3-Hydroxy-N-(3-(7H-pyrrolo[2,3-d]pyrimidin-4-yl)phenyl)pyrrolidine-1-carboxamide derivatives

Abstract

To provide intermediates in preparing 3-hydroxy-N-(3-(7H-pyrrolo[2,3-d]pyrimidin-4-yl)phenyl)pyrrolidine-1-carboxamide derivatives.SOLUTION: The invention provides compounds represented by formula (XXIa) in the figure, or salts thereof. (In the formula, R6 is selected from H and F; and R7 is selected from H, F, Cl, -CH3, -OCH3, and -OCH2CH3.)SELECTED DRAWING: None

Description

[Technical Field]

[0001] The present invention relates to 3-hydroxy-N-(3-(7H-pyrrolo[2,3-d]pyrimidine-4 -yl)phenyl)pyrrolidine-1-carboxamide derivatives, their preparation and pharmaceuticals containing same - Patents.com Compositions and treatments for conditions, diseases and disorders mediated by Bruton's tyrosine kinase - Patent Application 20070122999 Concerning its use in [Background technology]

[0002] Bruton's tyrosine kinase (BTK) is a ubiquitous kinase involved in B cell receptor (BCR) signaling. It is a critical node in cancer and an important target in cancer. Many cancers and lymphomas are caused by BT. They express BTK and depend on BTK function. They also regulate BCR signaling in tumor-infiltrating B cells. ng has been implicated in the tumor-promoting microenvironment of solid cancers (J.A. Burger and A. Wiestner, Nat Rev Cancer 2018,18,148). We used an inhibitor that irreversibly binds to BTK via cysteine-481, specifically cysteine-481. Pharmacological inhibition of BTK is an established strategy, and BTK is the primary inhibitor of the molecule ibrutinib. (J.A. Burger and J.Buggy, Leukemia and Lymphoma 2013,54,2385). This is a treatment for some cancers. It has been shown that the placement of m.Practice 2016,22,92-104.V.Kaur&A.Swami ,Ann.Hematol.2017,96,1175) and at least one previous Acalabrutinib is indicated for the treatment of patients with mantle cell lymphoma who have received prior treatment It has also been shown (Wang M et al, Lancet 2018, 391 ,Issue 10121,659-667).

[0003] BTK also plays an essential role in autoimmune diseases. in rheumatoid arthritis (L. Jansson and R. Holmdahl, Clin ical and experimental immunology 1993,94 ,459;LENyhoff et al,Arthritis Rheumatoid l.2016,68,1856), systemic lupus erythematosus (Steinberg,BJ .et al., J.Clin.Invest.1982,70,587-597) Allergic diseases and anaphylaxis (Hata, D. et al., J. Exp. Med. 1998, 187, 1235-1247) Because BTK protects against immune deficiencies, pharmacological inhibition of BTK may be useful in treating immune deficiencies.

[0004] In view of the above, modulators of BTK may be useful in treating proliferative disorders such as cancer and immune (e.g., autoimmune) disorders. These compounds may be useful in the treatment of infectious diseases.

[0005] BTK-dependent diseases, especially those that are resistant to or do not respond adequately to currently available drugs New drugs to treat this condition are needed.

[0006] Reducing or eliminating BTK protein by inducing its degradation Molecules designed to inhibit BTK (hereafter referred to as "BTK degraders") have been shown to inhibit a wide range of B It may be effective in treating TK-mediated diseases, such as proliferative disorders (such as cancer) and immune disorders. Furthermore, BTK degraders are irreversible BTK inhibitors (which bind covalently to BTK). Resistance can be effective in situations where there is resistance to, for example, a substitution of cysteine-481 with serine. It may arise from mutation (or other amino acid substitution).

[0007] Potential indicators of BTK degraders include, but are not limited to, those of hematopoietic origin. Cancer, e.g., Hodgkin's lymphoma, non-Hodgkin's lymphoma, post-transplant lymphoproliferative disorder, hairy cell Leukemias, histiocytic neoplasms, dendritic neoplasms, B-cell neoplasms, such as chronic lymphocytic leukemia (C LL), mantle cell lymphoma (MCL), small lymphocytic lymphoma (SLL), Waldenstrom lymphoma Strohm's macroglobulinemia, diffuse large B-cell lymphoma (DLBCL), Follicular lymphoma, Burkitt lymphoma, marginal zone lymphoma, immunoblastic large cell lymphoma, Richter's syndrome, precursor B-lymphoblastic lymphoma, primary multiple myeloma and secondary multiple myeloma Myeloma, B-cell prolymphocytic leukemia, lymphoplasmacytic lymphoma, splenic marginal zone lymphoma, Plasma cell myeloma, plasmacytoma, extranodal marginal zone B-cell lymphoma, nodal marginal zone B-cell lymphoma , mediastinal (thymus) large B-cell lymphoma, intravascular large B-cell lymphoma, primary effusion These include exacerbated lymphoma, lymphoma granulomatosis, and acute lymphoblastic leukemia.

[0008] Potential indicators of BTK degraders include, but are not limited to, the following: Immune disorders, such as rheumatoid arthritis, systemic lupus erythematosus, allergic diseases, These include inflammatory and inflammatory symptoms. As such, chronic graft-versus-host disease (cGvHD) and immunoglobulin light chain amyloidosis (A L).

[0009] The principle of induced degradation of protein targets as a potential therapeutic approach has been demonstrated, e.g., in C .M.Crews,2018,J.Med.Chem.,61(2),403-404 and and the references therein. Recruitment of target proteins to the E3 ubiquitin ligase IAP for incorporation and degradation The BTK degrader molecule incorporating an E3 ligase IAP-binding moiety for this purpose is described in International Publication No. 2002. 016 / 169989, page 12. Two additional BTK degrader molecules incorporating different moieties as BTK-binding components Huang et al., 2018, Cell Chemical Biolog The molecules described in that publication are ubiquitinated. and B to an E3 ligase complex containing cereblon (CRBN) for its subsequent degradation. Incorporating an immunomodulatory imide drug (IMiD) moiety (pomalidomide) for TK recruitment Also, Huang et al. described a method for identifying multiple targets, including BTK. and also binds the zinc finger DNA-binding protein IKZF1 (Ikaros). Promiscuous kinase binders have been reported to degrade certain non-kinase targets, including It is a molecule (TL12-186) based on IKZF1 and related protein IKZF3 ( Aiolos) is known to be degraded by pomalidomide and lenalidomide. (Kroenke, J. et al. 2014, Science 343, 301-3 05;Petzold et al.,Nature 2016,532,127-13 0;Bjorklund et al.,2015,Blood Cancer Jou rnal,5,e354;Lu et al.,2014,Science,343,3 05-309;Gandhi et al.,2014,Br.J.Haematol. 164,811-821). Summary of the Invention [Means for solving the problem]

[0010] The present invention relates to compounds of formula (I) or pharmaceutically acceptable salts thereof, as defined herein below. The compounds of formula (I) are BTK degraders and therefore are capable of inhibiting BTK. These compounds are potentially useful in the treatment of conditions, diseases and disorders mediated by

[0011] In one embodiment of the present invention, a compound of formula (I) [ka] (In the formula, R 1 is isobutyl; R 1a is H; R 2 is H or F; R 2a is H or F; R 6 is H or F; R 7 is selected from H, F, Cl, —CH3, —OCH3 and —OCH2CH3; X 1 is represented by formula (A) or (B): [ka] is a group of the formula * X 1a teeth, * -(CH2)1~3 -and * -CH2C(CH3)2-, where: * represents X in formula (I). 1a indicates the point of attachment of the group to the phenyl ring; * X 1b teeth, * -O-, * -OCH2- and * -CH2O-, wherein * represents X in formula (I). 1b indicates the point of attachment of the group to the phenyl ring; X 2a are represented by formulas (C), (D), (E), (F) and (G): [ka] is selected from: ** is X 1a indicates the point of attachment to; X 2b are represented by the formulas (E1) and (F1): [ka] is selected from: ** is X 1b indicates the point of attachment to; X 5 is CH or N; X 6 is CH or N; R 3 is H or -CH3; R 4 is H or —CHOH; R 5 is H or —CHOH; Z is absent or * -(CH2) 2~3 NH-, where * is the formula (C) Indicates the attachment point of Z to the N atom; Z 1 teeth, * -O-,* -C(O)-, * -(CH2) 1~3 -, * -(CH2)2O- and * -CHCH(CHOH)O-, wherein * is the formula (E) and the formula ( Z in E1) 1 X 5 indicates the point of attachment to; Z 2a is absent or NH(CH2)4- ** and; Z 2b is -(CH2) 3~4 NH(CH2)2- ** and; Z 3 is absent or ** -(CH2)4NH-, and Z 2a and Z 3 are both at the same time Not absent from; where Z 2a , Z 2b and Z 3 In each of ** is the formula (F) and the formula (F1) indicates the attachment points to each N atom in q is 0 or 1; and n and p are independently 0 or 1; (i) Z in formula (E) or formula (E1) 1 but * -O-, X 5 and X 6 teeth, is not N, and (ii) Z in formula (E) or formula (E1) 1 but * -(CH2)2-O- or * -CH2CH(CH2OH)O-, X 6 is not N) or a pharmaceutically acceptable salt thereof.

[0012] The present invention provides novel 3-hydroxy-N-(3-(7H-pyrrolo[2,3-d ]pyrimidin-4-yl)phenyl)pyrrolidine-1-carboxamide compounds, This leads to the degradation of Bruton's tyrosine kinase (BTK). (BTK mutants, especially BTK inhibitors, especially irreversible BTK inhibitors such as ibrutinib) by recruiting E3 ligases to the target protein (including those that confer resistance to inhibitors). Inducing BTK degradation inhibits the ubiquitination of BTK by the proteasome and subsequent The compounds of the present invention are designed to promote the subsequent degradation of E3-ligase cerebrospinal fluid (E3-ligase). A novel BTK-binding domain portion bound to a novel ligand that binds to CRBN. include.

[0013] Thus, the compounds of the present invention are useful in treating proliferative autoimmune diseases, particularly those mediated by BTK. Disorders and diseases (e.g., mutation of cysteine-481 to serine (or other amino acid substitution) These compounds are potentially useful in treating a wide range of diseases and disorders, including those for which resistance has developed. The compounds of the present invention can be used in combination with IMiDs such as thalidomide, lenalidomide and poliostatin. Degraded by malidomid and also by the proteolytic molecule TL12-186 mentioned above. Other proteins, particularly other tyrosine kinase proteins and / or or proteins such as IKZF1 and / or IKZF3 (non-tyrosine kinase) IK The compounds of the present invention may further exhibit selectivity for BTK degradation over the ZF family. enzyme selectivity and / or other off-target proteins, e.g., ion channels and GTPases It may further exhibit selectivity for protein-coupled receptors (GPCRs).

[0014] Thus, the compounds of formula (I) (including pharmaceutically acceptable salts thereof) are capable of being catalyzed by BTK. conditions, diseases and disorders mediated by steroids, especially proliferative conditions, diseases and disorders, such as cancer, especially Hematopoietic cancers (B-cell neoplasms, e.g., chronic lymphocytic leukemia (CLL), mantle cell lymphoma) Small lymphocytic lymphoma (MCL), small lymphocytic lymphoma (SLL), Waldenstrom's macroglobulinemia Blood plasma, diffuse large B-cell lymphoma (DLBCL), follicular lymphoma, Burkitt lymphoma Lymphoma, marginal zone lymphoma, immunoblastic large cell lymphoma, Richter's syndrome, precursor B lymphoma Lymphoblastic lymphoma, primary and secondary multiple myeloma, B-cell prolymphocytic Leukemia, lymphoplasmacytic lymphoma, splenic marginal zone lymphoma, plasma cell myeloma, plasmacytoma , extranodal marginal zone B-cell lymphoma, nodal marginal zone B-cell lymphoma, mediastinal (thymic) large cell B-cell Follicular lymphoma, intravascular large B-cell lymphoma, primary effusion lymphoma, granulomatous lymphoma are considered suitable for use in the treatment of leukemia, including leukemia, bronchial asthma, and acute lymphoblastic leukemia. .

[0015] In another aspect, the present invention provides a method for treating, preventing, or treating a BTK-mediated condition, disease, or disorder. The present invention provides a compound of formula (I) or a pharmaceutically acceptable salt thereof for use in a method for improving do.

[0016] In another aspect, the present invention provides a compound of formula (I) or Compositions comprising pharmaceutically acceptable salts thereof and one or more pharmaceutically acceptable carriers are provided. To provide.

[0017] In another aspect, the present invention provides a compound of formula (I) or Combinations are provided that include pharmaceutically acceptable salts thereof and one or more therapeutically active agents. DETAILED DESCRIPTION OF THE INVENTION

[0018] Various embodiments of the present invention are described herein. The specified features of each embodiment are: It is recognized that the features may be combined with other specified features to provide further embodiments of the present invention. Also, various (enumerated) embodiments of the invention are described herein. .

[0019] Substituent definitions, where applicable, are defined in formulae (I), (I'), (I''), (I'''), (I' This applies to compounds Ia), Ib and Ic.

[0020] The substituent definitions apply to the final product and the corresponding intermediates.

[0021] Thus, the present invention provides a compound of formula (I) [ka] (In the formula, R 1 is isobutyl; R 1a is H; R 2 is H or F; R 2a is H or F; R 6 is H or F; R 7 is selected from H, F, Cl, —CH3, —OCH3 and —OCH2CH3; X 1 is represented by formula (A) or (B): [ka] is a group of the formula *X 1a teeth, * -(CH2) 1~3 -and * -CH2C(CH3)2-, where: * represents X in formula (I). 1a indicates the point of attachment of the group to the phenyl ring; * X 1b teeth, * -O-, * -OCH2- and * -CH2O-, wherein * represents X in formula (I). 1b indicates the point of attachment of the group to the phenyl ring; X 2a are represented by formulas (C), (D), (E), (F) and (G): [ka] is selected from: ** is X 1a indicates the point of attachment to; X 2b are represented by the formulas (E1) and (F1): [ka] is selected from: ** is X 1b indicates the point of attachment to; X 5 is CH or N; X 6 is CH or N; R 3 is H or -CH3; R 4 is H or —CHOH; R 5 is H or —CHOH; Z is absent or * -(CH2) 2~3 NH-, where * is the formula (C) Indicates the attachment point of Z to the N atom; Z 1 teeth, * -O-, * -C(O)-, * -(CH2) 1~3 -, * -(CH2)2O- and * -CHCH(CHOH)O-, wherein * is the formula (E) and the formula ( Z in E1) 1 X 5 indicates the point of attachment to; Z 2a is absent or NH(CH2)4- ** and; Z 2b is -(CH2) 3~4 NH(CH2)2- ** and; Z 3 is absent or ** -(CH2)4NH-, and Z 2a and Z 3 are both at the same time Not absent from; where Z 2a , Z 2b and Z 3 In each of ** is expressed in equations (F) and (F1). indicates the attachment points to each N atom in the q is 0 or 1; and n and p are independently 0 or 1; (i) Z in formula (E) or formula (E1) 1 but * -O-, X 5 and X 6 teeth, is not N, and (ii) Z in formula (E) or formula (E1) 1 but * -(CH2)2-O- or * -CH2CH(CH2OH)O-, X 6 is not N) or a pharmaceutically acceptable salt thereof.

[0022] The compounds of formula (I) have the formula (Ia): [ka] where R 2 , R 2a , X 1 , R 6 and R 7 For compounds of formula (I), as defined in

[0023] Unless otherwise specified, the terms "compounds of the invention" or "a compound of the invention" , compounds of formula (I), sub-formulas (Ia), (Ib) and (Ic) and exemplary compounds, and their salts, and all stereoisomers (including diastereoisomers and enantiomers), Transisomers, tautomers (including formulas (I') and (II'')), and isotopically labeled Compounds (including deuterium-substituted, e.g., compounds of formula (I''')), as well as naturally formed This refers to the part that has been

[0024] Unless otherwise specified, the expressions used in this specification have the following meanings: Terminology used - (CH2) 1~3 - consists exclusively of carbon and hydrogen atoms and is unsaturated Contains no carbon atoms, has 1 to 3 carbon atoms, and is attached to other molecules at each end by a single bond refers to (especially) straight or branched hydrocarbon chain biradicals which: The end that attaches to another molecule at a specific position is marked with the indicator symbol * or ** Specified by Similar terms, such as -(CH2)2O-, -(CH2) 2~3 NH-, -(CH 2) 3~4 Groups incorporating NH(CH2)2- and -(CH2)4NH- are accordingly should be interpreted.

[0025] Enumerated embodiments: Embodiment 1. A compound of formula (I) or formula (Ia) as described above or a pharmaceutically acceptable salt thereof. Salt that can be used.

[0026] Embodiment 2. Formula (1b): [ka] The compound according to embodiment 1,

[0027] Embodiment 3. Formula (1c): [ka] The compound according to embodiment 1,

[0028] Embodiment 4.R 2 is H, and R 2a is F. or a pharmaceutically acceptable salt thereof.

[0029] Embodiment 5.R 2 is F, and R 2a is H. or a pharmaceutically acceptable salt thereof.

[0030] Embodiment 6.R 6 is H, or a compound according to any one of embodiments 1 to 5, Pharmaceutically acceptable salts.

[0031] Embodiment 7.R 7 is selected from —OCH3 and —OCH2CH3, 6. A compound according to any one of claims 1 to 6, or a pharmaceutically acceptable salt thereof.

[0032] Embodiment 8.R7 is —OCH 3 , Acceptable salt.

[0033] Embodiment 9. * X 1a teeth, * -(CH2) 1~3 Any of embodiments 1 to 8, wherein or a pharmaceutically acceptable salt thereof.

[0034] Embodiment 10. * X 1a teeth, * -CH2- and * -(CH2)2- The compound according to embodiment 9 or a pharmaceutically acceptable salt thereof.

[0035] Embodiment 11.X 2a are represented by formulas (C) and (E): [ka] or a pharmaceutically acceptable salt thereof, according to any one of embodiments 1 to 10, selected from Salt that can be used.

[0036] Embodiment 12. * X 1b teeth, * -O-, * -OCH2- and * -CH2O- 9. The compound according to any one of embodiments 1 to 8, or a pharmaceutically acceptable salt thereof.

[0037] Embodiment 13. * X 1b teeth, * -O-, or a pharmaceutical composition thereof according to embodiment 12. A commercially acceptable salt.

[0038] Embodiment 14.X 2b is the formula (E1): [ka] or a compound according to any one of embodiments 1 to 8, embodiment 12 or embodiment 13, is a pharmaceutically acceptable salt thereof.

[0039] Embodiment 15.R 4 is H; or a compound according to any one of embodiments 1 to 14, and pharmaceutically acceptable salts thereof.

[0040] Embodiment 16.R 5 is H; or a compound according to any one of embodiments 1 to 15, and pharmaceutically acceptable salts thereof.

[0041] Embodiment 17.q is a compound according to any one of embodiments 1 to 16, or A pharmaceutically acceptable salt of

[0042] Embodiment 18. The method according to any one of embodiments 1 to 17, wherein n and p are both 1. or a pharmaceutically acceptable salt thereof.

[0043] Embodiment 19. A compound according to any one of embodiments 1 to 18, wherein Z is absent; or and pharmaceutically acceptable salts thereof.

[0044] Embodiment 20.X 6 is CH is a pharmaceutically acceptable salt thereof.

[0045] Embodiment 21.Z 1 teeth, * -O-, * -(CH2) 1~3 -and * -(CH2)2O- A compound of formula (I) or a pharmaceutical composition thereof according to any one of embodiments 1 to 20, selected from A commercially acceptable salt.

[0046] Embodiment 22.Z 1 teeth, * -O-, * -CH2-, * -(CH2)2- and * -(CH 2) The compound according to embodiment 21, or a pharmaceutically acceptable salt thereof, selected from 2) 2O-.

[0047] Embodiment 23.Z 1 teeth, * -O-, * -CH2- and * -(CH2)2O- 23. The compound according to embodiment 22, or a pharmaceutically acceptable salt thereof,

[0048] Embodiment 24.X 1 teeth, [ka] is selected from: * is a group represented by the formula (I), (Ia), (Ib) or (Ic) A compound or pharmaceutical composition thereof according to any one of embodiments 1 to 8, showing the point of attachment to the phenyl ring. A commercially acceptable salt.

[0049] Embodiment 25.X 1 teeth, [ka] is selected from: * is a group represented by the formula (I), (Ia), (Ib) or (Ic) A compound according to embodiment 24 or a pharmaceutically acceptable salt thereof, showing the atoms attached to the phenyl ring. Salt.

[0050] Embodiment 26.R 4 is H. A pharmaceutically acceptable salt of

[0051] Embodiment 27.R 5 is H. is a pharmaceutically acceptable salt thereof.

[0052] Embodiment 28. Any one of embodiments 24 to 27, wherein n, p, and q are each 1. 1. A compound according to claim 1 or a pharmaceutically acceptable salt thereof.

[0053] Embodiment 29. A compound according to any one of embodiments 24 to 28, wherein Z is absent. is a pharmaceutically acceptable salt thereof.

[0054] Embodiment 30.X 6 The compound according to any one of embodiments 24 to 29, wherein is CH. or a pharmaceutically acceptable salt thereof.

[0055] Embodiment 31.Z 1 teeth, * -O-, * -(CH2) 1~3 -and * -(CH2)2O- or a pharmaceutically acceptable salt thereof, Salt to be used.

[0056] Embodiment 32.Z 1 teeth, * -O-, * -CH2-, * -(CH2)2- and * -(CH 2) The compound according to embodiment 31, or a pharmaceutically acceptable salt thereof, selected from 2) 2O-.

[0057] Embodiment 33.Z 1 teeth, * -O-, * -CH2- and * -(CH2)2O- 33. The compound according to embodiment 32, or a pharmaceutically acceptable salt thereof.

[0058] Embodiment 34.X 1 teeth, [ka] is selected from: * is a group represented by the formula (I), (Ia), (Ib) or (Ic) A compound according to any one of embodiments 1 to 8 or its derivatives, showing the atoms attached to the phenyl ring. Pharmaceutically acceptable salts.

[0059] Embodiment 35.X 1 teeth, [ka] is selected from: * represents the atom attached to the phenyl ring in formula (I) or (Ia). 35. The compound according to embodiment 34, or a pharmaceutically acceptable salt thereof, as shown:

[0060] Embodiment 36. A compound of formula (I) comprising: (3S,4R)-N-(3-(6-(4-((9-(3-(2,4-dioxotetrahydrofuran) Dropyrimidin-1(2H)-yl)-4-methoxybenzoyl)-3,9-diazaspirillum (5.5)undecan-3-yl)methyl)phenyl)-7H-pyrrolo[2,3-d] Pyrimidin-4-yl)-5-fluoro-2-methylphenyl)-3-hydroxy-4- isobutylpyrrolidine-1-carboxamide, (3R,4S)-N-(3-(6-(4-((4-(2-((1-(3-(2,4-di) Oxotetrahydropyrimidin-1(2H)-yl)-4-methoxybenzoyl)piperidin (piperazin-4-yl)oxy)ethyl)piperazin-1-yl)methyl)phenyl)-7H- Pyrrolo[2,3-d]pyrimidin-4-yl)-5-fluoro-2-methylphenyl)- 3-hydroxy-4-isobutylpyrrolidine-1-carboxamide, (3R,4S)-N-(3-(6-(4-((1-(2-(1-(3-(2,4-diodeio 1(2H)-1-(4-methoxybenzoyl)-1(2H)-pyrimidin-1(2H)-yl (phenyl-4-yl)ethyl)piperidin-4-yl)oxy)phenyl)-7H-pyrrolo[2 ,3-d]pyrimidin-4-yl)-5-fluoro-2-methylphenyl)-3-hydro oxy-4-isobutylpyrrolidine-1-carboxamide, (cis-rac)-N-(3-(6-(4-((1-(2-(1-(3-(2,4 -dioxotetrahydropyrimidin-1(2H)-yl)-4-methoxybenzoyl)pi 4-(2 ... H-pyrrolo[2,3-d]pyrimidin-4-yl)-5-fluoro-2-methylphenyl )-3-hydroxy-4-isobutylpyrrolidine-1-carboxamide, trans-rac-N-(3-(6-(4-((9-(3-(2,4-dioxoteto (1(2H)-yl)-4-methoxybenzoyl)-3,9-diaza spiro[5.5]undecan-3-yl)methyl)phenyl)-7H-pyrrolo[2,3- d]pyrimidin-4-yl)-5-fluoro-2-methylphenyl)-3-hydroxy- 4-isobutylpyrrolidine-1-carboxamide, (3R,4S)-N-(3-(6-(4-((9-(3-(2,4-dioxotetrahydrofuran) Dropyrimidin-1(2H)-yl)-4-methoxybenzoyl)-3,9-diazaspirillum (5.5)undecan-3-yl)methyl)phenyl)-7H-pyrrolo[2,3-d] Pyrimidin-4-yl)-5-fluoro-2-methylphenyl)-3-hydroxy-4- isobutylpyrrolidine-1-carboxamide, (3R,4R)-N-(3-(6-(4-(2-(9-(3-(2,4-dioxotetate (1(2H)-yl)-4-methoxybenzoyl)-3,9-diaza spiro[5.5]undecan-3-yl)ethyl)phenyl)-7H-pyrrolo[2,3- d]pyrimidin-4-yl)-5-fluoro-2-methylphenyl)-3-hydroxy- 4-isobutylpyrrolidine-1-carboxamide, (3R,4S)-N-(3-(6-(4-((4-((1-(3-(2,4-dioxo Tetrahydropyrimidin-1(2H)-yl)-4-methoxybenzoyl)piperidine- 4-yl)oxy)piperidin-1-yl)methyl)phenyl)-7H-pyrrolo[2,3 -d]pyrimidin-4-yl)-5-fluoro-2-methylphenyl)-3-hydroxy -4-isobutylpyrrolidine-1-carboxamide, (cis-rac-N-(3-(6-(4-((4-((1-(3-(2,4-dioxo (isotetrahydropyrimidin-1(2H)-yl)-4-methoxybenzoyl)piperidine -4-yl)methyl)piperazin-1-yl)methyl)phenyl)-7H-pyrrolo[2, 3-d]pyrimidin-4-yl)-5-fluoro-2-methylphenyl)-3-hydroxy ds-4-isobutylpyrrolidine-1-carboxamide, (3S,4R)-N-(3-(6-(4-((4-((1-(3-(2,4-dioxo Tetrahydropyrimidin-1(2H)-yl)-4-methoxybenzoyl)piperidine- 4-yl)methyl)piperazin-1-yl)methyl)phenyl)-7H-pyrrolo[2,3 -d]pyrimidin-4-yl)-5-fluoro-2-methylphenyl)-3-hydroxy -4-isobutylpyrrolidine-1-carboxamide, (3R,4S)-N-(3-(6-(4-((1-((1-(3-(2,4-dioxo Tetrahydropyrimidin-1(2H)-yl)-4-methoxybenzoyl)piperidine- 4-yl)methyl)piperidin-4-yl)oxy)phenyl)-7H-pyrrolo[2,3 -d]pyrimidin-4-yl)-5-fluoro-2-methylphenyl)-3-hydroxy -4-isobutylpyrrolidine-1-carboxamide, (3R,4S)-N-(3-(6-(4-((4-((1-(3-(2,4-dioxo Tetrahydropyrimidin-1(2H)-yl)-4-methoxybenzoyl)piperidine- 4-yl)methyl)piperazin-1-yl)methyl)phenyl)-7H-pyrrolo[2,3 -d]pyrimidin-4-yl)-5-fluoro-2-methylphenyl)-3-hydroxy -4-isobutylpyrrolidine-1-carboxamide, (3R,4S)-N-(3-(6-(4-(2-(4-((1-(3-(2,4-diodeio 1(2H)-1-(4-methoxybenzoyl)-1(2H)-pyrimidin-1(2H)-yl phenyl-4-yl)oxy)piperidin-1-yl)ethyl)phenyl)-7H-pyrrolo[2 ,3-d]pyrimidin-4-yl)-5-fluoro-2-methylphenyl)-3-hydro oxy-4-isobutylpyrrolidine-1-carboxamide, (3R,4S)-N-(3-(6-(4-((1-((1-(3-(2,4-dioxo Tetrahydropyrimidin-1(2H)-yl)-4-methoxybenzoyl)piperidine- 4-yl)methyl)piperidin-4-yl)methoxy)phenyl)-7H-pyrrolo[2, 3-d]pyrimidin-4-yl)-5-fluoro-2-methylphenyl)-3-hydroxy ds-4-isobutylpyrrolidine-1-carboxamide, (3R,4S)-N-(3-(6-(4-(2-(9-(3-(2,4-dioxotetate (1(2H)-yl)-4-methoxybenzoyl)-3,9-diaza spiro[5.5]undecan-3-yl)ethyl)phenyl)-7H-pyrrolo[2,3- d]pyrimidin-4-yl)-5-fluoro-2-methylphenyl)-3-hydroxy- 4-isobutylpyrrolidine-1-carboxamide, (3R,4S)-N-(3-(6-(4-(2-(9-(3-(2,4-dioxotetate (1(2H)-yl)-4-ethoxybenzoyl)-3,9-diaza spiro[5.5]undecan-3-yl)ethyl)phenyl)-7H-pyrrolo[2,3- d]pyrimidin-4-yl)-5-fluoro-2-methylphenyl)-3-hydroxy- 4-isobutylpyrrolidine-1-carboxamide, (3R,4S)-N-(3-(6-(4-(2-(9-(3-(2,4-dioxotetate (1(2H)-yl)-4-methoxybenzoyl)-3,9-diaza spiro[5.5]undecan-3-yl)ethyl)phenyl)-7H-pyrrolo[2,3- d]pyrimidin-4-yl)-6-fluoro-2-methylphenyl)-3-hydroxy- 4-isobutylpyrrolidine-1-carboxamide, (cis-rac)-N-(3-(6-(4-(2-(9-(3-(2,4-dioxo Tetrahydropyrimidin-1(2H)-yl)-4-methoxybenzoyl)-3,9-di azaspiro[5.5]undecan-3-yl)ethyl)phenyl)-7H-pyrrolo[2, 3-d]pyrimidin-4-yl)-5-fluoro-2-methylphenyl)-3-hydroxy ds-4-isobutylpyrrolidine-1-carboxamide, (3S,4R)-N-(3-(6-(4-(2-(9-(3-(2,4-dioxotetate (1(2H)-yl)-4-methoxybenzoyl)-3,9-diaza spiro[5.5]undecan-3-yl)ethyl)phenyl)-7H-pyrrolo[2,3- d]pyrimidin-4-yl)-5-fluoro-2-methylphenyl)-3-hydroxy- 4-isobutylpyrrolidine-1-carboxamide, (3R,4S)-N-(3-(6-(4-((1-(2-((1-(3-(2,4-di Oxotetrahydropyrimidin-1(2H)-yl)-4-methoxybenzoyl)piperidin Piperidin-4-yl)oxy)ethyl)piperidin-4-yl)oxy)phenyl)-7H- Pyrrolo[2,3-d]pyrimidin-4-yl)-5-fluoro-2-methylphenyl)- 3-hydroxy-4-isobutylpyrrolidine-1-carboxamide, (3S,4R)-N-(3-(6-(4-(((1-(2-(1-(3-(2,4-di Oxotetrahydropyrimidin-1(2H)-yl)-4-methoxybenzoyl)piperidin Piperidin-4-yl)ethyl)piperidin-4-yl)oxy)methyl)phenyl)-7H- Pyrrolo[2,3-d]pyrimidin-4-yl)-5-fluoro-2-methylphenyl)- 3-hydroxy-4-isobutylpyrrolidine-1-carboxamide, (3R,4S)-N-(3-(6-(4-((1-(2-(1-(3-(2,4-di Oxotetrahydropyrimidin-1(2H)-yl)-4-methoxybenzoyl)piperidin Piperidin-4-yl)ethyl)piperidin-4-yl)oxy)methyl)phenyl)-7H- Pyrrolo[2,3-d]pyrimidin-4-yl)-5-fluoro-2-methylphenyl)- 3-hydroxy-4-isobutylpyrrolidine-1-carboxamide, or (cis-rac)-N-(3-(6-(4-((9-(3-(2,4-dioxoteto (1(2H)-yl)-4-methoxybenzoyl)-3,9-diaza spiro[5.5]undecan-3-yl)methyl)phenyl)-7H-pyrrolo[2,3- d]pyrimidin-4-yl)-5-fluoro-2-methylphenyl)-3-hydroxy- 4-Isobutylpyrrolidine-1-carboxamide or a pharmaceutically acceptable salt thereof.

[0061] Embodiment 37. A compound of formula (I) comprising: (3R,4R)-N-(3-(6-(4-(2-(9-(3-(2,4-dioxotetate (1(2H)-yl)-4-methoxybenzoyl)-3,9-diaza spiro[5.5]undecan-3-yl)ethyl)phenyl)-7H-pyrrolo[2,3- d]pyrimidin-4-yl)-5-fluoro-2-methylphenyl)-3-hydroxy- 4-isobutylpyrrolidine-1-carboxamide, (3R,4S)-N-(3-(6-(4-((1-((1-(3-(2,4-dioxo Tetrahydropyrimidin-1(2H)-yl)-4-methoxybenzoyl)piperidine- 4-yl)methyl)piperidin-4-yl)oxy)phenyl)-7H-pyrrolo[2,3 -d]pyrimidin-4-yl)-5-fluoro-2-methylphenyl)-3-hydroxy -4-isobutylpyrrolidine-1-carboxamide, (3R,4S)-N-(3-(6-(4-(2-(4-((1-(3-(2,4-diodeio 1(2H)-1-(4-methoxybenzoyl)-1(2H)-pyrimidin-1(2H)-yl phenyl-4-yl)oxy)piperidin-1-yl)ethyl)phenyl)-7H-pyrrolo[2 ,3-d]pyrimidin-4-yl)-5-fluoro-2-methylphenyl)-3-hydro oxy-4-isobutylpyrrolidine-1-carboxamide, (3R,4S)-N-(3-(6-(4-(2-(9-(3-(2,4-dioxotetate (1(2H)-yl)-4-methoxybenzoyl)-3,9-diaza spiro[5.5]undecan-3-yl)ethyl)phenyl)-7H-pyrrolo[2,3- d]pyrimidin-4-yl)-5-fluoro-2-methylphenyl)-3-hydroxy- 4-isobutylpyrrolidine-1-carboxamide, (3R,4S)-N-(3-(6-(4-(2-(9-(3-(2,4-dioxotetate (1(2H)-yl)-4-methoxybenzoyl)-3,9-diaza spiro[5.5]undecan-3-yl)ethyl)phenyl)-7H-pyrrolo[2,3- d]pyrimidin-4-yl)-6-fluoro-2-methylphenyl)-3-hydroxy- 4-isobutylpyrrolidine-1-carboxamide, (cis-rac)-N-(3-(6-(4-(2-(9-(3-(2,4-dioxo Tetrahydropyrimidin-1(2H)-yl)-4-methoxybenzoyl)-3,9-di azaspiro[5.5]undecan-3-yl)ethyl)phenyl)-7H-pyrrolo[2, 3-d]pyrimidin-4-yl)-5-fluoro-2-methylphenyl)-3-hydroxy 4-isobutylpyrrolidine-1-carboxamide, or (3R,4S)-N-(3-(6-(4-((1-(2-((1-(3-(2,4-di Oxotetrahydropyrimidin-1(2H)-yl)-4-methoxybenzoyl)piperidin Piperidin-4-yl)oxy)ethyl)piperidin-4-yl)oxy)phenyl)-7H- Pyrrolo[2,3-d]pyrimidin-4-yl)-5-fluoro-2-methylphenyl)- 3-Hydroxy-4-isobutylpyrrolidine-1-carboxamide or a pharmaceutically acceptable salt thereof.

[0062] Embodiment 38. The compound (3R,4R)-N-(3-(6-(4-(2-(9-(3-( 2,4-Dioxotetrahydropyrimidin-1(2H)-yl)-4-methoxybenzoyl (phenyl)-3,9-diazaspiro[5.5]undecan-3-yl)ethyl)phenyl)-7 H-pyrrolo[2,3-d]pyrimidin-4-yl)-5-fluoro-2-methylphenyl )-3-hydroxy-4-isobutylpyrrolidine-1-carboxamide or its pharmaceutical equivalents Acceptable salts.

[0063] Embodiment 39. The compound (3R,4S)—N—(3-(6-(4-((1-((1-(3 -(2,4-dioxotetrahydropyrimidin-1(2H)-yl)-4-methoxybenzoate (diphenyl)piperidin-4-yl)methyl)piperidin-4-yl)oxy)phenyl)- 7H-Pyrrolo[2,3-d]pyrimidin-4-yl)-5-fluoro-2-methylphenyl (I)-3-hydroxy-4-isobutylpyrrolidine-1-carboxamide or its pharmaceutical Acceptable salts.

[0064] Embodiment 40. The compound (3R,4S)—N—(3-(6-(4-(2-(4-((1- (3-(2,4-dioxotetrahydropyrimidin-1(2H)-yl)-4-methoxy Benzoyl)piperidin-4-yl)oxy)piperidin-1-yl)ethyl)phenyl )-7H-pyrrolo[2,3-d]pyrimidin-4-yl)-5-fluoro-2-methyl (phenyl)-3-hydroxy-4-isobutylpyrrolidine-1-carboxamide or its drug A physiologically acceptable salt.

[0065] Embodiment 41. The compound (3R,4S)-N-(3-(6-(4-(2-(9-(3-( 2,4-Dioxotetrahydropyrimidin-1(2H)-yl)-4-methoxybenzoyl (phenyl)-3,9-diazaspiro[5.5]undecan-3-yl)ethyl)phenyl)-7 H-pyrrolo[2,3-d]pyrimidin-4-yl)-5-fluoro-2-methylphenyl )-3-hydroxy-4-isobutylpyrrolidine-1-carboxamide or its pharmaceutical equivalents Acceptable salts.

[0066] Embodiment 42. The compound (3R,4S)-N-(3-(6-(4-(2-(9-(3-( 2,4-Dioxotetrahydropyrimidin-1(2H)-yl)-4-methoxybenzoyl (phenyl)-3,9-diazaspiro[5.5]undecan-3-yl)ethyl)phenyl)-7 H-pyrrolo[2,3-d]pyrimidin-4-yl)-6-fluoro-2-methylphenyl )-3-hydroxy-4-isobutylpyrrolidine-1-carboxamide or its pharmaceutical equivalents Acceptable salts.

[0067] Embodiment 43. The compound (cis-rac)-N-(3-(6-(4-(2-(9-(3 -(2,4-dioxotetrahydropyrimidin-1(2H)-yl)-4-methoxybenzoate (zoyl)-3,9-diazaspiro[5.5]undecan-3-yl)ethyl)phenyl) -7H-pyrrolo[2,3-d]pyrimidin-4-yl)-5-fluoro-2-methylphen (Nyl)-3-hydroxy-4-isobutylpyrrolidine-1-carboxamide or its pharmaceutical preparation A commercially acceptable salt.

[0068] Embodiment 44. The compound (3R,4S)-N-(3-(6-(4-((1-(2-((1 -(3-(2,4-dioxotetrahydropyrimidin-1(2H)-yl)-4-methoxy (Dibenzoyl)piperidin-4-yl)oxy)ethyl)piperidin-4-yl)oxy )phenyl)-7H-pyrrolo[2,3-d]pyrimidin-4-yl)-5-fluoro-2 (-methylphenyl)-3-hydroxy-4-isobutylpyrrolidine-1-carboxamide or a pharmaceutically acceptable salt thereof.

[0069] Depending on the choice of starting materials and procedures, the compound may exist in one of the possible stereoisomers. or mixtures of stereoisomers, e.g. pure optical isomers or mixtures of stereoisomers, e.g. It may exist as a racemic or diastereomeric mixture (depending on the number of asymmetric carbon atoms). The present invention provides racemic mixtures, diastereomeric mixtures and optically pure forms. It is intended to include all possible stereoisomers, including the optically active -(R) stereoisomer. The isomers and (S)-stereoisomers can be prepared using chiral synthons or chiral reagents. or can be resolved using conventional techniques. If the compound contains a double bond, the substituents It may be in the E, E or Z configuration. When the compound contains a disubstituted cycloalkyl, the cycloalkyl may be in the E, E or Z configuration. Alkyl substituents may have cis or trans configurations. Isomeric forms are intended to be included.

[0070] The compounds of formula (I), (Ia), (Ib) or (Ic) may exist in various tautomeric forms. All tautomeric forms of the compounds of formula (I), (Ia), (Ib) or (Ic) may be For example, compounds of formula (I) can be represented by the formula (I') and the formula (I'') [ka] (In the formula, R 1 , R 1a , R 2 , R 2a , X 1 , R 6 and R 7 is represented by the formula (I), (Ia), ( (Ib) or (Ic) The tautomeric forms according to the formula:

[0071] As used herein, the term "salt" or "salts" refers to an acid salt of a compound of the present invention. "Salt" refers to a salt or a base addition salt. "Salt" specifically includes "pharmaceutically acceptable salts." .

[0072] The term "pharmaceutically acceptable salts" refers to compounds that retain the biological effectiveness and properties of the compounds of the present invention. and typically refers to salts that are undesirable, biologically or otherwise. The presence of amino and / or carboxyl groups or groups similar thereto makes the acid salt and / or base salts may be formed.

[0073] The pharmaceutically acceptable salts of the present invention can be prepared by conventional chemical methods from a basic or acidic moiety. Typically, such salts can be prepared by converting the free acid form of the compound into a suitable base. or by reacting the free base form of the compound with a stoichiometric amount of a suitable acid. It can be prepared by reacting it with a stoichiometric amount of methyl methyl ether. Such a reaction is typically The process is carried out in water, an organic solvent, or a mixture of the two. ether, ethyl acetate, ethanol, isopropanol, acetonitrile or tetrahydrofuran The use of a non-aqueous medium such as orchid is preferred. A list of suitable additional salts can be found, for example, in "R emington's Pharmaceutical Sciences”,20th ed., Mack Publishing Company, Easton, Pa., (1985) and “Handbook of Pharmaceutical Salts s:Properties,Selection,and Use”(Stahl an d Wermuth)(Wiley-VCH,Weinheim,Germany,20 02) can be found in

[0074] Also, when both basic and acid groups are present in the same molecule, the compounds of the present invention have an internal Salts, such as zwitterionic molecules, may be formed.

[0075] The compounds of the present invention are characterized in that the compounds contain at least one basic group, e.g., an amino group. It is particularly suitable for forming acid addition salts with

[0076] Pharmaceutically acceptable acid addition salts can be formed with inorganic and organic acids.

[0077] Examples of inorganic acids from which salts can be derived include hydrochloric acid, hydrobromic acid, sulfuric acid, nitric acid, and phosphoric acid. can be.

[0078] Examples of organic acids from which salts can be derived include acetic acid, propionic acid, glycolic acid, oxalic acid, Leic acid, malonic acid, succinic acid, fumaric acid, tartaric acid, citric acid, benzoic acid, mandelic acid, Examples include methanesulfonic acid, ethanesulfonic acid, toluenesulfonic acid, and sulfosalicylic acid. can be done.

[0079] Pharmaceutically acceptable base addition salts can be formed with inorganic and organic bases. .

[0080] Examples of inorganic bases from which salts can be derived include ammonium salts and salts of the metals of groups I to XII of the periodic table. In certain embodiments, the salts include sodium, potassium, ammonium Particularly suitable salts are those derived from calcium, magnesium, iron, silver, zinc and copper. Included are the ammonium, potassium, sodium, calcium and magnesium salts.

[0081] Examples of organic bases from which salts can be derived include primary, secondary and tertiary amines, naturally occurring Examples of suitable amines include substituted amines, including substituted amines containing cyclic amines, as well as basic ion exchange resins. Certain organic amines include isopropylamine, benzathine, cholinate, and diethanolamine. amines, diethylamine, lysine, meglumine, piperazine and tromethamine. do.

[0082] In another aspect, the present invention provides a compound of the present invention as a salt of acetate, ascorbate, adipine, or the like. Acid salts, aspartates, benzoates, besylates, bromides / hydrobromides, bicarbonates / Carbonate, bisulfate / sulfate, camphorsulfonate, caprate, chloride / hydrochloride, Chlortheophyllonate, citrate, ethanedisulfonate, fumarate, Glucept acid salts, glucuronate, gluconate, glutamate, glutarate, glycolate , hippurate, hydroiodide / iodide, isethionate, lactate, lactobionate, Lauryl sulfate, malate, maleate, malonate, mandelate, mesylate, Methyl sulfate, mucoate, naphthoate, napsylate, nicotinate, nitrate, octadecate Citric acid salts, oleate salts, oxalate salts, palmitate salts, pamoate salts, phosphate salts / phosphate water salts Dihydrogen phosphate, polygalacturonate, propionate, sebacate, stearyl phosphate, succinate, sulfosalicylate, sulfate, tartrate, tosylate, triphenyl It is provided in the form of a difluoroacetate, trifluoroacetate or xinafoate salt.

[0083] Any formula given herein represents unlabeled and isotopically labeled forms of the compounds. isotopically labeled compounds are compounds in which one or more atoms are selected from the group consisting of: The atomic mass or mass number given herein is the same as that given in the present specification, except that it is replaced by an atom having the specified atomic mass or mass number. Examples of isotopes that may be incorporated into compounds of the present invention include: Examples include isotopes of hydrogen.

[0084] In another embodiment of the present invention, a compound of formula (I''') [ka] (In the formula, R 1 , R 1a , R 2 , R 2a , R 6 is defined for formula (I) or formula (Ia) As stated above, R 7 is -C(R 10 )3, -OC(R 10 )3 or -OC(R 10) 2C(R 10 )3 and X 1 teeth, [ka] is selected from Each R 8 , R 9 and R 10 is independently selected at each occurrence from H or deuterium; The symbol # is independently substituted by H which may be replaced by H or deuterium at each occurrence. (Indicates the position where it is indicated that The compound of formula (I) is provided.

[0085] Certain isotopes, especially deuterium (i.e. 2 Incorporation of H or D) results in greater metabolic stability for example, by increasing in vivo half-life, reducing dosing requirements, or improving therapeutic index or tolerability. Deuterium, in this context, is a compound of formula (I) and formula (II). It is understood that the concentration of deuterium is considered to be a substituent of the compound of formula (Ia). The term "isotopic enrichment factor" as used herein refers to the amount of an isotope The term "abundance" refers to the ratio between the abundance and the natural abundance of the specified isotope in the compounds of the present invention. When a substituent of is represented as deuterium, the compound isotopically divided into two groups for each specified deuterium atom. A total concentration factor of at least 3500 (52.5% deuterium at each designated deuterium atom) incorporation), at least 4000 (60% deuterium incorporation), at least 4500 (67. (5% deuterium incorporation), at least 5000 (75% deuterium incorporation), at least 55 00 (82.5% deuterium incorporation), at least 6000 (90% deuterium incorporation), a little At least 6333.3 (95% deuterium incorporation), at least 6466.7 (97% deuterium incorporation) hydrogen incorporation), at least 6600 (99% deuterium incorporation) or at least 6633. 3 (99.5% deuterium incorporation). The term "isotopic enrichment factor" is used to describe deuterium. It should be understood that the same applies to any isotope as listed. be.

[0086] Other examples of isotopes that can be incorporated into compounds of the invention include hydrogen, carbon, nitrogen, Isotopes of oxygen, phosphorus, fluorine and chlorine, e.g. 3 H, 11 C. 13 C. 14 C. 15 N, 18 F, 31P, 32P, 35 S, 36 Cl and 125 I was mentioned. Thus, the present invention provides, for example, radioisotopes, e.g. 3 H and 14 Any of the above isotopes, including C Compounds incorporating one or more of the following: 2 H and 13 C exists It should be understood that such isotopically labeled compounds include those used in metabolic research. Research( 14 C), reaction kinetic studies (e.g., 2 H or 3 H), detection or imaging techniques such as positron emission tomography (PET) or single photon emission computed tomography (SPECT) ) (including drug or substrate tissue distribution assays) or radioactive treatment of patients. , 18 F-labeled compounds may be particularly desirable for PET or SPECT studies. Isotopically labeled compounds are typically prepared by substituting the appropriate isotope for the previously used non-labeled reagent. By conventional techniques known to those skilled in the art or as described in the accompanying examples, using labeled reagents. It can be prepared by processes similar to those described above.

[0087] As used herein, the term "pharmaceutical composition" refers to a pharmaceutical composition containing at least one pharmaceutically acceptable carrier. A compound of the invention or its derivatives in a form suitable for oral or parenteral administration together with a carrier. refers to a pharmaceutically acceptable salt of

[0088] As used herein, the term "pharmaceutically acceptable carrier" refers to a carrier that is suitable for use in the preparation of a pharmaceutical composition or refers to materials useful for use, such as suitable diluents, solvents, dispersants known to those skilled in the art. Vehicle, surfactant, antioxidant, preservative, isotonic agent, buffer, emulsifier, absorption retardant, salt, drug stabilizers, binders, excipients, disintegrants, lubricants, wetting agents, sweeteners, flavoring agents, dyes, and and combinations thereof (e.g., Remington's Pharmacy ical Sciences,18th Ed.Mack Printing Comp (See any, 1990, pp. 1289-1329).

[0089] The term "therapeutically effective amount" of a compound of the present invention refers to a therapeutically effective amount that elicits a biological or medical response in a subject. to inhibit, for example, enzyme or protein activity or to ameliorate disease symptoms or alleviating symptoms, slowing or delaying the course of the disease, or preventing the disease. In one embodiment, the term "therapeutically effective amount" refers to an amount of a compound of the present invention, such as When administered to a subject, (1) a compound that (i) is mediated by BTK or (ii) exhibits BTK activity or (iii) characterized by BTK activity (normal or abnormal). at least partially alleviate, prevent, and / or ameliorate the symptoms, disorders, or diseases (2) decrease or inhibit the activity of BTK; or (3) decrease the expression of BTK. These effects refer to the amount of a compound of the present invention that is effective to reduce or inhibit This effect can be achieved by lowering the amount of BTK, for example by degrading it. In another embodiment, the term "therapeutically effective amount" refers to a therapeutically effective amount of a cell, tissue, or non-cellular When administered to biomaterials or culture media, it at least partially reduces or at least partially reduces the activity of BTK. or inhibiting the expression of BTK; or at least inhibiting the expression of BTK, e.g., by degrading BTK. The term "inhibitory effect" refers to an amount of a compound of the present invention effective to partially reduce or inhibit the progression of inflammatory bowel disease.

[0090] As used herein, the term "subject" refers to a primate (e.g., a human, male or female), an iguanosine monophosphate (II), a phosphodiesterase (P2 ... In certain embodiments, the term "animal" refers to a mammal, such as a rabbit, a guinea pig, a pig, a rat, or a mouse. Elephants are primates. In one embodiment, the subject is a human.

[0091] As used herein, the term "inhibition" or "inhibiting" refers to the inhibition of a given condition, symptom, disorder, or or reduction or suppression of disease or baseline biological activity or biological process Refers to a large decrease in activity.

[0092] As used herein, the term "degrade" or "degradation" refers to the reduction of the biological activity (e.g., loss of activity) of BTK. by the cell's proteasome system to the extent that it reduces or eliminates the activity of the proteasome (especially abnormal activity) This refers to the partial or complete degradation of a target protein, such as BTK. Degradation can involve E3 ligases, This can be achieved in particular through the mediation of an E3 ligase complex that includes the protein cereblon. As used herein, the term "modulating BTK activity" or "modulating BTK activity" refers to the This means altering, especially reducing, inhibiting, or eliminating, the activity of BTK. The amount of degraded BTK can be measured before treatment with the compounds of the present invention. The initial amount or level of BTK present and the increase in BTK after treatment with the compounds of the invention were measured. In one embodiment, the initial level can be measured by comparing the residual amount. In one embodiment, at least about 30% of the BTK is degraded compared to the initial level. In one embodiment, at least about 40% of the BTK is degraded compared to the initial level. In one embodiment, at least about 50% of the BTK is degraded compared to the initial level. In one embodiment, at least about 60% of the BTK is degraded compared to the initial level. In one embodiment, at least about 70% of the BTK is degraded compared to the initial level. In one embodiment, at least about 80% of the BTK is degraded compared to the initial level. In one embodiment, at least about 90% of the BTK is degraded compared to the initial level. In one embodiment, at least about 95% of the BTK is degraded compared to the initial level. In one embodiment, greater than 95% of the BTK is degraded compared to the initial level. At least about 99% of the BTK is degraded.

[0093] In one embodiment, BTK is expressed in an amount that is about 30% to about 99% of the initial level. In one embodiment, BTK is reduced by about 40% to about 99% compared to initial levels. In one embodiment, BTK is degraded by about 50% to about 90% compared to the initial level. In one embodiment, BTK is degraded by about 60% compared to initial levels. In one embodiment, BTK is degraded by about 99% compared to the initial level. Between 70% and about 99% of the BTK is degraded. In one embodiment, the BTK is degraded to a level comparable to the initial level. In one embodiment, BTK is degraded at about 80% to about 99% of its initial level. In one embodiment, BTK is degraded by about 90% to about 99% compared to the initial amount. In one embodiment, BTK is degraded by about 95% to about 99% compared to the level. Approximately 90% to 95% of the initial level is decomposed.

[0094] As used herein, the term "BTK selectivity" refers to, for example, the ability of a compound of the present invention to selectively bind to BTK. It is intended to degrade a protein in preference to or to a greater extent than another protein. Taste.

[0095] As used herein, the term "treating" any disease or disorder or any "Treatment" of a disease or disorder means alleviating or ameliorating the disease or disorder (i.e., slowing or inhibiting the progression of the disease or at least one of its clinical symptoms. or associated with a disease or disorder (including those that may not be discernible to the patient) Alleviating or improving at least one associated physical parameter or biomarker. This refers to the following:

[0096] As used herein, the term "preventing" any disease or disorder or any "Prevention" of a disease or disorder means prophylactic treatment of the disease or disorder; or It refers to delaying the onset or progression of the disease.

[0097] As used herein, a subject is defined as a person who is biologically, medically, or otherwise affected by a treatment such as Treatment is "necessary" if one would benefit in quality of life from it.

[0098] As used herein, in connection with the present invention (especially in connection with the claims), The terms "a," "an," "the," and similar terms are used herein. Unless otherwise specified in the specification or clearly contradicted by context, the singular and plural It should be interpreted as including both.

[0099] All methods described herein are intended to be illustrative unless otherwise indicated herein or by context. The steps may be performed in any suitable order unless clearly contradicted by the principles set forth herein. Use of any and all examples or exemplary language (e.g., "etc." or "for example") provided The use is intended merely to better clarify the invention and, unless claimed, No limitation to the scope of the invention is posed.

[0100] Any asymmetric atoms (e.g., carbon) of the compounds of the present invention may be present in racemic or enantiomeric forms. It may be present in an asymmetrically enriched form, for example, in the (R)-, (S)-, or (R,S)-configuration. In this embodiment, each asymmetric atom is in enantiomeric excess of either the (R)- or (S)-configuration. at least 50%, enantiomeric excess of at least 60%, enantiomeric excess of at least 70% , enantiomeric excess of at least 80%, enantiomeric excess of at least 90%, enantiomeric excess of At least 95% or an enantiomeric excess of at least 99%. Substituents at atoms may be present in cis (Z)-form or trans (E)-form where possible. -It can exist in the form

[0101] Thus, as used herein, the compounds of the present invention are intended to encompass all possible stereoisomers, rotamers, and the like. In one form of isomer, atropisomer, tautomer or mixture thereof, e.g. substantially Pure geometric (cis or trans) stereoisomers, diastereoisomers, optical isomers (enantiomers) , racemic or as a mixture thereof.

[0102] Any resulting mixture of stereoisomers may be classified based on the physicochemical differences of the constituents, e.g. By chromatography and / or fractional crystallization, pure or substantially pure geometric isomers or It can be separated into optical isomers, diastereoisomers and racemates.

[0103] Any resulting racemates of the compounds or intermediates of the present invention can be prepared by known methods, e.g. For example, by separation of their diastereomeric salts obtained with optically active acids or optically active bases, and By liberating an optically active acidic compound or an optically active basic compound, the compound can be separated into enantiomers. Therefore, the basic moiety can be, in particular, an optically active acid, such as tartaric acid. , dibenzoyltartaric acid, diacetyltartaric acid, di-O,O'-p-toluoyltartaric acid, mannitol by fractional crystallization of salts formed with methyl, malic or camphor-10-sulfonic acid The racemization method of the present invention can be used to resolve the compounds of the present invention into their enantiomers. The compound or racemic intermediate can be purified by chiral chromatography, e.g., high pressure liquid chromatography using a chiral adsorbent. The compounds can be separated by chromatography (HPLC).

[0104] The compounds of the present application can be prepared by the methods of organic synthesis using commercially available starting materials, compounds known in the literature. The compounds can be prepared in a number of ways known to those skilled in the art or from readily prepared intermediates. Standard syntheses are known or will be apparent to those skilled in the art in view of the teachings herein. All examples can be prepared by using the methods and procedures. Alternative orthogonal protecting group strategies are discussed, e.g., Protective Groups in Org anic Synthesis,3 rd edition, John Wiley & Soc. ns: New York, 1999 or Protecting Groups, 3 rd Standards as described in the edition, Thieme, Stuttgart, 2004 Those skilled in the art will be able to use the techniques disclosed herein in accordance with standard textbook knowledge. You will recognize if a stereocenter exists in the compound.

[0105] The compounds of the present invention can be synthesized according to the following scheme: The final molecule is constructed using a set of reaction procedures in a modular fashion that allows for a variety of reaction sequences. The components can be assembled in a variety of ways.

[0106] Several reaction types are particularly useful for preparing the compounds. coupling reagent (e.g., HATU or HBTU) in a solvent such as DMF or DMA and amides between amines and carboxylic acids using a base (e.g., DIPEA or NMM). It contains an amide functionality, which is usually formed by a coupling reaction. The acid can first be converted to its pentafluorophenol ester. Subsequent facile reaction with amines in the presence of a base such as TEA in a solvent such as MF forms amides. Compounds of the invention containing a carbon-nitrogen bond often contain an amine and can be prepared using a reductive amination reaction starting from an aldehyde or ketone The reaction is carried out using NaBH3CN, ZnCl2 and TE in a solvent mixture such as THF and MeOH. A. The carbon-nitrogen bond can also be converted to a base ( containing a leaving group such as an alkyl halide or alkyl mesylate in the presence of They can be formed by nucleophilic substitution of amines with suitable reaction partners. In addition, compounds containing ethers can be converted by nucleophilic substitution, in this case to alcohols, In the presence of a base (e.g., TEA) in a solvent such as HF, a compound containing a leaving group such as a benzyl halide is reacted with the It can be prepared by reacting with a suitable partner containing an ether. Another generally useful method for preparing compounds of the present invention is the Mitsunobu reaction. Phenol and other alcohols can be prepared by the addition of phosphines (triphenylphosphine) in solvents such as THF. Sphins, etc.) and azodicarboxylates (diethyl azodicarboxylate or diethyl azodicarboxylate) The compounds of the present invention react with each other in the presence of isopropyl azodicarboxylate, etc. Another reaction that is highly useful for the synthesis of phenylalanine is the palladium ( Pd)-catalyzed cross-coupling reactions are particularly useful. The catalyst (e.g., PdCl2(dppf)) and base (e.g., Na2CO3 or Cs2CO3) to synthesize the quinone derivatives between aromatic halides and aromatic boronic acids or esters. This is a wood coupling reaction.

[0107] Specifically, compounds of formula (I) include R 1 , R 1a , R2 , R 2a , X 1 , R 6 , R 7 , X 1a and X 2a prepared as shown in Scheme 1, where M may be defined as H or as a protecting group such as -SO2Ph or -SEM. , and LG is defined as a leaving group such as mesylate (OM).

[0108] Therefore, compounds of formula (I) can be prepared by reacting them with a coupling reagent (e.g., dimethylformamide) in a solvent such as DMF or DMA. amines and carboxylic acids using a base (e.g., HATU) and a base (e.g., DIPEA or NMM) Amide coupling between the carboxylic acids to give the compound of formula (II) and the compound of formula (III) Alternatively, compounds of formula (I) can be treated with TEA in a solvent such as DMF. by treating the amine of formula (II) with the acid (IIIa) Compounds of formula (II) can be prepared by amide coupling between aryl esters of formula (I). Compounds of formula (IV) where M is a protecting group such as -SO2Ph can be prepared from compounds of formula (IV). For example, deprotection can be achieved by the addition of a base (e.g., DMSO, THF, and water) in a solvent mixture (e.g., DMSO, THF, and water). , NaOH); when M is a -SEM protecting group, in a solvent such as DCM Deprotection using an acid such as TFA can be utilized and can be combined with a subsequent amine deprotection step. t-Butoxycarbonyl esters can be prepared by the addition of t-butoxycarbonyl esters ... to t-butoxycarbonyl esters using an acid (e.g., TFA) in a solvent such as DCM. Further deprotection of the aryl (Boc) group provides compounds of formula (II). [ka]

[0109] Compounds of formula (IV) can be prepared by reacting a base (e.g., KCO) to form a compound of formula (VI) with a compound of formula (V) Alternatively, the compound of formula (IV) can be provided by the reaction of a compound of the formula (IV) with THF and M For example, under conditions using NaBH3CN, ZnCl2, and TEA in a solvent mixture such as eOH For example, in a reductive amination reaction, a compound of formula (VII) may be reacted with a compound of formula (VII). Thus, it can be provided.

[0110] The compound of formula (V) is R 1 , R 1a , R 2 , R 2a , X 1 , M and LG are previously defined The group -B(OR x )2 is a boronic acid or Boronic ester functional groups (including cyclic boronates, e.g., boron pinacol esters) Therefore, Pd-catalyzed couplings, for example, in solvent mixtures (e.g., dioxane / A catalyst (e.g., PdCl2(dppf)) and a base (e.g., Cs2CO3) are added to the reaction mixture in water. The second step is followed by a Suzuki reaction between the compound of formula (VIII) and the compound of formula (IX) In the process, for example, mesylation with MsO and TEA in a solvent such as THF to give X 1a Conversion of the alcohol functionality linked to ##STR00002## to a leaving group LG provides compounds of formula (V). Compounds of formula (VIII) can be prepared by Pd-catalyzed coupling, for example, in a solvent mixture (e.g., di oxane / water) with a catalyst (e.g., PdCl2(dppf)) and a base (e.g., Cs2 by Suzuki reaction between a compound of formula (X) and a compound of formula (XI) using CO It can be done. [ka]

[0111] By analogy, compounds of formula (VII) may be prepared by reacting R 1 , R 1a , R 2 , R 2a , M, LG and - B(OR x ) 2 can be prepared according to Scheme 3, where 2 is as previously defined.

[0112] Therefore, Pd-catalyzed couplings, e.g., in solvent mixtures (e.g., dioxane / water), Using a catalyst (e.g., PdCl2(dppf)) and a base (e.g., Cs2CO3), The Suzuki reaction between a compound of formula (XII) and a compound of formula (IX) gives a compound of formula (VII) The compound of formula (XII) can also be prepared by Pd-catalyzed coupling, for example, by the use of a solvent mixture ( For example, a catalyst (e.g., PdCl2(dppf)) and a base (e.g., dioxane / water) are For example, the Suzuki reaction between compounds of formula (X) and (XIII) using Cs2CO3 It can be produced by reaction. [ka]

[0113] Compounds of formula (II) can also be prepared according to Scheme 4. When is H, NaBH3CN, ZnCl2 and followed by reductive amination between compounds of formula (XIV) and formula (XV) using conditions such as methyltrimethylammonium bromide and TEA. In addition, deprotection of the amine with an acid (e.g., TFA) in a solvent such as DCM can give the compound of formula (II). The compound of formula (XIV) can be obtained by a similar sequence starting from the compound of formula (VII). The compound of formula (VII) can be prepared by the reaction of a cyclohexane-2-methyl-2-propanol (2-methyl-2-propanol) with a solvent mixture such as THF and MeOH. N-(t-butoxycarbonyl) followed by reductive amination with methyl)piperazine in a solvent such as DCM with an acid (e.g., TF Deprotection of the amine with A) can provide (XIV). [ka]

[0114] Compounds of formula (IV) can be prepared from compounds of formula (XVI) by Pd-catalyzed coupling according to Scheme 5. Pulling, e.g., a catalyst (e.g., PdCl2) in a solvent mixture (e.g., dioxane / water) (dppf)) and a base (e.g., CsCO) to give the compound of formula (IX The compound of formula (XVI) can also be prepared by reacting it with a compound of formula (XVI). Thus, compounds of formula (XVII) can be prepared by Pd-catalyzed coupling, for example in a solvent mixture (e.g. For example, a catalyst (e.g., PdCl(dppf)) and a base (e.g., dioxane / water) , Cs2CO3) with a compound of formula (X). [ka]

[0115] Compounds of formula (XVII) can be prepared by reaction of borane with borane in a solvent such as dioxane, as shown in Scheme 6. Boronate dimers (e.g., bis(pinacolato)diboron), PdCl2(dp pf) and a base such as KOAc, The compounds (where Hal represents a halogen) can be prepared by halogen-boron exchange reaction. XVIII) is, for example, when Hal and LG in formula (XIX) are both bromine, Nucleophilic substitution using a base such as K2CO3 in a solvent such as acetonitrile is used to obtain the compound ( XIX) and compound (VI).

[0116] A particular subset of compounds (XVIII) described by formula (XVIIIa) is From the halophenylacetic acid derivative (XX) and the compound of formula (VI), a two-step procedure (DM A coupling reagent (e.g., HATU) and a base (e.g., D) in a solvent such as F or DMA Amide coupling reaction using IPEA or NMM) followed by a catalyst in a solvent such as THF This involves the addition of a Grignard reagent such as MeMgBr in the presence of (e.g., ZrCl4). Compound (XVIIIa) can be synthesized using the method described for compound (XVIII). This is converted to compound (XVII) by halogen-boron exchange in a manner similar to the conversion obtain. [ka]

[0117] Compounds of formula (I) can be prepared according to Scheme 7 by reacting compounds of formula (XXI) and formula (VIIa) Compounds (particular embodiments of compound type (VII) when M=H) can be prepared by, for example, THF and Reductive amines using NaBH3CN, ZnCl2, and TEA in a solvent mixture such as MeOH Alternatively, compounds of formula (I) can be prepared using hydroxyl coupling. In a nucleophilic substitution reaction using a base (e.g., K2CO3) in DMF and ACN, In the compound of formula (Va) (particular embodiment of compound type (V) when M=H), XI) with a compound of formula (II). [ka]

[0118] The compound of formula (XXI) can be prepared from the compound of formula (VI) and the compound of formula (III) by the reaction of DMF. or a coupling reagent (e.g., HATU) and a base (e.g., DI) in a solvent such as DMA. Amide coupling reaction using PEA or NMM followed by acid (e.g., For example, by deprotection of the t-butoxycarbonyl (Boc) group of the amine using TFA It is synthesized.

[0119] Compounds of formula (I) where Z is absent can be prepared by, for example, N In a reductive amination coupling using aBH3CN, ZnCl2, and TEA, can be prepared by reacting a compound of formula (XXII) with a compound of formula (XXIII) (Z, R 1 , R 1a , R 2 , R 2a , X 1a , R 4 , R 5 , R 6 , R 7 , n, p and q are as previously defined). By analogy, compound (XXIV) and compound (XX III) can be reacted under similar conditions to provide compounds of formula (I) according to Scheme 8 do. [ka]

[0120] Compounds of formula (XVI) can be prepared according to Scheme 9 by Pd-catalyzed coupling, e.g., solvent mixing. A catalyst (e.g., PdCl(dppf)) and a base (e.g., dioxane / water) are added to the catalyst (e.g., PdCl(dppf)) and a base (e.g., dioxane / water). For example, a Suzuki reaction using Cs2CO3 can be used to prepare a compound of formula (X) and a compound of formula (XXV) It can be synthesized from compounds. [ka]

[0121] Compounds of formula (XXV) can be prepared using various procedures under reaction conditions previously described. For example, in Scheme 10, the common boronic acid / ester starting material (XXVII Starting from (I), Mitsunobu reaction with a compound of structure (XXIX) followed by deprotection gives a compound of formula (X XVI), which in turn undergoes a nucleophilic substitution reaction with a compound of formula (XXVII): Upon reaction, a compound of formula (XXV) can be obtained. In some cases, the compound of formula (XXVIII) A Mitsunobu reaction with a compound of formula (XXX) can directly provide (XXV). [ka]

[0122] Compounds of formula (XXV) can also be prepared from the common starting material 4-bromobenzyl bromide (XXX I) can be synthesized from 1,2-dichloro-2,3-dichloro-2,4 ... Nucleophilic substitution reaction with compound (XXX) using a base such as potassium t-butoxide in a solvent Subsequent halogen-boron exchange using previously described conditions can directly lead to (XXV). In other cases, nucleophilic substitution with compound (XXXII) followed by halogen-boron exchange and and Boc deprotection gives new intermediates (XXXIII), which are of the type (XXVII) The compound reacts in a further nucleophilic substitution reaction with the compound to form a compound similar to those previously described. Under certain conditions, this can lead to (XXV). [ka]

[0123] As is well known to those skilled in the art, reaction sequences often vary but are similar. Scheme 12 shows the synthesis of compounds of formula (I) using procedures similar to those previously described. V) to construct compounds of formula V. Therefore, Pd-catalyzed coupling, e.g. A catalyst (e.g., PdCl2(dppf)) in a solvent mixture (e.g., dioxane / water) and and a base (e.g., Cs2CO3) using compound (X) and compound (XXVIII). The reaction gives intermediate (XXXIV), which can be reacted with a compound of formula (XXXII) Compound (XXXV) can then be further reacted to provide intermediate (XXXV). undergoes Suzuki coupling to give a compound of formula (IX) and a subsequent deprotection sequence The compound of formula (XXXVI) can be obtained by the reaction of the compound of formula (XX XVII) to give a compound of formula (IV). [ka]

[0124] The compound of formula (XXXVI) can also be prepared by the reductive amide reaction with the compound of formula (XXXVIII). can be converted to give compounds of formula (IV), as shown in Scheme 13. Alternatively, two products can be produced: Q is H or Q is CH2OH. Alternatively, compound (IV) where Q is H may be prepared by reacting a masked alkyl group with compound (XXXVIII) instead of compound (XXXVIII). It can be prepared using aldehyde (XXXIX). [ka]

[0125] Scheme 14 shows a further approach to provide compounds of formula (IV). The intermediate of formula (XL) can be, for example, the reaction between compound (XXVIII) and compound (XXIX) Alternatively, (XL) can be prepared by the Mitsunobu reaction. II) is generated in two steps from nucleophilic substitution between compounds followed by halogen-boron exchange reaction. The reaction of intermediate (XL) in the Pd-catalyzed coupling reaction with the compound of formula (X) can be carried out. The reaction gives a compound of formula (XLI), which can be further reacted with a compound of formula (IX) using a Pd catalyst. The coupling reaction followed by deprotection can give a compound of formula (XLII). XLII) undergoes reductive amination with a compound of formula (XXXVII) to give (IV ) may be provided. [ka]

[0126] Compounds of formula (I) can be prepared from intermediates of formula (XLIV) as shown in Scheme 15. This can be prepared by direct analogy with compound (XL) in Scheme 14. Therefore, intermediate (XLIV) can be prepared by combining (XLIII) with (XLIII). Compound (XLIV) is then prepared by the reaction of a Pd catalyst with the following formula: Compound (XLV) is obtained by two steps of coupling and deprotection. XLV) reacts with a compound of formula (XLVI) in a reductive amination reaction to give (I) Compound (XLVI) can be prepared by the reaction of N-(2-hydroxyethyl)piperazine with Mido-coupling reactions followed by oxidation reactions such as Swern oxidation (e.g., oxalyl chloride and DMSO followed by the addition of TEA in a solvent such as DCM) to form a compound of formula (III) It is produced from compounds. [ka]

[0127] The dihydrouracil molecule of formula (III) reacts with urea in acetic acid heated to approximately 120°C. Compound (XLVII) can be prepared by cyclization of a molecule of formula (XLVII) using Therefore, heating in acrylic acid at a temperature of typically about 100 °C (Scheme 16) from the corresponding aniline derivative (XLVIII). [ka]

[0128] A compound of formula (IX) 1 , R 1a , R 2 , R 2a and -B(OR x )2 is the first (as defined in ) can be prepared by reacting compound (XLIX) with phosgene or an equivalent, e.g. triphos and then treated with benzophenone at low temperature (e.g., −20° C.), followed by Urea formation between compounds of formula (XLIX) and formula (L) by adding an amine of formula (L). It is prepared according to Scheme 17 using the synthesis reaction. [ka]

[0129] Finally, amines of formula (L) can be converted to protected pyrrolidines (LI) according to Scheme 18. II), where PG is -Boc or -CBz (benzyloxycarbonyl). Protective groups such as dimethyl sulfide (Cu(I) bromide complex) are used. The addition of a Grignard reagent in a solvent such as ether or THF yields the epoxide opens stereoselectively to give the racemic material (LII) (relative stereochemistry shown) This material can be deprotected to give a racemic mixture of the trans isomers of compound (L). Alternatively, the individual tetramers of compound (L) can be isolated by chiral separation prior to deprotection. Compound (LII) can be obtained by the addition of a reagent such as 4-nitrobenzoic acid. can undergo a Mitsunobu inversion reaction using This material (LI) can be deprotected to give the racemic cis isomer of compound (L). Alternatively, compound (L) can be obtained by chiral separation prior to deprotection. ) are obtained. Thus, all enantiomers of (L) are obtained. route, and also specific enantiomers can be obtained non-racemic, chirally pure. Since it is produced starting from the compound (LIII), chiral compounds are produced at an early stage of the synthesis. It will be appreciated by those skilled in the art that this may also result in rule splitting. [ka]

[0130] Specific preparations of intermediates and examples using the general methods described above are provided in the experimental section. This is described in detail in

[0131] In a further embodiment, the compound of formula (III) [ka] or a salt thereof, wherein R6 is selected from H and F; R 7 is H , F, Cl, —CH3, —OCH3 and —OCH2CH3.

[0132] In another embodiment, the compound of formula (IIIa) [ka] or a salt thereof, wherein R 6 is selected from H and F; R 7 is H , F, Cl, —CH3, —OCH3 and —OCH2CH3.

[0133] In another embodiment, the compound of formula (XXIa) [ka] or a salt thereof, wherein R 6 is selected from H and F; R 7 is H , F, Cl, —CH3, —OCH3 and —OCH2CH3.

[0134] In another embodiment, the compound of formula (IX) [ka] or a salt thereof, wherein R 1 , R 1a , R 2 and R 2a is represented by formula (I) is as defined for

[0135] In a further embodiment, 3-(2,4-dioxotetrahydropyrimidin-1(2H)-yl)-4-methoxy Benzoic acid: [ka] Pentafluorophenyl 3-(2,4-dioxotetrahydropyrimidine-1(2H) -yl)-4-methoxybenzoate: [ka] 1-(2-Methoxy-5-(3,9-diazaspiro[5.5]undecane-3-carbo (1H,3H)-dihydropyrimidine-2,4(1H,3H)-dione: [ka] N-(5-fluoro-2-methyl-3-(4,4,5,5-tetramethyl-1,3,2 -dioxaborolan-2-yl)phenyl)-3-hydroxy-4-isobutylpyrrolidine N-(cis-rac)-N-(5-fluoro-2-methyl- 3-(4,4,5,5-tetramethyl-1,3,2-dioxaborolan-2-yl)phenyl (tra)-3-hydroxy-4-isobutylpyrrolidine-1-carboxamide or (tra ns-rac)-N-(5-fluoro-2-methyl-3-(4,4,5,5-tetramethyl) (1,3,2-dioxaborolan-2-yl)phenyl)-3-hydroxy-4-isopropyl Butylpyrrolidine-1-carboxamide: [ka] (3R,4S)-N-(5-fluoro-2-methyl-3-(4,4,5,5-tetramethyl) (1,3,2-dioxaborolan-2-yl)phenyl)-3-hydroxy-4-isothiazolinone Isobutylpyrrolidine-1-carboxamide: [ka] (3S,4R)-N-(5-fluoro-2-methyl-3-(4,4,5,5-tetramethyl)- (1,3,2-dioxaborolan-2-yl)phenyl)-3-hydroxy-4-isothiazolinone Isobutylpyrrolidine-1-carboxamide: [ka] and (3R,4R)-N-(5-fluoro-2-methyl-3-(4,4,5,5-tetramethyl) (1,3,2-dioxaborolan-2-yl)phenyl)-3-hydroxy-4-isothiazolinone Isobutylpyrrolidine-1-carboxamide: [ka] or a salt thereof.

[0136] The compounds of these embodiments are useful in the preparation of compounds of the invention.

[0137] The present invention further includes any variation of this process, wherein any stage thereof an intermediate available in is used as a starting material and the remaining steps are carried out, or Alternatively, the starting materials may be formed in situ under the reaction conditions, or the reaction components may be formed in situ. The compounds and intermediates of the present invention are used in the form of a salt or an optically pure material. can be prepared according to methods commonly known to those skilled in the art, for example by reduction of the resulting compound, By oxidation and / or other functionalization and / or any protecting groups optionally present or by cleavage of the linker moiety and recovery of the compound so available. can be converted into

[0138] In another aspect, the present invention provides a compound of the present invention or a pharmaceutically acceptable salt thereof and a pharmaceutical The present invention provides a pharmaceutical composition comprising a physiologically acceptable carrier.

[0139] In another aspect, the present invention provides a therapeutically effective amount of a compound of the present invention or a pharmaceutically acceptable salt thereof. and a pharmaceutically acceptable carrier.

[0140] In a further embodiment, the composition comprises at least two pharmaceutically acceptable carriers: Pharmaceutical compositions may be administered by a particular route, e.g., oral, including those described herein. administration, parenteral administration (e.g., by injection, infusion, transdermal administration, or topical administration) and rectal administration The topical administration may also involve inhalation or intranasal application. The pharmaceutical compositions may be in solid form (including but not limited to capsules, tablets, pills, granules, powders or suppositories) or in liquid form (including but not limited to solutions, suspensions or emulsions). Tablets can be manufactured by methods known in the art. Thus, it may be film coated or enteric coated.

[0141] Typically, the pharmaceutical composition is a tablet or gel containing the active ingredient together with one or more of the following: It is a latin capsule. a) diluents, such as lactose, dextrose, sucrose, mannitol, sorbitol, Thor, cellulose and / or glycine; b) lubricants, such as silica, talc, stearic acid, its magnesium or calcium Calcium salts and / or polyethylene glycol; and for tablets, c) binders, such as magnesium aluminum silicate, starch paste, gelatin cellulose, tragacanth gum, methylcellulose, sodium carboxymethylcellulose and and / or polyvinylpyrrolidone; optionally d) disintegrating agents, such as starch, agar, alginic acid or its sodium salt, or boiling water. Sexual mixture; and e) Absorbents, colorants, flavorings and sweeteners.

[0142] The compounds of formula (I) or formula (Ia) or pharmaceutically acceptable salts thereof are valuable pharmacological agents. and / or other properties, such as modulation of BTK activity by acting as a BTK degrader. This can be achieved, for example, by using BTK or the BTK C481S mutant fusion protein described herein. By using engineered cell lines overexpressing the fusion protein as a fluorescent readout, This can be determined in vitro in cells and in cell lines that express endogenous BTK. The pharmacological usefulness of the compounds of the present invention can be demonstrated in patients with tumors such as TMD8 tumors. Compounds of the present invention are administered to animals, such as mice, to determine whether or not there is any significant difference in tumor tissue as a result of administration of the compound. This can be determined in vivo by measuring the reduction of BTK and the reduction in tumor volume in the Therefore, the compounds of formula (I) or formula (Ia) can be used to treat diseases mediated by BTK. These compounds may be useful in treating diseases such as

[0143] The compounds of formula (I) or formula (Ia) are useful for the study of diseases mediated by BTK. For example, they may be useful as tool compounds.

[0144] The compounds of the present invention, in free form or in the form of a pharmaceutically acceptable salt, are useful in treating cancer, e.g. The present invention may be useful for the prevention or treatment of cancers selected from tumor cancers and hematopoietic cancers.

[0145] Examples of solid tumor cancers include central nervous system cancer, brain cancer, breast cancer, head and neck cancer, lung cancer; esophageal cancer and Gastric junction cancer, stomach cancer, colorectal cancer, rectal cancer, anal cancer, hepatobiliary cancer, pancreatic cancer, non-melanoma skin cancer, melanoma Chromosomes, kidney cancer, prostate cancer, bladder cancer, uterine cancer, cervical cancer, ovarian cancer, bone cancer, neuroendocrine system cancer, These include mesothelioma cancer, testicular cancer, thymoma and thymic carcinoma, and thyroid cancer.

[0146] Examples of hematopoietic cancers include B-cell neoplasms (including rare B-cell malignancies) and Hodgkin's lymphoma. , non-Hodgkin's lymphoma, post-transplant lymphoproliferative disorder, hairy cell leukemia, histiocytic neoplasms and Dendritic neoplasms include:

[0147] Examples of B-cell neoplasms include chronic lymphocytic leukemia (CLL), mantle cell lymphoma (MCL), and CL), small lymphocytic lymphoma (SLL), Waldenstrom's macroglobulinemia, Diffuse large B-cell lymphoma (DLBCL), follicular lymphoma, Burkitt lymphoma lymphoma, marginal zone lymphoma, immunoblastic large cell lymphoma, Richter's syndrome, precursor B lymphoblasts lymphoma, primary and secondary multiple myeloma, B-cell prolymphocytic leukemia, Lymphoplasmacytic lymphoma, splenic marginal zone lymphoma, plasma cell myeloma, plasmacytoma, extranodal Marginal zone B-cell lymphoma, nodal marginal zone B-cell lymphoma, mediastinal (thymic) large B-cell lymphoma lymphoma, intravascular large B-cell lymphoma, primary effusion lymphoma, lymphoma granulomatosis, and Acute lymphoblastic leukemia is one of the most common types of leukemia.

[0148] In certain embodiments, the cancer is chronic lymphocytic leukemia (CLL), diffuse large cell type B DLBCL, mantle cell lymphoma (MCL), small lymphocytic lymphoma (SLL) and Waldenstrom's macroglobulinemia.

[0149] In a further embodiment, the cancer is chronic lymphocytic leukemia (CLL).

[0150] In another embodiment, the cancer is diffuse large B-cell lymphoma (DLBCL). do.

[0151] The compounds of the present invention are useful in treating cancers (e.g., CLL, DLBCL, MCL, SLL, and Waldenstrom syndrome). for the treatment of subjects with acquired resistance to ibrutinib (Ibrutinib macroglobulinemia) In the present invention, for example, a mutation of cysteine-481 to serine (i.e., mutation C It may be of particular use in cancers where resistance has been induced by 481S). For example, patients may have already been treated or continue to be treated with ibrutinib, Subjects had a reduced or no longer responded to treatment with ibrutinib. Therefore, the compounds of the present invention are effective in treating cancers that are resistant to ibrutinib, especially cancers that are resistant to ibrutinib. Niacin-resistant CLL, DLBCL, MCL, SLL, and Waldenstrom's macroglobulinemia It may be beneficially used in the treatment of CLL, particularly ibrutinib-resistant CLL.

[0152] In another embodiment, the compounds of the present invention are In the field of autoimmune disorders, inflammatory disorders, allergic diseases, anaphylaxis, allergies, For example, the compounds of the present invention may be useful in the prevention or treatment of chronic asthma and airway diseases, as well as in transplantation. The compound, in free form or in the form of a pharmaceutically acceptable salt, is effective in treating asthma; chronic obstructive pulmonary disease (COPD); COPD); transplant rejection; abnormalities in antibody production, antigen presentation, cytokine production, or lymphoid organogenesis Common or unwanted diseases; rheumatoid arthritis; systemic onset juvenile idiopathic arthritis (S OJIA); Gout; Pemphigus; Idiopathic thrombocytopenic purpura; Systemic lupus erythematosus; Multiple sclerosis myasthenia gravis; Sjogren's syndrome; autoimmune hemolytic anemia; antineutrophil cytoplasmic antibodies (ANCA)-associated vasculitis; cryoglobulinemia; thrombotic thrombocytopenic purpura; chronic autoimmune disease Urticaria; Allergies (atopic dermatitis, contact dermatitis, allergic rhinitis); Athero Atherosclerosis; Type 1 diabetes; Type 2 diabetes; Inflammatory bowel disease; Ulcerative colitis; Crohn's disease ;Pancreatitis;Glomerulonephritis;Goodpasture's syndrome;Hashimoto's disease;Graves' disease;Antibody-mediated transplant rejection Anti-Malignant Graft-versus-Host Disease (AMR); Graft-versus-Host Disease (GvHD); Chronic Graft-versus-Host Disease (cGvHD); B-cell Cell-mediated hyperacute; acute-chronic transplant rejection; thromboembolic disorders; myocardial infarction; angina; stroke; ischemic pulmonary embolism; polycythemia vera; essential thrombocythemia; and myelofibrosis due to myeloid metaplasia It may be useful for prevention or treatment.

[0153] In another embodiment, the compounds of the present invention are In this context, it may be useful for the prevention or treatment of immunoglobulin light chain amyloidosis (AL).

[0154] In a further aspect, the present invention provides a compound of the present invention or a pharmaceutically acceptable salt thereof for use in the treatment of In one embodiment, the present invention provides a compound of the present invention or a pharmaceutical composition thereof for use in the treatment of and (iii) providing a physiologically acceptable salt thereof for use in the prevention or treatment of a disease mediated by BTK. In another embodiment, the present invention provides a compound of the present invention or a pharmaceutically acceptable salt thereof. In a further embodiment, the cancer is hematopoietic. In a further embodiment, the hematopoietic cancer is chronic lymphocytic leukemia (CLL), Diffuse large B-cell lymphoma (DLBCL), mantle cell lymphoma (MCL), small Lymphocytic lymphoma (SLL) and Waldenström's macroglobulinemia, especially CLL or DLBCL.

[0155] In one embodiment, the compound is (3R,4R)-N-(3-(6-(4-(2-(9 -(3-(2,4-dioxotetrahydropyrimidin-1(2H)-yl)-4-methoxy (Dibenzoyl)-3,9-diazaspiro[5.5]undecan-3-yl)ethyl)phenyl (7H-pyrrolo[2,3-d]pyrimidin-4-yl)-5-fluoro-2-methyl (phenyl)-3-hydroxy-4-isobutylpyrrolidine-1-carboxamide or is a pharmaceutically acceptable salt of

[0156] In one embodiment, the compound is (3R,4S)-N-(3-(6-(4-((1-( (1-(3-(2,4-dioxotetrahydropyrimidin-1(2H)-yl)-4-methyl) (trimethyl)piperidin-4-yl)oxy) (phenyl)-7H-pyrrolo[2,3-d]pyrimidin-4-yl)-5-fluoro-2-methyl (ethylphenyl)-3-hydroxy-4-isobutylpyrrolidine-1-carboxamide or and pharmaceutically acceptable salts thereof.

[0157] In one embodiment, the compound is (3R,4S)—N—(3-(6-(4-(2-(4 -((1-(3-(2,4-dioxotetrahydropyrimidin-1(2H)-yl)-4 -Methoxybenzoyl)piperidin-4-yl)oxy)piperidin-1-yl)ethyl )phenyl)-7H-pyrrolo[2,3-d]pyrimidin-4-yl)-5-fluoro-2 (-methylphenyl)-3-hydroxy-4-isobutylpyrrolidine-1-carboxamide or a pharmaceutically acceptable salt thereof.

[0158] In one embodiment, the compound is (3R,4S)-N-(3-(6-(4-(2-(9 -(3-(2,4-dioxotetrahydropyrimidin-1(2H)-yl)-4-methoxy (Dibenzoyl)-3,9-diazaspiro[5.5]undecan-3-yl)ethyl)phenyl (7H-pyrrolo[2,3-d]pyrimidin-4-yl)-5-fluoro-2-methyl (phenyl)-3-hydroxy-4-isobutylpyrrolidine-1-carboxamide or is a pharmaceutically acceptable salt of

[0159] In one embodiment, the compound is (3R,4S)-N-(3-(6-(4-(2-(9 -(3-(2,4-dioxotetrahydropyrimidin-1(2H)-yl)-4-methoxy (Dibenzoyl)-3,9-diazaspiro[5.5]undecan-3-yl)ethyl)phenyl (7H-pyrrolo[2,3-d]pyrimidin-4-yl)-6-fluoro-2-methyl (phenyl)-3-hydroxy-4-isobutylpyrrolidine-1-carboxamide or is a pharmaceutically acceptable salt of

[0160] In one embodiment, the compound is (cis-rac)-N-(3-(6-(4-(2- (9-(3-(2,4-dioxotetrahydropyrimidin-1(2H)-yl)-4-methyl ... (trimethylbenzoyl)-3,9-diazaspiro[5.5]undecan-3-yl)ethyl Phenyl)-7H-pyrrolo[2,3-d]pyrimidin-4-yl)-5-fluoro-2- Methylphenyl)-3-hydroxy-4-isobutylpyrrolidine-1-carboxamide or is a pharmaceutically acceptable salt thereof.

[0161] In one embodiment, the compound is (3R,4S)-N-(3-(6-(4-((1-( 2-((1-(3-(2,4-dioxotetrahydropyrimidin-1(2H)-yl)- 4-Methoxybenzoyl)piperidin-4-yl)oxy)ethyl)piperidin-4-yl (phenyl)oxy)phenyl)-7H-pyrrolo[2,3-d]pyrimidin-4-yl)-5-phenyl (fluoro-2-methylphenyl)-3-hydroxy-4-isobutylpyrrolidine-1-chlor Voxamide or a pharmaceutically acceptable salt thereof.

[0162] In a further aspect, the present invention provides a compound of the invention or a pharmaceutical formulation thereof for use in therapy. In one embodiment, the present invention provides a method for treating BTK-mediated leukemia. The present invention provides a compound of the present invention or a pharmaceutically acceptable salt thereof for use in the prevention or treatment of a disease. In one embodiment, the present invention provides a compound of the present invention for use in the prevention or treatment of cancer. In a further embodiment, the cancer is a hematopoietic In a further embodiment, the hematopoietic cancer is chronic lymphocytic leukemia (CLL), diffuse large bowel disease (LVHD), or leukemia. malignant large B-cell lymphoma (DLBCL), mantle cell lymphoma (MCL), small lymphoma (SMLL) Lymphoid lymphoma (SLL) and Waldenström's macroglobulinemia, especially C LL or DLBCL.

[0163] In one embodiment, the compound is (3R,4R)-N-(3-(6-(4-(2-(9 -(3-(2,4-dioxotetrahydropyrimidin-1(2H)-yl)-4-methoxy (Dibenzoyl)-3,9-diazaspiro[5.5]undecan-3-yl)ethyl)phenyl (7H-pyrrolo[2,3-d]pyrimidin-4-yl)-5-fluoro-2-methyl (phenyl)-3-hydroxy-4-isobutylpyrrolidine-1-carboxamide or is a pharmaceutically acceptable salt of

[0164] In one embodiment, the compound is (3R,4S)-N-(3-(6-(4-((1-( (1-(3-(2,4-dioxotetrahydropyrimidin-1(2H)-yl)-4-methyl) (trimethyl)piperidin-4-yl)oxy) (phenyl)-7H-pyrrolo[2,3-d]pyrimidin-4-yl)-5-fluoro-2-methyl (ethylphenyl)-3-hydroxy-4-isobutylpyrrolidine-1-carboxamide or and pharmaceutically acceptable salts thereof.

[0165] In one embodiment, the compound is (3R,4S)—N—(3-(6-(4-(2-(4 -((1-(3-(2,4-dioxotetrahydropyrimidin-1(2H)-yl)-4 -Methoxybenzoyl)piperidin-4-yl)oxy)piperidin-1-yl)ethyl )phenyl)-7H-pyrrolo[2,3-d]pyrimidin-4-yl)-5-fluoro-2 (-methylphenyl)-3-hydroxy-4-isobutylpyrrolidine-1-carboxamide or a pharmaceutically acceptable salt thereof.

[0166] In one embodiment, the compound is (3R,4S)-N-(3-(6-(4-(2-(9 -(3-(2,4-dioxotetrahydropyrimidin-1(2H)-yl)-4-methoxy (Dibenzoyl)-3,9-diazaspiro[5.5]undecan-3-yl)ethyl)phenyl (7H-pyrrolo[2,3-d]pyrimidin-4-yl)-5-fluoro-2-methyl (phenyl)-3-hydroxy-4-isobutylpyrrolidine-1-carboxamide or is a pharmaceutically acceptable salt of

[0167] In one embodiment, the compound is (3R,4S)-N-(3-(6-(4-(2-(9 -(3-(2,4-dioxotetrahydropyrimidin-1(2H)-yl)-4-methoxy (Dibenzoyl)-3,9-diazaspiro[5.5]undecan-3-yl)ethyl)phenyl (7H-pyrrolo[2,3-d]pyrimidin-4-yl)-6-fluoro-2-methyl (phenyl)-3-hydroxy-4-isobutylpyrrolidine-1-carboxamide or is a pharmaceutically acceptable salt of

[0168] In one embodiment, the compound is (cis-rac)-N-(3-(6-(4-(2- (9-(3-(2,4-dioxotetrahydropyrimidin-1(2H)-yl)-4-methyl ... (trimethylbenzoyl)-3,9-diazaspiro[5.5]undecan-3-yl)ethyl Phenyl)-7H-pyrrolo[2,3-d]pyrimidin-4-yl)-5-fluoro-2- Methylphenyl)-3-hydroxy-4-isobutylpyrrolidine-1-carboxamide or is a pharmaceutically acceptable salt thereof.

[0169] In one embodiment, the compound is (3R,4S)-N-(3-(6-(4-((1-( 2-((1-(3-(2,4-dioxotetrahydropyrimidin-1(2H)-yl)- 4-Methoxybenzoyl)piperidin-4-yl)oxy)ethyl)piperidin-4-yl (phenyl)oxy)phenyl)-7H-pyrrolo[2,3-d]pyrimidin-4-yl)-5-phenyl (fluoro-2-methylphenyl)-3-hydroxy-4-isobutylpyrrolidine-1-chlor Voxamide or a pharmaceutically acceptable salt thereof.

[0170] In a further aspect, the present invention is a method for treating a disease mediated by BTK. and administering a therapeutically acceptable amount of this compound to a patient in need of treatment for a BTK-mediated disease. The present invention provides a method for treating a rheumatoid arthritis, comprising administering a compound of the invention or a pharmaceutically acceptable salt thereof. In an embodiment, the present invention provides a method of treating cancer, comprising administering to a patient in need of cancer treatment The method includes administering a therapeutically acceptable amount of a compound of the present invention or a pharmaceutically acceptable salt thereof. In a further embodiment, the cancer is a hematopoietic cancer. In this study, hematopoietic cancers included chronic lymphocytic leukemia (CLL), diffuse large B-cell lymphoma (DLBCL), and leukemia-associated lymphoma (LEM). DLBCL, mantle cell lymphoma (MCL), small lymphocytic lymphoma (SLL), and and Waldenström's macroglobulinemia, especially CLL or DLBCL.

[0171] In one embodiment, the compound is (3R,4R)-N-(3-(6-(4-(2-(9 -(3-(2,4-dioxotetrahydropyrimidin-1(2H)-yl)-4-methoxy (Dibenzoyl)-3,9-diazaspiro[5.5]undecan-3-yl)ethyl)phenyl (7H-pyrrolo[2,3-d]pyrimidin-4-yl)-5-fluoro-2-methyl (phenyl)-3-hydroxy-4-isobutylpyrrolidine-1-carboxamide or is a pharmaceutically acceptable salt of

[0172] In one embodiment, the compound is (3R,4S)-N-(3-(6-(4-((1-( (1-(3-(2,4-dioxotetrahydropyrimidin-1(2H)-yl)-4-methyl) (trimethyl)piperidin-4-yl)oxy) (phenyl)-7H-pyrrolo[2,3-d]pyrimidin-4-yl)-5-fluoro-2-methyl (ethylphenyl)-3-hydroxy-4-isobutylpyrrolidine-1-carboxamide or and pharmaceutically acceptable salts thereof.

[0173] In one embodiment, the compound is (3R,4S)—N—(3-(6-(4-(2-(4 -((1-(3-(2,4-dioxotetrahydropyrimidin-1(2H)-yl)-4 -Methoxybenzoyl)piperidin-4-yl)oxy)piperidin-1-yl)ethyl )phenyl)-7H-pyrrolo[2,3-d]pyrimidin-4-yl)-5-fluoro-2 (-methylphenyl)-3-hydroxy-4-isobutylpyrrolidine-1-carboxamide or a pharmaceutically acceptable salt thereof.

[0174] In one embodiment, the compound is (3R,4S)-N-(3-(6-(4-(2-(9 -(3-(2,4-dioxotetrahydropyrimidin-1(2H)-yl)-4-methoxy (Dibenzoyl)-3,9-diazaspiro[5.5]undecan-3-yl)ethyl)phenyl (7H-pyrrolo[2,3-d]pyrimidin-4-yl)-5-fluoro-2-methyl (phenyl)-3-hydroxy-4-isobutylpyrrolidine-1-carboxamide or is a pharmaceutically acceptable salt of

[0175] In one embodiment, the compound is (3R,4S)-N-(3-(6-(4-(2-(9 -(3-(2,4-dioxotetrahydropyrimidin-1(2H)-yl)-4-methoxy (Dibenzoyl)-3,9-diazaspiro[5.5]undecan-3-yl)ethyl)phenyl (7H-pyrrolo[2,3-d]pyrimidin-4-yl)-6-fluoro-2-methyl (phenyl)-3-hydroxy-4-isobutylpyrrolidine-1-carboxamide or is a pharmaceutically acceptable salt of

[0176] In one embodiment, the compound is (cis-rac)-N-(3-(6-(4-(2- (9-(3-(2,4-dioxotetrahydropyrimidin-1(2H)-yl)-4-methyl ... (trimethylbenzoyl)-3,9-diazaspiro[5.5]undecan-3-yl)ethyl Phenyl)-7H-pyrrolo[2,3-d]pyrimidin-4-yl)-5-fluoro-2- Methylphenyl)-3-hydroxy-4-isobutylpyrrolidine-1-carboxamide or is a pharmaceutically acceptable salt thereof.

[0177] In one embodiment, the compound is (3R,4S)-N-(3-(6-(4-((1-( 2-((1-(3-(2,4-dioxotetrahydropyrimidin-1(2H)-yl)- 4-Methoxybenzoyl)piperidin-4-yl)oxy)ethyl)piperidin-4-yl (phenyl)oxy)phenyl)-7H-pyrrolo[2,3-d]pyrimidin-4-yl)-5-phenyl (fluoro-2-methylphenyl)-3-hydroxy-4-isobutylpyrrolidine-1-chlor Voxamide or a pharmaceutically acceptable salt thereof.

[0178] In a further aspect, the present invention provides a pharmaceutical composition of the compounds of the present invention or pharmaceutically acceptable salts thereof. In one embodiment, the present invention provides a compound of the present invention or a compound of the present invention for use in the manufacture of a medicament. and a pharmaceutical composition comprising a pharmaceutically acceptable salt thereof for use in the prevention or treatment of a disease mediated by BTK. In one embodiment, the present invention provides a compound of the present invention or a compound of the present invention for use in the manufacture of a medicament. and the use of a pharmaceutically acceptable salt thereof for the manufacture of a medicament for the prevention or treatment of cancer. In a further embodiment, the cancer is a hematopoietic cancer. Organ cancers include chronic lymphocytic leukemia (CLL), diffuse large B-cell lymphoma (DLBC), L), mantle cell lymphoma (MCL), small lymphocytic lymphoma (SLL) and Waldenstrom's lymphoma and Ström's macroglobulinemia, especially CLL or DLBCL.

[0179] In one embodiment, the compound is (3R,4R)-N-(3-(6-(4-(2-(9 -(3-(2,4-dioxotetrahydropyrimidin-1(2H)-yl)-4-methoxy (Dibenzoyl)-3,9-diazaspiro[5.5]undecan-3-yl)ethyl)phenyl (7H-pyrrolo[2,3-d]pyrimidin-4-yl)-5-fluoro-2-methyl (phenyl)-3-hydroxy-4-isobutylpyrrolidine-1-carboxamide or is a pharmaceutically acceptable salt of

[0180] In one embodiment, the compound is (3R,4S)-N-(3-(6-(4-((1-( (1-(3-(2,4-dioxotetrahydropyrimidin-1(2H)-yl)-4-methyl) (trimethyl)piperidin-4-yl)oxy) (phenyl)-7H-pyrrolo[2,3-d]pyrimidin-4-yl)-5-fluoro-2-methyl (ethylphenyl)-3-hydroxy-4-isobutylpyrrolidine-1-carboxamide or and pharmaceutically acceptable salts thereof.

[0181] In one embodiment, the compound is (3R,4S)—N—(3-(6-(4-(2-(4 -((1-(3-(2,4-dioxotetrahydropyrimidin-1(2H)-yl)-4 -Methoxybenzoyl)piperidin-4-yl)oxy)piperidin-1-yl)ethyl )phenyl)-7H-pyrrolo[2,3-d]pyrimidin-4-yl)-5-fluoro-2 (-methylphenyl)-3-hydroxy-4-isobutylpyrrolidine-1-carboxamide or a pharmaceutically acceptable salt thereof.

[0182] In one embodiment, the compound is (3R,4S)-N-(3-(6-(4-(2-(9 -(3-(2,4-dioxotetrahydropyrimidin-1(2H)-yl)-4-methoxy (Dibenzoyl)-3,9-diazaspiro[5.5]undecan-3-yl)ethyl)phenyl (7H-pyrrolo[2,3-d]pyrimidin-4-yl)-5-fluoro-2-methyl (phenyl)-3-hydroxy-4-isobutylpyrrolidine-1-carboxamide or is a pharmaceutically acceptable salt of

[0183] In one embodiment, the compound is (3R,4S)-N-(3-(6-(4-(2-(9 -(3-(2,4-dioxotetrahydropyrimidin-1(2H)-yl)-4-methoxy (Dibenzoyl)-3,9-diazaspiro[5.5]undecan-3-yl)ethyl)phenyl (7H-pyrrolo[2,3-d]pyrimidin-4-yl)-6-fluoro-2-methyl (phenyl)-3-hydroxy-4-isobutylpyrrolidine-1-carboxamide or is a pharmaceutically acceptable salt of

[0184] In one embodiment, the compound is (cis-rac)-N-(3-(6-(4-(2- (9-(3-(2,4-dioxotetrahydropyrimidin-1(2H)-yl)-4-methyl ... (trimethylbenzoyl)-3,9-diazaspiro[5.5]undecan-3-yl)ethyl Phenyl)-7H-pyrrolo[2,3-d]pyrimidin-4-yl)-5-fluoro-2- Methylphenyl)-3-hydroxy-4-isobutylpyrrolidine-1-carboxamide or is a pharmaceutically acceptable salt thereof.

[0185] In one embodiment, the compound is (3R,4S)-N-(3-(6-(4-((1-( 2-((1-(3-(2,4-dioxotetrahydropyrimidin-1(2H)-yl)- 4-Methoxybenzoyl)piperidin-4-yl)oxy)ethyl)piperidin-4-yl (phenyl)oxy)phenyl)-7H-pyrrolo[2,3-d]pyrimidin-4-yl)-5-phenyl (fluoro-2-methylphenyl)-3-hydroxy-4-isobutylpyrrolidine-1-chlor Voxamide or a pharmaceutically acceptable salt thereof.

[0186] The pharmaceutical composition or combination of the present invention is administered in an amount of about 1 to 1,000 ml for a subject weighing about 50 to 70 kg. g of active ingredient or about 1 to 500 mg, about 1 to 250 mg, about 1 to 150 mg, about 0.5 to The unit dosage may be 100 mg or about 1 to 50 mg of the active ingredient. The therapeutically effective dosage of the composition or combination thereof depends on the species, weight, age and individual condition of the subject, It depends on the disorder or disease to be treated and its severity. If you are a physician, clinician, or veterinarian, you may be required to: The effective amount of each of the active ingredients can be readily determined.

[0187] The dosage characteristics cited above are for mammals, e.g., mice, rats, dogs, monkeys, or isolated animals. Demonstrated in vitro and in vivo tests using the selected organs, tissues and preparations thereof. The compounds of the present invention can be used in vitro and in the form of solutions, for example aqueous solutions. For example, it may be administered in vivo enterally, parenterally, preferably intravenously, as a suspension or in aqueous solution. The in vitro dosage is about 10 -6 Molar ~ 10 -10 The concentration may range from molar to molar. The therapeutically effective in vivo amount is about 0.1 to 500 mg / kg or about 1 mg / kg, depending on the route of administration. It can range up to 100 mg / kg.

[0188] The compounds of the present invention may be administered simultaneously with, before, or after one or more other therapeutic agents. The compounds of the present invention may be administered separately by the same or different routes of administration, or may be administered in combination with other The therapeutic agents may be administered together in the same pharmaceutical composition, for example, in combination with the compounds of the present invention. Compounds that are therapeutically active or enhance therapeutic activity when administered in combination to a patient The antibody may be a substance, a peptide, an antibody, an antibody fragment, or a nucleic acid.

[0189] In one embodiment, the present invention provides a method for administering a compound of the present invention and at least one other therapeutic agent to a patient in need thereof, comprising administering to the patient: The present invention provides a product containing the compounds as a combined preparation for simultaneous, separate or sequential therapeutic use. In one embodiment, the therapy is treatment of a disease or condition mediated by BTK. In another embodiment, the therapy is the treatment of a cancer described herein. The compounds of the present invention and other therapeutic agents may be combined in the same pharmaceutical composition as a product provided as a combined preparation. The compounds of the present invention and other compounds may be used in a composition together in a product or in separate forms, such as in the form of a kit. Therapeutic agents include:

[0190] In one embodiment, the present invention provides a pharmaceutical composition comprising a compound of the present invention and another therapeutic agent. In another embodiment, the present invention provides a therapeutically effective amount of a compound of the present invention and another Pharmaceutical compositions containing the therapeutic agents are provided.

[0191] Optionally, the pharmaceutical composition includes a pharmaceutically acceptable carrier, as described above. obtain.

[0192] In one embodiment, the present invention provides two or more pharmaceutical compositions, at least one of which contains a compound of the present invention. In one embodiment, the kit comprises separate pharmaceutical compositions of Means for keeping things separate, such as containers, separate bottles or separate foil packets Examples of such kits include a package of tablets, capsules, etc. There are blister packs used for packaging.

[0193] The kit of the present invention may be used to administer separate compositions at different dosage intervals or to administer separate compositions. For administering various dosage forms, e.g., oral and parenteral, to titrate one against another. To aid compliance, the kits of the invention typically include instructions for administration. Includes instructions.

[0194] In the combination therapy of the present invention, the compound of the present invention and the other therapeutic agent may be from the same manufacturer or from different manufacturers. Additionally, the compounds of the present invention and other therapeutic agents may be manufactured and / or formulated by manufacturers of the same. The drug may be (i) administered prior to the release of the combination product to a physician (e.g., a compound of the present invention and (ii) by the physician (or a physician) immediately prior to administration; (iii) e.g., during sequential administration of a compound of the invention and another therapeutic agent; It may be combined with combination therapy in the patient himself.

[0195] Thus, the present invention provides another method for treating a disease or condition mediated by BTK. The use of therapeutic agents is also provided, where other therapeutic agents are administered in conjunction with the compounds of the invention.

[0196] The present invention also provides a method for treating a BTK-mediated disease or condition. The present invention provides a compound of the present invention for use in treating atopic dermatitis, wherein the compound of the present invention is administered in combination with another therapeutic agent.

[0197] The present invention also provides a method for treating a BTK-mediated disease or condition. The present invention provides another therapeutic agent for the treatment of rheumatoid arthritis, wherein the other therapeutic agent is administered together with the compound of the present invention.

[0198] The present invention also provides a method for treating a disease or condition mediated by BTK using a compound of the present invention. and the patient has not previously (e.g., within 24 hours) been treated with another therapeutic agent. are.

[0199] The present invention also provides another therapeutic agent for treating a disease or condition mediated by BTK. and wherein the patient has previously (e.g., within 24 hours) been treated with a compound of the invention. are.

[0200] The present invention also provides the use of another therapeutic agent to treat cancer, the other therapeutic agent being a compound of the present invention. It is administered with the compound of interest.

[0201] The present invention also provides a compound of the present invention for use in a method of treating cancer, The compound is administered in conjunction with another therapeutic agent.

[0202] The present invention also provides other therapeutic agents for use in methods of treating cancer, is administered with a compound of the present invention.

[0203] The present invention also provides the use of a compound of the present invention to treat cancer, wherein the patient is receiving another treatment. have been previously treated (e.g., within 24 hours) with a therapeutic agent.

[0204] The present invention also provides the use of another therapeutic agent for treating cancer, wherein a patient is administered a compound of the present invention. have been previously treated (e.g., within 24 hours) with the compound.

[0205] In one embodiment, the other therapeutic agent is selected from: Apoptosis modulators, anti-CD20 antibodies, anti-CD22 antibodies, PI3K inhibitors, Tyrosine kinase inhibitors, immune checkpoint agents, CART therapeutic agents, immunomodulators , bispecific antibodies targeting CD20 and CD3, antibody-drug conjugates (ADCs), Loteasome inhibitor, epigenetic modifier, anti-CD38 mAb, anti SLAMF7 agents, XPO1 inhibitors as well as other agents such as chemotherapeutic agents.

[0206] In one embodiment, the apoptosis modulator is a Bcl2 inhibitor (e.g., amputees, obatoclax, venetoclax (Venclexta®) ), ethyl-2-amino-6-cyclopentyl-4-(1-cyano-2-ethoxy-2- Oxoethyl)-4H-chromone-3-carboxylate (HA14-1), Obrimel Genasense (G3139, Genasense®), Bak BH3 peptide, (- )-Gossypol (AT-101, BL-193), Navitoclax (ABT-26 3)), Mcl1 inhibitors (e.g., AMG176, S63845, AZD5991, MIK665) and MDM2 / p53 inhibitors (e.g., NVP-HDM201, NV P-CGM-097, ALRN-6924, idasanutlin, AMG232 and DS-3 032B).

[0207] In one embodiment, the anti-CD20 antibody is rituximab, obinutuzumab, ofatum The antibody is selected from the group consisting of umab, ocrelizumab and ublituximab.

[0208] In one embodiment, the anti-CD22 antibody is inotuzumab, epratuzumab, bectuzumab, The treatment is selected from the group consisting of rivaroxaban and moxetumomab.

[0209] In one embodiment, the PI3K inhibitor is duvelisib, umbralisib tosylar , INCB050465, apilimod mesylate (LAM-002), copanlisibhi Dolochloride (Aliqopa®), tenalisib, pictilisib (GDC 0 941), sonolisib (PX866), pilaralisib (SAR 245408 or XL 147), alpelisib (BYL719), and leniolisib (CDZ173). can be.

[0210] In one embodiment, the tyrosine kinase inhibitor is a BTK inhibitor, e.g., Eve Rutinib, acalabrutinib, zanubrutinib (BGB-3111), tirabrutinib ( ONO-4059), ARQ531, CC-292(AVL-292), CT-1530 , DTRMWXHS-12, GDC-0853, M7583 and becabrutinib (SNS -062), SYK inhibitors, such as entospletinib (GS9973), fosta Matinib and HMPL-523, SYK / JAK inhibitor cerduratinib (PRT0 62070), SYK / FLT inhibitors, e.g., TAK-659, FLT3 inhibitors FF-10101, FLT3 / BTK inhibitor (CG806), JAK inhibitor Vitabiotropin (e.g., itacitinib, INCB052793, BMS911543, fedracitinib) Nib, WP-1066, NS-018, and ruxolitinib (Jakavi®) etc.), erlotinib hydrochloride (Tarceva®), linifanib (A BT869), sunitinib malate (Sutent®), bosutinib (bos ulif®), dasatinib (Sprycel®), pazopanib (V otrient®), sorafenib (Nexavar®), Zac tima (ZD6474), imatinib or imatinib mesylate (Gilvec trademark) and Gleevec®) and tozasertib (VX680 or MK045 7) is selected.

[0211] In one embodiment, the immune checkpoint agent is an anti-PD-1 agent and an anti-PD-L1 The drugs are pembrolizumab, nivolumab, tislelizumab, atezolizumab, and ipilimumab. , cemiplimab, TLR4 agonist, CCR4 mAb mogamulizumab and CD47 mAb fusion protein (TTI-621).

[0212] In one embodiment, the CART therapy includes CD19, BCMA CART, CD20, C D79b, CD22, and CD30.

[0213] In one embodiment, the immunomodulator is lenalidomide (Revlimid®). )), thalidomide (Thalomid®), avadomide (CC-122) and and pomalidomide (Actimid®, Imnovid®, Poma lyst®).

[0214] In one embodiment, the bispecific antibody targeting CD20 and CD3 is REGN-197 9, XmAb-13676, BTCT-4465-A, CD20-TCB and 8RG-6 026 is selected.

[0215] In one embodiment, the ADC is the CD79 ADC polatuzumab vedotin, the CD30 ADC brentuximab vedotin, CD25 ADC camidanlumab tesirin and CD1 9 ADC loncastuximab tesirine.

[0216] In one embodiment, the proteasome inhibitor is bortezomib (Velcade Registered trademark), carfilzomib (Kyprolis®), marizomib (NP I-0052, ixazomib citrate (MLN-9708, Ninlaro (registered trademark) (target), delanzomib (CEP-18770) and oprozomib (ONX-0912) are selected.

[0217] In one embodiment, epigenetic modifiers, such as HDAC methylation inhibitors, Inhibitors and DNA methylation inhibitors include vorinostat (Zolinza® )), romidepsin (Istodax®), azacitidine (Mylosar® Registered Trademark), Vidaza®), Pyroxamide, Spiruchostatin A, Mirupu Selected from loin (valproic acid), entinostat and guadecitabine.

[0218] In one embodiment, the anti-CD38 mAb is selected from daratumumab and isatuximab. It is selected.

[0219] In one embodiment, the anti-SLAMF7 agent is elotuzumab.

[0220] In one embodiment, the XPO1 inhibitor is selected from the group consisting of selinexor and ertanexor. be selected.

[0221] In one embodiment, other drugs that can be combined with the compounds of the present invention, such as general chemical The chemotherapy agents include anastrozole (Arimidex®), bendamustine (T Reanda®), bicalutamide (Casodex®), bleoma isin sulfate (Blenoxane®), busulfan (Mylera n®), busulfan injection (Busulfex®), capecitabine (Xeloda®), N4-pentoxycarbonyl-5-deoxy-5-fluoro Orocitidine, carboplatin (Paraplatin®), carmustine ( BiCNU®), chlorambucil (Leukeran®), cisplatin Platinol®, Cladribine (Leustatin®), cyclophosphamide (Cytoxan® or Neosar®) )), cytarabine, cytosine arabinoside (Cytosar-U®), cytarabine vin liposome injection (DepoCyt®), dacarbazine (DTIC-Dom e®), dactinomycin (Actinomycin D, Cosmegan), Dow Norubicin hydrochloride (Cerubidine®), daunorubicin citrate Lateliposome injection (DaunoXome®), dexamethasone, docetaxel Cell (Taxotere®), doxorubicin hydrochloride (Adriam ycin®, Rubex®), epirubicin (Ellence®), (Trademark), etoposide (Vepesid®), fludarabine phosphate ( Fludara®), 5-fluorouracil (Adrucil®, Efudex®), flutamide (Eulexin®), tezativir Gemcitabine (difluorodeoxycytidine), hydroxyurea (Hydrea Registered Trademark), Idarubicin (Idamycin®), Ifosfamide (IF EX (registered trademark), irinotecan (Camptosar (registered trademark), L-asparagus ginase (ELSPAR®), leucovorin calcium, melphalan (Al keran®), 6-mercaptopurine (Purinethol®), ), methotrexate (Folex®), mitoxantrone (Novantr one®), Mylotarg, paclitaxel (Taxol®), n ab-paclitaxel (Abraxane®), Phoenix (yttrium 90 / MX-DTPA), pentostatin, and carmustine implants Losan 20 (Gliadel®), tamoxifen citrate (Nolvad ex (registered trademark), teniposide (Vumon (registered trademark)), 6-thioguanine, thio Tepa, tirapazamine (Tirazone®), injectable topotecan hydrochloride (Hycamptin®), vinblastine (Velban®) , vincristine (Oncovin®), vinorelbine (Navelbine (R), ROR mAb cirumutuzumab, dual PI3K / HDAC inhibitor (CUDC-907), Bet inhibitor (INCB357643), ALK inhibitor (crizotinib), EZH1 / 2 inhibitor (DS-3201b), MAPK inhibitor Aplidin, plitidepsin (eEF1A2 inhibitor), Wnt inhibitor, Radiopharmaceuticals, idiotype vaccines, pegfilgrastim (Neulasta and cytoplurikine (IRX-2).

[0222] In further embodiments, the other therapeutic agent is selected from: Venetoclax, oblimersen, navitoclax, MIK665, NVP-HD M201, rituximab, obinutuzumab, ofatumumab, ocrelizumab, ublitz Ximab, inotuzumab, epratuzumab, bectumomab, moxetumomab, Dubec Lisib, umbralisib tosylate, INCB050465, leniolisib (CDZ17 3), Apilimod mesylate (LAM-002), Copanlisib hydrochloride, Tenali Sib, pictilisib, alpelisib, ibrutinib, acalabrutinib, zanubrutinib (BGB-3111), tirabrutinib (ONO-4059), ARQ531, CC-2 92 (AVL-292), CT-1530, DTRMWXHS-12, GDC-0853 , M7583, becabrutinib (SNS-062), entospletinib (GS9973 ), fostamatinib, HMPL-523, celdulatinib (PRT062070), (TAK-659), FF-10101, FLT3 / BTK inhibitor (CG806), Itacitinib, INCB052793, BMS911543, fedratinib, WP-1 066, NS-018, ruxolitinib (Jakavi®), pembrolizumab bu, nivolumab, tislelizumab, atezolizumab, ipilimumab, cemiplimab, TL R4 agonist, CCR4 mAb mogamulizumab, CD47 mAb fusion protein ( TTI-621), CD19, BCMA CART, CD20, CD79b, CD22, CD30, lenalidomide, thalidomide, avadomide, pomalidomide, XmAb-13 676, CD79 ADC polatuzumab vedotin, CD30 ADC brentuximab vedotin Dotin, CD25 ADC Kamidan, lumabtesirin, CD19 ADC Loncastuximab Butecillin, carfilzomib, bortezomib, ixazomib, marizomib, oprozomib azacitidine, romidepsin, vorinostat, guadecitabine, daratumumab, ibuprofen Satuximab, elotuzumab, selinexor, ertanexor, fludarabine, calm cyclophosphamide, chlorambucil, bendamustine, melphalan, cladoxamic acid, Livin, dacarbazine, pentostatin, vincristine, etoposide, epirubicin, Doxorubicin, anthracyclines and antifolates.

[0223] In a further embodiment, the other therapeutic agent is selected from the group consisting of a Bcl2 inhibitor and a BTK inhibitor. are selected.

[0224] In a further embodiment, the other therapeutic agent is venetoclax, ibrutinib, and acaroxaban. brutinib.

[0225] Specific individual combinations that may provide particular treatment benefits include compounds selected from the following: nothing: (3R,4R)-N-(3-(6-(4-(2-(9-(3-(2,4-dioxotetate (1(2H)-yl)-4-methoxybenzoyl)-3,9-diaza spiro[5.5]undecan-3-yl)ethyl)phenyl)-7H-pyrrolo[2,3- d]pyrimidin-4-yl)-5-fluoro-2-methylphenyl)-3-hydroxy- 4-isobutylpyrrolidine-1-carboxamide, (3R,4S)-N-(3-(6-(4-((1-((1-(3-(2,4-dioxo Tetrahydropyrimidin-1(2H)-yl)-4-methoxybenzoyl)piperidine- 4-yl)methyl)piperidin-4-yl)oxy)phenyl)-7H-pyrrolo[2,3 -d]pyrimidin-4-yl)-5-fluoro-2-methylphenyl)-3-hydroxy -4-isobutylpyrrolidine-1-carboxamide, (3R,4S)-N-(3-(6-(4-(2-(4-((1-(3-(2,4-diodeio 1(2H)-1-(4-methoxybenzoyl)-1(2H)-pyrimidin-1(2H)-yl phenyl-4-yl)oxy)piperidin-1-yl)ethyl)phenyl)-7H-pyrrolo[2 ,3-d]pyrimidin-4-yl)-5-fluoro-2-methylphenyl)-3-hydro oxy-4-isobutylpyrrolidine-1-carboxamide, (3R,4S)-N-(3-(6-(4-(2-(9-(3-(2,4-dioxotetate (1(2H)-yl)-4-methoxybenzoyl)-3,9-diaza spiro[5.5]undecan-3-yl)ethyl)phenyl)-7H-pyrrolo[2,3- d]pyrimidin-4-yl)-5-fluoro-2-methylphenyl)-3-hydroxy- 4-isobutylpyrrolidine-1-carboxamide, (3R,4S)-N-(3-(6-(4-(2-(9-(3-(2,4-dioxotetate (1(2H)-yl)-4-methoxybenzoyl)-3,9-diaza spiro[5.5]undecan-3-yl)ethyl)phenyl)-7H-pyrrolo[2,3- d]pyrimidin-4-yl)-6-fluoro-2-methylphenyl)-3-hydroxy- 4-isobutylpyrrolidine-1-carboxamide, (cis-rac)-N-(3-(6-(4-(2-(9-(3-(2,4-dioxo Tetrahydropyrimidin-1(2H)-yl)-4-methoxybenzoyl)-3,9-di azaspiro[5.5]undecan-3-yl)ethyl)phenyl)-7H-pyrrolo[2, 3-d]pyrimidin-4-yl)-5-fluoro-2-methylphenyl)-3-hydroxy cis-4-isobutylpyrrolidine-1-carboxamide, and (3R,4S)-N-(3-(6-(4-((1-(2-((1-(3-(2,4-di Oxotetrahydropyrimidin-1(2H)-yl)-4-methoxybenzoyl)piperidin Piperidin-4-yl)oxy)ethyl)piperidin-4-yl)oxy)phenyl)-7H- Pyrrolo[2,3-d]pyrimidin-4-yl)-5-fluoro-2-methylphenyl)- 3-hydroxy-4-isobutylpyrrolidine-1-carboxamide, or its pharmaceutically acceptable salts (in combination with venetoclax);

[0226] Specific individual additional combinations that may provide particular treatment benefits include compounds selected from the following: Including: (3R,4R)-N-(3-(6-(4-(2-(9-(3-(2,4-dioxotetate (1(2H)-yl)-4-methoxybenzoyl)-3,9-diaza spiro[5.5]undecan-3-yl)ethyl)phenyl)-7H-pyrrolo[2,3- d]pyrimidin-4-yl)-5-fluoro-2-methylphenyl)-3-hydroxy- 4-isobutylpyrrolidine-1-carboxamide, (3R,4S)-N-(3-(6-(4-((1-((1-(3-(2,4-dioxo Tetrahydropyrimidin-1(2H)-yl)-4-methoxybenzoyl)piperidine- 4-yl)methyl)piperidin-4-yl)oxy)phenyl)-7H-pyrrolo[2,3 -d]pyrimidin-4-yl)-5-fluoro-2-methylphenyl)-3-hydroxy -4-isobutylpyrrolidine-1-carboxamide, (3R,4S)-N-(3-(6-(4-(2-(4-((1-(3-(2,4-diodeio 1(2H)-1-(4-methoxybenzoyl)-1(2H)-pyrimidin-1(2H)-yl phenyl-4-yl)oxy)piperidin-1-yl)ethyl)phenyl)-7H-pyrrolo[2 ,3-d]pyrimidin-4-yl)-5-fluoro-2-methylphenyl)-3-hydro oxy-4-isobutylpyrrolidine-1-carboxamide, (3R,4S)-N-(3-(6-(4-(2-(9-(3-(2,4-dioxotetate (1(2H)-yl)-4-methoxybenzoyl)-3,9-diaza spiro[5.5]undecan-3-yl)ethyl)phenyl)-7H-pyrrolo[2,3- d]pyrimidin-4-yl)-5-fluoro-2-methylphenyl)-3-hydroxy- 4-isobutylpyrrolidine-1-carboxamide, (3R,4S)-N-(3-(6-(4-(2-(9-(3-(2,4-dioxotetate (1(2H)-yl)-4-methoxybenzoyl)-3,9-diaza spiro[5.5]undecan-3-yl)ethyl)phenyl)-7H-pyrrolo[2,3- d]pyrimidin-4-yl)-6-fluoro-2-methylphenyl)-3-hydroxy- 4-isobutylpyrrolidine-1-carboxamide, (cis-rac)-N-(3-(6-(4-(2-(9-(3-(2,4-dioxo Tetrahydropyrimidin-1(2H)-yl)-4-methoxybenzoyl)-3,9-di azaspiro[5.5]undecan-3-yl)ethyl)phenyl)-7H-pyrrolo[2, 3-d]pyrimidin-4-yl)-5-fluoro-2-methylphenyl)-3-hydroxy cis-4-isobutylpyrrolidine-1-carboxamide, and (3R,4S)-N-(3-(6-(4-((1-(2-((1-(3-(2,4-di Oxotetrahydropyrimidin-1(2H)-yl)-4-methoxybenzoyl)piperidin Piperidin-4-yl)oxy)ethyl)piperidin-4-yl)oxy)phenyl)-7H- Pyrrolo[2,3-d]pyrimidin-4-yl)-5-fluoro-2-methylphenyl)- 3-hydroxy-4-isobutylpyrrolidine-1-carboxamide, or and pharmaceutically acceptable salts thereof (in combination with ibrutinib).

[0227] Specific individual additional combinations that may provide particular treatment benefits include compounds selected from the following: Including: (3R,4R)-N-(3-(6-(4-(2-(9-(3-(2,4-dioxotetate (1(2H)-yl)-4-methoxybenzoyl)-3,9-diaza spiro[5.5]undecan-3-yl)ethyl)phenyl)-7H-pyrrolo[2,3- d]pyrimidin-4-yl)-5-fluoro-2-methylphenyl)-3-hydroxy- 4-isobutylpyrrolidine-1-carboxamide, (3R,4S)-N-(3-(6-(4-((1-((1-(3-(2,4-dioxo Tetrahydropyrimidin-1(2H)-yl)-4-methoxybenzoyl)piperidine- 4-yl)methyl)piperidin-4-yl)oxy)phenyl)-7H-pyrrolo[2,3 -d]pyrimidin-4-yl)-5-fluoro-2-methylphenyl)-3-hydroxy -4-isobutylpyrrolidine-1-carboxamide, (3R,4S)-N-(3-(6-(4-(2-(4-((1-(3-(2,4-diodeio 1(2H)-1-(4-methoxybenzoyl)-1(2H)-pyrimidin-1(2H)-yl phenyl-4-yl)oxy)piperidin-1-yl)ethyl)phenyl)-7H-pyrrolo[2 ,3-d]pyrimidin-4-yl)-5-fluoro-2-methylphenyl)-3-hydro oxy-4-isobutylpyrrolidine-1-carboxamide, (3R,4S)-N-(3-(6-(4-(2-(9-(3-(2,4-dioxotetate (1(2H)-yl)-4-methoxybenzoyl)-3,9-diaza spiro[5.5]undecan-3-yl)ethyl)phenyl)-7H-pyrrolo[2,3- d]pyrimidin-4-yl)-5-fluoro-2-methylphenyl)-3-hydroxy- 4-isobutylpyrrolidine-1-carboxamide, (3R,4S)-N-(3-(6-(4-(2-(9-(3-(2,4-dioxotetate (1(2H)-yl)-4-methoxybenzoyl)-3,9-diaza spiro[5.5]undecan-3-yl)ethyl)phenyl)-7H-pyrrolo[2,3- d]pyrimidin-4-yl)-6-fluoro-2-methylphenyl)-3-hydroxy- 4-isobutylpyrrolidine-1-carboxamide, (cis-rac)-N-(3-(6-(4-(2-(9-(3-(2,4-dioxo Tetrahydropyrimidin-1(2H)-yl)-4-methoxybenzoyl)-3,9-di azaspiro[5.5]undecan-3-yl)ethyl)phenyl)-7H-pyrrolo[2, 3-d]pyrimidin-4-yl)-5-fluoro-2-methylphenyl)-3-hydroxy cis-4-isobutylpyrrolidine-1-carboxamide, and (3R,4S)-N-(3-(6-(4-((1-(2-((1-(3-(2,4-di Oxotetrahydropyrimidin-1(2H)-yl)-4-methoxybenzoyl)piperidin Piperidin-4-yl)oxy)ethyl)piperidin-4-yl)oxy)phenyl)-7H- Pyrrolo[2,3-d]pyrimidin-4-yl)-5-fluoro-2-methylphenyl)- 3-hydroxy-4-isobutylpyrrolidine-1-carboxamide, or and pharmaceutically acceptable salts thereof (in combination with acalabrutinib).

[0228] These combinations include a compound of the invention or a pharmaceutically acceptable salt thereof and venetoclax. It may be provided as a pharmaceutical composition containing LAXX, ibrutinib or acalabrutinib.

[0229] Alternatively, these combinations may comprise the compound of the present invention or a pharmaceutically acceptable salt thereof as described above. Treatment with venetoclax, ibrutinib, or acalabrutinib, either simultaneously, separately, or sequentially The compounds may be provided as a combined preparation for therapeutic use.

[0230] In particular, these combinations with ibrutinib are effective in the treatment of hematopoietic cancers, particularly CLL and DLBCL. It may be particularly effective in the treatment of

[0231] The activity of the compounds of the present invention was evaluated by the following in vitro methods described herein. It is possible.

[0232] The compounds of the present invention can be prepared as described in the following examples. [Example]

[0233] The following examples are illustrative of the present invention and should not be construed as limiting thereof. Temperatures are given in degrees Celsius. Abbreviations used are conventional in the art. These are listed below.

[0234] Starting materials, building blocks, reagents, acids, bases, decomposition products, etc. utilized in synthesizing the compounds of the present invention The solutions, solvents and catalysts are all commercially available or can be prepared by organic synthesis methods known to those skilled in the art. Furthermore, the compounds of the present invention can be prepared by the following steps. They can be produced by organic synthesis methods known to those skilled in the art.

[0235] Abbreviation ACN ACN AcOH acetic acid aq. water-based BISPIN Bis(pinacolato)diboron BOC tertiary butyl carboxylate br Wide CHX Cyclohexane d doublet DCM dichloromethane dd Doublet of Doublets DEA Diethylamine DEAD Diethyl azodicarboxylate DIAD Diisopropyl azodicarboxylate DIPEA Diisopropylethylamine DMA N,N-dimethylacetamide DME 1,4-dimethoxyethane DMEM Dulbecco's Modified Eagle's Medium DMF N,N-dimethylformamide DMSO dimethyl sulfoxide Et2O diethyl ether EtOAc ethyl acetate EtOH ethanol FCS calf serum h time HATU 1-[bis(dimethylamino)methylene]-1H-1,2,3-triazolo[ 4,5-b]pyridinium 3-oxide hexafluorophosphate HBTU 2-(1H-benzotriazol-1-yl)-1,1,3,3-tetramethicone uronium hexafluorophosphate HPLC High Pressure Liquid Chromatography HV high vacuum KOAc Potassium Acetate LC-MS Liquid Chromatography and Mass Spectrometry m multiplet m / z mass-to-charge ratio MeOH Methanol min MS mass spectrometry MsCl methanesulfonyl chloride Ms2O methanesulfonic anhydride NaOAc Sodium Acetate NaPyr. Sodium pyruvate NEAA Non-Essential Amino Acids NMM N-methylmorpholine NMR nuclear magnetic resonance PBS Phosphate-buffered saline PdCl2(dppf) [1,1'-bis(diphenylphosphino)ferrocene]para Diium(II) dichloride PdCl2(dppf)-CH2Cl2[1,1'-bis(diphenylphosphino)f [Erocene]palladium(II) dichloride-dichloromethane adduct PdCl2(PPh3)2 Bis(triphenylphosphine)palladium(II) dichloride Lido PG protecting group PPh3 Triphenylphosphine ppm (parts per million) rac racemic RM reaction mixture Rt retention time RT room temperature s singlet sat. saturation SFC Supercritical Fluid Chromatography t triplet TBME tert-butyl methyl ether TEA Triethylamine TFA trifluoroacetic acid THF tetrahydrofuran

[0236] Analysis method General conditions: NMR: Bruker AVAN with ICON-NMR under TopSpin program control CE 400MHz, 500MHz or 600MHz NMR spectrometer, NM R spectra were recorded. Spectra were measured at 298 K unless otherwise stated. , and referenced to known solvent resonances.

[0237] LC-MS: LC-electrospray, chemical and mass spectra using electron impact ionization methods. MS, SFC-MS or GC-MS systems were acquired from a wide range of instruments in the following configurations: Waters Ac using a photodiode array detector and a single quadrupole mass detector A quity UPLC / SQD system or G 6110 series mass spectrometer equipped Gilent 1200 system. [M+H] + is the protonated molecular ion of the species. This refers to the

[0238] Waters Acquity UPLC / SQD System: Method A Column: Waters Acquity HSS T3 1.8μm 2.1×50mm or 2.1 x 100 mm Column temperature: 60°C Eluent A: Water + 0.05% formic acid + 3.75 mM ammonium acetate, B: ACN + 0.0 4% formic acid Flow rate 1.0ml / min Gradient: 5% to 98% B in 1.4 minutes

[0239] Method B Column: Waters Acquity HSS T3 1.8μm 2.1×50mm or 2.1 x 100 mm Column temperature: 60°C Eluent A: Water + 0.05% formic acid + 3.75 mM ammonium acetate, B: ACN + 0.0 4% formic acid Flow rate 0.8ml / min Gradient: 5% to 98% B in 9.4 minutes

[0240] Method C Column: Waters Acquity HSS T3 1.8μm 2.1×50mm or 2.1 x 100 mm Column temperature: 50°C Eluent A: Water + 0.05% formic acid + 3.75 mM ammonium acetate, B: ACN + 0.0 4% formic acid Flow rate 1.2ml / min Gradient: 2% to 98% B in 1.4 minutes

[0241] Method D Column: Waters Acquity HSS T3 1.8μm 2.1×50mm or 2.1 x 100 mm Column temperature: 50°C Eluent A: Water + 0.05% formic acid + 3.75 mM ammonium acetate, B: ACN + 0.0 4% formic acid Flow rate 1.2ml / min Gradient: 1% to 98% B in 1.4 minutes

[0242] Agilent 1200 System: Method E Column: XBridge C18, 4.6 x 50 mm, 3.5 μm Column temperature: 50°C Eluent A: Water (10 mM ammonium bicarbonate), B: ACN Flow rate 1.8ml / min Gradient: 5% to 95% B in 1.5 min, 95% B for 1.5 min, return to 5% B within 0.01 min

[0243] Method F Column: SunFire C18, 3 x 30 mm, 2.5 μm Column temperature: 50°C Eluent A: water, B: ACN, both containing 0.01% TFA Flow rate 1.5ml / min Gradient: 5% to 95% B in 1.5 minutes

[0244] Method G Column: SunFire C18, 4.6 x 50 mm, 3.5 μm Column temperature: 50°C Eluent A: water, B: ACN, both containing 0.01% TFA Flow rate 2.0ml / min Gradient: 5% to 95% B in 1.4 min

[0245] Method H Column: SunFire C18, 4.6 x 50 mm, 3.5 μm Column temperature: 50°C Eluent A: water, B: ACN, both containing 0.01% TFA Flow rate 2.0ml / min Gradient: 5% to 95% B in 1.2 min, 95% B for 1.3 min, return to 5% B within 0.01 min

[0246] Method I Column: XBridge C18, 4.6 x 50 mm, 3.5 μm Column temperature: 40°C Eluent A: Water (10 mM ammonium bicarbonate), B: ACN Flow rate 1.8ml / min Gradient: 5% to 95% B in 1.4 min, 95% B in 1.6 min, return to 5% B within 0.01 min

[0247] Method J Column: Phenomenex, 3.0 x 30 mm, 5 μm Column temperature: 50°C Eluent A: Water (10 mM ammonium bicarbonate), B: ACN Flow rate 1.5ml / min Gradient: 5% to 95% B in 1.5 min, 95% B in 0.7 min

[0248] Method K Column: XBridge C18, 4.6 x 50 mm, 3.5 μm Column temperature: 40°C Eluent A: Water (10 mM ammonium bicarbonate), B: ACN Flow rate 2.0ml / min Gradient: 5% to 95% B in 1.5 minutes

[0249] Chiral analytical HPLC: Chiral analytical HPLC data were analyzed by Shimadz photodiode array detection. Purified by LC-20A analytical HPLC.

[0250] Method L Column: ChiralCel OJ, 5 μm, 250 × 4.6 mm Column temperature: 25°C Eluent: Hexane / EtOH (+0.05% DEA) 90:10 Flow rate 1.0ml / min UV detection 220nm (DAD detector)

[0251] Chiral analysis SFC: Chiral analytical SFC data were collected using a Waters A photodiode array detector. Generated by the cquity UPC2 system.

[0252] Method M Column Daicel Chiralpak AD-H, 5μm, 250×4.6mm Column temperature: 22°C Mobile phase CO2 / MeOH(80:20) Flow rate 3.0ml / min UV detection 210nm (DAD detector)

[0253] Preparative Chromatography: Normal and reversed phase flash chromatography purification was performed using CombiFlash® The purification was performed on an Rf200 or Rf+ system. Alternatively, chromatographic purification on reversed phase was performed. Interchim Puriflash 4250 system or Biotage system The analysis was performed on a Waters 2998 photodiode with MeOH as a modifier. Waters spectrometry with a diode array detector or Waters MS single quadrupole detection Supercritical fluid chromatography (SFC) separation was performed using a preparative SFC-100-MS system. Typically, the back pressure was 120 bar and the flow was 100 g CO2 / min. The column temperature was 40°C. Reverse-phase HPLC purification was performed using a Waters 2998 Photocatalyst. W with either a diode array detector or Waters MS single quadrupole detection The analysis was performed on a HPLC preparative system.

[0254] Chiral Preparative Chromatography: Method 1 Equipment Sepiatec SFC100 System Back pressure 120 bar Column Chiralpak AD-H, 5μm, 250×30mm Column temperature: 40°C Mobile phase CO2 / MeOH(80:20) Flow rate 80ml / min UV detection 254nm (DAD detector)

[0255] Method 2 Equipment MG II preparative SFC Back pressure 120 bar Column: ChiralCel OJ, 5 μm, 250 × 30 mm Column temperature: 38°C Mobile phase CO2 / EtOH(85:15) Flow rate 60ml / min UV detection 220nm (DAD detector)

[0256] Solid Phase Extraction (SPE) Cartridges: For acid removal: PL-HCO3 MP SPE cartridges were purchased from Agilent Stratix It was purchased from osPhere (reference: PL-HCO3 MP resin, 1.8 mmol / g, 100A, 150~300μm, 500mg, 6ml).

[0257] For catch and release: SCX cartridges were purchased from Agilent (see :HF Mega DE-SCX, 2g, 12ml).

[0258] Synthesis of intermediates Intermediate 1a 3-(2,4-dioxotetrahydropyrimidin-1(2H)-yl)-4-methoxybenzoate Zozoic acid [ka] Step 1: 3-((2-carboxyethyl)amino)-4-methoxybenzoic acid 3-Amino-4-methoxybenzoic acid (5.0 g, 29.3 mmol) was dissolved in acrylic acid (8 The resulting beige suspension was The mixture was stirred up to 100°C. After 10 minutes, the stirring was stopped and the RM was left standing at 100°C for 3 hours. The crude RM was used directly in the next step without further workup or purification. LC-MS (Method A): Rt=0.56min,[M+H] + =240.2.

[0259] Step 2: 3-(2,4-dioxotetrahydropyrimidin-1(2H)-yl)-4-methylpyrimidin Toxobenzoic acid Crude RM3-((2-carboxyethyl)amino)-4-methoxybenzoic acid (7.01 g To the resulting solution (29.3 mmol) was added AcOH (33 ml). The suspension was heated to 100°C. Stirred for 10 min. Then urea (11.00 g, 183 mmol) was added, resulting in The resulting mixture was stirred overnight at 120° C. The resulting brown solution was then diluted with water (150 ml) and concentrated HCl (10 ml). After stirring, the result The resulting beige suspension was stored overnight in a refrigerator at 5°C and then filtered. The solid was washed with water and dried to give a brown solid. The brown solid was dissolved in 0.05M aq. H The filter cake was washed with TBME (3 x 25 ml) and diluted under reduced pressure. Drying at 40° C. gave 6.29 g of the title compound as a beige solid. LC-MS (Method A): Rt=0.48min, [M+H] + =265.2.

[0260] Intermediate 1b Pentafluorophenyl 3-(2,4-dioxotetrahydropyrimidine-1(2H)- (yl)-4-methoxybenzoate [ka] In a 250 ml round-bottom flask, add (3-(2,4)-dioxotetrahydropyrimidine-1( 2H)-yl)-4-methoxybenzoic acid (Intermediate 1a) (28 g, 106 mmol), Trifluorophenyl 2,2,2-trifluoroacetate (36 g, 127 mmol) and DMF (50 ml) were added. Next, DIPEA (76 ml, 424 mmol) was added to C., and the RM was stirred at RT for 2 h before being diluted with water (300 ml). The mixture was extracted with EtOAc (2 x 250 ml) and the combined organic layers were washed with brine. Washed (2 x 10 ml), dried over Na2SO4, filtered and concentrated. Purify the crude mixture by silica gel chromatography eluting with 10-30% EtOAc in ether. Purification gave 40 g of the title compound as a white solid. LC-MS (Method E): Rt=1.51min, [M+H] + =432.

[0261] Intermediate 1c 3-(2,4-dioxotetrahydropyrimidin-1(2H)-yl)-4-ethoxyammonium Zozoic acid [ka] 3-Amino-4-ethoxybenzoic acid (2.7 g, 14.90 mmol) was dissolved in acrylic acid ( 4.09 ml, 59.6 mmol), and the RM was stirred at 110°C for 1 h. Urea (5.37 g, 89 mmol) and AcOH (18 ml) were added to the RM. Stirred for 2 h at 0° C. The RM was quenched with water and added to a concentrated aq. solution of HCl (37% The mixture was acidified with HCl and extracted with EtOAc. The organic phases were combined and evaporated. Water was added. The mixture was filtered and the solid was washed with water and EtOAc to give the title compound as a solid (1.1 g ) was obtained. Method A: Rt=0.56min;[M+H] + =279.1.

[0262] Intermediate 2 4-chloro-6-iodo-7-(phenylsulfonyl)-7H-pyrrolo[2,3-d]piperidin Lymidin [ka] Step 1: 4-chloro-7-(phenylsulfonyl)-7H-pyrrolo[2,3-d]pyrimidin gin In a flame-dried flask under argon, 60% sodium hydride ( 1.563 g, 39.1 mmol) was added to DMF (60 ml) and the resulting mixture The mixture was cooled to 0°C. MF solution (20 ml) was added slowly over 10 minutes. The mixture was stirred for 10 minutes until the temperature reached 100°C. Then, benzenesulfonyl chloride (3.36 ml, 26.0 ml) was added. mol) was added and the reaction was stirred at RT for 1 h. Water was then added, resulting in The resulting precipitate was filtered and dried under reduced pressure to give 7.418 g of the title compound as a light gray solid. Got it as a body. LC-MS (Method C): Rt=1.01min, [M+H] + =294.1 / 296.0 .

[0263] Step 2: 4-chloro-6-iodo-7-(phenylsulfonyl)-7H-pyrrolo[2,3 -d]pyrimidine 4-chloro-7-(phenylsulfonyl)-7H-pyrrolidone under argon atmosphere at -78°C A stirred solution of 2,3-d-pyrimidine in dry THF (80 ml) was added to 1.5 M lithium in CHX. ammonium diisopropylamide mono-THF (5.22 ml, 7.83 mmol) in 15 min. After 1 h, a solution of iodine (1.987 g, 7.83 mmol) in THF (2 0 ml) was added dropwise over 15 min. The resulting solution was stirred for 3 h. (2 ml) was added and the mixture was allowed to warm to RT. The mixture was diluted with DCM and the orange organic layer The residue was washed with brine (2x), dried over Na2SO4, and evaporated to dryness. The resulting orange-brown solid was triturated with ACN to give 1.513 g of the title compound as a base. Obtained as a beige solid. LC-MS (Method C): Rt=1.12min, [M+H]+ =419.9 / 421.9 .

[0264] Intermediate 3a 4-(4-chloro-7H-pyrrolo[2,3-d]pyrimidin-6-yl)benzaldehyde Do [ka] Step 1: (4-(4-chloro-7H-pyrrolo[2,3-d]pyrimidin-6-yl)phenyl (Nil)methanol Ethyl 4-(4-chloro-7H-pyrrolo[2,3-d]pyrimidine-6- Suspension of 10.2g (33.8mmol) of benzoate in 100ml of brown THF solution (described in published U.S. Pat. No. 6,140,332, column 45, Example 30) (which can be prepared according to the procedure described in) in 1M THF solution (50 0.7 ml, 50.7 mmol) was slowly added at 0-5°C. During the addition, RM was After addition, the RM was stirred at 0° C. for 10 min and then warmed to RT. After stirring at RT for 3 h, the RM was dissolved in water (50 ml) and 15% aq. NaOH (50 The mixture was quenched with 1 ml of RM at 0°C (exothermic, gas evolution occurred). The mixture was filtered through a filter material (Trademark), washed with THF (250 ml), and the filtrate was concentrated under reduced pressure. Concentration gave 9.32 g of the title compound. LC-MS (Method A): Rt=0.78min,[M+H] + =260.1 / 262.1 .

[0265] Step 2: 4-(4-chloro-7H-pyrrolo[2,3-d]pyrimidin-6-yl)benz aldehyde (4-(4-chloro-7H-pyrrolo[2,3-d]pyrimidin-6-yl)phenyl) Methanol (Step 1) (9.32 g, 32.7 mmol) and manganese dioxide (28.4 g, 327 mmol) in THF (250 ml) was stirred overnight at RT. An additional batch of manganese dioxide (8.52 g, 98 mmol) was added to the RM and the mixture was brought to RT. The RM was filtered through Hyflo® (filter material) and The resulting filtrate was concentrated and diluted with THF to give Again, filtration through Hyflo® and concentration under reduced pressure gave 5.68 g of the title compound. I got something. LC-MS (Method A): Rt=0.88min,[M+H] + =258.1 / 260.1 .

[0266] Intermediate 3b 4-(4-chloro-7-(phenylsulfonyl)-7H-pyrrolo[2,3-d]pyrimidin (6-phenyl)benzaldehyde [ka] In a 2 L flask purged and maintained under an inert atmosphere, 4-chloro-6-iodo-7-( phenylsulfonyl)-7H-pyrrolo[2,3-d]pyrimidine (Intermediate 2) (54 g, 129mmol), 4-formylphenylboronic acid (19g, 129mmol), Na2 CO3 (40 g, 370 mmol) and PdCl2 (dppf) (9 g, 12.9 mmol) ACN (1200 ml) and water (300 ml) were added and the RM was stirred under N The mixture was stirred at 100° C. for 16 h. The RM was filtered and concentrated in vacuo. The crude mixture was Purification by silica gel chromatography eluting with 3-9% MeOH in CM gave 39 g of 4-(4-chloro-7-(phenylsulfonyl)-7H-pyrrolo[2,3-d]pyridyl (6-(amidin-6-yl)benzaldehyde was obtained as a yellow solid. LC-MS (Method I): Rt=1.99min, [M+H] + =398.

[0267] Intermediate 4 tert-Butyl 4-(2-oxoethoxy)piperidine-1-carboxylate [ka] Step 1: tert-butyl 4-(allyloxy)piperidine-1-carboxylate 60% sodium hydride (964 mg, 24.10 mmol) in mineral oil was dissolved in 1- Boc-4-hydroxypiperidine (1000 mg, 4.82 mmol) dissolved in anhydrous THF The resulting solution (45 ml) was added in small portions at room temperature under argon and stirring was continued for 30 min. Allyl bromide (0.500 ml, 5.78 mmol) was then added dropwise to the mixture to form RM. The mixture was stirred at RT for 40 h. Then, the RM was quenched with water. The mixture was extracted with EtOAc. Extraction, drying over Na2SO4, filtering and concentration gave the crude compound. Purification by silica gel flash chromatography eluting with ~20% EtOAc This gave 1130 mg of the title compound as a colorless liquid. LC-MS (Method A): Rt=1.13min, [M-tBu+H] + =186.1.

[0268] Step 2: tert-Butyl 4-(2-oxoethoxy)piperidine-1-carboxylate to tert-Butyl 4-(allyloxy)piperidine-1-carboxylate (1120 mg, 4.64 mmol) in anhydrous DCM (40 ml) was placed in a two-neck flask at -78°C. Ozone was bubbled into the RM for 70 minutes. The RM was then warmed to RT and PPh3 (polymer-bound) (5 g, 16.00 mmol) was added to destroy the ozonide. Stirred at RT for 30 min. Then it was filtered through Hyflo® and The filtrate was evaporated to dryness to give 1147 mg of the title compound as a colorless oil. . 1 H NMR(400MHz,DMSO-d6)δ 9.58(s,1H),4.21( s,2H),3.70-3.40(m,10H),3.01(s,6H),1.87-1 .66(m,6H),1.38(dd,J=2.6,1.2Hz,34H).

[0269] Intermediate 5 Tert-butyl 4-(4-chloro-7H-pyrrolo[2,3-d]pyrimidine-6 -yl)benzyl)piperazine-1-carboxylate [ka] 4-chloro-6-iodo-7H-pyrrolo[2,3-d]pyrimidine (3.60 g, 12 0.88 mmol), Cs2CO3 (10.5 g, 32.2 mmol) and 4-(4-t- Boc-piperazinomethyl)phenylboronic acid (4.95 g, 15.46 mmol) A 1:1 mixture of oxane and water (100 ml) was degassed with argon. ppf)-CH2Cl2 adduct (1.052 g, 1.288 mmol) was added to the RM. Stirred at 100° C. for 4 h. The RM was cooled to RT and then partitioned between EtOAc and water. The layers were separated and the precipitate contained in the organic layer was filtered to obtain 2.18 g of the title compound. The resulting filtrate was washed with brine and dried over MgSO4. Drying and concentration gave 4.65 g of crude product. The crude product was triturated in ACN / Et2O. Trituration, filtration and drying under reduced pressure gave 1.938 g more of the title compound as a beige Obtained as a solid. LC-MS (Method A): Rt=0.81min,[M+H] + =428.2 / 430.2 .

[0270] Intermediate 6 (trans-rac)-tert-butyl 3-hydroxy-4-isobutylpyrrolidine -1-carboxylate [ka] tert-Butyl 6-oxa-3-azabicyclo[3,1,0]hexane-3-carbohydrate Xylate (10 g, 52.9 mmol) and copper(I) bromide-dimethyl sulfide complex (1.5 g, 7.30 mmol) in THF (200 ml) Magnesium chloride (100 ml, 200 mmol) was added under argon at -30°C. The resulting dark solution was stirred at below -15 °C for 1 h. RM was then added dropwise. Quenching with 0% aq. NH4Cl turned the mixture blue. EtOAc was added and the mixture was Stirred at RT for 30 min. Then the layers were separated and the aq. layer was extracted with EtOAc. The combined organic layers were washed with brine, dried over MgSO4, and filtered. The mixture was filtered and concentrated under reduced pressure. Silica gel was eluted with 0-20% EtOAc in petroleum ether. Purification of the crude product by flash chromatography gave 11.82 g of the title compound. Obtained as a pale yellow oil. 1 H NMR (400 MHz, chloroform-d) δ 3.96 (q, J = 5.2 Hz, 1H),3.59(dd,J=11.2,6.3Hz,2H),3.19(dd,J=1 1.5,4.6Hz,1H),3.00(dd,J=10.9,6.0Hz,1H),2 .07(dp,J=12.3,5.8Hz,1H),1.91(s,1H),1.60( dt,J=13.2,6.6Hz,1H),1.43(d,J=12.6Hz,13H) ,1.31(ddd,J=13.5,8.3,5.3Hz,1H),1.13(ddd, J=13.7,9.4,5.9Hz,1H),0.90(dd,J=8.8,6.6Hz ,6H).

[0271] Intermediate 7 (3R,4S)-N-(5-fluoro-2-methyl-3-(4,4,5,5-tetramethyl) (1,3,2-dioxaborolan-2-yl)phenyl)-3-hydroxy-4-isopropyl Butylpyrrolidine-1-carboxamide [ka] Step 1: (trans-rac)-Benzyl 3-hydroxy-4-isobutylpyrrolidine -1-carboxylate Benzyl 6-oxa-3-azabicyclo[3.1.0]hexane-3-carbohydrate under N2 xylate (8.9 g, 40.6 mmol) and copper(I) bromide-dimethyl sulfide complex A suspension of the compound (0.835 g, 4.06 mmol) in THF (200 ml) was added to 2 M isothiazole in THF. Isobutylmagnesium chloride (79 ml, 158 mmol) was added dropwise over 20 minutes. The temperature remained below -15°C. The resulting dark solution was The mixture was stirred for 1 h. The RM was quenched with 10% aq. NH4Cl (exothermic), which turned blue. EtOAc and water were added and the mixture was stirred at RT for 30 min. The layers were separated. The aq. layer was extracted with EtOAc (2x). The combined organic layers were washed with water (2x) and bromine. Wash with water (1x), dry over Na2SO4, filter, and concentrate under reduced pressure. 10.62 g of crude product was obtained. Purification of the crude product by flash chromatography gave 5.67 g of material. Silica gel flash chromatography eluting with 0-30% MeOH (+10% NH4OH) in DCM Purification of the material by chromatography gave 3.911 g of the title compound. LC-MS (Method A): Rt=1.05min, [M+H] + =278.4.

[0272] Step 2: (3S,4R)-benzyl 3-hydroxy-4-isobutylpyrrolidine-1-carboxylate Carboxylate and (3R,4S)-benzyl 3-hydroxy-4-isobutylpyrrolidine Benzene-1-carboxylate (trans-rac)-benzyl 3-hydroxy- Chiral separation of 4-isobutylpyrrolidine-1-carboxylate yields individual enantiomers The product was obtained as a colorless oil; the first eluting peak (peak 1) contained 1.64 g of (3S,4R )-benzyl 3-hydroxy-4-isobutylpyrrolidine-1-carboxylate The second eluting peak (peak 2) was 1.65 g of (3R,4S)-benzyl 3-hydroxybenzoate. This gave 4-isobutyl-2-pyrrolidine-1-carboxylate. (3S,4R)-Benzyl 3-hydroxy-4-isobutylpyrrolidine-1-carboxy Rate: SFC (Method M): Rt=2.51min. LC-MS (Method A): Rt=1.06min, [M+H] + =278.2. (3R,4S)-Benzyl 3-hydroxy-4-isobutylpyrrolidine-1-carboxy Rate: SFC (Method M): Rt=3.75min. LC-MS (Method A): Rt=1.06min, [M+H] + =278.2.

[0273] Step 3: (3R,4S)-4-Isobutylpyrrolidin-3-ol The second eluting peak from step 2 was (3R,4S)-benzyl 3-hydroxy-4-isobutene. Dissolve ethyl pyrrolidine-1-carboxylate (1.65 g, 5.95 mmol) in MeOH The solution (20 ml) was treated with 10% palladium on carbon (0.4 g, 3.76 mmol) to give R The M was placed under 0.1 bar of hydrogen at 25-30°C. After 2 h, the RM was dissolved in Hyflo (registered trademark). The mixture was filtered through a filter material and washed with MeOH. The filtrate was concentrated and dried under vacuum. This gave a yellow oil. The oil was dissolved in DCM and washed with 4M HCl (2.2%) in dioxane. 31 ml, 8.92 mmol) was added to form the hydrochloride salt. 0 was added, the precipitate formed was filtered and dried under reduced pressure to give 840 mg of the title compound. The product was obtained as the HCl salt. 1H NMR(600MHz,DMSO-d6)δ ppm 0.88(dd,J=16 .69,6.60Hz,6H)1.13(ddd,J=13.66,8.99,6.33 Hz,1H)1.25(ddd,J=13.75,7.70,6.42Hz,1H)1. 54-1.63(m,1H)2.06-2.13(m,1H)2.81(dq,J=11 .14,5.70Hz,1H)2.86-2.97(m,1H)3.19-3.27(m ,1H)3.30-3.35(m,1H)3.97(q,J=3.85Hz,1H)5. 46(br s,1H)9.12-9.58(m,2H).

[0274] Step 4: (3R,4S)—N-(5-fluoro-2-methyl-3-(4,4,5,5-tetrafluoroethane) tetramethyl-1,3,2-dioxaborolan-2-yl)phenyl)-3-hydroxy- 4-Isobutylpyrrolidine-1-carboxamide 5-Fluoro-2-methyl-3-(4,4,5,5-tetramethyl-1,3,2-diol) (oxaborolan-2-yl)aniline (commercially available or as disclosed in International Publication No. It can be prepared according to the procedure of intermediate 5 in 2013 / 008095, page 37. (1 g, 3.98 mmol) and DIPEA (2.78 ml, 15.93 mmol) A solution of 20% phosgene in toluene (2.51 ml, 4.78 mmol) was added to a DCM solution (25 ml). l) was added slowly below 0°C. The resulting solution was stirred at 0°C for 30 minutes. Then, (3R,4S)-4-isobutylpyrrolidin-3-ol (Step 3) (0.78 7g, 4.38mmol) in DCM (25ml) at 0°C. The resulting mixture was stirred at 0° C. for 45 min. The RM was then concentrated and c / MeOH (9:1) and washed with water (3x) and brine (1x). The organic layer was dried over MgSO4 and concentrated to give 1.86 g of crude product. Silica gel flash chromatography eluting with 0-100% EtOAc (+5% EtOH) Purification of the crude product by chromatography gave 1.455 g of the title compound. LC-MS (Method A): Rt=1.18min, [M+H] + =421.4.

[0275] Intermediate 8 (3S,4R)-N-(5-fluoro-2-methyl-3-(4,4,5,5-tetramethyl) (1,3,2-dioxaborolan-2-yl)phenyl)-3-hydroxy-4-isopropyl Butylpyrrolidine-1-carboxamide [ka] See Step 1 and Step 2: Intermediate 7. Step 3: (3S,4R)-N-(5-fluoro-2-methyl-3-(4,4,5,5-tetrafluoroethane) tetramethyl-1,3,2-dioxaborolan-2-yl)phenyl)-3-hydroxy- 4-Isobutylpyrrolidine-1-carboxamide

[0276] 5-Fluoro-2-methyl-3-(4,4,5,5-tetramethyl-1,3,2-diol) (oxaborolan-2-yl)aniline (commercially available or as disclosed in International Publication No. It can be prepared according to the procedure of intermediate 5 in 2013 / 008095, page 37. (950 mg, 3.78 mmol) and DIPEA (2.64 ml, 15.13 mmol) A solution of 20% phosgene in toluene (2.389 ml, 4.5 4 mmol) was added slowly below 0° C. The resulting solution was stirred at 0° C. for 15 min. After stirring for 1 minute, (3S,4R)-4-isobutylpyrrolidin-3-ol (748 mg (4.16 mmol) in DCM (25 ml) at 0° C. The resulting mixture was stirred at 0° C. for 30 min. The RM was then concentrated and It was diluted with MeOH (9:1) and washed with water (3x) and brine (1x). The organic layer was dried over MgSO4 and concentrated to give 1.764 g of crude product. Silica gel flash chromatography eluting with 0-100% EtOAc (+5% EtOH) Purification of the crude product by filtration gave 1.38 g of the title compound as a white foam. LC-MS (Method A): Rt=1.18min, [M+H] + =421.4.

[0277] Intermediate 9 (cis-rac)-N-(5-fluoro-2-methyl-3-(4,4,5,5-tetrafluoroethane) Methyl-1,3,2-dioxaborolan-2-yl)phenyl)-3-hydroxy-4- Isobutylpyrrolidine-1-carboxamide [ka] Step 1: cis-rac-tert-butyl 3-isobutyl-4-((4-nitrobenzoyl) (yl)oxy)pyrrolidine-1-carboxylate (trans-rac)-tert-butyl 3-hydroxy-4-isobutylpyridine at 0°C Roridin-1-carboxylate (Intermediate 6) (11.82 g, 43.2 mmol), 4 -Nitrobenzoic acid (11 g, 65.2 mmol) and PPh3 (18 g, 65.2 mmol) l) in THF (250 ml) and add DIAD (13 ml, 65.5 mmol) under argon. The resulting orange solution was slowly heated to RT for another 3 h. The RM was quenched with water and the THF was partially evaporated. EtOAc was added and The mixture was extracted with EtOAc (3x). The combined organic layers were washed with 0.2M HCl and Washed with water, dried over MgSO4, filtered and evaporated under reduced pressure. Crude preparation by silica gel flash chromatography eluting with 0-15% EtOAc in water Purification of the material gave 16.43 g of the title compound as a pale yellow foam. LC-MS (Method A): Rt=1.41min, [M-tBu+H] + =337.2.

[0278] Step 2: (cis-rac)-tert-butyl 3-hydroxy-4-isobutylpyrrolidone Zin-1-carboxylate (cis-rac)-tert-butyl 3-isobutyl-4-((4-nitrobenzoyl) (( ... mol) in a 3:1 solution of MeOH / H2O (160 ml) with NaOH (3.35 g, 84 The RM was stirred at RT for 1.5 h. Then, 1 M aq The pH was adjusted to 6 with HCl. MeOH was partially evaporated, and then EtOAc was added. The mixture was then stirred at RT for 30 min. The mixture was extracted with EtOAc (3× ), dried over MgSO4, filtered, and concentrated under reduced pressure. The residue was triturated in DCM and filtered. Purification of the resulting yellow filtrate by gel flash chromatography gave The material obtained was then triturated in DCM and filtered. The resulting filtrate was concentrated. Concentration gave 10.602 g of the title compound as a yellow oil. 1 H NMR (400 MHz, chloroform-d) δ 4.26-4.15 (m, 1H) ,3.53(t,J=9.1Hz,1H),3.44(d,J=1.7Hz,2H),3 .03(t,J=10.7Hz,1H),2.86-2.21(m,1H),2.13( dqd,J=11.4,7.9,3.8Hz,1H),1.59(dp,J=13.3, 6.7Hz,1H),1.43(d,J=13.2Hz,24H),0.91(d,J= 6.6Hz, 7H).

[0279] Step 3: (cis-rac)-4-isobutylpyrrolidin-3-ol (cis-rac)-tert-butyl 3-hydroxy-4-isobutylpyrrolidine- 1-carboxylate (Step 2) (1.040 g, 4.06 mmol) and 4 M HCl A solution of in dioxane (10 ml) was stirred at RT overnight. The RM was concentrated and then diluted with DC Coevaporation with M and drying under reduced pressure gave 770 mg of the title compound as an off-white solid. Obtained as the HCl salt as a solid. 1 H NMR(400MHz,DMSO-d6)δ 9.27(s,2H),5.46- 5.17(m,1H),4.25-3.97(m,1H),3.26-3.11(m,3 H),3.04(d,J=12.1Hz,1H),2.72(t,J=11.3Hz,1 H),2.05(dt,J=7.3,3.8Hz,1H),1.55(dq,J=13. 2,6.6Hz,1H),1.38(dt,J=13.9,7.1Hz,1H),1.1 8(dt,J=13.9,7.2Hz,1H),0.86(d,J=6.3Hz,6H) .

[0280] Step 4: (cis-rac)-N-(5-fluoro-2-methyl-3-(4,4,5,5 -tetramethyl-1,3,2-dioxaborolan-2-yl)phenyl)-3-hydroxy 4-isobutylpyrrolidine-1-carboxamide 15% phosgene in toluene (1.3 ml, 1.821 mmol) was added to 5-fluoro-2- Methyl-3-(4,4,5,5-tetramethyl-1,3,2-dioxaborolane-2-yl) aniline (CAS 1227210-37-8) (commercially available or publicly available) In the pamphlet of International Publication No. 2013 / 008095, page 37, the procedure for intermediate 5 is (438 mg, 1.708 mmol) and DIPEA (0.5 ml RM was added dropwise to a dry DCM solution (10 ml) of RM (2.86 mmol) at 0°C. The mixture was stirred at 0° C. for 30 minutes. Then, (cis-rac)-4-isobutylpyrrolidine 1-3-ol (Step 3) (323 mg, 1.705 mmol) and DIPEA (0.5 m A solution of 1 ml of 1H 2 O (2.86 mmol) in dry DCM was added dropwise at 0°C. The resulting pale orange solution was stirred at 0° C. for 2 h. The mixture was diluted with DCM and sat. aq. The organic layer was washed with saturated aqueous NH4Cl and brine. The mixture was dried over Na2SO4 and evaporated. Elution was with 0-15% MeOH in DCM. Purification of the crude compound by silica gel flash chromatography gave 793 mg of the title compound. The compound was obtained. LC-MS (Method A): Rt=1.22min, [M+H] + =421.4.

[0281] Intermediate 10 (cis-rac)-N-(5-fluoro-3-(6-(4-formylphenyl)-7H -pyrrolo[2,3-d]pyrimidin-4-yl)-2-methylphenyl)-3-hydroxy 4-isobutylpyrrolidine-1-carboxamide [ka] 4-(4-chloro-7H-pyrrolo[2,3-d]pyrimidin-6-yl)benzaldehyde Hydride (Intermediate 3a) (375 mg, 1.323 mmol), K2CO3 (402 mg, 2 0.88mmol) and (cis-rac)-N-(5-fluoro-2-methyl-3-(4 ,4,5,5-tetramethyl-1,3,2-dioxaborolan-2-yl)phenyl)- 3-Hydroxy-4-isobutylpyrrolidine-1-carboxamide (Intermediate 9) (701 mg, 1.151 mmol) in a 1:1 mixture of dioxane and water (10 ml) was degassed with argon. Next, PdCl2(dppf)-CH2Cl2 adduct (94 mg, 0.115 m mol) was added and the RM was stirred at 100°C for 1 h. The RM was partitioned between EtOAc and water. The organic layer was washed with brine, dried over MgSO4, and concentrated under reduced pressure. The product was diluted in MeOH / diisopropyl ether cooled to 4°C and the suspension was filtered. The title compound was obtained as a yellow solid by filtration from 0 to 12.5% ​​Me in DCM. Purification of the filtrate by silica gel flash chromatography eluting with OH yielded an additional (311 mg) of the title compound was obtained. LC-MS (Method A): Rt=0.98min,[M+H] + =516.3.

[0282] Intermediate 11 (3R,4S)-N-(5-fluoro-2-methyl-3-(6-(4-piperazine-1 -ylmethyl)phenyl)-7H-pyrrolo[2,3-d]pyrimidin-4-yl)phenyl (I)-3-hydroxy-4-isobutylpyrrolidine-1-carboxamide [ka] Step 1: tert-Butyl 4-(4-(5-fluoro-3-((3R,4S)-3 -Hydroxy-4-isobutylpyrrolidine-1-carboxamido)-2-methylphenyl )-7H-pyrrolo[2,3-d]pyrimidin-6-yl)benzyl)piperazine-1-carboxylate Ruboxylate tert-Butyl 4-(4-(4-chloro-7H-pyrrolo[2,3-d]pyrimidine- 6-yl)benzyl)piperazine-1-carboxylate (Intermediate 5) (500 mg, 1 0.110 mmol), K2CO3 (384 mg, 2.78 mmol) and (3R,4S) -N-(5-fluoro-2-methyl-3-(4,4,5,5-tetramethyl-1,3,2 -dioxaborolan-2-yl)phenyl)-3-hydroxy-4-isobutylpyrrolidine Benzene-1-carboxamide (Intermediate 7) (500 mg, 1.13 mmol) in dioxane / A 1:1 mixture of water (10 ml) was degassed with argon. H2Cl2 adduct (91 mg, 0.111 mmol) was added and the RM was heated at 100 °C. Stirred for 2 h. The RM was cooled to RT and then partitioned between EtOAc and water. The layers were separated. The organic layer was washed with brine, dried over MgSO4, and concentrated under reduced pressure. Silica gel flushing eluted with 0-40% DCM / MeOH / NH3 (80:20:1) Purification of the crude product by chromatographic chromatography gave 514 mg of the title compound as an orange solid. Got it as a body. LC-MS (Method A): Rt=0.88min,[M+H] + =686.5.

[0283] Step 2: (3R,4S)-N-(5-fluoro-2-methyl-3-(6-(4-(piperazinyl)methyl)-2-methyl-4 ... (1-pyridin-1-ylmethyl)phenyl)-7H-pyrrolo[2,3-d]pyrimidin-4-yl )phenyl)-3-hydroxy-4-isobutylpyrrolidine-1-carboxamide tert-Butyl 4-(4-(4-(5-fluoro-3-((3R,4S)-3-hydro 4-Isobutylpyrrolidine-1-carboxamido)-2-methylphenyl)-7 H-Pyrrolo[2,3-d]pyrimidin-6-yl)benzyl)piperazine-1-carboxamide Silane (Step 1) (507 mg, 0.724 mmol) and 4 M HCl in dioxane (2 ml, 8.00 mmol) in brownish MeOH (2 ml) at RT. The RM was concentrated and dried under reduced pressure to give 509 mg of the title compound as the HCl salt. was obtained as. LC-MS (Method A): Rt=0.71min,[M+H] + =586.5.

[0284] Intermediate 12 (3R,4S)-N-(5-fluoro-2-methyl-3-(6-(4-(piperidine-4 -yloxy)phenyl)-7H-pyrrolo[2,3-d]pyrimidin-4-yl)phenyl (I)-3-hydroxy-4-isobutylpyrrolidine-1-carboxamide [ka] Step 1: tert-Butyl 4-(4-(4,4,5,5-tetramethyl-1,3,2-diphenyl ether) Oxaborolan-2-yl)phenoxy)piperidine-1-carboxylate 4-Hydroxyphenylboronic acid pinacol ester (1.030 g, 4.68 mmol), 1-Boc-4-hydroxypiperidine (1.057 g, 5.15 mmol) ) and PPh3 (1.35 g, 5.15 mmol) in THF (20 ml) (1 ml, 5.14 mmol) was added dropwise under argon. The resulting solution was allowed to cool to RT. The RM was partitioned between EtOAc and saturated aqueous NaHCO3 solution. The organic layer was separated, washed with brine, dried over MgSO4, and concentrated under reduced pressure. Silica gel flash chromatography eluting with 0-20% EtOAc in CHX was used. Purification of the crude product by HPLC gave 1.249 g of the title compound. LC-MS (Method A): Rt=1.48min, [M+H] + =404.2.

[0285] Step 2: tert-Butyl 4-(4-chloro-7H-pyrrolo[2,3-d]pyrimidinyl) Diphenyl-6-yl)phenoxy)piperidine-1-carboxylate 4-Chloro-6-iodo-7H-pyrrolo[2,3-d]pyrimidine (Synnovat or, Inc., CAS[876343-10-1])(855mg, 3.06mmol ), Cs2CO3 (2492 mg, 7.65 mmol) and tert-butyl 4-(4- (4,4,5,5-tetramethyl-1,3,2-dioxaborolan-2-yl)phenoxy (c) Piperidine-1-carboxylate (Step 1) (1234 mg, 3.06 mmol) A 1:1 mixture of dioxane and water (30 ml) was degassed with argon. f) -CH2Cl2 adduct (250 mg, 0.306 mmol) was added to adjust the RM to 100 The mixture was stirred at RT for 3 h at 20° C. The RM was cooled to RT and then diluted with EtOAc and saturated aqueous NaCl. The layers were separated and the organic layer was washed with brine and The mixture was dried over 200°C and concentrated under reduced pressure. Purification of the crude product by flash chromatography gave a brown residue. The residue was triturated with MeOH and the resulting suspension was filtered and washed with Et2O. After rinsing and drying under reduced pressure, 1.039 g of the title compound was obtained as a beige powder. . LC-MS (Method A): Rt=1.24min, [M+H] + =429.3 / 431.2 .

[0286] Step 3: tert-Butyl 4-(4-(5-fluoro-3-((3R,4S)-3 -Hydroxy-4-isobutylpyrrolidine-1-carboxamido)-2-methylphenyl )-7H-pyrrolo[2,3-d]pyrimidin-6-yl)phenoxy)piperidine-1- Carboxylate tert-Butyl 4-(4-(4-chloro-7H-pyrrolo[2,3-d]pyrimidine- 6-yl)phenoxy)piperidine-1-carboxylate (Step 2) (295 mg, 0 0.420 mmol), K2CO3 (145 mg, 1.049 mmol) and (3R,4S )-N-(5-fluoro-2-methyl-3-(4,4,5,5-tetramethyl-1,3, 2-Dioxaborolan-2-yl)phenyl)-3-hydroxy-4-isobutylpyrrolyl Dioxazine-1-carboxamide (Intermediate 7) (200 mg, 0.476 mmol) A 1:1 mixture of ethanol and water (4 ml) was degassed with argon. Cl2 adduct (34 mg, 0.042 mmol) was added and the RM was heated at 100 °C for 1 h. The RM was cooled to RT and then partitioned between EtOAc and water. The layers were separated and The organic layer was washed with brine, dried over MgSO4 and concentrated under reduced pressure. Purify the crude product by silica gel flash chromatography eluting with 0-38% MeOH in water. Purification of this product gave 303 mg of the title compound. LC-MS (Method A): Rt=1.22min, [M+H] + =687.3.

[0287] Step 4: (3R,4S)-N-(5-fluoro-2-methyl-3-(6-(4-(piperidinyl) (7H-pyrrolo[2,3-d]pyrimidin-4-yloxy)phenyl)-7H-pyrrolo[2,3-d]pyrimidin-4-yl )phenyl)-3-hydroxy-4-isobutylpyrrolidine-1-carboxamide tert-Butyl 4-(4-(4-(5-fluoro-3-((3R,4S)-3-hydro 4-Isobutylpyrrolidine-1-carboxamido)-2-methylphenyl)-7 H-Pyrrolo[2,3-d]pyrimidin-6-yl)phenoxy)piperidine-1-carbo xylate (Step 3) (303 mg, 0.393 mmol) and 4M HCl in dioxane A brownish solution of 1 (2 ml, 8.00 mmol) in MeOH (2 ml) was added at RT. Stirred for 1 h. Then, the RM was concentrated under reduced pressure. 2 to 100% in (water + 0.1% TFA) Reversed-phase flash chromatography on a Redisep® C18 column eluted with ACN Purification of the crude product by filtration gave 317 mg of the title compound as an orange powder as the TFA salt. Finally obtained. LC-MS (Method A): Rt=0.76min,[M+H] + =587.3.

[0288] Intermediate 13 tert-Butyl 9-(4-(4-chloro-7-(phenylsulfonyl)-7H-pyrrolo [2,3-d]pyrimidin-6-yl)phenethyl)-3,9-diazaspiro[5.5] Undecane-3-carboxylate [ka] Step 1: 2-(4-(4,4,5,5-tetramethyl-1,3,2-dioxaborolane- 2-yl)phenyl)ethan-1-ol 2-(4-Bromophenyl)ethan-1-ol (CAS 4654-39-1)(6 0g, 300mmol), BISPIN (84g, 330mmol), KOAc (90g , 900 mmol) and PdCl2(dppf) (6.6 g, 9 mmol) in dioxane The mixture (600 ml) was stirred under N2 at 85 °C for 16 h. The RM was then cooled to RT. The resulting solution was concentrated under reduced pressure. Purification of the crude residue by silica gel chromatography eluting with EtOAc gave 100 g of the title compound as a colorless oil. LC-MS (Method I): Rt=1.87min,[M+NH4] + =266.

[0289] Step 2: 4-(4,4,5,5-tetramethyl-1,3,2-dioxaborolane-2-yl) (I) Phenethyl methanesulfonate 2-(4-(4,4,5,5-tetramethyl-1,3,2-dioxaborolane-2-yl) (phenyl)ethan-1-ol (Step 1) (100 g, 300 mmol) and TEA (240g, 2400mmol) in DCM (1300ml) at 0℃ for 20 minutes. Next, MsCl (136 g, 1200 mmol) in DCM (200 ml) was added After the addition, the RM was stirred at RT for 16 h. The mixture was then washed with water ( 3 x 300 ml), dried over Na2SO4 and concentrated under reduced pressure. Purification of the crude residue by silica gel chromatography eluting with 87% EtOAc gave 87% HCl. g of the title compound as a colorless oil. LC-MS (Method H): Rt=1.92min, [M+H] + =327.

[0290] Step 3: tert-Butyl 9-(4-(4,4,5,5-tetramethyl-1,3,2-diphenyl ether) Oxaborolan-2-yl)phenethyl)-3,9-diazaspiro[5.5]undecane -3-carboxylate tert-Butyl 3,9-diazaspiro[5.5]undecane-3-carboxylate (CAS 173405-78-2)(34g, 133mmol), 4-(4,4,5, 5-Tetramethyl-1,3,2-dioxaborolan-2-yl)phenethylmethanesulfonate Nat (Step 2) (86g, 172mmol), K2CO3 (47g, 345mmol) A mixture of KI (2.3 g, 13.8 mmol) and ACN (1000 ml) was heated to 60°C. The mixture was stirred for 16 h. The RM was then filtered and the solution was concentrated under reduced pressure. Purification of the crude residue by silica gel chromatography eluting with 0% MeOH gave 49 g of the title compound as a white solid. LC-MS (Method F): Rt=1.47min, [M+H] + =485.

[0291] Step 4: tert-Butyl 9-(4-(4-chloro-7-(phenylsulfonyl)-7H) -pyrrolo[2,3-d]pyrimidin-6-yl)phenethyl)-3,9-diazaspiro[ 5.5]Undecane-3-carboxylate tert-Butyl 9-(4-(4,4,5,5-tetramethyl-1,3,2-dioxa (Borolan-2-yl)phenethyl)-3,9-diazaspiro[5.5]undecane-3- Carboxylate (Step 3) (38 g, 79 mmol), Intermediate 2 (37 g, 88 mmol), l), K2CO3 (22 g, 160 mmol) and PdCl2(dppf) (5.8 g, 8 mmol) in a 5:1 dioxane / water mixture (480 ml) was heated at 80°C under N2 for 1 The mixture was stirred for 6 h. Then, the RM was poured into EtOAc (1500 ml) and the organic layer was washed with water (10 0 ml), dried over Na2SO4, filtered and concentrated under reduced pressure. Purify the crude residue by silica gel chromatography eluting with 0-10% MeOH in M This gave 34 g of the title compound as a yellow solid. LC-MS (Method F): Rt=1.99min, [M+H] + =650.

[0292] Intermediate 14 1-(2-Methoxy-5-(3,9-diazaspiro[5.5]undecane-3-carbonyl) (1H,3H)phenyl)dihydropyrimidine-2,4(1H,3H)-dione [ka] Step 1: tert-Butyl 9-(3-(2,4-dioxotetrahydropyrimidine-1( 2H)-yl)-4-methoxybenzoyl)-3,9-diazaspiro[5.5]undeca Benzene-3-carboxylate 3,9-diazaspiro[5.5]undecane-3-carbohydrate under argon at RT Phosphonic acid tert-butyl ester (432 mg, 1.698 mmol) and NMM (0.3 A stirred solution of Intermediate 1a (471 mg, 92 ml, 3.57 mmol) in DMF (4 ml) was added to 1.783 mmol) followed by HATU (743 mg, 1.953 mmol) was added. The clear RM was stirred at RT for 2.5 h and then quenched with saturated aqueous NaHCO3. The layers were separated and the aqueous layer was extracted with EtOAc (1 The combined organic layers were washed with brine / water 1:1 (2x) and brine (1x). , dried over MgSO4, filtered, and concentrated under reduced pressure to give 900 mg of the title compound obtained. LC-MS (Method A): Rt=0.91min,[M+H] + =501.4.

[0293] Step 2: 1-(2-methoxy-5-(3,9-diazaspiro[5.5]undecane-3- (carbonyl)phenyl)dihydropyrimidine-2,4(1H,3H)-dione tert-Butyl 9-(3-(2,4-dioxotetrahydropyrimidine-1(2H) -yl)-4-methoxybenzoyl)-3,9-diazaspiro[5.5]undecane-3 -carboxylate (Step 1) (100 mg, 0.200 mmol) and 4 M HCl The dioxane solution (1 ml, 4 mmol) was stirred in MeOH (1 ml) at RT for 1.5 h. The RM was concentrated and dried under reduced pressure to give 99 mg of the title compound by hydrochlorination. It was obtained as a salt. LC-MS (Method D): Rt=0.76min;[M+H] + =401.4.

[0294] Intermediate 15 tert-Butyl 4-((4-(4-chloro-7H-pyrrolo[2,3-d]pyrimidine- 6-yl)benzyl)oxy)piperidine-1-carboxylate [ka] 4-Chloro-6-iodo-7H-pyrrolo[2,3-d]pyrimidine (84 8 mg, 3.03 mmol) and (4-(((1-(tert-butoxycarbonyl)pyridinyl) Peridine-4-yl)oxy)methyl)phenyl)boronic acid (1.068 g, 3.19 m mol) in an orange suspension of PdCl2(PPh3)2 (1 06 mg, 0.152 mmol) followed by 2 M Na2CO3 in water (3.03 ml, 6. 07 mmol) was added. The RM was stirred at 100°C overnight. It was then diluted with EtOAc. The organic layer was dried over MgSO4 and filtered. The mixture was then concentrated under reduced pressure. Silica gel flash elution was performed using 0-100% EtOAc in CHX. Purification of the crude product by microchromatography gave 844 mg of the title compound. LC-MS (Method A): Rt=1.29min, [M+H] + =443.3

[0295] Intermediate 16 tert-Butyl 4-(2-(4-((4-(4-chloro-7H-pyrrolo[2,3-d] Pyrimidin-6-yl)benzyl)oxy)piperidin-1-yl)ethyl)piperidine -1-carboxylate [ka] Step 1: 4-chloro-6-(4-((piperidin-4-yloxy)methyl)phenyl) -7H-Pyrrolo[2,3-d]pyrimidine tert-Butyl 4-((4-(4-chloro-7H-pyrrolo[2,3-d]pyrimidine (5-6-yl)benzyl)oxy)piperidine-1-carboxylate (Intermediate 15) Yellow color of TFA (15 mg, 1.163 mmol) and TFA (2.69 ml, 34.9 mmol) A solution of this in DCM (3 ml) was stirred at RT under argon for 2 h. The solution was then concentrated. It was then dried under reduced pressure to give 664 mg of the title compound as the TFA salt. LC-MS (Method A): Rt=0.66min;[M+H] + =343.2 / 345.2 .

[0296] Step 2: tert-Butyl 4-(2-(4-((4-(4-chloro-7H-pyrrolo[2,3-d] Pyrimidin-6-yl)benzyl)oxy)piperidin-1-yl)ethyl)piperidine -1-carboxylate 4-chloro-6-(4-((piperidin-4-yloxy)methyl)phenyl)-7H -pyrrolo[2,3-d]pyrimidine (Step 1) (664 mg, 1.163 mmol), t ert-Butyl 4-(2-oxoethyl)piperidine-1-carboxylate (291m g, 1.279 mmol) and TEA (0.486 ml, 3.49 mmol) 0.5M ZnCl2 in THF (2.56ml, 1.279mm The RM was stirred at RT for 3 h before adding NaBH3CN (80 mg, 1 0.279 mmol) was added and the RM was stirred overnight at RT under argon. The organic layer was dried over MgSO4 and filtered. The extract was concentrated and dried under reduced pressure to give 730 mg of the title compound. LC-MS (Method A): Rt=0.95min,[M+H] + =554.4 / 556.3 .

[0297] Intermediate 17 2-(4-(4-chloro-7H-pyrrolo[2,3-d]pyrimidin-6-yl)phenyl )ethanol [ka] 4-chloro-6-iodo-7H-pyrrolo[2,3-d]pyrimidine (1.2 g, 4.2 9mmol), 4-(2-hydroxyethyl)phenylboronic acid (750mg, 4.29 mmol), 2M Na2CO3 in water (4.72 ml, 9.45 mmol) and PdCl 2(PPh3)2 (154 mg, 0.215 mmol) mixed with yellow-white 1-propanol The solution (36 ml) was flushed with N2 at RT and then placed in a preheated oil bath at 105 °C. After stirring at 105° C. overnight, the brown mixture was concentrated to dryness and Drying under V-pump gave a dark solid. Elution with 40-100% EtOAc in CHX Purification of the crude compound by silica gel flash chromatography yielded 762 mg of The title compound was obtained as a yellow solid. LC-MS (Method A): Rt=0.82min,[M+H] + =274.0.

[0298] Intermediate 18 tert-Butyl 4-(piperidin-4-yloxy)piperidine-1-carboxylate to [ka] Step 1: tert-Butyl 4-(pyridin-4-yloxy)piperidine-1-carboxylate Silat In a 500 ml round-bottom flask, add pyridin-4-ol (5 g, 52.6 mmol), dry THF (200 ml), tert-butyl 4-hydroxypiperidine-1-carboxylate PPh3 (18g, 68.4mmol) was mixed with PPh3 (13.3g, 65.8mmol). Then, DEAD (12 g, 68.4 mmol) was added dropwise at RT. After stirring at RT for 3 h, the RM was concentrated. Purification by column chromatography gave 10 g of the title compound as a white solid. . LC-MS (Method H): Rt=1.35min, [M+H] + =279.3.

[0299] Step 2: tert-Butyl 4-(piperidin-4-yloxy)piperidine-1-carbohydrate Xylate In a 500 ml round bottom flask purged and maintained under an inert atmosphere, tert-butyl 4 -(pyridin-4-yloxy)piperidine-1-carboxylate (2 g, 7.2 mm ol), EtOH (100 ml), AcOH (5 ml) and palladium on carbon (0.4 g) The RM was stirred under a H2 atmosphere (4 MPa) at 80°C for 16 hours. The extract was filtered through Hyflo® and the filtrate was concentrated under reduced pressure. Purification of the crude mixture by silica gel chromatography eluting with H gave 0.5 g of the title compound. The compound was obtained as a colorless oil. LC-MS (Method H): Rt=1.32min, [M+H] + =285.3.

[0300] Synthesis of the final compound compound 1 (3S,4R)-N-(3-(6-(4-((9-(3-(2,4-dioxotetrahydrochloride 3,9-diazaspiro(4-methoxybenzoyl)-1(2H)-yl-4-pyrimidin-1(2H)-yl [5.5]undecan-3-yl)methyl)phenyl)-7H-pyrrolo[2,3-d]pi (Irimidin-4-yl)-5-fluoro-2-methylphenyl)-3-hydroxy-4-isopropyl Isobutylpyrrolidine-1-carboxamide [ka] Step 1: (3S,4R)—N-(5-fluoro-3-(6-(4-formylphenyl)- 7-(phenylsulfonyl)-7H-pyrrolo[2,3-d]pyrimidin-4-yl)-2 (-methylphenyl)-3-hydroxy-4-isobutylpyrrolidine-1-carboxamide In a 100 ml round-bottom flask, add 4-(4-chloro-7-(phenylsulfonyl)-7H-pyridinium chloride) Iodo[2,3-d]pyrimidin-6-yl)benzaldehyde (410 mg, 1.03 m mol) (Intermediate 3b), (3S,4R)-N-(5-fluoro-2-methyl-3-(4 ,4,5,5-tetramethyl-1,3,2-dioxaborolan-2-yl)phenyl)- 3-Hydroxy-4-isobutylpyrrolidine-1-carboxamide (420 mg, 1.0 mmol) (intermediate 8), PdCl2(dppf) (110 mg, 0.15 mmol), Na2CO3 (280 mg, 2.64 mmol), ACN (16 ml) and H2O (4 m The mixture was degassed and purged with N2 (2x) and heated to 100 °C for 1.5 min. The mixture was stirred for 1 h. The RM was concentrated in vacuo and cold water (30 ml) was added. The mixture was diluted with EtOAc (3 x 50 ml) and the combined organic layers were evaporated to give 800 mg of the title compound. I got something. LC-MS (Method J): Rt=1.74min, [M+H] + =656.

[0301] Step 2: tert-Butyl 9-(4-(4-(5-fluoro-3-((3S,4R)-3 -Hydroxy-4-isobutylpyrrolidine-1-carboxamido)-2-methylphenyl )-7-(phenylsulfonyl)-7H-pyrrolo[2,3-d]pyrimidin-6-yl) benzyl)-3,9-diazaspiro[5.5]undecane-3-carboxylate In a round-bottom flask (100 ml), (3S,4R)-N-(5-fluoro-3-(6-(4 -formylphenyl)-7-(phenylsulfonyl)-7H-pyrrolo[2,3-d]pyr (4-amino-2-methylphenyl)-3-hydroxy-4-isobutylpyrrolidine tert-Butyl-1-carboxamide (720 mg, 0.9 mmol) (Step 1) 3,9-diazaspiro[5.5]undecane-3-carboxylate (360 mg, 1. 41 mmol) and MeOH (32 ml) were added. l) and 1M ZnCl2 in THF (1.0 ml, 1.0 mmol) were added to the mixture. The mixture was stirred at 30 °C for 1.5 h, and then added NaBH3CN (160 mg, 2.57 (mmol) was added to the mixture at 5°C. The mixture was stirred at 30°C for 1 h. RM The mixture was extracted with EtOAc (3×50 ml). l), the combined organic layers were evaporated to give 1.2 g of the title compound. LC-MS (Method K): Rt=2.67min,[M+H] + =895.

[0302] Step 3: tert-Butyl 9-(4-(4-(5-fluoro-3-((3S,4R)-3 -Hydroxy-4-isobutylpyrrolidine-1-carboxamido)-2-methylphenyl )-7H-pyrrolo[2,3-d]pyrimidin-6-yl)benzyl)-3,9-diaza Pyro[5.5]undecane-3-carboxylate tert-Butyl 9-(4-(4-(5-fluoro-3-((3S,4R)-3-hydrogen 4-Isobutylpyrrolidine-1-carboxamido)-2-methylphenyl)-7 -(phenylsulfonyl)-7H-pyrrolo[2,3-d]pyrimidin-6-yl)benzyl (I)-3,9-diazaspiro[5.5]undecane-3-carboxylate (610mg A round-bottom flask (5 ml) containing a DMSO solution (6 ml) of 1,4-dichloro-2 ... Add 1.2 ml of NaOH (140 mg, 3.5 mmol) in H2O to a 100 ml flask at 0°C. The mixture was stirred at 0°C for 3 h. A mixture of ice and cold water (40 The precipitated solid was collected and the silica gel was eluted with 0-18% MeOH in DCM. Purification by column chromatography gave 230 mg of the title compound as a yellow solid. Got it. LC-MS (Method E): Rt=2.44min, [M+H] + =754.

[0303] Step 4: (3S,4R)-N-(3-(6-(4-(3,9-diazaspiro[5.5]urethane) (3-methyl-phenyl)-7H-pyrrolo[2,3-d]pyrimidine-4- (yl)-5-fluoro-2-methylphenyl)-3-hydroxy-4-isobutylpyrrolidone Zin-1-carboxamide tert-Butyl 9-(4-(4 -(5-fluoro-3-((3S,4R)-3-hydroxy-4-isobutylpyrrolidine -1-carboxamido)-2-methylphenyl)-7H-pyrrolo[2,3-d]pyrimidin (6-phenyl)benzyl)-3,9-diazaspiro[5.5]undecane-3-carboxamide A round-bottom flask (100 ml) containing a solution of silane (230 mg, 0.305 mmol) was l) Add 4M HCl in dioxane (2.0 ml, 8.0 mmol) dropwise at 5°C. The mixture was stirred at 30 °C for 4 h. An additional amount of 4 M HCl in dioxane (2 0.0 ml, 8.0 mmol) was added dropwise and the RM was stirred for an additional 40 min. The crude compound was extracted with petroleum ether / TBME 1:1 (3 x 30 ml), TBM E (30 ml) and DCM / TBME 2:1 (30 ml), and the solid was triturated in vacuo. Drying at 4°C gave 172 mg of the title compound as a tan solid as the hydrochloride salt. Got it. LC-MS (Method F): Rt=1.05min, [M+H] + =654.

[0304] Step 5: (3S,4R)-N-(3-(6-(4-((9-(3-(2,4-dioxote tetrahydropyrimidin-1(2H)-yl)-4-methoxybenzoyl)-3,9-diazomethane Zaspiro[5.5]undecan-3-yl)methyl)phenyl)-7H-pyrrolo[2,3 -d]pyrimidin-4-yl)-5-fluoro-2-methylphenyl)-3-hydroxy 4-Isobutylpyrrolidine-1-carboxamide (3S,4R)-N-(3-(6-(4-(3,9-diazaspiro[5.5]undeca) (phenyl)-7H-pyrrolo[2,3-d]pyrimidin-4-yl -5-fluoro-2-methylphenyl)-3-hydroxy-4-isobutylpyrrolidine- 1-carboxamide (172 mg, 0.237 mmol) (Step 4) and 3-(2,4- Dioxotetrahydropyrimidin-1(2H)-yl)-4-methoxybenzoic acid (63m g, 0.237 mmol) (Intermediate 1a) in DMF (2.5 ml) DIPEA (183 mg, 1.42 mmol) was added to a round-bottom flask at 5°C. Then, HATU (90 mg, 0.237 mmol) was added at 5°C, and the mixture was stirred for 5 The RM was filtered and diluted with 0.01M NH4HCO3 in water / ACN. Preparative HPLC (XBridge C18, 21.2 x 250 mm, 10 μm) to give 63 mg of the title compound as a white solid. LC-MS (Method E): Rt=1.85min,[M / 2+H] + =450.7. 1 H NMR(500MHz,DMSO-d6)δ 12.70(s,1H),10.3 3(s,1H),8.82(s,1H),7.92(d,J=8.2Hz,2H),7. 68(s,1H),7.49(dd,J=10.8,2.7Hz,1H),7.40-7 .34(m,3H),7.32(d,J=2.1Hz,1H),7.14(d,J=8. 7Hz,1H),7.05(dd,J=8.9,2.8Hz,1H),6.75(s,1 H),5.12(s,1H),3.90-3.86(m,1H),3.84(s,3H) ,3.65(dd,J=16.3,9.2Hz,2H),3.59(t,J=6.6Hz ,2H),3.53-3.35(m,4H),3.49(s,2H),3.19(dd, J=10.1,4.7Hz,1H),3.11-3.05(m,1H),2.68(t, J=6.3Hz,2H),2.38-2.32(m,4H),2.09(s,3H),2 .06-2.00(m,1H),1.66-1.58(m,1H),1.52-1.47 (m,4H),1.45-1.38(m,4H),1.38-1.29(m,1H),1 .16-1.09(m,1H),0.90(dd,J=10.8,6.6Hz,6H).

[0305] compound 2 (3R,4S)-N-(3-(6-(4-((4-(2-((1-(3-(2,4-diodeio 1(2H)-1-(4-methoxybenzoyl)-1(2H)-pyrimidin-1(2H)-yl (4-phenyl)oxy)ethyl)piperazin-1-yl)methyl)phenyl)-7H-pi (2,3-d)pyrimidin-4-yl)-5-fluoro-2-methylphenyl)-3 -Hydroxy-4-isobutylpyrrolidine-1-carboxamide [ka] Step 1: 2-((1-(tert-butoxycarbonyl)piperidin-4-yl)oxy) )-1-Hydroxyethanesulfonic acid tert-Butyl 4-(2-oxoethoxy)piperidine-1-carboxylate (medium A solution of intermediate 4 (1.0 g, 3.70 mmol) in EtOH (6 ml) was purged with argon. Next, an aqueous solution (1 ml) of sodium metabisulfite (500 mg, 2.63 mmol) was added. l) was added and the RM was stirred at 80°C for 1 h. The heterogeneous mixture was then cooled to RT. After stirring at RT for 2 days, the suspension was filtered, washed with EtOH and dried under reduced pressure. Drying gave 833 mg of the title compound as a white solid. 1 H NMR(400MHz,DMSO-d6)δ 5.32(d,J=5.7Hz,1 H),3.96(t,J=7.2Hz,1H),3.80(d,J=10.3Hz,1H ),3.61(d,J=13.4Hz,2H),3.46(s,1H),3.35(s, 2H),2.99(s,2H),1.73(s,2H),1.39(s,9H),1.3 0(q,J=9.1,5.9Hz,2H).

[0306] Step 2: tert-Butyl 4-(2-(4-(4-(4-(5-fluoro-3-((3R ,4S)-3-Hydroxy-4-isobutylpyrrolidine-1-carboxamido)-2-methyl (ethylphenyl)-7H-pyrrolo[2,3-d]pyrimidin-6-yl)benzyl)pipera Diphenyl-1-yl)ethoxy)piperidine-1-carboxylate (3R,4S)-N-(5-fluoro-2-methyl-3-(6-(4-(piperazine- 1-ylmethyl)phenyl)-7H-pyrrolo[2,3-d]pyrimidin-4-yl)phenyl (Nyl)-3-hydroxy-4-isobutylpyrrolidine-1-carboxamide (Intermediate 11 ) (200 mg, 0.321 mmol) in MeOH (3 ml) g, 0.973 mmol) was added and the resulting orange solution was stirred at RT for 5 min. The mixture was stirred. Then, 2-((1-(tert-butoxycarbonyl)piperidin-4-yl )oxy)-1-hydroxyethanesulfonic acid (Step 1) (130 mg, 0.380 mm ol) and 2-picoline borane complex (21 mg, 0.167 mmol) were added, and the RM The mixture was stirred at RT for 3 days and then concentrated under reduced pressure. Reversed-phase flash chromatography on a Redisep® C18 column eluted with 100% ACN. Purification of the crude product by chromatography gave 364 mg of the title compound as the TFA salt. Ta. LC-MS (Method A): Rt=0.94min,[M+H] + =813.6.

[0307] Step 3: (3R,4S)—N-(5-fluoro-2-methyl-3-(6-(4-((4- (2-(piperidin-4-yloxy)ethyl)piperazin-1-yl)methyl)phenyl (phenyl)-7H-pyrrolo[2,3-d]pyrimidin-4-yl)phenyl)-3-hydroxy 4-Isobutylpyrrolidine-1-carboxamide tert-Butyl 4-(2-(4-(4-(4-(5-fluoro-3-((3R,4S )-3-Hydroxy-4-isobutylpyrrolidine-1-carboxamido)-2-methylpyrrolidine (phenyl)-7H-pyrrolo[2,3-d]pyrimidin-6-yl)benzyl)piperazine- 1-yl)ethoxy)piperidine-1-carboxylate (Step 2) (364 mg, 0. 224 mmol) and 4 M HCl in dioxane (2 ml, 8.00 mmol) MeO The RM solution (2 ml) was stirred at RT for 2 h. The RM was then concentrated under reduced pressure. Redisep® C18 column eluted with 2-100% ACN in 0.1% TFA Purification of the crude product by reversed-phase flash chromatography afforded 155 mg of the title compound. The compound was obtained as the TFA salt. LC-MS (Method A): Rt=0.70min,[M+H] + =713.6.

[0308] Step 4: (3R,4S)-N-(3-(6-(4-((4-(2-((1-(3-(2, 4-dioxotetrahydropyrimidin-1(2H)-yl)-4-methoxybenzoyl Piperidin-4-yl)oxy)ethyl)piperazin-1-yl)methyl)phenyl)- 7H-Pyrrolo[2,3-d]pyrimidin-4-yl)-5-fluoro-2-methylphenyl (I)-3-hydroxy-4-isobutylpyrrolidine-1-carboxamide RT of 3-(2,4-dioxotetrahydropyrimidin-1(2H)-yl)-4-methylpyrimidin-1-yl A solution of benzoic acid (41 mg, 0.155 mmol) (Intermediate 1a) in DMF (1 ml ) with NMM (0.050 ml, 0.455 mmol) followed by HATU (59 mg, 0. After stirring at RT for 30 min, (3R,4S)-N-(5 -fluoro-2-methyl-3-(6-(4-((4-(2-(piperidin-4-yloxy) (B)ethyl)piperazin-1-yl)methyl)phenyl)-7H-pyrrolo[2,3-d] Pyrimidin-4-yl)phenyl)-3-hydroxy-4-isobutylpyrrolidine-1- Carboxamide (Step 3) (155 mg, 0.143 mmol) and NMM (0.050 A DMF solution (0.5 ml) of 0.455 mmol of HCl was added dropwise to the mixture, and a yellow The RM was stirred at RT overnight. Then, the RM was concentrated under reduced pressure. (Water + 0.1% NH Redisep® C18 column eluted with 2-100% ACN in 4HCO3 Purification of the crude product by reversed-phase flash chromatography (Interchim) gave 114 mg of material was obtained. SFC (column: P) eluting with 40-60% CO in MeOH. Purification of substances by RINCESTON 4-EP, 60A, 250 x 30 mm, 5 μM This gave 80 mg of the title compound as a solid. LC-MS (Method B): Rt=3.52min,[M+H] + =959.7. 1 H NMR(400MHz,DMSO-d6)δ ppm 12.72(br s,1 H),10.32(s,1H),8.83(s,1H)7.92(br d,J=7.9 2Hz,2H),7.67(s,1H),7.50(br d,J=10.71Hz,1 H),7.30-7.40(m,4H),7.14(br d,J=8.51Hz,1H ),7.06(br d,J=8.80Hz,1H),6.76(s,1H),5.11 (br d,J=4.11Hz,1H),3.81-3.89(m,4H),3.42- 3.77(m,11H),3.19-3.25(m,2H),3.05-3.16(m, 2H),2.67(br t,J=5.94Hz,2H),2.52-2.55(m,1 H),2.23-2.48(m,9H),2.01-2.12(m,4H),1.81( br s,2H),1.62(m,1H),1.30-1.48(m,3H),1.07 -1.17(m,1H),0.90(br t,J=7.48Hz,6H).

[0309] compound 3 (3R,4S)-N-(3-(6-(4-((1-(2-(1-(3-(2,4-dioxo (isotetrahydropyrimidin-1(2H)-yl)-4-methoxybenzoyl)piperidine -4-yl)ethyl)piperidin-4-yl)oxy)phenyl)-7H-pyrrolo[2, 3-d]pyrimidin-4-yl)-5-fluoro-2-methylphenyl)-3-hydroxy 4-isobutylpyrrolidine-1-carboxamide [ka] Step 1: tert-Butyl 4-(2-(4-(4-(4-(5-fluoro-3-((3R ,4S)-3-Hydroxy-4-isobutylpyrrolidine-1-carboxamido)-2-methyl (ethylphenyl)-7H-pyrrolo[2,3-d]pyrimidin-6-yl)phenoxy)piperidine Lysin-1-yl)ethyl)piperidine-1-carboxylate RT (3R,4S)-N-(5-fluoro-2-methyl-3-(6-(4-(piperidinyl) (7H-pyrrolo[2,3-d]pyrimidin-4-yloxy)phenyl)-7H-pyrrolo[2,3-d]pyrimidin-4-yl )phenyl)-3-hydroxy-4-isobutylpyrrolidine-1-carboxamide (intermediate Body 12) (200mg, 0.248mmol), TEA (0.100ml, 0.717m mol) and N-boc-4-piperidineacetaldehyde (68 mg, 0.299 mm A stirred solution of 2 ml of ZnCl2 in MeOH was added to 0.600 ml of ZnCl2 in THF. , 0.300 mmol) was added and the RM was stirred under argon at RT for 6 h. Then, NaBH3CN (18 mg, 0.286 mmol) was added. The RM was stirred at RT overnight. After stirring, the mixture was concentrated under reduced pressure to give 198 mg of the title compound. LC-MS (Method A): Rt=0.96min,[M+H] + =798.6.

[0310] Step 2: (3R,4S)—N-(5-fluoro-2-methyl-3-(6-(4-((1- (2-(piperidin-4-yl)ethyl)piperidin-4-yl)oxy)phenyl)- 7H-pyrrolo[2,3-d]pyrimidin-4-yl)phenyl)-3-hydroxy-4- Isobutylpyrrolidine-1-carboxamide tert-Butyl 4-(2-(4-(4-(4-(5-fluoro-3-((3R,4S )-3-Hydroxy-4-isobutylpyrrolidine-1-carboxamido)-2-methylpyrrolidine (phenyl)-7H-pyrrolo[2,3-d]pyrimidin-6-yl)phenoxy)piperidine -1-yl)ethyl)piperidine-1-carboxylate (Step 1) (198 mg, 0. 248 mmol) and 4 M HCl in dioxane (1.5 ml, 6.00 mmol) The solution in eOH (1.5 ml) was stirred at RT for 3 h. The RM was then concentrated under reduced pressure. Redisep® eluted with 2-100% ACN in (water + 0.1% TFA) Purification of the crude product by reversed-phase flash chromatography on a C18 column yielded 235 mg of the title compound as a yellow solid as the TFA salt. LC-MS (Method A): Rt=0.70min,[M+H] + =698.6.

[0311] Step 3: (3R,4S)-N-(3-(6-(4-((1-(2-(1-(3-(2,4 -dioxotetrahydropyrimidin-1(2H)-yl)-4-methoxybenzoyl)pi (4-pyridin-4-yl)ethyl)piperidin-4-yl)oxy)phenyl)-7H-pyrro (2,3-d)pyrimidin-4-yl)-5-fluoro-2-methylphenyl)-3- Hydroxy-4-isobutylpyrrolidine-1-carboxamide 3-(2,4-dioxotetrahydropyrimidin-1(2H)-yl)-4-methoxy A stirred solution of benzoic acid (Intermediate 1a) (76 mg, 0.289 mmol) in DMF (1 ml) NMM (0.050 ml, 0.455 mmol) was added followed by HATU (110 mg, 0. 289 mmol) was added. The resulting RM was stirred at RT for 30 min. (3R,4S)-N-(5-fluoro-2-methyl-3-(6-(4-((1-(2 -(piperidin-4-yl)ethyl)piperidin-4-yl)oxy)phenyl)-7H -pyrrolo[2,3-d]pyrimidin-4-yl)phenyl)-3-hydroxy-4-iso Butylpyrrolidine-1-carboxamide (Step 2) (235 mg, 0.241 mmol) and NMM (0.050 ml, 0.455 mmol) in DMF (0.5 ml) were mixed. The yellow RM was stirred at RT for 3 h. (water + 0.1% NH4HCO 3) Redisep® C18 column reversed-phase fraction eluted with 2-100% ACN Purification of the crude product by column chromatography gave 125 mg of the title compound. LC-MS (Method B): Rt=3.77min,[M / 2+H] + =473.2. 1 H NMR(400MHz,DMSO-d6)δ ppm 12.62(br s,1 H),10.33(br s,1H),8.80(br s,1H),7.78-8.0 0(m,2H),7.59-7.74(m,1H),7.44-7.54(m,1H), 7.25-7.41(m,2H),6.94-7.20(m,4H),6.65(br s,1H),4.98-5.28(m,1H),4.38-4.53(m,1H),3. 77-3.92(m,4H),3.56-3.71(m,4H),3.08-3.20( m,2H),2.61-2.90(m,6H),1.84-2.36(m,12H),1 .35-1.70(m,8H),1.01-1.28(m,4H)0.79-0.98( m,6H).

[0312] compound 4 (cis-rac)-N-(3-(6-(4-(((1-(2-(1-(3-(2,4- Dioxotetrahydropyrimidin-1(2H)-yl)-4-methoxybenzoyl)piperidine Lysin-4-yl)ethyl)piperidin-4-yl)oxy)methyl)phenyl)-7H -pyrrolo[2,3-d]pyrimidin-4-yl)-5-fluoro-2-methylphenyl -3-Hydroxy-4-isobutylpyrrolidine-1-carboxamide [ka] Step 1: (cis-rac)-tert-butyl 4-((4-(4-(5-fluoro-3-(3- Hydroxy-4-isobutylpyrrolidine-1-carboxamido)-2-methylphenyl) -7H-pyrrolo[2,3-d]pyrimidin-6-yl)benzyl)oxy)piperidine- 1-carboxylate tert-Butyl 4-((4-(4-chloro-7H-pyrrolo[2,3-d]pyrimidine (6-yl)benzyl)oxy)piperidine-1-carboxylate (Intermediate 15) (1 50 mg, 0.339 mmol), (cis-rac)-N-(5-fluoro-2-methyl 3-(4,4,5,5-tetramethyl-1,3,2-dioxaborolan-2-yl) (phenyl)-3-hydroxy-4-isobutylpyrrolidine-1-carboxamide (intermediate 9) (157 mg, 0.373 mmol) and 2 M Na2CO3 in water (0.339 ml , 0.677 mmol) in 1-propanol (20 ml) )2 (11.88 mg, 0.017 mmol) was added. The resulting RM was The mixture was irradiated in a microwave oven at 140°C for 15 minutes. It was then concentrated under reduced pressure. Purify the crude product by silica gel flash chromatography eluting with ~100% EtOAc. Purification of this product gave 94 mg of the title compound. LC-MS (Method A): Rt=1.25min, [M+H] + =701.5.

[0313] Step 2: (cis-rac)-N-(5-fluoro-2-methyl-3-(6-(4-(( Piperidin-4-yloxy)methyl)phenyl)-7H-pyrrolo[2,3-d]pyrimidin (4-(phenyl)-3-hydroxy-4-isobutylpyrrolidine-1-carbo oxamide (cis-rac)-tert-butyl 4-((4-(4-(5-fluoro-3-hydroxybenzoate 4-Isobutylpyrrolidine-1-carboxamido)-2-methylphenyl)-7 H-pyrrolo[2,3-d]pyrimidin-6-yl)benzyl)oxy)piperidine-1- Carboxylate (Step 1) (94 mg, 0.134 mmol) and TFA (0.310 A yellow solution of 1 ml (4.02 mmol) in DCM (3 ml) was added under argon at RT. The mixture was stirred for 1 h. It was then concentrated under reduced pressure to give 143 mg of the title compound as a TFA salt. Got it. LC-MS (Method A): Rt=0.78min,[M+H] + =601.6.

[0314] Step 3: (cis-rac)-tert-butyl 4-(2-(4-((4-(4-(5-fluoro -3-(3-hydroxy-4-isobutylpyrrolidine-1-carboxamido)-2-methyl (phenyl)-7H-pyrrolo[2,3-d]pyrimidin-6-yl)benzyl)oxy Piperidin-1-yl)ethyl)piperidine-1-carboxylate (cis-rac)-N-(5-fluoro-2-methyl-3-(6-(4-((piperidinyl) (4-(4-methylphenyl)-2,3-diphenyl-4-yloxymethyl)phenyl)-7H-pyrrolo[2,3-d]pyrimidine- 4-yl)phenyl)-3-hydroxy-4-isobutylpyrrolidine-1-carboxamine (Step 2) (143 mg, 0.173 mmol), tert-butyl 4-(2-oxopropyl Ethyl)piperidine-1-carboxylate (43.1 mg, 0.190 mmol) and A brown solution of TEA (0.072 ml, 0.518 mmol) in MeOH (4 ml) was added to TH 0.5 M ZnCl2 in F (0.380 ml, 0.190 mmol) was added. The resulting RM was stirred at RT for 3 h. Then, NaBH3CN (11.93 mg, 0 0.190 mmol) was added and the RM was stirred overnight at RT under argon. The resulting solution was diluted with DCM and washed with water and brine. The organic layer was evaporated over MgSO4 Dry, filter and concentrate under reduced pressure. Purification of the crude compound by gel flash chromatography gave 83 mg of the title compound. obtained. LC-MS (Method A): Rt=0.99min,[M+H] + =812.8.

[0315] Step 4: (cis-rac)-N-(5-fluoro-2-methyl-3-(6-(4-(( (1-(2-(piperidin-4-yl)ethyl)piperidin-4-yl)oxy)methyl )phenyl)-7H-pyrrolo[2,3-d]pyrimidin-4-yl)phenyl)-3- Hydroxy-4-isobutylpyrrolidine-1-carboxamide (cis-rac)-tert-butyl 4-(2-(4-((4-(4-(5-fluoro (2-3-hydroxy-4-isobutylpyrrolidine-1-carboxamido)-2-methyl (phenyl)-7H-pyrrolo[2,3-d]pyrimidin-6-yl)benzyl)oxy)piperidine Lysin-1-yl)ethyl)piperidine-1-carboxylate (Step 3) (83 mg, 0.102 mmol) and TFA (0.236 ml, 3.07 mmol) in yellow DCM The solution (3 ml) was stirred under argon at RT for 1 h. It was then concentrated under reduced pressure. This gave 142 mg of the title compound as a TFA salt. LC-MS (Method A): Rt=0.71min,[M+H] + =712.4.

[0316] Step 5: (cis-rac)-N-(3-(6-(4-((1-(2-(1-(3-() 2,4-Dioxotetrahydropyrimidin-1(2H)-yl)-4-methoxybenzoyl (I)piperidin-4-yl)ethyl)piperidin-4-yl)oxy)methyl)phenyl )-7H-pyrrolo[2,3-d]pyrimidin-4-yl)-5-fluoro-2-methyl (phenyl)-3-hydroxy-4-isobutylpyrrolidine-1-carboxamide (cis-rac)-N-(5-fluoro-2-methyl-3-(6-(4-(((1- (2-(piperidin-4-yl)ethyl)piperidin-4-yl)oxy)methyl)phen (7H-pyrrolo[2,3-d]pyrimidin-4-yl)phenyl)-3-hydroxy 4-isobutylpyrrolidine-1-carboxamide (Step 4) (142 mg, 0.10 3mmol), 3-(2,4-dioxotetrahydropyrimidin-1(2H)-yl)- 4-Methoxybenzoic acid (Intermediate 1a) (29.9 mg, 0.113 mmol) and HBT A brown DMF solution (3 ml) of U (46.8 mg, 0.123 mmol) was added to DIPEA ( The resulting RM was stirred under argon for 1 hour at 20°C for 1 hour. Stirred at RT for 2 h. Then poured into water. The resulting white suspension The residue was filtered, washed with water, and dried under reduced pressure to give 100 mg of crude material. Reversed-phase HPLC (column: XBrid) eluting with 38-58% ACN in 0.1% NH4OH Purification of material by GE C18, 250 x 50 mm, 5 μm; flow: 100 ml / min) This gave 28.5 mg of the title compound. LC-MS (Method B): Rt=3.85min, [M+H] + =959.5. 1 H NMR(400MHz,DMSO-d6)δ ppm 12.77(br s,1 H),10.35(s,1H),8.85(s,1H),7.96(br d,J=7. 80Hz,2H),7.66(s,1H),7.51(m,1H),7.43(br d ,J=7.90Hz,2H),7.37(br d,J=8.40Hz,1H),7.3 3(s,1H),7.16(d,J=8.31Hz,1H),7.07(br d,J= 8.60Hz,1H),6.80(s,1H),4.84-4.99(m,1H),4. 55(s,2H),4.07-4.16(m,1H),3.85(s,3H),3.61 (m,3H),3.43-3.52(m,3H),3.05-3.14(m,1H),2 .55-2.92(m,6H),2.21-2.40(m,3H),2.13-2.21 (m,1H),2.11(s,3H),2.03(br t,J=9.11Hz,2H) ,1.88(m,2H),1.04-1.75(m,13H),0.92(br d,J =6.48Hz,6H).

[0317] compound 5 trans-rac-N-(3-(6-(4-((9-(3-(2,4-dioxotetra Hydropyrimidin-1(2H)-yl)-4-methoxybenzoyl)-3,9-diaza pyrro[5.5]undecan-3-yl)methyl)phenyl)-7H-pyrrolo[2,3-d ]pyrimidin-4-yl)-5-fluoro-2-methylphenyl)-3-hydroxy-4 -Isobutylpyrrolidine-1-carboxamide [ka] Step 1: trans-rac-benzyl 3-hydroxy-4-isobutylpyrrolidine-1 -carboxylate In a 3L round-bottom flask, benzyl 6-oxa-3-azabicyclo[3.1.0]hexane -3-carboxylate (CAS 31865-25-5) (43.5g, 148.1m mol) and copper(I) bromide dimethylsulfane complex (14 g, 68.4 mmol) were added to TH The solution was cooled to -30°C under N2 and then suspended in THF (1000 ml). 2M isobutylmagnesium bromide (913 ml, 1820 mmol) was added over 90 min. After the addition, the reaction was allowed to warm slowly to -15°C over 45 minutes, and the mixture was The mixture was stirred at -15°C for 2 hours. Then, the reaction mixture was added to 2M HCl (1000 ml) at 0°C. The mixture was then quenched with HCl and stirred at RT for 30 min. The layers were then separated and The aq. layer was extracted with EtOAc (3 x 200 ml), dried over Na2SO4, and filtered. The extract was chromatographed on silica gel eluting with 0-20% EtOAc in petroleum ether. Purification of the crude mixture by filtration gave 108 g of the title compound as a yellow oil. LC-MS (Method F): Rt=1.51min, [M+H] + =278.

[0318] Step 2: trans-rac-4-isobutylpyrrolidin-3-ol In a 250 ml round-bottom flask, trans-rac-benzyl 3-hydroxy-4-isopropyl Butyl pyrrolidine-1-carboxylate (Step 1) (1 g, 3.6 mmol) and 10 A mixture of 100 mg palladium on carbon and 40 ml MeOH was heated at RT under H2. The mixture was stirred for 16 h. The mixture was filtered and the filtrate was concentrated to give 510 mg of the title compound as a yellow solid. Obtained as an oil. LC-MS (Method E): Rt=1.05min, [M+H] + =144.

[0319] Step 3: trans-rac-N-(5-fluoro-2-methyl-3-(4,4,5,5 -tetramethyl-1,3,2-dioxaborolan-2-yl)phenyl)-3-hydroxy 4-isobutylpyrrolidine-1-carboxamide 5-Fluoro-2-methyl-3-(4,4,5,5-tetramethyl-1,3,2-diol) (oxaborolan-2-yl)aniline (commercially available or as disclosed in International Publication No. 2013 / 008095, page 37, Intermediate 5) ( Mixture of DIPEA (853 mg, 3.4 mmol) and DIPEA (2.2 g, 17 mmol) in THF The solution (40 ml) was stirred at 0° C. for 15 minutes. Then, triphosgene (480 mg, 1 0.63 mmol) was added and the mixture was stirred at 0°C for 2 h. ac-4-Isobutylpyrrolidin-3-ol (Step 2) (486 mg, 3.4 mmol After the addition, the mixture was stirred at RT for 16 h. MeOH (10 ml) was added. After concentration, the mixture was purified by silica gel eluting with 0-5% MeOH in DCM. Purification of the crude mixture by column chromatography gave 1.0 g of the title compound. LC-MS (Method J): Rt=1.46min, [M+H] + =421.

[0320] Step 4: trans-rac-N-(5-fluoro-3-(6-(4-formylphenyl) )-7-(phenylsulfonyl)-7H-pyrrolo[2,3-d]pyrimidin-4-yl) -2-methylphenyl)-3-hydroxy-4-isobutylpyrrolidine-1-carboxamide Mido In a 50 ml round-bottom flask, trans-rac-N-(5-fluoro-2-methyl-3 -(4,4,5,5-tetramethyl-1,3,2-dioxaborolan-2-yl)phenyl (4)-3-hydroxy-4-isobutylpyrrolidine-1-carboxamide (Step 3) 20 mg, 1 mmol), 4-(4-chloro-7-(phenylsulfonyl)-7H-pyrro 2,3-d)pyrimidin-6-yl)benzaldehyde (410 mg, 1.05 mm ol) (Intermediate 3b), Na2CO3 (280 mg, 2.6 mmol) and PdCl2 ( dppf) (110 mg, 0.15 mmol) in ACN (12 ml) and water (3 ml) The mixture was stirred under N2 at 100 °C for 16 h and then concentrated under reduced pressure. Agela C18 eluted with 5-90% ACN in water (10 mM NH4HCO3). Purification of the crude mixture by column reversed-phase flash chromatography yielded 400 mg of the title compound. The compound was obtained. LC-MS (Method E): Rt=2.07min, [M+H] + =656.

[0321] Step 5: trans-rac-tert-butyl 9-(4-(4-(5-fluoro-3- (3-hydroxy-4-isobutylpyrrolidine-1-carboxamido)-2-methylphen (phenylsulfonyl)-7-(phenylsulfonyl)-7H-pyrrolo[2,3-d]pyrimidin-6-yl (I)benzyl)-3,9-diazaspiro[5.5]undecane-3-carboxylate In a 50 ml flask, trans-rac-N-(5-fluoro-3-(6-(4-hydroxybenzoate) (pyrrolo[2,3-d]pyrimidinyl)-7-(phenylsulfonyl)-7H-pyrrolo[2,3-d]pyrimidinyl (4-phenyl-2-methylphenyl)-3-hydroxy-4-isobutylpyrrolidine- 1-Carboxamide (400 mg, 0.61 mmol), tert-butyl 3,9-diazomethane Zaspiro[5.5]undecane-3-carboxylate (CAS 173405-78- 2) (186 mg, 0.73 mmol) and K2CO3 (166 mg, 1.2 mmol) was suspended in DMSO (3 ml). After stirring for 15 min at RT, 1M ZnC A solution of l2 in THF (0.78 ml, 0.78 mmol) was added and the mixture was heated at RT. The mixture was stirred for 3 h. Then, NaBH3CN (300 mg, 5 mmol) and MeOH (3 ml ) was added and the mixture was stirred at RT for 16 h and then filtered. Reversed-phase flash chromatography was performed on an Agela C18 column, eluting with 5-80% ACN in HCl. Purification of the filtrate by chromatography gave 200 mg of the title compound. LC-MS (Method F): Rt=1.61min, [M+H] + =894

[0322] Step 6: trans-rac-tert-butyl 9-(4-(4-(5-fluoro-3- (3-hydroxy-4-isobutylpyrrolidine-1-carboxamido)-2-methylphen (nyl)-7H-pyrrolo[2,3-d]pyrimidin-6-yl)benzyl)-3,9-diazo Zaspiro[5.5]undecane-3-carboxylate In a 25 ml round-bottom flask, tert-butyl trans-rac-9-(4-(4-( 5-Fluoro-3-(3-hydroxy-4-isobutylpyrrolidine-1-carboxamide )-2-Methylphenyl)-7-(phenylsulfonyl)-7H-pyrrolo[2,3-d] Pyrimidin-6-yl)benzyl)-3,9-diazaspiro[5.5]undecane-3- Carboxylate (Step 5) (200 mg, 0.22 mmol) in DMSO (3 ml) and The mixture was stirred at RT for 15 min, and then the mixture was The mixture was cooled to 0°C, and an aqueous solution (1 ml) of NaOH (35 mg, 0.88 mmol) was added. The mixture was stirred at 0° C. for 30 min. The mixture was warmed to RT and stirred at RT for 16 h. Agela eluted with 5-90% ACN in water (10 mM NH4HCO3) Purification of the crude mixture by reversed-phase flash chromatography on a C18 column yielded 100 mg of the title compound as a yellow solid. LC-MS (Method F): Rt=1.48min, [M+H] + =754

[0323] Step 7: trans-rac-N-(3-(6-(4-(3,9-diazaspiro[5.5 ]undecan-3-ylmethyl)phenyl)-7H-pyrrolo[2,3-d]pyrimidine- 4-yl)-5-fluoro-2-methylphenyl)-3-hydroxy-4-isobutyl Roridin-1-carboxamide In a 50 ml round-bottom flask, trans-rac-tert-butyl 9-(4-(4-( 5-Fluoro-3-(-3-hydroxy-4-isobutylpyrrolidine-1-carboxamine (2-methylphenyl)-7H-pyrrolo[2,3-d]pyrimidin-6-yl)benzoate Diazabicyclo[5.5]undecane-3-carboxylate (110m g, 0.15 mmol) was suspended in DCM (5 ml). 4M HCl in dioxane Solution (4 ml, 16 mmol) was added and the RM was stirred at RT for 3 h. The resulting mixture was concentrated to dryness to give 120 mg of the title compound as the hydrochloride salt. as a grey solid. LC-MS (Method E): Rt=1.74min, [M+H] + =654

[0324] Step 8: trans-rac-N-(3-(6-(4-((9-(3-(2,4-dioxo-N-methylpropional) tetrahydropyrimidin-1(2H)-yl)-4-methoxybenzoyl)-3,9- Diazaspiro[5.5]undecan-3-yl)methyl)phenyl)-7H-pyrrolo[2 ,3-d]pyrimidin-4-yl)-5-fluoro-2-methylphenyl)-3-hydro 4-Isobutyl-2-pyrrolidine-1-carboxamide In a 25 ml round-bottom flask, trans-rac-N-(3-(6-(4-(3,9-dichloro-N-methyl-N- isopropyl ether) Azaspiro[5.5]undecan-3-ylmethyl)phenyl)-7H-pyrrolo[2,3 -d]pyrimidin-4-yl)-5-fluoro-2-methylphenyl)-3-hydroxy -4-Isobutylpyrrolidine-1-carboxamide (120 mg, 0.146 mmol) , 3-(2,4-dioxotetrahydropyrimidin-1(2H)-yl)-4-methoxy Benzoic acid (Intermediate 1a) (47 mg, 0.18 mmol) and DIPEA (78 mg, 0 HATU (68 mg, 0.1 mmol) was then suspended in DMF (3 ml). ACN and water (0.01 mmol) were added and the mixture was stirred at RT for 16 h. XBridge C18 column (2 M NH4HCO3 buffer) Purification of the RM by reverse-phase HPLC (1.2 x 250 mm, 10 μm) yielded 65 mg of the title compound. The compound was obtained as a white solid. LC-MS (Method E): Rt=1.73min,[M / 2+H] + =450.7. 1 H NMR(500MHz,DMSO-d6)δ 12.73(s,1H),10.3 4(s,1H),8.83(s,1H),7.92(d,J=8.2Hz,2H),7. 68(s,1H),7.49(dd,J=10.8,2.7Hz,1H),7.37(t d,J=11.0,4.9Hz,3H),7.32(d,J=2.1Hz,1H),7. 15(d,J=8.7Hz,1H),7.06(dd,J=8.8,2.8Hz,1H) ,6.76(d,J=2.8Hz,1H),5.12(d,J=4.5Hz,1H),3 .88-3.84(m,4H),3.68-3.64(m,2H),3.60-3.30 (m,7H),3.20-3.17(m,1H),3.09-3.06(m,1H),2 .67(t,J=6.4Hz,2H),2.36(s,4H),2.15-2.00(m ,4H),1.67-1.60(m,1H),1.50-1.34(m,10H),1. 16-1.07(m,1H),0.91(d,J=6.6Hz,3H),0.89(d, J = 6.6 Hz, 3H).

[0325] compound 6 (3R,4S)-N-(3-(6-(4-((9-(3-(2,4-dioxotetrahydrochloride 3,9-diazaspiro(4-methoxybenzoyl)-1(2H)-yl-4-pyrimidin-1(2H)-yl [5.5]undecan-3-yl)methyl)phenyl)-7H-pyrrolo[2,3-d]pi (Irimidin-4-yl)-5-fluoro-2-methylphenyl)-3-hydroxy-4-isopropyl Isobutylpyrrolidine-1-carboxamide [ka] Step 1: (3R,4S)—N-(5-fluoro-3-(6-(4-formylphenyl)- 7-(phenylsulfonyl)-7H-pyrrolo[2,3-d]pyrimidin-4-yl)-2 (-methylphenyl)-3-hydroxy-4-isobutylpyrrolidine-1-carboxamide In a 50 ml round bottom flask purged with N and maintained under an inert atmosphere, add (3R, 4S )-N-(5-fluoro-2-methyl-3-(4,4,5,5-tetramethyl-1,3, 2-Dioxaborolan-2-yl)phenyl)-3-hydroxy-4-isobutylpyrrolyl Zinc-1-carboxamide (Intermediate 7) (420 mg, 1 mmol), 4-(4-chloro -7-(phenylsulfonyl)-7H-pyrrolo[2,3-d]pyrimidin-6-yl)benzyl A mixture of benzoxaldehyde (intermediate 3b) (410 mg, 1.05 mmol), Na2CO3 (28 0 mg, 2.6 mmol) and PdCl2(dppf) (110 mg, 0.15 mmol) ACN (12 ml) and water (3 ml) were then added and the RM was stirred under N2 for 10 min. The mixture was stirred at 0°C for 2 h. Silica gel chromatography was performed eluting with 3-6% MeOH in DCM. Purification of the crude mixture by elution gave 500 mg of the title compound as a yellow solid. LC-MS (Method E): Rt=1.99min, [M+H] + =656;

[0326] Step 2: tert-Butyl 9-(4-(4-(5-fluoro-3-((3R,4S)-3 -Hydroxy-4-isobutylpyrrolidine-1-carboxamido)-2-methylphenyl )-7-(phenylsulfonyl)-7H-pyrrolo[2,3-d]pyrimidin-6-yl) benzyl)-3,9-diazaspiro[5.5]undecane-3-carboxylate In a 50 ml round-bottom flask, add (3R,4S)-N-(5-fluoro-3-(6-(4-chloro-2-methyl-2-propanol)-4-yl) (phenylphenyl)-7-(phenylsulfonyl)-7H-pyrrolo[2,3-d]pyrimidine -4-yl)-2-methylphenyl)-3-hydroxy-4-isobutylpyrrolidine-1 -carboxamide (500 mg, 0.76 mmol), tert-butyl 3,9-diaza Spiro[5.5]undecane-3-carboxylate (CAS 173405-78-2 ], 1 ClickChemistry, Inc.) (234mg, 0.92mmol) To the mixture, K2CO3 (207 mg, 1.5 mmol) and DMSO (3 ml) were added. After stirring at RT for 15 min, 1M ZnCl in THF (0.99 ml, 0.9 9 mmol) was added. The RM was then stirred at RT for 3 h, and NaBH3CN (37 A solution of 8 mg of RM in MeOH (3 ml) was added. After the addition, the RM was cooled to RT. The mixture was stirred for 16 hours and then filtered. Purification of the filtrate by reversed-phase flash chromatography on an Agela C18 column eluted at different concentrations. The workup gave 400 mg of the title compound as a yellow solid. LC-MS (Method F): Rt=1.50min, [M+H] + =894.

[0327] Step 3: tert-Butyl 9-(4-(4-(5-fluoro-3-((3R,4S)-3 -Hydroxy-4-isobutylpyrrolidine-1-carboxamido)-2-methylphenyl )-7H-pyrrolo[2,3-d]pyrimidin-6-yl)benzyl)-3,9-diaza Pyro[5.5]undecane-3-carboxylate In a 50 ml round-bottom flask, add tert-butyl 9-(4-(4-(5-fluoro-3-(( 3R,4S)-3-Hydroxy-4-isobutylpyrrolidine-1-carboxamide)-2 -methylphenyl)-7-(phenylsulfonyl)-7H-pyrrolo[2,3-d]pyrimidin (Di-6-yl)benzyl)-3,9-diazaspiro[5.5]undecane-3-carbo Add xylate (400 mg, 0.45 mmol) (step 2) and DMSO (2 ml). Next, an aqueous solution (1 ml) of NaOH (72 mg, 1.79 mmol) was added, and the RM The mixture was stirred at RT for 3 h. The RM was then poured into water (10 ml) and extracted with EtOAc. The combined organic layers were then dried to give a crude mixture. Purify the crude mixture by silica gel chromatography eluting with 3-6% MeOH in CM. This gave 160 mg of the title compound as a yellow solid. LC-MS (Method F): Rt=1.34min, [M+H] + =754

[0328] Step 4: (3R,4S)-N-(3-(6-(4-((3,9-diazaspiro[5.5] Undecane-3-yl)methyl)phenyl)-7H-pyrrolo[2,3-d]pyrimidine- 4-yl)-5-fluoro-2-methylphenyl)-3-hydroxy-4-isobutyl Roridin-1-carboxamide In a 50 ml round-bottom flask, add tert-butyl 9-(4-(4-(5-fluoro-3-(( 3R,4S)-3-Hydroxy-4-isobutylpyrrolidine-1-carboxamide)-2 -methylphenyl)-7H-pyrrolo[2,3-d]pyrimidin-6-yl)benzyl)- 3,9-diazaspiro[5.5]undecane-3-carboxylate (160 mg, 0. 21 mmol) and DCM (6 ml) were added. The RM was stirred at RT and 4M H A solution of Cl in dioxane (5 ml, 20 mmol) was added. The RM was stirred at RT for 2 h. and then concentrated to give 92 mg of the title compound as the hydrochloride salt as a yellow solid. Got it. LC-MS (Method F): Rt=1.02min, [M+H] + =654.

[0329] Step 5: (3R,4S)-N-(3-(6-(4-((9-(3-(2,4-dioxote tetrahydropyrimidin-1(2H)-yl)-4-methoxybenzoyl)-3,9-diazomethane Zaspiro[5.5]undecan-3-yl)methyl)phenyl)-7H-pyrrolo[2,3 -d]pyrimidin-4-yl)-5-fluoro-2-methylphenyl)-3-hydroxy 4-Isobutylpyrrolidine-1-carboxamide In a 50 ml round-bottom flask, add (3R,4S)-N-(3-(6-(4-((3,9-diaza spiro[5.5]undecan-3-yl)methyl)phenyl)-7H-pyrrolo[2,3- d]pyrimidin-4-yl)-5-fluoro-2-methylphenyl)-3-hydroxy- 4-Isobutylpyrrolidine-1-carboxamide (92 mg, 0.14 mmol), 3- (2,4-dioxotetrahydropyrimidin-1(2H)-yl)-4-methoxybenzoic acid Acid (Intermediate 1a) (45 mg, 0.17 mmol), DIPEA (91 mg, 0.71 mmol), mol) and DMF (3 ml) were added. Then, HATU (65 mg, 0.17 mmol) ) was added at RT and the RM was stirred at RT for 16 h. XBridge C18 column (containing NH4HCO3 buffer) eluted with a gradient Purification of RM by reversed-phase HPLC yielded 40 mg of RPMS. The title compound was obtained as a white solid. LC-MS (Method F): Rt=1.19min, [M+H] + =900. 1 H NMR(500MHz,DMSO-d6)δ 12.69(s,1H),10.3 3(s,1H),8.80(s,1H),7.92(d,J=8.2Hz,2H),7. 67(s,1H),7.49(dd,J=10.7,2.6Hz,1H),7.37-7 .35(m,3H),7.31(d,J=2.1Hz,1H),7.14(d,J=8. 7Hz,1H),7.05(dd,J=8.9,2.8Hz,1H),6.73(s,1 H),5.12(s,1H),3.89-3.84(m,4H),3.71-3.41( m,9H),3.20-3.17(m,1H),3.09-3.06(m,1H),2. 67(t,J=6.0Hz,2H),2.36(s,4H),2.09-2.04(m, 4H),1.65-1.60(m,1H),1.50-1.32(m,10H),1.1 6-1.08(m,1H),0.91(d,J=6.6Hz,3H),0.89(d,J =6.6Hz,3H).

[0330] compound 7 (3R,4R)-N-(3-(6-(4-(2-(9-(3-(2,4-dioxotetra Hydropyrimidin-1(2H)-yl)-4-methoxybenzoyl)-3,9-diaza pyrro[5.5]undecan-3-yl)ethyl)phenyl)-7H-pyrrolo[2,3-d ]pyrimidin-4-yl)-5-fluoro-2-methylphenyl)-3-hydroxy-4 -Isobutylpyrrolidine-1-carboxamide [ka] Step 1: (3S,4S)-tert-butyl 3-isobutyl-4-((4-nitrobenzoyl) (3R,4R)-tert-butyl)pyrrolidine-1-carboxylate and (3R,4R)-tert-butyl 3-isobutyl-4-((4-nitrobenzoyl)oxy)pyrrolidine-1-carboxylate Silat RT (trans-rac)-tert-butyl 3-hydroxy-4-isobutyl phenyl Roridin-1-carboxylate (Intermediate 6) (9.65 g, 39.7 mmol), 4- Nitrobenzoic acid (11 g, 65.2 mmol) and PPh3 (18 g, 65.2 mmol) ) in THF (250 ml) was added to DIAD (13 ml, 65. 5 mmol) was added dropwise. The resulting yellow solution was slowly warmed to RT for another 3 h. The RM was quenched with water and the THF was partially evaporated. EtOAc was added and the layers were separated. The aq. layer was extracted with EtOAc (3x) and the combined organic layers were diluted with 0.2M Wash with HCl and brine, dry over Na2SO4, filter and concentrate under reduced pressure This gave 50.2 g of crude product. Silica was eluted with 0-40% EtOAc in hexanes. Purification of one-quarter of the crude product by gel flash chromatography yielded 4.28 g of crude product. Product 1 was obtained. Silica gel flash chromatography eluting with 0-13% EtOAc in hexanes. Purification of the remaining 3 / 4 of the crude product by HPLC gave 3.98 g of products 2 and 6.5 7 g of product 3 was obtained. Silica gel flash elution with 0-25% EtOAc in hexanes yielded 7 g of product 3. Purification of product 2 by chromatography gave 2.56 g of product 4. Hexane Product 3 by silica gel flash chromatography eluting with 0-15% EtOAc in water. Purification of the product 1, 4 and 5 gave 5.97 g of product 5. The combined products 1, 4 and 5 were This gave 0.44g of the racemate.

[0331] Chiral separation of the racemate using SFC (preparative method 2) gave the individual enantiomers. After separation, each single enantiomer was analyzed by chiral HPLC (Method L) to confirm chiral purity. I checked the degree.

[0332] (3S,4S)-tert-butyl 3-isobutyl-4-((4-nitrobenzoyl)o (oxy)pyrrolidine-1-carboxylate: 6.01g First eluting peak (Peak 1) HPLC Rt (Method L) = 5.99 min. 1 H NMR(600MHz,DMSO-d6)δ ppm 0.79-0.92(m, 6H)1.29-1.35(m,1H)1.40(d,J=19.44Hz,10H)1 .46-1.60(m,1H)2.52-2.59(m,1H)3.04-3.16(m ,1H)3.42-3.51(m,1H)3.58-3.70(m,2H)5.47(t ,J=3.85Hz,1H)8.22(dd,J=8.80,3.30Hz,2H)8. 31-8.42(m,2H)

[0333] (3R,4R)-tert-butyl 3-isobutyl-4-((4-nitrobenzoyl)o (oxy)pyrrolidine-1-carboxylate: 6.09g Second eluting peak (Peak 2) HPLC Rt(Method L)=9.06min. 1 H NMR(600MHz,DMSO-d6)δ ppm 0.79-0.95(m, 6H)1.28-1.36(m,1H)1.40(d,J=19.44Hz,10H)1 .48-1.57(m,1H)2.52-2.59(m,1H)3.06-3.15(m ,1H)3.44-3.49(m,1H)3.60-3.70(m,2H)5.47(t ,J=3.94Hz,1H)8.22(dd,J=8.80,3.30Hz,2H)8. 30-8.46(m,2H)

[0334] Step 2: (3S,4S)-tert-butyl 3-hydroxy-4-isobutylpyrrolidine -1-carboxylate and (3R,4R)-tert-butyl 3-hydroxy-4-isopropyl Isobutylpyrrolidine-1-carboxylate (3S,4S)-tert-butyl 3-isobutyl-4-((4-nitrobenzoyl) oxy)pyrrolidine-1-carboxylate (first eluting peak from step 1) (5.8 g, A solution of 14.78 mmol) in MeOH (20 ml) was added to NaOH (14.78 ml, 29. 6 mmol) was added. The RM was stirred at RT for 30 min before adding EtOAc and water. The layers were separated and the organic layer was washed with water (2x) and brine (1x). , dried over Na2SO4, filtered, and concentrated under reduced pressure to give 3.331 g of the title compound. (3S,4S)-tert-butyl 3-hydroxy-4-isobutylpyrrolidine-1 -carboxylate was obtained. 1 H NMR(600MHz,DMSO-d6)δ ppm 0.83-0.91(m, 6H)1.17-1.23(m,1H)1.39(m,10H)1.49-1.58(m ,1H)2.00-2.11(m,1H)2.79-2.92(m,1H)3.19-3 .24(m,1H)3.26-3.32(m,1H)3.33(m,J=5.00Hz, 1H)3.98-4.02(m,1H)4.81(br s,1H).

[0335] (3R,4R)-tert-butyl 3-isobutyl-4-((4-nitrobenzoyl) oxy)pyrrolidine-1-carboxylate (second eluting peak from step 1) (5.8 g, A solution of 14.78 mmol) in MeOH (20 ml) was added to NaOH (14.78 ml, 29. 6 mmol) was added. The RM was stirred at RT for 1 h before being added to a mixture of EtOAc and water. The layers were separated and the organic layer was diluted with water (2x), 10% aq. citric acid (1x), Wash with brine (1x), dry over Na2SO4, filter, and concentrate under reduced pressure. 2.995 g of the title compound (3R,4R)-tert-butyl 3-hydroxy-4- Isobutyl pyrrolidine-1-carboxylate was obtained. 1 H NMR(600MHz,DMSO-d6)δ ppm 0.85-0.90(m, 6H)1.18-1.23(m,1H)1.39(m,10H)1.49-1.57(m ,1H)2.00-2.10(m,1H)2.81-2.91(m,1H)3.19-3 .24(m,1H)3.25-3.31(m,1H)3.31-3.34(m,1H)4 .01(m,1H)4.81(t,J=3.30Hz,1H).

[0336] Step 3: (3R,4R)-4-isobutylpyrrolidin-3-ol (3R,4R)-tert-butyl 3-hydroxy-4-isobutylpyrrolidine-1- A solution of carboxylate (2.99 g, 12.29 mmol) in DCM (7 ml) was added to 4M HCl in water (20 ml, 80 mmol) was added. The resulting solution was heated at RT The RM was then concentrated to an orange slurry and diluted with EtO to give a The precipitate formed was filtered, washed with Et2O, and Drying under vacuum gave 1.909 g of the title compound as the HCl salt as white crystals. . 1 H NMR(600MHz,DMSO-d6)δ ppm 0.88(dd,J=6. 60,2.57Hz,6H)1.14-1.28(m,1H)1.34-1.45(m, 1H)1.51-1.66(m,1H)2.07(dqd,J=11.55,7.61, 7.61,7.61,3.76Hz,1H)2.74(t,J=11.37Hz,1H) 3.06(d,J=12.10Hz,1H)3.16-3.28(m,2H)4.16( q,J=3.48Hz,1H)5.35(d,J=3.85Hz,1H)9.33(br s,2H).

[0337] Step 4: (3R,4R)-N-(5-fluoro-2-methyl-3-(4,4,5,5-tetrafluoroethane) tetramethyl-1,3,2-dioxaborolan-2-yl)phenyl)-3-hydroxy- 4-Isobutylpyrrolidine-1-carboxamide 5-Fluoro-2-methyl-3-(4,4,5,5-tetramethyl-1, 3,2-dioxaborolan-2-yl)aniline (commercially available or publicly available) According to the procedure of WO 2013 / 008095, page 37, intermediate 5 (Used as prepared) (1.2 g, 4.78 mmol) and DIPEA (3. A stirred solution of 34 ml of 19.12 mmol) in DCM (25 ml) in toluene at <0°C 20% phosgene (3.02 ml, 5.73 mmol) was added slowly. The resulting solution was stirred at 0°C for 10 min and then added to (3R,4R)-4-isobutylpyridine at 0°C. A stirred solution of roridin-3-ol (Step 3) (0.945 g, 5.26 mmol) in DCM (25 ml). The resulting mixture was stirred at 0° C. for 1 h. is concentrated and then poured into EtOAc / MeOH (9:1) and washed with water (3x) and brine. The organic layer was then dried over MgSO4 and concentrated under reduced pressure to give 2 Obtained 0.1 g of crude product. Eluted with 0-100% EtOAC in hexane (+5% EtOH). Purification of the crude product by silica gel flash chromatography gave 1.46 g of The title compound was obtained as a white foam. LC-MS (Method A): Rt=1.21min, [M+H] +=421.4.

[0338] Step 5: (3R,4R)-N-(5-fluoro-3-(6-(4-(2-hydroxyethyl) (phenyl)phenyl)-7H-pyrrolo[2,3-d]pyrimidin-4-yl)-2-methylphenyl (Nyl)-3-hydroxy-4-isobutylpyrrolidine-1-carboxamide 2-(4-(4-chloro-7H-pyrrolo[2,3-d]pyrimidin-6-yl)phenyl (3R,4R)-ethanol (Intermediate 17) (200 mg, 0.731 mmol), N-(5-fluoro-2-methyl-3-(4,4,5,5-tetramethyl-1,3,2- Dioxaborolan-2-yl)phenyl)-3-hydroxy-4-isobutylpyrrolidine -1-carboxamide (Step 4) (307 mg, 0.731 mmol) and KCO ( PdCl2(dppf) (5 3.5 mg, 0.073 mmol) followed by dioxane (3 ml). The resulting RM was stirred at 100°C for 30 min and cooled to RT. Purification by silica gel flash chromatography eluting with MeOH gave 294m g of the title compound was obtained. LC-MS (Method A): Rt=0.90min,[M+H] + =532.2.

[0339] Step 6: 4-(4-(5-fluoro-3-((3R,4R)-3-hydroxy-4-isopropyl Butylpyrrolidine-1-carboxamido)-2-methylphenyl)-7H-pyrrolo[2, 3-d]pyrimidin-6-yl)phenethyl methanesulfonate (3R,4R)-N-(5-fluoro-3-(6-(4-(2-hydro)- (oxyethyl)phenyl)-7H-pyrrolo[2,3-d]pyrimidin-4-yl)-2-methyl (ethylphenyl)-3-hydroxy-4-isobutylpyrrolidine-1-carboxamide ( Step 5) (294 mg, 0.553 mmol) and TEA (0.385 ml, 2.77 mm Ms2O (193 mg, 1.106 mmol) was added to a THF mixture (3 ml) of The RM was stirred at 0°C for 30 min before the solution was quenched with water at 0°C. The layers were separated and the aq. layer was extracted with DCM (2x). The combined organic layers were washed with Mg Dry over SO4, filter and evaporate at RT to give 343 mg of the title compound. Obtained as a yellow solid. LC-MS (Method A): Rt=0.97min,[M+H] + =610.3.

[0340] Step 7: tert-Butyl 9-(4-(4-(5-fluoro-3-((3R,4R)-3 -Hydroxy-4-isobutylpyrrolidine-1-carboxamido)-2-methylphenyl )-7H-pyrrolo[2,3-d]pyrimidin-6-yl)phenethyl)-3,9-diaza Spiro[5.5]undecane-3-carboxylate RT 4-(4-(5-fluoro-3-((3R,4R)-3-hydroxy-4-isopropyl) Butylpyrrolidine-1-carboxamido)-2-methylphenyl)-7H-pyrrolo[2, 3-d]pyrimidin-6-yl)phenethyl methanesulfonate (Step 6) (150 mg , 0.246 mmol), tert-butyl 3,9-diazaspiro[5.5]undecane HCl-3-carboxylate (188 mg, 0.738 mmol) and KCO (204 m ACN (6 ml) was added to a DMF solution (1.5 ml) of 1.476 mmol (g). The resulting RM was stirred at 60°C overnight and then cooled to RT. Yellow suspension After filtering, the filtrate was diluted with DCM / MeOH and filtered through a pad of silica. Concentration under reduced pressure gave 257 mg of the title compound. LC-MS (Method A): Rt=0.98min,[M+H] + =768.5.

[0341] Step 8: (3R,4R)-N-(3-(6-(4-(2-(3,9-diazaspiro[5. 5]Undecane-3-yl)ethyl)phenyl)-7H-pyrrolo[2,3-d]pyrimidin (4-phenyl-5-fluoro-2-methylphenyl)-3-hydroxy-4-isobutyl pyrrolidine-1-carboxamide tert-Butyl 9-(4-(4-(5-fluoro-3-((3R,4R)-3-hydrogen 4-Isobutylpyrrolidine-1-carboxamido)-2-methylphenyl)-7 H-Pyrrolo[2,3-d]pyrimidin-6-yl)phenethyl)-3,9-diazaspiro [5.5] Undecane-3-carboxylate (Step 7) (189 mg, 0.246 mm ol) and TFA (0.569 ml, 7.38 mmol) in orange DCM (5 ml) The mixture was stirred at RT for 2 h and then concentrated under reduced pressure. Reversed-phase flash chromatography on a Redisep® C18 column eluted with 100% ACN. Purification of the crude product by chromatography gave 87.3 mg of the title compound as the TFA salt. Got it. LC-MS (Method A): Rt=0.68min,[M+H] + =668.5.

[0342] Step 9: (3R,4R)-N-(3-(6-(4-(2-(9-(3-(2,4-dioxanediol) tetrahydropyrimidin-1(2H)-yl)-4-methoxybenzoyl)-3,9- Diazaspiro[5.5]undecan-3-yl)ethyl)phenyl)-7H-pyrrolo[2 ,3-d]pyrimidin-4-yl)-5-fluoro-2-methylphenyl)-3-hydro 4-Isobutyl-2-pyrrolidine-1-carboxamide (3R,4R)-N-(3-(6-(4-(2-(3,9-diazaspiro[5.5]u) (3-indecane-3-yl)ethyl)phenyl)-7H-pyrrolo[2,3-d]pyrimidine-4 -yl)-5-fluoro-2-methylphenyl)-3-hydroxy-4-isobutylpyrrolidone Lysine-1-carboxamide (Step 8) (87.3 mg, 0.086 mmol) and intermediate A mixture of 1a (25.1 mg, 0.095 mmol) and DMF (3 ml) was added to DIPEA ( 0.091 ml, 0.519 mmol) and HBTU (49.2 mg, 0.130 mmol) l) was added. The resulting RM was stirred under argon at RT for 2 h before being added water The resulting precipitate was filtered and dried under reduced pressure to give the crude product. Redisep® eluted with 10-100% ACN in (water + 0.1% TFA) Purification of the crude product by reversed-phase flash chromatography on a C18 column gave the title compound The title compound as the TFA salt was then dissolved in MeOH to give It was filtered through an SCX column and released from the SCX column with 7N ammonia in MeOH. The filtrate was then concentrated under reduced pressure to give 47.3 mg of the title compound. LC-MS (Method B): Rt=3.68min, [M+H] + =914.8. 1 H NMR(400MHz,DMSO-d6)δ ppm 12.69(s,1H), 10.33(s,1H),8.82(s,1H),7.88(br d,J=7.92H z,2H),7.63(s,1H),7.49(dd,J=10.78,2.57Hz, 1H),7.37(dd,J=8.51,1.91Hz,1H),7.27-7.34( m,3H),7.15(d,J=8.66Hz,1H),7.05(dd,J=8.80 ,2.64Hz,1H),6.74(s,1H),4.88(br d,J=3.37H z,1H),4.06-4.15(m,1H),3.84(s,3H),3.35-3. 65(m,9H),3.08(br t,J=8.88Hz,1H),2.71-2.8 2(m,2H),2.68(m,2H),2.52-2.61(m,2H),2.34- 2.47(m,4H),2.12-2.21(m,1H),2.09(s,3H),1. 56-1.63(m,1H),1.34-1.56(m,9H),1.21-1.30( m, 1H), 0.90 (d, J = 6.02 Hz, 6H).

[0343] compound 8 (3R,4S)-N-(3-(6-(4-((4-((1-(3-(2,4-dioxote tetrahydropyrimidin-1(2H)-yl)-4-methoxybenzoyl)piperidine-4 -yl)oxy)piperidin-1-yl)methyl)phenyl)-7H-pyrrolo[2,3- d]pyrimidin-4-yl)-5-fluoro-2-methylphenyl)-3-hydroxy- 4-Isobutylpyrrolidine-1-carboxamide [ka] The title compound can be prepared by analogy with compound 6 using compound 6, step 1, and intermediates 18 and 1b. It was prepared by the method. LC-MS (Method I): Rt=1.72min, [M+H] + =930.

[0344] compound 9 (cis-rac)-N-(3-(6-(4-((4-((1-(3-(2,4-dioxo) (isotetrahydropyrimidin-1(2H)-yl)-4-methoxybenzoyl)piperidine -4-yl)methyl)piperazin-1-yl)methyl)phenyl)-7H-pyrrolo[2, 3-d]pyrimidin-4-yl)-5-fluoro-2-methylphenyl)-3-hydroxy 4-isobutylpyrrolidine-1-carboxamide [ka] Step 1: (cis-rac)-tert-butyl 4-(4-(4-(5-fluoro-3-(3-hydroxybenzoyl) Hydroxy-4-isobutylpyrrolidine-1-carboxamido)-2-methylphenyl)- 7H-Pyrrolo[2,3-d]pyrimidin-6-yl)benzyl)piperazine-1-carbo Xylate RT 1-Boc-piperazine (77 mg, 0.413 mmol) (CAS 5726 0-71-6), TEA (0.100 ml, 0.717 mmol) and (cis-rac )-N-(5-fluoro-3-(6-(4-formylphenyl)-7H-pyrrolo[2,3 -d]pyrimidin-4-yl)-2-methylphenyl)-3-hydroxy-4-isobutene Ipirrolidine-1-carboxamide (214 mg, 0.345 mmol) (Intermediate 10) MeOH mixture (3 ml) of 0.7 M ZnCl2 in THF (0.500 ml, 0.3 50 mmol) was added. The resulting cloudy greenish solution was stirred at RT overnight. After stirring, NaBH3CN (22 mg, 0.350 mmol) was added to further dissolve the RM. Stirred at RT for 5 h. Then the RM was concentrated under reduced pressure. Redisep® C18 column reversed-phase flash eluted with 2-100% ACN Purification of the crude product by chromatography gave 99 mg of the title compound as the TFA salt. Got it. LC-MS (Method A): Rt=0.91min,[M+H] + =686.5

[0345] Step 2: (cis-rac)-N-(5-fluoro-2-methyl-3-(6-(4-(biphenyl)-2-yl)methyl)-2-methyl-4 ... Perazin-1-ylmethyl)phenyl)-7H-pyrrolo[2,3-d]pyrimidine-4- (yl)phenyl)-3-hydroxy-4-isobutylpyrrolidine-1-carboxamide (cis-rac)tert-butyl 4-(4-(4-(5-fluoro-3-hydroxybenzoyl) 4-isobutylpyrrolidine-1-carboxamido)-2-methylphenyl)-7H- Pyrrolo[2,3-d]pyrimidin-6-yl)benzyl)piperazine-1-carboxylate methylpropional (Step 1) (99 mg, 0.072 mmol) and 4M HCl in dioxane (0. A solution of 5 ml of 2.00 mmol) in MeOH (2 ml) was stirred at RT for 3 h. The RM was then concentrated under reduced pressure. Elution was performed with 2-100% ACN in (water + 0.1% TFA). Crude purification by reversed-phase flash chromatography on a Redisep® C18 column Purification of the product gave 61.5 mg of the title compound as a TFA salt. LC-MS (Method A): Rt=0.73min,[M+H] + =586.6.

[0346] Step 3: (cis-rac)-tert-butyl 4-((4-(4-(4-(5-fluoro-3- (3-hydroxy-4-isobutylpyrrolidine-1-carboxamido)-2-methylphen (7H-pyrrolo[2,3-d]pyrimidin-6-yl)benzyl)piperazine-1 -yl)methyl)piperidine-1-carboxylate RT (cis-rac)-N-(5-fluoro-2-methyl-3-(6-(4-(pyridyl)methyl)-2-methyl-2-methyl-3-(6-(4- ... Perazin-1-ylmethyl)phenyl)-7H-pyrrolo[2,3-d]pyrimidine-4- yl)phenyl)-3-hydroxy-4-isobutylpyrrolidine-1-carboxamide ( Step 2) (59 mg, 0.069 mmol), TEA (0.050 ml, 0.359 mm ol) and 1-Boc-piperidine-carboxaldehyde (17 mg, 0.080 mmol) A mixture of 1 ml of ZnCl2 in 0.7 M THF (0.120 ml, 0 The RM was stirred under argon at RT for 6 h. Then, N aBH3CN (6 mg, 0.095 mmol) was added and the RM was stirred overnight at RT. The RM was concentrated under reduced pressure to give 53.9 mg of the title compound. LC-MS (Method A): Rt=0.92min,[M+H] + =783.7.

[0347] Step 4: (cis-rac)-N-(5-fluoro-2-methyl-3-(6-(4-(( 4-(Piperidin-4-ylmethyl)piperazin-1-yl)methyl)phenyl)-7H -pyrrolo[2,3-d]pyrimidin-4-yl)phenyl)-3-hydroxy-4-iso Butylpyrrolidine-1-carboxamide (cis-rac)-tert-butyl 4-((4-(4-(4-(5-fluoro-3 -Hydroxy-4-isobutylpyrrolidine-1-carboxamido)-2-methylphenyl )-7H-pyrrolo[2,3-d]pyrimidin-6-yl)benzyl)piperazine-1-yl (methyl)piperidine-1-carboxylate (Step 3) (0.069 mmol) and A yellow solution of 4 M HCl in dioxane (0.5 ml, 2.00 mmol) in MeOH (1 ml) was stirred at RT for 2 h. The RM was concentrated under reduced pressure to give the title compound as the HCl salt. And got it. LC-MS (Method A): Rt=0.66min,[M+H] + =683.7.

[0348] Step 5: (cis-rac)-N-(3-(6-(4-((4-((1-(3-(2,4 -dioxotetrahydropyrimidin-1(2H)-yl)-4-methoxybenzoyl)pi 4-(4-(2 ... (2,3-d)pyrimidin-4-yl)-5-fluoro-2-methylphenyl)-3- Hydroxy-4-isobutylpyrrolidine-1-carboxamide A DMF solution (0.5 ml) of intermediate 1a (27 mg, 0.104 mmol) was added to NMM ( 0.025 ml, 0.227 mmol) followed by HATU (39 mg, 0.104 mmol) l) was added. The RM was stirred at RT for 30 min. Then, (cis-rac)-N- (5-fluoro-2-methyl-3-(6-(4-((4-(piperidin-4-ylmethyl )Piperazin-1-yl)methyl)phenyl)-7H-pyrrolo[2,3-d]pyrimidine -4-yl)phenyl)-3-hydroxy-4-isobutylpyrrolidine-1-carboxamide amide (Step 4) (52 mg, 0.069 mmol) and NMM (0.025 ml, 0.2 A DMF solution (0.5 ml) of 27 mmol of HCl was added dropwise to the RM, and the resulting yellow The mixture was stirred at RT for 2 days. Reversed-phase flash chromatography on a Redisep® C18 column eluted with 10% ACN Purification of the crude product by filtration gave 38 mg of the title compound as a white powder. LC-MS (Method B): Rt=3.68min,[M / 2+H] + =465.4. 1 H NMR(400MHz,DMSO-d6)δ ppm 12.72(s,1H); 10.32(s,1H),8.83(s,1H),7.92(d,J=7.95Hz,2 H),7.64(s,1H),7.46-7.52(m,1H),7.28-7.41( m,4H),7.14(d,J=8.44Hz,1H),7.05(dd,J=8.93 ,2.32Hz,1H),6.76(s,1H),4.95-4.85(m,1H),4 .15-4.05(m,1H),3.84(s,3H),3.65-3.55(m,3H ),3.38-3.54(m,4H)3.15-3.05(m,1H),2.70-2. 60(m,2H),2.35-2.48(m,12H),2.20-2.11(m,3H ),2.06-2.11(m,3H),1.64-1.81(m,2H),1.56-1 .63(m,1H),1.48-1.40(m,1H),1.22-1.30(m,1H ),1.00-1.15(m,3H),0.95-0.85(m,6H)

[0349] compound 10 (3S,4R)-N-(3-(6-(4-((4-((1-(3-(2,4-dioxote tetrahydropyrimidin-1(2H)-yl)-4-methoxybenzoyl)piperidine-4 -yl)methyl)piperazin-1-yl)methyl)phenyl)-7H-pyrrolo[2,3- d]pyrimidin-4-yl)-5-fluoro-2-methylphenyl)-3-hydroxy- 4-Isobutylpyrrolidine-1-carboxamide [ka] Step 1: tert-Butyl 4-(4-(5-fluoro-3-((3S,4R)-3 -Hydroxy-4-isobutylpyrrolidine-1-carboxamido)-2-methylphenyl )-7H-pyrrolo[2,3-d]pyrimidin-6-yl)benzyl)piperazine-1-carboxylate Ruboxylate Argon-degassed tert-butyl 4-(4-(4-chloro-7H-pyrrolo[2,3 -d]pyrimidin-6-yl)benzyl)piperazine-1-carboxylate (Intermediate 5 )(500mg, 1.110mmol), K2CO3(384mg, 2.78mmol) and (3S,4R)-N-(5-fluoro-2-methyl-3-(4,4,5,5-tetrafluoroethylene) Methyl-1,3,2-dioxaborolan-2-yl)phenyl)-3-hydroxy-4- Isobutylpyrrolidine-1-carboxamide (Intermediate 8) (500 mg, 1.13 mmol) l) Add PdCl2(dppf)-DCM to a 1:1 mixture of dioxane and water (10 ml) The RM was stirred at 100°C for 2 h, and then Then, it was cooled to RT and partitioned between EtOAc and water. Both layers were separated and the organic layer was The mixture was washed with water, dried over MgSO4, and concentrated under reduced pressure. Purification of the crude product by silica gel flash chromatography eluting with eOH gave 692 mg of the title compound was obtained as a brown residue. LC-MS (Method A): Rt=0.86min,[M+H] + =686.5.

[0350] Step 2: (3S,4R)-N-(5-fluoro-2-methyl-3-(6-(4-piperazinyl)methyl)-2-methyl-4-(4-(piperazinyl)methyl)-2-methyl-4-(4- ... (1-pyridin-1-ylmethyl)phenyl)-7H-pyrrolo[2,3-d]pyrimidin-4-yl )phenyl)-3-hydroxy-4-isobutylpyrrolidine-1-carboxamide tert-Butyl 4-(4-(4-(5-fluoro-3-((3S,4R)-3-hydrogen 4-Isobutylpyrrolidine-1-carboxamido)-2-methylphenyl)-7 H-Pyrrolo[2,3-d]pyrimidin-6-yl)benzyl)piperazine-1-carboxamide Silane (Step 1) (692 mg, 0.807 mmol) and 4 M HCl in dioxane (2 ml, 8.00 mmol) in brownish MeOH (2 ml) at RT. After stirring for 1 h, the RM was concentrated under reduced pressure. Reversed-phase flash chromatography on a Redisep® C18 column eluted with N Purification of the crude product by HCl afforded 570 mg of the title compound as the TFA salt. LC-MS (Method A): Rt=0.72min,[M+H] + =586.5.

[0351] Step 3: tert-Butyl 4-((4-(4-(4-(5-fluoro-3-((3S,4 R)-3-Hydroxy-4-isobutylpyrrolidine-1-carboxamido)-2-methyl Phenyl)-7H-pyrrolo[2,3-d]pyrimidin-6-yl)benzyl)piperazine -1-yl)methyl)piperidine-1-carboxylate RT (3S,4R)-N-(5-fluoro-2-methyl-3-(6-(4-piperazinyl)propanol) (1-pyridin-1-ylmethyl)phenyl)-7H-pyrrolo[2,3-d]pyrimidin-4-yl )phenyl)-3-hydroxy-4-isobutylpyrrolidine-1-carboxamide (step 2)(188mg, 0.269mmol), TEA(0.100ml, 0.717mmol) l) and 1-Boc-piperidine-carboxaldehyde (60 mg, 0.281 mmol ) in MeOH (2 ml) with 0.5 M ZnCl2 in THF (0.550 ml, 0.2 75 mmol) was added and the RM was stirred under argon at RT for 3 days. BH3CN (16 mg, 0.255 mmol) was added. The RM was stirred at RT overnight. The mixture was concentrated under reduced pressure. Red eluted with 2-100% ACN in water (water + 0.1% TFA). Purification of the crude product by reversed-phase flash chromatography on an isep® C18 column The preparation gave 223 mg of the title compound as the TFA salt. LC-MS (Method A): Rt=0.90min,[M+H] + =783.5.

[0352] Step 4: (3S,4R)-N-(5-fluoro-2-methyl-3-(6-(4-((4- (Piperidin-4-ylmethyl)piperazin-1-yl)methyl)phenyl)-7H-pi (2,3-d)pyrimidin-4-yl)phenyl)-3-hydroxy-4-isobutene pyrrolidine-1-carboxamide tert-Butyl 4-((4-(4-(4-(5-fluoro-3-((3S,4R)- 3-Hydroxy-4-isobutylpyrrolidine-1-carboxamido)-2-methylphenyl -7H-pyrrolo[2,3-d]pyrimidin-6-yl)benzyl)piperazine-1- (methyl)piperidine-1-carboxylate (Step 3) (0.246 mmol) and and a yellow solution of 4 M HCl in dioxane (1.5 ml, 6.00 mmol) in MeOH ( 2 ml) was stirred at RT for 2 h. The RM was concentrated under reduced pressure to give 100 mg of the title compound. The product was obtained as the HCl salt. LC-MS (Method A): Rt=0.63min,[M+H] + =683.6.

[0353] Step 5: (3S,4R)-N-(3-(6-(4-((4-((1-(3-(2,4-di Oxotetrahydropyrimidin-1(2H)-yl)-4-methoxybenzoyl)piperidin (4-yl)methyl)piperazin-1-yl)methyl)phenyl)-7H-pyrrolo[ 2,3-d]pyrimidin-4-yl)-5-fluoro-2-methylphenyl)-3-hydro 4-isobutyl-4-pyrrolidine-1-carboxamide 3-(2,4-dioxotetrahydropyrimidin-1(2H)-yl)-4-methoxy A solution of benzoic acid (Intermediate 1a) (40 mg, 0.151 mmol) in DMF (1 ml) was added to N MM (0.050 ml, 0.455 mmol) followed by HATU (59 mg, 0.155 The resulting RM was stirred at RT for 30 min before (3 S,4R)-N-(5-fluoro-2-methyl-3-(6-(4-((4-piperidine -4-ylmethyl)piperazin-1-yl)methyl)phenyl)-7H-pyrrolo[2,3 -d]pyrimidin-4-yl)phenyl)-3-hydroxy-4-isobutylpyrrolidine -1-carboxamide (Step 4) (100 mg, 0.131 mmol) and NMM (0. A solution of 0.050 ml of 0.455 mmol) in DMF (0.5 ml) was added dropwise to the mixture, The yellow RM was stirred at RT for 2 h and then concentrated under reduced pressure. (water + 0.1% NH Redisep® C18 column reversed phase eluted with 2-100% ACN in CO3 Purification of the crude product by flash chromatography gave a yellow suspension after evaporation of ACN. which was then filtered and dried under reduced pressure to give 70 mg of the title compound as a solid . LC-MS (Method B): Rt=3.55min,[M / 2+H] + =465.6. 1 H NMR(400MHz,DMSO-d6)δ 13.95(s,1H),10.3 2(s,1H),9.12(s,1H),8.20(d,J=7.8Hz,2H),7. 95-7.78(m,2H),7.66(d,J=10.8Hz,1H),7.55(s ,1H),7.38-7.31(m,2H),7.25-7.12(m,3H),3.9 5-3.65(m,10H),3.58-2.89(m,13H),2.67(m,2H) ),2.18-2.01(m,6H),1,99-1,82(m,2H),1.60(m ,1H),1.40-1.27(m,1H,)1.26-1.11(m,6H),0.8 8(m,6H).

[0354] compound 11 (3R,4S)-N-(3-(6-(4-((1-((1-(3-(2,4-dioxote tetrahydropyrimidin-1(2H)-yl)-4-methoxybenzoyl)piperidine-4 -yl)methyl)piperidin-4-yl)oxy)phenyl)-7H-pyrrolo[2,3- d]pyrimidin-4-yl)-5-fluoro-2-methylphenyl)-3-hydroxy- 4-Isobutylpyrrolidine-1-carboxamide [ka] Step 1: tert-Butyl 4-(4-(4,4,5,5-tetramethyl-1,3,2-diphenyl ether) Oxaborolan-2-yl)phenoxy)piperidine-1-carboxylate In a 500 ml round-bottom flask, tert-butyl 4-hydroxypiperidine-1-carboxamide Xylate (5g, 24.88mmol) (CAS 109384-19-2), 4-( 4,4,5,5-tetramethyl-1,3,2-dioxaborolan-2-yl)phenol (CAS 269409-70-3) (6 g, 27.36 mmol) and PPh3 (9. A mixture of 78 g (37.31 mmol) of dried THF (200 ml) was heated at 0°C for 5 minutes. Then, DIAD (10 g, 49.75 mmol) was added dropwise at 0° C. to give 3 The RM was then concentrated. The silica gel was purified by eluting with 20% EtOAc in petroleum ether. Purification of the residue by flash chromatography gave 3 g of the title compound as a white solid. Got it as a body. LC-MS (Method J): Rt=1.73min, [M+NH4] + =404.

[0355] Step 2: tert-Butyl 4-(4-(4-chloro-7-(phenylsulfonyl)-7H) -pyrrolo[2,3-d]pyrimidin-6-yl)phenoxy)piperidine-1-carboxamide Silat In a 100 ml round-bottom flask purged and maintained under an inert atmosphere, 4-chloro-6-iodo iodo-7-(phenylsulfonyl)-7H-pyrrolo[2,3-d]pyrimidine (Intermediate 2 ) (400 mg, 0.954 mmol), tert-butyl 4-(4-(4,4,5,5 -tetramethyl-1,3,2-dioxaborolan-2-yl)phenoxy)piperidine- 1-carboxylate (CAS 889865-34-3) (385 mg, 0.954 m mol), K2CO3 (289 mg, 2.1 mmol) and PdCl2(PPh3)2 ( 70 mg, 0.0954 mmol) was added. Then, ACN (12 ml) and H2O (3 ml) was added, and the mixture was stirred at 100°C for 2 hours. The mixture was filtered, and the filtrate was concentrated. The residue was extracted with EtOAc (30 ml) and the organic layer was washed with water and brine. The extract was evaporated, dried over Na2SO4, and concentrated under reduced pressure to give 542 mg of the title compound. LC-MS (Method I): Rt=2.28min, [M+H] + =570.

[0356] Step 3: tert-Butyl 4-(4-(5-fluoro-3-((3R,4S)-3 -Hydroxy-4-isobutylpyrrolidine-1-carboxamido)-2-methylphenyl )-7H-pyrrolo[2,3-d]pyrimidin-6-yl)phenoxy)piperidine-1- Carboxylate In a 100 ml round bottom flask purged and maintained under an inert atmosphere, tert-butyl 4- -(4-(4-chloro-7-(phenylsulfonyl)-7H-pyrrolo[2,3-d]pyrrol- (6-amino-4-phenyl)-phenoxy)piperidine-1-carboxylate (542 mg, 0. 954mmol), (3R,4S)-N-(5-fluoro-2-methyl-3-(4,4, 5,5-Tetramethyl-1,3,2-dioxaborolan-2-yl)phenyl)-3-phenyl Hydroxy-4-isobutylpyrrolidine-1-carboxamide (400 mg, 0.954 m mol), K2CO3 (289 mg, 2.1 mmol) and PdCl2(PPh3)2 ( 70 mg, 0.0954 mmol) was added. Then, ACN (12 ml) and H2O (3 ml) was added, and the mixture was stirred at 100° C. for 16 hours. The mixture was filtered, and the filtrate was The residue was extracted with EtOAc (3 x 300 ml) and washed with water and brine. , dried over Na2SO4 and concentrated under reduced pressure. Eluted with 10% MeOH in EtOAc Purification of the residue by silica gel chromatography afforded 300 mg of the title compound. Got it. LC-MS (Method I): Rt=2.02min,[M+H] + =687.

[0357] Step 4: (3R,4S)-N-(5-fluoro-2-methyl-3-(6-(4-(piperidinyl) (7H-pyrrolo[2,3-d]pyrimidin-4-yloxy)phenyl)-7H-pyrrolo[2,3-d]pyrimidin-4-yl )phenyl)-3-hydroxy-4-isobutylpyrrolidine-1-carboxamide In a 100 ml round-bottom flask, add tert-butyl 4-(4-(4-(5-fluoro-3-( (3R,4S)-3-Hydroxy-4-isobutylpyrrolidine-1-carboxamide)- 2-Methylphenyl)-7H-pyrrolo[2,3-d]pyrimidin-6-yl)phenoxy ) piperidine-1-carboxylate (300 mg, 0.437 mmol) and DCM ( 10 ml) was added. 4 M HCl solution in dioxane (1 ml, 1 mmol) was added at 0°C. The mixture was stirred at 0°C for 1 h. The solvent was removed and the residue was dried under vacuum. Drying gave 300 mg of the title compound as a white solid as the HCl salt. LC-MS (Method J): Rt=1.3min;MS m / z[M+H] + 587.

[0358] Step 5: tert-butyl 4-formylpiperidine-1-carboxylate Oxalyl chloride (5.86 g, 46.51 mmol) in dry DCM (40 ml) A mixture of DMSO (7.25 g, 93.02 mmol) and dry DCM (20 ml) was added at -78 °C. After stirring at -78°C for 30 minutes, N-Boc-4-piperidine methoxide was added. A mixture of 4g of ethanol (CAS 123855-51-6) (18.6mmol) in dry DCM The combined solution (40 ml) was added, and the mixture was stirred at -78°C for 30 minutes. (18.77 g, 186.05 mmol) was added at -78°C, and the RM was stirred for 30 min. The RM was then extracted with DCM (2 x 100 ml) and combined. The organic layer was washed with brine (100 ml), dried over Na2SO4, filtered, and Concentration under reduced pressure was followed by silica gel chromatography eluting with 25% EtOAc in petroleum ether. Purification of the crude product by filtration gave 3.04 g of the title compound. LC-MS (Method J): Rt=1.21min,[M+tBu+H] + =158.

[0359] Step 6: tert-Butyl 4-((4-(4-(4-(5-fluoro-3-((3R,4 S)-3-Hydroxy-4-isobutylpyrrolidine-1-carboxamido)-2-methyl Phenyl)-7H-pyrrolo[2,3-d]pyrimidin-6-yl)phenoxy)piperidin (1-methyl-1-phenyl)piperidine-1-carboxylate In a 100 ml round-bottom flask, add (3R,4S)-N-(5-fluoro-2-methyl-3- (6-(4-(piperidin-4-yloxy)phenyl)-7H-pyrrolo[2,3-d] Pyrimidin-4-yl)phenyl)-3-hydroxy-4-isobutylpyrrolidine-1- A solution of carboxamide hydrochloride (280 mg, 0.449 mmol) in DMF (4 m 1) and TEA (49 mg, 0.493 mmol) were added. The mixture was stirred at RT for 10 min. After stirring, tert-butyl 4-formylpiperidine-1-carboxylate (CAS 1 37076-22-3) (287 mg, 1.34 mmol) and 1 M ZnCl2 in TH Solution F (0.67 ml, 0.67 mmol) was added. The mixture was stirred at RT for 2 h. Then, NaBH3CN (170 mg, 2.68 mmol) was added and the mixture was allowed to cool to RT. The RM was filtered and the solid was washed with DMF (1 ml). Agela C18 column reverse eluted with 0-60% ACN in NH4HCO3 buffer Purification of the filtrate by phase flash chromatography (Biotage) yielded 210 mg of the title compound as a solid. LC-MS (Method G): Rt=1.39min, [M+H] + =784.

[0360] Step 7: (3R,4S)—N-(5-fluoro-2-methyl-3-(6-(4-((1- (Piperidin-4-ylmethyl)piperidin-4-yl)oxy)phenyl)-7H-pi (2,3-d)pyrimidin-4-yl)phenyl)-3-hydroxy-4-isobutene Pyrrolidine-1-carboxamide hydrochloride In a 100 ml round-bottom flask, add tert-butyl 4-((4-(4-(4-(5-fluoro -3-((3R,4S)-3-hydroxy-4-isobutylpyrrolidine-1-carboxamide (2-methylphenyl)-7H-pyrrolo[2,3-d]pyrimidin-6-yl)phenyl (phenoxy)piperidin-1-yl)methyl)piperidine-1-carboxylate (137 mg, 0.175 mmol) and DCM (10 ml) were added. A solution of ethanol (1 ml, 4 mmol) was added and the mixture was stirred at RT for 1 h. Concentration under reduced pressure gave 100 mg of the title compound as a yellow solid as the HCl salt. LC-MS (Method I): Rt=1.67min,[M+H] + =684.

[0361] Step 8: (3R,4S)-N-(3-(6-(4-(1-((1-(3-(2,4-geo) 1(2H)-1-(4-methoxybenzoyl)-1(2H)-pyrimidin-1(2H)-yl (phenyl-4-yl)methyl)piperidin-4-yloxy)phenyl)-7H-pyrrolo[2, 3-d]pyrimidin-4-yl)-5-fluoro-2-methylphenyl)-3-hydroxy 4-isobutylpyrrolidine-1-carboxamide In a 100 ml round-bottom flask, add (3R,4S)-N-(3-(6-(4-(2-(3,9 -diazaspiro[5.5]undecan-3-yl)ethyl)phenyl)-7H-pyrrolo[ 2,3-d]pyrimidin-4-yl)-5-fluoro-2-methylphenyl)-3-hydro 4-isobutylpyrrolidine-1-carboxamide hydrochloride (100 mg, 0.137 mmol), TEA (0.54 ml, 0.27 mmol) and DMF (5 ml Then, intermediate 1b (60 mg, 0.27 mmol) was added at 0° C. The mixture was stirred at RT for 1 h. ACN and water (0.01 M NH4HCO3 buffer) were added. XBridge C18 column (21.2 × 250 mm, 10 μm) was used for elution with a gradient of ) Purification of the mixture by reverse phase HPLC gave 27 mg of the title compound as a white solid. Ta. LC-MS (Method I): Rt=1.75min, [M+H] + =931. 1 H NMR(500MHz,DMSO-d6)δ 12.63(m,1H),10.3 4(s,1H),8.8(s,1H),7.89(d,J=8.0Hz,2H),7.6 7(s,1H),7.49(dd,J1=3.0Hz,J2=8.0Hz,1H),7. 37-7.31(m,2H),7.16(d,J=9.0Hz,1H),7.06-7. 02(m,3H),6.65(s,1H),5.13(m,1H),4.46(m,2H ),3.88-3.84(m,4H),3.67-3.58(m,5H),3.2(m, 1H),3.07(m,2H),2.69(m,5H),2.17(m,4H),2.0 8(m,4H),1.94(m,2H),1.79-1.59(m,6H),1.35( m,1H),1.15-1.05(m,3H),0.9(m,6H).

[0362] compound 12 (3R,4S)-N-(3-(6-(4-((4-((1-(3-(2,4-dioxote tetrahydropyrimidin-1(2H)-yl)-4-methoxybenzoyl)piperidine-4 -yl)methyl)piperazin-1-yl)methyl)phenyl)-7H-pyrrolo[2,3- d]pyrimidin-4-yl)-5-fluoro-2-methylphenyl)-3-hydroxy- 4-Isobutylpyrrolidine-1-carboxamide [ka] Step 1: tert-Butyl 4-((4-(4-(4-(5-fluoro-3-((3R,4 S)-3-Hydroxy-4-isobutylpyrrolidine-1-carboxamido)-2-methyl Phenyl)-7H-pyrrolo[2,3-d]pyrimidin-6-yl)benzyl)piperazine -1-yl)methyl)piperidine-1-carboxylate RT (3R,4S)-N-(5-fluoro-2-methyl-3-(6-(4-piperazinyl)methyl)-2-methyl ... (1-pyridin-1-ylmethyl)phenyl)-7H-pyrrolo[2,3-d]pyrimidin-4-yl )phenyl)-3-hydroxy-4-isobutylpyrrolidine-1-carboxamide (intermediate Body 11) (128mg, 0.195mmol), TEA (0.100ml, 0.717m mol) and 1-Boc-piperidine-carboxaldehyde (50 mg, 0.234 mm ol) in MeOH (2 ml) was added to 0.7 M ZnCl2 in THF (0.300 ml, 0.210 mmol) was added and the resulting RM was stirred under argon at RT for 7 h. Then, NaBH3CN (14 mg, 0.223 mmol) was added and the RM was heated to RT. The mixture was stirred at rt for 4 days and concentrated under reduced pressure to give 153 mg of the title compound. LC-MS (Method A): Rt=0.91min,[M+H] + =783.7.

[0363] Step 2: (3R,4S)—N-(5-fluoro-2-methyl-3-(6-(4-((4- (Piperidin-4-ylmethyl)piperazin-1-yl)methyl)phenyl)-7H-pi (2,3-d)pyrimidin-4-yl)phenyl)-3-hydroxy-4-isobutene pyrrolidine-1-carboxamide tert-Butyl 4-((4-(4-(4-(5-fluoro-3-((3R,4S)- 3-Hydroxy-4-isobutylpyrrolidine-1-carboxamido)-2-methylphenyl -7H-pyrrolo[2,3-d]pyrimidin-6-yl)benzyl)piperazine-1- (methyl)piperidine-1-carboxylate (Step 1) (0.195 mmol) and and a yellow solution of 4 M HCl in dioxane (1 ml, 4.00 mmol) in MeOH (2 ml l) was stirred at RT for 2 h, and then the RM was concentrated under reduced pressure. (water + 0.1% TFA Redisep® C18 column reversed-phase flushing eluted with 2-100% ACN in Purification of the crude product by chromatography gave 160 mg of the title compound as a TFA salt. was obtained as. LC-MS (Method A): Rt=0.65min,[M+H] + =683.7.

[0364] Step 3: (3R,4S)-N-(3-(6-(4-((4-((1-(3-(2,4-di) Oxotetrahydropyrimidin-1(2H)-yl)-4-methoxybenzoyl)piperidin (4-yl)methyl)piperazin-1-yl)methyl)phenyl)-7H-pyrrolo[ 2,3-d]pyrimidin-4-yl)-5-fluoro-2-methylphenyl)-3-hydro 4-isobutyl-4-pyrrolidine-1-carboxamide 3-(2,4-dioxotetrahydropyrimidin-1(2H)-yl)-4-methoxy A solution of benzoic acid (Intermediate 1a) (46 mg, 0.174 mmol) in DMF (1 ml) was added to N MM (0.050 ml, 0.455 mmol) followed by HATU (67 mg, 0.176 The resulting RM was stirred at RT for 30 min before (3 R,4S)-N-(5-fluoro-2-methyl-3-(6-(4-((4-piperidine -4-ylmethyl)piperazin-1-yl)methyl)phenyl)-7H-pyrrolo[2,3 -d]pyrimidin-4-yl)phenyl)-3-hydroxy-4-isobutylpyrrolidine -1-carboxamide (Step 2) (160 mg, 0.158 mmol) and NMM (0. A solution of 0.050 ml of 0.455 mmol) in DMF (0.5 ml) was added dropwise to the mixture, The yellow RM was stirred at RT for 3 h and then concentrated under reduced pressure. (water + 0.1% NH4 Redisep® C18 column reverse eluted with 2-100% ACN in HCl Purification of the crude product by phase flash chromatography afforded 127 mg of the title compound. Obtained as a white powder. LC-MS (Method B): Rt=3.63min,[M / 2+H] + =465.5. 1 H NMR(400MHz,DMSO-d6)δ 12.72(s,1H),10.3 2(s,1H),8.83(s,1H),7.92(d,J=7.8Hz,2H),7. 67(s,1H),7.49(dd,J=10.8,2.7Hz,1H),7.45-7 .27(m,4H),7.14(d,J=8.5Hz,1H),7.05(dd,J=9 .1,2.7Hz,1H),6.76(s,1H),5.12(d,J=4.6Hz,1 H),4.35(s,1H),3.85(s,4H),3.62(dt,J=26.9, 7.8Hz,5H),3.48(s,2H),3.19(dt,J=8.6,4.7Hz ,1H),3.14-3.04(m,1H),2.73-2.60(m,2H),2.3 7(s,7H),2.09(d,J=11.7Hz,7H),1.85-1.53(m, 4H),1.35(dt,J=13.9,6.7Hz,1H),1.21-0.96(m ,3H),0.89(t,J=7.6Hz,6H).

[0365] compound 13 (3R,4S)-N-(3-(6-(4-(2-(4-((1-(3-(2,4-dioxo) (isotetrahydropyrimidin-1(2H)-yl)-4-methoxybenzoyl)piperidine -4-yl)oxy)piperidin-1-yl)ethyl)phenyl)-7H-pyrrolo[2, 3-d]pyrimidin-4-yl)-5-fluoro-2-methylphenyl)-3-hydroxy 4-isobutylpyrrolidine-1-carboxamide [ka] Step 1: tert-Butyl 4-((1-(4-(4,4,5,5-tetramethyl-1,3 ,2-Dioxaborolan-2-yl)phenethyl)piperidin-4-yl)oxy)piperidine Lysine-1-carboxylate In a 100 ml round-bottom flask, add 4-(4,4,5,5-tetramethyl-1,3,2-dioxa Saborolan-2-yl)phenethyl methanesulfonate (1 g, 3.0 mmol), te rt-Butyl 4-(piperidin-4-yloxy)piperidine-1-carboxylate ( Intermediate 18) (1.7 g, 6.0 mmol), K2CO3 (828 mg, 6.0 mmol) ), KI (50 mg, 0.3 mmol) and ACN (20 ml) were added. The RM was heated to 50°C. The mixture was stirred at RT for 16 h and then filtered. The filter cake was washed with DCM (2 x 30 ml). The crude mixture was purified by silica gel eluting with 0-10% MeOH in DCM. Purification by column chromatography gave 1.3 g of the title compound as a white solid. Ta. LC-MS (Method I): Rt=2.54min, [M+H] + =515.

[0366] Step 2: tert-butyl 4-((1-(4-(4-chloro-7-(phenylsulfonyl )-7H-pyrrolo[2,3-d]pyrimidin-6-yl)phenethyl)piperidine-4- (yl)oxy)piperidine-1-carboxylate In a 100 ml round-bottom flask purged and maintained under an inert atmosphere, 4-chloro-6-iodo 7-(phenylsulfonyl)-7H-pyrrolo[2,3-d]pyrimidine (intermediate 2) (163 mg, 0.39 mmol), tert-butyl 4-((1-(4-(4,4,5 ,5-Tetramethyl-1,3,2-dioxaborolan-2-yl)phenethyl)piperidinyl (4-amino-4-yl)oxy)piperidine-1-carboxylate (Step 1) (200 mg, 0 0.39 mmol), Na2CO3 (83 mg, 0.78 mmol) and PdCl2 (dp pf)-CH2Cl2 (43 mg, 0.06 mmol) was added. Then, ACN (8 ml ) and water (2 ml) were added, and the RM was stirred at 100 °C under N2 for 16 h. It was diluted with water (10 ml) and extracted with DCM (4 x 20 ml). The crude mixture was dried over Na2SO4 and concentrated under reduced pressure. Purification by silica gel chromatography eluting with H gave 130 mg of the title compound t ert-butyl 4-((1-(4-(4-chloro-7-(phenylsulfonyl)-7H- Pyrrolo[2,3-d]pyrimidin-6-yl)phenethyl)piperidin-4-yl)oxy (c) Piperidine-1-carboxylate (P1) was obtained as a yellow solid and 50 mg of t ert-butyl 4-((1-(4-(4-chloro-7H-pyrrolo[2,3-d]pyrimidinyl) (6-phenyl)phenethyl)piperidin-4-yl)oxy)piperidine-1-carboxylate The sylate was obtained as a yellow solid (P2). P1:LC-MS(Method I):Rt=2.42min,[M+H] + =680. P2: LC-MS (Method I): Rt=2.16min, [M+H] + =540.

[0367] Step 3: tert-Butyl 4-((1-(4-(4-(5-fluoro-3-((3R,4 S)-3-Hydroxy-4-isobutylpyrrolidine-1-carboxamido)-2-methyl Phenyl)-7H-pyrrolo[2,3-d]pyrimidin-6-yl)phenethyl)piperidin (4-phenyl)oxy)piperidine-1-carboxylate P1 (130 ml) from step 2 was added to a 100 ml round bottom flask purged and maintained under an inert atmosphere. mg, 0.19 mmol), P2 from step 2 (50 mg, 0.09 mmol), intermediate 7 ( 114 mg, 0.28 mmol), Na2CO3 (74 mg, 0.7 mmol) and Pd Cl2(dppf)-CH2Cl2 (30 mg, 0.04 mmol) was added. ACN( 8 ml) and water (2 ml) were added and the RM was stirred at 100° C. under N 2 for 16 h. The RM was diluted with water (10 ml) and extracted with DCM (4 x 20 ml). The organic layer was dried over Na2SO4 and concentrated under reduced pressure. The crude mixture was diluted with 0-10% DCM Purification by silica gel chromatography eluting with 10% MeOH gave 85 mg of the title compound. The mixture was obtained as a deep yellow solid. LC-MS (Method I): Rt=2.03min,[M+H] + =798.

[0368] Step 4: (3R,4S)—N-(5-fluoro-2-methyl-3-(6-(4-(2-( 4-(Piperidin-4-yloxy)piperidin-1-yl)ethyl)phenyl)-7H -pyrrolo[2,3-d]pyrimidin-4-yl)phenyl)-3-hydroxy-4-iso Butylpyrrolidine-1-carboxamide In a 50 ml round-bottom flask, add tert-butyl 4-((1-(4-(4-(5-fluoro- 3-((3R,4S)-3-hydroxy-4-isobutylpyrrolidine-1-carboxamine (2-methylphenyl)-7H-pyrrolo[2,3-d]pyrimidin-6-yl)phenyl (Nethyl)piperidin-4-yl)oxy)piperidine-1-carboxylate (Step 3) (85 mg, 0.1 mmol) and DCM (3 ml) were added and the RM was stirred at RT. A solution of 4M HCl in dioxane (3 ml, 12 mmol) was slowly added. The RM was then stirred at RT for 1 h and then concentrated under reduced pressure to give 120 mg of the title compound. was obtained as a yellow solid as the HCl salt. LC-MS (Method F): Rt=1.40min, [M+H] + =698.

[0369] Step 5: (3R,4S)-N-(3-(6-(4-(2-(4-((1-(3-(2,4) -dioxotetrahydropyrimidin-1(2H)-yl)-4-methoxybenzoyl)pi (4-pyridin-4-yl)oxy)piperidin-1-yl)ethyl)phenyl)-7H-pyrro (2,3-d)pyrimidin-4-yl)-5-fluoro-2-methylphenyl)-3- Hydroxy-4-isobutylpyrrolidine-1-carboxamide In a 25 ml round-bottom flask, add (3R,4S)-N-(5-fluoro-2-methyl-3-(6 -(4-(2-(4-(piperidin-4-yloxy)piperidin-1-yl)ethyl) (phenyl)-7H-pyrrolo[2,3-d]pyrimidin-4-yl)phenyl)-3-hydroxy 4-isobutylpyrrolidine-1-carboxamide (Step 4) (120 mg, 0. 1mmol), pentafluorophenyl 3-(2,4-dioxotetrahydropyrimidine -1(2H)-yl)-4-methoxybenzoate (43 mg, 0.1 mmol) (intermediate Compound 1b), DIPEA (64 mg, 0.5 mmol) and DMF (2 ml) were added. M was stirred at RT for 2 h. RM was diluted with 0.01 M NH4HCO3 in water / ACN Preparative HPLC (XBridge C18, 21.2 × 250 mm, 10 μL) m) to give 40 mg of the title compound as a white solid. LC-MS (Method I): Rt=1.71min, [M+H] + =944. 1 H NMR(500MHz,DMSO-d6)δ 8.82(s,1H),7.87( d,J=8.1Hz,2H),7.67(s,1H),7.49(dd,J=10.7, 2.7Hz,1H),7.38(dd,J=8.4,2.1Hz,1H),7.35-7 .30(m,3H),7.15(d,J=8.6Hz,1H),7.06(dd,J=8 .9,2.7Hz,1H),6.74(s,1H),5.12(s,1H),3.95- 3.79(m,5H),3.72-3.55(m,6H),3.43(s,1H),3. 27-3.13(m,4H),3.11-3.04(m,1H),2.83-2.71( m,4H),2.68(t,J=6.6Hz,2H),2.20-1.95(m,6H) ,1.87-1.75(m,4H),1.66-1.58(m,1H),1.45-1. 31(m,5H),1.17-1.08(m,1H),0.91-0.88(m,6H) .

[0370] compound 14 (3R,4S)-N-(3-(6-(4-((1-((1-(3-(2,4-dioxote tetrahydropyrimidin-1(2H)-yl)-4-methoxybenzoyl)piperidine-4 -yl)methyl)piperidin-4-yl)methoxy)phenyl)-7H-pyrrolo[2,3 -d]pyrimidin-4-yl)-5-fluoro-2-methylphenyl)-3-hydroxy 4-Isobutylpyrrolidine-1-carboxamide [ka] Step 1: tert-Butyl 4-((4-(4,4,5,5-tetramethyl-1,3,2- Dioxaborolan-2-yl)phenoxy)methyl)piperidine-1-carboxylate 4-Hydroxyphenylboronic acid pinacol ester (4.5 g, 20.44 m mol), tert-butyl 4-(hydroxymethyl)piperidine-1-carboxylate PPh3 (4 g, 18.58 mmol) and PPh3 (7.3 g, 27.9 mmol) in THF To the solution (70 ml) was added dropwise DIAD (5.4 ml, 27.8 mmol) under argon. The resulting solution was stirred at RT for 3 days. It was then diluted with EtOAc and The layers were separated and the organic layer was washed with brine and MgSO The silica was dried over 4 and concentrated under reduced pressure. Elution with 0-15% EtOAc in CHX Purification of the crude product by gel flash chromatography gave 1.636 g of the title compound. I got something. LC-MS (Method A): Rt=1.51min, [M+H]+ =418.2.

[0371] Step 2: 4-((4-(4,4,5,5-tetramethyl-1,3,2-dioxaborolane -2-yl)phenoxy)methyl)piperidine tert-Butyl 4-((4-(4,4,5,5-tetramethyl-1,3,2-dioxa Saborolan-2-yl)phenoxy)methyl)piperidine-1-carboxylate (step 1) (1.626 g, 3.70 mmol) and 4 M HCl in dioxane (10 ml, 4 0.00 mmol) in a 1:1 DCM / MeOH solution (10 ml) was stirred at RT for 5 h. and then concentrated under reduced pressure to give 1.347 g of the title compound as a white solid, HCl salt. was obtained as. LC-MS (Method A): Rt=0.83min,[M+H] + =318.1.

[0372] Step 3: tert-Butyl 4-((4-((4-(4,4,5,5-tetramethyl-1, 3,2-Dioxaborolan-2-yl)phenoxy)methyl)piperidin-1-yl)methyl (ethyl)piperidine-1-carboxylate RT 4-((4-(4,4,5,5-tetramethyl-1,3,2-dioxaborolane (2-yl)phenoxy)methyl)piperidine (Step 2) (348 mg, 0.886 mm ol), TEA (0.300 ml, 2.152 mmol) and 1-Boc-piperidine- 4-Carboxaldehyde (200 mg, 0.919 mmol) in MeOH (8 ml) 0.5M ZnCl2 in THF (2 ml, 1.000 mmol) was added to the RM. The mixture was stirred under nitrogen at RT for 1 h. Then NaBH3CN (60 mg, 0.955 mmol) was added. l) was added. The RM was stirred at RT for 1.5 h and concentrated under reduced pressure. Silica gel flash chromatography eluting with 15% DCM / MeOH / NH3 (95:4:1) Purification of the crude product by chromatography gave 372 mg of the title compound as a colorless residue. And got it. LC-MS (Method A): Rt=1.05min, [M+H] + =515.3.

[0373] Step 4: tert-Butyl 4-((4-((4-chloro-7H-pyrrolo[2,3- d]pyrimidin-6-yl)phenoxy)methyl)piperidin-1-yl)methyl)piperidine Lysine-1-carboxylate 4-chloro-6-iodo-7H-pyrrolo[2,3-d]pyrimidine degassed with argon (177mg, 0.633mmol), Cs2CO3(516mg, 1.583mmol) ) and tert-butyl 4-((4-((4-(4,4,5,5-tetramethyl-1,3 ,2-Dioxaborolan-2-yl)phenoxy)methyl)piperidin-1-yl)methyl (I)piperidine-1-carboxylate (Step 3) (362 mg, 0.633 mmol) In a 1:1 mixture of dioxane and water (6 ml), PdCl2(dppf)-CH2Cl2(5 The resulting RM was heated at 100°C for 5 h. After stirring, the mixture was cooled to RT and partitioned between EtOAc and water. The layers were allowed to separate. The organic layer was washed with brine, dried over MgSO4 and concentrated under reduced pressure. Silica gel flash eluted with 0-60% DCM / MeOH / NH3 (95:4:1) Purification of the crude product by microchromatography gave 268 mg of the title compound as a beige was obtained as a solid. LC-MS (Method A): Rt=0.93min,[M+H] + =540.3 / 542.2 .

[0374] Step 5: tert-Butyl 4-((4-((4-(4-(5-fluoro-3-((3R, 4S)-3-Hydroxy-4-isobutylpyrrolidine-1-carboxamido)-2-methyl (phenyl)-7H-pyrrolo[2,3-d]pyrimidin-6-yl)phenoxy)methyl )Piperidin-1-yl)methyl)piperidine-1-carboxylate Argon-degassed tert-butyl 4-((4-((4-chloro-7H-pyrrolidine) (2,3-d)pyrimidin-6-yl)phenoxy)methyl)piperidin-1-yl) Methyl)piperidine-1-carboxylate (Step 4) (134 mg, 0.223 mmol) l), K2CO3 (77 mg, 0.558 mmol) and (3R,4S)-N-(5-furan) Fluoro-2-methyl-3-(4,4,5,5-tetramethyl-1,3,2-dioxaboro) (2-yl)phenyl)-3-hydroxy-4-isobutylpyrrolidine-1-carbo oxamide (Intermediate 7) (113 mg, 0.268 mmol) in a 1:1 mixture of dioxane and water The solution (3 ml) was added to PdCl2(dppf)-CH2Cl2 adduct (18 mg, 0.022 m mol) was added and the resulting RM was stirred at 100°C for 2 h. The resulting solution was cooled to RT and filtered through Hyflo® (filter material). The filtrate was concentrated under reduced pressure. R was eluted with 2 to 100% ACN in (water + 0.1% TFA). Crude product by reversed-phase flash chromatography on an edisep® C18 column Purification of afforded 201 mg of the title compound as a TFA salt as a yellow solid. LC-MS (Method A): Rt=0.96min,[M+H] + =798.5.

[0375] Step 6: (3R,4S)—N-(5-fluoro-2-methyl-3-(6-(4-((1- (Piperidin-4-ylmethyl)piperidin-4-yl)methoxy)phenyl)-7H- Pyrrolo[2,3-d]pyrimidin-4-yl)phenyl)-3-hydroxy-4-isobutyrate Tylpyrrolidine-1-carboxamide tert-Butyl 4-((4-((4-(4-(5-fluoro-3-((3R,4S) -3-hydroxy-4-isobutylpyrrolidine-1-carboxamido)-2-methylphen (Nyl)-7H-pyrrolo[2,3-d]pyrimidin-6-yl)phenoxy)methyl)piperidine Lysin-1-yl)methyl)piperidine-1-carboxylate (Step 5) (201 mg , 0.198 mmol) and 4 M HCl in dioxane (1 ml, 8.00 mmol) The MeOH solution (1 ml) was stirred at RT for 2 h and then concentrated under reduced pressure. Redisep® C18 column eluted with 2-100% ACN in 1% TFA Purification of the crude product by reversed-phase flash chromatography gave 133 mg of the title compound. The product was obtained as a TFA salt as a yellow powder. LC-MS (Method A): Rt=0.70min,[M+H] + =698.7.

[0376] Step 7: (3R,4S)-N-(3-(6-(4-((1-((1-(3-(2,4-di) Oxotetrahydropyrimidin-1(2H)-yl)-4-methoxybenzoyl)piperidin (4-methyl)piperidin-4-yl)methoxy)phenyl)-7H-pyrrolo [2,3-d]pyrimidin-4-yl)-5-fluoro-2-methylphenyl)-3- Hydroxy-4-isobutylpyrrolidine-1-carboxamide 3-(2,4-dioxotetrahydropyrimidin-1(2H)-yl)-4-methoxy A solution of benzoic acid (Intermediate 1a) (43 mg, 0.163 mmol) in DMF (1 ml) was added to N MM (0.050 ml, 0.455 mmol) followed by HATU (62 mg, 0.163 The resulting RM was stirred at RT for 30 min before (3 R,4S)-N-(5-fluoro-2-methyl-3-(6-(4-((1-(piperidine -4-ylmethyl)piperidin-4-yl)methoxy)phenyl)-7H-pyrrolo[2, 3-d]pyrimidin-4-yl)phenyl)-3-hydroxy-4-isobutylpyrrolidine N-1-carboxamide (Step 6) (133 mg, 0.136 mmol) and NMM (0 A solution of 0.050 ml of 0.455 mmol in DMF (0.5 ml) was added dropwise to the mixture. The yellow RM was stirred at RT for 1.5 h and then concentrated under reduced pressure (water + 0.1% N Redisep® C18 column eluted with 2-100% ACN in (H4HCO3) Purification of the crude product by reversed-phase flash chromatography gave 97 mg of material. The material was diluted in MeOH / DCM 4:1 (1 ml). The precipitate formed was filtered off. Drying under vacuum gave 75 mg of the title compound as a white solid. LC-MS (Method B): Rt=3.82min;[M+H] + =944.7. 1 H NMR(400MHz,DMSO-d6)δ 12.60(s,1H),10.3 1(s,1H),8.77(s,1H),7.86(d,J=8.8Hz,2H),7. 73(s,1H),7.43(dd,J=10.7,2.8Hz,1H),7.35(d d,J=8.5,2.2Hz,1H),7.29(d,J=2.1Hz,1H),7.1 4(d,J=8.6Hz,1H),7.07-6.94(m,3H),6.63(s,1 H),5.23(m,1H),3.84(m,6H),3.24-2.79(m,13H) ),2.75-2.60(m,4H),2.22-1.54(m,12H),1.50- 0.94(m,6H),0.88(m,6H).

[0377] compound 15 (3R,4S)-N-(3-(6-(4-(2-(9-(3-(2,4-dioxotetramethyl) Hydropyrimidin-1(2H)-yl)-4-methoxybenzoyl)-3,9-diaza pyrro[5.5]undecan-3-yl)ethyl)phenyl)-7H-pyrrolo[2,3-d ]pyrimidin-4-yl)-5-fluoro-2-methylphenyl)-3-hydroxy-4 -Isobutylpyrrolidine-1-carboxamide [ka] Step 1: tert-Butyl 9-(4-(4-(5-fluoro-3-((3R,4S)-3 -Hydroxy-4-isobutylpyrrolidine-1-carboxamido)-2-methylphenyl )-7-(phenylsulfonyl)-7H-pyrrolo[2,3-d]pyrimidin-6-yl) (phenethyl)-3,9-diazaspiro[5.5]undecane-3-carboxylate In a 50 ml round-bottom flask, add (3R,4S)-N-(5-fluoro-2-methyl-3-(4 ,4,5,5-tetramethyl-1,3,2-dioxaborolan-2-yl)phenyl)- 3-Hydroxy-4-isobutylpyrrolidine-1-carboxamide (Intermediate 7) (168 mg, 0.40 mmol), tert-butyl 9-(4-(4-chloro-7-(phenyl sulfonyl)-7H-pyrrolo[2,3-d]pyrimidin-6-yl)phenethyl)-3, 9-Diazaspiro[5.5]undecane-3-carboxylate (Intermediate 13) (250 mg, 0.38 mmol), Na2CO3 (101 mg, 0.95 mmol) and PdC l2(dppf) (41 mg, 0.06 mmol) was added. Then, ACN (8 ml) and Water (2 ml) was added and the RM was stirred at 100°C under N2 for 2 h. The crude residue was purified by silica gel chromatography eluting with 6% MeOH in DCM. Purification of the material gave 250 mg of the title compound as a yellow solid. LC-MS (Method F): Rt=1.51min, [M+H] + =908.

[0378] Step 2: tert-Butyl 9-(4-(4-(5-fluoro-3-((3R,4S)-3 -Hydroxy-4-isobutylpyrrolidine-1-carboxamido)-2-methylphenyl )-7H-pyrrolo[2,3-d]pyrimidin-6-yl)phenethyl)-3,9-diaza Spiro[5.5]undecane-3-carboxylate In a 25 ml round-bottom flask, add tert-butyl 9-(4-(4-(5-fluoro-3-(( 3R,4S)-3-Hydroxy-4-isobutylpyrrolidine-1-carboxamide)-2 -methylphenyl)-7-(phenylsulfonyl)-7H-pyrrolo[2,3-d]pyrimidin (Di-(phenethyl)-3,9-diazaspiro[5.5]undecane-3-yl) boxylate (250 mg, 0.27 mmol), DMSO (2 ml) and water (1 ml) The RM was stirred at 0°C for 15 min, then NaOH (86 mg, 2.16 m A solution of 2 ml of 1000 mol of RM in water was added. The RM was warmed to RT and then stirred at RT for 16 h. After dilution with water (20 ml), the mixture was extracted with EtOAc (3 x 20 ml). The combined organic layers were dried over Na2SO4, filtered and concentrated. Purification of the crude residue by silica gel chromatography eluting with 130 mg of the title compound The mixture was obtained as a yellow solid. LC-MS (Method F): Rt=1.35min, [M+H] + =768.

[0379] Step 3: (3R,4S)-N-(3-(6-(4-(2-(3,9-diazaspiro[5. 5]Undecane-3-yl)ethyl)phenyl)-7H-pyrrolo[2,3-d]pyrimidin (4-phenyl-5-fluoro-2-methylphenyl)-3-hydroxy-4-isobutyl pyrrolidine-1-carboxamide In a 50 ml flask, add tert-butyl 9-(4-(4-(5-fluoro-3-((3R ,4S)-3-Hydroxy-4-isobutylpyrrolidine-1-carboxamido)-2-methyl (phenyl)-7H-pyrrolo[2,3-d]pyrimidin-6-yl)phenethyl)-3 ,9-diazaspiro[5.5]undecane-3-carboxylate (130 mg, 0.1 7 mmol) and DCM (10 ml) were added and the RM was cooled to 0°C. A solution of 1 in dioxane (2 ml, 8 mmol) was slowly added, and the RM was then warmed to RT. , stirred at RT for 3 h and concentrated to give 130 mg of the title compound as a grey HCl salt. was obtained as a solid. LC-MS (Method F): Rt=1.06min, [M+H]+ =668.

[0380] Step 4: (3R,4S)-N-(3-(6-(4-(2-(9-(3-(2,4-dioxane tetrahydropyrimidin-1(2H)-yl)-4-methoxybenzoyl)-3,9- Diazaspiro[5.5]undecan-3-yl)ethyl)phenyl)-7H-pyrrolo[2 ,3-d]pyrimidin-4-yl)-5-fluoro-2-methylphenyl)-3-hydro 4-Isobutyl-2-pyrrolidine-1-carboxamide In a 25 ml flask, add (3R,4S)-N-(3-(6-(4-(2-(3,9-diaza spiro[5.5]undecan-3-yl)ethyl)phenyl)-7H-pyrrolo[2,3- d]pyrimidin-4-yl)-5-fluoro-2-methylphenyl)-3-hydroxy- 4-Isobutylpyrrolidine-1-carboxamide hydrochloride (120 mg, 0.17 mmol), Intermediate 1a (50 mg, 0.19 mmol), DIPEA (88 mg, 0. 68 mmol) and DMF (3 ml) were added. Then, HATU (76 mg, 0.20 m mol) was added and the RM was stirred at RT for 16 h. XBridge C18 column (21.2 x 250 mm) eluted with ACN in 3 buffer. Purification of the crude mixture by reverse phase HPLC (10 μm) afforded 72 mg of the title compound as a white solid. Obtained as a solid. LC-MS (Method J): Rt=1.41min, [M / 2+H] + =457.6. 1 H NMR(400MHz,DMSO-d6)δ 0.90(dd,J=8.44,6 .68Hz,6H)1.08-1.16(m,1H)1.31-1.36(m,1H)1 .37-1.45(m,4H)1.49(br s,4H)1.62(dt,J=13. 86,6.71Hz,1H)2.01-2.07(m,1H)2.09(s,3H)2. 41(br s,4H)2.55(br s,2H)2.66-2.70(m,2H)2 .72-2.79(m,2H)3.08(br dd,J=9.39,6.46Hz,1 H)3.19(br dd,J=10.34,4.92Hz,1H)3.35-3.6( m,4H)3.59(br t,J=6.68Hz,2H)3.62-3.69(m,2 H)3.84(s,3H)3.85-3.92(m,1H)5.11(d,J=4.55 Hz,1H)6.74(s,1H)7.05(dd,J=8.88,2.57Hz,1H )7.15(d,J=8.66Hz,1H)7.28-7.33(m,3H)7.37( dd,J=8.51,1.91Hz,1H)7.49(dd,J=10.71,2.64 Hz,1H)7.66(s,1H)7.87(d,J=8.22Hz,2H)8.82( s,1H)10.32(s,1H)12.69(s,1H).

[0381] compound 16 (3R,4S)-N-(3-(6-(4-(2-(9-(3-(2,4-dioxotetramethyl) Hydropyrimidin-1(2H)-yl)-4-ethoxybenzoyl)-3,9-diaza pyrro[5.5]undecan-3-yl)ethyl)phenyl)-7H-pyrrolo[2,3-d ]pyrimidin-4-yl)-5-fluoro-2-methylphenyl)-3-hydroxy-4 -Isobutylpyrrolidine-1-carboxamide [ka] This compound was prepared by a method similar to that of the analogues described above. N-(3-(6-(4-(2-(3,9-diazaspiro[5.5]undecan-3-yl )ethyl)phenyl)-7H-pyrrolo[2,3-d]pyrimidin-4-yl)-5-fluoro (O-2-methylphenyl)-3-hydroxy-4-isobutylpyrrolidine-1-carbo Coupling of the oxamide (compound 15, step 3) and intermediate 1c under standard amide forming conditions Pulling gave the title compound as a yellow solid. LC-MS (Method K): Rt=2.03min, [M+H] + =928.

[0382] compound 17 (3R,4S)-N-(3-(6-(4-(2-(9-(3-(2,4-dioxotetramethyl) Hydropyrimidin-1(2H)-yl)-4-methoxybenzoyl)-3,9-diaza pyrro[5.5]undecan-3-yl)ethyl)phenyl)-7H-pyrrolo[2,3-d ]pyrimidin-4-yl)-6-fluoro-2-methylphenyl)-3-hydroxy-4 -Isobutylpyrrolidine-1-carboxamide [ka] This compound was prepared by a method similar to that of the analogues described above. N-(3-(6-(4-(2-(3,9-diazaspiro[5.5]undecan-3-yl )ethyl)phenyl)-7H-pyrrolo[2,3-d]pyrimidin-4-yl)-6-fluoro (O-2-methylphenyl)-3-hydroxy-4-isobutylpyrrolidine-1-carbo Coupling of the oxamide with intermediate 1b gave the title compound as a white solid. LC-MS (Method K): Rt=1.93min, [M+H] + =915.2.

[0383] compound 18 (cis-rac)-N-(3-(6-(4-(2-(9-(3-(2,4-dioxote tetrahydropyrimidin-1(2H)-yl)-4-methoxybenzoyl)-3,9-diazomethane Zaspiro[5.5]undecan-3-yl)ethyl)phenyl)-7H-pyrrolo[2,3 -d]pyrimidin-4-yl)-5-fluoro-2-methylphenyl)-3-hydroxy 4-Isobutylpyrrolidine-1-carboxamide [ka] Step 1: tert-Butyl 9-(4-(4-(5-fluoro-3-((cis-rac) -3-hydroxy-4-isobutylpyrrolidine-1-carboxamido)-2-methylphen (phenylsulfonyl)-7-(phenylsulfonyl)-7H-pyrrolo[2,3-d]pyrimidin-6-yl (phenyl)phenethyl)-3,9-diazaspiro[5.5]undecane-3-carboxylate Into a 50 ml round bottom flask purged and maintained under an inert atmosphere was added tert-butyl-9- (4-(4-chloro-7-(phenylsulfonyl)-7H-pyrrolo[2,3-d]pyrimidinyl) (Di-(phenethyl)-3,9-diazaspiro[5.5]undecane-3-yl) Boxylate (Intermediate 13) (200 mg, 0.31 mmol), (cis-rac)- N-(5-fluoro-2-methyl-3-(4,4,5,5-tetramethyl-1,3,2- Dioxaborolan-2-yl)phenyl)-3-hydroxy-4-isobutylpyrrolidine -1-carboxamide (Intermediate 9) (155 mg, 0.37 mmol), Na2CO3 ( 85 mg, 0.8 mmol) and PdCl2(dppf) (34 mg, 0.05 mmol ACN (12 ml) and water (3 ml) were added, and the RM was heated at 100°C for 2 After stirring for 1 hour, the mixture was concentrated under reduced pressure. Purification of the crude mixture by chromatography gave 380 mg of the title compound as a yellow solid. Got it. LC-MS (Method F): Rt=1.54min, [M+H] + =909.

[0384] Step 2: tert-Butyl 9-(4-(4-(5-fluoro-3-((cis-rac) -3-hydroxy-4-isobutylpyrrolidine-1-carboxamido)-2-methylphen (7H-pyrrolo[2,3-d]pyrimidin-6-yl)phenethyl)-3,9-di Azaspiro[5.5]undecane-3-carboxylate In a 50 ml round-bottom flask, add tert-butyl 9-(4-(4-(5-fluoro-3-(( cis-rac)-3-hydroxy-4-isobutylpyrrolidine-1-carboxamide -2-methylphenyl)-7-(phenylsulfonyl)-7H-pyrrolo[2,3-d]pi (Irimidin-6-yl)phenethyl)-3,9-diazaspiro[5.5]undecane-3- Carboxylate (380 mg, 0.31 mmol) and DMSO (2 ml) were added. A solution of NaOH (50 mg, 1.24 mmol) in water (1 ml) was slowly added at room temperature. The RM was then stirred at RT for 16 h. The RM was poured into water (10 ml) and The combined organic layers were then dried to give a crude mixture. The crude mixture was purified by silica gel chromatography eluting with 3-6% MeOH in DCM. Purification gave 130 mg of the title compound as a yellow solid. LC-MS (Method F): Rt=1.37min, [M+H] + =769.

[0385] Step 3: (cis-rac)-N-(3-(6-(4-(2-(3,9-diazaspiro[ 5.5]undecan-3-yl)ethyl)phenyl)-7H-pyrrolo[2,3-d]pyrrolidine (4-amino-5-fluoro-2-methylphenyl)-3-hydroxy-4-isopropyl Butylpyrrolidine-1-carboxamide In a 50 ml round-bottom flask, add tert-butyl 9-(4-(4-(5-fluoro-3-(( cis-rac)-3-hydroxy-4-isobutylpyrrolidine-1-carboxamide -2-methylphenyl)-7H-pyrrolo[2,3-d]pyrimidin-6-yl)phenethyl (I)-3,9-diazaspiro[5.5]undecane-3-carboxylate (100mg , 0.13 mmol) (Step 2) and DCM (6 ml) were added. The RM was stirred at RT. While stirring, 4M HCl in dioxane (3.5 ml, 14 mmol) was added. The mixture was stirred at RT for 3 h. The RM was concentrated to give 120 mg of the title compound in HCl. It was obtained as a yellow solid as the l salt. LC-MS (Method F): Rt=1.09min, [M+H] + =668.

[0386] Step 4: (cis-rac)-N-(3-(6-(4-(2-(9-(3-(2,4-dichlorophenyl)-2,4-dichlorophenyl)-2,4-dichlorophenyl)-2,4-dichlorophenyl Oxotetrahydropyrimidin-1(2H)-yl)-4-methoxybenzoyl)-3, 9-Diazaspiro[5.5]undecan-3-yl)ethyl)phenyl)-7H-pyrrolo [2,3-d]pyrimidin-4-yl)-5-fluoro-2-methylphenyl)-3- Hydroxy-4-isobutylpyrrolidine-1-carboxamide In a 50 ml round-bottom flask, add (cis-rac)-N-(3-(6-(4-(2-(3,9 -diazaspiro[5.5]undecan-3-yl)ethyl)phenyl)-7H-pyrrolo[ 2,3-d]pyrimidin-4-yl)-5-fluoro-2-methylphenyl)-3-hydro 4-isobutylpyrrolidine-1-carboxamide hydrochloride (120 mg, 0.17 mmol) (Step 3), 3-(2,4-dioxotetrahydropyrimidine-1( 2H)-yl)-4-methoxybenzoic acid (Intermediate 1a) (53 mg, 0.20 mmol) DIPEA (110 mg, 0.85 mmol) and DMF (3 ml) were added. After stirring at RT, HATU (76 mg, 0.20 mmol) was added at RT. The mixture was then stirred for another 2 h. Purification of the RM by reversed-phase HPLC eluting with a gradient of 1000 mg of hexane gave 70 mg of the title compound as a white solid. Obtained as a solid. LC-MS (Method E): Rt=1.75min, [M+H] + =914. 1 H NMR(500MHz,DMSO)δ 12.71(s,1H),10.35(s ,1H),8.82(s,1H),7.88(d,J=8.2Hz,2H),7.65( s,1H),7.49(dd,J=10.9,2.7Hz,1H),7.38(dd,J =8.4,2.1Hz,1H),7.33-7.31(m,3H),7.16(d,J= 8.6Hz,1H),7.06(dd,J=8.8,2.7Hz,1H),6.75(s ,1H),4.91(s,1H),4.11(s,1H),3.85(s,3H)3.6 8-3.40(m,9H),3.08(s,1H),2.76(t,J=6.4Hz,2 H),2.66(m,2H),2.54(m,2H)2.42-2.37(m,4H), 2.17(s,1H),2.10(s,3H),1.64-1.56(m,1H),1. 49-1.42(m,9H),1.29-1.25(m,1H),0.92-0.90( m,6H).

[0387] compound 19 (3S,4R)-N-(3-(6-(4-(2-(9-(3-(2,4-dioxotetramethyl) Hydropyrimidin-1(2H)-yl)-4-methoxybenzoyl)-3,9-diaza pyrro[5.5]undecan-3-yl)ethyl)phenyl)-7H-pyrrolo[2,3-d ]pyrimidin-4-yl)-5-fluoro-2-methylphenyl)-3-hydroxy-4 -Isobutylpyrrolidine-1-carboxamide [ka] Step 1: tert-Butyl 9-(4-(4-(5-fluoro-3-((3S,4R)-3 -Hydroxy-4-isobutylpyrrolidine-1-carboxamido)-2-methylphenyl )-7H-pyrrolo[2,3-d]pyrimidin-6-yl)phenethyl)-3,9-diaza Spiro[5.5]undecane-3-carboxylate In a 50 ml round bottom flask purged and maintained under an inert atmosphere, (3S,4R)-N-( 5-Fluoro-2-methyl-3-(4,4,5,5-tetramethyl-1,3,2-dioxa (saborolan-2-yl)phenyl)-3-hydroxy-4-isobutylpyrrolidine-1- Carboxamide (Intermediate 8) (154 mg, 0.37 mmol), tert-butyl 9- (4-(4-chloro-7-(phenylsulfonyl)-7H-pyrrolo[2,3-d]pyrimidinyl) (Di-(phenethyl)-3,9-diazaspiro[5.5]undecane-3-yl) carboxylate (Intermediate 13) (250 mg, 0.38 mmol), Na2CO3 (101 mg, 0.95 mmol) and PdCl2(dppf) (41 mg, 0.06 mmol) ACN (8 ml) and water (2 ml) were added, and the RM was heated at 100°C under N2. The mixture was stirred for 2 h and then concentrated under reduced pressure. Silica gel was eluted with 3-6% MeOH in DCM. Purification of the crude mixture by chromatography gave 200 mg of the title compound as a yellow solid. And got it. LC-MS (Method F): Rt=1.34min, [M+H] + =768.

[0388] Step 2: (3S,4R)-N-(3-(6-(4-(2-(3,9-diazaspiro[5. 5]Undecane-3-yl)ethyl)phenyl)-7H-pyrrolo[2,3-d]pyrimidin (4-phenyl-5-fluoro-2-methylphenyl)-3-hydroxy-4-isobutyl pyrrolidine-1-carboxamide In a 50 ml round-bottom flask, add tert-butyl 9-(4-(4-(5-fluoro-3-(( 3S,4R)-3-Hydroxy-4-isobutylpyrrolidine-1-carboxamide)-2 -methylphenyl)-7H-pyrrolo[2,3-d]pyrimidin-6-yl)phenethyl -3,9-diazaspiro[5.5]undecane-3-carboxylate (120 mg, 0 0.16 mmol) and DCM (6 ml) were added. The RM was stirred at RT and then 4 A solution of 4 M HCl in dioxane (4 ml, 16 mmol) was added. After the addition, the RM was cooled to RT. Stir for 3 h at rt and concentrate to give 115 mg of the title compound as a yellow solid as the HCl salt. And got it. LC-MS (Method F): Rt=1.08min, [M+H] + =668.

[0389] Step 3: (3S,4R)-N-(3-(6-(4-(2-(9-(3-(2,4-dioxanediol) tetrahydropyrimidin-1(2H)-yl)-4-methoxybenzoyl)-3,9- Diazaspiro[5.5]undecan-3-yl)ethyl)phenyl)-7H-pyrrolo[2 ,3-d]pyrimidin-4-yl)-5-fluoro-2-methylphenyl)-3-hydro 4-Isobutyl-2-pyrrolidine-1-carboxamide In a 50 ml flask, add (3S,4R)-N-(3-(6-(4-(2-(3,9-diaza spiro[5.5]undecan-3-yl)ethyl)phenyl)-7H-pyrrolo[2,3- d]pyrimidin-4-yl)-5-fluoro-2-methylphenyl)-3-hydroxy- 4-Isobutylpyrrolidine-1-carboxamide (Step 2) (106 mg, 0.16 mm ol), 3-(2,4-dioxotetrahydropyrimidin-1(2H)-yl)-4-methyl Trimethoxybenzoic acid (Intermediate 1a) (50 mg, 0.19 mmol), DIPEA (103 m g, 0.8 mmol) and DMF (3 ml) were added. mol) was added at RT and the RM was stirred at RT for 16 h. ACN / water (0. XBridge C18 column eluted with a gradient containing 0.1M NH4HCO3 buffer. Purification of the RM by reverse phase HPLC gave 41 mg of the title compound as a white solid. Ta. LC-MS (Method F): Rt=1.20min, [M+H] + =914. 1 H NMR(500MHz,DMSO-d6)δ 12.67(s,1H),10.3 4(s,1H),8.79(s,1H),7.87(d,J=8.2Hz,2H),7. 66(s,1H),7.48(dd,J=10.7,2.6Hz,1H),7.38-7 .29(m,4H),7.15(d,J=8.6Hz,1H),7.05(dd,J=8 .8,2.8Hz,1H),6.71(s,1H),5.13(s,1H),3.87- 3.84(m,4H),3.73-3.38(m,8H),3.20-3.17(m,1 H),3.09-3.06(m,1H),2.80-2.72(m,2H),2.68( t,J=6.5Hz,2H),2.41-2.36(m,6H),2.09-2.04( m,4H),1.66-1.58(m,1H),1.56-1.27(m,9H),1. 16-1.10(m,1H),0.91(d,J=6.6Hz,3H),0.89(d, J = 6.6 Hz, 3H).

[0390] compound 20 (3R,4S)-N-(3-(6-(4-((1-(2-((1-(3-(2,4-diodeio 1(2H)-1-(4-methoxybenzoyl)-1(2H)-pyrimidin-1(2H)-yl (phenyl-4-yl)oxy)ethyl)piperidin-4-yl)oxy)phenyl)-7H-pi (2,3-d)pyrimidin-4-yl)-5-fluoro-2-methylphenyl)-3 -Hydroxy-4-isobutylpyrrolidine-1-carboxamide [ka] Step 1: 2-((1-(tert-butoxycarbonyl)piperidin-4-yl)oxy)-1- Hydroxyethanesulfonic acid tert-Butyl 4-(2-oxoethoxy)piperidine-1-carboxylate (medium A solution of intermediate 4 (1000 mg, 3.70 mmol) in EtOH (6 ml) was gassed with argon. After rinsing, an aqueous solution of sodium metabisulfite (500 mg, 2.63 mmol) was added (1 ml) was added. The RM was then stirred at 80°C for 1 h. The heterogeneous RM was cooled to RT and 2 The mixture was stirred for 1 day and then filtered. The solid cake was washed with EtOH and dried under reduced pressure to give 8 33 mg of the title compound was obtained as a white solid. 1 H NMR(400MHz,DMSO-d6)δ 5.32(d,J=5.7Hz,1 H),3.96(t,J=7.2Hz,1H),3.80(d,J=10.3Hz,1H ),3.61(d,J=13.4Hz,2H),3.46(s,1H),3.35(s, 2H),2.99(s,2H),1.73(s,2H),1.39(s,9H),1.3 0(q,J=9.1,5.9Hz,2H).

[0391] Step 2: tert-Butyl 4-(2-(4-(4-(4-(5-fluoro-3-((3R,4S) -3-hydroxy-4-isobutylpyrrolidine-1-carboxamido)-2-methylphen 7H-pyrrolo[2,3-d]pyrimidin-6-yl)phenoxy)piperidine- 1-yl)ethoxy)piperidine-1-carboxylate (3R,4S)-N-(5-fluoro-2-methyl-3-(6-(4-(piperidine- 4-yloxy)phenyl)-7H-pyrrolo[2,3-d]pyrimidin-4-yl)phenyl (Nyl)-3-hydroxy-4-isobutylpyrrolidine-1-carboxamide (Intermediate 12 ) (130 mg, 0.161 mmol) was dissolved in MeOH (1.5 ml) at RT. Next, NaOAc (33 mg, 0.402 mmol) was added, and the orange solution was stirred at RT. The mixture was stirred at RT for 5 minutes. Then, 2-((1-(tert-butoxycarbonyl)piperazine) Lysin-4-yl)oxy)-1-hydroxyethanesulfonic acid (90 mg, 0.277 mmol) and 2-picoline borane complex (CAS 3999-38-0) (8 mg, 0 0.064 mmol) was added and the RM was stirred at RT overnight. tert-Butoxycarbonyl)piperidin-4-yl)oxy)-1-hydroxyethanoate benzoxazole sulfonic acid (15 mg, 0.046 mmol) and 2-picoline borane complex (4 mg A further batch of 0.032 mmol) was added and the RM was stirred for 2 days before being evaporated to dryness. The Redisep (registered trademark) was eluted with 2 to 90% ACN in water + 0.1% TFA. Purification of the crude product by reversed-phase flash chromatography on a C18 column gave 12 8 mg of the title compound was obtained. LC-MS (Method A): Rt=0.96min,[M+H] + =814.7

[0392] Step 3: (3R,4S)—N-(5-fluoro-2-methyl-3-(6-(4-((1- (2-(piperidin-4-yloxy)ethyl)piperidin-4-yl)oxy)phenyl (phenyl)-7H-pyrrolo[2,3-d]pyrimidin-4-yl)phenyl)-3-hydroxy 4-Isobutylpyrrolidine-1-carboxamide tert-Butyl 4-(2-(4-(4-(4-(5-fluoro-3-((3R,4S )-3-Hydroxy-4-isobutylpyrrolidine-1-carboxamido)-2-methylpyrrolidine (phenyl)-7H-pyrrolo[2,3-d]pyrimidin-6-yl)phenoxy)piperidine (1-1-yl)ethoxy)piperidine-1-carboxylate (Step 2) (128 mg, 0 0.127 mmol) and 4 M HCl in dioxane (1 ml, 4.00 mmol) OH solution (1.5 ml) was stirred at RT for 1 h, and then the RM was concentrated to dryness. Redisep® C1 eluted with 2-100% ACN in water + 0.1% TFA Purification of the crude product by 8-column reversed-phase flash chromatography yielded 94 mg of the title compound. The compound was obtained as a yellow powder as the TFA salt. LC-MS (Method A): Rt=0.64min,[M+H] + =714.5

[0393] Step 4: (3R,4S)-N-(3-(6-(4-((1-(2-((1-(3-(2, 4-dioxotetrahydropyrimidin-1(2H)-yl)-4-methoxybenzoyl Piperidin-4-yl)oxy)ethyl)piperidin-4-yl)oxy)phenyl)- 7H-Pyrrolo[2,3-d]pyrimidin-4-yl)-5-fluoro-2-methylphenyl (I)-3-hydroxy-4-isobutylpyrrolidine-1-carboxamide 3-(2,4-dioxotetrahydropyrimidin-1(2H)-yl)-4-methoxy Benzoic acid (Intermediate 1a) (31 mg, 0.117 mmol) was dissolved in DMF (1 ml). Next, NMM (0.050 ml, 0.455 mmol) was added followed by HATU (45 mg, 0.118 mmol) was added. After 30 minutes, (3R,4S)-N-(5-fluoro -2-methyl-3-(6-(4-((1-(2-(piperidin-4-yloxy)ethyl )piperidin-4-yl)oxy)phenyl)-7H-pyrrolo[2,3-d]pyrimidine -4-yl)phenyl)-3-hydroxy-4-isobutylpyrrolidine-1-carboxamide amide (94 mg, 0.098 mmol) (Step 3) and NMM (0.050 ml, 0.4 A DMF solution (0.5 ml) of 55 mmol of HCl was added dropwise to the mixture, and the yellow RM was cooled to RT. The mixture was stirred for 3 h. Re eluted with 2-100% ACN in water + 0.1% NH4HCO3. Disep® C18 column reversed-phase flash chromatography of the crude product Purification gave 43 mg of the title compound. LC-MS (Method B): Rt=3.69min, [M+H] + =960.5 1 H NMR(400MHz,DMSO-d6)δ 12.62(s,1H),10.3 2(s,1H),8.80(s,1H),7.88(d,J=8.4Hz,2H),7. 67(s,1H),7.48(dd,J=10.8,2.8Hz,1H),7.44-7 .29(m,2H),7.15(d,J=8.5Hz,1H),7.04(m,2.9H z,3H),6.65(s,1H),5.12(d,J=4.6Hz,1H),4.45 (s,1H),3.85(m,4H),3.74-3.44(m,7H),3.27-3 .01(m,4H),2.83-2.61(m,4H),2.50(m,2H),2.3 2(m,4H),2.08(m,4H),1.93(m,2H),1.83(m,2H) ,1.62(m,3H),1.55-1.29(m,3H),1.13(m,1H),0 .89(m,6H).

[0394] compound 21 (3S,4R)-N-(3-(6-(4-(((1-(2-(1-(3-(2,4-diodeio 1(2H)-1-(4-methoxybenzoyl)-1(2H)-pyrimidin-1(2H)-yl (phenyl-4-yl)ethyl)piperidin-4-yl)oxy)methyl)phenyl)-7H-pi (2,3-d)pyrimidin-4-yl)-5-fluoro-2-methylphenyl)-3 -Hydroxy-4-isobutylpyrrolidine-1-carboxamide [ka] Step 1: tert-Butyl 4-(2-(4-((4-(4-(5-fluoro-3-((3 S,4R)-3-Hydroxy-4-isobutylpyrrolidine-1-carboxamide)-2- Methylphenyl)-7H-pyrrolo[2,3-d]pyrimidin-6-yl)benzyl)oxide Piperidin-1-yl)ethyl)piperidine-1-carboxylate tert-Butyl 4-(2-(4-((4-(4-chloro-7H-pyrrolo[2,3-d ]pyrimidin-6-yl)benzyl)oxy)piperidin-1-yl)ethyl)piperidin Benzene-1-carboxylate (Intermediate 16) (130 mg, 0.195 mmol), (3S ,4R)-N-(5-fluoro-2-methyl-3-(4,4,5,5-tetramethyl-1 ,3,2-Dioxaborolan-2-yl)phenyl)-3-hydroxy-4-isobutyl Pyrrolidine-1-carboxamide (Intermediate 8) (90 mg, 0.214 mmol) and water Mixture of 2M Na2CO3 (0.195 ml, 0.389 mmol) in 1-propanol PdCl2(PPh3)2 (6.83 mg, 9.74 μmol) was added to the solution (15 ml). The resulting RM was irradiated in a microwave at 140°C for 15 minutes. The mixture was concentrated under reduced pressure. Silica gel flash chromatography was performed eluting with 0-16% MeOH in DCM. Purification of the crude product by chromatography gave 25 mg of the title compound. LC-MS (Method A): Rt=0.96min,[M+H] + =812.7.

[0395] Step 2: (3S,4R)-N-(5-fluoro-2-methyl-3-(6-(4-(((1 -(2-(piperidin-4-yl)ethyl)piperidin-4-yl)oxy)methyl) (phenyl)-7H-pyrrolo[2,3-d]pyrimidin-4-yl)phenyl)-3-hydro 4-Isobutyl-2-pyrrolidine-1-carboxamide tert-Butyl 4-(2-(4-((4-(4-(5-fluoro-3-((3S,4 R)-3-Hydroxy-4-isobutylpyrrolidine-1-carboxamido)-2-methyl Phenyl)-7H-pyrrolo[2,3-d]pyrimidin-6-yl)benzyl)oxy)pi (Peridine-1-yl)ethyl)piperidine-1-carboxylate (Step 1) (25 mg , 0.031 mmol) and TFA (0.071 ml, 0.924 mmol) in green D The CM solution (3 ml) was stirred at RT for 24 h. The solution was then concentrated to dryness under pressure. Drying gave 47 mg of the title compound as the TFA salt. LC-MS (Method A): Rt=0.70min;[M+H] + =712.5.

[0396] Step 3: (3S,4R)-N-(3-(6-(4-((1-(2-(1-(3-(2, 4-dioxotetrahydropyrimidin-1(2H)-yl)-4-methoxybenzoyl Piperidin-4-yl)ethyl)piperidin-4-yl)oxy)methyl)phenyl)- 7H-Pyrrolo[2,3-d]pyrimidin-4-yl)-5-fluoro-2-methylphenyl (I)-3-hydroxy-4-isobutylpyrrolidine-1-carboxamide (3S,4R)-N-(5-fluoro-2-methyl-3-(6-(4-(((1-(2 -(piperidin-4-yl)ethyl)piperidin-4-yl)oxy)methyl)phenyl )-7H-pyrrolo[2,3-d]pyrimidin-4-yl)phenyl)-3-hydroxy- 4-Isobutylpyrrolidine-1-carboxamide (Step 2) (28.9 mg, 0.031 mmol) and 3-(2,4-dioxotetrahydropyrimidin-1(2H)-yl)- 4-Methoxybenzoic acid (Intermediate 1a) (8.94 mg, 0.034 mmol) in DMF The combined solution (3 ml) was added with DIPEA (0.032 ml, 0.184 mmol) followed by HBTU. (17.49 mg, 0.046 mmol) was added. The resulting RM was stirred at RT. The mixture was stirred for 2 h, then poured into H2O and filtered. The resulting filtrate was filtered twice. The combined solids were dissolved in MeOH and concentrated under reduced pressure. The product was adsorbed onto Isolute® (adsorbent) and diluted with (water + 0.1% TFA). Redisep® C18 column reversed-phase flushing eluted with 10-100% ACN. Purification by chromatography gave 7.5 mg of the title compound as the TFA salt. . LC-MS (Method B): Rt=3.82min,[M / 2+H] + =480.1 1 H NMR(400MHz,DMSO-d6)δ 12.83(s,1H),10.3 5(s,1H),9.05(s,1H),8.87(s,1H),7.99(d,J=8 .1Hz,2H),7.72(s,1H),7.63-7.28(m,5H),7.13 (dd,J=33.8,7.4Hz,2H),4.59(d,J=9.7Hz,2H), 3.98-3.78(m,5H),3.75-3.54(m,6H),3.14(d,J =33.2Hz,9H),2.77-2.64(m,3H),2.40-2.17(m, 3H),2.09(d,J=16.7Hz,5H),1.86(s,1H),1.63( d,J=6.6Hz,7H),1.37(s,1H),1.15(d,J=8.7Hz, 3H), 1.00-0.83(m,6H).

[0397] compound 22 (3R,4S)-N-(3-(6-(4-(((1-(2-(1-(3-(2,4-diodeio 1(2H)-1-(4-methoxybenzoyl)-1(2H)-pyrimidin-1(2H)-yl (phenyl-4-yl)ethyl)piperidin-4-yl)oxy)methyl)phenyl)-7H-pi (2,3-d)pyrimidin-4-yl)-5-fluoro-2-methylphenyl)-3 -Hydroxy-4-isobutylpyrrolidine-1-carboxamide [ka] Step 1: tert-Butyl 4-(2-(4-((4-(4-(5-fluoro-3-((3 R,4S)-3-Hydroxy-4-isobutylpyrrolidine-1-carboxamide)-2- Methylphenyl)-7H-pyrrolo[2,3-d]pyrimidin-6-yl)benzyl)oxide Piperidin-1-yl)ethyl)piperidine-1-carboxylate tert-Butyl 4-(2-(4-((4-(4-chloro-7H-pyrrolo[2,3-d ]pyrimidin-6-yl)benzyl)oxy)piperidin-1-yl)ethyl)piperidin Benzene-1-carboxylate (Intermediate 16) (358 mg, 0.646 mmol), (3R ,4S)-N-(5-fluoro-2-methyl-3-(4,4,5,5-tetramethyl-1 ,3,2-Dioxaborolan-2-yl)phenyl)-3-hydroxy-4-isobutyl Pyrrolidine-1-carboxamide (Intermediate 7) (272 mg, 0.646 mmol) and A mixture of K2CO3 (223 mg, 1.615 mmol) and water (10 ml) was added to PdCl2 ( dppf) (47.3 mg, 0.065 mmol) followed by dioxane (10 ml) was added. The resulting RM was then stirred at 100 °C for 1 h before being added to EtOAc and The layers were separated and the aqueous layer was extracted with EtOAc (3x). The combined organic layers were washed with brine, dried over MgSO4, filtered, and The mixture was concentrated under reduced pressure. Silica gel flash chromatography was performed eluting with 0-20% MeOH in DCM. Purification of the crude product by chromatography gave 300 mg of the title compound. LC-MS (Method A): Rt=0.95min,[M+H] + =812.6.

[0398] Step 2: (3R,4S)-N-(5-fluoro-2-methyl-3-(6-(4-(((1 -(2-(piperidin-4-yl)ethyl)piperidin-4-yl)oxy)methyl) (phenyl)-7H-pyrrolo[2,3-d]pyrimidin-4-yl)phenyl)-3-hydro 4-Isobutyl-2-pyrrolidine-1-carboxamide tert-Butyl 4-(2-(4-((4-(4-(5-fluoro-3-((3R,4 S)-3-Hydroxy-4-isobutylpyrrolidine-1-carboxamido)-2-methyl Phenyl)-7H-pyrrolo[2,3-d]pyrimidin-6-yl)benzyl)oxy)pi (Peridine-1-yl)ethyl)piperidine-1-carboxylate (Step 1) (300 ml g, 0.314 mmol) and TFA (0.726 ml, 9.42 mmol) The CM solution (3 ml) was stirred at RT for 2 h, and then the RM was concentrated under reduced pressure to give 300 mg of the title compound was obtained as the TFA salt. LC-MS (Method A): Rt=0.68min,[M+H] + =712.6.

[0399] Step 3: (3R,4S)-N-(3-(6-(4-((1-(2-(1-(3-(2, 4-dioxotetrahydropyrimidin-1(2H)-yl)-4-methoxybenzoyl Piperidin-4-yl)ethyl)piperidin-4-yl)oxy)methyl)phenyl)- 7H-Pyrrolo[2,3-d]pyrimidin-4-yl)-5-fluoro-2-methylphenyl (I)-3-hydroxy-4-isobutylpyrrolidine-1-carboxamide (3R,4S)-N-(5-fluoro-2-methyl-3-(6-(4-(((1-(2 -(piperidin-4-yl)ethyl)piperidin-4-yl)oxy)methyl)phenyl )-7H-pyrrolo[2,3-d]pyrimidin-4-yl)phenyl)-3-hydroxy- 4-Isobutylpyrrolidine-1-carboxamide (Step 2) (295 mg, 0.314 m mol) and 3-(2,4-dioxotetrahydropyrimidin-1(2H)-yl)-4 -Methoxybenzoic acid (Intermediate 1a) (91 mg, 0.345 mmol) in DMF ( 3 ml) with DIPEA (0.329 ml, 1.883 mmol) and HBTU (179 m g, 0.471 mmol) was added. The RM was stirred under argon at RT for 2 h before The resulting mixture was poured into water and DCM. After separation of both layers, the resulting mixture contained a slightly sticky solid. The resulting organic layer was diluted with MeOH to dissolve the solids. The layer was concentrated under reduced pressure and absorbed onto Isolute® (adsorbent). Redisep® C18 eluted with 10-100% ACN in 0.1% TFA Purification of the crude product by column reversed-phase flash chromatography afforded the title compound as TF The title compound as the TFA salt was then dissolved in MeOH and reacted with SCX The column was filtered and released from the SCX column with 7N ammonia in MeOH. Concentration under reduced pressure gave 142 mg of the title compound as a solid. LC-MS (Method B): Rt=3.88min, [M+H] + =959. 1 H NMR(400MHz,DMSO-d6)δ 12.75(s,1H),10.3 3(s,1H),8.84(s,1H),7.95(d,J=8.2Hz,2H),7. 67(s,1H),7.49(dd,J=10.8,2.6Hz,1H),7.41(d ,J=8.1Hz,2H),7.35(dd,J=8.5,1.9Hz,1H),7.3 1(d,J=1.9Hz,1H),7.15(d,J=8.6Hz,1H),7.06( dd,J=8.8,2.6Hz,1H),6.82-6.75(m,1H),5.12( d,J=4.4Hz,1H),4.53(s,2H),4.47-4.20(m,1H) ,3.92-3.85(m,1H),3.84(s,3H),3.71-3.61(m, 2H),3.59(t,J=6.6Hz,2H),3.45-3.34(m,1H),3 .24-3.14(m,1H),3.14-3.03(m,1H),2.91-2.52 (m,6H),2.32-2.20(m,2H),2.09(s,3H),2.06-1 .94(m,3H),1.93-1.82(m,2H),1.80-1.21(m,10 H),1.18-1.02(m,3H),0.94-0.84(m,6H).

[0400] compound 23 (cis-rac)-N-(3-(6-(4-((9-(3-(2,4-dioxotetradecanoate) Hydropyrimidin-1(2H)-yl)-4-methoxybenzoyl)-3,9-diaza pyrro[5.5]undecan-3-yl)methyl)phenyl)-7H-pyrrolo[2,3-d ]pyrimidin-4-yl)-5-fluoro-2-methylphenyl)-3-hydroxy-4 -Isobutylpyrrolidine-1-carboxamide [ka] Step 1: tert-Butyl 9-(3-(2,4-dioxotetrahydropyrimidine-1( 2H)-yl)-4-methoxybenzoyl)-3,9-diazaspiro[5.5]undeca Benzene-3-carboxylate 3,9-diazaspiro[5.5]undecane-3-carboxylic acid te at RT under argon rt-butyl ester (432 mg, 1.698 mmol) and NMM (0.392 ml A stirred DMF solution (4 ml) of 3-(2,4-dioxotetrahydrofuran, 3.57 mmol) 471mg 4-Methoxybenzoic acid (Intermediate 1a) (471mg) , 1.783 mmol) followed by HATU (743 mg, 1.953 mmol) was added. The clear RM was stirred at RT for 2.5 h and then quenched with saturated aqueous NaHCO3. The mixture was thawed and diluted with EtOAc. The layers were separated and the aq. layer was extracted with EtOAc. The combined organic layers were washed with brine / water 1:1 (2x) and brine (1x). Wash with HCl, dry over MgSO4, filter and evaporate to give 900 mg of the title compound obtained. LC-MS (Method A): Rt=0.91min, [M+H]+=501.4.

[0401] Step 2: 1-(2-methoxy-5-(3,9-diazaspiro[5.5]undecane-3- (carbonyl)phenyl)dihydropyrimidine-2,4(1H,3H)-dione tert-Butyl 9-(3-(2,4-dioxotetrahydropyrimidine-1(2H) -yl)-4-methoxybenzoyl)-3,9-diazaspiro[5.5]undecane-3 -carboxylate (Step 1) (100 mg, 0.200 mmol) and 4 in dioxane A solution of 1 M HCl (1 ml, 4 mmol) in MeOH (1 ml) was heated at RT for 1.5 min. The RM was concentrated and dried under reduced pressure to give 99 mg of the title compound as the HCl salt. I got it. LC-MS (Method D): Rt=0.76min;[M+H] + =401.4.

[0402] Step 3: (cis-rac)-N-(3-(6-(4-((9-(3-(2,4-dioxo) tetrahydropyrimidin-1(2H)-yl)-4-methoxybenzoyl)-3,9- Diazaspiro[5.5]undecan-3-yl)methyl)phenyl)-7H-pyrrolo[2 ,3-d]pyrimidin-4-yl)-5-fluoro-2-methylphenyl)-3-hydro 4-Isobutyl-2-pyrrolidine-1-carboxamide RT (cis-rac)-N-(5-fluoro-3-(6-(4-formylphenyl) )-7H-pyrrolo[2,3-d]pyrimidin-4-yl)-2-methylphenyl)-3- Hydroxy-4-isobutylpyrrolidine-1-carboxamide (Intermediate 10) (100m g, 0.193 mmol), TEA (0.100 ml, 0.717 mmol) and 1-( 2-Methoxy-5-(3,9-diazaspiro[5.5]undecane-3-carbonyl)furan (phenyl)dihydropyrimidine-2,4(1H,3H)-dione (Step 2) (96 mg, 0 A stirred mixture of 0.193 mmol) and MeOH (2 ml) was added to 0.5 M ZnCl2 ( 0.450 ml, 0.225 mmol) was added and the RM was stirred overnight at RT. To the mixture, NaBH3CN (15 mg, 0.239 mmol) was added and the RM was heated at RT for 3 The mixture was stirred for 1 day. Then, it was concentrated under reduced pressure. 2 to 100% in (water + 0.1% TFA) Reversed-phase flash chromatography on a Redisep® C18 column eluted with ACN Purification of the crude product by filtration gave a solution which was then added to the PL-HCO3 MP SPE cartridge. Ridge filtration and lyophilization gave 210 mg of material. SFC (column: Princeton PPU, 250 × 30 mm, 10 Purification of the material by HPLC (0A, 5 μm) gave 130 mg of the title compound as a white powder. Ta. LC-MS (Method B): Rt=3.61min, [M+H] + =900.7. 1 H NMR(400MHz,DMSO-d6)δ 12.78(s,1H),10.3 1(s,1H),8.84(s,1H),8.02(d,J=33.4Hz,2H),7 .64(s,1H),7.60-7.41(m,3H),7.35(d,J=8.5Hz ,1H),7.30(s,1H),7.14(d,J=8.5Hz,1H),7.09- 6.99(m,1H),6.85(s,1H),4.88(s,1H),4.09(m, 1H),3.83(s,3H),3.57(m,3H),3.52-3.37(m,7H ),3.06(m,1H),2.66-2.61(m,6H),2.14(m,1H), 2.08(s,3H),1.68-1.18(m,12H),0.89(m,6H).

[0403] Assay description Compounds of the present invention were tested in the following cellular assays. The data obtained are shown in Table 1. The terms in Table 1 are defined as follows: DC 50 is the concentration at which 50% of maximum degradation was observed. degAmax is the degree of degradation, and the value is the concentration at which maximum degradation is observed. Prol GI refers to the % of protein remaining after saturation. 50 refers to growth data and ink At the end of the incubation period, 50% growth inhibition was observed compared to vehicle-treated controls. TMD8 cells are BTK-dependent, and OCI-LY3 cells are , BTK independence.

[0404] BTK-GFP and IKZF3-GFP protein abundance profiles in HEK293A cells Flow cytometry assay: Stably integrated BTK-GFP and RFP or IKZF3-GFP and RFP Bicistronic BTK-GFP-iresRFP construct or IKZF3-GFP-i HEK293A cells (Invitrogen) expressing each of the resRFP constructs The degradation of BTK or IKZF3 was measured in the presence of β-glucan (R70507). The decrease in GFP signal measured by β-actin was due to BTK degradation or IKZ degradation after degrader treatment. It served as a readout for F3 decomposition.

[0405] i) pLenti6-BTK-GFP-Ires-RFP sensor vector and IKZF 3. Cloning of GFP-Ires-RFP Sensor Vector The bicistronic BTK-GFP-iresRFP construct is GFP was introduced into the unique Xho1 site downstream of the DEST and the internal ribosome was inserted. pLenti6-DES, in which RFP was cloned after the Ires entry site Based on the T vector backbone. Specifically, NanoLuciferase (NLuc) was pLe Sensor construct by substituting from nti6-DEST-NLuc-Ires-FF We engineered the blunt-end cloning to replace Ires-eGFP between two PmlI sites. eGFP was synthesized from pLenti6-DEST-Ires-eGFP using The element (Ires-FF) encodes the FF, which is flanked by two Nhe1 restriction sites. pLenti6-DEST-NLuc-Ires-FF The sensor construct was cloned. Linearize pLenti6-DES using Xho1 digestion to allow end-tagging Linker primer with Xho1 site for ligation into T-Ires-FF NLuc was amplified from pNL1.1 (Promega #N1001) using The construct pLenti6-DEST-NLuc-Ires-FF was obtained.

[0406] pLenti6-DEST-GFP-Ires-RF was used with Gibson assembly pLenti6-DEST-NLu was used as a base vector for cloning P c-Ires-FF was used to replace FF with RFP and NLuc with GFP. In round 1, the following Gibson assembly linker primers (Gibson n-Nhe1 RFPfw, CGATGAATTCGCCACCgctagcATGGT GAGCAAGGGCGAGGAGC (SEQ ID NO: 1); Gibson-Nhe1 RFP -Stoprev, CTCATTACTAACCGGctagcTTACTTGTACA GCTCGTCCATGC (SEQ ID NO: 2)) was used to amplify RFP from the template. FF was replaced by RFP, and the resulting plasmid was digested with Nhe1 and transformed into pLenti6-DEST- The FF fragment was cloned into NLuc-Ires-FF and gel purified. The resulting pLenti6-DEST-NLuc-Ires-RFP vector The vector served as a template and the following Gibson assembly linker primers (G ibson-Xho1 GFPfw, CCAGCACAGTGGCGGCCGCTCGA GcATGGTGAGCAAGGGCGAGGAGCTGTTCACC (SEQ ID NO: 3); Gibson-Xho1 GFP-Stoprev, CCGCGGGCCCTCTAGA CTCGAGTTACTTGTACAGCTCGTCCATGCCGAGAGT (Sequence No. 4)) to amplify GFP from the template, replacing NLuc with GFP. , cloned into Xho1-digested pLenti6-DEST-NLuc-Ires-RFP The NLuc fragment was removed by gel-purification. Yellowtail Master Mix (New England Biolabs NEB E26 All Gibson assembly reactions were carried out according to the manufacturer's instructions. , and then insert the destination vector pLenti6-DEST-GFP-Ires-R FP was obtained, making Gateway cloning possible.

[0407] To enable Gateway cloning of BTK and C-terminal GFP tagging, The TK open reading frame (ORF) was first used to prepare the Gateway BP reaction. Used according to the manufacturer's instructions (Invitrogen 11789-013), PC DNA-DEST40-BTK vector (Invitrogen library ID INV _20090504v1) to pDONR221 (Invitrogen 12536- 017) vector to obtain the new construct pENTR221-BTK. For mutagenesis, QuikChange Lightning mutagenesis kit (Ag (Illuminent Technologies #210518) according to the manufacturer's instructions. The following primers (pENTR221-BTK Quikchange S TOP-Leu fw, gtcatggatgaagaatccTTGaacccagc tttcttgtac;pENTR221-BTK Quikchange STOP- Leu REVC, gtacaagaaagctgggttCAAggattcttca A mutagenesis reaction with tccatgac was performed to convert the STOP codon to leucine. This was then mutated to yield pENTR221-BTK(STOP-Leu).

[0408] To obtain the final pLenti6-BTK-GFP-Ires-RFP sensor construct The Gateway LR reaction was performed using the Lr Clonase kit (Invitrogen) 11791-019) according to the manufacturer's instructions. ST-GFP-Ires-RFP and pENTR221-BTK(STOP-Leu) All vectors described were sequenced for verification.

[0409] By analogy, the Lr Clonase kit (Invitrogen 11791-01 9) according to the manufacturer's instructions, and pENTR221-IKZF3(STOP -Leu) construct, as previously described pLenti6-DEST-GFP-Ires- Gateway cloning of IKZF3 into the RFP vector resulted in bicistronic pLenti6-IKZF3-GFP-iresRFP was engineered. All vectors described The target was sequenced for confirmation.

[0410] To enable Gateway cloning and C-terminal GFP tagging of IKZF3 , QuikChange Lightning Mutagenesis Kit (Agilent T Technologies #210518) according to the manufacturer's instructions. The primers below (pENTR221-IKZF3 Quikchange STOP-L eu fw, AGAGCCCTGCTGAAGttgaaccCAGCTTTcttgt ac (SEQ ID NO: 5); pENTR221-IKZF3 Quickchange STOP -Leu REVC, gtacaagAAAGCTGggttcaaCTTCAGCAG A mutagenesis reaction with pENTR221-GGCTCT (SEQ ID NO: 6) was carried out to Cloning the STOP codon from IKZF3 (Invitrogen #INVE089_A8) This was mutated to isin, resulting in pENTR221-IKZF3(STOP-Leu).

[0411] ii) 293A BTK-GFP-Ires-RFP sensor cells stably expressing IKZF Engineering 3-GFP-Ires-RFP sensor cells The previously described pLenti6-BTK-GFP-Ires-RFP sensor construct or Lenti6-IKZF3-GFP-Ires-RFP sensor construct was used for lentivirus detection. Transduction of 293A BTK-GFP-Ires-RFP receptors by viral vectors Ser cells and IKZF3-GFP-Ires-RFP sensor cells were generated. g pLenti6-BTK-GFP-Ires-RFP or pLenti6-IKZF 3-GFP-Ires-RFP, 500ng delta8.71 and 200ng pV SVG (3 μl Lipofectamine 2 in 97 μl OptiMEM serum-free medium) 5 min preincubation with 000 (Invitrogen #11668-019) After the injection, 100 μl OptiMEM serum-free medium (Invitrogen # Lentiviral particles were co-transfected into HEK cells by co-transfection of 11058-021 (diluted in 11058-021). The mixture was produced in 293FT cells (Invitrogen R70007). Incubate for another 20 minutes in 1 ml of PBS in the wells of a 6-well plate. Freshly prepared suspension of HEK293FT cells (concentration 1.2 x 10 6 cells / ml) plus One day after transfection, the medium was replaced with 1.5 ml of complete growth medium (DMEM high glucose + 10 ml). 1% FCS + 1% L-glutamine + 1% NEAA + 1% NaPyr). 48 h post-transfection supernatant containing the transducing particles was collected and frozen at -80°C.

[0412] 1 × 10 cells two days before transduction with viral particles. 5 HEK293A cells (Invitr The cells (gen R70507) were seeded in 2 ml of growth medium in the wells of a 6-well plate. Infection was performed in 1 ml medium containing 8 μg / ml polybrene, with viral transducing particles. 24 h after infection, stably transfected cells were cultured in 90 μl of collected supernatant containing The cells were selected with blasticidin at a concentration of 8 μg / ml.

[0413] iii) Quantitative BTK-GFP and IKZF3-GFP abundance measurement Culture stable HEK293A-BTK-GFP-iresRFP cells in complete growth medium (DMEM) High glucose + 10% FCS + 1% L-glutamine + 1% NEAA + 1% NaPyr) On day 0, HEK293A-BTK-G cells were subcultured at 100°C for 1 hour. FP-iresRFP or HEK293A-IKZF3-GFP-iresRFP and H EK293A-iresRFP cells were plated in 260 μL of 96-well microtiter plates. On day 1, cells were plated at 10,000 cells / well in complete medium. 10 points of compound were dispensed using a Digital Dispenser (Tecan). The cells were treated in duplicate with a 1:3 dilution series of DMSO. On day 2, after 24 h of incubation at 37°C, treatment Discard the medium and rinse the cells with 100 μl / well PBS, then add 40 μl trypsin. Trypsin was added to the wells at 100 μl / well in PBS+20% F for 5 min. The cells were neutralized with BD FACS CANTO II (Becton Dickinson's CS). Flow cytometry was performed on the samples using forward scatter (FSC) Cell identification was performed using a plot of side scatter (SSC) versus side scatter (SSC). Single cell discrimination was performed using S Perform using SC-width (SSC-W) vs. SSC-height (SSC-H) plots. The median GFP value for 100 single cells is used to determine BTK levels. The median GFP value from 293A-iresRFP was used as the background signal. 0% BTK signal is defined as 0%. Media derived from iresRFP or HEK293A-IKZF3-GFP-iresRFP Using the GFP values, subsequent DC 50 100 for the curve (concentration for 50% BTK degradation) Define the %BTK signal. GFP and RFP are referred to as FITC and PE, respectively. Read in the appropriate channel.

[0414] GFP signal for 10 compound concentrations (starting concentration 10 μM, 3-fold dilution steps) by concentration-response curves plotting the relative reduction in β-glucan (measured by flow cytometry) , D.C. 50 The value was generated.

[0415] For the IKZF3 abundance assay, the literature molecules pomalidomide and lenalidomide were used as positive controls. The data are shown in Table 2. 50 is 50% maximum degradation refers to the concentration at which deg Amax is observed; deg Amax is the degree of degradation, and the value is the concentration at which maximum degradation is observed. It refers to the % protein remaining at the concentration used.

[0416] BTK(C481S)-GFP protein abundance in TMD8 cells by flow cytometry Reassay: Degradation of BTK(C481S) was suppressed by the stably integrated second-generation bicistronic B TK(C481S)-GFP-CHYSEL-mCherry construct to BTK(C48 Measurements were performed in TMD8 cells expressing 1S-GFP and mCherry. The decrease in GFP signal measured by cytometry was consistent with the decrease in BTK (C 481S) degradation.

[0417] pLenti6-BTK(C481S)-GFP-CHYSEL-mCherry sensor -Vector cloning BTK(C481S) protein abundance sensor is a second-generation bicistronic construct It is based on the BTK gene, which contains two reading frames, BTK(C481S) and mC herry controls are separated by a cis-acting hydrolase element (Lo e t al., 2015 Cell Reports 13, 2634), Ires has been replaced from the first generation vector previously described.

[0418] Bicistronic BTK(C481S)-GFP-CHYSEL-mCherry construct The construct is based on the pLenti6-DEST vector backbone, where GFP-CHY The SEL-mCherry cassette was synthesized by Gibson assembly and inserted downstream of the ST cassette into the new Gateway-compatible vector pLenti6-D The resulting vector was transformed into pENTR221-BTK( Gateway cloning with (STOP-Leu)(C481S)(STOP-Leu) resulted in the final The construct pLenti6-BTK(C481S)-GFP-CHYSEL-mCher ry. QuikChange Lightning Mutagenesis Kit A manufacturer's manual was used (Agilent Technologies #210518). Follow the instructions to use the following primers (BTK C481S Quickchan) ge fw, gagtacatggccaatggctCcctcctgaactacc tgagg (SEQ ID NO: 7); BTK C481S Quikchange REVC, c ctcaggtagttcaggaggGagccattggccatgtactc(arrangement Mutagenesis reaction with pENTR221-BTK(STOP-Leu) pENT was obtained by mutating wild-type BTK to BTK(C481S) via the R221-BTK(C481S)(STOP-Leu) was generated.

[0419] The sequence of the synthesized construct (Xho1 site is shown in bold and mCherry-ORF is shown in small letters) (indicated by letter): [ka]

[0420] Stably expressing TMD8 BTK(C481S)-GFP-CHYSEL-mCherry Manipulation of Sir cells pLenti6-BTK(C481S)-GFP-CHYSEL-mC, previously described Lentiviral vector transduction with herry sensor constructs resulted in the expression of TMD8 BTK(C481S)-GFP-CHYSEL-mCherry sensor cells were generated. 500ng pLenti6-BTK-GFP-Ires-RFP or pLenti6 -IKZF3-GFP-Ires-RFP, 500ng delta8.71 and 200 ng pVSVG (3 μl Lipofecta in 97 μl OptiMEM serum-free medium) 5 min pre-injection with mine2000 (Invitrogen #11668-019) After incubation, 100 μl OptiMEM serum-free medium (Invitrogen) was added. Lentiviral particles were co-transfected with 100% ribosomal RNA (100%) diluted in 100% ribosomal RNA (100%). was produced in HEK293FT cells (Invitrogen R70007). Incubate the mixture at RT for another 20 min before transferring the mixture to the wells of the 6-well plate. 1 ml of freshly prepared suspension of HEK293FT cells (concentration 1.2 x 10 6 cells / ml One day after transfection, the medium was replaced with 1.5 ml of complete growth medium (DMEM high glucose). The medium was replaced with 10% FCS, 1% L-glutamine, 1% NEAA, and 1% NaPyr. The 48 h post-transfection supernatant containing the viral transduction particles was collected and frozen at -80°C. It was concluded.

[0421] 1 × 10 cells two days before transduction with viral particles. 5 HEK293A cells (Invitr The cells (gen R70507) were seeded in 2 ml of growth medium in the wells of a 6-well plate. Infection was performed in 1 ml medium containing 8 μg / ml polybrene, with viral transducing particles. 24 h after infection, stably transfected cells were cultured in 90 μl of collected supernatant containing The cells were selected with blasticidin at a concentration of 8 μg / ml.

[0422] Cell viability assay for DLBCL (diffuse large B-cell lymphoma) cells: The effect of BTK compounds on cell proliferation was measured using Resazurin (Sigma, #R701 7)-based cell viability assay. Cells and OCI-LY3 (BTK compound insensitive) were treated with the corresponding compounds at 37°C, 5% CO₂. Resazurin was virtually non-fluorescent and incubated for 72 h in O2. Resazuri is a non-toxic, cell-permeable substrate that is readily absorbed into living cells. n (Sigma, #R7017) is reduced to the highly fluorescent Resorufin. Metabolic activity was measured by measuring the fluorescence signal (ex. 530 nm; em. 600 nm). I rated it as follows.

[0423] TMD8 cells and OCI-Ly3 cells were cultured on day 0 in a 96-well plate (Cost 1 x 10 per well in 150 μl of 1 x 10 per well of ar#3904 4 Cell density was 3.5 At the beginning of the experiment, an additional plate was added to assess the basal metabolic activity of both cell lines. Resazurin (Sigma, #R70) was used for the reference plate. 17) was added 3 h after seeding to a final concentration of 13 μg / ml, and the mixture was incubated at 37°C, 5% CO2. After incubation, the fluorescent signals of the 96-well plate were Null intensity was measured using a Mithras LB940 multimode plate reader at 530 / 600. Measurements were made in nm (Berthold Technologies, Germany).

[0424] At the same time, 3 h after seeding, the test plates were treated with various concentrations of compounds or vehicle (DMSO). The plates were treated with only 100% ethanol for 3 days. Compounds were added to the plates using an HP D300 digital dispenser. The compound was administered at 100 μg / ml for OCI-LY3 cells. 8-point serial dilutions (1:1) with a starting concentration of 1 μM for TMD8 cells and 1 μM for TMD8 cells, respectively. 4) were tested in triplicate. To evaluate the relative proliferation of cells, n was added directly to the medium of each well to a final concentration of 13 μg / ml. The plates were incubated at 37°C. The cells were incubated for 2 hours in 5% CO2, resulting in a 72 hour endpoint. After incubation, the fluorescent signal intensity of the 96-well plate was measured using a Mithras LB940 Measurements were made at 530 / 600 nm on a multimode plate reader (Berthol d Technologies, Germany). The formation of Resorufin pigment is due to metabolic activity. For each triplicate treatment, the mean and standard deviation were calculated using the curve fit. The 50% growth inhibition (GI) was calculated and analyzed using software. 50 ) Value-generating The compound concentration was calculated. 50 The values ​​are typically calculated in at least two completely independent This was determined through experience.

[0425] OCI-LY3 cells were donated to the University Health Network, To The cells were obtained through a license agreement with Ronto, Canada. yClone, GE#SH30066.03, lot AB217603), 2mM L -Glutamine (BioConcept, #5-10K50-H, lot.LA03467) P), 1 mM sodium pyruvate (BioConcept, #5-60F00-H, l ot.LB10510P), 10mM HEPES (Gibco, #15630-056 , lot.1854074), 1%Pen / Strep(BioConcept, #4- RPMI 1640 medium (Gib) supplemented with 01F00-H, lot. LB04235P co, #61870-010, lot.1894759).

[0426] TMD8 cells were obtained through a license agreement with Tokyo Medical and Dental University, Japan. , 10% FCS (HyClone, GE#SH30066.03, lot AB217 603), 2 mM L-glutamine (BioConcept, #5-10K50-H, l ot.LA03467P), 1%Pen / Strep(BioConcept, #4-0 MEM Alpha (BioCo) supplemented with 1F00-H, lot. LB04235P The cells were cultured in a medium containing 100% ethanol (ncept, #1-23F01-I, lot.LB04262P).

[0427] [Table 1]

[0428] [Table 2] The present invention includes the following aspects. <1> Formula (I)

change

change

Claims

1. The following formula (XXIa): [C101] (In the formula, R 6 is selected from H and F; R7 is selected from H, F, Cl, -CH3, -OCH3, and -OCH2CH3. A compound represented by the formula:

2. The compound or salt thereof according to claim 1, wherein R 6 is F.

3. The compound or salt thereof according to claim 1, wherein R 7 is F, Cl, -CH 3 , -OCH 3 , or -OCH 2 CH 3 .

4. A compound of the following formula: [C102] The compound according to claim 1 , or a salt thereof,

Images