Double-stranded nucleic acids modified with 5-halouracil and their use in the treatment of cancer
Patent Information
- Application Number
- JP2026512121
- Authority / Receiving Office
- JP · JP
- Patent Type
- Applications
- Current Assignee / Owner
- Priority Date
- 2023-08-22
- Filing Date
- 2024-08-22
- Publication Date
- 2026-08-27
AI Technical Summary
【0033】 本明細書に提供されるデータは、知られている抗がん剤、例えば、5-FU、ゲムシタビン又はメトトレキセート(MTX)単独と比較して、本明細書に記載されている二本鎖核酸組成物の腫瘍抑制の増強された治療有効性を示し、腫瘍特異性を改善する。従って、本組成物及び方法は、より低い毒性及びより少ない副作用をもたらすより低い投薬を可能にすることの追加的な利益を提供する。記載されている核酸組成物によって示される更に別の著しい利点は、本組成物が、修飾されていないmiR-15a配列と比較して安定性を著しく改善したことである。よって、少なくとも顕著な利点を考慮して、本明細書に開示されている核酸組成物は、複数の癌遺伝子及びシグナル伝達経路を抑制することによるがんの処置における実質的な進歩を表す。
Smart Images

Figure 2026529142000013 
Figure 2026529142000014 
Figure 2026529142000015
Abstract
Description
[Technical Field]
[0001] Cross-reference of related applications This application claims the benefit of priority from U.S. Provisional Patent Application No. 63 / 578,033, filed on 22 August 2023, which is incorporated herein by reference in its entirety.
[0002] Inclusion by referencing the sequence list A 15KB XML sequence listing, named 050_9294_US_SequenceListing, created on August 18, 2023, and submitted to the United States Patent and Trademark Office via the Patent Center, is incorporated herein by reference.
[0003] This disclosure broadly relates to compositions and methods for treating cancer, and more particularly to methods for which modified double-stranded nucleic acids, alone or in combination with 5-fluorouracil, are used in the treatment of cancer, particularly pancreatic, ovarian, and colorectal cancer. [Background technology]
[0004] MicroRNAs (miRNAs, miRs) are a highly conserved class of non-coding small RNA molecules that negatively regulate the expression of their target genes, thereby mediating translation in cells or organisms by causing translational arrest, mRNA cleavage, or a combination thereof. See Bartel DP. Cell. (2009) 136(2):215-33. By targeting multiple transcripts, miRNAs regulate a wide range of biological processes, including apoptosis, differentiation, and cell proliferation; therefore, abnormal microRNA function can lead to cancer (see Ambros V. Nature. (2004) 431 (7006):350-35), and consequently, miRNAs have recently been identified as biomarkers, oncogenes, or tumor suppressors. See, for example, Croce, CM, Nat Rev Genet. (2009) 10:704-714.
[0005] Pancreatic cancer is a highly difficult and often fatal cancer to treat. See Siegel, RL et al., CA Cancer J. Clin. (2015) 65: pp. 5-29. Unique aspects of pancreatic cancer include a very low 5-year survival rate of less than 7% (ibid.), late-onset symptoms, early metastasis, and poor response to chemotherapy and radiation. See Maitra A and Hruban RH, Annu Rev. Pathol. (2008) 3: pp. 157-188. To date, gemcitabine-based chemotherapy (2',2'-difluoro-2'deoxycytidine) is the absolute standard for treating pancreatic cancer, but the effectiveness of the treatment intervention is limited due to drug resistance. See Oettle, H et al., JAMA (2013) 310: pp. 1473-1481.
[0006] Ovarian cancer is present in approximately 225,000 women in the United States, with approximately 12 out of 100,000 women newly diagnosed with ovarian cancer each year. (Noone AM et al., SEER Cancer Statistics Review, 1975–2015, National Cancer Institute. Bethesda, MD (2018)). There are three main forms of ovarian cancer: ovarian epithelial cancer, fallopian tube cancer, and primary peritoneal cancer, which form in the tissue covering the ovary, the fallopian tube, or the tissue lining the peritoneum, respectively. Many chemotherapy agents, including but not limited to cytotoxic drugs such as Taxol (e.g., paclitaxel), doxorubicin hydrochloride, topotecan hydrochloride, gemcitabine hydrochloride, carboplatin, and cisplatin, are used to treat ovarian cancer. In addition, many antibody-based therapies, such as bevacizumab, olaparib, and rucaparib cansylate, are administered to treat ovarian cancer.
[0007] 5-Fluorouracil (i.e., 5-FU, or more specifically, 5-fluoro-1H-pyrimidine-2,4-dione) is a well-known pyrimidine antagonist used in many adjuvant chemotherapy agents, including Carac® cream, Efudex®, Fluoroplex®, and Adrucil®. It is well established that 5-FU targets thymidylate synthase (TYMS or TS), a critical enzyme that catalyzes the methylation of deoxyuridine monophosphate (dUMP) to deoxythymidine monophosphate (dTMP), an essential step in DNA biosynthesis. (Danenberg PV, Biochim. Biophys. Acta. (1977) 473(2):73-92). However, despite steady improvements in 5-FU-based therapies, patient response rates to 5-FU-based chemotherapy remain modest due to the development of drug resistance. Longley D. B et al., Apoptosis, Cell Signaling, and Human Diseases, (2007) pp. 263-78. [Prior art documents] [Patent Documents]
[0008] [Patent Document 1] U.S. Patent Application Publication No. 2016 / 0090636 [Patent Document 2] International PCT application WO / 1996 / 041809 [Non-patent literature]
[0009] [Non-Patent Document 1] Bartel DP. Cell. (2009) 136(2):215~33 [Non-Patent Document 2] Ambros V. Nature. (2004) 431 (7006): pages 350~5 [Non-Patent Document 3] Croce, CM, Nat Rev Genet. (2009) 10:704~714 pages [Non-licensed Document 4] Siegel, RL et al., CA Cancer J. Clin. (2015) 65: 5-29 [Non-licensed Document 5] Maitra A and Hruban RH, Annu Rev. Pathol. (2008) 3:157~188 pages [Non-licensed Document 6] Oettle, H et al., JAMA (2013) 310:1473~1481 [Non-licensed Document 7] Noone AM et al. (Eds.), SEER Cancer Statistics Review, 1975~2015, National Cancer Institute. Bethesda, MD (2018) [Non-licensed Document 8] Danenberg PV, Biochim. Biophys. Acta. (1977) 473(2): pages 73~92 [Non-licensed Document 9] Longley D. B et al., Apoptosis, Cell Signaling, and Human Diseases, (2007) pages 263~78 [Non-licensed Document 10] Gottesman MM et al., Nature Reviews Cancer, (2002) 2(1): 48-58 [Non-licensed Document 11] Fesler, A., Liu, H., Ju, J., Modified miR-15a has therapeutic potential for improving treatment of advanced stage colorectal cancer through inhibition of BCL2, BMI1, YAP1 and DCLK1, Oncotarget, 2018, 9 (2), pp. 2367~2383 [Non-licensed Document 12] Guo, S., Fesler, A., Huang, W., Wang, Y., Yang, J., Wang, [Non-licensed Document 13] Xie T et al., Clin Transl Oncol. (2015) 17(7):504~10 pages [Non-licensed Document 14] Acunzo M and Croce CM, Clin. Chem. (2016) 62(4):655~6 pages [Non-licensed Document 15] J. Wu et al., Cell Cycle, (2010) 9:9, pp. 1809-1818 [Non-licensed Document 16] Zhai, H. et al., Oncotarget. (2015) 6: 19735-46 [Non-licensed Document 17] Song, B. et al., Clin. Cancer Res. (2008), 14: 8080-8086. [Non-licensed Document 18] Zhai, H et al., Oncogene. (2013), 32:12, pp. 1570-1579. [Non-licensed Document 19] Li, J et al., Oncotarget. (2016), 7:38, pp. 62778-62788. [Non-licensed Document 20] Li, J. et al., Oncogene. (2016) 35, 5501-5514 [Non-licensed Document 21] CM Dunham et al., Nature Methods, (2007) 4(7), pp. 547-548 [Non-licensed Document 22] Bertino, JR, Cancer research: from folate antagonism to molecular targets, Best Pract Res Clin Haematol, 2009, 22 (4), pages 577~82 [Non-licensed Document 23] Schweitzer, BI, Dicker, AP, Bertino, JR, Dihydrofolate reductase as a therapeutic target, FASEB J, 1990, 4 (8), pages 2441~52 [Non-licensed Document 24] Brzezinska, A., Winska, P. Balinska, M., Cellular aspects of folate and antifolate membrane transport, Acta Biochim Pol, 2000, 47 (3), pages 735~49 [Non-licensed Document 25] Li, MH, Choi, SK, Thomas, TP, Desai, A., Lee, KH, Kotlyar, A., Banaszak Holl, MM, Baker, JR, Jr., Dendrimer-based multivalent methotrexates as dual acting nanoconjugates for cancer cell targeting, Eur J Med Chem 2012, 47 (1), pp. 560~72 [Non-licensed Document 26] Oettle, H et al., JAMA (2013) 310, pp. 1473-1481 [Non-licensed Document 27] "Remington's Pharmaceutical Sciences", The Science and Practice of Pharmacy, 19th Edition, Mack Publishing Company, Easton, Pa., (1995) [Non-licensed Document 28] Liu et al., Gastroenterology, 2022, 162, pp. 575 - 589
Non - Patent Document 29
Non - Patent Document 30
Non - Patent Document 31
Non - Patent Document 32
Non - Patent Document 33
Non - Patent Document 34
Non - Patent Document 35
Summary of the Invention
Problems to be Solved by the Invention
[0010] Nevertheless, existing cancer therapies continue to face numerous obstacles, including toxic side effects and resistance. For example, while 5-FU is considerably effective in treating various cancers, it is well known to possess substantial toxicity and can induce many adverse side effects. Regarding miRNAs, such compounds are known to be sensitive to enzymatic degradation upon administration, resulting in insufficient stability. Furthermore, tumor cells are known to evade the apoptotic pathway by developing resistance to common therapeutic agents such as 5-FU and gemcitabine. See Gottesman MM et al., Nature Reviews Cancer, (2002) 2(1):48-58. Therefore, there would be significant benefits in developing more effective, stable, and less toxic drug therapies for cancer treatment. [Means for solving the problem]
[0011] Tumor suppressor miRNA candidates such as miR-15a, modified with the pyrimidine analog 5-fluorouracil (5-FU), have potent efficacy in inhibiting tumor growth in colorectal cancer, pancreatic cancer, and many other tumor types (Fesler, A., Liu, H., Ju, J., Modified miR-15a has therapeutic potential for improving treatment of advanced stage colorectal cancer through inhibition of BCL2, BMI1, YAP1 and DCLK1, Oncotarget, 2018, 9 (2), pp. 2367-2383), (Guo, S., Fesler, A., Huang, W., Wang, Y., Yang, J., Wang, X., Zheng, Y., Hwang, GR, Wang, H., Ju, J., Functional Significance and Therapeutic Potential of miR-15a Mimic in Pancreatic Ductal Adenocarcinoma, Mol Ther Nucleic Acids, 2020, 19, pp. 228-239). In addition, along with 5-FU modification, gemcitabine is introduced into 5-FU-miR-15a by replacing C with gemcitabine in the guide strand of miR-15a. The dual modification of 5-FU and gemcitabine further enhanced the therapeutic efficacy of the tumor suppressor miR-15a. To further improve the tumor specificity of 5-FU-modified miR-15a against cancer cells, MTX-miRNA (in this case, miR-15a modified with 5-FU and gemcitabine as an example) conjugates are designed and synthesized using click chemistry. Both 5-FU and gemcitabine modifications are present in the guide (target) strand of miR-15a, while the MTX conjugation is present in the sense (passenger) strand of miR-15a. The rationale behind this design is that folate receptors / reduced folate carriers (which are elevated in cancer cells) are used as a way to improve tumor specificity.Because MTX is present on the passenger strand of miRNA, it does not interfere with mRNA target recognition or target strand binding. When MTX is broken down from miRNA mimetic, it adds an additional tumor-killing effect to the modified miRNA tumor suppressor.
[0012] Accordingly, one aspect of the present disclosure relates to a double-stranded nucleic acid composition comprising a modified double-stranded nucleic acid sequence comprising uracil, gemcitabine, and methotrexate (MTX), wherein the uracil comprises 5-fluorouracil.
[0013] In some embodiments, the modified double-stranded nucleic acid sequence includes a modified microRNA nucleotide sequence. In some embodiments, the modified microRNA nucleotide sequence includes the miR-15a microRNA nucleotide sequence shown in SEQ ID NO: 1.
[0014] In some embodiments, the miR-15a microRNA nucleotide sequence includes a guide strand and a passenger strand.
[0015] In some embodiments, cytidine is replaced with gemcitabine in the guide strand of the miR-15a microRNA nucleotide sequence. In some embodiments, uracil in the guide strand of the miR-15a microRNA nucleotide sequence is 5-fluorouracil.
[0016] In some embodiments, methotrexate (MTX) is conjugated in the passenger strand of the miR-15a microRNA nucleotide sequence. In some embodiments, methotrexate (MTX) is conjugated at the 5' end of the passenger strand of the miR-15a microRNA nucleotide sequence.
[0017] In some embodiments, dual modification of miR-15a using 5-fluorouracil and gemcitabine enhances the therapeutic efficacy of tumor suppression compared to unmodified miR-15a.
[0018] In some embodiments, dual modification of miR-15a using 5-fluorouracil and gemcitabine enhances the therapeutic efficacy of tumor suppression compared to unmodified miR-15a.
[0019] Another aspect of the present disclosure relates to a double-stranded nucleic acid composition comprising a double-stranded nucleic acid sequence comprising uracil, gemcitabine, and methotrexate (MTX), wherein the uracil comprises 5-fluorouracil, and a pharmaceutically acceptable carrier.
[0020] In some embodiments, the modified microRNA nucleotide sequence in the pharmaceutical composition includes the miR-15a microRNA nucleotide sequence shown in SEQ ID NO: 1.
[0021] In some embodiments, the miR-15a microRNA nucleotide sequence in the pharmaceutical composition includes a guide strand and a passenger strand.
[0022] In some embodiments, cytidine is replaced with gemcitabine in the guide strand of the miR-15a microRNA nucleotide sequence in the pharmaceutical composition. In some embodiments, uracil in the guide strand of the miR-15a microRNA nucleotide sequence in the pharmaceutical composition is 5-fluorouracil.
[0023] In some embodiments, methotrexate (MTX) is conjugated at the passenger strand of the miR-15a microRNA nucleotide sequence in the pharmaceutical composition. In some embodiments, methotrexate (MTX) is conjugated at the 5' end of the passenger strand of the miR-15a microRNA nucleotide sequence in the pharmaceutical composition.
[0024] Another aspect of the present disclosure relates to a double-stranded nucleic acid composition comprising a modified double-stranded nucleic acid sequence comprising uracil, gemcitabine, and methotrexate (MTX), wherein the method for treating cancer comprises the step of administering an effective amount of the double-stranded nucleic acid composition comprising uracil, 5-fluorouracil.
[0025] In some embodiments, the subject is a mammal. In some embodiments, the mammal is a human.
[0026] In some embodiments, the subject has cancer selected from the group consisting of colorectal, gastric, esophageal, breast, lung, prostate, ovarian, uterine, pancreatic, liver, skin, blood, or cervical cancer. In some embodiments, the subject has pancreatitis or fibrosis.
[0027] In some embodiments, the subject has pancreatic cancer. In some embodiments, the pancreatic cancer is pancreatic ductal adenocarcinoma (PDAC). In some embodiments, the subject has ovarian cancer.
[0028] In some embodiments, the double-stranded nucleic acid composition is administered to the subject by injection.
[0029] In some embodiments, the modified double-stranded nucleic acid sequence for a method for treating cancer comprises a modified microRNA nucleotide sequence. In some embodiments, the modified microRNA nucleotide sequence for a method for treating cancer comprises the miR-15a microRNA nucleotide sequence shown in SEQ ID NO: 1.
[0030] In some embodiments, the miR-15a microRNA nucleotide sequence for a method of treating cancer includes a guide strand and a passenger strand. In some embodiments, the uracil in the guide strand of the miR-15a microRNA nucleotide sequence for a method of treating cancer is 5-fluorouracil.
[0031] In some embodiments, cytidine is replaced with gemcitabine in the guide strand of the miR-15a microRNA nucleotide sequence for a method for treating cancer.
[0032] In some embodiments, the modified double-stranded nucleic acid sequence induces apoptosis. In some embodiments, the modified double-stranded nucleic acid sequence includes MTX-5FU-Gem-miR-15a. In some embodiments, the modified miR-15a exhibits enhanced efficacy in inducing apoptosis compared to both unmodified miR-15a and co-treatment with 5-FU and gemcitabine.
[0033] The data provided herein demonstrate the enhanced therapeutic efficacy of the double-stranded nucleic acid compositions described herein in tumor suppression and improved tumor specificity compared to known anticancer agents, such as 5-FU, gemcitabine, or methotrexate (MTX) alone. Therefore, the compositions and methods offer the additional benefit of enabling lower dosages, resulting in lower toxicity and fewer side effects. Yet another significant advantage demonstrated by the described nucleic acid compositions is their significantly improved stability compared to unmodified miR-15a sequences. Thus, at least considering the significant advantages, the nucleic acid compositions disclosed herein represent a substantial advance in the treatment of cancer by suppressing multiple oncogenes and signaling pathways. [Brief explanation of the drawing]
[0034] [Figure 1] The MTX-5-FU-GEM-miR-15a sequence and the location of its modifications. MTX-5-FU-GEM-miR-15a has uracil replaced with 5-fluorouracil (5-FU) and cytidine replaced with gemcitabine (GEM) on its 5' strand. Methotrexate (MTX) is conjugated at the 5' end of the 3' strand of the modified miRNA. [Figure 2]MTX-5-FU-GEM-miR-15a exhibits dose-dependent inhibition of cancer cell growth without the use of a delivery medium. (A) MTX-5-FU-GEM-miR-15a can inhibit proliferation in MD-MBA-231 cells without the use of a delivery medium (IC50 = 4.6 nM), whereas miR-15a cannot enter cells and inhibit proliferation without a delivery medium. (B) Furthermore, MTX-5-FU-GEM-miR-15a inhibits cancer cell growth in A549 non-small cell lung cancer cells, MD-MBA-231 trinegative breast cancer cells, and MIA PaCa-2 and PANC-1 pancreatic cancer cells without the use of a delivery medium. A549 has undetectable levels of folate receptors, while MD-MBA-231 cells exhibit relatively high levels of folate receptors. Compared to each other, MD-MBA-231 cells are 22.2 times more sensitive than A549 cells. Similarly, in PDAC, PANC-1 cells have very low expression of the folate receptor, while MIA PaCa-2 cells have higher expression. The relative sensitivity of the two is such that MIA PaCa-2 cells are 1.8 times more sensitive, suggesting a correlation with folate receptor status. [Figure 3] MTX-5-FU-GEM-miR-15a acts similarly to miRNA while maintaining its target specificity for its miR-15a targets, YAP1 and BMI1. MTX-5-FU-GEM-miR-15a can knock down the reported targets of miR-15a. MTX-5-FU-GEM-miR-15a knocks down YAP1 and BMI1 in (A) MD-MBA-231 trinegative breast cancer cells, and (B) YAP1 in MIA PaCa-2 pancreatic cancer cells. [Figure 4]MTX-5FU-Gem-miR-15a can inhibit the growth of PDAC PDX organoids (hF44, hF3, hT89) under medium-free conditions. The IC50 of the modified miRNA is approximately 2 nM in treatment of these organoids, which is about 1 / 250th that of gemcitabine. (B) Representative image of (A) untreated hF44 PDAC organoids compared to those treated with 12.5 nM MTX-5-FU-GEM-miR-15a. (C) >200-fold enhancement of growth inhibition compared to gemcitabine alone is observed in hF3, (D) hF44, and (E) hT89 organoids. Data are presented as mean ± standard error of the mean (n=3). [Figure 5] Dose-response curves of modified miR-15a mimetic and gemcitabine in human PDAC organoids hT89. Human PDAC hT89 cells were seeded in 96-well plates and treated with 5-FU-miR-15a (IC50 = 24.7 ± 3.4 nM), MTX-5-FU-GEM-miR-15a (IC50 = 1.2 ± 0.2 μM), and gemcitabine (IC50 = 1.2 ± 0.2 μM). [Figure 6] PDAC cell lines (PANC-1, MIAPaCa-2, and Hs766T) and gemcitabine-resistant counterparts of Hs766T were treated with varying concentrations of MTX-5FU-Gem-miR-15a without the use of any delivery medium. Modified miR-15a successfully crossed the lipid bilayer without the use of any delivery medium and demonstrated its ability to inhibit cancer cell growth in a dose-dependent manner. The IC50 values for modified miRNA and gemcitabine are shown in the table. [Figure 7](A) MTX-5FU-Gem-15a was found to induce cell cycle arrest in both Hs766T parental and gemcitabine-resistant cells, as measured by propidium iodide (PI) staining. The G2 / S ratio was significantly reduced after treatment with modified miR-15a, indicating an increase in the S phase cell population and a simultaneous decrease in G2 phase cells, suggesting that modified miR-15a induced cell cycle arrest in both parental and gemcitabine-resistant PDAC cells. (B) Annexin V / PI staining demonstrated the induction of apoptosis in both cell lines after treatment with MTX-5FU-Gem-miR-15a. Modified miR-15a showed enhanced efficacy in inducing apoptosis in both cell lines compared to unmodified miR-15a and both co-treatment with 5-FU and Gem. [Figure 8] MTX-5FU-Gem-miR-15a maintains target specificity and downregulates the expression of miR-15a targets. PDAC cell lines (Hs766T) were transfected with unmodified miR-15a and MTX-5FU-Gem-miR-15a using a delivery medium. Modified miRNA treatment was found to result in increased downregulation of several key miR-15a targets, CHK1, WEE1, and YAP1, which play a critical role in PDAC progression and drug resistance. [Figure 9] Modified miR-15a demonstrated significant inhibition of metastatic pancreatic ductal adenocarcinoma (PDAC) tumor growth in NOD / SCID mice. Xenografts were established by intravenous injection of luciferase-expressing Hs766T cells into mice via the tail vein. By day 37 post-injection, mice treated with a dose of 4 mg / kg of MTX-5FU-Gem-miR-15a showed a 7.3-fold reduction in tumor growth compared to the control group. [Figure 10](A) Comparative effect of modified and unmodified miR-15a on ovarian cancer cell viability. OVCAR-3 (ovarian epithelial cancer cell line) cells were treated with varying concentrations of both MTX-5FU-Gem-miR-15a and unmodified miR-15a without the use of any delivery medium. It was observed that unmodified miR-15a could not effectively cross the lipid bilayer in the absence of a delivery medium. In contrast, modified miR-15a successfully crossed the lipid bilayer and demonstrated the ability to inhibit cancer cell growth in a dose-dependent manner. The IC50 value of MTX-5FU-Gem-15a was calculated to be 1.88 ± 0.31 nM in OVCAR-3 parent cells. (B) The efficacy of the modified miRNA mimic was also observed in two other ovarian epithelial cancer cell lines - SK-OV-3 and A2780. In SK-OV-3 cells, the efficacy of miRNA mimics was observed to be even higher with a delivery medium (IC50 - 5.67 ± 2.1 nM) compared to treatment without a delivery medium (IC50 - 37.5 ± 16.9 nM). [Figure 11] (A) Flow cytometry analysis of cell cycle progression in OVCAR-3 ovarian cancer cells treated with MTX-5FU-Gem-miR-15a (using propidium iodide staining). The G2 / S ratio was significantly reduced after treatment with modified miR-15a, indicating an increase in the cell population in S phase and a simultaneous decrease in cells in G2 phase, suggesting cell cycle arrest in S phase. (B) Annexin V / PI staining demonstrated increased efficacy in inducing apoptosis in MTX-5FU-Gem-miR-15a-treated cells compared to both unmodified miR-15a and co-treatment with 5FU and Gem. (C) The effects of modified miRNA mimics on cell cycle and apoptosis in two other ovarian cancer cell lines, SK-OV-3 and A2780, were also evaluated. Similar cell cycle arrest and apoptosis induction were observed in both cell lines. [Figure 12](A) Parental OVCAR-3 cells were made resistant to olaparib by gradually exposing them to increasing concentrations of the drug, and the efficacy of MTX-5FU-Gem-miR-15a was evaluated for its cytotoxic effect in such olaparib-resistant ovarian cancer cells in the absence of any delivery medium. Unmodified miR-15a was observed to have no effect without any delivery medium. However, modified miR-15a demonstrated significant potential in inhibiting proliferation and inducing cytotoxicity in drug-resistant cells (IC50 -6.5nM). (B) The effects of MTX-5FU-Gem-miR-15a treatment on cell cycle progression and apoptosis induction were also evaluated. Consistent with observations in parental cell lines, modified miRNA treatment resulted in a significant decrease in the G2 / S ratio, indicating S-phase cell cycle arrest, and demonstrated enhanced apoptosis induction in drug-resistant cells compared to both unmodified miR-15a and co-treatment with 5-FU and gemcitabine. [Figure 13] MTX-5FU-Gem-miR-15a also demonstrated sustained miR-15a functionality and was found to downregulate the expression of miR-15a targets WEE1, BMI1, DCLK1, and BCL2 in the OVCAR-3 cell line. OVCAR-3 cells were transfected with 50 nM miRNA using oligofectamine as the delivery medium, and protein samples were collected 3 days after transfection. [Modes for carrying out the invention]
[0035] This disclosure provides double-stranded nucleic acid compositions incorporating 5-fluorouracil (5-FU), gemcitabine (GEM), and methotrexate (MTX). Surprisingly, without being constrained by any one particular theory, this disclosure reveals that substitution of uracil nucleotides with 5-halouracil within double-stranded nucleic acid sequences, such as microRNA oligonucleotide sequences, increases the ability of microRNAs to inhibit cancer development, progression, and tumorigenesis. Because chemotherapeutic agents, such as 5-fluorouracil, gemcitabine, and methotrexate (MTX), are highly toxic and often cause resistance and patient mortality, this limits the effectiveness of these chemotherapeutic agents in benefiting patients. While microRNA tumor suppressors can suppress multiple oncogenic targets, concerns about microRNA off-target effects and toxicity always remain. This disclosure surprisingly reveals that the incorporation of both 5-FU and gemcitabine into double-stranded nucleic acids (e.g., microRNAs) and their conjugation with methotrexate (MTX) creates a new class of anticancer agents with high potency and tumor specificity. Contrary to concerns about toxic side effects from combining these, double-stranded nucleic acids modified with 5-FU and / or gemcitabine and conjugated with methotrexate (MTX) are highly tumor-specific and effective in eliminating cancer cells without toxic side effects. In addition, the modified double-stranded nucleic acids (e.g., miRNAs) can be delivered to cancer cells independently of the delivery medium, which is another unique feature.
[0036] Accordingly, this disclosure provides various double-stranded nucleic acid (e.g., microRNA) compositions incorporating the 5-halouracil molecule, gemcitabine, and methotrexate (MTX) into their nucleic acid sequences, as well as methods for using the same. This disclosure further provides formulations such as pharmaceutical compositions comprising the modified nucleic acid compositions, and methods for treating cancer, including administration thereof to subjects requiring it.
[0037] The term "double-stranded nucleic acid" is used interchangeably to refer to microRNA or siRNA (small interfering RNA).
[0038] The term "siRNA (small interfering RNA)," also known as short interfering RNA or silencing RNA, refers, like miRNA, to a class of double-stranded RNA molecules, initially non-coding RNA molecules, that operate within the RNA interference (RNAi) pathway and are typically 20–24 (usually 21) base pairs long.
[0039] The terms "microRNA," "miRNA," or "miR" are used interchangeably to refer to small, non-coding ribose nucleic acid (RNA) molecules that can regulate gene expression through interactions with messenger RNA molecules (mRNA), DNA, or proteins. Typically, microRNAs consist of nucleic acid sequences of approximately 19–25 nucleotides and are found in mammalian cells.
[0040] The terms "guide strand" and "passenger strand" refer to the two strands in a miRNA double helix. The guide strand (also known as the leading strand or miR) is the active strand that is incorporated into RISC (RNA-induced silencing complex), while the passenger strand (or miR*) is the complementary strand that is degraded.
[0041] The terms “modified microRNA,” “modified miRNA,” or “modified miR” are used interchangeably herein to refer to microRNA that is different from native or endogenous microRNA (unmodified microRNA). More specifically, in this disclosure, modified microRNA differs from an unmodified or unaltered microRNA nucleic acid sequence by one or more bases. In some embodiments of this disclosure, the modified microRNA of this disclosure comprises at least one uracil (U) nucleotide base substituted with 5-halouracil. In some embodiments, 5-halouracil is 5-fluorouracil. In other embodiments, the modified microRNA comprises additional nucleotides (i.e., adenine (A), cytosine (C), uracil (U), and guanine (G)) and at least one uracil base substituted with 5-halouracil.
[0042] One aspect of this disclosure describes a nucleic acid composition comprising a modified double-stranded nucleic acid sequence (e.g., a modified microRNA nucleotide sequence) having a uracil base (U,U base) replaced with 5-halouracil, for example, 5-fluorouracil (5-FU); a cytidine replaced with gemcitabine; and a conjugated methotrexate (MTX). As further described herein, the nucleic acid compositions of this disclosure are useful at least in the treatment of cancer, particularly pancreatic cancer.
[0043] In some embodiments, the nucleic acid composition contains a nucleotide sequence modified by derivatizing at least one uracil nucleobase at the 5-position with a group that produces an effect similar to that of a halogen atom. In some embodiments, the group that produces an effect similar to that of a halogen atom has a similar size in mass or spatial dimensions, for example, a molecular weight of 20, 30, 40, 50, 60, 70, 80, 90, or 80 g / mol or less. In certain embodiments, the group that produces an effect similar to that of a halogen atom may be, for example, a methyl group, a trihalomethyl (e.g., trifluoromethyl) group, a pseudohalide (e.g., trifluoromethanesulfonic acid, cyano, or cyanate), or a deuterium (D) atom. The group that produces an effect similar to that of a halogen atom may be present in the absence of or in addition to the 5-halouracil base in the miR-15a nucleotide sequence.
[0044] In certain embodiments, the modified microRNA has more than one or exactly one uracil that is replaced by 5-halouracil.
[0045] In some embodiments, the modified microRNA nucleotide sequence contains 3, 4, 5, 6, 7, or 8 or more uracil bases that are replaced by 5-halouracil.
[0046] In other embodiments, all uracil nucleotide bases of the modified mRNA are replaced with 5-halouracil.
[0047] In some embodiments, 5-halouracil is, for example, 5-fluorouracil, 5-chlorouracil, 5-bromouracil, or 5-iodouracil. In certain embodiments, 5-halouracil is 5-fluorouracil.
[0048] In exemplary embodiments, the disclosure relates to nucleic acid compositions comprising a modified miR-15a nucleotide sequence. In some embodiments, the miR-15a nucleotide sequence is modified by replacing at least one U base with 5-halouracil.
[0049] The term "miR-15a" is intended herein to be synonymous with the terms "microRNA-15a" or "miRNA-15a" and refers to an oligonucleotide having the following nucleotide sequence:UAGCAGCACAUAAUGGUUUGUG[SEQ ID NO: 1] (wherein A=adenine, C=cytosine, U=uracil, and G=guanine). The aforementioned nucleotide sequence is referred herein as the unmodified (i.e., "native") miR-15a sequence unless otherwise specified. miR-15a may also be referred in the art as hsa-miR-15a or hsa-miR-15a-5p, with accession number MI0000069. miR-15a is well known and has been studied in detail. See, for example, Xie T et al., Clin Transl Oncol. (2015) 17(7):504-5010; and Acunzo M and Croce CM, Clin. Chem. (2016) 62(4):655-6516. Methods for producing miR-15a mimics are known to those skilled in the art. Unless otherwise stated, all such modified miR-15a forms are considered in this specification to be within the scope of the term “miR-15a mimic”.
[0050] Generally, modified miR-15a (i.e., miR-15a mimics) contain one, two, three, four, or five or fewer additional nucleotides covalently added to the native miR-15a sequence, where the additional bases are independently selected from C, U, G, and C, or the additional bases may exclusively be U. Typically, miR-15a is used in single-stranded form, but double-stranded versions are also considered herein.
[0051] In some embodiments, at least one U base in the miR-15a sequence is 5-halouracil, whether in the native portion or / or the added portion. 5-halouracil can be, for example, 5-fluorouracil, 5-chlorouracil, 5-bromouracil, or 5-iodouracil.
[0052] In some embodiments, the miR-15a sequence is a double-stranded sequence including a guide strand and a passenger strand. In some embodiments, the guide strand of the miR-15a sequence corresponds to Sequence ID No. 1. In some embodiments, all U bases in the miR-15a guide strand sequence are 5-halouracil. In certain embodiments, all U bases in the miR-15a guide strand sequence are 5-fluorouracil. In some embodiments, all cytidines in the miR-15a guide strand sequence are replaced with gemcitabine.
[0053] In some embodiments, the passenger strand of the miR-15a sequence has the nucleotide sequence CAGGCCAUAUUGUGCUGCCUCA[SEQ ID NO: 2]. In some embodiments, methotrexate (MTX) is conjugated in the passenger strand of the miR-15a microRNA nucleotide sequence. In some embodiments, methotrexate (MTX) is conjugated at the 5' end of the passenger strand of the miR-15a microRNA nucleotide sequence.
[0054] In some embodiments, the double-stranded MTX-5-FU-GEM-miR-15a sequence has the nucleotide sequence [SEQ ID NO: 3] as depicted in Figure 1.
[0055] In certain embodiments, the nucleic acid composition contains a miR-15a nucleotide sequence modified by derivatizing at least one uracil (U) nucleic acid base at the 5-position with a group that produces an effect similar to that of a halogen atom. In some embodiments, the group that produces an effect similar to that of a halogen atom has a similar size in mass or spatial dimensions, for example, a molecular weight of 20, 30, 40, 50, 60, 70, 80, 90, or less than 80 g / mol. The group that produces an effect similar to that of a halogen atom may be, for example, a methyl group, a trihalomethyl (e.g., trifluoromethyl) group, a pseudohalide (e.g., trifluoromethanesulfonate, cyano, or cyanate), or a deuterium (D) atom. The group that produces an effect similar to that of a halogen atom may be present in the miR-15a nucleotide sequence in the absence of or in addition to the 5-halouracil base. Furthermore, the group that produces an effect similar to that of a halogen atom may be located in the native (or seed) portion and / or added portion of the miR-15a nucleotide sequence.
[0056] In some embodiments, the candidate microRNAs are 5-FU-miR-129, 5-FU-miR-506, 5-FU-miR-200, 5-FU-miR-200b, 5-FU-miR-200c, 5-FU-miR-140, 5-FU-miR-194, 5-FU-miR-miR-215, 5-FU-miR-34, 5-FU-let-7g, and 5-FU-miR-489.
[0057] The term "miR-129" is intended herein to be synonymous with the terms "microRNA-129" or "miRNA-129" and refers to an oligonucleotide having the following nucleotide sequence:CUUUUUGCGGUCUGGGCUUGC[SEQ ID NO: 4] (wherein C=cytosine, U=uracil, and G=guanine). The aforementioned nucleotide sequence is referred herein to as the unmodified miR-129 (i.e., "native") sequence unless otherwise specified. miR-129 may also be referred in this art as hsa-miR-129 or hsa-miR-129-5p, having accession numbers MI0000252 and MIMAT0000242. miR-129 is well known and has been studied in detail. See, for example, J. Wu et al., Cell Cycle, (2010) 9:9, pp. 1809–1818. Similarly, as is well known in the art, miR-129 sequences may be modified to produce “miR-129 mimics” that have a modified sequence from the native sequence but retain the known function or activity of the native miR-129. Unless otherwise stated, all such modified miR-129 compositions are considered herein to be within the scope of the term “miR-129 mimic”.
[0058] The term "miR-140" is intended herein to be synonymous with the terms "microRNA-140" or "miRNA-140" and refers to an oligonucleotide having the following nucleotide sequence: CAGUGGUUUUACCCUAUGGUAG[SEQ ID NO: 5] (wherein A=adenine, C=cytosine, U=uracil, and G=guanine bases). The aforementioned nucleotide sequence is referred herein as the unmodified (i.e., "native") miR-140 sequence unless otherwise specified. miR-140 can also be referred to by accession number NT_010498 or miRBase accession MI0000456. miR-140 is well known and has been studied in detail. See, for example, Zhai, H. et al., Oncotarget. (2015) 6: 19735-46. As described above for exemplary mimics miR-129 and miR-15a, methods for producing miR-140 mimics are known to those skilled in the art. Unless otherwise stated, all such modified miR-140 forms are considered in this specification to be within the scope of the term “miR-140 mimic”.
[0059] The term "miR-192" is intended herein to be synonymous with the terms "microRNA-192" or "miRNA-192" and refers to an oligonucleotide having the following nucleotide sequence:CUGACCUAUGAAUUGACAGCC[SEQ ID NO: 6] (wherein A=adenine, C=cytosine, U=uracil, and G=guanine bases). The aforementioned nucleotide sequence is referred herein as the unmodified (i.e., "native") miR-192 sequence unless otherwise specified. miR-192 may also be referred to as hsa-mir-192 or by the miRBase commission MI0000234 or MIMAT0000222. miR-192 is well known and has been studied in detail. See, for example, Song, B. et al., Clin. Cancer Res. (2008), 14: pp. 8080-8086. As described above for exemplary mimics miR-129, miR-140, and miR-15a, methods for producing miR-192 mimics are known to those skilled in the art. Unless otherwise stated, all such modified miR-192 forms are considered herein to be within the scope of the term “miR-192 mimic”.
[0060] The term "miR-502" is intended herein to be synonymous with the terms "microRNA-502" or "miRNA-502" and refers to an oligonucleotide having the following nucleotide sequence: AUCCUUGCUAUCUGGGUGCUA[SEQ ID NO: 7] (wherein A=adenine, C=cytosine, U=uracil, and G=guanine). The aforementioned nucleotide sequence is referred herein as the unmodified (i.e., "native") miR-502 sequence unless otherwise specified. miR-502 may also be referred to as hsa-mir-502 or by the miRBase commissions MI0003186 or MIMAT0002873. miR-502 is well known and has been studied in detail. See, for example, Zhai, H et al., Oncogene. (2013), 32:12, pp. 1570-1579. As described above for exemplary mimics miR-129, miR-140, miR-192, and miR-15a, methods for producing miR-502 mimics are known to those skilled in the art. Unless otherwise stated, all such modified miR-502 forms are considered herein to be within the scope of the term “miR-502 mimic”.
[0061] The term "miR-506" is intended herein to be synonymous with the terms "microRNA-506" or "miRNA-506" and refers to an oligonucleotide having the following nucleotide sequence: UAUUCAGGAAGGUGUUACUUAA[SEQ ID NO: 8] (wherein A=adenine, C=cytosine, U=uracil, and G=guanine bases). The aforementioned nucleotide sequence is referred herein as the unmodified (i.e., "native") miR-506 sequence unless otherwise specified. miR-506 may also be referred to as hsa-mir-506 or by the miRBase commission MI0003193 or MIMAT0022701. miR-506 is well known and has been studied in detail. See, for example, Li, J. et al., Oncotarget. (2016), 7:38, pp. 62778-62788 and Li, J. et al., Oncogene. (2016), 35, pp. 5501-5514. As described above for exemplary mimics miR-129, miR-140, miR-502, miR-192 and miR-15a, methods for producing miR-506 mimics are known to those skilled in the art. Unless otherwise stated, all such modified miR-506 forms are considered in this specification to be within the scope of the term “miR-506 mimic”.
[0062] In some embodiments, the nucleic acid compositions of this disclosure can be produced by biosynthesis, such as by using in vitro RNA transcription from plasmids, PCR fragments, or synthetic DNA templates, or by using recombinant (in vivo) RNA expression methods. See, for example, CM Dunham et al., Nature Methods, (2007) 4(7), pp. 547-548. MicroRNA sequences (e.g., miR-15a, miR-140, miR-192, miR-502, miR-506, or miR-129 sequences) can be further chemically modified by techniques well known in the art, such as by functionalization with polyethylene glycol (PEG) or hydrocarbons or targeting agents, particularly cancer cell targeting agents such as folic acid. To include such groups, reactive groups (e.g., amino, aldehyde, thiol, or carboxylic acid groups) that can be used to add desired functional groups may first be included in the oligonucleotide sequence. Such reactions or functional groups can be incorporated into as-produced nucleic acid sequences, but they can be more easily incorporated by using automated oligonucleotide synthesis that includes non-nucleoside phosphoramidites containing the reactive group or reactive precursor group.
[0063] The term "methotrexate (MTX)" in this specification refers to a folate analog that acts as a competitive inhibitor to inhibit dihydrofolate reductase (DHFR), an enzyme involved in tetrahydrofolate synthesis (Bertino, JR, Cancer research: from folate antagonism to molecular targets, Best Pract Res Clin Haematol, 2009, 22 (4), pp. 577-582). The affinity of MTX for DHFR is approximately 1000 times that of folate (Bertino, JR, Cancer research: from folate antagonism to molecular targets, Best Pract Res Clin Haematol, 2009, 22 (4), pp. 577-582). DHFR catalyzes the conversion of dihydrofolate to active tetrahydrofolate (Schweitzer, BI, Dicker, AP, Bertino, JR, Dihydrofolate reductase as a therapeutic target, FASEB J, 1990, 4 (8), pp. 2441-2452). Folic acid is required for the de novo synthesis of nucleoside thymidines, which are necessary for DNA synthesis (Schweitzer, BI, Dicker, AP, Bertino, JR, Dihydrofolate reductase as a therapeutic target, FASEB J, 1990, 4 (8), pp. 2441-2452). Furthermore, since folate is essential for purine and pyrimidine base biosynthesis, its synthesis will likely be inhibited. Therefore, MTX inhibits the synthesis of DNA, RNA, thymidylates, and proteins. As a result, MTX is one of the key anticancer drugs (Schweitzer, BI, Dicker, AP, Bertino, JR, Dihydrofolate reductase as a therapeutic target, FASEB J, 1990, 4 (8), pp. 2441-2452).
[0064] MTX binds to folate receptors and / or reduced folate carriers (Brzezinska, A., Winska, P. Balinska, M., Cellular aspects of folate and antifolate membrane transport, Acta Biochim Pol, 2000, 47 (3), pp. 735-49). Elevated folate receptor levels have been found in many tumor types, and as a result, folate receptors can be utilized as a means of targeted delivery of anticancer drugs to cancer cells (Li, MH, Choi, SK, Thomas, TP, Desai, A., Lee, KH, Kotlyar, A., Banaszak Holl, MM, Baker, JR, Jr., Dendrimer-based multivalent methotrexates as dual acting nanoconjugates for cancer cell targeting, Eur J Med Chem 2012, 47 (1), pp. 560-572).
[0065] Methotrexate is one of the mainstays of treatment for the inflammatory forms of arthritis. It can reduce pain and swelling and can actually slow joint damage and disease progression over time. For this reason, methotrexate is known as a disease-modifying antirheumatic drug (DMARD). Methotrexate is used as a first-line treatment for patients with rheumatoid arthritis (RA), psoriatic arthritis (PsA), and juvenile idiopathic arthritis (JIA).
[0066] Gemcitabine (i.e., 2'2'-difluoro-2'deoxycytidine, dFdC, dFdCyd, difluorodeoxycytidine hydrochloride, or more specifically, gemcitabine hydrochloride) is a well-known pyrimidine nucleoside. Gemcitabine is the hydrochloride salt of an antimetabolite nucleoside deoxycytidine analog, possessing antineoplastic activity. Gemcitabine is converted intracellularly to the active metabolites difluorodeoxycytidine diphosphates and triphosphates (dFdCDP, dFdCTP). dFdCDP inhibits ribonucleotide reductase, thereby reducing the deoxynucleotide pool available for DNA synthesis; dFdCTP is incorporated into DNA, leading to DNA strand termination and apoptosis. Gemcitabine has the chemical structure 1-(2-oxo-4-amino-1,2-dihydropyrimidine-1-yl)-2-deoxy-2,2-difluororibose hydrochloride. To date, gemcitabine-based chemotherapy (2',2'-difluoro2'deoxycytidine) has been the absolute standard for the treatment of pancreatic cancer, but the effectiveness of the therapeutic intervention is limited by drug resistance (Oettle, H et al., JAMA (2013) 310, pp. 1473-1481).
[0067] Pancreatic ductal adenocarcinoma (PDAC) has the worst prognosis of any major malignant lesion, with over 45,000 deaths in the United States. Despite all the advances in pancreatic cancer research regarding early detection and treatment, only limited improvements in patient outcomes have been achieved. New strategies to address this disease are urgently needed. Resistance to chemotherapy based on 5-fluorouracil (5-FU) or gemcitabine is one of the leading causes of treatment failure in advanced PDAC. Chemotherapy resistance is highly complex for PDAC, involving protein-coding gene mutations such as KRAS, TP53, and tumor-associated fibroblasts. In addition, it has recently been recognized that epigenetic alterations play a key role in oncogenesis and resistance to chemotherapy based on 5-fluorouracil (5-FU). Recent studies have shown that epigenetic alterations, such as changes in non-coding miRNA expression, are major contributors to 5-FU and gemcitabine resistance by resulting in acute changes in protein synthesis at the post-transcriptional and post-translational levels. miRNAs are a class of small non-coding RNAs that modulate protein expression by promoting RNA degradation and inhibiting mRNA translation.
[0068] miR-15a was identified for its tumor suppressor function in PDACs by inhibiting the expression of several key therapeutic target genes (Wee1, Chk1, BMI1, and YAP1). More importantly, a novel strategy was developed to create a modified miR-15a mimic with enhanced efficacy in eliminating 5-FU and gemcitabine-resistant PDAC cells while maintaining target specificity. The miR-15a mimic was designed by modifying the target chain of miR-15a by substituting uracil (U) bases with 5-FU at various positions to combine the powers of 5-FU and therapeutic miRNA into a single entity to produce a therapeutic synergy. A unique feature of 5-FU-modified miRNA is that it can be internally transported by pancreatic cancer cells without the use of any delivery medium (e.g., oligofectamine, lipid nanoparticles, magnetic nanoparticles). This represents a major advance and paradigm shift in the development of miRNA-based therapies. This modification improves the potency and stability of the miR-15a mimic and enhances its ability to inhibit PDAC cancer metastasis in vivo. Cytidine is replaced with gemcitabine in the guide (target) strand of the 5-FU modified miR-15a microRNA nucleotide sequence. Such dual modification of miR-15a using 5-fluorouracil and gemcitabine enhances the therapeutic efficacy of tumor suppression compared to unmodified miR-15a. Furthermore, methotrexate (MTX) is conjugated at the 5' end of the passenger strand of the double-stranded 5-FU-GEM-miR-15a sequence. The MTX-5-FU-GEM-miR-15a sequence improves tumor specificity compared to unconjugated modified miR-15a, and when methotrexate (MTX) is disintegrated from the modified miR-15a miRNA, it adds an additional tumor-killing effect to the modified miR-15a miRNA tumor suppressor.
[0069] In another embodiment, this disclosure covers formulations of nucleic acid compositions described herein. For example, the nucleic acid compositions can be formulated for pharmaceutical use. In certain embodiments, the formulation is a pharmaceutical composition comprising the nucleic acid composition described herein and a pharmaceutically acceptable carrier.
[0070] The term “pharmaceutically acceptable carrier” is used herein synonymously with a pharmaceutically acceptable diluent, medium, or excipient. Depending on the type of pharmaceutical composition and the intended mechanism of administration, nucleic acid compositions may be dissolved or suspended in a pharmaceutically acceptable carrier (e.g., as an emulsion). A pharmaceutically acceptable carrier may be any liquid or solid compound, material, composition, and / or dosage form suitable for use in contact with the target tissue, within the bounds of sound medical judgment. A carrier should be “acceptable” in the sense that it is not harmful to the target to which it is given, and should be compatible with the other components of the formulation, i.e., should not alter its biological or chemical function.
[0071] Some non-limiting examples of materials that can function as pharmaceutically acceptable carriers include: sugars such as lactose, glucose, and sucrose; starches such as corn starch and potato starch; celluloses and their derivatives such as sodium carboxymethylcellulose, ethylcellulose, and cellulose acetate; gelatin; talc; waxes; oils such as peanut oil, cottonseed oil, safflower oil, sesame oil, olive oil, corn oil, and soybean oil; glycols such as ethylene glycol and propylene glycol; polyols such as glycerin, sorbitol, mannitol, and polyethylene glycol; esters such as ethyl oleate and ethyl laurate; agar; buffers; water; isotonic saline; pH buffer solutions; and other non-toxic, suitable substances used in pharmaceutical formulations. Pharmaceutically acceptable carriers may also include manufacturing aids (e.g., lubricants, talc, magnesium stearate, calcium or zinc, or stearic acid), solvents, or capsule encapsulation materials. Certain sweeteners and / or flavorings and / or colorings may be added as desired. Other suitable excipients can be found in standard pharmaceutical textbooks, such as "Remington's Pharmaceutical Sciences," The Science and Practice of Pharmacy, 19th edition, Mack Publishing Company, Easton, Pa., (1995).
[0072] In some embodiments, pharmaceutically acceptable carriers may include diluents that increase the bulk of the solid pharmaceutical composition and make the pharmaceutical dosage form easier for patients and caregivers to handle. Diluents for solid compositions include, for example, microcrystalline cellulose (e.g., Avicel®), ultrafine cellulose, lactose, starch, pregelatinized starch, calcium carbonate, calcium sulfate, sugars, dextrate, dextrin, dextrose, dicalcium phosphate dihydrate, tricalcium phosphate, kaolin, magnesium carbonate, magnesium oxide, maltodextrin, mannitol, polymethacrylate (e.g., Eudragit®), potassium chloride, powdered cellulose, sodium chloride, sorbitol, and talc.
[0073] The nucleic acid compositions of this disclosure can be formulated into compositions and dosage forms according to methods known in the art. In certain embodiments, the formulated compositions can be specifically formulated for administration in solid or liquid form, including forms adapted to: (1) oral administration, e.g., tablets, capsules, powders, granules, pastes for application to the tongue, aqueous or non-aqueous solutions or suspensions, drench or syrup; (2) parenteral administration, e.g., as sterile solutions or suspensions, e.g., by subcutaneous, intramuscular or intravenous injection; (3) topical application, e.g., as creams, ointments or sprays applied to the skin, lungs or mucous membranes; or (4) intravaginally or rectally, e.g., as pessaries, creams or foams; (5) sublingually or buccally; (6) into the eye; (7) percutaneously; or (8) nasally.
[0074] In some embodiments, the formulations of the present disclosure may include a solid pharmaceutical agent that has been compressed into a dosage form such as a tablet, and may include excipients whose function is to help bind the active ingredient and other excipients together after compression. Binders for solid pharmaceutical compositions include acacia, alginic acid, carbomer (e.g., Carbopol), sodium carboxymethylcellulose, dextrin, ethylcellulose, gelatin, guar gum, hydrogenated vegetable oil, hydroxyethylcellulose, hydroxypropylcellulose (e.g., Klucel®), hydroxypropylmethylcellulose (e.g., Methocel®), liquid glucose, magnesium aluminum silicate, maltodextrin, methylcellulose, polymethacrylate, povidone (e.g., Kollidon®, Plasdone®), pregelatinized starch, sodium alginate, and starch.
[0075] The dissolution rate of compressed solid pharmaceutical compositions in the stomach can be increased by adding disintegrants to the composition. Disintegrants include alginic acid, calcium carboxymethylcellulose, sodium carboxymethylcellulose (e.g., Ac-Di-Sol®, Primellose®), colloidal silicon dioxide, sodium croscarmellose, crospovidone (e.g., Kollidon®, Polyplasdone®), guar gum, magnesium aluminum silicate, methylcellulose, microcrystalline cellulose, potassium polacrilin, powdered cellulose, pregelatinized starch, sodium alginate, sodium starch glycolate (e.g., Explotab®), and starch.
[0076] Therefore, in certain embodiments, a flow enhancer can be added to the formulation to improve the fluidity of an uncompressed solid drug and improve the accuracy of drug administration. Excipients that can function as flow enhancers include colloidal silicon dioxide, magnesium trisilicate, powdered cellulose, starch, talc, and tricalcium phosphate.
[0077] When dosage forms such as tablets are produced by compressing a powder composition, the composition is subjected to pressure from the die. Some excipients and active ingredients tend to adhere to the surface of the die, which can result in indentations and other surface irregularities in the product. Lubricants can be added to the composition to reduce adhesion and mitigate the release of the product from the die. Lubricants include magnesium stearate, calcium stearate, glyceryl monostearate, glyceryl palmitostearate, hydrogenated castor oil, hydrogenated vegetable oil, mineral oil, polyethylene glycol, sodium benzoate, sodium lauryl sulfate, sodium stearyl fumarate, stearic acid, talc, and zinc stearate.
[0078] Formulated pharmaceutical compositions for tableting or capsule filling can be prepared by wet granulation. In wet granulation, some or all of the active ingredients and excipients in powder form are blended and then further mixed in the presence of a liquid, typically water, that aggregates the powder into granules. The granules are sieved and / or powdered, dried, and then sieved and / or powdered again until the desired particle size is achieved. The granules can then be tableted, or other excipients, such as flow promoters and / or lubricants, can be added prior to tableting. Tablet compositions can conventionally be prepared by dry blending. For example, a blended composition of active ingredients and excipients can be compressed into a slag or sheet and then ground into compressed granules. The compressed granules can then be compressed into tablets.
[0079] In other embodiments, as an alternative to dry granulation, the blended composition can be directly compressed into a compressed dosage form using a direct compression technique. Direct compression produces more uniform tablets without granules. Excipients particularly well suited to direct compression include microcrystalline cellulose, spray-dried lactose, dicalcium phosphate dihydrate, and colloidal silica. The appropriate use of the above and other excipients in direct compression is known to those skilled in the art who have experience and skills in the specific formulation challenges of direct compression. Capsule filling may include any of the above-described blends and granules in relation to tableting; however, these are not subjected to the final tableting process.
[0080] In the liquid pharmaceutical compositions of this disclosure, the drug and any other solid excipient are dissolved or suspended in a liquid carrier such as water, water for injection, vegetable oil, alcohol, polyethylene glycol, propylene glycol, or glycerin. The liquid pharmaceutical compositions may contain emulsifiers to uniformly disperse the active ingredient or other excipients insoluble in the liquid carrier throughout the composition. The liquid formulations can be used as injection, enteral, or emollient formulations. Emulsifiers that may be useful in the liquid compositions of the present invention include, for example, gelatin, egg yolk, casein, cholesterol, acacia, tragacanth, chondrus, pectin, methylcellulose, carbomer, cetostearyl alcohol, and cetyl alcohol.
[0081] In some embodiments, the liquid pharmaceutical compositions of the present disclosure may also contain viscosity enhancers to improve the mouthfeel of the product and / or to coat the lining of the gastrointestinal tract. Such agents include acacia, alginic acid, bentonite, carbomer, calcium or sodium carboxymethylcellulose, cetostearyl alcohol, methylcellulose, ethylcellulose, gelatin, guar gum, hydroxyethylcellulose, hydroxypropylcellulose, hydroxypropylmethylcellulose, maltodextrin, polyvinyl alcohol, povidone, propylene carbonate, propylene glycol, alginate, sodium alginate, sodium starch glycolate, starch, tragacanth, and xanthan gum. In other embodiments, the liquid compositions of the present disclosure may also contain buffers such as gluconic acid, lactic acid, citric acid or acetic acid, sodium gluconate, sodium lactate, sodium citrate, or sodium acetate.
[0082] Sweeteners such as sorbitol, saccharin, sodium saccharin, sucrose, aspartame, fructose, mannitol, and invert sugar may be added to certain formulations of the present disclosure to improve taste. Flavor enhancers and seasonings can make the dosage form more palatable to patients. Common flavor enhancers and seasonings for pharmaceutical products that may be included in the compositions of the present disclosure include maltol, vanillin, ethyl vanillin, menthol, citric acid, fumaric acid, ethyl maltol, and tartaric acid.
[0083] Preservatives and chelating agents such as alcohol, sodium benzoate, butylated hydroxytoluene, butylated hydroxyanisole, and ethylenediaminetetraacetic acid can be added in levels safe for oral ingestion to improve storage stability. Solid and liquid compositions can also be stained with any pharmaceutically acceptable colorant to improve their appearance and / or to facilitate patient identification of the product and unit dose levels.
[0084] The drug formulations of this disclosure may be capsules containing the composition, for example, the powder or granulated solid composition of this disclosure, within either a hard or soft shell. The shell may be made of gelatin and may optionally contain plasticizers such as glycerin and sorbitol, as well as opacifiers or colorants.
[0085] As described above, the nucleic acid compositions of this disclosure exhibit unexpected and exceptional anticancer activity compared to native microRNAs and / or known cancer therapies (chemotherapy), such as those shown by 5-fluoro(fluro)uracil. Accordingly, another aspect of this disclosure provides a method for treating cancer in mammals by administering an effective amount of the nucleic acid compositions described herein to a mammal.
[0086] Generally, a method for treating cancer according to the Disclosure includes the step of administering a nucleic acid composition according to the Disclosure (e.g., a modified double-stranded nucleic acid, e.g., modified miR-15a) to a target. In certain embodiments, the nucleic acid composition may be administered as a formulation comprising the nucleic acid composition and a carrier. In other embodiments, the nucleic acid composition according to the Disclosure may be administered in the absence of a carrier (i.e., naked) and / or with a carrier such as polyethyleneimine (PEI), lipid nanoparticles, or gold nanoparticles to further improve efficacy.
[0087] The term “Subject” in this specification refers to any mammal. A mammal may be any mammal, but the methods described herein more typically refer to humans. The phrase “Subject requiring it” in this specification refers to any mammalian subject that is included in the term Subject and requires treatment, in particular having cancer or a medically determined increased risk of a cancerous or precancerous condition. In certain embodiments, Subject includes human cancer patients. In some embodiments, Subject has colorectal cancer or a medically determined increased risk of developing colorectal cancer. In other embodiments, Subject has pancreatic cancer or a medically determined increased risk of developing pancreatic cancer, for example, being diagnosed with chronic pancreatitis. In yet other embodiments, Subject of the Disclosure has lung cancer or a medically determined increased risk of developing lung cancer.
[0088] The terms “treatment,” “to treat,” and “to treat” refer to the medical management of a disease, condition, or disorder, such as cancer, with the intention of curing, relieving, stabilizing, or preventing such disease, condition, or disorder. These terms are used interchangeably and include active treatment, i.e., treatment directed in particular to the improvement of a disease, condition, or disorder, and causal treatment, i.e., treatment aimed at eliminating the cause of the related disease, condition, or disorder. In addition, treating includes symptomatic treatment, i.e., treatment designed to alleviate symptoms rather than cure the disease, condition, or disorder; preventive treatment, i.e., treatment aimed at minimizing or partially or completely inhibiting the onset of the related disease, condition, or disorder; and supportive treatment, i.e., treatment used to supplement another specific treatment aimed at improving the related disease, condition, or disorder. It is understood that treatment is intended to cure, relieve, stabilize, or prevent a disease, condition, or disorder, but does not necessarily have to actually result in a cure, remission, stabilization, or prevention. The effects of the treatment can be measured or evaluated as described herein and known in the art, in a manner appropriate to the disease, condition, or disorder in question. Such measurement and evaluation can be carried out from a qualitative and / or quantitative perspective. Thus, for example, the characteristics or features of a disease, condition, or disorder, and / or the symptoms of a disease, condition, or disorder, can be reduced to any effect or to any amount.
[0089] In certain embodiments, the nucleic acid compositions of the present disclosure are used to treat cancer, for example, pancreatic cancer, more specifically pancreatic ductal adenocarcinoma (PDAC).
[0090] In certain embodiments, the nucleic acid compositions of this disclosure are used to treat pancreatitis or fibrosis.
[0091] In certain embodiments, the nucleic acid compositions of this disclosure are used to treat autoimmune diseases or hepatocellular carcinoma. MicroRNA 15a / 16-1 has been shown to prevent hepatocellular carcinoma (Liu et al., Gastroenterology, 2022, 162, pp. 575-589) and autoimmune diseases (Johansson et al., bioRxiv preprint).
[0092] The term "organoid" refers to a small, self-organizing, three-dimensional tissue culture derived from stem cells and progenitor cells. Such cultures can be created to replicate most of the complexity of an organ, or to represent selected aspects of it, such as producing only specific types of cells. Organoids mimic their corresponding in vivo organs so that they can be used in tissue culture dishes to study aspects of that organ.
[0093] In certain embodiments, the organoid is a human PDAC organoid.
[0094] The term "cancer" as used herein includes any disease resulting from the uncontrolled division and growth of abnormal cells, including, for example, malignant and metastatic growth of tumors. The term "cancer" also includes precancerous conditions, or conditions characterized by an increased risk of cancer or precancerous conditions. Thus, treatment of cancer is also considered herein to include methods for the prevention of cancer or methods for preventing a precancerous condition from transforming into a cancerous condition or a completely noncancerous condition. Cancer or precancerous conditions (neoplasms) can be located in any part of the body, including the internal organs and skin. Some examples of applicable body parts containing cancer cells include the colon, rectum (including the anus), stomach, esophagus, digestive tract, lungs, pancreas, and liver. Cancer or neoplasms may also include the presence of one or more carcinomas, sarcomas, lymphomas, blastomas, or teratomas (germ cell tumors). In some embodiments, cancer may also take the form of leukemia.
[0095] In some embodiments, the nucleic acid compositions described herein are used to treat pancreatic, colorectal, gastric, esophageal, breast, lung, prostate, ovarian, uterine, liver, skin, blood, or cervical cancer at any of its stages, as further described below. As is well known, cancer spreads throughout the body of a subject by invading normal, non-cancerous tissue surrounding the tumor via lymph nodes and blood vessels, and, after the tumor has entered the veins, capillaries, and arteries of the subject, by the blood. When cancer cells detach from the primary tumor ("metastasize"), secondary tumors arise throughout the affected body of the subject, forming metastatic lesions.
[0096] In some embodiments, the treatment methods of this disclosure target cancer subjects exhibiting reduced levels of miR-15a expression, miR-129 expression, miR-506 expression, miR-502, miR-140, or combinations thereof. In this regard, miR-15a is known to be downregulated in cancer. See, for example, RI Aqeilan et al., Cell Death and Differentiation (2010) 17, pp. 215-220. Furthermore, cancer cells with reduced levels of miR-129 expression are known to be resistant to 5-fluorouracil, for example, as described in U.S. Patent Application Publication 2016 / 0090636, which is incorporated herein by reference in its entirety. In addition, pancreatic cancer cells are known to exhibit reduced levels of miR-506. See, for example, Li, J et al., Oncogene. 35, pp. 5501-5514.
[0097] The nucleic acid compositions relating to this disclosure can be administered by any of the routes commonly known in the art, including, for example, (1) oral administration; (2) parenteral administration, such as by subcutaneous, intramuscular or intravenous injection; (3) topical administration; or (4) vaginal or rectal administration; (5) sublingual or buccal administration; (6) intraocular administration; (7) transdermal administration; (8) nasal administration; and (9) direct administration to organs or cells that require it.
[0098] The amount of the nucleic acid composition of this disclosure administered (dosage) depends on several factors, including the type and stage of cancer, the presence or absence of adjuvant drugs, and the subject's body weight, age, health, and drug resistance. Depending on these various factors, the dosage may be, for example, approximately 2 mg / kg body weight, 5 mg / kg body weight, 10 mg / kg body weight, 15 mg / kg body weight, 20 mg / kg body weight, 25 mg / kg body weight, 30 mg / kg body weight, 40 mg / kg body weight, 50 mg / kg body weight, 60 mg / kg body weight, 70 mg / kg body weight, 80 mg / kg body weight, 90 mg / kg body weight, 100 mg / kg body weight, 125 mg / kg body weight, and 150 mg / kg body weight. The dosage may be approximately 175 mg / kg body weight, approximately 200 mg / kg body weight, approximately 250 mg / kg body weight, approximately 300 mg / kg body weight, approximately 350 mg / kg body weight, approximately 400 mg / kg body weight, approximately 500 mg / kg body weight, approximately 600 mg / kg body weight, approximately 700 mg / kg body weight, approximately 800 mg / kg body weight, approximately 900 mg / kg body weight, or approximately 1000 mg / kg body weight, where the term "approximately" is generally understood to be within ±10%, 5%, 2%, or 1% of the indicated value. The dosage may also be within a range bounded by any two of the aforementioned values. By monitoring the effects of the compound on cancerous or precancerous conditions, or on microRNA expression levels or activity (e.g., miR-15a, miR-129, miR-140, miR-192, miR-502, miR-506), or on BCL2 levels or activity, or on TS levels or activity, or on E2F3 levels or disease pathology, an appropriate dosage regimen can be determined for each patient. All of these can be monitored frequently and easily according to methods known in the art. Depending on the various factors described above, any of the exemplary nucleic acid doses described above may be administered once, twice, or multiple times daily.
[0099] The capacity of the nucleic acid compositions described herein and, if applicable, any additional chemotherapeutic agents for use in this method can be determined using pharmacological models well known in the art, such as cytotoxicity assays, apoptosis staining assays, xenograft assays, and binding assays.
[0100] The nucleic acid compositions described herein may be administered concurrently or not concurrently with one or more chemotherapeutic agents, which may be adjuvant drugs different from the nucleic acid compositions described herein.
[0101] In this specification, “chemotherapy” or the phrase “chemotherapeutic agent” refers to a drug useful in the treatment of cancer. Chemotherapeutic agents useful in combination with the methods described herein include any agent that modulates BCL2, E2F3, or TS, either directly or indirectly. Examples of chemotherapeutic agents include pyrimidine antagonists based on methotrexate and fluoropyrimidine, 5-fluorouracil (5-FU) (Carac® cream, Efudex®, Fluoroplex®, Adrucil®) and S-1; polyglutamatable folate antagonist compounds; folate antagonists including larcitrexed (Tomudex®), GW1843 and pemetrexed (Alimta®) and polyglutamatable folate antagonist compounds; nolatrexide (nol This includes antimetabolites such as atrexed (Thymitaq®), previtrexed, and BGC945; folic acid analogs such as denopterin, methotrexate, pteropterin, and trimethrexate; and purine analogs such as fludarabine, 6-mercaptopurine, thiamiprine, and thioguanine; and pyrimidine analogs such as ancitabine, azacitidine, 6-azauridine, carmofur, cytarabine, dideoxyuridine, doxifluridine, enocitabine, and phloxuridine. In certain embodiments of the present disclosure, the chemotherapeutic agent is a compound that can inhibit the expression or activity of a gene or gene product involved in signaling pathways related to abnormal cell proliferation or apoptosis, such as YAP1, BMI1, DCLK1, BCL2, thymidylate synthase, or E2F3; and any pharmaceutically acceptable salt, acid, or derivative thereof.
[0102] In some embodiments, the chemotherapeutic agent is an anticancer drug, or a tissue sensitizer or other enhancer for an anticancer drug. In some embodiments, the co-drug may be another nucleic acid or another miRNA, such as the microRNA mimic of this disclosure, gemcitabine, or free 5-FU.
[0103] In certain embodiments, the other nucleic acid is a small hairpin RNA (shRNA), siRNA, or nucleic acid complementary to the BCL2 3'UTR portion.
[0104] In other embodiments, chemotherapy may be one or more of the following cancer drugs, for example, methotrexate, doxorubicin, cyclophosphamide, cisplatin, oxaliplatin, bleomycin, vinblastine, gemcitabine, vincristine, epirubicin, folinic acid, paclitaxel, and docetaxel. The chemotherapeutic agent may be administered before, during, or after the initiation of treatment with the nucleic acid composition.
[0105] In some embodiments, the chemotherapeutic agent is a co-agent.
[0106] E2F transcription factor 3, E2F3 (RefSeq NG_029591.1, NM_001243076.2, NP_001230005.1) is a transcription factor that binds to DNA and interacts with effector proteins, including but not limited to retinoblastoma protein, to regulate the expression of genes involved in cell cycle regulation. Therefore, any drug that inhibits E2F3 expression can be considered a co-drug in this specification.
[0107] B-cell lymphoma 2 (BCL2) (RefSeq NG_009361.1, NM_000633, NP_000624), including its isoforms α (NM_000633.2, NP_000624.2) and β (NM_000657.2, NP_000648.2), is encoded by the Bcl-2 gene, a member of the BCL2 family of regulatory protein that regulates mitochondrial-regulated cell death via the endogenous apoptotic pathway. BCL2 is a complex mitochondrial outer membrane protein that blocks apoptotic cell death by binding to the BAD and BAK proteins. Non-exclusive examples of BCL2 inhibitors include antisense oligonucleotides such as oblimersen (Genta Inc.), and BH3 mimetic small molecule inhibitors including ABT-737 (Abbott Laboratories, Inc.), ABT-199 (Abbott Laboratories, Inc.), and ovatoclax (Cephalon Inc.). Any drug that inhibits BCL2 expression may be considered as a co-drug in this specification.
[0108] Thymidylate synthase (RefSeq: NG_028255.1, NM_001071.2, NP_001062.1) is a ubiquitous enzyme that catalyzes the essential methylation of dUMP to produce dTMP, one of the four bases that make up DNA. This reaction requires CH₃H₄-folate as a cofactor, both as a methyl group donor and specifically as a reduced form. The constant requirement of CH₃H₄-folate means that thymidylate synthase activity is strongly related to the activity of two enzymes responsible for replenishing the folate pool in cells: dihydrofolate reductase and serine transhydroxymethylase. Thymidylate synthase is a homodimer of 30-35 kDa subunits. The active site simultaneously binds to both the folate cofactor and the dUMP substrate, and dUMP is covalently bound to the enzyme via a nucleophilic cysteine residue (see Carreras et al., Annu. Rev. Biochem., (1995) 64:721-762). The thymidylate synthase reaction is a critical part of the pyrimidine biosynthesis pathway, producing dCTP and dTTP for incorporation into DNA. This reaction is required for DNA replication and cell growth. Thymidylate synthase activity is therefore required by all rapidly dividing cells, such as cancer cells. Due to its association with DNA synthesis and thus cell replication, thymidylate synthase has long been a target for anticancer drugs. Non-exclusive examples of thymidylate synthase inhibitors include folate and dUMP analogs, such as 5-fluorouracil (5-FU). Any drug that inhibits thymidylate synthase expression may be considered a co-agent herein.
[0109] If desired, the administration of the nucleic acid compositions described herein may be combined with one or more non-pharmacological therapies, such as radiation therapy and / or surgery. As is well known in the art, the administration of radiation therapy and / or chemotherapeutic agents (in this case, the nucleic acid compositions described herein and any additional chemotherapeutic agents as needed) can be performed before surgery to, for example, shrink tumors or halt cancer spread before surgery. Similarly, as is well known in the art, the administration of radiation therapy and / or chemotherapeutic agents can be performed after surgery to destroy all remaining cancer cells.
[0110] Examples are shown below for illustrative purposes and to illustrate certain specific embodiments of this disclosure. However, the scope of this disclosure should by no means be limited by the examples shown herein. [Examples]
[0111] (Example 1) Synthesis of methotrexate-miRNA mimic (MTX-5-FU-Gem-miR-15a) conjugate: Next, the synthesis and purification of MTX-5-FU-Gem-miR-15a are described in detail:
[0112] Scheme 1. Synthesis of methotrexate-miRNA conjugates [ka] [ka] [ka]
[0113] Experiment section: Fmoc-Glu(PEG3N3)-O t Bu(1-1) [ka]
[0114] In a solution of Fmoc-Glu-OtBu (600 mg, 1.41 mmol) and azido-peg3-amine (1.2 equivalents) in CH2Cl2 (20-30 mL), EDC was added. . A suspension of HCl (1.3 equivalents) in CH2Cl2 (15 mL) was added. The solution was stirred at room temperature for 4 hours, and the reaction progress was monitored by TLC. After the reaction was complete, the reactants were diluted with H2O, extracted with CH2Cl2 (3 × 20 mL), washed with brine (3 × 15 mL), dried on MgSO4, filtered, and the filtrate was concentrated under vacuum. Purification was performed by column chromatography on silica gel with increasing amounts of methanol in CH2Cl2 to obtain 1-1 (827 mg, 94%) as a yellow oil. 1 1H NMR, 13 Characterized by 13C NMR and FIA. 1 H NMR (700 MHz, CDCl3) δ 7.78 (d, J = 7.6 Hz, 2H), 7.63 (t, J = 7.3 Hz, 2H), 7.42 (t, J = 7.5 Hz, 2H), 7.35 - 7.32 (m, 2H), 6.39 (s, 1H), 5.72 (d, J = 6.5 Hz, 1H), 4.41 (ddd, J = 25.2, 10.6, 7.3 Hz, 2H), 4.24 (t, J = 7.0 Hz, 2H), 3.66 - 3.61 (m, 10H), 3.57 (dd, J = 7.9, 3.1 Hz, 2H), 3.47 (tdd, J = 19.0, 9.0, 5.3 Hz, 2H), 3.39 - 3.33 (m, 2H), 2.34 - 2.26 (m, 2H), 2.25 - 2.18 (m, 1H), 1.98 (dt, J = 14.3, 7.7 Hz, 1H), 1.49 (s, 9H). 13C NMR (176 MHz, CDCl3) δ 172.14, 171.16, 156.30, 143.96, 143.75, 141.33, 141.29, 132.15, 132.10, 132.04, 132.03, 128.59, 128.52, 127.74, 127.10, 125.17, 120.00, 119.99, 82.42, 72.48, 72.46, 71.31, 70.72, 70.69, 70.68, 70.67, 70.66, 70.63, 70.62, 70.61, 70.59, 70.58, 70.57, 70.56, 70.55, 70.55, 70.54, 70.54, 70.53, 70.52, 70.51, 70.46, 70.42, 70.38, 70.37, 70.27, 70.09, 70.08, 70.02, 70.02, 69.71, 66.95, 61.79, 61.77, 54.09, 53.47, 50.67, 50.64, 47.20, 42.76, 39.39, 32.44, 28.76, 28.01. ESI-MS m / z: 626.4 [M+H] + All data were consistent with literature values (Willibald, J., Harder, J., Sparrer, K., Conzelmann, KK, Carell, T., Click-modified anandamide siRNA enables delivery and gene silencing in neuronal and immune cells, J Am Chem Soc 2012, 134(30), pp. 12330-1233).
[0115] Fmoc-Glu(PEG3N3)-OH(1-2) [ka]
[0116] A solution of 1-1 (280 mg, 0.45 mmol) in CH2Cl2 (20 mL) was cooled to 0 °C, and TFA (5 mL) was added dropwise. The reaction mixture was stirred at 0 °C overnight, and the progress of the reaction was monitored by TLC. After completion of the reaction, the mixture was diluted with CH2Cl2 (30 mL) and washed with H2O (4 × 20 mL) until the aqueous pH was no longer acidic. Next, the organic layer was dried over MgSO4, filtered, and the filtrate was concentrated in vacuo to afford a brownish oil. Next, nitrogen was passed through the TFA residue for 1 h, redissolved in distilled water, and placed in a lyophilizer overnight to give 1-2 (230 mg, 90%) as a brownish solid. The product was used directly for further steps without chromatographic purification. The product was 1 characterized by 13 1H NMR, 1 13C NMR and FIA. 13C NMR (126 MHz, CDCl3) δ 173.64, 173.35, 156.20, 143.92, 143.72, 141.32, 132.12, 128.70, 128.61, 127.75, 127.13, 125.15, 119.99, 70.58, 70.43, 70.15, 69.96, 69.41, 67.08, 53.35, 50.63, 47.13, 39.66, 32.34, 28.77, 15.26. + All data were consistent with literature values (Willibald, J., Harder, J., Sparrer, K., Conzelmann, KK, Carell, T., Click-modified anandamide siRNA enables delivery and gene silencing in neuronal and immune cells, J Am Chem Soc 2012, 134(30), pp. 12330-1233).
[0117] Methotrexate-Glu(PEG3N3)-Arg-OH(1-3) [ka]
[0118] Fmoc-Arg(Pbf)-Wang resin (250 mg, 85 μmol) was suspended in 2 mL of DMF and allowed to expand for 1 hour, after which the solvent was filtered off. A 20% solution of piperidine in 2 mL of DMF was added to these beads, and the mixture was aerated with nitrogen for 30 minutes. The solvent was filtered off, and the beads were washed with 3 × 2 mL of DMF. A Kaiser test was performed after each step.
[0119] A solution of 1-2 (90 mg, 3.0 equivalents), DIPEA (3.0 equivalents), HOBt (3.0 equivalents), and HBTU (3.0 equivalents) in DMF (2 mL) was added to the beads, and the reaction mixture was aerated with nitrogen for 4 hours. The solvent was filtered off, and the beads were washed with DMF (3 × 2 mL).
[0120] A 20% solution of piperidine in 2 mL of DMF was added to the beads, and the mixture was aerated with nitrogen for 30 minutes. The solvent was filtered off, and the beads were washed with 3 × 2 mL of DMF.
[0121] A solution of Fmoc-Glu-OtBu (3.0 equivalents), DIPEA (3.0 equivalents), HOBt (3.0 equivalents), and HBTU (3.0 equivalents) in DMF (2 mL) was added to the beads, and nitrogen was passed through the reaction mixture for 4 hours. The solvent was filtered off, and the beads were washed with DMF (3 × 2 mL).
[0122] A 20% solution of piperidine in 2 mL of DMF was added to the beads, and the mixture was aerated with nitrogen for 30 minutes. The solvent was filtered off, and the beads were washed with 3 × 2 mL of DMF.
[0123] N 10 A solution of methylpteroic acid (50 mg, 3.0 equivalents), DIPEA (3.0 equivalents), HOBt (3.0 equivalents), and HBTU (3.0 equivalents) in DMF (2 mL) was added to the beads, and the reaction mixture was aerated with nitrogen for 4 hours. The solvent was filtered off, and the beads were washed with DMF (3 × 2 mL) and IPA (3 × 2 mL). The beads were dried under vacuum for 1 hour to remove as much DMF as possible.
[0124] A 95:2.5:2.5 mixture of TFA:TIPS:H2O was added to dried beads, and nitrogen was passed through for 2 hours. The yellow solution was separated from the beads by filtration, and the liquid was concentrated using a rotary evaporator (rotavap). Nitrogen was passed through the solution for 1-2 hours to remove most of the TFA, and then the mixture was dissolved in distilled water and freeze-dried to obtain a brown crude solid. Purification was performed using reverse-phase Yamazen (5% ACN in water to 65% ACN in water) to obtain final products 1-3 (72 mg, 91%) as a pale yellow solid.
[0125] The product 1 1H NMR, 13 The samples were characterized by 13C NMR and HRMS. 1H NMR (700 MHz, MeOD) δ 8.35 (s, 1H), 7.39 (s, 2H), 6.45 (s, 2H), 4.55 (s, 2H), 4.25 (s, 1H), 4.17 - 3.99 (m, 2H), 3.52 (dd, J = 14.0, 7.1 Hz, 10H), 3.43 (s, 2H), 3.32 (s, 2H), 3.20 (s, 2H), 2.99 (s, 5H), 2.31 (d, J = 7.7 Hz, 2H), 2.14 (d, J = 23.2 Hz, 3H), 2.00 - 1.89 (m, 2H), 1.79 (d, J = 6.1 Hz, 1H), 1.71 (d, J = 7.3 Hz, 1H), 1.54 (d, J = 6.6 Hz, 1H), 1.42 (d, J = 6.7 Hz, 2H). 13 C NMR (176 MHz, D2O) δ 175.38, 174.82, 172.59, 168.31, 162.72, 156.54, 151.40, 151.17, 148.92, 128.59, 121.78, 120.18, 111.25, 70.72, 69.52, 69.51, 69.44, 69.33, 69.14, 68.62, 54.74, 53.26, 50.07, 43.15, 40.53, 38.88, 38.82, 31.76, 28.73, 27.54, 26.88, 24.36. HRMS (TOF) m / z: C 39 H 57 N 17 O 11 Calculated value, 939.4423. Measured value, 940.4517.
[0126] Micro-Glu(PEG3NH2)-Arg-OH(1-4)
change
[0127] To a solution of 1-3 (23 mg, 0.025 mmol) in solvent (EtOH:H2O = 3:1, 2 mL), a 20 mol% pd / C catalyst was added under hydrogen. The reaction mixture was stirred overnight at room temperature, and the reaction progress was monitored by TLC. After the completion of the reaction, the mixture was filtered through Celite and washed with water. The crude mixture was concentrated under vacuum to remove ethanol. The crude product was then freeze-dried overnight to remove water, yielding 1-4 (18.3 mg, 81%) as a pale yellow solid. The crude product was used directly for further steps without chromatographic purification. 1 1H NMR, 13 Characterized by 13C NMR and FIA. 1 H NMR (700 MHz, D2O) δ 8.35 (s, 1H), 7.50 (s, 2H), 6.59 (d, J = 7.4 Hz, 2H), 4.50 (s, 2H), 4.23 (s, 1H), 4.06 (dd, J = 16.2, 8.8 Hz, 2H), 3.53 - 3.39 (m, 10H), 3.17 (d, J = 24.5 Hz, 3H), 3.05 (s, 3H), 3.00 (s, 3H), 2.98 - 2.93 (m, 2H), 2.29 (dd, J = 14.2, 6.9 Hz, 2H), 2.21 - 2.09 (m, 3H), 1.93 (d, J = 5.5 Hz, 2H), 1.80 (d, J = 9.4 Hz, 1H), 1.69 (s, 1H), 1.52 (s, 1H), 1.40 (d, J = 7.0 Hz, 2H). 13C NMR (176 MHz, D2O) δ 178.32, 178.16, 175.38, 174.87, 174.84, 172.58, 169.43, 168.87, 168.78, 162.76, 161.95, 160.42, 157.37, 156.49, 154.13, 153.39, 151.50, 149.04, 148.06, 128.85, 128.71, 122.14, 120.18, 120.04, 112.16, 111.55, 111.26, 98.99, 70.68, 69.54, 69.52, 69.49, 69.45, 69.39, 69.35, 69.34, 69.26, 69.21, 69.18, 68.63, 68.60, 66.52, 57.13, 54.79, 54.47, ESI-MS m / z: 914.3 [M+H] + .
[0128] Methotrexate-DBCO(1-5) [ka]
[0129] To a solution of 1-4 (18 mg, 0.02 mmol) and DBCO-NHS ester (9 mg, 1.1 equivalents) in DMSO (1 mL), DIPEA (1.5 equivalents) was added dropwise. The solution was stirred overnight at room temperature. After the reaction was complete, the reactants were loaded directly onto a reversed-phase YAMAZEN column and purified by column chromatography on an ODS gel with increasing amounts of acetonitrile in water to obtain crude 1-5 as an orange solid. Next, the crude product was purified by semi-prep HPLC using an acetonitrile / water system to obtain 1-5 (15.3 mg, 65%) as a pale yellow solid. Purity was confirmed by HPLC (Rt: 13.51 min, 95% at 210 nm, 96% at 254 nm). 1H NMR, 13 C NMR and HRMS testing. 1 H NMR (700 MHz, D2O) δ 8.25 (d, J = 6.6 Hz, 1H), 7.45 (t, J = 7.5 Hz, 2H), 7.22 (dd, J = 20.7, 7.4 Hz, 1H), 7.13 - 7.02 (m, 4H), 6.97 (s, 1H), 6.94 - 6.86 (m, 1H), 6.76 (t, J = 7.3 Hz, 1H), 6.52 (d, J = 7.9 Hz, 2H), 4.60 - 4.50 (m, 1H), 4.43 - 4.32 (m, 2H), 4.25 (ddd, J = 6.7, 3.9, 1.3 Hz, 1H), 4.06 (dt, J = 14.3, 6.8 Hz, 2H), 3.45 - 3.33 (m, 10H), 3.26 (dt, J = 10.1, 5.1 Hz, 1H), 3.22 - 3.09 (m, 3H), 3.07 - 2.95 (m, 5H), 2.87 (s, 3H), 2.25 (dd, J = 16.3, 7.8 Hz, 3H), 2.17 - 2.06 (m, 3H), 2.05 - 1.98 (m, 1H), 1.97 - 1.86 (m, 3H), 1.73 (ddd, J = 21.4, 15.9, 8.0 Hz, 3H), 1.54 (dd, J = 14.1, 7.1 Hz, 1H), 1.42 (dt, J = 14.5, 7.0 Hz, 2H). 13C NMR (176 MHz, D2O) δ 178.11, 175.20, 174.71, 173.95, 173.42, 172.55, 168.30, 162.43, 156.51, 151.33, 150.12, 147.34, 131.58, 128.73, 127.75, 126.63, 125.23, 121.96, 121.14, 120.39, 113.97, 111.47, 107.38, 69.51, 69.30, 68.61, 68.58, 54.71, 54.40, 53.22, 40.54, 38.90, 38.83, 38.79, 38.73, 31.79, 31.67, 30.69, 29.94, 28.88, 26.82, 24.43; 58 H 72 N 16 O 13 Calculated value: 1200.5465. Measured value: 1201.5577.
[0130] Methotrexate-miRNA conjugate (1-6) [ka]
[0131] Methotrexate-DBCO and azid-PEG 24 A copper-free click reaction was performed between 5-Fu-Gem-miR-15a. The click reaction was carried out in water at room temperature for 8 hours at a molar ratio of 1:10 (azido oligo:methotrexate-DBCO = 464ug:700ug), followed by cooling to 4°C for 4 hours. Unconjugated methotrexate-DBCO was removed from the reactant using Oligo Clean & Concentrator (Zymo Research) as per the manufacturer's instructions. Conjugation was verified using MALDI spectral analysis. Target MW 9489.1, observation 9491.918.
[0132] (Example 2) Preparation of modified microRNAs conjugated with double-stranded methotrexate Crude samples of single-stranded methotrexate (MTX) conjugated miR-15a (ssMTX-miR-15a) were purified using the Zymo Oligo Clean & Concentrator® kit. The crude ssMTX-miR-15a samples were diluted to 200 ng / μL and divided into equal 50 μL aliquots, after which cleanup was initiated (i.e., 10 μg per 50 μL). 100 μl of oligo-binding buffer and 400 μl of 100% ethanol were added to each 50 μl sample. The samples were transferred to collection tubes of a Zymo-Spin® IC column and centrifuged at maximum speed (13,000 × g) for 30 seconds. The flow-through was discarded. Next, 750 μl of DNA washing buffer was added to the column and centrifuged at maximum speed for 1 minute. The column was transferred to a nuclease-free tube, 15 μl of water was added directly to the column matrix, and the purified sample was eluted by centrifugation at maximum speed for 30 seconds. The purified sample was a combined purified RNA sample, which was quantified using Nanodrop.
[0133] To anneal the samples, a sterile 2'-deprotection buffer was prepared (100 mL of 100 mM acetic acid was prepared using 571 μL glacial acetic acid and 99.4 mL of RNase-free water. The pH of the 100 mM acetic acid was adjusted to 3.4-3.8 using TEMED. Filtration sterilization was performed). The modified miR-15a 5' strand was resuspended in the 2'-deprotection buffer to a concentration of 100 μM. ssMTX-miR-15a was combined with the modified miR-15a 5' in a 1:1 ratio (in concentration). The combined samples were incubated at 60°C for 45 minutes, followed by 30 minutes at room temperature. 25 μl of 3 M sodium acetate and 750 μl of 100% ethanol were added per 200 μL of combined miRNA solution. The solutions were mixed and allowed to precipitate the RNA by incubating at -20°C overnight or at -80°C for 2 hours. The sample was then centrifuged at 13,000 × g for 20 minutes at 4°C. The supernatant was discarded, and the pellet was then washed with 200 μL of 95% ethanol. The supernatant was discarded again, and the pellet was dried in a sterile hood for 5-10 minutes. The pellet was resuspended in water and then adjusted to the respective working concentrations.
[0134] (Example 3) Materials and methods Cell culture: MD-MBA-231, MIA PaCa-2, and PANC-1 cells were all cultured in Dulbecco's modified Eagle medium (DMEM) supplemented with 10% fetal bovine serum. A549 cells were cultured in Ham's F-12K (Kaighn's) medium supplemented with 10% fetal bovine serum (FBS).
[0135] Cell lines and tissue cultures: Human ovarian cancer cell lines, OVCAR-3, SK-OV-3, and A2780, were purchased from the American Type Culture Collection (ATCC, Manassas, VA, USA) and MilliporeSigma (St. Louis, MO, USA). All cells were cultured in a humidified atmosphere in a 5% (V / V) CO2 incubator at 37°C using specific media (Table).
[0136] [Table 1]
[0137] Western blotting: MD-MBA-231 and MIA PaCa-2 cells were seeded in 6-well plates at a cell density of 100,000 cells per well. After 24 hours, the cells were incubated with oligofectamine and 50 nM MTX-5-FU-GEM-miR-15a. After 5 hours, the medium was replaced with DMEM supplemented with 10% dialyzed fetal bovine serum. After 72 hours, the cells were lysed with RIPA buffer, and protein samples were used for Western immunoblotting. Proteins were searched using anti-BMI1 antibody (Cell Signaling, 1:10,000), anti-YAP1 antibody (Cell Signaling, 1:10,000), and anti-GAPDH antibody (Santa Cruz, 1:200,000). Protein bands were visualized using the LI-COR Biosciences Odyssey FC imaging system and the Super Signal West Pico chemiluminescent substrate (Thermo Fisher Scientific).
[0138] Design and Synthesis of Gemcitabine-Modified miRNA Mimics: The MTX-5FU-Gem-miR-15a mimic was designed and synthesized by incorporating 5-FU and gemcitabine into the guide / antisense strands of hsa-miR-15a and substituting uridine and cytidine, respectively. The passenger / sense strand was conjugated with methotrexate (MTX). The 5-FU and Gem-modified guide strand and the unconjugated passenger strand with an azide linker at the 5' end were purchased from Horizon Discovery (Horizon Discovery, Cambridge, UK). Both oligonucleotide strands were purified by HPLC. Methotrexate-dibenzocyclooctin (MTX-DBCO) was synthesized at the Ojima Lab at Stony Brook University and used to conjugate MTX to the azide-linked passenger strand via a copper-free biorthogonal click reaction. The guide and passenger strands were then annealed before use.
[0139] miRNA transfection: Nonspecific scrambled miRNA, pre-miR negative control #2 (negative control) (Thermo Fisher Scientific, Waltham, MA, USA) was used to represent the negative control. The pre-miR hsa-miR-15a-5p and miRNA mimics, identical to the miR-15a (miR-15a) strand, were purchased from Thermo Fisher Scientific (Thermo Fisher Scientific, Waltham, MA, USA). Cells were transfected with oligonucleotides at a concentration of 50 nM (negative control, miR-15a, and MTX-5FU-Gem-miR-15a).
[0140] For medium-mediated transfection, cell lines were seeded in 6-well plates at a density of 100,000 cells per well. After 24 hours, cells were transfected using oligofectamine (Thermo Fisher Scientific, Waltham, MA, USA) and a mixture of each oligonucleotide according to the manufacturer's instructions. Five hours after transfection, the medium was replaced with fresh medium supplemented with 10% dialyzed fetal bovine serum (DFBS) (Thermo Fisher Scientific).
[0141] For medium-free transfection, cell lines were seeded into 96-well plates at a density of 1,000 cells per well. After 24 hours, the medium was replaced with fresh medium containing the respective oligonucleotides. 24 hours after transfection, the medium was again replaced with fresh medium supplemented with 10% DFBS.
[0142] Cytotoxicity Analysis: The cytotoxicity of all miRNAs was evaluated without the use of any delivery medium. Therefore, cells were seeded and transfected as described above. Briefly, cells were seeded directly into 96-well plates at a density of 1,000 cells / well. After 24 hours, cells were transfected with varying concentrations of oligonucleotides. Cell viability was measured 6 days after transfection using WST-1 cell proliferation reagent (MilliporeSigma, St. Louis, MO, USA) according to the manufacturer's protocol. In short, cells were incubated at 37°C for 1 hour with 10 μL of WST-1 per 100 μL of medium. After incubation, absorbance at 450 and 630 nm was measured using a SpectraMax i3 (Molecular Devices, San Jose, CA, USA) plate reader. OD was calculated by subtracting the absorbance at 630 nm from the absorbance at 450 nm. Relative proliferation was calculated by normalizing the OD for cells transfected with only negative controls. Absolute IC50 values were calculated using GraphPad Prism 9 (GraphPad Software, San Diego, CA, USA) with the following equation (where "Y" = 50). Y = Lower part + (Upper part - Lower part) / (1 + (IC50X)HillSlope)
[0143] Cell cycle analysis: OC cells were seeded in 6-well plates at a density of 100,000 cells / well. The cells were then transfected with the respective oligonucleotides and concentrations as described above, or treated with 300 nM 5-FU and 150 nM Gem (concentrations equivalent to 5-FU and Gem in 5-FU-Gem-miR-15a). 48 hours after transfection, the cells were resuspended in Krishan-modified buffer supplemented with 0.02 mg / mL RNase H (Thermo Fisher Scientific, Waltham, MA, USA) and 0.05 mg / mL propidium iodide (MilliporeSigma, St. Louis, MO, USA). The cells were then analyzed by flow cytometry using a CytoFLEX flow cytometer (Beckman Coulter, Brea, CA, USA), and the results were analyzed using Modfit LT software (BD Biosciences, Sparks, MD, USA).
[0144] Apoptosis Assay: OC cells were seeded and transfected under the respective treatment conditions by medium-mediated transfection as described above. 72 hours after transfection, cells were stained with Annexin V (Thermo Fisher Scientific, Waltham, MA, USA) and propidium iodide (MilliporeSigma, St. Louis, MO, USA). Apoptotic cells were quantified by flow cytometry analysis using a CytoFLEX flow cytometer (Beckman Coulter, Brea, CA, USA), and Annexin V-positive cells were categorized as "apoptotic." The fold change in apoptotic cells was calculated in relation to the number of apoptotic cells observed in the negative control.
[0145] Cell proliferation assay: Cells were seeded in 96-well plates at a rate of 1000 cells per well. 24 hours after seeding, MTX-5-FU-GEM-miR-15a was diluted in standard culture medium, the medium was removed from the cells in the 96-well plate, and then the MTX-5-FU-GEM-miR-15a-containing medium was added to the cells. These cells were incubated for 24 hours, and then the medium was replaced with fresh medium supplemented with 10% dialysis FBS. Cell counts were measured 6 days after transfection using WST-1 dye (Roche). Cells were incubated with 10 μl of WST-1 dye per 100 μl of medium for 1 hour, and absorbance was read at 450 and 630 nm. OD was calculated by subtracting the absorbance at 630 nm from the absorbance at 450 nm, and relative proliferation was calculated by normalizing the OD for a negative control.
[0146] Western immunoblotting analysis: Ovarian cancer cells were seeded and transfected with or without the transfection medium as described above. Cells were transfected with the respective oligonucleotides and concentrations as described above. 72 hours after transfection, cells were lysed in a mixture of RIPA buffer (MilliporeSigma, St. Louis, MO, USA) and a protease inhibitor cocktail (MilliporeSigma, St. Louis, MO, USA), and the protein samples were then collected and used for Western immunoblotting analysis. We investigated the proteins using rabbit anti-BMI1 antibody (Cell Signaling, 6964, 1:1000), rabbit anti-WEE1 antibody (Cell Signaling, 13084, 1:1000), rabbit anti-BCL2 antibody (Cell Signaling, 3498, 1:1000), rabbit anti-DCAMLK1 antibody (Abcam, Ab31704, 1:500), and mouse anti-GAPDH antibody (Santa Cruz, sc47724, 1:100,000). Primary antibodies were diluted in 5% milk in TBST (Bio-Rad, Hercules, CA, USA). After staining with the primary antibody, proteins were searched using either the secondary antibody goat anti-mouse-HRP (Bio-Rad, 1706516, 1:5000) or goat anti-rabbit-HRP (Bio-Rad, 1721019, 1:5000), depending on the primary antibody used. Protein bands were visualized using the LI-COR Biosciences Odyssey FC imaging system after adding the SuperSignal West Pico PLUS chemiluminescent substrate (Thermo Fisher Scientific). Next, proteins were quantified using Image Studio version 5.2.4 (LI-COR Biosciences, Lincoln, NE, USA).
[0147] 5-FU-modified miR-15a: 5-FU-modified miR-15a molecules were synthesized by an automated oligonucleotide synthesis process and purified by HPLC. The two strands were annealed to produce mature modified 5-FU-miR-15a. More specifically, a process called "2'-ACE RNA synthesis" was used. 2'-ACE RNA synthesis is based on a protecting group scheme in which a silyl ether is used to protect the 5'-hydroxyl group in combination with an acid-unstable orthoester protecting group at the 2'-hydroxyl group (2'-ACE). This protecting group combination was then used by standard phosphoramidite solid-phase synthesis techniques. For example, see SA Scaringe, FE Wincott and MH Caruthers, J. Am. Chem. Soc., 120 (45), pp. 11820–11821 (1998); International PCT application WO / 1996 / 041809; MD Matteucci, MH Caruthers, J. Am. Chem. Soc., 103, pp. 3185–3191 (1981); SL Beaucage, MH Caruthers, Tetrahedron Lett. 22, pp. 1859–1862 (1981), which clearly incorporate the entire contents of each of these into this specification.
[0148] Some exemplary structures of currently used protected and functionalized ribonucleoside phosphoramidites are shown below: [ka]
[0149] (Example 4) Dose-dependent inhibition of cancer cell growth without the use of MTX-5-FU-GEM-miR-15a and its delivery medium. MTX-5-FU-GEM-miR-15a can inhibit proliferation in MD-MBA-231 cells without the use of a delivery medium (IC 50(=4.6nM), on the other hand, miR-15a could not enter cells and inhibit proliferation without a delivery medium. Furthermore, MTX-5-FU-GEM-miR-15a inhibited cancer cell growth in A549 non-small cell lung cancer cells, MD-MBA-231 trinegative breast cancer cells, and MIA PaCa-2 and PANC-1 pancreatic cancer cells without the use of a delivery medium. A549 cells had undetectable levels of folate receptors, while MD-MBA-231 cells exhibited relatively high levels of folate receptors. Compared to each other, MD-MBA-231 cells were 22.2 times more sensitive than A549 cells. Similarly, in PDAC, PANC-1 cells had very low expression of the folate receptor, while MIA PaCa-2 cells had higher expression. The relative sensitivity of the two cells was 1.8 times higher in MIA PaCa-2 cells, suggesting a correlation with folate receptor status (Figure 2).
[0150] Table 1 (Table 2) below illustrates the IC50 values of 5-FU-miR-15a, MTX-5-FU-GEM-miR-15a, and gemcitabine in hT89 human PDAC organoids.
[0151] [Table 2]
[0152] While preferred embodiments of this disclosure have been shown and described, those skilled in the art can make various changes and modifications that still fall within the scope of this disclosure as defined by the appended claims.
Claims
1. A double-stranded nucleic acid composition comprising a modified double-stranded nucleic acid sequence containing uracil, gemcitabine, and methotrexate (MTX), wherein the uracil comprises 5-fluorouracil.
2. The double-stranded nucleic acid composition according to claim 1, wherein the modified double-stranded nucleic acid sequence comprises a modified microRNA nucleotide sequence.
3. The double-stranded nucleic acid composition according to claim 2, wherein the modified microRNA nucleotide sequence comprises the miR-15a microRNA nucleotide sequence shown in SEQ ID NO:
1.
4. The double-stranded nucleic acid composition according to claim 3, wherein the miR-15a microRNA nucleotide sequence comprises a guide strand and a passenger strand.
5. The double-stranded nucleic acid composition according to claim 4, wherein cytidine is replaced with gemcitabine in the guide strand of the miR-15a microRNA nucleotide sequence.
6. The double-stranded nucleic acid composition according to claim 4, wherein the uracil in the guide strand of the miR-15a microRNA nucleotide sequence is 5-fluorouracil.
7. The double-stranded nucleic acid composition according to claim 4, wherein methotrexate (MTX) is conjugated in the passenger strand of a miR-15a microRNA nucleotide sequence.
8. The double-stranded nucleic acid composition according to claim 7, wherein methotrexate (MTX) is conjugated at the 5' end of the passenger strand of a miR-15a microRNA nucleotide sequence.
9. The double-stranded nucleic acid composition according to claim 1, wherein the dual modification of miR-15a using 5-fluorouracil and gemcitabine enhances the therapeutic efficacy of tumor suppression compared to unmodified miR-15a.
10. The double-stranded nucleic acid composition according to claim 1, wherein the methotrexate (MTX) conjugation of modified miR-15a improves tumor specificity compared to unconjugated modified miR-15a, and when methotrexate (MTX) is disintegrated from the modified miR-15a miRNA, it adds an additional tumor-killing effect of the modified miR-15a miRNA tumor suppressor.
11. (i) A double-stranded nucleic acid composition comprising a double-stranded nucleic acid sequence comprising uracil, gemcitabine and methotrexate (MTX), wherein the uracil comprises 5-fluorouracil, (ii) A pharmaceutically acceptable carrier and A pharmaceutical composition containing the following:
12. The pharmaceutical composition according to claim 11, wherein the modified double-stranded nucleic acid sequence comprises a modified microRNA nucleotide sequence.
13. The pharmaceutical composition according to claim 12, wherein the modified microRNA nucleotide sequence comprises the miR-15a microRNA nucleotide sequence shown in Sequence ID No.
1.
14. The pharmaceutical composition according to claim 13, wherein the miR-15a microRNA nucleotide sequence comprises a guide strand and a passenger strand.
15. The pharmaceutical composition according to claim 14, wherein cytidine is replaced with gemcitabine in the guide strand of the miR-15a microRNA nucleotide sequence.
16. The pharmaceutical composition according to claim 14, wherein the uracil in the guide strand of the miR-15a microRNA nucleotide sequence is 5-fluorouracil.
17. The pharmaceutical composition according to claim 14, wherein methotrexate (MTX) is conjugated in the passenger strand of a miR-15a microRNA nucleotide sequence.
18. The pharmaceutical composition according to claim 17, wherein methotrexate (MTX) is conjugated at the 5' end of the passenger strand of a miR-15a microRNA nucleotide sequence.
19. A double-stranded nucleic acid composition comprising a modified double-stranded nucleic acid sequence containing uracil, gemcitabine, and methotrexate (MTX), wherein the uracil contains 5-fluorouracil, and the process involves administering an effective amount of the double-stranded nucleic acid composition to a target. Methods for treating cancer, including [specific example].
20. The method according to claim 19, wherein the subject is a mammal.
21. The method according to claim 20, wherein the mammal is a human.
22. The method according to claim 19, wherein the subject has cancer selected from the group consisting of colorectal, gastric, esophageal, breast, lung, prostate, ovarian, uterine, pancreatic, liver, skin, blood, or cervical cancer.
23. The method according to claim 19, wherein the subject has pancreatitis or fibrosis.
24. The method according to claim 22, wherein the subject has pancreatic cancer.
25. The method according to claim 24, wherein the pancreatic cancer is pancreatic ductal adenocarcinoma (PDAC).
26. The method according to claim 22, wherein the subject has ovarian cancer.
27. The method according to claim 19, wherein the double-stranded nucleic acid composition is administered to a subject by injection.
28. The method according to claim 19, wherein the modified double-stranded nucleic acid sequence comprises a modified microRNA nucleotide sequence.
29. The method according to claim 28, wherein the modified microRNA nucleotide sequence includes the miR-15a microRNA nucleotide sequence shown in SEQ ID NO:
1.
30. The method according to claim 29, wherein the miR-15a microRNA nucleotide sequence comprises a guide strand and a passenger strand.
31. The method according to claim 30, wherein cytidine is replaced with gemcitabine in the guide strand of the miR-15a microRNA nucleotide sequence.
32. The method according to claim 30, wherein the uracil in the guide strand of the miR-15a microRNA nucleotide sequence is 5-fluorouracil.
33. The method according to claim 30, wherein methotrexate (MTX) is conjugated in the passenger strand of a miR-15a microRNA nucleotide sequence.
34. The method according to claim 33, wherein methotrexate (MTX) is conjugated at the 5' end of the passenger strand of a miR-15a microRNA nucleotide sequence.
35. The method according to claim 19, wherein a modified double-stranded nucleic acid sequence induces apoptosis.
36. The method according to claim 35, wherein the modified double-stranded nucleic acid sequence comprises MTX-5FU-Gem-miR-15a.
37. The method according to claim 36, wherein modified miR-15a exhibits enhanced efficacy in inducing apoptosis compared to both unmodified miR-15a and co-treatment with 5-FU and gemcitabine.
Citation Information
Patent Citations
AM2013
MicroRNA-129 AS A BIOMARKER FOR COLORECTAL CANCER
US20160090636A1
Novel protecting groups and use thereof in an improved process for oligonucleotide synthesis
WO1996041809A1