regulatory elements of the human IgH locus.

[0066] An example sequence of a human constant region is provided in Table A of International Publication No. 2020 / 049128 (Kymab), the contents of which are incorporated herein by reference.

[0067] According to this disclosure, there is substantially no expression of non-human heavy chains. Therefore, there is substantially no expression of endogenous IgH constant regions. In one embodiment, there is no expression of any non-human IgH constant regions.

[0068] In one embodiment, the endogenous non-human animal IgHC C region is inactivated to render it dysfunctional. This can be achieved by introducing an inactivating mutation such as a loss-of-function mutation, complete or partial deletion, or inversion as described above. In one embodiment, the endogenous non-human animal IgHC region sequence is excised and replaced by an insertion of a human IgHC region sequence.

[0069] According to this disclosure, the human heavy chain constant region includes the Cμ gene segment and the Cγ1 gene segment, and optionally one or more of the alpha, delta, epsilon, and other gamma C gene segments. In one embodiment, the constant region includes all of the human Cμ, Cδ, Cε, Cγ1, Cγ2, Cγ3, and Cα gene segments.

[0070] In one embodiment, the Cμ gene segment is located upstream of the Cγ1 gene segment. In one embodiment, the gene segments of the C region are in the germline arrangement of the C segments found at the wild-type (human and mouse) IgH locus, namely Cμ, Cδ, Cγ3, Cγ1, Cα1, Cγ2, Cγ4, Cε, and Cα2 in the 5' to 3' direction.

[0071] According to this disclosure, the CH1 domain is inactivated in both the heavy chain Cμ gene segment and the Cγ1 gene segment so that there is no expression of the CH1 domain in the Cμ gene segment and / or the Cγ1 gene segment.

[0072] The CH1 domain can be inactivated in the Cμ and Cγ1 gene segments by any suitable means, such as loss-of-function mutations, partial or complete deletion of nucleotide sequences encoding at least a portion of the CH1 domain, or introduction of inactivating mutations that introduce a stop codon into the CH1 domain of the Cμ and / or Cγ1 gene segments.

[0073] As used herein, the term “loss-of-function mutation” may refer to any genetic alteration that results in the inactivation of a gene segment (i.e., loss of transcriptional activity and / or failure of functional protein expression) compared to a wild-type gene. Loss of function-related alterations may encompass an entire locus or be located within a gene sequence or within a regulatory or promoter sequence. Loss of function-related alterations include, but are not limited to, point mutations, insertions, deletions, frameshift mutations, and translocations that result in gene inactivation or a null allele genotype.

[0074] Inactivation of the CH1 domain in the Cμ and Cγ1 gene segments can be achieved by complete or partial deletion of the relevant gene segments, resulting in no CH1 expression in the Cμ and Cγ1 gene segments.

[0075] In one embodiment, CH1 is inactivated by partial deletion of the CH1 domain in the Cμ gene segment. In another embodiment, CH1 is inactivated by partial deletion of the CH1 domain in the Cγ1 gene segment. In yet another embodiment, CH1 is inactivated by partial deletion of both the CH1 domains in the Cμ and Cγ1 gene segments.

[0076] In one embodiment, the deleted portion of the CH1 domain includes all or part of the CH1 domain, preferably at least 50, 55, 60, 65, 70, 75, 80, 85, 90, 95, 99, or 100% of the total nucleotide sequence encoding the CH1 domain.

[0077] In one embodiment, CH1 is inactivated in the Cμ gene segment by complete deletion of the Cμ CH1 domain. In another embodiment, CH1 is inactivated in the Cγ1 gene segment by complete deletion of the Cγ1 CH1 domain.

[0078] In one embodiment, CH1 is inactivated by complete deletion of both the Cμ and Cγ1 CH1 domains in both the Cμ and Cγ1 gene segments.

[0079] As used herein, the term "complete deletion" refers to the deletion of the entire nucleotide sequence encoding the Cμ and / or Cγ1 CH1 domain.

[0080] As used herein, the term “partial deletion” refers to a deletion of less than 100% of the entire nucleotide sequence encoding the CH1 domain, which results in inactivation of the CH1 domain such that there is no expression of a functional CH1 domain protein. In one embodiment, “partial deletion” refers to a deletion of at least 50, 55, 60, 65, 70, 75, 80, 85, 90, 95, 96, 97, 98, or 99% of the entire nucleotide sequence encoding the CH1 domain.

[0081] In one embodiment, CH1 is inactivated in the Cμ gene segment by complete deletion of the entire Cμ CH1 domain, and CH1 is inactivated in the Cγ1 gene segment by partial deletion of the Cγ1 CH1 domain.

[0082] In one embodiment, CH1 is inactivated in the Cμ gene segment by partial deletion of the Cμ CH1 domain, and CH1 is inactivated in the Cγ1 gene segment by complete deletion of the entire Cγ1 CH1 domain.

[0083] Inactivation of the CH1 domain in the Cμ and Cγ1 gene segments can be achieved in a single or multi-step process. In one embodiment, inactivation of the gene segment can be achieved in a two-step process including a first partial or complete deletion of CH1 in Cμ, followed by a second partial or complete deletion of CH1 in Cγ1. This is illustrated in Figure 4 and described in Example 2 below.

[0084] In addition, the CH1 domain can be inactivated in the Cμ and C1 gene segments through a two-step process involving a first deletion of CH1 in Cγ1 and a subsequent second deletion of CH1 in Cμ.

[0085] In addition, the CH1 domain can be inactivated simultaneously in a single step, for example, by multiple modifications, in both the Cμ1 gene segment and the Cμ1 gene segment.

[0086] The CH1 domain is retained in some or all of the other constant region gene segments. In one embodiment, the heavy chain constant region encodes the CH1 domain in each of the Cδ, Cε, Cγ2, Cγ3, and Cα gene segments.

[0087] Accordingly, in one embodiment, the present disclosure relates to a non-human animal cell comprising an antibody heavy chain locus that includes a plurality of human IgH V gene segments, one or more human IgH D gene segments, and one or more human IgH J gene segments upstream of all or part of the human heavy constant (C) region, forming a human heavy VDJC region: i) Human heavy VDJC DNA is inserted upstream, downstream, or at the endogenous non-human animal IgH locus; ii) The human heavy chain constant region comprises the Cδ, Cε, Cγ2, Cγ3, and / or Cα gene segments, each encoding a CH1 domain, and the Cμ and Cγ1 gene segments, wherein the Cμ CH1 domain and the Cγ1 CH1 domain are inactivated by complete deletion of both CH1 domains; iii) No light chain expression and no non-human heavy chain expression.

[0088] All technical features disclosed herein apply to these embodiments.

[0089] In another embodiment, the disclosure relates to a non-human animal cell comprising an antibody heavy chain locus that includes multiple human IgH V gene segments, one or more human IgH D gene segments, and one or more human IgH J gene segments upstream of all or part of the human heavy constant (C) region, forming a human heavy VDJC region: i) Human heavy VDJC DNA is inserted upstream, downstream, or at the endogenous non-human animal IgH locus; ii) The human heavy chain constant region comprises the Cδ, Cε, Cγ2, Cγ3, and / or Cα gene segments, each encoding a CH1 domain, and the Cμ and Cγ1 gene segments, wherein the Cμ CH1 domain and the Cγ1 CH1 domain are inactivated by partial deletion of both CH1 domains; iii) No light chain expression and no non-human heavy chain expression.

[0090] All technical features disclosed herein apply to this embodiment.

[0091] In another embodiment, the disclosure relates to a non-human animal cell comprising an antibody heavy chain locus that includes multiple human IgH V gene segments, one or more human IgH D gene segments, and one or more human IgH J gene segments upstream of all or part of the human heavy constant (C) region, forming a human heavy VDJC region: i) Human heavy VDJC DNA is inserted upstream, downstream, or at the endogenous non-human animal IgH locus; ii) The human heavy chain constant region comprises the Cδ, Cε, Cγ2, Cγ3, and / or Cα gene segments, each encoding a CH1 domain, and the Cμ and Cγ1 gene segments, wherein the Cμ CH1 domain is inactivated by complete deletion of the CH1 domain, and the Cγ1 CH1 domain is inactivated by partial deletion of the CH1 domain; iii) No light chain expression and no non-human heavy chain expression.

[0092] All technical features disclosed herein apply to this embodiment.

[0093] Inactivation of CH1 in Cμ Sequence ID 7, referred to herein as the CC1-3 allele, is an exemplary sequence of the Cμ gene segment in which the CH1 region is inactivated by a complete deletion of the CH1 gene. For a detailed description of the methodology for constructing this allele, see Example 2 below.

[0094] An overview of strategies for inactivating CH1 in Cμ is provided in Figure 5.

[0095] Inactivation of CH1 in Cγ1 Sequence IDs 11 and 12, referred to herein as the Vega2-8 allele and the Vega2-15 allele, respectively, are exemplary sequences of the Cγ1 gene segment containing a partial deletion of CH1. The construction of these alleles is described in detail in Example 2 below and illustrated in Figures 6 and 7, respectively.

[0096] Sequence ID 16, referred to herein as the Vega2-28 allele, is an exemplary sequence of the Cγ1 gene segment containing a complete deletion of CH1 (shown in Figure 8a and described in detail in Example 2 below).

[0097] In one embodiment, the Cγ1 hinge region is manipulated to include the H237Y mutation. The presence of a single nucleotide polymorphism (SNP) has been shown to substantially improve the fragmentation resistance of IgG1 in the presence of H2O2 (see S. Suzuki et al. (Nature Scientific Reports (2018) 8:17253) (the whole article is incorporated herein by reference)).

[0098] Sequence ID 17, referred to herein as the Vega2-31 allele, is an exemplary gene segment sequence that includes incorporation of a donor sequence (Sequence ID 18; described in detail in Example 2 below) in the IgG1 coding sequence, with a complete deletion of CH1 and a C-to-T point mutation resulting in a non-harmful histidine-to-tyrosine change (H237Y).

[0099] Sequence ID 19, referred to herein as the Vega2-32 allele, is an alternative exemplary sequence of the Cγ1 gene segment containing a complete deletion of CH1 (described in detail in Example 2 below).

[0100] Inactivation of the endogenous Ig light chain locus According to this disclosure, in non-human animal cells of the present invention, light chain expression is substantially absent; that is, endogenous light chains are inactivated, and the expression of functional Ig light chains is inhibited.

[0101] In one embodiment, no lambda light chain or kappa light chain is expressed.

[0102] In one embodiment, all endogenous lambda and / or kappa V and / or J genes are inactivated, preferably by introducing one or more loss-of-function mutations into the endogenous lambda and kappa light chain loci, or by complete or partial deletion of the endogenous lambda and kappa light chain loci.

[0103] In one embodiment, all endogenous lambda and / or kappa V and J genes are inactivated.

[0104] In one embodiment, the endogenous lambda locus holds JC1 and / or JC3. In another embodiment, the endogenous lambda locus holds JC1 and JC3. In one embodiment, all endogenous kappa V genes are deleted. In yet another embodiment, the endogenous lambda locus holds JC1 and JC3, and all endogenous kappa V genes are deleted.

[0105] By turning off light chain expression, the heavy chain is expressed in the absence of light chain expression, so during B cell proliferation and during heavy chain selection after somatic mutation and antigen or epitope immunization, there is no possibility of residual pairing of the light chain with either the ΔCH1 IgM / ΔCH1 IgG heavy chain or other isotypes (e.g., IgD). Therefore, heavy chain generation is essentially exclusively the generation of H2 antibody-type heavy chains, and the variable region binds to the antigen in the absence of a light chain variable region partner.

[0106] Such H2 antibodies can be a good source of antibody single variable domain sequences (e.g., human VH single variable domains if the heavy chain locus contains a human variable region). Therefore, the in vivo antibody production mechanism of non-human vertebrates or cells of the present invention can be dedicated to H2 antibody production without significant production of any four-chain antibodies (H2L2) that interfere with the degree of the H2 antibody response after immunization and ultimately the desired level of H2 that can be obtained.

[0107] An exemplary methodology for inactivating endogenous kappa and lambda genes is provided in Example 1 below. Furthermore, Example 5 of International Publication No. 2020 / 049128 describes the inactivation of endogenous kappa and lambda light chain loci in transgenic animals, resulting in the production of antibodies against only fully human VH. The contents of this publication are incorporated herein by reference.

[0108] Accordingly, one embodiment of the present disclosure provides a non-human animal cell comprising an antibody heavy chain locus that includes a plurality of human IgH V gene segments, one or more human IgH D gene segments, and one or more human IgH J gene segments upstream of all or part of the human heavy constant (C) region, forming a human heavy VDJC region: i) Human heavy VDJC DNA is inserted upstream, downstream, or at the endogenous non-human animal IgH locus; ii) The human heavy chain constant region includes the Cδ, Cε, Cγ2, Cγ3, and / or Cα gene segments, each encoding a CH1 domain, and the Cμ and Cγ1 gene segments, wherein the Cμ CH1 domain and the Cγ1 CH1 domain are inactivated; iii) Non-human animal cells do not express any endogenous or exogenous kappa or lambda light chains, nor any endogenous or non-human heavy chains.

[0109] Transgenic non-human animal cells according to this disclosure can produce antibodies of both IgG and IgM isotypes and are capable of isotype switching. Thus, in one embodiment, the present invention relates to transgenic non-human animal cells according to this disclosure, wherein the cells can produce antibodies of both IgG and IgM isotypes and are capable of isotype switching. Typically, the cells produce a matureable IgM antibody, and the cells undergo class switching to produce another isotype, such as IgG, IgA, or IgE, preferably IgG.

[0110] A second aspect of this disclosure provides a transgenic non-human animal comprising a plurality of cells according to the first aspect, which is capable of expressing a repertoire of antibodies consisting only of IgM and IgG heavy chains.

[0111] immunization Further aspects of this disclosure relate to the use of non-human animals described herein for generating human HCAbs that specifically bind to target antigens. HCAbs according to the present invention can be generated by exposing non-human animals described herein to immunogenic stimulation with target antigens.

[0112] Accordingly, a third aspect of the present disclosure provides a method for generating a human HCAb specific to a desired antigen, comprising immunizing a non-human animal according to a second aspect of the present disclosure with the desired antigen, and recovering an antibody or its encoding nucleic acid from the animal, or recovering antibody-producing cells.

[0113] In one embodiment, the antigen is selected from human cytokines, growth factors, hormones, enzymes, and serum proteins. In another embodiment, the antigen is a multi-subunit human protein antigen.

[0114] Non-human animals can be sensitized to a target antigen, and lymphoid cells (such as B cells) can then be recovered from animals that express antibodies. Immortal hybridoma cell lines can be prepared by fusing lymphoid cells with myeloma cell lines, and such hybridoma cell lines can be screened and selected to identify hybridoma cell lines that produce antibodies specific to the antigen of interest. Nucleic acids encoding antibody heavy chains can be isolated from lymphocytes.

[0115] Modifications to the nucleic acid encoding the antibody heavy chain region may be performed, such as residue mutations and variant creation. Variant creation may be desirable for several reasons, including sequence optimization for large-scale production, accelerated purification, enhanced stability, or improved inclusion in the desired pharmaceutical formulation. Protein manipulation can be performed at one or more selected residues in the sequence, for example, by substituting a certain amino acid with an alternative amino acid (optionally, variants containing all naturally occurring amino acids at this position may be created, with the exception of Cys and Met), and the effects on function and expression can be monitored to determine the best substitution. In some cases, substituting residues with Cys or Met, or introducing these residues into the sequence, may be undesirable, as this can create difficulties in production, for example, through the formation of novel intramolecular or intermolecular cysteine-cysteine ​​bonds. Once lead candidates have been selected and optimized for production and clinical development, it is generally desirable to maintain their antigen-binding properties as little as possible, or at least preserve the affinity and potency of the parent molecule. However, variants may also be designed to modulate important antibody properties such as affinity, cross-reactivity, or neutralizing efficacy.

[0116] In one embodiment, the method further comprises cloning an encoding nucleic acid into recombinant host cells, such as CHO, HEK293, Cos, or yeast cells; culturing the cells for the expression of a heavy chain antibody; and recovering and purifying the antibody from the cells or culture medium.

[0117] In one embodiment, the method further includes formulating an antibody or antibody chain together with a pharmaceutically acceptable carrier or other excipient to produce a pharmaceutical composition.

[0118] Pharmaceutical composition A fourth aspect of the present disclosure provides a method for producing a pharmaceutical composition comprising an antibody specific to a desired antigen and a pharmaceutically acceptable carrier or other excipient, the method comprising immunizing a non-human animal according to a second aspect with the desired antigen, recovering the antibody, and formulating the antibody together with a pharmaceutically acceptable carrier or other excipient.

[0119] In one embodiment, the method further includes packaging the composition in a sterile container.

[0120] In one embodiment, the method further includes generating a kit, which includes combining the package with a label or instructions indicating the use of the antibody composition for human medical use. In one embodiment, the label or instructions include a drug batch number and / or marketing authorization number, e.g., an EMA or FDA marketing authorization number.

[0121] Antibodies and their encoding nucleic acids according to the present invention may be provided in isolated form and / or in solution, such as an aqueous solution.

[0122] The present invention further provides compositions (e.g., pharmaceutical compositions or compositions for medical use) comprising an HCAb that can be obtained or obtained by the methods of the present invention disclosed herein.

[0123] The antibody may be monoclonal or polyclonal, but it is preferable to provide it as a monoclonal antibody for therapeutic use. The antibody may also be provided as part of a mixture of other antibodies, optionally containing antibodies with different binding specificities.

[0124] Antibodies and coding nucleic acids according to the present invention are typically provided in isolated form. Therefore, antibodies and nucleic acids may be provided purified from their natural environment or their production environment. Isolated antibodies and isolated nucleic acids are separated from, or substantially separated from, the substances to which the antibodies and nucleic acids naturally associate, e.g., other polypeptides or nucleic acids found in vivo, or, if the preparation is by in vitro recombinant DNA technology, from the environment in which the antibodies and nucleic acids are prepared (e.g., cell culture). Optionally, isolated antibodies or nucleic acids are (1) separated from at least some other proteins commonly found, (2) essentially separated from other proteins from the same source, e.g., from the same species, (3) expressed by cells of a different species, (4) separated from at least about 50% of naturally associated polynucleotides, lipids, carbohydrates, or other substances, (5) operably associated (by covalent or noncovalent interactions) with polypeptides that do not naturally associate, or (6) not naturally present.

[0125] Antibodies or nucleic acids may be formulated with diluents or adjuvants, and may also be isolated for practical purposes. For example, if used to coat microtiter plates used in immunoassays, antibodies or nucleic acids may be mixed with a carrier, and if used therapeutically, they may be mixed with a pharmaceutically acceptable carrier or diluent. Other active ingredients may also be included in the therapeutic preparation. Antibodies may be glycosylated in vivo naturally or by a system of heterologous eukaryotic cells such as CHO cells, or they may be unglycosylated (for example, if produced by expression in prokaryotic cells). The present invention encompasses antibodies having modified glycosylation patterns. In some applications, modification to remove undesirable glycosylation sites, or removal of fucose moieties to enhance ADCC function, for example, may be useful. In other applications, galactosylation modification can be performed to modify CDC.

[0126] Typically, the isolated product constitutes at least about 5%, at least about 10%, at least about 25%, or at least about 50% of a given sample. Antibodies can be substantially separated from proteins or polypeptides or other contaminants found in their natural or production environment that would interfere with their therapeutic, diagnostic, prophylactic, research, or other uses.

[0127] Antibodies can be identified, isolated, and / or recovered from components of their production environment (e.g., natural or recombinant). Isolated antibodies are free from association with all other components from their production environment, for example, so that the antibodies are isolated to an FDA-approved or approved standard. Contaminating components of the production environment, such as those derived from recombinant transfection cells, are typically materials that interfere with the research, diagnostic, or therapeutic use of the antibody and may include enzymes, hormones, and other protein solutes or non-protein solutes. In some embodiments, antibodies are purified to: (1) a concentration of over 95% by weight, and in some embodiments, over 99% by weight, as determined, for example by the Lowry method; (2) a concentration of at least 15 residues of the N-terminal or internal amino acid sequence obtained sufficiently by the use of a spinning cup sequencer; or (3) homogenization by SDS-PAGE under non-reducing or reducing conditions using Coomassie blue or silver staining. Isolated antibodies include in-situ antibodies from recombinant cells. This is because at least one component of the antibody's natural environment is absent. However, typically, isolated antibodies or their encoding nucleic acids are prepared through at least one purification step.

[0128] The HCAb-containing polypeptide of the present invention, or the coding nucleic acid thereof, can be formulated, for example, in a liquid for injection (optionally aqueous solution) for a desired route of administration to a patient. The composition may contain the polypeptide or nucleic acid in combination with a medical injection buffer and / or adjuvant. Various delivery systems are known and can be used to administer the pharmaceutical composition of the present invention. Methods of delivery include, but are not limited to, intradermal, intramuscular, intraperitoneal, intravenous, subcutaneous, intranasal, epidural, and oral routes.

[0129] The composition may contain diluents, excipients, or carriers. If the composition is a pharmaceutical composition or a composition for medical use, the diluents, excipients, or carriers may be pharmaceutically acceptable. "Pharmaceutically acceptable" means that they are approved or eligible for approval by a U.S. federal or state regulatory agency for use in animals including humans, or that they are listed in the United States Pharmacopeia or other generally recognized pharmacopoeias.

[0130] "Pharmacologically acceptable carrier, excipient, or adjuvant" means a carrier, excipient, or adjuvant that can be administered to a subject together with an agent, for example, any antibody described herein, and is non-toxic when administered in a dose sufficient to deliver a therapeutic amount of the agent without impairing its pharmacological activity. Compositions comprising polypeptides or nucleic acids described herein may be contained in vitro in a sterile container. Compositions may be in a bag attached to an IV syringe or in other medical containers. Compositions may be in vials, syringes, or injection devices. In one example, a kit is provided comprising an antibody, polypeptide, or nucleic acid, plus packaging and instructions for use in a therapeutic method.

[0131] This disclosure provides therapeutic compositions comprising polypeptides containing antibody heavy chains as described herein. Therapeutic compositions comprising nucleic acids encoding such polypeptides are also provided. Encoding nucleic acids are described in more detail elsewhere herein and include DNA and RNA, such as mRNA. In the therapeutic methods described herein, the use of antibody-encoding nucleic acids and / or cells containing such nucleic acids may be used as a substitute for (or in addition to) compositions containing the antibody itself. Cells (e.g., human cells, e.g., human lymphocytes) contain antibody-encoding nucleic acids, and optionally, the nucleic acids are stably incorporated into the genome, thus representing a pharmaceutical agent used therapeutically in a patient. CAR-expressing cells, such as CAR-T cells, are one example. In addition, the antibody-encoding nucleic acids of the present invention may be introduced into human B lymphocytes, optionally, into B lymphocytes derived from the intended patient and modified ex vivo. Optionally, memory B cells are used. Administration of cells containing encoding nucleic acids to a patient provides a reservoir of cells capable of expressing antibodies, which may provide therapeutic benefits over a longer period compared to the administration of isolated nucleic acids or isolated antibodies.

[0132] It will be understood that the specific embodiments described herein are presented as examples, not as limitations of the invention. The main features of the invention can be used in various embodiments without departing from the scope of the invention. Those skilled in the art will be able to recognize or confirm many equivalents to the specific procedures described herein by means of mere common study. Such equivalents are considered to be within the scope of the invention and are covered by the claims. All publications and patent applications referenced herein indicate the level of skill of those skilled in the art to which the invention belongs. All publications and patent applications are incorporated herein by reference as if each individual publication or patent application were specifically and individually indicated to be incorporated by reference. The use of the words “a” or “an” in conjunction with the term “comprising” in the claims and / or specification may mean “one,” but also coincide with the meanings of “one or more,” “at least one,” and “one or more.” The use of the term “or” in the claims is used to mean “and / or” unless it is expressly indicated that it refers only to the options, or unless the options are mutually exclusive; however, this disclosure supports the definition that refers only to the options and “and / or.” Throughout this application, the term “about” is used to indicate that a value includes inherent variations in errors of the apparatus, method, or other devices or methods that will be used to determine the value, or variations that exist among the subjects of study.

[0133] The words “comprising” (and any form of “comprise,” such as “comprises,” and “comprises”), “having” (and any form of “have,” such as “have,” and “has”), “including” (and any form of “includes,” such as “includes,” and “include”), or “containing” (and any form of “contains,” such as “contain”) are comprehensive or open-ended and do not exclude any additional unlisted elements or method steps.

[0134] As used herein, the terms “or any combination thereof” refer to all reorders and combinations of the terms listed before them. For example, “A, B, C, or any combination thereof” is intended to include at least one of A, B, C, AB, AC, BC, or ABC, and also BA, CA, CB, CBA, BCA, ACB, BAC, or CAB, where the order is important in the particular context. Continuing this example, expressly included are combinations containing one or more repetitions of items or terms, such as BB, AAA, MB, BBC, AAABCCCC, CBBAAA, and CABABB. A person skilled in the art will understand that, unless otherwise evident from the context, there is typically no limit to the number of items or terms in any combination. Unless otherwise evident from the context, any part of this disclosure may be read in conjunction with any other part of this disclosure.

[0135] All compositions and / or methods disclosed and claimed herein can be manufactured and performed without excessive experimentation in consideration of this disclosure. While the compositions and methods of the present invention have been described in terms of preferred embodiments, it will be apparent to those skilled in the art that variations can be applied to the compositions and / or methods and the steps or sets of steps of the methods described herein without departing from the concept, spirit, and scope of the invention. All such similar substitutes and modifications that are apparent to those skilled in the art are deemed to be within the spirit, scope, and concept of the invention as defined by the appended claims.

[0136] array Sequence ID 1: gRNA ID # HCG013 GATGCCACTGGGACGCCAA Sequence ID 2: gRNA ID # HCG014 AAGTCCCTTGGCGTCCCCAG Sequence ID 3: gRNA ID # HCG015 GGAGCCGGCTGAGAGAAGTT Sequence ID 4: gRNA ID # HCG016 GTGGAGATAATCTGTCCTAA Sequence ID 5: gRNA ID # HCG062 TCACTACTTGCGTCCCGCTG Sequence ID 6: gRNA ID # HCG066 GCCCAGCCACCGGGACAGAG Sequence ID 7: Nucleotide sequence of the Cμ ΔCH1 CC1-3 allele CCTGAGGCCTCACCACGGCCCCGCCACCCCTGATAGCCATGACAGTCTCTCTAGAGAGGGAAGAGGGAGCCGAAGGGGGCGGGAGTGGCGGGCACCGGGCTGACACGTG Sequence ID 8: gRNA ID # HCG104 GATTGGGAGTTACTGGAATC Sequence ID 9: gRNA ID # HCG105 GCCCCCCAGAGGTGCTCTTGG Sequence ID 10: ssDNA donor template CTGCGCCCTGGGCCCAGCTCTGTCCCACACCGCGGTCACATGGCACCACCTCTTGCAGAGCCCAAATCTTGTGACAAACTCACACATGCCCACCGTGCCCAGGTAAGCCAGCCCAGG Sequence ID 11: Nucleotide sequence of the human Cγ1 (partial)ΔCH1 Vega2-8 allele CCTCCACCAAGGGCCCATCGGTCTTCCCCCTGGCACCCTCCTCCAATCCAGTAACTCCCCAATCTTCTGCAG Sequence ID 12: Nucleotide sequence of the human Cγ1 (partial)ΔCH1 Vega2-15 allele CCTCCACCAAGGGCCCATCGGTCTTCCCCCTGGCACCCTCCTCCACTGCAGAGAAGATTGGGAGTTACTG Sequence ID 13: gRNA ID # HCG069 TGGGTTCTTAACTGTCCGCG Sequence ID 14: gRNA ID # HCG108 CACACATGCCCACCGTGCCC Sequence ID 15: ssDNA donor template [ka] Sequence ID 16: Nucleotide sequence of the human Cγ1 ΔCH1 Vega2-28 allele [ka] Sequence ID 17: Nucleotide sequence of the human Cγ1 ΔCH1 Vega2-31 allele [ka] Sequence ID No. 18: Amino acid sequence of the IgG1 hinge region with a point mutation (shown in bold): [ka] Sequence ID 19: Nucleotide sequence of the human Cγ1 ΔCH1 Vega2-32 allele [ka]

[0137] The present disclosure will be further described here with reference to the following non-limiting embodiments. [Examples]

[0138] Example 1: Production of transgenic mice containing a complete human heavy chain and inactivated mouse lambda and kappa gene loci. The human heavy chain V, D, and J gene segments were inserted at the mouse heavy chain locus on chromosome 12, as illustrated in Figure 2.

[0139] The transgenic animals of the present invention containing human IgH-VDJ can be produced using a site-directed recombination (SSR)-based technique called sequential RMCE (SRMCE), which allows for the sequential insertion of BAC inserts into the same locus. The methods for introducing the human IgH VDJ gene and inactivating endogenous VDJ, summarized below, are described in detail in Examples 1 and 2 of International Publication No. 2011 / 004192, which are incorporated herein by reference in their entirety.

[0140] Insertion of human VDJ gene segment This method includes the following steps: 1. Insertion of DNA that forms an initiation cassette (also referred to herein as a landing pad) into the cell's genome; 2. Insertion of a first DNA fragment into an insertion site, wherein the first DNA fragment comprises a first portion of human DNA and a first vector portion containing a first selectable marker or, upon insertion, producing a selectable marker; 3. Removal of a portion of the vector DNA; 4. Insertion of a second DNA fragment into the vector portion of a first DNA fragment, wherein the second DNA fragment contains a second portion of human DNA and a second vector portion, and the second vector portion contains a second selectable marker or, upon insertion, produces a second selectable marker; 5. Removal of any vector DNA that would enable the first and second human DNA fragments to form a continuous sequence; and 6. Repeated steps of inserting a portion of human V(D)J DNA and removing vector DNA, as needed, to generate cells having all or part of a human VDJ or VJ region sufficient to produce a chimeric antibody in combination with a host constant region, wherein at least one DNA fragment insertion uses site-directed recombination.

[0141] Inactivation of endogenous VDJs The endogenous VDJ sequence was inactivated by inversion via chromosomal manipulation as follows: 1. Target the "flip-over" cassette in the 5' region 10–40 megabases away from the endogenous VDJ. The flip-PB3-over vector contains the PB3'LTR-PGK promoter-HPRT minigene 5' portion-loxP-puroΔTK-CAGGS promoter-PB3'LTR. 2. Transient CRE expression results in recombination between the loxP site in the "flipover" cassette and the loxP site in the 5' modification. This 5' modification occurs by inserting an odd number of BACs after correcting the 3' modification. Since the loxP sites are inverted relative to each other, the recombination event described results. Cells with the correct inversion become HAT resistant because the HPRT minigene is rearranged by the correct inversion. 3. Furthermore, correct inversion leaves two transposon structures that flank the "flip-over" cassette and the 5' modification. Both can be excised by transient piggyBAC transposase expression, leaving no modification residue. Cells in which excision is correct can be selected as follows: (i) 6TG resistant (deletion of HPRT mini gene) and (ii) FIAU resistant (deletion of puroΔTK gene). Inversion described on the Ig locus moves and separates the endogenous IGH-VDJ region from the Eμ enhancer region, resulting in inactivation of the endogenous IGH-VDJ region.

[0142] The resulting transgenic animals possess an inactivated endogenous IgH VDJ region and contain a human IgH VDJ gene segment.

[0143] Creation of a complete human IgH gene locus Embryonic stem cells (ESCs) derived from the transgenic mice described above, which possess an inactivated endogenous IgH VDJ region and contain human IgH V, D, and J gene segments, were cultured and modified to humanize the constant region of the IgH locus. This involved seven sequential manipulation steps, each including clonal screening, expansion, and QC. The steps are summarized below and in Figure 1: 1. Insertion of the PiggBac / Lox2272 / NeoR / Lox5171 / CMV cassette at the 5' end of the IgH constant region, i.e., immediately downstream of human J and upstream of the mouse Cμ gene. 2. Insertion of the PuroR / Lox5171 / PGK / PiggBac cassette at the 3' end of the IgH steady-state region, i.e., immediately downstream of the mouse Chr12 replication origin. 3. Cre recombinase was introduced into the ESC to induce excision of the entire constant region between two Lox5171 sites. 4. A bacterial artificial chromosome (BAC) containing the 3' "half" of the human constant region, which flanks the Lox2272 and Lox5171 regions, was inserted at the complementary Lox2272 and Lox5171 regions within the IgH gene locus by recombination-mediated cassette exchange. 5. The residual 3' PiggyBac flanking puromycin cassette was excised using PiggyBac transposase. 6. A BAC containing the 5' "half" of the human constant region where the Lox2272 and LoxP sites are flanked was inserted at the complementary Lox2272 and LoxP sites within the IgH gene locus by recombinant-mediated cassette exchange. 7. Residual PiggyBac flanking Lox2272 and PiggyBac flanking Puro / PGK / LoxP were excised using PiggyBac transposase. 8. mESCs derived from step 7 were microinjected into WT C57bl / 6 blastocysts, and the resulting chimeric progenitor males were mated with WT C57bl / 6 females. The F1 animals that had inherited the modified IgH locus were mated to create homozygous colonies of strains containing human IgH VDJC (i.e., complete human IgH).

[0144] Endogenous mouse "J deletion" To ensure complete inactivation of the inverted mouse IgH variable region, the region containing the mouse J gene segment was deleted. This was done by microinjecting the CRISPR-Cas9 reagent into embryos obtained from a strain containing full human IgH VDJC (step 8 above).

[0145] Two pairs of gRNA sequences that flank the mouse J gene segment were used in combination:

[0146] [Table 1]

[0147] Microinjected embryos were transferred to pseudopregnancy recipient females, and F0 ancestral animals were screened by PCR for the desired J deletion allele. One allele (containing a deletion of HJD5-J but without donor sequence insertion) was selected, and the creation of "J deletion" colonies was initiated.

[0148] Kappa knockout allele creation The kappa KO allele was generated by manipulating mESCs derived from embryos containing the WT mouse kappa locus. The mESCs were electroporated with a targeted vector containing a PGK promoter and a Neo-cassette with a 4.5kb homology arm complementary to the mouse kappa locus that flanks. This promoted insertion of the cassette approximately 800bp downstream of the mouse J gene. This insertion resulted in disrupted rearrangement and / or transcription of the locus constituting the kappa KO phenotype in mouse strains generated by subsequent microinjection, chimeric breeding, and colony expansion of the ESCs.

[0149] Creation of lambda knockout alleles The lambda knockout allele was generated by microinjecting CRISPR-Cas9 into mouse WT lambda locus embryos. The knockout strategy involved creating a deletion at the endogenous lambda locus, which inactivates lambda light chain expression.

[0150] Inactivation of the lambda locus can be achieved by deletion or substitution of the V2, V3, and V1 plus the J2 / C2 cluster, while preserving the J3 / C3 and J1 / 1 clusters.

[0151] Figure 3 illustrates a 200kb deletion of the endogenous mouse lambda gene locus for generating lambda knockout.

[0152] Ear clips derived from F0 ancestral animals obtained through embryonic manipulation were screened for deletions by PCR, and the deletion junctions were sequenced. Alleles (allele name LKD9) in which the incorporation of the donor-specific sequence was confirmed were selected, and colony generations were advanced.

[0153] Example 2: Manipulation of a complete human heavy chain allele containing a CH1 deletion in Cμ and Cγ1 The mouse embryos described in Example 1 were further modified using CRISPR-Cas9 to delete CH1 from Cμ and Cγ1. An overview of this two-step deletion strategy is illustrated in Figure 4.

[0154] Creation of Cμ CH1 deletion at the IgH gene locus Cμ CH1 deletions were created by microinjecting a CRISPR Cas9 reagent into embryos containing the humanized IgH locus, as detailed in Example 1. A pair of gRNAs were designed to induce Cas9 to produce a double-strand break flanking the CH1 exon at the humanized Cμ locus. The gRNA pair used was as follows:

[0155] [Table 2]

[0156] F0 progenitor animals were screened by PCR for deletions between gRNA sites and / or integration of donor sequences. Alleles with a 50 bp deletion and a small 11 bp "random sequence" insertion were selected, and colony formation was initiated. These alleles are referred to herein as "CC1-3" (see Figure 5).

[0157] Sequence of the CC1-3 allele: CCTGAGGCCTCACCACGGCCCCGCCACCCCTGATAGCCATGACAGTCTCTCTAGAGAGGGAAGAGAGGGAGCCGAAGGGGGCGGGAGTGGCGGGCACCGGGCTGACACGTG (SEQ ID NO: 7)

[0158] Creation of partial genomic CH1 deletion in the humanized Cγ1 gene segment This strategy was designed to create precise deletions that inactivate the expression of Cγ1 CH1 and CH1-hinged exons using CRISPR Cas9 and ssDNA oligo repair templates.

[0159] These deletion alleles were generated by electroporating CRISPR-Cas9 reagent into human IgH VDJC region sequences homozygous for the "CC1-3" Cμ CH1 deletion allele described above.

[0160] A pair of gRNAs were designed to induce Cas9 to produce double-strand breaks within the Cγ1 CH1 exon and within the CH1-hinged intron at the humanized Cγ1 locus (see Figure 6). The gRNA pair used was as follows:

[0161] [Table 3]

[0162] Furthermore, the ssDNA donor template was included in the reagent electroporation mix having the following sequence: CTGCGCCCTGGGCCCAGCTCTGTCCCACACCGCGGTCACATGGCACCACCTCTCTTGCAGAGCCCAAATCTTGTGACAAAACTCACACATGCCCACCGTGCCCAGGTAAGCCAGCCCAGG (SEQ ID NO: 10)

[0163] F0 progenitor animals were screened by PCR for deletions between gRNA sites and / or integration of donor sequences. Two alleles with deletions were selected, and colony formation and investigation were carried out. Each allele retains a small region at the 5' of CH1, with the remainder of CH1 and the CH1-hinged intron region deleted.

[0164] These alleles are referred to herein as Vega2-8 and Vega2-15.

[0165] Vega2-8 sequence: CCTCCACCAAGGGCCCATCGGTCTTCCCCCTGGCACCCTCCTCCAATCCAGTAACTCCCAATCTTCTCTCTGCAG (SEQ ID NO: 11)

[0166] Sequence of Vega2-15: CCTCCACCAAGGGCCCATCGGTCTTCCCCCTGGCACCCTCCTCCACTGCAGAGAGAAGATTGGGAGTTACTG (SEQ ID NO: 12)

[0167] Creation of complete CH1 and CH1-hinged intron deletions in the humanized Cγ1 gene segment The deletion allele was generated by pronuclear microinjection of CRISPR-Cas9 reagent into homozygous embryos containing the "CC1-3" Cμ CH1 deletion allele.

[0168] A pair of gRNAs were designed to induce Cas9 to produce a double-strand break in the hinge exon at the 5' upstream of Cγ1 CH1 and within the humanized Cγ1 locus. The gRNA pair used was as follows:

[0169] [Table 4]

[0170] Furthermore, an ssDNA donor template was included in the reagent electroporation mix. This donor is 234 bp long and designed to facilitate precise deletion of CH1 and the CH1-hinge intron while substituting the hinge with a modifying sequence. The donor is designed to introduce one silent mutation at the 5' end of CH1 and three silent mutations within the hinge to prevent further Cas9 activity after repair of the target locus. The donor sequence is as follows: [ka]

[0171] F0 progenitor animals were screened by PCR for deletions between gRNA sites and / or integration of donor sequences.

[0172] Figure 7 illustrates the creation of alleles with complete deletions of Cγ1 CH1 and CH1-hinged introns using a longer ssDNA donor template.

[0173] We advanced three alleles, referred to herein as Vega2-28, Vega2-31, and Vega2-32, which have various configurations.

[0174] Allele Vega2-28: Complete deletion and integration of a donor sequence with a modified hinge, but with a 168 bp deletion near the 5' gRNA site upstream of the hinge (shown in Figure 8a).

[0175] Sequence of the Vega2-28 allele: [ka]

[0176] Allele Vega2-31: Complete deletion and integration of a donor sequence with one base pair mutation within the hinge (this is a C-to-T point mutation resulting in a non-harmful histidine-to-tyrosine change (H237Y) in the IgG1 coding sequence) (shown in Figure 8b).

[0177] Sequence of the Vega2-31 allele: [ka]

[0178] Sequence of the IgG1 hinge region containing point mutations (bold): [ka]

[0179] Allele Vega2-32: Complete deletion and integration of a donor sequence with a modified hinge, but with a 24 bp insertion near the 5' gRNA site upstream of the hinge (duplication of adjacent sequences in the 5' homology arm of the repair donor) (shown in Figure 8c).

[0180] Sequence of the Vega2-32 allele: [ka]

[0181] Example 3: B cell development Normal B cell compartment in transgenic mice as described herein In a mouse, approximately 2 x 10 7 Numerous immature B cells are produced daily in the bone marrow. Of these, only 10-20% survive and leave the bone marrow to enter the spleen. The immature spleen B cell population is divided into two distinct subsets: transitional 1 (T1) and transitional 2 (T2) B cells. In vivo experiments show that T1 cells give rise to T2 cells, and that T2 cells can further differentiate into mature (M) B cells. In contrast to immature B cells (3-4 days old), mature B cells are long-lived (15-20 weeks old) and ready to respond to antigens (Pillai S et al; Immunol.Reviews.2004.197:206-218). Therefore, the components of the mature B cell population are directly related to the efficiency of the humoral immune response.

[0182] T1, T2, and M cell populations can be classified by their cell surface IgM and IgD levels. A normal phenotype of the splenic B cell compartment is required to initiate a robust immune response.

[0183] method Flow cytometry analysis of mature B lymphocytes: To obtain single-cell suspensions from the spleen, the spleens of the mice listed below were gently passed through a 30 μm cell strainer. Single cells were resuspended in PBS supplemented with 3% heat-inactivated fetal bovine serum (FCS; Gibco®). The following antibodies were used for staining: • Antibodies against B220 / CD45R conjugated with allophycocyanin (APC) (eBioscience, clone RA3-6B2), • Antibodies against IgD receptors conjugated with phycoerythrin (PE) (eBioscience, clone 1 1-26), and • IgM receptor conjugated with fluorescein isothiocyanate (FITC) (eBioscience, clone 1 1 / 41).

[0184] 5 x 10 per stain 6 Cells were used. A cocktail of antibodies consisting of the following was added to each vial containing splenocytes: IgD (PE) (eBioscience, clone 1 1-26), IgM (FITC), and B220 / CD45R (APC). The cells were incubated at 6°C for 15 minutes, washed to remove excess unbound antibody, and analyzed using a fluorescence-activated cell sorting (FACS) analyzer from Miltenyi Biotech. B cells were gated as B220+IgM+IgD'' for the T1 population, B220+IgM+IgD+ for the T2 population, and B220+IgM+IgD+ for the M population. The percentage of cells was calculated using the gating system.

[0185] result Spleens were collected from the mice described herein and their B cell compartments were analyzed. The number and percentage of T1, T2, and M cells among these mice were similar to those of the wild type, indicating that genetic manipulation of the endogenous IG locus in transgenic mice according to the present invention does not impair B cell development. This data helps establish that animals according to the present invention provide a robust platform for antibody discovery.

[0186] As described above, in such mice of the present invention, normal spleen and bone marrow compartments are observed (i.e., equivalent to the compartments in mice expressing only mouse antibody chains).

[0187] Example 4: Method for analyzing responses to class switching, affinity maturation, and antigen sensitization induction in transgenic mice as described herein. Transgenic animals known in the field of human HCAb production (e.g., the platform developed by Harbour Biomed, Crescendo Biologics, and Teneobio Inc. (UNIRAT)) cannot undergo class switching because either the entire Cμ region is deleted, or the CH1 region of all constant genes is deleted.

[0188] In contrast, the transgenic non-human animal cells described herein provide a platform for producing human HCAbs that can tolerate class switching from IgM to IgG1. In particular, the CH1 deletion described herein results in correct splicing of VH to CH2 for IgM and to the hinge region for IgG.

[0189] Unimmunized mice: Spleens and lymph nodes were collected from naive mice and processed for sorting. In this particular case, the mice were older than those used as a reference, at approximately 14 weeks of age.

[0190] Mouse immunization: Transgenic mice aged 6-8 weeks were primed by subcutaneous injection of 20 μg of target protein suspended in phosphate-buffered saline (PBS) and an equal volume of Addavax as an adjuvant. Immunized mice were boosted three times every three weeks after priming with 10 μg of target protein in PBS and the same volume of Addavax as an adjuvant. Three weeks after the last boost, a final boost was administered using 5 μg of target protein in PBS without adjuvant. Five days after the final boost, spleens and lymph nodes were collected and processed for sorting.

[0191] Isolation of spleen and lymph node cells, and enrichment of B cells Splenocytes were isolated from the spleen using the flushing method. Briefly, a complete spleen was flushed with approximately 10 ml of 10% FBS / RPMI without the use of phenol red buffer, or until the spleen lost its red color. The cell suspension was periodically pipetted onto a 40 μm cell strainer. Homogenized LN cells were filtered using the same 40 μm cell strainer used for the spleen. The cells were pelleted at RT, 400 × g for 10 minutes, resuspended in 5 mL of 3% FBS / 1 mM EDTA / RPMI, and then enriched with B cells using magnetic beads.

[0192] IgG+ B cell sorting from naive mice B cell-enriched samples were resuspended in 300 μl of 3% FBS / RPMI without phenol red. 20 μl of Fc blocker was added, and the mixture was incubated on ice for 10 minutes. 100 μl of staining cocktails contained B220-BUV395, CD19-BUV395, CD4-BV510, CD8α-BV510, Ly6G-BV510, F4 / 80-BV510, IgM-BV650, and IgG-PE. The samples were incubated on ice for 30 minutes. Cells were pelleted at 4°C, 400 × g for 10 minutes and resuspended in 800 μl before sorting. IgG+ B cells were collected and used to read VDJ sequences.

[0193] Antigen-specific B cell sorting B-cell enriched samples were resuspended in 300 μl of 3% FBS / RPMI without phenol red. 20 μl of Fc blocker was added, and the samples were incubated on ice for 10 minutes. 100 μl of a staining cocktail containing B220-BUV395, CD19-BUV395, CD4-BV510, CD8α-BV510, Ly6G-BV510, F4 / 80-BV510, IgM-BV650, IgG-PE, and CD138-BV711, along with target proteins conjugated with -PE or -APC, were added to each sample. Samples were incubated on ice for 30 minutes. Cells were pelleted at 4°C, 400×g for 10 minutes and resuspended in 800 μl before sorting. Live cells were gated using the CD4 / CD8 / Ly6G / F4-80 marker to exclude doublets and non-B cells. CD138+, IgM- cells were sorted as a plasmablast / plasma cell population. CD138-, CD19 / B220+, IgM-, IgG+, Ag+ cells were sorted as an antigen-positive B cell population. VDJ sequences were read using both the collected antigen-positive B cells and plasmablast / plasma cells.

[0194] VDJ sequence recovery and analysis using microfluidics Sorted cells were processed using standard kits prepared according to the manufacturer's protocol, using 10×Genomics:Chromium Single Cell 5' Reagent Kits (v2 Chemistry Dual Index) and the Chromium Single Cell Human BCR amplification Kit. Additional IgM and IgG1 CH2-specific oligonucleotides were spiked in during the VDJ amplification step to capture CH1 deletion transcripts.

[0195] In short, after sorting, cells were loaded onto a Chromium Next GEM chip K and GEM (Gel bead-in-EMulsion) was formed using a 10× Genomics Controller. The GEM was transferred to a PCR tube and incubated on a thermocycle for RT reaction to produce cDNA. The cDNA was purified using magnetic beads and amplified as described by the 10× Genomics protocol. After amplification, the sample was cleaned using SPRIselect reagent. The resulting amplified cDNA was VDJ enriched by two sequential PCRs using a mouse BCR amplification kit with round primers targeting the constant region above the deletion CH1. The enriched material was then processed according to the protocol to construct an NGS library and sequenced using NextSeq2000. The sequencing data was analyzed using 10× Genomics Cell Ranger 3.0.0.

[0196] Class switching and affinity maturation in unimmunized animals To provide initial evidence for this feature, spleens and lymph nodes from unimmunized animals homozygous for two heavy locus alleles (Vega2-8 and Vega2-15) plus one of the lambda and kappa knockout alleles were harvested and analyzed using a 10× platform. B cells were sorted using a panel of markers and scRNA-seq experiments, and next-generation sequencing (NGS) analysis was performed to further demonstrate that transgenic mice can class switch from IgM to IgG1.

[0197] Results from unimmunized animals The rearranged transcripts can be detected from spleen and lymph node cells of naive and immunized transgenic mice using Chromium Single Cell 5' Reagent Kits (v2 Chemistry Dual Index) spiked with hinge and CH2-specific primers and containing Immune Receptor Mapping. Further sequence analysis of these amplified fragments demonstrated hypermutation within the human variable region of these IgG chains.

[0198] These results demonstrate that transgenic loci described herein, including insertions of human heavy chain sequences and deletions of CH1 in Cμ and Cγ1, enable IgM-to-IgG class switching.

[0199] The data is summarized in Table 1 below.

[0200] [Table 5]

[0201] Despite the non-immunized state of these animals, a considerable number of heavy-chain-only IgG-presenting B cells were isolated, and class switching from heavy-chain-only IgM to IgG was confirmed, as illustrated in Table 1.

[0202] Furthermore, sequence analysis of transcripts produced by isolated B cells revealed mutations detached from germline sequences, as well as several sequence clusters—namely, related sequences derived from a common VDJ recombination event but with different levels of somatic hypermutation—suggesting active clonal expansion.

[0203] Example 5: Immunization of the transgenic mice of this disclosure using immunogen A (adjuvant recombinant protein) Immunization and downstream processing Six transgenic mice (4×Vega2-8 and 2×Vega2-15) were immunized with human recombinant protein immunogen A using a standard 12-week prime regimen and three boost regimens with gradually decreasing protein doses from 20 μg to 5 μg. Immunogen A was formulated with Addavax adjuvant and administered via subcutaneous injection.

[0204] Each individual animal was assigned a reference ID, as detailed in Table 2 below.

[0205] [Table 6]

[0206] Serial blood collection (SB) and terminal blood collection (TB) samples were collected to determine antigen-specific IgG titers. Spleen and lymph node tissue were harvested 10 days after the final boost without adjuvant. Antigen-specific B cells were sorted by flow cytometry and processed using a single-cell protocol for the 10× Genomics platform to produce VDJ, gene expression, and surface protein libraries. The libraries were sequenced using a standard Illumina sequencing platform. Raw data were processed using 10× Genomics cell ranger software to quantify antibody repertoire, gene expression, and cell surface proteins.

[0207] Evidence of antigen-specific IgG response in Vega mouse serum Serum samples (SB and TB) derived from transgenic animals were analyzed for antigen-specific IgG by serial dilution and staining of HEK cell lines overexpressing human immunogen A and control parental wild-type HEK cell lines that do not express the target. A secondary anti-IgG antibody conjugated with allophycocyanin (APC) was used to detect the binding of human IgG in the serum samples to the target protein expressed on the cells. Geometric mean fluorescence was calculated from flow cytometry data for each serum dilution.

[0208] The serum titers shown in Figures 9A to 9D clearly demonstrate the antigen-specific IgG response in the transgenic mice of this disclosure. The transgenic mice possess anti-immunogen A-specific IgG titers (Figures 9A and 9B), as evidenced by the increased signaling from SB to TB, and these are target-specific, as they are negative for both PB controls and parental cell line controls (Figures 9C and 9D).

[0209] Example 6: Immunization of the transgenic mice of this disclosure using immunogen B (mRNA-LNP) Immunization and downstream processing Six Vega mice (2×Vega2-15, 3×Vega2-28, and 1×Vega2-31) were immunized with immunogen B mRNA in LNPs via adjuvant-free intramuscular injection using a 6-week prime regime with a dose of 2 μg mRNA-LNPs.

[0210] Each individual animal was assigned a reference ID, as detailed in Table 3 below.

[0211] [Table 7]

[0212] On day 0 (D0), samples were collected from bleeding 1 (BL1), bleeding 2 (BL2), and terminal bleeding (TB), and antigen-specific IgG titers were determined.

[0213] Evidence of antigen-specific IgG response in Vega mouse serum Serum samples from Vega animals (D0, BL1, BL2, and TB) were analyzed by ELISA for antigen-specific IgG by serial dilutions covering an immunogen B coating. Binding of human IgG in the serum samples to the coated target protein was detected using a secondary anti-IgG antibody conjugated with peroxidase (PO). Relative fluorescence units (RFUs) were obtained for each serum dilution.

[0214] The serum titer data shown in Figure 10 clearly demonstrate the antigen-specific IgG response in the transgenic mice of this disclosure. The transgenic mice have an anti-immunogen B-specific IgG titer, as evidenced by the increased signaling from BL1 to BL2 and TB, which is target-specific as it is negative for the D0 control.

[0215] Example 7: Evidence of somatic hypermutation in antigen-responsive transgenic mice The sequencing dataset from immunized transgenic mice described in Example 5 above was compared with a similar sequencing dataset from naive transgenic mice according to this disclosure. The V segment was identified in each dataset, the number of germline nucleotide mutations was quantified, and histograms were created as follows.

[0216] The data shown in Figure 11 clearly demonstrate that B cells that have not undergone class switch recombination (CSR) in the naive transgenic animals of this disclosure have, as expected, a low frequency of somatic hypermutation (SHM). This can be seen in Figure 11A (IgM sequences) and Figure 11C (IgG sequences). IgG in "naive" mice has some mutations due to innate immune responses to environmental sensitization, for example, from food and the microbiome.

[0217] However, in the immunized transgenic animals of the present disclosure, B cells that have undergone CSR are also associated with high levels of somatic hypermutation. This is evident when comparing FIGS. 11B and 11D, which contrast the number of heavy chain variable region nucleotide mutations in the IgM sequences of immunized mice (FIG. 11B) versus the number of heavy chain variable region nucleotide mutations in the IgG sequences of immunized mice (FIG. 11D). This finding not only demonstrates the functionality of the transgenic Ig heavy chain locus in which CSR and SHM are present, but also demonstrates the utility of having both IgM and IgG constant regions with a CH1 deletion in transgenic mice. This is because affinity matured antibodies (increased SHM) are enriched in the class switched population.

[0218] Thus, an end user of the transgenic mice of the present disclosure can focus on the class switched population of B cells as a surrogate marker for the antigen response and enrich the antigen specific pool of B cells to be analyzed. This advantage is not present in competing platforms without intact CSR.

[0219] Example 8: Evidence of Affinity Maturation in Transgenic Mice After immunization of transgenic mice as described in Example 5 above and analysis of VDJ sequencing via 10x genomics, additional 10x genomics libraries were generated from the same samples and antigen binding was quantified by DNA barcoded sorted baits (a process known as LIBRA-Seq).

[0220] The dataset was analyzed to assign LIBRA-Seq scores according to the amount of barcoded antigen bound to each individual B cell, with scores ranging from 0 (low) to 14 (high).

[0221] Figure 12 demonstrates the distribution of LIBRA-Seq scores partitioned by isotype. IgG antibodies are associated with a shift to higher LIBRA-Seq scores compared to IgM antibodies. This supports the previously described data that IgG class switch sequences were more mutated than non-class switch sequences. Collectively, these data demonstrate affinity maturation in the transgenic platform of the present disclosure.

[0222] Example 9: Evidence of Binding Affinity of Antibodies Expressed as HCab After immunization with immunogen A and sequencing as described in Example 5 above, a subset of clones was selected to sample the repertoire and expressed as IgG1 antibodies lacking CH1 and consisting only of the heavy chain (HCab).

[0223] The HCab molecules were purified and quantified, and the affinity for human immunogen A was determined by SPR using the Caterra system (performed using the Caterra LSA instrument on a carboxymethyldextran planar (CMDP) sensor).

[0224] Figure 13 exemplifies the affinity spread of 63 clones that were expressed at sufficient levels, bound to immunogen A, and had kinetics that passed the quality cut-off. As can be seen from the affinity data, the majority of the clones tested had a K D in the range of 100 nM, and some clones had a range of higher affinity up to approximately 100 pM, showing a spread of affinity.

[0225] These data are evidence that the transgenic heavy-chain-only platform of the present disclosure functions successfully to generate high-affinity target-specific heavy-chain-only molecules.

Claims

1. A non-human animal cell containing multiple human IgH V gene segments, one or more human IgH D gene segments, and one or more human IgH J gene segments upstream of all or part of the human heavy constant (C) region, and containing an antibody heavy chain locus that forms a human heavy VDJC region: i) Human heavy VDJC DNA is inserted upstream, downstream, or into the endogenous non-human animal IgH locus; ii) The human heavy chain constant region comprises Cδ, Cε, Cγ2, Cγ3, and / or Cα gene segments, each encoding a CH1 domain, and Cμ and Cγ1 gene segments, wherein the Cμ CH1 domain and Cγ1 CH1 domain are inactivated; iii) There is virtually no expression of light chains and virtually no expression of non-human heavy chains. Non-human animal cells.

2. The cell according to claim 1, wherein the cell can produce antibodies of both IgG and IgM isotypes and undergo isotype switching.

3. The cell according to claim 1 or 2, wherein the Cμ CH1 domain and / or the Cγ1 CH1 domain are inactivated by a partial deletion of the nucleotide sequence encoding the CH1 domain.

4. The cell according to any one of claims 1 to 3, wherein the Cμ CH1 domain and / or the Cγ1 CH1 domain are inactivated by complete deletion of the nucleotide sequence encoding the CH1 domain.

5. The cell according to any one of claims 1 to 4, wherein the Cμ CH1 domain is inactivated by complete deletion of the nucleotide sequence encoding the CH1 domain, and the Cγ1 CH1 domain is inactivated by partial deletion of the nucleotide sequence encoding the CH1 domain.

6. The cell according to claim 4, wherein the Cμ CH1 domain is inactivated by complete deletion of the nucleotide sequence encoding the CH1 domain, and the Cγ1 CH1 domain is inactivated by complete deletion of the nucleotide sequence encoding the CH1 domain.

7. The cell according to any one of claims 1 to 6, wherein the endogenous non-human animal heavy chain VDJ gene segment is inverted.

8. The cell according to any one of claims 1 to 7, wherein one or more of the endogenous heavy chain J gene segments are deleted.

9. The cell according to any one of claims 1 to 8, wherein the inserted human heavy chain VDJ region comprises, in germline arrangement, all of the human-derived V, D, and J gene segments and intervening sequences.

10. The cell according to any one of claims 1 to 9, wherein the inserted human heavy chain DNA includes, preferably, a complete human heavy chain VDJC region.

11. The cell according to any one of claims 1 to 10, wherein the non-human animal is a rodent, preferably a mouse or a rat.

12. The cell according to any one of claims 1 to 11, wherein the endogenous lambda locus holds the JC1 and / or JC3 gene segments.

13. The cell according to any one of claims 1 to 12, wherein all endogenous lambda and / or kappa V genes are deleted.

14. A cell according to any one of claims 1 to 13, which does not express light chains and does not express non-human heavy chains.

15. The cell according to any one of claims 1 to 14, wherein the heavy chain constant region comprises Cδ, Cε, Cγ2, Cγ3, and Cα gene segments, each encoding a CH1 domain.

16. The cell according to any one of claims 1 to 15, wherein the Cμ gene segment is positioned upstream of the Cγ1 gene segment.

17. The cell according to any one of claims 1 to 16, wherein the Cγ1 gene segment includes a point mutation that results in an H237Y mutation in the IgG1 coding sequence.

18. The cell according to any one of claims 1 to 17, wherein the antibody heavy chain gene locus includes a fully human constant region.

19. The cell according to any one of claims 1 to 18, wherein the cell is homozygous with respect to the antibody heavy chain gene locus.

20. A transgenic non-human animal comprising a plurality of cells according to any one of claims 1 to 19, the animal capable of expressing a repertoire of antibodies consisting only of IgM and IgG heavy chains.

21. A method for producing an antibody consisting solely of human heavy chains specific to a desired antigen, comprising: immunizing a non-human animal described in claim 20 with the desired antigen; recovering the antibody or its coding nucleic acid from the animal; or recovering cells that produce the antibody.

22. The method according to claim 21, further comprising cloning the coding nucleic acid into recombinant host cells, culturing the cells for the expression of the heavy chain antibody, and recovering and purifying the antibody from the cells or culture medium.

23. The method according to claim 21 or 22, further comprising formulating the antibody or antibody chain together with a pharmaceutically acceptable carrier or other excipient to produce a pharmaceutical composition.

24. A method for producing a pharmaceutical composition comprising an antibody specific to a desired antigen and a pharmaceutically acceptable carrier or other excipient, comprising: immunizing a non-human animal according to claim 20 with the desired antigen; recovering the antibody; and formulating the antibody together with the pharmaceutically acceptable carrier or other excipient.

Images