Paired-end library tag compositions and their use in MGI sequencing platforms

Abstract

The present invention provides a paired-end library label composition and its use in an MGI sequencing platform. The paired-end library label composition comprises a plurality of 5'-end library labels and a plurality of 3'-end library labels, wherein the 5'-end library labels are all the same length, the 3'-end library labels are all the same length, and the number of bases occurring at the same position in the paired-end library label composition is the same. The optimized paired-end library labels are used for data partitioning to eliminate crosstalk problems that occur during synthesis, experimental steps, and sequencing. By ensuring that the lengths of the 5'-end library labels and the 3'-end library labels are all the same and that the number of bases occurring at the same position is the same, multiple libraries with well-balanced paired-end library label bases can be obtained. When these multiple libraries are mixed and sequenced, the paired-end labels of each library can be read with high accuracy, further improving the effective library partitioning rate.

Description

[Technical field]

[0001] The present invention relates to the area of ​​plasma DNA library construction, specifically paired-end libraries. tag The present invention relates to a composition and its use in the MGI sequencing platform. [Background technology]

[0002] In the sequencing process of the MGI high-throughput sequencer, each sample is sequenced in a different tag It is necessary to label the sequence (index) and sequence it, then split it. However, existing MGI sequencing platforms are basically single-ended. tag It uses the library. Single-ended tag Due to the presence of natural defects in the index, crosstalk between samples is likely to occur. tag Crosstalk is inevitable due to contamination by adapters or primers, so it is necessary to solve the low-frequency crosstalk between samples. Currently, there are only paired-end PCR methods that can effectively eliminate crosstalk between samples. tag The following method is optimal.

[0003] Paired-end tag The adoption of single-ended tag Compared to using the tag The ability to read sequences accurately has a significant impact on the effective partitioning of sequence data. tag Problems with sequence readings will reduce the effective resolution of sequence data and increase sequencing costs.

[0004] Therefore, how to do paired-end tagBy labeling a library of mixed sequences in this manner, it is problematic to on the one hand reduce the crosstalk phenomenon of samples and on the other hand improve the effective resolution rate of data after multi-sample mixed sequencing. Summary of the Invention [Problem to be solved by the invention]

[0005] The primary objective of this invention is to develop a method for sequencing single-ended genomic DNA (SEQ ID NO: 1) that utilizes the current MGI sequencing platform. tag To address the problem of sample crosstalk when labeling libraries using tag The present invention provides a composition and its use in the MGI sequencing platform. [Means for solving the problem]

[0006] In order to achieve the above object, according to a first aspect of the present application, a paired-end library tag Compositions are provided, and paired-end libraries tag The composition comprises a library of multiple 5' ends. tag and a library of multiple 3' ends tag and a library of multiple 5' ends. tag The length of each is the same, and the library of multiple 3' ends tag The lengths of all the DNA fragments are the same, and the paired-end libraries tag In the composition, the number of occurrences of each base at the same position is the same.

[0007] In addition, multiple 5' end libraries tag The length of the library is tag The length of each of the paired-end libraries is preferably the same as that of the paired-end libraries, and each of the paired-end libraries is preferably a fixed length between 6 and 10 bp. tag In the composition, any two libraries tag There are at least three base differences between any one library. tagThe number of consecutive identical bases in the sequence is 3 or less, and preferably, any one of the libraries tag The GC content of the paired-end library is 40-60%. tag The composition comprises: tag Balanced paired-end libraries tag combination of or 8 tag Balanced paired-end libraries tag where 4 tag Balanced paired-end libraries tag The combination of 4n 5'-ends is tag and a library of 4n 3' ends tag It is a combination of 8 tag Balanced paired-end libraries tag The combination of these is a library of 8n 5' ends. tag and a library of 8n 3' ends tag where n is a natural number equal to or greater than 1.

[0008] In addition, 4 tag Balanced paired-end libraries tag In the combination of tag is selected from any one or more of the 96 groups shown in Table 1, and the 3'-end library tag The groups are the 5'-end libraries in the 96 groups shown in Table 1. tag The compound is selected from any one or more groups different from the group.

[0009] In addition, 8 tag Balanced paired-end libraries tag In the combination of tag is selected from any one or more of the 48 groups shown in Table 2, and the 3'-end library tag The groups are the 5'-end libraries in the 48 groups shown in Table 2. tag The compound is selected from any one or more groups different from the group.

[0010] According to a second aspect of the present invention, a paired-end library based on the MGI sequencing platform is provided. tag and a primer composition for amplifying a plurality of paired-end libraries is provided, the primer composition comprising: tag Each amplification primer pair comprises a combination of amplification primer pairs that are 5′-terminal to the library tag and the 3' end library tag a library of 5' ends of a plurality of amplification primer pairs; tag The length of each primer is the same, and the 3' end of each primer pair is the same. tag are all the same length, and each base appears the same number of times at the same position.

[0011] In addition, a library of 5' ends of multiple amplification primer pairs tag The length of the library of 3' ends of multiple amplification primer pairs. tag Preferably, the length of the 5'-end library is the same as that of the tag and 3' end libraries tag The length of each primer is a fixed length between 6 and 10 bp, and preferably, in the amplification primer composition, tag There are at least three base differences between any one library. tag The number of consecutive identical bases in the 5' end is 3 or less, and preferably, the number of consecutive identical bases in the 5' end is 3 or less. tag and multiple 3' end libraries tag The GC content of each of the amplification primer compositions is 40 to 60%. tag Balanced 4n amplification primer pair combinations, or 8 tag It contains 8n balanced combinations of amplification primer pairs, where n is a natural number of 1 or more.

[0012] In addition, 4 tag Balanced 4n amplification primer pairs, 5' end library tag is selected from any one or more of the 96 groups shown in Table 1, and the 3'-end library tag The groups are the 5'-end libraries in the 96 groups shown in Table 1. tag and preferably selected from any one or more groups different from the group 8. tag Balanced 8n amplification primer pairs for the 5' end of the library tag is selected from any one or more of the 48 groups shown in Table 2, and the 3'-end library tag The groups are the 5'-end libraries in the 48 groups shown in Table 2. tag The compound is selected from any one or more groups different from the group.

[0013] Further, each amplification primer pair further comprises a 5' terminal common amplification sequence and a 3' terminal common amplification sequence, and the 5' terminal common amplification sequence is a library tag The consensus sequence located upstream of the 5'-end library tag and a common sequence located downstream of the 3'-end common amplification sequence, tag The consensus sequence located upstream of the 3′-terminus of the library tag and a common sequence located downstream of the 5' end of the library, preferably tag The consensus sequence located upstream of the 5′ end of the library is SEQ ID NO:793. tag The consensus sequence located downstream of the 3′ end of the library is SEQ ID NO:794. tag The consensus sequence located upstream of the 3′ end of the library is SEQ ID NO:795. tag The consensus sequence located downstream of is SEQ ID NO:796; or 5' end library tag The consensus sequence located upstream of the 5′ end of the library is SEQ ID NO:793. tag The consensus sequence located downstream of the 3′ end of the library is SEQ ID NO:797. tag The consensus sequence located upstream of the 3′ end of the library is SEQ ID NO:795. tag The consensus sequence located downstream is SEQ ID NO:798.

[0014] According to a third aspect of the present invention, there is provided a sequencing library construction reagent kit comprising any one of the amplification primer compositions described above.

[0015] In addition, the reagent kit includes: Bubble Adapter Including, Bubble Adapter comprises a first adapter sequence and a second adapter sequence, wherein the first adapter sequence is SEQ ID NO:769 and the second adapter sequence is SEQ ID NO:770, or wherein the first adapter sequence is SEQ ID NO:773 and the second adapter sequence is SEQ ID NO:774.

[0016] According to a fourth aspect of the present invention, there is provided a method for constructing a sequencing library based on the MGI sequencing platform, which is constructed using the above-mentioned reagent kit.

[0017] According to a fifth aspect of the present invention, there is provided a sequencing library, the sequencing library being the paired-end library described above. tag A combination or amplification primer composition of any of the above. Effect of the Invention

[0018] Applying the technical scheme of the present invention, paired-end libraries tag and optimized paired-end libraries tag Introducing the combination, paired-end library tag By using this method to divide the data, the crosstalk problems that occur during synthesis, experiment and sequencing processes can be solved, and the detection results can be made more accurate.

[0019] In addition, paired-end libraries tag Libraries for each 5' end in the combination tag The length of the library is the same, and the 3' end tagThe length of each base is also controlled to be the same, and the number of occurrences of each base at the same position is restricted to be the same, thereby tag Since the occurrence probability of the bases is the same, the paired ends in the composition tag If you synthesize adapters or library amplification primers, paired-end libraries tag It is possible to obtain multiple libraries with good base balance. When these multiple libraries are mixed and sequenced, the paired-end sequence of each library in the mixed library is tag This provides high reading accuracy and improves the effective division rate of the library. [Brief description of the drawings]

[0020] The accompanying drawings in the specification forming a part of this application are used to provide a further understanding of the present invention, and the schematic embodiments of the present invention and the description thereof are used to explain the present invention and are not to be construed as unduly limiting the present invention. The accompanying drawings are as follows:

[0021] [Figure 1A] 1 shows the advantage of the MGI sequencing platform using paired-end tags rather than single-end tags for crosstalk elimination. [Figure 1B] 1 shows the advantage of the MGI sequencing platform using paired-end tags rather than single-end tags for crosstalk elimination. [Figure 1C] 1 shows the advantage of the MGI sequencing platform using paired-end tags rather than single-end tags for crosstalk elimination. [Figure 2A] 1 shows the MGI single-ended tag adapter. [Figure 2B] 1 shows the MGI single-ended tag adapter. [Figure 3A] MGI paired-end tag adapters. [Figure 3B] MGI paired-end tag adapters. [Figure 4]The realization process of constructing two types of paired-end tag libraries on the MGI platform is shown. [Diagram 5] The paired-end tag scheme of the present invention is shown to be compatible with single-end tag amplicon schemes. [Figure 6] The paired-end tag amplification primers of the present application are shown to be compatible with molecular tag adapters of single-end tags. [Figure 7A] Shown are 4- and 8-balanced tag sequence base-balanced types. [Figure 7B] Shown are 4- and 8-balanced tag sequence base-balanced types. [Figure 8] A comparison of base balance during the 4-balance and 8-balance multimixing processes is shown. [Figure 9] A comparison of the yields of two different library construction schemes is shown. [Figure 10] The data splitting difference during the 12-mix sequencing process with 4 and 8 balances is shown. DETAILED DESCRIPTION OF THE PREFERRED EMBODIMENTS

[0022] Unless otherwise stated, it should be noted that the embodiments of the present application are merely specific examples and are not uniquely limited, and the embodiments of the present application and the features in the embodiments can be combined with each other. Hereinafter, the present invention will be described in detail with reference to the embodiments.

[0023] Explanation of terms Paired-end tag Adapter: For high-throughput sequencing, a universal sequence adapter needs to be added to the end of each fragment, and the variable sequence region sequence that each has in the non-complementary region of the adapter is: tag An array, which is used to partition the data during sequencing.

[0024] tag Sequence base balance: DNA sequences are made up of four types of bases, A, T, G, and C, and in order to be read efficiently during the sequencing process, tagA set of bases is created so that each position in the sequence has an equal proportion of bases. tag Assemble the array.

[0025] As mentioned in the Background section, MGI's high-throughput sequencer is a single-end tag When constructing libraries with sequences, a certain percentage of crosstalk between samples occurs (this phenomenon also exists in Illumina sequencing platforms; although the sequencing processes of the MGI platform and the Illumina platform are significantly different, the adapter sequence synthesis, library construction, and hybridization capture processes inevitably result in crosstalk between samples). tag crosstalk is unavoidable).

[0026] As shown in Figure 1A, if there is 1% crosstalk in an experiment, whether it is adapter synthesis, library construction, hybridization capture or sequencing, they will all have the same crosstalk effect. Currently, the best way to resolve crosstalk between samples is to use paired-end PCR during the library construction process. tag As shown in Figure 1B, the key to solving the crosstalk problem is to perform paired-end PCR with as much control as possible at each step of the experiment. tag The only way to introduce sequences is paired-end PCR, as shown in Figure 1C. tag The scheme reduces crosstalk by a factor of 100 (1% to 0.01%) over the single-ended scheme.

[0027] Therefore, the present application aims to solve the sample crosstalk problem of the MGI sequencing platform by using the existing single-ended tag Paired-end tag The specific development ideas and history are as follows:

[0028] The MGI library construction scheme uses bubble adapters, which are different from Illumia's Y-shaped adapters, and MGI's single-ended tagThe primers may be fused within the adapter (see Figure 2B) or separated (see Figure 2A), but the paired-end tag The sequence cannot be fused to the leading end sequence (see FIG. 3B). tag When the sequences are fused, the front-end complementary region is only 7 bp long, resulting in a longer intermediate bubble-like structure, which is very unstable and poorly realized. tag (This is less effective than the truncated scheme in which the sequencing primer and the universal adapter are separated), and the universal adapter and the paired-end tag Only the amplification primer structure format shown in FIG. 3A can be used.

[0029] The inventors performed paired-end PCR according to the structure shown in FIG. 3A. tag However, during actual use, it was found that the middle bubble of the bubble adapter was too large, which affected the stability of the annealed secondary structure, and insufficient annealing affected the adapter ligation efficiency (average ligation efficiency is 20% to 40%). MGI's bubble adapter is a paired-end ligation of Illumina's Y-shaped adapter. tag This is different from the fact that they can be fused together like this.

[0030] As further research shows, MGI Bubble Adapter The unpaired base in the intermediate region may be 30±5 bp as shown in Scheme 1 in FIG. 4. In this case, if the paired base is 20±2 bp, a more stable annealing ligation is easily formed and the ligation efficiency can be improved. The unpaired base in the intermediate region may be 45±5 bp as shown in Scheme 2 in FIG. 4. In this case, if the paired base is 25±2 bp, the formed annealing ligation is more stable and the ligation efficiency is also higher.

[0031] The inventors have found that, compared with Scheme 2, Scheme 1 has the following advantages: first, the adapter with a bubble region of 30±5 bp is stable for annealing, has a smaller region that requires complementation, and is stable and contributes to ligation; second, the single-end tag The amplicons were analyzed as single-end and paired-end as shown in Figure 5. tag Third, as shown in Figure 6, single-ended molecules can be switched tag It has been found that the above-mentioned method has the advantage of being compatible with the adapter.

[0032] As a result of further research, the inventors found that although the above scheme 1 is superior to scheme 2, paired-end tag We have also found that if one wishes to obtain a sequence library for the MGI sequencing platform, either scheme 1 or scheme 2 will achieve the objective. tag When the library constructed in step 1 is used for sequencing and post-sequencing data splitting, the paired-end MGI library is used as shown in Figure 1B. tag The adapter must be connected to both ends to split the data. tag The sequences must all be correct, and the base balance requirement for single-end sequencing is tag The inventors have found that this is even more severe than

[0033] In other words, paired-end tag Although it solves the sample crosstalk problem, the base balance requirement of the sequence is very strict, and poor base balance seriously affects the accurate reading of sequence data and affects the effective division of data.

[0034] To split the data more precisely, tag For example, when all the base numbers of each are 10, the inventors: tagThe paired-end PCR was performed according to the following base screening rules: 1) there are three base differences between the sequences; 2) the GC content of each sequence is controlled between 0.4 and 0.6; and 3) the number of consecutive identical bases is 3 or less. tag The base balance was optimized.

[0035] And the tag The sequence forms a secondary structure, such as a hairpin fold, with the common primer at the 3' end of the amplification primer, thus reducing the amplification efficiency of the amplification primer and at the same time reducing the amplification efficiency of each of the amplification primers in the entire mixed library. tag It affects the balance of the bases and each subsequent tag Each of the screened sequences according to the above rules is evaluated to evaluate whether it affects the accuracy of readings of the sequence data, thereby reducing the accuracy of the sequence data division. tag Secondary structure assessment of the sequences was performed.

[0036] According to the above screening and optimization rules, in this application, 384 kinds of 4 tag Balance and 384 types of 8 tag Optimize the balance arrangement. 4 tag Balance means a group of four tag The sequence is balanced, as shown in FIG. 7A (numbers 1 to 4 in Table 4). tag ), a group of four tag The array is tag has one each of the bases A, T, G and C at positions 1 to 10 of tag Balance means a group of eight tag The sequence is balanced, as shown in FIG. 7B (numbers 1 to 8 in Table 5). tag ), 8 groups tag The array is tag At positions 1 to 10, it has two of each of the bases A, T, G and C.

[0037] According to multiple tests of this application, it has been found that a balance of 4 units is the smallest balance unit and the optimal combination. The 4-unit balance combination can be assembled into a balance combination of multiples of 4, such as 4 units, 8 units, 12 units, and 16 units, while the 8-unit balance combination needs to be assembled into a balance combination of multiples of 8, such as 8 units and 16 units.

[0038] As shown in Figure 8 (four balance combinations on the left) tag The sequences are the library sequences attached to the first four groups of amplification primers in Table 1. tag The right side shows the library of 8 balanced combinations. tag The library was attached to the first two groups of amplification primers in Table 2. tag (compatible with all combinations), 4 libraries tag When sequencing a mixture of 4 bases, the ratio of each base is 25% because each base is balanced, but when sequencing a library with 8 balanced combinations, tag When the above is adopted, the proportion of each base is 0 to 50%.

[0039] When sequencing a mixture of multiples of 8, e.g. 8 or 16 samples, the library tag The ratio of each base is 25% and balanced. When sequencing 12 samples, a library with 8 balanced combinations is generated. tag The proportion of each base in the sequence ranges from 16.7% to 33.3%.

[0040] In addition, non-integer multiples of 4-balance are better balanced than combinations of 8-balance, and the application of 4-balance is advantageous for scheduling of the MGI sequencer. As the sequence throughput of the MGI sequencer increases, the 384 types of 4-balance optimized in this application tag Combinations are used to group four items close to each other, which is advantageous for scheduling (Table 1 shows 384 types of four balances). tag (See the array). 384 optimized 8 balances tagCombinations of 8 pieces close to each other in a group are also advantageous for scheduling (Table 2, 384 types of 8 balances) tag See Arrays).

[0041] Preferably, the two types of balance in the present application tag In the construction of paired-end amplification primers, primer 1 sequence is a forward sequence of 384 kinds of numbers, and primer 2 is a reverse sequence of 384 kinds of numbers, which is only one preferred recommended sequence method of the present invention. In practical application, it is also possible to combine the sequences according to actual needs. For example, as shown in Table 1 below, when primer 1 is selected from one of 96 groups, primer 2 can be selected from the remaining 95 groups.

[0042] Of course, if the number of mixed samples is more than 4, for example 8 or 12, the primer was selected as primer 1. tag Group number was selected as primer 2 tag For example, the first three groups can be selected as primer 1, and any three groups from the remaining 93 groups can be selected as primer 2. By analogy, when sequencing a mixture of samples that are an integer multiple of four, the paired library can be created according to this rule. tag can be selected.

[0043] If the number of samples mixed is not an integer multiple of four, the four samples with the most sequence data are grouped into one balanced group. tag The combination was prioritized, and the samples with less than 4 sample sequences were placed in a further group of balance. tagA library is constructed and sequenced by arranging the 4-balanced combinations in combinations. In this case, arranging the 4-balanced combinations is clearly more advantageous than the 8-balanced combinations. In addition to the fact that half of the integer multiples of 4 are more advantageous than the 8-balanced combinations (4, 12, 20), the 4-balanced combinations also outperform the 8-balanced combinations, and even in the cases of 4n+1 and 4n+2, the balance is better than the same sample mixture sequence of the 8-balanced combination.

[0044] Therefore, compared with 8-balance, 4-balance has the following advantages: 1) the number of combinations of balanced samples in 4-balance combinations is twice as many as in 8-balance combinations; 2) among the combinations of the three unbalanced groups, the 4n+1 and 4n+2 combinations are more balanced than the 8-balance combinations; and 3) when there is a difference in the amount of sequence data between samples, 4-balance samples are easier to arrange in combinations that are close to balance, so big data samples are preferentially arranged in balanced combinations, and samples with small sequence amounts do not need to be balanced.

[0045] [Table 1] TIFF0007602621000002.tif162170

[0046] [Table 2] TIFF0007602621000004.tif155170

[0047] The reason why the data split rate is higher in the 4-balanced group is because the sequencer reads the balanced bases more accurately. If the bases are not balanced, they will be read incorrectly, resulting in a lower data split rate. When 12 samples are mixed in equal proportions and sequenced, the 4-balanced and 8-balanced groups are respectively. tag We constructed a library with the sequences and sequenced it. The data partitioning results showed that there were 4 balanced sequences, as shown in Figure 10. tagThe array has 12 samples with little variation in data division, and 8 balanced tag The array has a significantly lower data resolution of 12 samples for some samples.

[0048] Based on the above research results, the applicant has proposed the technical scheme of the present application.

[0049] In one exemplary embodiment of the present application, a paired-end library tag A composition is provided, the paired-end library tag The composition comprises a library of multiple 5' ends. tag and a library of multiple 3' ends tag and a library of multiple 5' ends. tag The length of each is the same, and the library of multiple 3' ends tag The lengths of all the DNA fragments are the same, and the paired-end libraries tag In the composition, the number of occurrences of each base at the same position is the same.

[0050] The paired-end library provided in this application tag The composition comprises a library of each 5' end in the combination. tag The length of the library is the same, and the 3' end tag The length of each base is also the same, and the number of occurrences of each base at the same position is also the same, thereby tag Since the occurrence probability of the bases is the same, the paired ends in the composition tag If you synthesize adapters or library amplification primers, paired-end libraries tag It is possible to obtain multiple libraries with good base balance. When these multiple libraries are mixed and sequenced, the paired-end sequence of each library in the mixed library is tag The reading accuracy is high and the effective division rate of the library is improved.

[0051] Library tagIn order to further improve the base balance and read accuracy of the library, in one preferred embodiment, a library of multiple 5' ends is prepared. tag The length of the library is tag The length of each of the libraries is preferably a fixed length between 6 and 10 bp. tag The lengths of the libraries are the same, so when splitting the sample, tag Since the number of bases involved in determining the origin of each sample is the same, the probability of support provided by the double-ended library is the same, and the one-end library tag The longer the reference probability of the submitted support is, the higher the other end library tag The library has a short length and the reference probability of the support it provides is low, so the split result depends on one end. tag This can prevent the division results from being biased towards the first division result.

[0052] Preferably, a paired-end library tag In the composition, any two libraries tag There are at least three base differences between tag The number of consecutive identical bases in the sequence is 3 or less, and preferably, any one of the libraries tag The GC content of each is 40-60%. tag When used in combination, the base readings are well balanced, the reading results are more accurate, and the data division rate is higher.

[0053] Preferably, a paired-end library tag The composition comprises: tag Balanced paired-end libraries tag combination of or 8 tag Balanced paired-end libraries tag where 4 tag Balanced paired-end libraries tag The combination of 4n 5'-ends is tag and a library of 4n 3' ends tag It is a combination of 8 tag Balanced paired-end libraries tag The combination of these is a library of 8n 5' ends. tag and a library of 8n 3' ends tag where n is a natural number greater than or equal to 1.

[0054] In one preferred embodiment, 4 tag Balanced paired-end libraries tag In the combination of tag is selected from any one or more of the 96 groups shown in Table 1, and the 3'-end library tag The groups are the 5'-end libraries in the 96 groups shown in Table 1. tag The compound is selected from any one or more groups different from the group.

[0055] In one preferred embodiment, 8 tag Balanced paired-end libraries tag In the combination of tag is selected from any one or more of the 48 groups shown in Table 2, and the 3'-end library tag The groups are the 5'-end libraries in the 48 groups shown in Table 2. tag The compound is selected from any one or more groups different from the group.

[0056] In a second exemplary embodiment of the present application, a paired-end library based on the MGI sequencing platform is tag and a primer composition for amplifying a plurality of paired-end libraries is provided, the primer composition comprising: tag Each amplification primer pair comprises a combination of amplification primer pairs that are 5′-terminal to the library tag and the 3' end library tag a library of 5' ends of a plurality of amplification primer pairs; tag The length of each primer is the same, and the 3' end of each primer pair is the same. tagare all the same length, and each base appears the same number of times at the same position.

[0057] A library of the 5' ends of each amplification primer pair in the combination tag The length of the library is the same, and the 3' end tag The length of each base is also the same, and the number of occurrences of each base at the same position is also the same, thereby forming a paired end in the assembled amplification primer composition. tag When labeling samples of a multiple mixed sample sequence, tag The base readings are balanced, making the readings more accurate and relevant. tag The sample data split based on this is more accurate, and the sample split rate is improved.

[0058] 5' end library of the above mixed sample tag Same length and 5' end library tag Based on the same length, the library tag In order to further improve the base balance and reading accuracy of the library of 5' ends of the plurality of amplification primer pairs, in one preferred embodiment, tag The length of the library of 3' ends of multiple amplification primer pairs. tag is the same length as

[0059] The libraries at both ends of each pair of amplification primers tag The lengths of the libraries are the same, so when splitting the sample, tag Since the number of bases involved in determining the origin of each sample is the same, the probability of support provided by the two-ended library is the same, and the longer library at one end tag provides a higher probability of support for the reference, and the other end is a shorter library. tag However, it provides a lower reference probability, so that the partitioning result is not dependent on one end. tag This can prevent the division results from being biased towards the first division result.

[0060] More preferably, the 5' end library tag and 3' end libraries tag The length of each of the sequences is a fixed length between 6 and 10 bp, and more preferably 10 bp. The preferred length here is 10 bp, which has the beneficial effect of greater discrimination and more selection combinations compared to other lengths such as 6 bp and 8 bp.

[0061] A more balanced library of bases tag In one preferred embodiment, the amplification primer composition further comprises any two-class library tag There are at least three base differences between tag The number of consecutive identical bases in the 5' end is 3 or less, and more preferably, the number of consecutive identical bases in the 5' end is 3 or less. tag and multiple 3' end libraries tag The GC content of each is 40-60%. tag When used in combination, the base readings are well balanced, the reading results are more accurate, and the data division rate is higher.

[0062] In one preferred embodiment, the amplification primer composition comprises four groups: tag Balanced combination of 4n amplification primer pairs, or 8 groups tag The combination of 8n balanced amplification primer pairs, where n is a natural number of 1 or more, is more preferably 4 groups. tag Balanced 4n amplification primer pairs, 5' end library tag is selected from any one or more of the 96 groups shown in Table 1 above, and the 3'-end library tag The groups are the 5'-end libraries in the 96 groups shown in Table 1. tag The number of groups is determined according to actual needs. tag The combination of sequences has high reading accuracy, so data division is more accurate and the division rate is higher.

[0063] In another preferred embodiment, eight groups of tag Balanced 8n amplification primer pairs for the 5' end of the library tag is selected from any one or more of the 48 groups shown in Table 2, and the 3'-end library tag The groups are the 5'-end libraries in the 48 groups shown in Table 2 above. tag The compound is selected from any one or more groups different from the group.

[0064] In the above amplification primer composition, each amplification primer pair further comprises a 5'-terminal common amplification sequence and a 3'-terminal common amplification sequence, and the 5'-terminal common amplification sequence is a library tag The consensus sequence located upstream of the 5'-end library tag and a common sequence located downstream of the 3'-end common amplification sequence, tag The consensus sequence located upstream of the 3′-terminus of the library tag and a common sequence located downstream of the primer pair. The specific sequence of the common amplification sequence in each of the above width primer pairs is determined according to the common sequence of MGI's existing sequencing platform.

[0065] The improved library of the present application tag The amplification primer combination formed using the amplification primer pair containing tag It is possible to improve the reading accuracy rate, and further improve the division accuracy and division rate of the sequence data of each sample.

[0066] According to the above, library construction is relatively short. Bubble Adapter (i.e., the number of unpaired bases in the middle region is 30±5 bp) may be adopted, and a relatively long Bubble Adapter (The number of unpaired bases in the intermediate region is 45±5 bp) may be adopted. Therefore, the common sequence in the amplification primer pair here is Bubble Adapter Depending on the length of the common amplification sequence, it can be adjusted to be relatively long or relatively short.

[0067] In one preferred embodiment, a relatively short bubble adaptor is used to provide a 5' end library. tag The consensus sequence located upstream of the 5′ end of the library is SEQ ID NO:793. tag The consensus sequence located downstream of the 3′ end of the library is SEQ ID NO:794. tag The consensus sequence located upstream of the 3′ end of the library is SEQ ID NO:795. tag The consensus sequence located downstream is SEQ ID NO:796.

[0068] In another preferred embodiment, a relatively long bubble adaptor is used to accommodate the use of the 5' end of the library. tag The consensus sequence located upstream of the 5′ end of the library is SEQ ID NO:793. tag The consensus sequence located downstream of the 3′ end of the library is SEQ ID NO:797. tag The consensus sequence located upstream of the 3′ end of the library is SEQ ID NO:795. tag The consensus sequence located downstream is SEQ ID NO:798.

[0069] In a third exemplary embodiment of the present application, there is provided a library construction reagent kit based on the MGI sequencing platform, comprising any one of the amplification primer compositions described above. tag is the number of each sample after mixed sequencing tag The sequence can be read accurately, and the sample division accuracy and division rate of mixed sample data can be improved.

[0070] To further improve the convenience of library construction, the above reagent kit is compatible with the MGI sequencing platform. Bubble Adapter may further include Bubble AdapterThe improved short sequence comprises a first adaptor sequence and a second adaptor sequence, wherein the first adaptor sequence is SEQ ID NO:769 and the second adaptor sequence is SEQ ID NO:770, or the first adaptor sequence is SEQ ID NO:773 and the second adaptor sequence is SEQ ID NO:774. Bubble Adapter is relatively long Bubble Adapter In addition to the high stability and efficiency of the adapter ligation step compared to conventional methods, the relatively long PCR amplification steps after adapter ligation are also possible. Bubble Adapter More compatible than

[0071] In a fourth exemplary embodiment of the present application, a method for constructing a sequence library based on the MGI sequencing platform is further provided, which is constructed using any one of the above-mentioned reagent kits. The library constructed using the above-mentioned reagent kit of the present application is a library when mixed sequencing is performed. tag Well-balanced library tag The reading accuracy is high when reading, and the sequence data division of each subsequent sample is also more accurate, and the data division rate is also higher.

[0072] In a fifth exemplary embodiment of the present application, a sequencing library is provided, comprising any one of the amplification primer compositions described above or constructed using any one of the methods described above. A library of a plurality of samples in the sequencing library. tag The library after sequencing is well balanced. tag This results in higher read accuracy and subsequent library partitioning rates.

[0073] The beneficial effects of the present application are further described below in connection with specific examples. For illustrative purposes, the following examples are based on the NadPrep™ DNA Library Construction Reagent Kit (for MGI), Product No.: 1002212 / NadPrep® Plasma-Free DNA Paired-End Molecules. tagThe library construction process provided in the Library Construction Reagent Kit (for MGI), Product No. 1003811 Instruction Manual V1.0 (Nanjing Namda Biotechnology Co., Ltd.) is used. The specific process can be briefly described as follows:

[0074] DNA sample fragmentation---end repair and A addition---adapter ligation---fragment screening---PCR amplification---library purification, quantification and quality check---sequencing on MGI platform or sequencing after target capture.

[0075] It should also be noted that the following examples are merely illustrative and do not limit the method of the present application to the following methods.

[0076] Example 1 Library Construction Scheme 1 and Scheme 2 Specific procedures: Refer to the NadPrepTM DNA Library Construction Reagent Kit (for MGI) (201909 Version 2.0) Instructions The only difference is Bubble Adapter The difference is the sequence and the amplification primer sequence.

[0077] (1) Scheme 1: Bubble Adapter array: Adapter sequence 1 shown in SEQ ID NO:769 and adapter sequence 2 shown in SEQ ID NO:770: SEQ ID NO:769:(31b) / phos / agtcggaggccaagcggtcttaggaagacaa, SEQ ID NO:770(40bp):ttgtcttcctaacaggaacgacatggctacgatccgact*t.

[0078] Amplification primer 1 shown in SEQ ID NO:771 and amplification primer 2 shown in SEQ ID NO:772: SEQ ID NO:771:(64bp) TIFF0007602621000005.tif27170

[0079] SEQ ID NO:772:(52bp) TIFF0007602621000006.tif27170

[0080] Features of Scheme 1: 1. The complementary region of the adapter is 7+13 bp (belonging to the range of 20±2 bp), and the intermediate bubble region is 20+12 bp (belonging to the range of 30±5 bp). 2. Amplification primers are relatively long.

[0081] Such advantages include the following: 1. The annealed structure is stable because the bubble region is short. 2. Amplification primers are single-end amplicon scheme and molecular tag Adapter schemes compatible with both plasma library construction molecules (Application No. 201910229527.4) tag (See patents).

[0082] (2) Scheme 2: Adapter sequences Adapter sequence 1 shown in SEQ ID NO:773 and adapter sequence 2 shown in SEQ ID NO:774. SEQ ID NO:773(35bp): / phos / agtcggaggccaagcggtcttaggaagacaatcag. SEQ ID NO:774(59bp): ctgattgtcttcctaagcaactccttggctcacagaacgacatggctacgatccgactt. Amplification primer 1 shown in SEQ ID NO:775 and amplification primer 2 shown in SEQ ID NO:776.

[0083] SEQ ID NO:775:(51bp) / phos / ctctcagtacgtcagcagttnnnnnnnnnncaactccttggctcacagaac, where the sequence before nnnnnnnnnn ( / phos / CTCtcagtacgtcagcagtt) is still SEQ ID NO:793 and the sequence after nnnnnnnnnn (caactccttggctcacagaac) is SEQ ID NO:797.

[0084] SEQ ID NO:776:(50bp) gcatggcgaccttatcagnnnnnnnnnnttgtcttcctaagaccgcttgg, where the sequence before nnnnnnnnnn (gcatggcgaccttatcag) is still SEQ ID NO:795, and the sequence after nnnnnnnnnn (ttgtcttcctaagaccgcttgg) is SEQ ID NO:798.

[0085] The features of this scheme are as follows: 1. The complementary region of the adapter is 7+17bp (belonging to the range of 25±2bp), and the intermediate bubble region is 34+12bp (belonging to the range of 45±5bp). 2. The amplification primer is short and refers to the portion of the amplification primer.

[0086] Compared with Scheme 1, this scheme has the following disadvantages: 1. The bubble-like region is relatively long, so the annealing structure is relatively unstable. 2. The compatibility of the amplification primers is poor and incompatible with other schemes (the amplification primer sequence is relatively short, the overlapping region with the bubble region in Scheme 1 is missing, and it is incompatible with the adapter sequence in Scheme 1).

[0087] The specific adapter structures and amplification primers for Scheme 1 and Scheme 2 are shown in Figure 4. tagThe library can be constructed, and the library construction experiments were carried out with input amounts of 25ng and 100ng, respectively, and the specific information is shown in the table below.

[0088] [Table 3]

[0089] Both schemes 1 and 2 were successful in constructing libraries properly, and the library yields were relatively close (see Figure 9). However, scheme 2 was not as efficient as the single-end MGI platform. tag Amplicons and molecules developed in tag The adapter is not compatible.

[0090] Example 2 Comparison of 4-balanced and 8-balanced 12-sample mixed data partitions Paired-end tag The scheme in Fig. 1 is a crosstalk between samples ( tag This effectively removes the missing bits (also called skips), but splitting the data requires the use of tag If the sequence is not correct, valid sequence data cannot be divided. tag Balance requirement is single ended tag It will be tougher than that.

[0091] This application optimizes two schemes, 4-balance and 8-balance. In this embodiment, 4-balance and 8-balance are used to mix 12 libraries for testing, and the effective splitting rate of each sample in the two schemes is measured. The specific experimental steps and information are as follows:

[0092] Specific steps: The library construction steps are single-ended tag Paired-end adapter tag Please refer to the NadPrepTM DNA Library Construction Reagent Kit (for MGI) (201909 Version 2.0) instructions, except for changing to the adapter library construction scheme.

[0093] Four balanced paired-end clones were used in the experiment. tag The sequences are balanced in groups of four, with each group distinguished by bold or non-bold font, as shown in Table 4 below. tag 1 is the forward sequence of 384 sequences; tag 2 is 384 tag The reverse sequence of primer 1 is tag 1 and primer 2 tag 384 is the first group of paired-end tag Assemble the primer combination and use primer 1 tag 2 and primer 2, 383, are paired-end primers of the second group. tag Primer combinations are constructed and sequenced to give 384 different combinations.

[0094] The 8-balanced array method is the same as the 4-balanced array method, with the only difference being that 8 items are balanced in one group, and the library is composed of 12 groups, as shown in Table 5. tag Putting them together, the first 8 are balanced and the last 4 are unbalanced, and accordingly, a library of 12 groups of 4-balanced combinations is created. tag Putting them together is perfectly balanced.

[0095] [Table 4]

[0096] [Table 5]

[0097] The same human genome standard was used for paired-end sequencing of 12 4-balanced and 12 8-balanced samples. tag Construct libraries by sequencing, and prepare 12 4-balanced paired-end libraries. tag The sequences are shown in column order in Table 4. The twelve 8 balanced libraries were paired-end tagThe sequences are shown in the order of columns in Table 5. The 4-balanced and 8-balanced libraries were each sequenced on the MGI sequencing platform. tag performed sequencing and analysis.

[0098] We performed two rounds of partitioning on the data obtained from the two mixed sample libraries. The first round used a maximum fault-tolerant partitioning scheme (which also partitioned sequencing faults), and the second round used a maximum fault-tolerant partitioning scheme (which also partitioned sequencing faults). tag The splitting was performed to allow only one fault in each pair. After the data splitting, as shown in Figure 10, the splitting rate of the 12 library mixed data with 4 balances is more stable, while the splitting variation of the 12 library mixed data with 8 balances is relatively large. This is because the paired-end tag It is shown that strict balance is more beneficial for the effective division of MGI sequencers, among which the 8-balance design can improve the effective division rate of data to a certain extent, and the 4-balance design has better data division effect.

[0099] Example 3 8 Balance 48 Groups of this Application tag Arrangement and 12 groups of 8 balances made by Kadaisha tag In order to ensure the performance difference between the arrays, this application has 8 balanced 48 groups tag The arrangement is 12 groups with 8 balances made by Kadaisha. tag The 8-balanced 48 group of the present application is designed to be compatible for use with the array. tag The arrangement is 12 groups with 8 balances made by Kadaisha. tag There are three base differences between any two sequences.

[0100] The main differences are as follows: 1. The present invention tag The sequence has a more balanced base composition with a GC% content of 40% to 60%, whereas the Kadai product has a GC% content of 20% to 80%. 2. The present invention tagThe sequences were subjected to matching calculations with the adapter sequences in Scheme 1 in order to produce a balanced amplification efficiency of the amplified library, but the amplification efficiency of the sequences from Huada did not meet the amplification balance requirements for certain individual sequences.

[0101] In order to further verify the performance difference of the above amplification balance, eight balances of MDI001-MDI008 of the present invention were tag Arrangement and 8 balance of MGI001-MGI008 made by Kadaisha tag One group of sequences (shown in Table 6) was selected for each group, and a library was constructed and measured using Scheme 1 of the present invention. In both cases, 100 ng of DNA was used as input, and the library yield was measured after five cycles of amplification. The results are shown in Table 7.

[0102] As shown in Table 7, one of the eight balanced groups of the present invention has a balanced yield, but the one manufactured by Hua Da Sheng has one library whose yield is less than half of the normal value, which is the same as the optimized group of the present invention. tag The sequence is more balanced, and the amplification efficiency is more stable. At the same time, the throughput of the current MGI sequencer is relatively high, so the 384 types of the two groups of the present invention can be obtained. tag There are 120 kinds of Kadaisha products. tag Compared with, it can better meet the throughput requirements of multi-sample mixed sequencing.

[0103] [Table 6]

[0104] [Table 7]

[0105] As can be seen from the above examples, the present application relates to a method for sequencing paired-end libraries on an MGI sequencing platform. tag is introduced at both ends of the sample. tagBy partitioning the data by sequence, crosstalk problems that occur during synthesis, experimental steps and sequencing processes can be eliminated, making the detection results more accurate.

[0106] In addition, the present application has tested and optimized this special structure for the bubble adapter of the MGI sequencing platform, and found that the optimal effect is obtained when the unpaired region in the middle of the bubble adapter is 30±5 bp and the paired base is 20±2 bp. The bubble adapter of this structure has the most stable annealing, and the corresponding amplification primer is an extended amplification primer and has a single-end tag Amplicons and molecules tag I found it to be compatible with the adapter.

[0107] The bubble adapter of this construct is attached to the extended amplification primer (paired-end library tag When building a library in combination with the existing MGI platform single-ended tag It is compatible with the solution's modules, facilitating its use in MGI sequencers.

[0108] Based on the above, the present application proposes 384 types of 4-balance and 8-balance, respectively, to better arrange the data division after the sequence. tag The sequences are optimized to provide an optimal solution for high-throughput sequencing and data partitioning on MGI sequencers.

[0109] The above description is merely a preferred embodiment of the present invention, and is not intended to limit the present invention. It goes without saying that various modifications and variations are possible for those skilled in the art. Any modifications, equivalent replacements, improvements, etc. made within the spirit and principle of the present invention shall be included in the protection scope of the present invention.

Claims

1. A paired-end library tag composition, the paired-end library tag composition comprising a plurality of 5'-end library tags and a plurality of 3'-end library tags, the plurality of 5'-end library tags all having the same length, the plurality of 3'-end library tags all having the same length, and the number of occurrences of each base at the same position in the paired-end library tag composition is the same; the length of the 5'-terminal library tags of the plurality is the same as the length of the 3'-terminal library tags of the plurality; In the paired-end library tag composition, there is a difference of at least three bases between any two types of the library tags, and the number of consecutive identical bases in any one type of the library tag is 3 or less; the GC content of any one of said library tags is between 40% and 60%; The paired-end library tag composition includes a 4-tag balanced paired-end library tag combination, or an 8-tag balanced paired-end library tag combination, where the 4-tag balanced paired-end library tag combination refers to a combination of 4n library tags at the 5' end and 4n library tags at the 3' end, and the 8-tag balanced paired-end library tag combination refers to a combination of 8n library tags at the 5' end and 8n library tags at the 3' end, where n is a natural number equal to or greater than 1; In the combination of the paired-end library tags of the 4 tag balance, the library tag at the 5' end is selected from any one or more groups among the 96 groups shown in Table 1, and the library tag group at the 3' end is selected from any one or more groups different from the library tag group at the 5' end among the 96 groups shown in Table 1; In the combination of paired-end library tags with 8 tags balance, the library tag at the 5' end is selected from any one or more groups among the 48 groups shown in Table 2, and the library tag group at the 3' end is selected from any one or more groups different from the library tag group at the 5' end among the 48 groups shown in Table 2. Paired-end library tag composition.

2. A paired-end library tagging amplification primer composition based on an MGI sequencing platform, the amplification primer composition comprising a combination of a plurality of paired-end library tagging amplification primer pairs, each of the amplification primer pairs comprising a library tag at a 5' end and a library tag at a 3' end; the lengths of the library tags at the 5' ends of the plurality of amplification primer pairs are all the same, the lengths of the library tags at the 3' ends of the plurality of amplification primer pairs are all the same, and the number of occurrences of each base at the same position is the same; the length of the library tag at the 5' end of the plurality of said amplification primer pairs is the same as the length of the library tag at the 3' end of the plurality of said amplification primer pairs; In the amplification primer composition, there is a difference of at least three bases between any two types of library tags, and the number of consecutive identical bases in any one type of library tag is 3 or less; the GC content of the plurality of 5'-terminal library tags and the plurality of 3'-terminal library tags is 40% to 60%; The amplification primer composition includes a 4-tag balanced combination of 4n amplification primer pairs, or an 8-tag balanced combination of 8n amplification primer pairs, wherein the 4-tag balanced paired-end library tag combination refers to a combination of 4n library tags at the 5' end and 4n library tags at the 3' end, and the 8-tag balanced paired-end library tag combination refers to a combination of 8n library tags at the 5' end and 8n library tags at the 3' end, where n is a natural number of 1 or more; In the 4n amplification primer pairs having 4 tag balance, the library tag at the 5' end is selected from any one or more groups among the 96 groups shown in Table 1, and the library tag group at the 3' end is selected from any one or more groups among the 96 groups shown in Table 1 that are different from the library tag group at the 5' end; In the 8n amplification primer pairs with 8 tag balance, the library tag at the 5' end is selected from any one or more groups among the 48 groups shown in Table 2, and the library tag group at the 3' end is selected from any one or more groups different from the library tag group at the 5' end among the 48 groups shown in Table 2. Amplification primer compositions.

3. Each of the amplification primer pairs further comprises a 5'-end common amplification sequence and a 3'-end common amplification sequence, the 5'-end common amplification sequence comprising a common sequence located upstream of the 5'-end library tag and a common sequence located downstream of the 5'-end library tag, and the 3'-end common amplification sequence comprising a common sequence located upstream of the 3'-end library tag and a common sequence located downstream of the 3'-end library tag; the consensus sequence located upstream of the 5'-terminal library tag is SEQ ID NO:793, the consensus sequence located downstream of the 5'-terminal library tag is SEQ ID NO:794, the consensus sequence located upstream of the 3'-terminal library tag is SEQ ID NO:795, and the consensus sequence located downstream of the 3'-terminal library tag is SEQ ID NO:796; or the consensus sequence located upstream of the 5'-end library tag is SEQ ID NO: 793, the consensus sequence located downstream of the 5'-end library tag is SEQ ID NO: 797, the consensus sequence located upstream of the 3'-end library tag is SEQ ID NO: 795, and the consensus sequence located downstream of the 3'-end library tag is SEQ ID NO: 798; The amplification primer composition of claim 2.

4. The amplification primer composition of claim 2, Sequencing library construction reagent kit.

5. The reagent kit further comprises a bubble adaptor, the bubble adaptor comprising a first adaptor sequence and a second adaptor sequence, the first adaptor sequence being SEQ ID NO: 769 and the second adaptor sequence being SEQ ID NO: 770, or the first adaptor sequence being SEQ ID NO: 773 and the second adaptor sequence being SEQ ID NO:

774. The reagent kit according to claim 4.

6. The reagent kit according to claim 4 or 5 is used to construct the reagent kit. A method for constructing a sequencing library based on the MGI sequencing platform.

7. The paired-end library tag composition of claim 1 or the amplification primer composition of claim 2, Sequencing library.

Images