Novel Ligand Assay

Abstract

The present invention relates to the detection of ligands that bind to and activate steroid hormone receptors. Specifically, the present invention provides test kits and assay methods for selectively identifying steroid hormone receptor ligands from a test sample. Importantly, the test kits and assay methods described herein are cell-free and do not require expensive nuclear extracts to produce for their performance. Instead, the test kits and assay methods described herein use a single polypeptide polymerase, such as T7 RNA polymerase, linked to a reporter construct. The enzyme's activity is inhibited, rather than activated, by the ligand-bound steroid hormone receptor complex, which forms only in the presence of the target ligand. Thus, the measured change in the physical properties of the reporter construct (e.g., fluorescence output) can be used to determine the presence of the target ligand in the sample under investigation.

Description

[Technical field]

[0001] The present invention relates generally to assays, methods, and test kits for detecting ligands in a sample. In particular, the present invention provides assays, methods, and test kits for screening a test sample for the presence of ligands characterized by their ability to form complexes with steroid hormone receptors and induce a steroid hormone-specific genomic response. [Background technology]

[0002] The detection of ligands capable of eliciting steroid hormone genomic responses is important in many areas of biochemistry, molecular biology, and medicine. Such ligands include endogenous steroids, exogenous steroids, nonsteroidal molecules, and synthetic molecules. For example, the determination of total hormone bioactivity in serum or plasma is important for monitoring human health-related conditions including aging, perimenopause, menopause, hypoandrogenism, hyperandrogenism, hormone replacement therapy, endocrine cancers including breast and prostate cancer, osteoporosis and other hormone-related conditions including liver toxicity, irregular menstruation, polycystic ovarian syndrome, disorders of sexual development, and infertility. Conventional detection methods of androgen / estrogen and antiandrogen / antiestrogen molecules do not provide information about the biological activity of hormones. The biological activity of hormones is an important measurement for understanding the underlying mechanisms driving health conditions so that appropriate treatments / interventions can be implemented.

[0003] Detection of hormonal bioactivity in samples is also important in the monitoring of illegal human and animal performance enhancement, injury concealment, food supplement and food adulteration, growth promoters in the dairy industry, and environmental contaminants. Measuring hormonal bioactivity provides information about contaminants and / or adulterants that may regulate endocrine pathways in the body and thereby affect human health.

[0004] Ligands that trigger the steroid hormone genomic response first activate the steroid hormone receptor protein by forming a complex with it in the cytoplasm or nucleus of eukaryotic cells to form an activated receptor protein. The ligand displaces the receptor protein's cofactors, which then expose the DNA-binding motif. The activated receptor protein dimerizes with a second activated receptor protein and translocates to the nucleus by binding to specific nucleotide sequences called response elements when required to interact with DNA. In normal biological function, the assembly of ligand-activated steroid hormone receptor proteins bound to response elements regulates gene expression by enhancing or repressing the initiation of transcription mediated by RNA polymerase II. RNA polymerase II is a multisubunit holoenzyme that assembles to catalyze RNA transcription by polymerizing nucleotide triphosphates on a DNA template.

[0005] Steroid hormone genomic responses are induced by ligands that bind to steroid hormone receptor proteins and receptor-specific response elements, such as androgen receptor (AR) and androgen response element (ARE), estrogen receptor-α (ER-α), estrogen receptor-β (ER-β) and estrogen response element (ERE), glucocorticoid receptor (GR) and glucocorticoid response element (GRE), mineralocorticoid receptor (MR) and mineralocorticoid response element (MRE), progesterone receptor-A (PR-A), progesterone receptor-B (PR-B), and progesterone response element (PRE).

[0006] However, not all ligands that bind to steroid hormone receptor proteins induce a steroid hormone genomic response. Some ligands induce non-genomic responses characterized by second messenger signaling, such as activation of G proteins. Such non-genomic responses occur within seconds to minutes of ligand binding and are not typical steroid hormone responses.

[0007] A common method of detecting the presence of a ligand in a sample is to measure the ligand directly in that sample. However, samples are often complex mixtures of molecules and typically require a complex process of preparation for analysis. Detecting the presence of a ligand(s) in a sample typically relies on processes such as liquid or gas chromatography to separate molecular species from a complex mixture into fractions of relatively pure composition and then analyze each fraction using structure-sensitive methods such as mass spectrometry. Using this approach, over 100 ligands can be tested in any one sample. Automated purification systems, gas or liquid chromatograms, and mass spectrometers are costly and technically complex laboratory equipment that must be continually calibrated and operated by trained technicians to produce reliable results. Another drawback is that some ligands may be rendered biologically inactive by interactions with proteins such as sex hormone binding globulin or serum albumin, and this technique does not distinguish between biologically active and inactive fractions of the ligand. Also, the process of ionization may result in the decay of some steroid molecules, which cannot be measured using such techniques. In addition, this approach does not provide information about the total biological activity of a sample from multiple ligands when all known ligands cannot be identified, or, when ligands can be identified, it is unclear whether the activity is additive, synergistic, or even competitive. Furthermore, to achieve reliable identification of the presence of a ligand(s) in a sample, prior knowledge of the molecular structure of the ligand(s) and its associated metabolite(s) resulting from the biological metabolism of the ligand(s) is required.

[0008] Another common way to detect the presence of steroid hormone ligands in a sample is to use biological assays based on immunological techniques, such as radioimmunoassays and enzyme-linked immunosorbent assays. The limitation of immunological techniques is the requirement of antibody molecules to detect the ligands directly or bound to sex hormone binding globulin. Immunological assays lack reproducibility due to the high variability of antibody molecules produced by different manufacturers of the assay.

[0009] To overcome limitations in detecting ligands in samples, cell-based steroid hormone assays have been developed in which the ligand binds to a steroid hormone receptor protein and triggers a steroid hormone genomic response. In these assays, the steroid hormone receptor is activated, increasing RNA polymerase II transcription of a reporter gene, which is then translated into protein and the presence of the ligand in the sample is then detected. Most commonly, the reporter gene encodes a fluorescent protein (such as GFP) or an enzyme that will trigger a light or colorimetric response in the presence of a specific substrate.

[0010] However, these cell-based assays have significant limitations in that they require specialized equipment and expertise to maintain live cell cultures.This increases the cost of cell-based testing and reduces the high-throughput application of these methods.In addition, the high level of molecular complexity of live cells makes testing difficult, reducing both specificity and reproducibility.

[0011] To overcome the limitations of detecting ligands in a sample using cell-based assays, a cell-free system was developed to detect ligands in a sample, where the ligand is capable of inducing a steroid hormone genomic response.

[0012] However, a limitation of cell-free assays is the requirement for the use of a multi-subunit holoenzyme polymerase such as RNA polymerase II. Recombinant production of RNA polymerase II is highly difficult to achieve with variable reproducibility, and as a result, holoenzymes are typically made accessible by using nuclear extracts in which all components are present and together at the promoter sequence. However, preparing nuclear extracts from eukaryotic cells is expensive to produce due to the need for expensive cell growth media and the technical expertise required to concentrate the nuclear material. Summary of the Invention [Problem to be solved by the invention]

[0013] Specifically, the present invention provides test kits, assays, and methods involving a single polypeptide polymerase, the activity of which is reduced or inhibited rather than activated by ligand binding to a steroid hormone receptor protein.

[0014] [Summary of the Invention] The invention described and claimed herein has many attributes and examples, including but not limited to those described or illustrated or referenced in this Summary of the Invention. It is not intended to be comprehensive, and the invention described and claimed herein is not limited to the features or examples identified in this Summary of the Invention, which are included for purposes of illustration only and not limitation. [Means for solving the problem]

[0015] In one aspect of the invention there is provided a test kit for screening a sample for the presence of a ligand capable of inducing a steroid hormone genomic response comprising: (i) a steroid hormone receptor capable of forming a receptor-ligand complex with a ligand from a sample; (ii) a nucleic acid molecule comprising: (a) a polymerase promoter sequence, (b) a response element that is capable of being bound by a receptor-ligand complex, and (c) comprising a reporter construct; a nucleic acid molecule, wherein a response element (b) is located between the promoter sequence (a) and the reporter construct (c), and wherein (a), (b), and (c) are operably linked; (iii) a polymerase, A test kit is provided in which, when a sample is combined with the test kit, the presence of the ligand in the sample is detected by measuring the reduction or inhibition of transcription of the reporter construct caused by binding of the ligand-receptor complex to the response element.

[0016] In a further aspect of the invention there is provided a test kit for screening a sample for the presence of a ligand capable of inducing a steroid hormone genomic response comprising: (i) a steroid hormone receptor capable of forming a receptor-ligand complex with a ligand from a sample; (ii) a nucleic acid molecule comprising: (a) a polymerase promoter sequence, (b) a response element that is capable of being bound by a receptor-ligand complex, and (c) comprising a reporter construct; a nucleic acid molecule, wherein a response element (b) is located between the promoter sequence (a) and the reporter construct (c), and wherein (a), (b), and (c) are operably linked; (iii) a single polypeptide polymerase, A test kit is provided in which, when a sample is combined with the test kit, the presence of the ligand in the sample is detected by measuring the reduction or inhibition of transcription of the reporter construct caused by binding of the ligand-receptor complex to the response element.

[0017] In a further aspect of the invention there is provided a test kit for screening a sample for the presence of a ligand capable of inducing a steroid hormone genomic response comprising: (i) a steroid hormone receptor capable of forming a receptor-ligand complex with a ligand from a sample; (ii) a nucleic acid molecule comprising: (a) a polymerase promoter sequence, (b) a response element that is capable of being bound by a receptor-ligand complex, and (c) comprising a reporter construct; a nucleic acid molecule, wherein a response element (b) is located between the promoter sequence (a) and the reporter construct (c), and wherein (a), (b), and (c) are operably linked; (iii) a single polypeptide RNA polymerase, A test kit is provided in which, when a sample is combined with the test kit, the presence of the ligand in the sample is detected by measuring the reduction or inhibition of transcription of the reporter construct caused by binding of the ligand-receptor complex to the response element.

[0018] In yet a further aspect of the invention there is provided a test kit for screening a sample for the presence of a ligand capable of inducing a steroid hormone genomic response comprising: (i) a steroid hormone receptor capable of forming a receptor-ligand complex with a ligand from a sample; (ii) a nucleic acid molecule comprising: (a) T7 RNA polymerase promoter sequence, (b) a response element that is capable of being bound by a receptor-ligand complex, and (c) comprising a reporter construct; a nucleic acid molecule, wherein a response element (b) is located between the promoter sequence (a) and the reporter construct (c), and wherein (a), (b), and (c) are operably linked; (iii) T7 RNA polymerase, A test kit is provided in which, when a sample is combined with the test kit, the presence of the ligand in the sample is detected by measuring the reduction or inhibition of transcription of the reporter construct caused by binding of the ligand-receptor complex to the response element.

[0019] In yet a further aspect of the invention there is provided a test kit for screening a sample for the presence of a ligand capable of inducing a steroid hormone genomic response comprising: (i) a steroid hormone receptor capable of forming a receptor-ligand complex with a ligand from a sample; (ii) a steroid hormone receptor cofactor selected from heat shock protein 90 (HSP90), a complex of HSP90 and heat shock protein 70 (HSP70); a complex of HSP90, HSP70, and heat shock protein 40 (HSP40); a complex of HSP90, HSP70, HSP40, and p23; a complex of HSP90, HSP70, HSP40, p23, and heat shock protein organizing protein (Hop); a complex of HSP90, HSP70, HSP40, p23, Hop, and 48 kD Hip protein (Hip); a complex of HSP90, HSP70, HSP40, p23, Hop, Hip, and p60; and a complex of HSP90, HSP70, HSP40, p23, Hop, Hip, p60, and FKBP52. (iii) a nucleic acid molecule comprising: (a) a T7 RNA polymerase promoter sequence as defined by SEQ ID NO:1; (b) a response element that is capable of being bound by a receptor-ligand complex, and (c) comprising a reporter construct; a nucleic acid molecule, wherein a response element (b) is located between the promoter sequence (a) and the reporter construct (c), and wherein (a), (b), and (c) are operably linked; (iv) T7 RNA polymerase, A test kit is provided in which, when a sample is combined with the test kit, the presence of the ligand in the sample is detected by measuring the reduction or inhibition of transcription of the reporter construct caused by binding of the ligand-receptor complex to the response element.

[0020] In yet a further aspect of the invention there is provided a test kit for screening a sample for the presence of a ligand capable of inducing a steroid hormone genomic response comprising: (i) a steroid hormone receptor capable of forming a receptor-ligand complex with a ligand from a sample; (ii) a steroid hormone receptor cofactor selected from heat shock protein 90 (HSP90), a complex of HSP90 and heat shock protein 70 (HSP70); a complex of HSP90, HSP70, and heat shock protein 40 (HSP40); a complex of HSP90, HSP70, HSP40, and p23; a complex of HSP90, HSP70, HSP40, p23, and heat shock protein organizing protein (Hop); a complex of HSP90, HSP70, HSP40, p23, Hop, and 48 kD Hip protein (Hip); a complex of HSP90, HSP70, HSP40, p23, Hop, Hip, and p60; and a complex of HSP90, HSP70, HSP40, p23, Hop, Hip, p60, and FKBP52. (iii) a nucleic acid molecule comprising: (a) a T7 RNA polymerase promoter sequence as defined by SEQ ID NO:1; (b) a response element that is capable of being bound by a receptor-ligand complex, and (c) a reporter construct comprising an RNA aptamer capable of binding to a fluorophore; a nucleic acid molecule, wherein a response element (b) is located between the promoter sequence (a) and the reporter construct (c), and wherein (a), (b), and (c) are operably linked; (iv) T7 RNA polymerase, A test kit is provided in which, when a sample is combined with the test kit, the presence of the ligand in the sample is detected by measuring the reduction or inhibition of fluorescence of the reporter construct caused by binding of the ligand-receptor complex to the response element.

[0021] In yet a further aspect of the invention there is provided a test kit for screening a sample for the presence of a ligand capable of inducing a steroid hormone genomic response comprising: (i) a steroid hormone receptor capable of forming a receptor-ligand complex with a ligand from a sample; (ii) a steroid hormone receptor cofactor selected from heat shock protein 90 (HSP90), a complex of HSP90 and heat shock protein 70 (HSP70); a complex of HSP90, HSP70, and heat shock protein 40 (HSP40); a complex of HSP90, HSP70, HSP40, and p23; a complex of HSP90, HSP70, HSP40, p23, and heat shock protein organizing protein (Hop); a complex of HSP90, HSP70, HSP40, p23, Hop, and 48 kD Hip protein (Hip); a complex of HSP90, HSP70, HSP40, p23, Hop, Hip, and p60; and a complex of HSP90, HSP70, HSP40, p23, Hop, Hip, p60, and FKBP52. (iii) a nucleic acid molecule comprising: (a) a T7 RNA polymerase promoter sequence as defined by SEQ ID NO:1; (b) a response element that is capable of being bound by a receptor-ligand complex, and (c) a reporter construct comprising an RNA aptamer capable of binding to a fluorophore; a nucleic acid molecule, wherein a response element (b) is located between the promoter sequence (a) and the reporter construct (c), and wherein (a), (b), and (c) are operably linked; (iv) a fluorophore capable of binding to the RNA aptamer; and (v) T7 RNA polymerase, A test kit is provided in which, when a sample is combined with the test kit, the presence of the ligand in the sample is detected by measuring the reduction or inhibition of fluorescence of the reporter construct caused by binding of the ligand-receptor complex to the response element.

[0022] In yet a further aspect of the invention there is provided a test kit for screening a sample for the presence of a ligand capable of inducing a steroid hormone genomic response comprising: (i) a steroid hormone receptor capable of forming a receptor-ligand complex with a ligand from a sample; (ii) a steroid hormone receptor cofactor selected from heat shock protein 90 (HSP90), a complex of HSP90 and heat shock protein 70 (HSP70); a complex of HSP90, HSP70, and heat shock protein 40 (HSP40); a complex of HSP90, HSP70, HSP40, and p23; a complex of HSP90, HSP70, HSP40, p23, and heat shock protein organizing protein (Hop); a complex of HSP90, HSP70, HSP40, p23, Hop, and 48 kD Hip protein (Hip); a complex of HSP90, HSP70, HSP40, p23, Hop, Hip, and p60; and a complex of HSP90, HSP70, HSP40, p23, Hop, Hip, p60, and FKBP52. (iii) a nucleic acid molecule comprising: (a) a T7 RNA polymerase promoter sequence as defined by SEQ ID NO:1; (b) a response element that is capable of being bound by a receptor-ligand complex, and (c) a reporter construct comprising a Mango aptamer capable of binding to thiazole orange; a nucleic acid molecule, wherein a response element (b) is located between the promoter sequence (a) and the reporter construct (c), and wherein (a), (b), and (c) are operably linked; (iv) thiazole orange, (v) T7 RNA polymerase, A test kit is provided in which, when a sample is combined with the test kit, the presence of the ligand in the sample is detected by measuring the reduction or inhibition of fluorescence of the reporter construct caused by binding of the ligand-receptor complex to the response element.

[0023] In yet another aspect of the invention there is provided an assay method for detecting a ligand in a sample, wherein the ligand is capable of eliciting a steroid hormone genomic response, comprising the steps of: (i) a sample, (a) a steroid hormone receptor that forms a ligand-receptor complex with a ligand from a sample; and (b) a nucleic acid molecule comprising: (1) a polymerase promoter sequence, (2) a response element that is bound by the ligand-receptor complex, and (3) comprising a reporter construct; a nucleic acid molecule, wherein a response element (b) is located between the promoter sequence (a) and the reporter construct (c), and wherein (a), (b), and (c) are operably linked; (c) a single polypeptide polymerase, and (d) contacting with a nucleoside triphosphate; (ii) measuring the reduction or inhibition of transcription of the reporter construct caused by binding of the ligand-receptor complex to the response element; An assay method is provided in which a measured reduction or inhibition of transcription of the reporter construct indicates detection of a ligand in the sample.

[0024] In yet another aspect of the invention there is provided an assay method for detecting a ligand in a sample, wherein the ligand is capable of eliciting a steroid hormone genomic response, comprising the steps of: (i) a sample, (a) a steroid hormone receptor that forms a ligand-receptor complex with a ligand from a sample; and (b) a steroid hormone receptor cofactor selected from heat shock protein 90 (HSP90), a complex of HSP90 and heat shock protein 70 (HSP70); a complex of HSP90, HSP70, and heat shock protein 40 (HSP40); a complex of HSP90, HSP70, HSP40, and p23; a complex of HSP90, HSP70, HSP40, p23, and heat shock protein organizing protein (Hop); a complex of HSP90, HSP70, HSP40, p23, Hop, and 48 kD Hip protein (Hip); a complex of HSP90, HSP70, HSP40, p23, Hop, Hip, and p60; and a complex of HSP90, HSP70, HSP40, p23, Hop, Hip, p60, and FKBP52, (c) a nucleic acid molecule comprising: (1) a polymerase promoter sequence, (2) a response element that is bound by the ligand-receptor complex, and (3) comprising a reporter construct; a nucleic acid molecule, wherein a response element (b) is located between the promoter sequence (a) and the reporter construct (c), and wherein (a), (b), and (c) are operably linked; (d) a single polypeptide polymerase, and (e) contacting with a nucleoside triphosphate; (ii) measuring the reduction or inhibition of transcription of the reporter construct caused by binding of the ligand-receptor complex to the response element; An assay method is provided in which a measured reduction or inhibition of transcription of the reporter construct indicates detection of a ligand in the sample.

[0025] In yet another aspect of the invention there is provided an assay method for detecting a ligand in a sample, wherein the ligand is capable of eliciting a steroid hormone genomic response, comprising the steps of: (i) contacting the sample with a test kit as described herein; (ii) measuring the reduction or inhibition of transcription of the reporter construct caused by binding of the ligand-receptor complex to the response element; An assay method is provided in which a measured reduction or inhibition of transcription of the reporter construct indicates detection of a ligand in the sample.

[0026] In yet another aspect of the invention there is provided an assay method for detecting a ligand in a sample, wherein the ligand is capable of eliciting a steroid hormone genomic response, comprising the steps of: (i) a sample, (a) a steroid hormone receptor that forms a ligand-receptor complex with a ligand from a sample; and (b) a nucleic acid molecule comprising: (1) a polymerase promoter sequence, (2) a response element that is bound by the ligand-receptor complex, and (3) comprising a fluorescence-based reporter construct; a nucleic acid molecule, wherein a response element (b) is located between the promoter sequence (a) and the reporter construct (c), and wherein (a), (b), and (c) are operably linked; (c) a single polypeptide polymerase, and (d) contacting with a nucleoside triphosphate; (ii) measuring the reduction or inhibition of fluorescence of the reporter construct caused by binding of the ligand-receptor complex to the response element; An assay method is provided in which a measured reduction or inhibition of fluorescence of the reporter construct indicates detection of the ligand in the sample.

[0027] In yet another aspect of the invention there is provided an assay method for detecting a ligand in a sample, wherein the ligand is capable of eliciting a steroid hormone genomic response, comprising the steps of: (i) a sample, (a) a steroid hormone receptor that forms a ligand-receptor complex with a ligand from a sample; and (b) a steroid hormone receptor cofactor selected from heat shock protein 90 (HSP90), a complex of HSP90 and heat shock protein 70 (HSP70); a complex of HSP90, HSP70, and heat shock protein 40 (HSP40); a complex of HSP90, HSP70, HSP40, and p23; a complex of HSP90, HSP70, HSP40, p23, and heat shock protein organizing protein (Hop); a complex of HSP90, HSP70, HSP40, p23, Hop, and 48 kD Hip protein (Hip); a complex of HSP90, HSP70, HSP40, p23, Hop, Hip, and p60; and a complex of HSP90, HSP70, HSP40, p23, Hop, Hip, p60, and FKBP52, (c) a nucleic acid molecule comprising: (1) a polymerase promoter sequence, (2) a response element that is bound by the ligand-receptor complex, and (3) comprising a fluorescence-based reporter construct; a nucleic acid molecule, wherein a response element (b) is located between the promoter sequence (a) and the reporter construct (c), and wherein (a), (b), and (c) are operably linked; (d) a single polypeptide polymerase, and (e) contacting with a nucleoside triphosphate; (ii) measuring the reduction or inhibition of fluorescence of the reporter construct caused by binding of the ligand-receptor complex to the response element; An assay method is provided in which a measured reduction or inhibition of fluorescence of the reporter construct indicates detection of the ligand in the sample.

[0028] In yet another aspect of the invention there is provided an assay method for detecting a ligand in a sample, wherein the ligand is capable of eliciting a steroid hormone genomic response, comprising the steps of: (i) contacting the sample with a test kit comprising a fluorescence-based reporter construct as described herein; (ii) measuring the reduction or inhibition of fluorescence of the reporter construct caused by binding of the ligand-receptor complex to the response element; An assay method is provided in which a measured reduction or inhibition of fluorescence of the reporter construct indicates detection of the ligand in the sample.

[0029] In a further aspect of the invention, a method is provided for determining the steroid hormone bioactivity of a sample, comprising combining the sample with a test kit as described herein to determine whether the sample contains a ligand sufficient to activate the steroid hormone receptor and cause a change in a physical property of the reporter construct, wherein the change in the physical property of the reporter construct provides information about the steroid hormone bioactivity of the sample.

[0030] In a further aspect of the invention, a method is provided for determining the steroid hormone bioactivity of a biological sample, comprising combining the biological sample with a test kit as described herein to determine whether the sample contains a ligand sufficient to activate the steroid hormone receptor and cause a change in a physical property of the reporter construct, wherein the change in the physical property of the reporter construct provides information about the steroid hormone bioactivity of the biological sample.

[0031] In a further aspect of the present invention, there is provided a method for determining the steroid hormone bioactivity of a clinical specimen, comprising combining a sample obtained from the clinical specimen with a test kit as described herein to determine whether the sample contains a ligand sufficient to activate the steroid hormone receptor and cause a change in the physical property of the reporter construct, wherein the change in the physical property of the reporter construct provides information about the steroid hormone bioactivity of the clinical specimen.

[0032] In a further aspect of the present invention, there is provided a method for determining the steroid hormone bioactivity of a food or dietary supplement, comprising combining the food or dietary supplement or an extract of the food or dietary supplement with a test kit as described herein to determine whether the sample contains sufficient ligand to activate the steroid hormone receptor and cause a change in the physical property of the reporter construct, wherein the change in the physical property of the reporter construct provides information about the steroid hormone bioactivity of the food or dietary supplement.

[0033] In a further aspect of the present invention, a method is provided for determining the steroid hormone bioactivity of a sample derived from an environmental source, comprising combining a sample obtained from the environmental source with a test kit as described herein to determine whether the sample contains a ligand sufficient to activate the steroid hormone receptor and cause a change in the physical property of the reporter construct, wherein the change in the physical property of the reporter construct provides information about the steroid hormone bioactivity of the environmental sample.

[0034] In a further aspect of the present invention, a method is provided for determining the doping status of an athlete, comprising combining a sample obtained from the athlete with a test kit as described herein to determine whether the sample contains a ligand sufficient to activate a steroid hormone receptor and cause a change in a physical property of a reporter construct, wherein the change in the physical property of the reporter construct provides information about the doping status of the athlete.

[0035] In a further aspect of the invention, there is provided a method for determining the steroid hormone bioactivity of a sample, comprising subjecting the sample to an assay method as described herein to ascertain whether the sample contains a ligand sufficient to activate a steroid hormone receptor and cause a change in a physical property of a reporter construct, wherein the change in the physical property of the reporter construct provides information about the steroid hormone bioactivity of the sample.

[0036] In a further aspect of the present invention, there is provided a method for determining the steroid hormone bioactivity of a biological sample, comprising subjecting the sample to an assay method as described herein to ascertain whether the sample contains a ligand sufficient to activate a steroid hormone receptor and cause a change in a physical property of a reporter construct, wherein the change in the physical property of the reporter construct provides information about the steroid hormone bioactivity of the biological sample.

[0037] In a further aspect of the present invention, there is provided a method for determining the steroid hormone bioactivity of a food or dietary supplement, comprising subjecting the food or dietary supplement or an extract from the food or dietary supplement to the assay method described herein to ascertain whether the food or dietary supplement contains a ligand sufficient to activate the steroid hormone receptor and cause a change in the physical properties of the reporter construct, wherein the change in the physical properties of the reporter construct provides information about the steroid hormone bioactivity of the food or dietary supplement.

[0038] In a further aspect of the present invention, there is provided a method for determining the steroid hormone bioactivity of a clinical sample, comprising subjecting the clinical sample to an assay method as described herein to ascertain whether the sample contains a ligand sufficient to activate the steroid hormone receptor and cause a change in a physical property of the reporter construct, wherein the change in the physical property of the reporter construct provides information about the steroid hormone bioactivity of the clinical sample.

[0039] In a further aspect of the present invention, there is provided a method for determining steroid hormone bioactivity of a sample derived from an environmental source, comprising subjecting the environmental sample to the assay method described herein to ascertain whether the sample contains a ligand sufficient to activate a steroid hormone receptor and cause a change in a physical property of a reporter construct, wherein the change in the physical property of the reporter construct provides information about the steroid hormone bioactivity.

[0040] In a further aspect of the present invention, there is provided a method for determining the doping status of an athlete, comprising subjecting a sample obtained from the athlete to the assay method described herein to ascertain whether the sample contains a ligand sufficient to activate a steroid hormone receptor and cause a change in a physical property of a reporter construct, wherein the change in the physical property of the reporter construct provides information about the doping status of the athlete.

[0041] In a further aspect of the present invention, there is provided an article of manufacture for screening a sample for the presence of a ligand, which ligand is capable of inducing a steroid hormone genomic response, comprising a test kit as described herein together with instructions on how to detect the presence of the ligand in a sample.

[0042] In a further aspect of the present invention, there is provided an article of manufacture for screening a biological sample for the presence of a ligand, which ligand is capable of inducing a steroid hormone genomic response, comprising a test kit as described herein together with instructions on how to detect the presence of the ligand in a biological sample.

[0043] In a further aspect of the present invention, there is provided an article of manufacture for screening foods or dietary supplements for the presence of a ligand, which ligand is capable of eliciting a steroid hormone genomic response, comprising a test kit as described herein together with instructions on how to detect the presence of the ligand in a food or dietary supplement.

[0044] In yet a further aspect of the invention, there is provided an article of manufacture for determining steroid hormone bioactivity of a sample, comprising a test kit as described herein together with instructions for detecting steroid hormone bioactivity in a sample, wherein the presence of a bioactive ligand in the sample is indicative of steroid hormone bioactivity of the sample.

[0045] In yet a further aspect of the present invention, there is provided an article of manufacture for determining steroid hormone bioactivity of a clinical sample, comprising a test kit as described herein together with instructions for detecting steroid hormone bioactivity in a clinical sample, wherein the presence of a bioactive ligand in the clinical sample is indicative of steroid hormone bioactivity of the clinical sample.

[0046] In yet a further aspect of the present invention, there is provided an article of manufacture for determining steroid hormone bioactivity of an environmental sample, comprising a test kit as described herein together with instructions for detecting steroid hormone bioactivity in an environmental sample, wherein the presence of a bioactive ligand in the environmental sample is indicative of steroid hormone bioactivity of the environmental sample.

[0047] In yet a further aspect of the present invention, there is provided an article of manufacture for determining doping in an athlete, comprising a test kit as described herein together with instructions for detecting the presence of a ligand in a sample from an athlete, the presence of the ligand in the sample being indicative of doping in the athlete.

[0048] General definition Unless otherwise defined, all technical and scientific terms used herein are intended to have the same meaning as commonly understood by one of ordinary skill in the art (e.g., in immunology, immunohistochemistry, protein chemistry, molecular genetics, synthetic biology, and biochemistry).

[0049] Reference to a numerical range disclosed herein (e.g., 1-10) also incorporates reference to all associated numbers within that range (e.g., 1, 1.1, 2, 3, 3.9, 4, 5, 6, 6.5, 7, 8, 9, and 10), as well as any range of rational numbers within that range (e.g., 2-8, 1.5-5.5, and 3.1-4.7), and thus is intended to expressly disclose all subranges of every range explicitly disclosed herein. These are merely examples of what is specifically intended, and all possible combinations of numerical values ​​between the minimum and maximum values ​​recited are to be considered as being expressly set forth in this application in a similar manner.

[0050] The term "and / or," e.g., "X and / or Y," shall be understood to mean either "X and Y" or "X or Y," and shall be interpreted as providing explicit endorsement of both meanings or either meaning.

[0051] The terms "a" or "an" refer to one or more of a specified entity, for example, "a receptor" or "a nucleic acid molecule" can refer to one or more receptors or nucleic acid molecules, or at least one receptor or nucleic acid molecule. Thus, the terms "a" or "an," "one or more," and "at least one" can be used interchangeably herein.

[0052] Throughout this specification the word "comprise" or variations such as "comprises" or "comprising" will be understood to mean the inclusion of a stated element, integer, or step, or group of elements, integers, or steps, but will not exclude any other element, integer, or step, or group of elements, integers, or steps.

[0053] Throughout this specification, unless otherwise indicated or otherwise required by context, references to a single step, composition of matter, group of steps, or group of composition of matter shall be interpreted as encompassing one and more (i.e., one or more) of that step, composition of matter, group of steps, or group of composition of matter.

[0054] Selected Definitions For purposes of the present invention, the following terms shall have the following meanings.

[0055] As used herein, the term "test kit" refers to an article of manufacture that contains various components for carrying out the assays and methods according to the invention described herein.

[0056] The term "steroid hormone receptor" or "SHR" as used herein refers to a polypeptide comprising a protein or recombinant polypeptide that selectively binds to a ligand, which can activate the steroid hormone receptor, including, but not limited to, the androgen receptor, the estrogen receptor, the progesterone receptor, the mineralocorticoid receptor, and the glucocorticoid receptor. Typically, a steroid hormone receptor comprises a ligand-binding domain, an activation domain, and a deoxyribonucleic acid-binding domain. According to this definition, a "steroid hormone receptor" may optionally include other cofactors, including (for example) heat shock proteins, which help to keep the steroid hormone receptor folded and responsive to hormones for activation by the ligand.

[0057] As used herein, the term "steroid hormone receptor cofactor" refers to one or more cofactors that hold a steroid hormone receptor in an inactive state until displaced by a ligand upon activation of the steroid hormone receptor. Examples of steroid hormone receptor cofactors according to the present invention include, but are not limited to, heat shock protein 90 (HSP90), a complex of HSP90 and heat shock protein 70 (HSP70); a complex of HSP90, HSP70, and heat shock protein 40 (HSP40); a complex of HSP90, HSP70, HSP40, and p23; a complex of HSP90, HSP70, HSP40, p23, and heat shock protein organizing protein (Hop); a complex of HSP90, HSP70, HSP40, p23, Hop, and 48 kD Hip protein (Hip); a complex of HSP90, HSP70, HSP40, p23, Hop, Hip, and p60; and a complex of HSP90, HSP70, HSP40, p23, Hop, Hip, p60, and FKBP52.

[0058] The term "ligand" generally refers to any molecule that binds to a receptor, including, but not limited to, steroids, polypeptides, proteins, vitamins, carbohydrates, glycoproteins, therapeutic agents, drugs, glycosaminoglycans, or any combination thereof. As used herein, "ligand" includes, but is not limited to, steroid hormones, such as sex hormones, including, but not limited to, estrogens, progestagens, androgens, and their natural and synthetic derivatives and analogs and metabolites, designer steroid hormones, anabolic androgenic steroids, and selective androgen receptor modulators, progestagen receptor modulators, and estrogen receptor modulators, currently known and those that are developed or expected to be found naturally in biological samples.

[0059] The terms "receptor-ligand complex" and "activated steroid hormone receptor", as used interchangeably herein, refer to a ligand-bound steroid hormone receptor, which undergoes a structural transformation upon binding to a ligand and is then in an activated form. Receptor-ligand complexes as described herein include, but are not limited to, dimers of ligand-bound hormone receptors (i.e., (HR-L)2).

[0060] The term "genomic response" as used herein refers to the ability of an activated steroid hormone receptor (or receptor-ligand complex) to selectively bind to its corresponding nucleic acid response element and activate or repress transcription of downstream genes. In a cellular environment, the ligand-binding receptor binds to a nucleic acid response element and switches a gene on or off in response to an external stimulus (i.e., the presence of a ligand). The test kits, assays, and methods according to the present invention have been developed to identify ligands that will induce a steroid hormone genomic response in a cellular environment by providing a reporter-based framework that mimics aspects of cell-based systems.

[0061] The term "steroid metabolic machinery" as used herein refers to any enzyme, including a combination of enzymes sufficient to convert a ligand from a physiologically inactive form to a physiologically active form, or from a physiologically active form to a more physiologically active form, or from a physiologically active form to a less physiologically active form, or from a physiologically active form to a physiologically inactive form.

[0062] The term "detection means" as used herein refers to any device, equipment, or configuration adapted to detect the binding interaction between an activated steroid hormone receptor and a nucleic acid response element. Examples of detection means include, but are not limited to, optical methods, spectroscopy, visible spectroscopy, Raman spectroscopy, UV spectroscopy, surface plasmon resonance, electrochemical methods, impedance, resistance, capacitance, mechanical sensing by change in mass, change in mechanical resonance, electrophoresis, gel electrophoresis, gel retardation, imaging, fluorescence and fluorescence resonance energy transfer, polymerase chain reaction, etc.

[0063] The term "nucleic acid sequence" as used herein refers to deoxyribonucleic acid (DNA) sequences, ribonucleic acid sequences (RNA), messenger ribonucleic acid (mRNA), and complementary DNA (cDNA), which are composed of a contiguous sequence of two or more nucleotides, also referred to as polynucleotides or oligonucleotides. Nucleic acid sequences can be single-stranded or double-stranded.

[0064] As used herein, the term "reporter construct" refers to a nucleic acid sequence that encodes a reporter molecule that encodes an RNA whose expression can be assayed, including, but not limited to, a fluorophore-conjugated aptamer, or a synthetic RNA or mRNA. In addition, a reporter gene can encompass any gene of interest whose expression product can be detected by RNA analysis.

[0065] The term "promoter" as used herein is a nucleic acid sequence located proximal to the 5' end of the transcription start of the operably linked transcribed sequence. A promoter may contain one or more regulatory elements that interact to regulate the transcription of the operably linked gene. Examples of promoters according to the present invention include, but are not limited to, T7, T3, and SP6 bacteriophage promoters or initiation sequences. The terms "promoter", "promoter sequence", "initiator sequence", or "initiation sequence" may be used interchangeably throughout the present specification to mean the same thing.

[0066] The term "operably linked" as used herein describes two polymeric elements arranged such that modulating the activity of the first element induces an effect on the second element. In this manner, modulation of the activity of the promoter element can be used to alter and / or modulate the expression of the reporter construct to which it is operably linked. For example, transcription of a reporter construct operably linked to a promoter element is induced by an agent that "activates" the activity of the promoter, and transcription of a reporter construct operably linked to a promoter element is inhibited by an agent that "blocks" the activity of the promoter. Thus, a promoter region is operably linked to a reporter construct if transcription of such a reporter construct is affected by the activity of the promoter.

[0067] The term "expression" as used herein refers to the process by which the information encoded in a gene is expressed. When a gene codes for a protein, expression involves both transcription of DNA into mRNA, processing of the mRNA into a mature mRNA product (if necessary), and translation of the mature mRNA into a protein. A nucleic acid molecule, such as a deoxyribonucleic acid (DNA) or gene, is said to be "capable of expressing" a polypeptide (or protein) when the molecule contains a polypeptide coding sequence and expression control sequences that provide the ability to transcribe, process, and translate the genetic information contained in the DNA into a protein product in a suitable host environment, and when such expression control sequences are operably linked to the nucleotide sequence encoding the polypeptide.

[0068] As used herein, the term "sample" refers to any sample in which one desires to test for the presence of a ligand. As used herein, the terms "sample" and "test sample" are used interchangeably.

[0069] The term "relative potency" or "RP" as used herein refers to the multiplier of the biological activity exhibited by a test compound compared to a reference compound, measured using the assays and test kits described herein, where the biological activity is defined by the ability of the compound to bind to and activate (for example) a steroid hormone receptor. If the relative potency is >1, the test compound is more potent in terms of its biological activity compared to the reference compound, if the relative potency is <1, the test compound is less potent in terms of its biological activity compared to the reference compound, and if the relative potency=1, the test compound and the reference compound are equally potent in terms of biological activity.

[0070] The term "activator" or "AF" as used herein relates to the measurement of metabolic conversion of a test compound (for example) from a physiologically inactive state to a physiologically active state, or from a less physiologically active state to a more physiologically active state. An activator > 1 means that the test compound underwent metabolic conversion to a more physiologically active state in the presence of the metabolic machinery in the assay.

[0071] The term "reference threshold" or "reference standard" may be used interchangeably to mean the level of assay activity measured (for example) in the absence of a test sample, or in the absence of a test sample and a steroid hormone receptor. In certain examples according to the invention described herein, the reference threshold or reference standard is determined using ethanol instead of a test sample. The reference threshold is intended to establish the baseline activity or signal of the assay in the absence of a target ligand. [Brief description of the drawings]

[0072] [Figure 1] FIG. 1 shows a schematic diagram of androgen response element (ARE)-mediated inhibition of T7 RNA polymerase-mediated transcription of a reporter construct containing a Mango II aptamer sequence under the control of a T7 promoter. [Diagram 2]Figure 1 shows that AR reduced T7-mediated transcription of RNA Mango II aptamer. In vitro transcription reactions were assembled using the T7 promoter-ARE-RNA Mango II aptamer DNA template. Reactions were assembled in 0.5 mL Eppendorf tubes and initiated by the addition of 11.5 ng / mL testosterone. After 2 hours of incubation, RNA Mango II aptamer was measured by adding TO1-biotin (TO1-B) and detecting the increase in fluorescence using a standard fluorometer. Black cylinders - control reactions with no AR added, grey cylinders - reactions with AR added at 100 ng / reaction or 400 ng / reaction. [Diagram 3] Figure 1 shows that AR reduced T7-mediated transcription of RNA Mango II aptamer. In vitro transcription reactions were assembled using the T7 promoter-ARE-RNA Mango II aptamer DNA template. Reactions were assembled in 0.5mL Eppendorf tubes. After 2 hours of incubation, the RNA Mango II aptamer was measured by adding TO1-B and detecting the increase in fluorescence using a standard fluorometer. Black cylinders - control reaction with no AR added, grey cylinders - reaction with AR added at 100ng / reaction. Dark grey cylinders - reaction with AR added at 100ng / reaction and activated with 11.5ng / mL testosterone. [Figure 4]We show that HSP90 blocks AR inhibition of T7-mediated RNA Mango II aptamer expression. In vitro transcription reactions were assembled using the T7 promoter-ARE-RNA Mango II aptamer DNA template. Reactions were assembled in 0.5 mL Eppendorf tubes. After 2 hours of incubation, the RNA Mango II aptamer was measured by adding TO1-B and detecting the increase in fluorescence using a standard fluorometer. Black cylinders - control reaction with no AR added; grey cylinders - reactions with AR added at 100 ng / reaction; dark grey cylinders - reactions with AR added at 100 ng / reaction and activated with testosterone at 11.5 ng / mL; light grey cylinders - reactions with AR added at 100 ng / reaction, and HSP90 added at 200 ng / reaction; darkest grey cylinders - reactions with AR added at 100 ng / reaction, and HSP90 added at 200 ng / reaction, and testosterone added at 11.5 ng / mL. [Diagram 5] We show that testosterone-activated AR reduces T7-mediated expression of the RNA aptamer, Mango II, in a dose-dependent manner. Reactions were assembled as described in the text. In these reactions, an ethanol control demonstrated that T7 produced the RNA Mango II. An ethanol control was included because this is a dilution of the steroids, testosterone (T), and dihydrotestosterone (DHT). The fluorescence output produced in the ethanol control was arbitrarily assigned 100% and used as a reference for the ligand-activated reactions. AR was activated by the addition of decreasing concentrations of testosterone (over a range of 2.5 mM to 25 μM) or DHT was added at 250 μM. Both T and DHT are endogenous androgens and potent activators of the AR. ****p<0.001 (vs. ethanol) One-way ANOVA with Dunnett's multiple comparison test. [Figure 6]We show that titration of AR has a direct effect on ΔMango II. Reactions were set up as described in the text (see, for example, Table 7). In these reactions, an ethanol control demonstrated that T7 produced RNA Mango II (grey cylinders). The ethanol control was included because this is a dilution of testosterone (T). The fluorescence output produced in the ethanol control was arbitrarily assigned 100% and used as a reference for reactions activated with 250 μM testosterone (black cylinders). Decreasing the concentration of AR from 50 ng to 25 ng to 4.2 ng maintained significant levels of AR blockade (n=5); however, the magnitude of the effect of T7 inhibition was reduced compared to 50 ng. Increasing the AR concentration to 100 ng (n=2) had no further effect on T7 inhibition. ****p<0.001, ***p=0.002 (vs. ethanol) One-way ANOVA with Dunnett's multiple comparison test. [Figure 7] We show that the HSP90:AR ratio influences ΔMango II. Reactions were assembled as described in the text (see Table 8). In these reactions, the ethanol control demonstrated that T7 produced RNA Mango II (grey cylinders). The fluorescence output produced in the ethanol control was arbitrarily assigned 100% and used as a reference for the reaction activated with 250 μM testosterone (black cylinders). The results show that the 1:1 ratio was only effective with increasing AR concentrations, with the maximum ΔMango II recorded at an AR concentration of 100 ng. A 2:1 ratio was effective at AR concentrations of 50 ng or 100 ng, while a 4:1 ratio worked even at lower AR concentrations, while a 8:1 ratio showed a reduced degree of effect of ΔMango II. [Figure 8]This shows that a single ARE site is potent enough to reduce T7 transcription. Reactions were assembled as described in the text, except that the DNA templates were different. One set of reactions used a DNA template encoding only a single ARE, and a second set of reactions used the original 3XARE DNA template (sequences shown in Table 2). In these reactions, an ethanol control demonstrated that T7 produced RNA Mango II (grey cylinders). The fluorescence output produced by the ethanol control was arbitrarily assigned 100% and used as a reference for reactions activated with 250 μM testosterone (black cylinders). The results show that a single ARE is as effective as a 3XARE (****p<0.0001, ***p=0.002). [Figure 9] Figure 1 shows that decreasing DNA template concentration reduces ΔMango II. Reactions were set up as described in the text. In these reactions, an ethanol control demonstrated that T7 produced RNA Mango II (grey cylinders). The fluorescence output produced in the ethanol control was arbitrarily assigned 100% and used as a reference for reactions activated with 250 μM testosterone (black cylinders). Results show that when DNA template concentration was reduced below 25 ng per reaction, there was a loss of ability to detect ΔMango II (****p<0.0001, ***p=0.003). [Figure 10] Titrating the T7 units from 50U to 10U shows that the fluorescence decreases below the detection threshold for the change. The T7 RNA polymerase was titrated so that 50U to 10U of enzyme was added per reaction. The reactions consisted of only T7 RNA polymerase, DNA template, and reaction buffer. Note that at 50U, the Mango II produced from the reaction produced a fluorescence reading of approximately 340000. Adding 40U of enzyme nicely reduced this to approximately 200000. Further dilutions did not produce a measurable change in fluorescence, indicating that approximately 200000 fluorescence units is the threshold for this reaction. [Figure 11]The threshold for ΔMango II detection is shown. Reactions were established with 50U or 100U of T7 RNA polymerase, DNA template, reaction buffer, 50ng of AR, 100ng of HSP90, and 250μM testosterone (or ethanol as a control). The data show that adding 50U of T7 enzyme was capable of detecting ΔMango II, however the magnitude of the effect, although significant, was relatively small (n=5, *p=0.0155 one-way ANOVA with Sidaks post-hoc test). Adding 100U of T7 enzyme allowed ΔMango II to be readily detected with a larger magnitude of effect (n=5, ****p<0.0001). The threshold for ΔMango II detection is approximately 200000. Below this output, the test results would be difficult to interpret. [Figure 12] Estradiol-activated ERα demonstrates that a single ERE site is strong enough to reduce T7 transcription. Reactions were set up as described in the text. In these reactions, the ethanol control demonstrates that T7 produced RNA Mango II. The ethanol control was included because this is a dilution of the steroid hormone, estradiol (E2). The fluorescence output produced in the ethanol control was arbitrarily assigned 100% and used as a reference for the estradiol-activated reactions. Estradiol was added at 5uM to activate ERα. n=3, ****p<0.001 (vs. ethanol) One-way ANOVA with Dunnett's multiple comparison test. [Figure 13] This shows that the AR / HSP90-ARE assay is capable of detecting a range of AAS and SARMs. Testosterone (250 μM) was used as a positive reference, while ethanol was used as a negative reference and activity was set to 100% (green dotted line). All data are normalized to the ethanol control. The classes of androgen molecules are described in the text (Table 10). [Figure 14]This shows that RNA polymerase activity is not affected by serum. Reactions were assembled with DNA template (100 ng), buffer, nuclease-free water, and for AR reactions, AR (50 ng) and HSP90 (100 ng). Horse serum or FCS (10 μl) was added, followed by the addition of 100 U (or equivalent) T7 RNA polymerase to initiate the reaction. Reactions were held at 37°C for 150 min, after which the Mango II RNA aptamer was detected with TO1-biotin (100 nM). The data show that the presence of horse serum or FCS did not affect T7-generated Mango II. [Figure 15] Detection of testosterone in serum samples is shown. Reactions were set up as described in the text, except that 13 μl FCS spiked with testosterone was added. FCS spiked with ethanol was used as a non-activated AR control, and T7 activity was arbitrarily set to 100%. Testosterone showed a dose-dependent inhibition of T7-generated Mango II, with higher testosterone concentrations resulting in greater ΔMango II. p<0.0001 vs. ethanol, one-way ANOVA with Sidak's post-hoc comparisons. [Figure 16] Detection of androgenic activity in urine samples is shown. Reactions were set up as described in the text. Ethanol was used as a negative (vehicle) control for AR activation, and testosterone (250 μM) was used as a positive control. Foal #1 and Foal #2 represent urine samples obtained from two different young male racehorses. Gelding #1 and Gelding #2 represent urine samples obtained from two different gelded male horses. Trenbolone added represents gelding urine samples to which trenbolone was added prior to the removal and extraction steps. T7 activity measured in the ethanol control was arbitrarily set to 100%. Testosterone showed inhibition of T7-generated Mango II, which was also seen in the foal urine samples and in the urine samples spiked with trenbolone, however, little inhibition of T7 activity was measured in the gelding samples. Since geldings have had their testes removed and these organs are the main source of testosterone production in men, endogenous androgen levels would be expected to be low. [Figure 17] Detection of prohormones using the SHR / SRE assay is shown. After pre-incubation of androstenedione with S9 liver fractions, liver S9 fraction reactions were extracted with steroids. Extracted samples were then tested for androgenic activity. Data show that the methanol control represented full T7 activity, i.e., unaffected by the addition of AR / HSP90 in the absence of androgens. Testing androstenedione / S9 extracted samples resulted in a significant reduction in fluorescence readout (n=2, independent steroid metabolism / extraction reactions) compared to androstenedione (n=2, no independent NAD S9 fraction / extraction reactions). DETAILED DESCRIPTION OF THE PREFERRED EMBODIMENTS

[0073] The present invention provides test kits, assays and methods useful for screening samples for the presence of ligands capable of activating steroid hormone receptors and inducing a steroid hormone genomic response.

[0074] In certain examples according to the present invention, the test kits, assays and methods described herein are useful for determining the hormonal status of a subject, for example, by measuring the androgenic and / or estrogenic activity of a sample obtained from the subject. This information can then be used, for example, to determine whether the subject has cancer or is at risk of developing cancer, or to investigate age-related endocrine problems, such as menopause, or to evaluate the effectiveness of hormone replacement therapy or hormone suppression therapy.

[0075] In another example according to the present invention, the test kits, assays and methods described herein are useful for screening foods and dietary supplements for banned additives or natural activators that may be harmful to health, including, but not limited to, phytoestrogens, which may promote hormone-sensitive cancers.

[0076] Enzyme-Mediated Activity Assays and Test Kits The assay according to the present invention, on which the test kits and methods described herein are based, is an activity-based assay, which works on the principle of steroid hormone receptor activation through the binding of a ligand from the sample being tested. Activation of a steroid hormone receptor occurs when a ligand binds to the receptor and induces a conformational change in the tertiary structure of the protein, meaning that the receptor-ligand complex (also referred to herein as "activated steroid hormone receptor") can then bind to a nucleic acid response element, affect RNA polymerase, and induce the so-called "genomic response". In other words, the ability to up-regulate or down-regulate the expression of genes from the genome of a cell, which can then result in a physiological effect. It is this binding interaction between the activated steroid hormone receptor and the nucleic acid response element that is measured by the test kits, assays, and methods described herein, as a surrogate for detecting the presence of a ligand with steroid or steroid-like activity in the sample under investigation.

[0077] Importantly, this means that the test kits and assays according to the invention have the ability to detect steroid hormone bioactivity / activity induced by ligands of unknown structure such as (for example) "designer drugs". Previously, this was not possible because traditional laboratory testing equipment such as gas / liquid chromatography and mass spectrometry requires prior knowledge of the structure of the molecule being investigated.

[0078] Previous approaches to detect steroid hormone bioactivity / activity have involved yeast and mammalian cell reporter assays (see, e.g., Cooper et al. (2013) Sensors 13:2148-2163). Such assays have well-recognized limitations, such as the need for (e.g.) specialized equipment and expertise to maintain live cell cultures. The development of cell-free assays modeled on molecular frameworks that largely mimic cell-based systems has produced in vitro assays with enhanced functionality and improved assay sensitivity compared to their cell-based reporter counterpart(s). However, a limitation of cell-free assays is the requirement for the use of a multi-subunit holoenzyme polymerase, such as RNA polymerase II. Recombinant production of RNA polymerase II is highly difficult to achieve with variable reproducibility, and as a result, the holoenzyme is typically made accessible by using nuclear extracts in which all components are present and together at the promoter sequence. However, preparing nuclear extracts from eukaryotic cells is expensive to produce due to the need for expensive cell growth media and the technical expertise required to concentrate the nuclear material.

[0079] To address this limitation, Applicants have now developed a cell-free assay based on an in vitro transcription reaction that involves a more readily available single polypeptide polymerase.

[0080] In developing these next generation assays, Applicants have identified that a single polypeptide DNA-dependent RNA polymerase derived from (for example) a bacteriophage-infected prokaryotic cell is capable of expressing the readout of a reporter construct. See Examples 1-2 when viewed in conjunction with Figures 1-16.

[0081] Importantly, the use of recombinant, commercially available bacteriophage polymerase replaces the need for nuclear extracts, which are expensive to produce.

[0082] Thus, in one aspect of the invention there is provided a test kit for screening a sample for the presence of a ligand capable of inducing a steroid hormone genomic response comprising: (i) a steroid hormone receptor capable of forming a ligand-receptor complex with a ligand from a sample; (ii) a nucleic acid molecule comprising: (a) a polymerase promoter sequence, (b) a response element that is capable of being bound by a ligand-receptor complex, and (c) comprising a reporter construct; a nucleic acid molecule, wherein a response element (b) is located between the promoter sequence (a) and the reporter construct (c), and wherein (a), (b), and (c) are operably linked; (iii) a single polypeptide polymerase, A test kit is provided in which, when a sample is combined with the test kit, the presence of the ligand in the sample is detected by measuring the reduction or inhibition of transcription of the reporter construct caused by binding of the ligand-receptor complex to the response element.

[0083] In one example of the invention, the test kit further comprises nucleotide triphosphates (NTPs).

[0084] In yet another aspect of the invention there is provided an assay method for detecting a ligand in a sample, wherein the ligand is capable of eliciting a steroid hormone genomic response, comprising the steps of: (i) a sample, (a) a steroid hormone receptor that forms a ligand-receptor complex with a ligand from a sample; and (b) a nucleic acid molecule comprising: (1) a polymerase promoter sequence, (2) a response element that is bound by the ligand-receptor complex, and (3) comprising a reporter construct; a nucleic acid molecule, wherein a response element (b) is located between the promoter sequence (a) and the reporter construct (c), and wherein (a), (b), and (c) are operably linked; (c) a single polypeptide polymerase, and (d) contacting with a nucleoside triphosphate; (ii) measuring the reduction or inhibition of transcription of the reporter construct caused by binding of the ligand-receptor complex to the response element; An assay method is provided in which a measured reduction or inhibition of transcription of the reporter construct indicates detection of a ligand in the sample.

[0085] An important advantage provided by the test kits and assay methods described herein is the significant reduction in molecular complexity present in the cellular environment of yeast and mammalian cell reporter assays, or through the use of nuclear extracts for cell-free assays such as those described in WO2018 / 088852, which require RNA polymerase II for performance. The reduced molecular complexity significantly improves the specificity of the assay by limiting non-specific activation of the hormone response element by the steroid hormone receptor(s) in the absence of a target ligand. It is understood that hormone response elements (e.g., androgen response elements) are not highly selective for their complementary receptors (e.g., androgen receptors) and may in fact be activated by other steroid hormone receptors that may be present in the cell or nuclear extract. For example, in the case of androgen response elements, other non-androgen receptors of the Group II hormone receptor class, such as progesterone receptor A, progesterone receptor B, glucocorticoid receptor, and / or mineralocorticoid receptor, may potentially activate the ARE. This in turn results in a reduction in the specificity of the assay.

[0086] Indeed, the absence of molecular complexity caused by the cellular environment or nuclear extracts means that the test kits and assay methods described herein are highly selective for the detection of their target ligands. Furthermore, the ability to easily switch (for example) steroid hormone receptors and / or hormone response elements gives the test kits and assay methods described herein the versatility to detect other target ligands of interest.

[0087] Another important advantage provided by the test kits and assay methods described herein is the unique ability to stoichiometrically define biological reactions. For example, by precisely controlling the molecular relationship(s) between both essential and non-essential assay components, assay sensitivity can be significantly improved for detection of target ligands. In other words, the test kits and assay methods described herein can be configured to measure the optimal number of binding interactions between the activated ligand-hormone receptor complex and the hormone response element present in the reporter construct. In contrast, cell-based reporter assays configured to detect the presence of ligands are difficult to reproduce with the same degree of control, if not impossible, since the total copy number of recombinant receptor and / or nucleic acid response element coding genes or nucleic acid sequences (for example) cloned into cells cannot be precisely predicted or controlled. Cell-free reporter assays based on nuclear extracts are also difficult to control, given the difficulty in determining the exact amount of RNA polymerase II subunits, cofactors, and other non-essential proteins present.

[0088] These and other considerations are documented by the following examples. For illustration, see Example 2 when viewed in conjunction with Figures 6-9. Specifically, in a prototype assay involving the detection of androgen ligands (e.g., testosterone) ("Androgen Assay Prototype 2"), Applicants demonstrate that activated androgen receptor (AR) is most effective in blocking binding to its complementary hormone response element (ARE, located within the nucleic acid as defined herein) and T7-mediated expression of a reporter construct when (i) the AR:nucleic acid ratio is ≧7.2, and (ii) the concentration of nucleic acid in the reaction mix is ​​≧0.789 nM.

[0089] Thus, in further examples of the test kits, assays, and methods described herein, the ratio of steroid hormone receptor to nucleic acid is from about 7:1 to about 10:1, including, but not limited to, 7.0:1, 7.1:1, 7.2:1, 7.3:1, 7.4:1, 7.5:1, 7.6:1, 7.7:1, 7.8:1, 7.9:1, 8.0:1, 8.1:1, 8.2:1, 8.3:1, 8.4:1, 8.5:1, 8.6:1, 8.7:1, 8.8:1, 8.9:1, 9.0:1, 9.1:1, 9.2:1, 9.3:1, 9.4:1, 9.5:1, 9.6:1, 9.7:1, 9.8:1, 9.9:1, and 10.0:1.

[0090] Those skilled in the art will further appreciate that the molecular stoichiometry between the steroid hormone receptor and the nucleic acid comprising the hormone receptor response element may vary depending on the component parts of the test kit / assay as well as the nature of the sample being tested. For example, the test kit / assay may be configured to detect ligands that bind to different steroid hormone receptors, including but not limited to androgen receptor, estrogen receptor alpha, estrogen receptor beta, progesterone receptor A, progesterone receptor B, mineralocorticoid receptor, and glucocorticoid receptor, and the ratio between the steroid hormone receptor and its complementary nucleic acid / response element may be (for example) about 1:1 to about 20:1.

[0091] Thus, in yet another example according to the test kits and assay methods described herein, (i) the test kit comprises an androgen receptor, and the ratio of androgen receptor to nucleic acid comprising an androgen response element is from about 1:1 to about 20:1, including but not limited to 1:1, 2:1, 3:1, 4:1, 5:1, 6:1, 7:1, 8:1, 9:1, 10:1, 11:1, 12:1, 13:1, 14:1, 15:1, 16:1, 17:1, 18:1, 19:1, or 20:1; (ii) the test kit comprises an estrogen receptor, and the ratio of estrogen receptor to nucleic acid comprising an estrogen response element is from about 1:1 to about 20:1, including but not limited to 1:1, 2:1, 3:1, 4:1, 5:1, 6:1, 7:1, 8:1, 9:1, 10:1, 11:1, 12:1, 13:1, 14:1, 15:1, 16:1, 17:1, 18:1, 19:1, or 20:1; (iii) the test kit comprises a progesterone receptor, wherein the ratio of progesterone receptor to nucleic acid comprising a progesterone response element is from about 1:1 to about 20:1, including but not limited to 1:1, 2:1, 3:1, 4:1, 5:1, 6:1, 7:1, 8:1, 9:1, 10:1, 11:1, 12:1, 13:1, 14:1, 15:1, 16:1, 17:1, 18:1, 19:1, or 20:1; (iv) the test kit comprises a mineralocorticoid receptor, wherein the ratio of mineralocorticoid receptor to nucleic acid comprising a mineralocorticoid response element is from about 1:1 to about 20:1, including but not limited to 1:1, 2:1, 3:1, 4:1, 5:1, 6:1, 7:1, 8:1, 9:1, 10:1, 11:1, 12:1, 13:1, 14:1, 15:1, 16:1, 17:1, 18:1, 19:1, or 20:1; (v) The test kit comprises a glucocorticoid receptor, and the ratio of glucocorticoid receptor to nucleic acid comprising a glucocorticoid response element is from about 1:1 to about 20:1, including but not limited to, 1:1, 2:1, 3:1, 4:1, 5:1, 6:1, 7:1, 8:1, 9:1, 10:1, 11:1, 12:1, 13:1, 14:1, 15:1, 16:1, 17:1, 18:1, 19:1, or 20:1.

[0092] Notwithstanding the above considerations, care must be taken not to saturate the assay when too many receptors are present, as too many receptors themselves may create thermodynamic or kinetic barriers that prevent optimal binding of the ligand-receptor complex to the complementary response element. Given the disclosure provided herein, one skilled in the art can perform routine experimentation to titrate the optimized concentration / range of steroid hormone receptor for the performance of the test kits and assay methods described herein (see, for example, Example 2.3 below).

[0093] As mentioned above, applicants have further determined that steroid hormone receptors retain some ability to bind to and activate corresponding nucleic acid response elements in the absence of ligands specific for the steroid hormone receptors. This phenomenon is sometimes referred to as autoactivation of nucleic acid response elements. Although the level of autoactivation is significantly reduced in the test kits and assays described herein due to the reduced molecular complexity, it may be desirable to determine a reference threshold (i.e., a baseline signal resulting from autoactivation of response elements) in the absence of ligand to assist in determining absolute assay signal / readout in the presence of samples containing target ligands.

[0094] Thus, in another example according to the test kits and assay methods described herein, the reduction or inhibition of transcription of a reporter construct is measured relative to a reference threshold value.

[0095] In yet another example according to the test kits and assay methods described herein, the reduction or inhibition of transcription of the reporter construct is measured relative to a reference threshold determined by measuring transcription of the reporter construct in the absence of the test sample.

[0096] In still further examples according to the test kits and assay methods described herein, the reduction or inhibition of transcription of the reporter construct is measured relative to a reference threshold determined by measuring transcription of the reporter construct in the absence of the test sample and in the absence of the receptor.

[0097] In a parallel approach to improve assay specificity and performance, the test kits and assay methods described herein can be modified to include at least one steroid hormone receptor cofactor, the main purpose of which is to hold the steroid hormone receptor in an inactive conformation, thereby preventing it from binding to and activating the hormone response element in the absence of a target ligand.

[0098] Contacting (or combining) the test kit with a test sample causes transfer of the cofactor due to the presence of the ligand, and the ligand-binding receptor is then free to form a complex with a second ligand-binding receptor and a hormone response element.

[0099] Thus, in another example according to the test kits and assay methods described herein, the test kit or assay method further comprises at least one steroid hormone receptor cofactor.

[0100] In a relevant example, the steroid hormone receptor cofactor includes, but is not limited to, a steroid hormone receptor cofactor selected from heat shock protein 90 (HSP90), a complex of HSP90 and heat shock protein 70 (HSP70); a complex of HSP90, HSP70, and heat shock protein 40 (HSP40); a complex of HSP90, HSP70, HSP40, and p23; a complex of HSP90, HSP70, HSP40, p23, and heat shock protein organizing protein (Hop); a complex of HSP90, HSP70, HSP40, p23, Hop, and 48 kD Hip protein (Hip); a complex of HSP90, HSP70, HSP40, p23, Hop, Hip, and p60; and a complex of HSP90, HSP70, HSP40, p23, Hop, Hip, p60, and FKBP52.

[0101] In a further related embodiment according to the test kits and assay methods described herein, the test kit or assay method further comprises heat shock protein 90.

[0102] However, it will be understood by those skilled in the art that the presence of steroid hormone receptor cofactor is not a necessary feature of the test kit, assay and method described herein.This is because the assay result can be achieved even in the absence of cofactor.For example, the data presented in Example 1 / Figure 4 shows that in the absence of heat shock protein 90, there is still a measurable difference in the signal between the ligand assay result and the non-ligand assay result (i.e., AR / T vs. AR).

[0103] Indeed, there are further approaches to minimize the amount of signal generated by autoactivation of hormone response elements by unliganded receptors, for example, by modifying the temperature at which the assay method is performed.

[0104] Applicants have observed differences in binding affinity / kinetics between liganded and unliganded steroid hormone receptors to their nucleic acid response elements. Thus, the test kits, assays, and methods described herein can be performed at a temperature or range of temperatures that preferentially measure activation of hormone response elements by liganded receptors over unliganded receptors, thereby minimizing background signal generated by unliganded receptors.

[0105] Thus, in yet another example according to this aspect of the invention, the performance of the test kit or assay method is carried out at a temperature range of about 25°C to about 42°C, preferably about 35°C to about 37°C.

[0106] The term "temperature range of about 25° C. to about 42° C." is intended to include any temperature between 25° C. and 42° C., including, but not limited to, 25° C., 26° C., 27° C., 28° C., 29° C., 30° C., 31° C., 32° C., 33° C., 34° C., 35° C., 36° C., 37° C., 38° C., 39° C., 40° C., 41° C., and 42° C. One of ordinary skill in the art will recognize that decimal ranges of temperatures may also be used. To further illustrate this point, "at a temperature range of about 35°C to about 37°C" includes, but is not limited to, 35.0°C, 35.1°C, 35.2°C, 35.3°C, 35.4°C, 35.5°C, 35.6°C, 35.7°C, 35.8°C, 35.9°C, 36.0°C, 36.1°C, 36.2°C, 36.3°C, 36.4°C, 36.5°C, 36.6°C, 36.7°C, 36.8°C, 36.9°C, and 37.0°C.

[0107] Applicants have further discovered that the stoichiometric relationship between the cofactor and the steroid hormone receptor can be manipulated to further improve assay sensitivity. For example, in accordance with the androgen assay prototype 2 described in Example 2, Applicants have determined that the AR is most effective at being activated by AR-specific ligands and binding to the ARE when the HSP90:AR ratio is between about 1.22 and 4.88.

[0108] Thus, in further examples of the test kits and assay methods described herein, the ratio of HSP90 to steroid hormone receptor is defined as about 1:1 to about 5:1, including, but not limited to, 1.0:1, 1.1:1, 1.2:1, 1.3:1, 1.4:1, 1.5;1, 1.6:1, 1.7:1, 1.8:1, 1.9:1, 2.0:1, 2.1:1, 2.2:1, 2.3:1, 2.4:1, 2.5;1, 2.6:1, 2.7:1, 2.8:1, 2.9:1, 3.0:1, 3.1:1, 3. and ratios of HSP90 to steroid hormone receptors defined as 2:1, 3.3:1, 3.4:1, 3.5;1, 3.6:1, 3.7:1, 3.8:1, 3.9:1, 4.0:1, 4.1:1, 4.2:1, 4.3:1, 4.4:1, 4.5;1, 4.6:1, 4.7:1, 4.8:1, 4.9:1, or 5.0:1.

[0109] However, one skilled in the art will understand that the molecular stoichiometry between the steroid hormone receptor cofactor and the steroid hormone receptor may vary depending on the composition of the test kit / assay. For example, the test kit / assay may be configured to detect a ligand that binds to an estrogen receptor, including estrogen receptor alpha or estrogen receptor beta, and the ratio between the estrogen receptor cofactor and the estrogen receptor may be (for example) about 1:1 to about 20:1.

[0110] Thus, in yet another example according to the test kits and assay methods described herein, (i) the test kit comprises an androgen receptor, and the ratio of androgen receptor cofactor to androgen receptor is from about 1:1 to about 20:1, including but not limited to 1:1, 2:1, 3:1, 4:1, 5:1, 6:1, 7:1, 8:1, 9:1, 10:1, 11:1, 12:1, 13:1, 14:1, 15:1, 16:1, 17:1, 18:1, 19:1, or 20:1; (ii) the test kit comprises an estrogen receptor, and the ratio of estrogen receptor cofactor to estrogen receptor is from about 1:1 to about 20:1, including but not limited to 1:1, 2:1, 3:1, 4:1, 5:1, 6:1, 7:1, 8:1, 9:1, 10:1, 11:1, 12:1, 13:1, 14:1, 15:1, 16:1, 17:1, 18:1, 19:1, or 20:1; (iii) the test kit comprises a progesterone receptor, and the ratio of progesterone receptor cofactor to progesterone receptor is from about 1:1 to about 20:1, including but not limited to 1:1, 2:1, 3:1, 4:1, 5:1, 6:1, 7:1, 8:1, 9:1, 10:1, 11:1, 12:1, 13:1, 14:1, 15:1, 16:1, 17:1, 18:1, 19:1, or 20:1; (iv) the test kit comprises a mineralocorticoid receptor, and the ratio of mineralocorticoid cofactor to mineralocorticoid receptor is from about 1:1 to about 20:1, including but not limited to 1:1, 2:1, 3:1, 4:1, 5:1, 6:1, 7:1, 8:1, 9:1, 10:1, 11:1, 12:1, 13:1, 14:1, 15:1, 16:1, 17:1, 18:1, 19:1, or 20:1; (v) The test kit comprises a glucocorticoid receptor, and the ratio of glucocorticoid receptor cofactor to glucocorticoid receptor is from about 1:1 to about 20:1, including but not limited to, 1:1, 2:1, 3:1, 4:1, 5:1, 6:1, 7:1, 8:1, 9:1, 10:1, 11:1, 12:1, 13:1, 14:1, 15:1, 16:1, 17:1, 18:1, 19:1, or 20:1.

[0111] The information in Table 9 of Example 4 summarizes important considerations related to the discussion of molecular stoichiometry when considering the composition of the test kits and assay methods described herein, which is supported by the data accompanying Examples 1-3, among others.

[0112] An assay reaction mix according to the invention will typically contain a total volume of between 10 μL and 50 μL. According to the information summarized in Table 9, this means the following: (i) the concentration of steroid hormone receptor should be kept within the range defined by about 10 nM to about 60 nM, including, but not limited to, 10, 11, 12, 13, 14, 15, 16, 17, 18, 19, 20, 21, 22, 23, 24, 25, 26, 27, 28, 29, 30, 31, 32, 33, 34, 35, 36, 37, 38, 39, 40, 41, 42, 43, 44, 45, 46, 47, 48, 49, 50, 51, 52, 53, 54, 55, 56, 57, 58, 59, or 60 nM steroid hormone receptor; (ii) the concentration of the nucleic acid molecule comprising a hormone response element should be kept within the range defined by about 0.70 nM to about 3.5 nM, including but not limited to 0.70, 0.80, 0.90, 1.0, 1.1, 1.2, 1.3, 1.4, 1.5, 1.6, 1.7, 1.8, 1.9, 2.0, 2.1, 2.2, 2.3, 2.4, 2.5, 2.6, 2.7, 2.8, 2.9, 3.0, 3.1, 3.2, or 3.3 nM of the nucleic acid molecule; (iii) if present, the concentration of heat shock protein 90 should be kept within the range defined by about 40 nM to about 60 nM, including, but not limited to, 40, 41, 42, 43, 44, 45, 46, 47, 48, 49, 50, 51, 52, 53, 54, 55, 56, 57, 58, 59, or 60 nM heat shock protein 90.

[0113] An additional consideration is the concentration / amount of enzyme; optimal assay results were achieved with approximately 50-100 enzyme units (U) in the reaction mix, assuming an absolute baseline threshold activity of approximately 200,000 U. See Figures 10 and 11.

[0114] In yet another example according to the test kits and assay methods described herein, the reduction or inhibition of transcription is a reduction or inhibition of transcription mediated by a single polypeptide polymerase selected from a bacteriophage RNA polymerase, a viral RNA polymerase, a bacterial RNA polymerase, and a eukaryotic viral RNA polymerase.

[0115] In related examples, the polymerase is a bacteriophage RNA polymerase. In further related examples, the promoter sequence is a bacteriophage RNA polymerase initiation sequence.

[0116] In yet another example according to the test kits and assay methods described herein, the polymerase is a bacteriophage polymerase selected from the group consisting of DNA-dependent RNA polymerases, including T7 RNA polymerase, T3 RNA polymerase, and SP6 RNA polymerase.

[0117] In another example according to the test kits and assay methods described herein, the bacteriophage polymerase is T7 RNA polymerase.

[0118] In another example according to the test kits and assay methods described herein, the promoter sequence is a T7 RNA polymerase initiation sequence.

[0119] In a related example, a T7 RNA polymerase initiation sequence comprises the sequence defined by 5'-TAATACGACTCACTATAG-3' (SEQ ID NO:1).

[0120] In a further example according to the test kits and assay methods described herein, the bacteriophage polymerase is T3 RNA polymerase and the promoter sequence is a T3 RNA polymerase initiation sequence.

[0121] In a related example, a T3 RNA polymerase initiation sequence comprises the sequence defined by 5'-AATTAACCCTCACTAAAG-3' (SEQ ID NO:2).

[0122] In yet a further example according to the test kits and assay methods described herein, the bacteriophage polymerase is SP6 RNA polymerase and the promoter sequence is an SP6 RNA polymerase initiation sequence.

[0123] In a related example, the SP6 RNA polymerase initiation sequence comprises the sequence defined by 5'-ATTTAGGTGACACTATAG-3' (SEQ ID NO:3).

[0124] In yet another example according to the test kits and assay methods described herein, the reporter construct comprises a sequence encoding an RNA aptamer that, when transcribed to form the RNA aptamer, is capable of binding to a fluorophore, thereby generating a fluorescent signal.

[0125] In a related example, the RNA aptamer is further supported by an RNA scaffold that promotes secondary structure formation of the RNA aptamer, thereby optimizing the binding interaction with its fluorophore(s). In a further related example, the RNA scaffold includes, but is not limited to, F30.

[0126] In another example, the RNA aptamer is Mango, including but not limited to Mango I, Mango II, Mango III, and Mango IV. In a related example, the fluorophore that binds to the Mango RNA aptamer and thereby generates a fluorescent signal is a derivative of thiazole orange (TO).

[0127] In another example, the RNA aptamer is selected from Spinach, iSpinach, babySpinach, and Broccoli. In a related example, the fluorophore that binds to the Spinach or Broccoli RNA aptamer and thereby generates a fluorescent signal is 3,5-difluoro-4-hydroxybenzylidene imidazolinone (DFHBI).

[0128] In another example, the RNA aptamer is Malachite Green. In a related example, the fluorophore that binds to the Malachite Green RNA aptamer and thereby generates a fluorescent signal is Malachite Green.

[0129] In further examples according to the test kit and assay method described herein, reporter construct comprises a single sequence copy of RNA aptamer or multiple sequence copies of RNA aptamer.The term "multiple sequence copies" is intended to mean, but is not limited to, 2, 3, 4, 5, 6, 7, 8, 9, 10, 11, 12, 13, 14, 15, 16, 17, 18, 19, 20, 21, 22, 23, 24, 25, 26, 27, 28, 29, 30, 31, 32 or more copies of the sequence encoding RNA aptamer.Those skilled in the art will recognize that the number of copies of RNA aptamer sequence will be controlled by the optimal signal-to-noise ratio, which is determined by routine assay optimization.

[0130] In other examples according to the test kits and assay methods described herein, the reporter construct is selected from the group consisting of genes that may or may not code for a protein or polypeptide that can be detected by RNA analysis.

[0131] Thus, the test kits and assay methods described herein can be configured to detect transcription levels of a reporter construct, for example, by examining messenger ribonucleic acid (mRNA) or complementary deoxyribose nucleic acid (cDNA) levels, when a test sample is combined with an assay as a means of screening the sample for the presence of a ligand having steroid hormone receptor activity.

[0132] In still further examples according to the test kits and assay methods described herein, reduction or inhibition of transcription of the reporter construct can be measured using polymerase chain reaction (PCR) quantitative PCR (also known as real-time PCR, qPCR), digital PCR (dPCR), reverse transcription PCR (RT-PCR), reverse transcription qPCR (RTqPCR), reverse transcription digital PCR (RTdPCR), RNAseq or in situ hybridization.

[0133] In other examples according to the test kits and assay methods described herein, reporter gene transcription levels, including (for example) mRNA or cDNA, can be semi-quantitative / quantitative using established techniques such as quantitative polymerase chain reaction (qPCR, including real-time qPCR and reverse transcription qPCR), or using other techniques such as fluorescence based on detection of intercalating dyes or direct addition of fluorescent nucleotides. For example, the use of fluorophores that bind to RNA aptamers to form RNA-fluorophore complexes, as described herein. These and other techniques will be known to those skilled in the art.

[0134] The test kits and assay methods described herein are configured for the detection of a variety of ligands of both known and unknown structure that will bind to steroid hormone receptors, including the androgen receptor (AR), estrogen receptor-alpha (ER-α), estrogen receptor-beta (ER-β), progesterone receptor A (PRA), progesterone receptor B (PRB), mineralocorticoid receptor (MR), and glucocorticoid receptor (GR).

[0135] Examples of ligands known to bind to the androgen receptor include, but are not limited to, testosterone, dihydrotestosterone; androgenic anabolic steroids (AAS), including, but not limited to, TRENA, 17α-trenbolone, 17β-trenbolone, trendione, nandrolone, boldenone, altrenogest; and selective androgen receptor modulators (SARMs), including, but not limited to, 93746, BMS-546929, LGD4033, ACP105, YK-11, andarine, ligandrol, ostarine.

[0136] Examples of ligands known to bind to the estrogen receptor alpha include, but are not limited to, estradiol, estrone, estriol; selective estrogen receptor modulators, including raloxifene, tamoxifen, toremifene, ospemifene, lasofoxifene, cyclophenyl, clomiphene, broparestrol, basedoxifene, anordrin; polyphenols (resveratrol), flavanones (eriodictyol, hesperetin, homoeriodictyol, naringenin), flavones (apigenin, luteolin, tangeritin), flavonols (fisetin, kaempferol, myricetin, pachypodol), and the like. Phytoestrogens, including dietary estrogens such as catechins (proanthocyanides), isoflavonoids (isoflavone biochanin A, clicitein, daidzein, formononetin, genistein), isoflavans (equol), and coumestrol; estrogenic endocrine disrupting chemicals (EEDCs), including but not limited to dichlorodiphenyltrichloroethane (DDT), dioxins, polychlorinated biphenyls (PCBs), bisphenol A (BPA), polybrominated biphenyls (PBBs), phthalate esters, endosulfan, atrazine, and zeranol; and designer compounds such as hydrazide derivatives.

[0137] Examples of ligands known to bind to estrogen receptor beta include, but are not limited to, all ligands that bind to estrogen receptor alpha, as well as diarylpropionitriles (DPNs) and benzoxazoles from Wyeth, such as Way-659, Way-818 and Way-200070.

[0138] Examples of ligands known to bind to progesterone receptor A and progesterone receptor B include, but are not limited to, progesterone, norethisterone, levonorgestrel, medroxyprogesterone acetate, megestrol acetate, dydrogesterone, drospirenone; selective progesterone receptor modulators, including ulipristal acetate, telapristone acetate, Vilaprisan, Asoprisnil, Asoprisnil Ecamate; antiprogestins, including mifepristone, onapristone, Lilopritone, and gestrinone.

[0139] Examples of ligands known to bind to the mineralocorticoid receptor include, but are not limited to, aldosterone; synthetic mineralocorticoids such as fludrocortisone; anti-mineralocorticoids such as spironolactone and eplerenone; and glucocorticoid receptor ligands such as those described below.

[0140] Examples of ligands known to bind to the glucocorticoid receptor include, but are not limited to, dexamethasone, hydrocortisone, cortisone, prednisolone, methylprednisolone, prednisone, amcinonide, budesonide, desonide, fluocinonide, halcinonide, beclomethasone, betamethasone, fluocortolone, halometasone, mometasone, or as antagonists, mifepristone, and ketoconazole.

[0141] Exemplary Assay Components and Constructs A steroid hormone receptor activated by a ligand present in a sample will dimerize (i.e., form a receptor-ligand complex as defined) and bind to its complementary hormone response element. In the test kits and assays described herein, the hormone response element is linked to a reporter construct, and a change in the physical properties of the reporter construct can be used to indicate the presence of the ligand in the sample under investigation. Exemplary hormone response elements according to the present invention include androgen response elements (ARE), estrogen response elements (ERE), progesterone response elements (PRE), mineralocorticoid response elements (MRE), and glucocorticoid response elements (GRE).

[0142] As previously described, various hormone response elements incorporate binding motifs that are configured to selectively bind activated ligand-receptor complexes. For example, the androgen, estrogen, progesterone, mineralocorticoid, and glucocorticoid response elements each contain two imperfect dihexameric palindromic sequences that promote binding of dimerized ligand-receptor complexes (i.e., (HR-L)2) in their secondary structural orientation via zinc finger binding motifs.

[0143] In one example according to the test kit and assay method described herein, the androgen response element comprises a DNA-binding motif that binds to activated androgen receptor. In a related example, the DNA-binding motif binds to a dimer of ligand-bound androgen receptor (i.e. (AR-L)2, where "AR" is the androgen receptor and "L" is the ligand). In a related example, the DNA-binding motif comprises two imperfect hexamer palindromic sequences that generate binding specificity between activated androgen receptor and the androgen response element. In a further related example, the androgen response element that comprises a DNA-binding motif is a double-stranded deoxyribonucleic acid.

[0144] In one example according to the test kit and assay method described herein, the estrogen response element comprises a DNA-binding motif that binds to an activated estrogen receptor. In a related example, the DNA-binding motif binds to a dimer of ligand-bound estrogen receptor (i.e., (ER-L)2, where "ER" is an estrogen receptor selected from ER-α or ER-β). In a further related example, the DNA-binding motif comprises two imperfect hexamer palindromic sequences that create binding specificity between the activated estrogen receptor and the estrogen response element. In a further related example, the estrogen response element that comprises a DNA-binding motif is a double-stranded deoxyribonucleic acid.

[0145] In one example according to the test kit and assay method described herein, the progesterone response element comprises a DNA-binding motif that binds to an activated progesterone receptor. In a related example, the DNA-binding motif binds to a dimer of ligand-bound progesterone receptor (i.e., (PR-L)2, where "PR" is a progesterone receptor selected from PRA or PRB). In a further related example, the DNA-binding motif comprises two imperfect hexamer palindromic sequences that create binding specificity between the activated progesterone receptor and the progesterone response element. In a further related example, the progesterone response element that comprises a DNA-binding motif is a double-stranded deoxyribonucleic acid.

[0146] In one example according to the test kits and assay methods described herein, the mineralocorticoid response element comprises a DNA-binding motif that selectively binds to an activated mineralocorticoid receptor. In a related example, the DNA-binding motif binds to a dimer of the ligand-bound mineralocorticoid receptor (i.e., (MR-L)2, where "MR" is the mineralocorticoid receptor). In a further related example, the DNA-binding motif comprises two imperfect hexameric palindromic sequences that create binding specificity between the activated mineralocorticoid receptor and the mineralocorticoid response element. In a further related example, the mineralocorticoid response element that comprises the DNA-binding motif is a double-stranded deoxyribonucleic acid.

[0147] In one example according to the test kit and assay method described herein, the glucocorticoid response element comprises a DNA-binding motif that selectively binds to the activated glucocorticoid receptor. In a related example, the DNA-binding motif binds to a dimer of the ligand-bound glucocorticoid receptor (i.e., (GR-L)2, where "GR" is the glucocorticoid receptor). In a further related example, the DNA-binding motif comprises two imperfect hexameric palindromic sequences that create binding specificity between the activated glucocorticoid receptor and the glucocorticoid response element. In a further related example, the glucocorticoid response element that comprises the DNA-binding motif is a double-stranded deoxyribonucleic acid.

[0148] Detection of ligands that bind to and activate the androgen receptor, such as testosterone, dihydrotestosterone, synthetic steroid hormones (e.g., AAS), and selective androgen receptor modulators (i.e., SARMs), and phyto- or xenoandrogens, requires a test kit / assay that includes the androgen receptor together with an androgen response element capable of binding to the activated androgen receptor complex.

[0149] In one example according to the test kits and assay methods described herein, the androgen response element comprises or consists of the sequence 5'-AGAACAnnnTGTTCT-3' (SEQ ID NO: 4), where n is any nucleobase selected from G, C, T, or A. Its complementary antisense sequence is defined as 5'-AGAACAnnnTGTTCT-3' (SEQ ID NO: 5), where n represents the bases that are complementary to SEQ ID NO: 4 based on sequence alignment between SEQ ID NOs: 4 and 5 (i.e., A=T, T=A, G=C, C=G).

[0150] In another example according to the test kits and assay methods described herein, the androgen response element comprises or consists of the sequence 5'-GGTACAnnnTGTTCT-3' (SEQ ID NO:6), where n is any nucleobase selected from G, C, T, or A. Its complementary antisense sequence is defined as 5'-AGAACAnnnTGTACC-3' (SEQ ID NO:7), where n represents the bases that are complementary to SEQ ID NO:6 based on sequence alignment between SEQ ID NOs:6 and 7 (i.e., A=T, T=A, G=C, C=G).

[0151] Detection of ligands that bind to and activate the estrogen receptor, such as other estrogenic steroid hormones, including estradiol, estrone, phyto- and xenoestrogens, as well as selective estrogen receptor modulators (SERMs), requires a test kit / assay that contains either the estrogen receptor alpha (ER-α) or estrogen receptor beta (ER-β) along with an estrogen response element capable of binding to the activated estrogen receptor complex.

[0152] In one example according to the test kits and assay methods described herein, the estrogen response element comprises or consists of the sequence 5'-AGGTCAnnnTGACCT-3' (SEQ ID NO:8), where n is any nucleobase selected from G, C, T, or A. Its complementary antisense sequence is defined as 5'-AGGTCAnnnTGACCT-3' (SEQ ID NO:9), where n represents the bases that are complementary to SEQ ID NO:8 based on sequence alignment between SEQ ID NOs:8 and 9 (i.e., A=T, T=A, G=C, C=G).

[0153] Detection of ligands that bind to and activate the progesterone receptor, such as progesterone, norethisterone, levonorgestrel, other progesterone-like steroid hormones, and selective progesterone receptor modulators (SPRMs), requires a test kit / assay that contains either the progesterone receptor A (PRA) or progesterone receptor B (PRB) together with a progesterone response element capable of binding to the activated progesterone receptor complex.

[0154] In one example according to the test kits and assay methods described herein, the progesterone response element comprises or consists of the sequence 5'-GGTACAAACTGTTCT-3' (SEQ ID NO: 10), the complementary antisense sequence of which is defined as 5'-AGAACAGTTTGTACC-3' (SEQ ID NO: 11).

[0155] Detection of ligands that bind to and activate the mineralocorticoid receptor, such as aldosterone, synthetic mineralocorticoids such as fludrocortisone, and anti-mineralocorticoids such as spironolactone and eplerenone, requires a test kit / assay that includes the mineralocorticoid receptor together with a mineralocorticoid response element capable of binding to the activated mineralocorticoid receptor complex.

[0156] In another example according to the test kits and assay methods described herein, the mineralocorticoid response element comprises or consists of the sequence 5'-AGAACAnAATGTTCT-3' (SEQ ID NO: 12), where n is any nucleobase selected from G, C, T, or A. Its complementary antisense sequence is defined as 5'-AGAACATTnTGTTCT-3' (SEQ ID NO: 13), where n represents the bases that are complementary to SEQ ID NO: 12 based on sequence alignment between SEQ ID NOs: 12 and 13 (i.e., A=T, T=A, G=C, C=G).

[0157] Detection of ligands that bind to and activate the glucocorticoid receptor, such as cortisol, dexamethasone, and 11-dihydrocorticosterone, requires a test kit / assay that contains the glucocorticoid receptor together with a glucocorticoid response element capable of binding to the activated glucocorticoid receptor complex.

[0158] In another example according to the test kits and assay methods described herein, the glucocorticoid response element comprises or consists of the sequence 5'-AGAACAnAATGTTCT-3' (SEQ ID NO: 12), where n is any nucleobase selected from G, C, T, or A. Its complementary antisense sequence is defined as 5'-AGAACATTnTGTTCT-3' (SEQ ID NO: 13), where n represents the bases that are complementary to SEQ ID NO: 12 based on sequence alignment between SEQ ID NOs: 12 and 13 (i.e., A=T, T=A, G=C, C=G).

[0159] Exemplary nucleic acid sequences according to the test kits and assay methods described herein include, but are not limited to, the following: T7i-ARE(n)-MangoII:n=1,2,3,4, T7i-ERE(n)-MangoII:n=1,2,3,4, T7i-PRE(n)-MangoII:n=1,2,3,4, T7i-MRE(n)-MangoII:n=1,2,3,4, T7i-GRE(n)-MangoII:n=1,2,3,4, T7i-ARE(n)-F30-MangoII:n=1,2,3,4, T7i-ERE(n)-F30-MangoII:n=1,2,3,4, T7i-PRE(n)-F30-MangoII:n=1,2,3,4, T7i-MRE(n)-F30-MangoII:n=1,2,3,4, T7i-GRE(n)-F30-MangoII:n=1,2,3,4, T7i-ARE(n)-iSpinach:n=1,2,3,4, T7i-ERE(n)-iSpinach:n=1,2,3,4, T7i-PRE(n)-iSpinach:n=1,2,3,4, T7i-MRE(n)-iSpinach:n=1,2,3,4, T7i-GRE(n)-iSpinach:n=1,2,3,4, T7i-ARE(n)-F30-iSpinach:n=1,2,3,4, T7i-ERE(n)-F30-iSpinach:n=1,2,3,4, T7i-PRE(n)-F30-iSpinach:n=1,2,3,4, T7i-MRE(n)-F30-iSpinach:n=1,2,3,4, T7i-GRE(n)-F30-iSpinach:n=1,2,3,4, T7i represents the promoter / initiation sequence for T7 RNA polymerase.

[0160] In a related example, the T7i promoter / initiator sequence is defined by 5'-TAATACGACTCACTATAG-3' (SEQ ID NO:1).

[0161] Alternative exemplary nucleic acid sequences according to the test kits and assay methods described herein include, but are not limited to, the following: T3i-ARE(n)-MangoII:n=1,2,3,4, T3i-ERE(n)-MangoII:n=1,2,3,4, T3i-PRE(n)-MangoII:n=1,2,3,4, T3i-MRE(n)-MangoII:n=1,2,3,4, T3i-GRE(n)-MangoII:n=1,2,3,4, T3i-ARE(n)-F30-MangoII:n=1,2,3,4, T3i-ERE(n)-F30-MangoII:n=1,2,3,4, T3i-PRE(n)-F30-MangoII:n=1,2,3,4, T3i-MRE(n)-F30-MangoII:n=1,2,3,4, T3i-GRE(n)-F30-MangoII:n=1,2,3,4, T3i-ARE(n)-iSpinach:n=1,2,3,4, T3i-ERE(n)-iSpinach:n=1,2,3,4, T3i-PRE(n)-iSpinach:n=1,2,3,4, T3i-MRE(n)-iSpinach:n=1,2,3,4, T3i-GRE(n)-iSpinach:n=1,2,3,4, T3i-ARE(n)-iSpinachx3:n=1,2,3,4, T3i-ERE(n)-iSpinachx3:n=1,2,3,4, T3i-PRE(n)-iSpinachx3:n=1,2,3,4, T3i-MRE(n)-iSpinachx3:n=1,2,3,4, T3i-GRE(n)-iSpinachx3:n=1,2,3,4, T3i represents the promoter or initiation sequence for T3 RNA polymerase.

[0162] In a related example, the T3i promoter / start sequence is defined by 5'-AATTAACCCTCACTAAAG-3' (SEQ ID NO:2).

[0163] Alternative exemplary nucleic acid sequences according to the test kits and assay methods described herein include: SP6i-ARE(n)-MangoII:n=1,2,3,4, SP6i-ERE(n)-MangoII:n=1,2,3,4, SP6i-PRE(n)-MangoII:n=1,2,3,4, SP6i-MRE(n)-MangoII:n=1,2,3,4, SP6i-GRE(n)-MangoII:n=1,2,3,4, SP6i-ARE(n)-F30-MangoII:n=1,2,3,4, SP6i-ERE(n)-F30-MangoII:n=1,2,3,4, SP6i-PRE(n)-F30-MangoII:n=1,2,3,4, SP6i-MRE(n)-F30-MangoII:n=1,2,3,4, SP6i-GRE(n)-F30-MangoII:n=1,2,3,4, SP6i-ARE(n)-iSpinach:n=1,2,3,4, SP6i-ERE(n)-iSpinach:n=1,2,3,4, SP6i-PRE(n)-iSpinach:n=1,2,3,4, SP6i-MRE(n)-iSpinach:n=1,2,3,4, SP6i-GRE(n)-iSpinach:n=1,2,3,4, SP6i-ARE(n)-iSpinachx3:n=1,2,3,4, SP6i-ERE(n)-iSpinachx3:n=1,2,3,4, SP6i-PRE(n)-iSpinachx3:n=1,2,3,4, SP6i-MRE(n)-iSpinachx3:n=1,2,3,4, SP6i-GRE(n)-iSpinachx3:n=1,2,3,4, SP6i represents the promoter or initiation sequence of SP6 RNA polymerase.

[0164] In a related example, the SP6i promoter / start sequence is defined by 5'-ATTTAGGTGACACTATAG-3' (SEQ ID NO:3).

[0165] In another example according to the invention, the test kit and / or assay method is configured to detect a ligand that binds to the androgen receptor, wherein the nucleic acid sequence comprised of a T7 RNA polymerase initiation sequence, an androgen response element, and a reporter construct encoding an F30 scaffold and a Mango II RNA aptamer comprises the sequence set forth in SEQ ID NO: 14 below: [SEQ ID NO: 14] 5'TAATACGACTCACTATAGACTCTGGAGGAATGGAGAACAGCCTGTTCTCCATTGCCATGTGTATGTGGGTACGAAGGAGAGGAGAGGAAGAGGAGAGTACCCACATACTCTGATGATCCTTCGGGATCATTCATGGCAATCTAGGA3'

[0166] In yet another example according to the invention, the test kit and / or assay method is configured to detect a ligand that binds to estrogen receptor alpha or estrogen receptor beta, wherein the nucleic acid sequence comprised of a T7 RNA polymerase initiation sequence, an estrogen response element, and a reporter construct encoding an F30 scaffold and a Mango II RNA aptamer comprises the sequence set forth in SEQ ID NO: 15 below: [SEQ ID NO: 15] 5'TAATACGACTCACTATAGACTCTGGAGGAACAGGTCAGCATGACCTGTTGCCATGTGTATGTGGGTACGAAGGAGAGGAGAGGAAGAGGAGAGTACCCACATACTCTGATGATCCTTCGGGATCATTCATGGCAATCTAGGA3'

[0167] In yet a further example according to the invention, the test kit and / or assay method is configured to detect a ligand that binds to progesterone receptor A or progesterone receptor B, wherein the nucleic acid sequence comprised of a T7 RNA polymerase initiation sequence, a progesterone response element, and a reporter construct encoding an F30 scaffold and a Mango II RNA aptamer comprises the sequence set forth in SEQ ID NO: 16 below: [SEQ ID NO: 16] 5'TAATACGACTCACTATAGACTCTGGAGGAAGGTACAAACTGTTCTTTGCCATGTGTATGTGGGTACGAAGGAGAGGAGAGGAAGAGGAGAGTACCCACATACTCTGATGATCCTTCGGGATCATTCATGGCAATCTAGGA3'

[0168] In another example according to the invention, the test kit and / or assay method is configured to detect a ligand that binds to the mineralocorticoid receptor, wherein the nucleic acid sequence comprised of a T7 RNA polymerase initiation sequence, a mineralocorticoid response element, and a reporter construct encoding an F30 scaffold and a Mango II RNA aptamer comprises the sequence set forth in SEQ ID NO: 17 below: [SEQ ID NO:17] 5'TAATACGACTCACTATAGACTCTGGAGGAATGTACAGGATGTTCTTTGCCATGTGTATGTGGGTACGAAGGAGAGGAGAGGAAGAGGAGAGTACCCACATACTCTGATGATCCTTCGGGATCATTCATGGCAATCTAGGA3'

[0169] In another example according to the invention, the test kit and / or assay method is configured to detect a ligand that binds to the glucocorticoid receptor, wherein the nucleic acid sequence comprised of a T7 RNA polymerase initiation sequence, a glucocorticoid response element, and a reporter construct encoding an F30 scaffold and a Mango II RNA aptamer comprises the sequence set forth in SEQ ID NO: 18 below: [SEQ ID NO:18] 5'TAATACGACTCACTATAGACTCTGGAGGAATGTACAGGATGTTCTTTGCCATGTGTATGTGGGTACGAAGGAGAGGAGAGGAAGAGGAGAGTACCCACATACTCTGATGATCCTTCGGGATCATTCATGGCAATCTAGGA3'

[0170] Other nucleic acids / constructs for use in the test kits and assay methods according to the invention are summarized in Table 1 below. [Table 1-1] [Table 1-2] [Table 1-3] [Table 1-4]

[0171] Multiplex Assay System The present invention further contemplates multiplex assays configured to detect two or more steroid hormone genomic responses from the same test sample.

[0172] To further illustrate the relevance of the multiplex system, in certain situations, for example, it would be useful for a clinician investigating a subject's hormonal status to know both the subject's androgen and estrogen levels / activity.

[0173] Ligands that bind to androgen receptors will not bind to and activate estrogen receptors that are also present in the same assay, and conversely, ligands that bind to estrogen receptors will not bind to and activate androgen receptors that are also present in the same assay, so it is possible to detect androgen ligands and estrogen ligands in parallel from the same test sample.This is because androgen receptors and estrogen receptors belong to different steroid hormone receptor classes, so there is no "crosstalk" in terms of receptor activation.Therefore, a multiplex assay has been developed to detect both androgen ligands and estrogen ligands from the same sample.

[0174] Therefore, in another aspect of the invention there is provided a test kit for screening samples for the parallel detection of androgenic and / or estrogenic ligands, comprising: (i) an androgen receptor, the androgen receptor being capable of forming an androgen receptor-ligand complex with a complementary ligand from a sample; (ii) a first nucleic acid molecule, (a) a polymerase promoter sequence, (b) an androgen response element that is capable of being bound by an androgen receptor-ligand complex, and (c) a first reporter construct; a first nucleic acid molecule, wherein a response element (b) is located between the promoter sequence (a) and the reporter construct (c), and wherein (a), (b), and (c) are operably linked; (iii) an estrogen receptor, the estrogen receptor being capable of forming an estrogen receptor-ligand complex with a complementary ligand from the sample; (iv) a second nucleic acid molecule, (d) a polymerase promoter sequence; (e) an estrogen response element capable of being bound by an etrogen receptor-ligand complex, and (f) a second nucleic acid molecule comprising a second reporter construct; and (iv) a single polypeptide polymerase, The first and second reporter constructs are different, When the sample is combined with the test kit, the presence of an androgen ligand in the sample is detected by measuring the reduction or inhibition of transcription of the first reporter construct caused by binding of the androgen receptor-ligand complex to the response element; A test kit is provided in which, when a sample is combined with the test kit, the presence of an estrogen ligand in the sample is detected by measuring the reduction or inhibition of transcription of a second reporter construct caused by binding of the estrogen receptor-ligand complex to the response element.

[0175] In one example according to this aspect of the invention, the test kit further comprises heat shock protein 90 (HSP90), a complex of HSP90 and heat shock protein 70 (HSP70); a complex of HSP90, HSP70, and heat shock protein 40 (HSP40); a complex of HSP90, HSP70, HSP40, and p23; a complex of HSP90, HSP70, HSP40, p23, and heat shock protein organizing protein (Hop); a complex of HSP90, HSP70, HSP40, p23, Hop, and 48 kD Hip protein (Hip); a complex of HSP90, HSP70, HSP40, p23, Hop, Hip, and p60; and a complex of HSP90, HSP70, HSP40, p23, Hop, Hip, p60, and FKBP52.

[0176] In one example according to this aspect of the invention, the first and second nucleic acid molecules are separate molecules.

[0177] In another example according to this aspect of the invention, the first and second nucleic acid molecules are operably linked.

[0178] In yet another example according to this aspect of the invention, the first nucleic acid molecule comprises the sequence defined by SEQ ID NO:14.

[0179] In a further example according to this aspect of the invention, the second nucleic acid molecule comprises the sequence defined by SEQ ID NO:15.

[0180] In yet a further example according to this aspect of the invention, the first and second nucleic acid molecules are operably linked and comprise a sequence defined by SEQ ID NO:80. [ka]

[0181] Advantageously, the assays and test kits described herein are particularly suitable for configuration in a multiplex system, since (i) they can be performed in the absence of cell extracts, they do not contain naturally occurring ligands and / or steroid hormone receptors that would interfere with the assay signal (e.g., ligand-receptor "crosstalk" resulting in autoactivation of the response element), and (ii) the simplicity of the assay systems described herein means that existing assays or test kits can be routinely modified to include a second or more receptor / reporter construct combination specific for detection of a second ligand, and by utilizing the same in vitro transcription machinery (e.g., bacteriophage polymerase + nucleoside triphosphates), the separate signals generated by each reporter can be conveniently detected. To further illustrate this point, a multiplex assay system according to the present invention may include, for example, an androgen-specific reporter construct that will generate a reporter readout in the presence of androgen or androgen-like ligands that can be measured independently of the readout generated by a reporter construct specific for detection of estradiol in the same sample.

[0182] Those skilled in the art will appreciate the advantages afforded by the lack of molecular complexity associated with the multiplex systems of the present invention and will recognize that detection of multiple (e.g., 2, 3, 4 or more) distinct steroid hormone genomic responses from the same test sample is possible.

[0183] Thus, a test kit according to the invention comprises at least one steroid hormone receptor and at least one nucleic acid molecule comprising at least one reporter construct.

[0184] Thus, the term "steroid hormone receptor" in accordance with the test kits and methods described herein is intended to mean "at least one steroid hormone receptor," in the sense that there may be two or more different types of steroid hormone receptors (for example, and by way of illustration only, a steroid hormone receptor that binds testosterone and a steroid hormone receptor that binds estradiol).

[0185] Similarly, the term "nucleic acid molecule [comprising a response element]" is intended to mean "at least one nucleic acid," in the sense that there can be two or more separate nucleic acid molecules, each comprising a different response element and, optionally, a different reporter molecule.

[0186] In one example according to this aspect of the invention, the test kit comprises (i) a nucleic acid molecule comprising an estrogen receptor and an estrogen response element, and (ii) a nucleic acid molecule comprising an androgen receptor and an androgen response element.

[0187] In a related example, the nucleic acid molecule comprising an estrogen response element further comprises a first RNA aptamer capable of binding to a first fluorophore.

[0188] In another related example, the nucleic acid molecule comprising an androgen response element further comprises a second RNA aptamer capable of binding to a second fluorophore.

[0189] In related examples, the first and second RNA aptamers include, but are not limited to, Mango I, Mango II, Mango III, and Mango IV, Spinach, iSpinach, baby Spinach, Broccoli, and Malachite Green, provided that the first RNA aptamer is not identical to the second RNA aptamer.

[0190] In a further related example, the first RNA aptamer is Mango II and the second RNA aptamer is Malachite Green.

[0191] In a further related example, the first RNA aptamer is Mango II and the second RNA aptamer is iSpinach.

[0192] Availability of test kits and assays Advantageously, the present invention provides activity-based test kits, assays, and methods that function fundamentally on the principle of steroid hormone receptor activation.By detecting steroid hormone receptor activation by target ligands present in the sample being tested (with the resulting binding to hormone response elements), the present invention provides cell-free test kits, assays, and methods that do not rely on structural knowledge of the ligand(s) under investigation, can easily distinguish between the presence of biologically active and inactive ligands, and provide a cost-effective, reliable, and reproducible system that does not require complex laboratory equipment or specific expertise to implement.

[0193] Thus, in another aspect of the present invention, there is provided a method for determining the doping status of an athlete, comprising combining a sample obtained from the athlete with a test kit as described herein and determining the doping status of the athlete.

[0194] In one example according to this aspect of the invention, the sample obtained from the athlete is a serum sample, a plasma sample, or a urine sample.

[0195] In another example, the athlete is a human athlete or a non-human athlete selected from a horse, camel, or dog.

[0196] In a further aspect of the present invention, there is provided an article of manufacture for screening a test sample for the presence of a ligand, which ligand is capable of activating a steroid hormone receptor and inducing a hormonogenetic response in a cell, comprising a test kit as described herein together with instructions on how to detect the presence of the ligand in the sample.

[0197] In yet a further aspect of the present invention, there is provided an article of manufacture for determining doping in an athlete, comprising a test kit as described herein together with instructions for detecting the presence of a ligand in a sample from an athlete, the presence of the ligand in the sample being indicative of doping in the athlete.

[0198] The various test kits and assays described herein each provide (i) a steroid hormone receptor comprising a ligand binding domain for binding a ligand that may be present in the sample being tested, and (ii) a nucleic acid response element comprising a protein binding domain that is bound by an activated steroid hormone receptor (or ligand-receptor complex, HR-L). The term "activated steroid hormone receptor" refers to a receptor-ligand complex, which may include various modifications of the HR-L structure (monomer, dimer, trimer, etc.). Importantly, the hormone response element contains a binding motif specific for the receptor-ligand complex. Thus, by combining the test kits and assays of the present invention with a sample of interest, detection of ligands that have the potential to bind to the steroid hormone receptor and induce a steroid hormone genomic response is possible.

[0199] The terms "receptor binding domain," "activated receptor binding domain," "hormone receptor binding domain," "activated hormone receptor binding domain," "receptor-ligand binding domain," and "hormone receptor-ligand binding domain" are used interchangeably to refer to the protein binding domain of a hormone response element that is bound by an activated hormone receptor or ligand-receptor complex, as defined herein.

[0200] In other examples, the invention described herein finds utility in detecting performance enhancing prodrugs / drugs (e.g., anabolic steroids) used in humans and non-human athletes, including race horses and dogs. In other examples, the invention described herein has utility in screening foods and dietary supplements for additives that bind to steroid hormone receptors and may induce a genomic response in cells, or (i.e., in the case of so-called "prodrugs") may induce a genomic response in cells following metabolic processing.

[0201] The present invention further contemplates the detection of one or more physiologically inactive ligands from test samples, which can eventually activate steroid hormone receptors when the ligands are converted into physiologically active forms.Therefore, the test kits, assays and methods described herein further comprise steroid metabolism machinery that can process ligands in such a way that they will activate corresponding steroid hormone receptors.In this manner, it is possible to detect physiologically inactive ligands (e.g., prohormones) from samples such as dietary supplements.

[0202] Thus, the test kits, assays, and methods described herein may further include sufficient steroid metabolism machinery to convert the ligand from a physiologically inactive form to a physiologically active form, or from a physiologically active form to a more physiologically active form, or from a physiologically active form to a less physiologically active form, or from a physiologically active form to a physiologically inactive form. The steroid metabolism machinery has the ability to activate the steroid hormone receptor and induce a genomic response only when the ligand is in a physiologically active form. Thus, the inclusion of steroid metabolism machinery in the test kits, assays, and methods according to the present invention helps to facilitate the detection of physiologically inactive ligands from test samples of interest where (for example) the ligand exists as a prodrug (e.g., a prohormone) and may avoid detection using established techniques. Furthermore, the inclusion of steroid metabolism machinery in the test kits, assays, and methods according to the present invention helps to determine the biological activity / potency of the ligand required to show an effect.

[0203] The data presented in Figure 17 further illustrates this point. Androstenedione (i.e., androgen prohormone) was pre-incubated with S9 liver fractions, after which the reaction mix was extracted for steroids (i.e., to remove potential non-specific ligands). The various test and control samples were then analyzed for androgenic activity. The results demonstrate a statistically significant reduction in the fluorescence of the reporter construct in androstenedione+S9 liver treatment compared to untreated controls (i.e., androstenedione-S9 liver), where the androgenic activity levels of the untreated controls were approximately equal to the vehicle controls (i.e., methanol+T7, methanol+AR / HSP90).

[0204] The test kits, assays, and methods described herein may further comprise a detection means for detecting binding between the receptor-ligand complex and a response element contained within the nucleic acid, as defined.

[0205] The test kits and assays according to the present invention are cell-free. This is particularly important because the molecular complexity of the assay system is significantly reduced. For example, the absence of (i) cell membrane structures that have the potential to create a thermodynamic sink for steroid hormone molecules, and (ii) endogenous steroid hormone metabolism observed in cell-based systems provides an assay system with improved sensitivity. Additionally and advantageously, the test kits, assays, and methods described herein allow precise control of the relative amounts of essential structural elements (e.g., steroid hormone receptors and nucleic acid response elements that include one or more activated receptor binding domains) to provide improved assay function and increased sensitivity.

[0206] According to the methods described herein, test results may be compared to a reference threshold value to determine the absolute level of signal generated by the ligand present in the test sample. In fact, applicants have observed non-specific binding and / or activation of response elements by non-ligand-bound receptors. Thus, if it is desired to perform semi-quantitative analysis for any given test sample, the assays and methods described herein may be performed in the absence of the test sample (e.g., in the presence of ethanol, which acts as a negative control) to first establish a reference threshold value. The assay results obtained from the test sample may then be compared to the reference threshold value to determine the absolute activity due to the ligand(s) present in the sample using a simple subtraction approach.

[0207] The present invention further contemplates the use of the assays and test kits described herein to determine the potency of a test compound relative to a reference compound. According to the present invention, the term "relative potency" is defined as the multiplier of the biological activity of a test compound relative to a reference compound, determined by normalizing the biological activity of the test compound to the reference compound.

[0208] The biological activity of the test compounds and reference compounds was determined by EC 50Or, it can be determined using the concentration of the compound that gives half the maximum response from the dose-response curve of that particular compound. The dose-response curve is generated by serially diluting the compound and measuring its steroid hormone receptor binding / activation profile. A plot is then made of the measured activity (e.g., measured by fluorescence) versus the concentration of the compound (i.e., the concentration range in which the serial dilutions of the compound are best presented on a logarithmic scale).

[0209] Those skilled in the art will recognize that the measure of relative potency of a test compound is relative to the reference compound used. In other words, the relative potency of a test compound may vary depending on the reference compound to which its biological activity is normalized.

[0210] If the relative potency is >1, the test compound produces a higher measured biological activity in the assay compared to the reference compound. If the relative potency is <1, the test compound produces a lower measured biological activity in the assay compared to the reference compound. If the relative potency = 1, the test compound and the reference compound produce equal biological activity in the assay.

[0211] Relative potency can also be used to determine the activator of the test compound in question. As used herein, activator refers to the relative potency of a test compound determined using yeast cells or extracts that do not contain yeast cells (i.e., do not contain metabolic machinery) as a measure of the relative activation between two states of the test compound, or the relative potency of the same test compound determined using mammalian cells or extracts that do not contain mammalian cells (i.e., contain metabolic machinery). An activator > 1 means that the test compound has undergone metabolic conversion to a more physiologically active state in the presence of metabolic machinery in the assay.

[0212] Yet another advantage provided by the test kits and assays according to the present invention is the relative ease of performance. In other words, the performance of the test kits, assays, and methods described herein does not require complex cell culture techniques, experienced laboratory technicians, or complex laboratory testing equipment and analysis. This is particularly advantageous because the test kits, assays, and methods according to the present invention can be performed by untrained personnel in the field according to relatively simple testing procedures. Furthermore, the performance of the test kits, assays, and methods can provide real-time information when testing for performance-enhancing substances in samples taken from athletes (for example) immediately before or after competition.

[0213] In another aspect of the invention there is provided a test kit for screening a sample for the presence of a ligand, the ligand being capable of forming a complex with a steroid hormone receptor and inducing a genomic response when in a cell, comprising: (i) an androgen receptor that is capable of forming a ligand-receptor complex with a ligand from a test sample; or (ii) an estrogen receptor capable of forming a ligand-receptor complex with a ligand from the test sample, wherein the estrogen receptor is estrogen receptor alpha or estrogen receptor beta; or (iii) a progesterone receptor capable of forming a ligand-receptor complex with a ligand from the test sample, wherein the progesterone receptor is progesterone receptor A or progesterone receptor B; or (iv) a mineralocorticoid receptor that is capable of forming a ligand-receptor complex with a ligand from the test sample; or (v) a glucocorticoid receptor capable of forming a ligand-receptor complex with a ligand from a test sample; and (vi) a nucleic acid molecule comprising: (a) a polymerase promoter sequence, (b) a response element that is capable of being bound by a receptor-ligand complex, and (c) comprising a reporter construct; a nucleic acid molecule, wherein a response element (b) is located between the promoter sequence (a) and the reporter construct (c), and wherein (a), (b), and (c) are operably linked; (iii) a single polypeptide polymerase, A test kit is provided in which, when a sample is combined with the test kit, the presence of the ligand in the sample is detected by measuring the reduction or inhibition of transcription of the reporter construct caused by binding of the ligand-receptor complex to the response element.

[0214] In another aspect of the invention there is provided a test kit for screening a sample for the presence of a ligand, the ligand being capable of forming a complex with a steroid hormone receptor and inducing a genomic response when in a cell, comprising: (i) an androgen receptor that is capable of forming a ligand-receptor complex with a ligand from a test sample; or (ii) an estrogen receptor capable of forming a ligand-receptor complex with a ligand from the test sample, wherein the estrogen receptor is estrogen receptor alpha or estrogen receptor beta; or (iii) a progesterone receptor capable of forming a ligand-receptor complex with a ligand from the test sample, wherein the progesterone receptor is progesterone receptor A or progesterone receptor B; or (iv) a mineralocorticoid receptor that is capable of forming a ligand-receptor complex with a ligand from the test sample; or (v) a glucocorticoid receptor capable of forming a ligand-receptor complex with a ligand from a test sample; and (vi) a steroid hormone receptor cofactor selected from heat shock protein 90 (HSP90), a complex of HSP90 and heat shock protein 70 (HSP70); a complex of HSP90, HSP70, and heat shock protein 40 (HSP40); a complex of HSP90, HSP70, HSP40, and p23; a complex of HSP90, HSP70, HSP40, p23, and heat shock protein organizing protein (Hop); a complex of HSP90, HSP70, HSP40, p23, Hop, and 48 kD Hip protein (Hip); a complex of HSP90, HSP70, HSP40, p23, Hop, Hip, and p60; and a complex of HSP90, HSP70, HSP40, p23, Hop, Hip, p60, and FKBP52. (vii) a nucleic acid molecule comprising: (a) a polymerase promoter sequence, (b) a response element that is capable of being bound by a receptor-ligand complex, and (c) comprising a reporter construct; a nucleic acid molecule, wherein a response element (b) is located between the promoter sequence (a) and the reporter construct (c), and wherein (a), (b), and (c) are operably linked; (iii) a single polypeptide polymerase, A test kit is provided in which, when a sample is combined with the test kit, the presence of the ligand in the sample is detected by measuring the reduction or inhibition of transcription of the reporter construct caused by binding of the ligand-receptor complex to the response element.

[0215] In yet a further aspect of the invention there is provided a test kit for screening a test sample for the presence of a ligand capable of eliciting a steroid hormone genomic response comprising: (i) an androgen receptor that is capable of forming a ligand-receptor complex with a ligand from a test sample; or (ii) an estrogen receptor capable of forming a ligand-receptor complex with a ligand from the test sample, wherein the estrogen receptor is estrogen receptor alpha or estrogen receptor beta; or (iii) a progesterone receptor capable of forming a ligand-receptor complex with a ligand from the test sample, wherein the progesterone receptor is progesterone receptor A or progesterone receptor B; or (iv) a mineralocorticoid receptor that is capable of forming a ligand-receptor complex with a ligand from the test sample; or (v) a glucocorticoid receptor capable of forming a ligand-receptor complex with a ligand from a test sample; and (vi) a nucleic acid molecule comprising: (a) a polymerase promoter sequence, (b) a response element capable of being bound by a receptor-ligand complex as defined in any of (i) to (v) above; and (c) comprising a reporter construct; a nucleic acid molecule, wherein a response element (b) is located between the promoter sequence (a) and the reporter construct (c), and wherein (a), (b), and (c) are operably linked; (vii) a single polypeptide polymerase; and (viii) a nucleoside triphosphate, A test kit is provided in which, when a sample is combined with the test kit, the presence of the ligand in the sample is detected by measuring the reduction or inhibition of transcription of the reporter construct caused by binding of the ligand-receptor complex to the response element.

[0216] In yet a further aspect of the invention there is provided a test kit for screening a test sample for the presence of a ligand capable of eliciting a steroid hormone genomic response comprising: (i) an androgen receptor that is capable of forming a ligand-receptor complex with a ligand from a test sample; or (ii) an estrogen receptor capable of forming a ligand-receptor complex with a ligand from the test sample, wherein the estrogen receptor is estrogen receptor alpha or estrogen receptor beta; or (iii) a progesterone receptor capable of forming a ligand-receptor complex with a ligand from the test sample, wherein the progesterone receptor is progesterone receptor A or progesterone receptor B; or (iv) a mineralocorticoid receptor that is capable of forming a ligand-receptor complex with a ligand from the test sample; or (v) a glucocorticoid receptor capable of forming a ligand-receptor complex with a ligand from a test sample; and (vi) a steroid hormone receptor cofactor selected from heat shock protein 90 (HSP90), a complex of HSP90 and heat shock protein 70 (HSP70); a complex of HSP90, HSP70, and heat shock protein 40 (HSP40); a complex of HSP90, HSP70, HSP40, and p23; a complex of HSP90, HSP70, HSP40, p23, and heat shock protein organizing protein (Hop); a complex of HSP90, HSP70, HSP40, p23, Hop, and 48 kD Hip protein (Hip); a complex of HSP90, HSP70, HSP40, p23, Hop, Hip, and p60; and a complex of HSP90, HSP70, HSP40, p23, Hop, Hip, p60, and FKBP52. (vii) a nucleic acid molecule comprising: (a) a polymerase promoter sequence, (b) a response element capable of being bound by a receptor-ligand complex as defined in any of (i) to (v) above; and (c) comprising a reporter construct; a nucleic acid molecule, wherein a response element (b) is located between the promoter sequence (a) and the reporter construct (c), and wherein (a), (b), and (c) are operably linked; (viii) a single polypeptide polymerase; and (ix) a nucleoside triphosphate, A test kit is provided in which, when a sample is combined with the test kit, the presence of the ligand in the sample is detected by measuring the reduction or inhibition of transcription of the reporter construct caused by binding of the ligand-receptor complex to the response element.

[0217] In certain examples according to the assays, methods and test kits of the present invention, the nucleic acid molecules contain one or more copies of various components of the nucleic acid, including a response element or a reporter construct. For example, a reporter construct or nucleic acid molecule may contain a single copy or multiple copies of a nucleic acid response element, including but not limited to a double copy, a triple copy, a quadruple copy, etc.

[0218] In another example of the invention, the steroid hormone receptor is purified from a cell or derived from a cell-based hormone receptor through recombinant cloning, expression and purification. In a further example, the steroid hormone receptor is synthetic, the sequence of which is modeled or evolved from an endogenous steroid hormone receptor sequence known in the art.

[0219] Those skilled in the art will also recognize that any steroid hormone receptor may be used in the test kits, assays, and methods of the present invention, including steroid hormone receptors based on endogenous cellular forms as well as recombinant or synthetic forms, provided that the receptor retains the ability to bind and be activated by a ligand of interest for detection.

[0220] Thus, the test kits, assays and methods according to the present invention can be configured to screen / detect any ligand that induces a steroid hormone genomic response. However, those skilled in the art will recognize that, according to the various assay concepts described herein, the detection of different hormone classes (i.e., ligands) requires appropriately configured and optimized test kit, assay and method formats. For example, the detection of ligands that bind to and activate the androgen receptor, such as testosterone and other testosterone-like hormones, requires a test kit / assay that includes the androgen receptor together with androgen response elements that can bind to the activated androgen-receptor complex, etc.

[0221] Designer steroids and non-steroidal anabolic drugs pose a significant and growing challenge to anti-doping experiments. First identified in the early 2000s in the detection of tetrahydrogestrinone and madol, the threat posed by designer anabolic drugs is rapidly increasing to include a large number of potential agents. These synthetically derived anabolic drugs are designed to avoid detection or legal controls on both production and supply, and many are widely available on the Internet when sold as so-called "supplements."

[0222] Mass spectrometry remains the primary technique for identifying known illegal steroid hormones and nonsteroidal anabolic drugs in biological samples and / or supplements. Despite its sensitivity and specificity, mass spectrometry is still limited by requiring prior knowledge of the chemical structures of steroid and nonsteroidal anabolic drugs for detection. Furthermore, mass spectrometry cannot provide information about the biological activity of the detected anabolic drugs and is unable to distinguish between bioactive and inactive molecules, information necessary for legal prosecution of athletes, coaches, trainers, managers, and manufacturers.

[0223] In recent years, yeast and mammalian cell-based in vitro androgen bioassays have been used to detect the presence of novel synthetic androgens in food supplements, progestins, and the androgenic potential of androgens, proandrogens, designer androgens, and designer nonsteroidal anabolic drugs.However, these assays suffer from limitations related to molecular complexity, as described elsewhere herein, require technical skills that are both molecular and cellular in nature, are time-consuming and labor-intensive, and are expensive.Therefore, it is not practical to consider the current form of the assay for inclusion in routine screening.In other words, yeast and mammalian cell-based assays suffer from significant limitations, as they are not high-throughput and cost-effective.

[0224] Advantageously, the present invention provides activity-based test kits, assays and methods that function fundamentally on the principle of steroid hormone receptor activation.By detecting steroid hormone receptor activation by ligands present in the sample being tested, the present invention provides cell-free test kits, assays and methods that do not rely on structural knowledge of the ligand(s) under investigation, can easily distinguish between the presence of biologically active and inactive ligands, and provide a cost-effective, reliable and reproducible system that does not require complex laboratory equipment or specific expertise to implement.

[0225] Thus, in one example according to the test kits, assays, and methods described herein, the ligand is a performance enhancing designer drug and / or a steroid.

[0226] In another example according to the test kits, assays, and methods described herein, the ligand is of unknown chemical structure.

[0227] In a further example according to the test kits, assays, and methods described herein, the ligand is of a previously unknown chemical structure.

[0228] The present invention further contemplates the use of the test kits, assays, and methods described herein to detect antagonists of a target ligand that do not activate the receptor and do not elicit a genomic response, by screening a sample of interest for compounds that will prevent the binding of the ligand to its steroid hormone receptor.

[0229] This is particularly useful when it is necessary to screen for antagonists that block steroid hormone receptor activation (for example) as potential therapies for the treatment of endocrine and non-endocrine cancers. For example, the activity-based test kits, methods, and assays according to the present invention, including one or more estrogen receptors, can be used to screen compound libraries for the presence of antagonists, or to monitor the loss of estrogen receptor activation in breast cancer tissue or blood of patients undergoing cancer therapy.

[0230] In still further examples according to all embodiments of the test kits, assays, and methods described herein, the biological sample is derived from an animal selected from the group consisting of horse, dog, camel, cow, pig, sheep, goat, bird, monkey, mouse, rabbit, deer, fish, salmon, primate, and human.

[0231] In still further examples according to all embodiments of the test kits, assays, and methods described herein, the test sample is derived from biological material selected from the group consisting of urine, saliva, stool, hair, tissue, including but not limited to blood (plasma and serum), muscle, tumor, semen, etc.

[0232] In still further examples according to all embodiments of the test kits, assays, and methods described herein, the test sample is derived from a food selected from the group consisting of vegetables, meat, beverages including but not limited to sports drinks and milk, food supplements, and supplements including but not limited to sports supplements, nutritional supplements, herbal extracts, and the like.

[0233] In still further examples according to all of the embodiments of the test kits, assays, and methods described herein, the test sample is derived from a pharmaceutical product selected from the group consisting of drugs, tonics, syrups, tablets, electuaries, creams, sprays, and gels.

[0234] In still further examples according to all embodiments of the test kits, assays, and methods described herein, the sample is derived from an environment selected from the group consisting of liquids, water, soil, textiles, including but not limited to plastics and minerals.

[0235] The information presented in Example 6 viewed in conjunction with Figures 14-16 demonstrates that the test kit and assay method were used to detect testosterone (as an example of a steroid hormone ligand) from biological matrices such as serum from calves and horses (Figures 14-16), and urine from foals (Figures 15 and 16). These data reinforce the field utility of the test kit and assay method according to the present invention for, for example, determining trackside doping status of human and equine athletes, or performing analysis on dietary supplements as part of export / import quality control.

[0236] Thus, in another example, the sample is a biological sample. In a related example, the biological sample is a bodily fluid sample, including but not limited to blood, plasma, serum, saliva, interstitial fluid, semen, and urine.

[0237] In another example, samples derived from plants include, but are not limited to, leaves, flowers, stems, bark, roots, buds, pods, pollen, and seeds.

[0238] In another example, the sample is derived from an animal, including, but not limited to, a horse animal, a dog animal, a dromedary animal, a bovine animal, a porcine animal, a sheep animal, a goat animal, a bird animal, a monkey animal, a murine animal, a rabbit animal, a deer animal, a fish animal, a salmon animal, a primate animal, and a human animal.

[0239] In another example, the test sample is a non-biological sample. In a related example, non-biological samples include liquid samples including, but not limited to, water, soil samples, textile samples including, but not limited to, plastics, mineral samples, food samples, and pharmaceuticals.

[0240] Examples of food samples include, but are not limited to, vegetables, meats, beverages, food supplements, and herbal extracts.

[0241] Examples of pharmaceutical agents include, but are not limited to, drugs, tonics, syrups, tablets, electuaries, creams, sprays, and gels.

[0242] The invention will be further described with reference to the following examples, it being understood that the invention as claimed is not intended to be limited in any way by these examples. EXAMPLES

[0243] The following information and data demonstrate various prototype assays for detecting ligands that bind to and activate the androgen receptor, including (for example) testosterone and dihydrotestosterone, or ligands that bind to and activate the estrogen receptor, including (for example) estradiol. These examples are used to explain the activity assay platform described and claimed herein, in which the concepts and principles of the assay exemplified by the detection of ligands that bind to the androgen receptor or ligands that bind to the estrogen receptor (i.e., ER-α and ER-β) will be equally applicable to the detection of other receptor ligands of interest, including but not limited to ligands that bind to the progesterone receptor, including but not limited to progesterone, ligands that bind to the mineralocorticoid receptor, including but not limited to aldosterone, and ligands that bind to the glucocorticoid receptor, including but not limited to cortisol.

[0244] Example 1 Androgen Assay Prototype 1: Assay Architecture and Results 1.1 In vitro transcription platform Applicants first developed an in vitro transcription platform that includes a DNA construct encoding a T7 RNA consensus promoter sequence upstream of a tandem array of 3X androgen response elements (AREs) upstream of a Mango II RNA aptamer sequence, combined with recombinant androgen receptor (AR), recombinant heat shock protein 90 (HSP90), T7 RNA polymerase, nucleoside triphosphates, and transcription buffer. The T7 promoter will drive high levels of RNA aptamer expression, which will be detected by binding to the fluorophore Thiazole Orange 1-biotin (TO1). When the ARE is bound by ligand-activated AR, T7-driven inhibition of aptamer expression will occur. Androgen response element (ARE) The androgen response element tested in these experiments was a tandem array of 3xAREs. Androgen Receptor (AR) Commercially available recombinant AR from Sigma-Aldrich has been tested T7 RNA polymerase These studies used the MegaScript kit from ThermoFisher as a source of T7 RNA polymerase, and the necessary buffers and nucleotide triphosphates.

[0245] 1.2 Description of ARE-mediated transcription / translation Natural androgen signaling begins with androgen molecules diffusing into the cell and binding to the AR, which is held in an inactive state in the cytoplasm and bound to heat shock protein 90 (HSP90). Upon binding of the androgen molecule (or ligand), the AR undergoes a conformational change that releases HSP90 and exposes nuclear localization and dimerization sites. The ligand-AR complex is targeted for translocation to the nucleus, where AR binds to ARE sites in DNA and RNA polymerase II holoenzyme assembles, initiating transcription of AR-regulated genes. Transcription of genes by RNA polymerase II results in mRNA transcription, which in turn acts as a template for the ribosomal machinery to make proteins.

[0246] The ARE is located downstream of the T7 promoter (and transcription start site), so binding of testosterone-ligated AR to the ARE reduces T7-mediated transcription. Taking advantage of this natural biology, the experiments described show that testosterone (a natural androgen)-activated AR reduces / inhibits T7-mediated transcription.

[0247] FIG. 1 shows a schematic diagram of ARE-mediated blockade of T7 RNA polymerase-mediated transcription.

[0248] In the presence of a ligand, such as the natural androgen testosterone, the AR binds to the ARE and inhibits transcription by T7 polymerase: in this state, fewer RNA Mango II aptamers are formed.

[0249] In the absence of ligand, the AR is not activated and does not bind to the ARE, and therefore the DNA does not contain interfering proteins. T7 advances along the DNA construct to generate the RNA Mango II aptamer, which is then detected by TO1-B binding and fluorescence.

[0250] With reference to the results presented in Figures 2 and 3, testosterone activation with AR transcription blocked was investigated. AR did not show complete T7-mediated transcription and expression of the RNA Mango II aptamer, which is reduced in the presence of AR and further reduced when AR is activated by 11.5 ng / ml testosterone.

[0251] Next, referring to FIG. 4, we investigated whether HSP90 can inhibit the baseline activation of AR. AR is activated by conformational changes through testosterone-mediated activation of area activator-1 (AF-1) or through autoactivation of area activator-2 (AF-2). In AR, AF-2 is highly active and may account for up to 50% of AR activity. To suppress autoactivation of AF-2, HSP90 was added to hold AR in an inactivated state that would not bind to ARE in the absence of ligand. However, in the presence of ligand, HSP90 should competitively dissociate from AR and the coordinated AR should bind to ARE.

[0252] Example 2: Androgen Assay Prototype 2: Assay Architecture and Results The concept of the androgen assay prototype 2 is that a single protein RNA polymerase, such as T7 RNA polymerase, binds to its promoter sequence on a DNA template. The DNA template encodes the RNA aptamer Mango II sequence downstream of the promoter. A hormone response element (HRE) is located between the T7 promoter and the Mango II sequence. When a steroid hormone receptor (SHR) is added to the T7 in vitro transcription (IVT) reaction mix and activated by a receptor-specific ligand, the SHR binds to the HRE on the DNA template and physically inhibits the T7 RNA polymerase from transcribing DNA into RNA at this binding location, and thus the Mango II aptamer is not formed. The formation of Mango II is detected by adding a specific fluorophore, such as TO1-biotin, to the reaction mix that binds to the Mango II aptamer. TO1, when bound to the Mango II aptamer, emits an excitation wavelength at a wavelength of 535 nm when excited at a wavelength of 510 nm. Fluorescence is measured using a standard fluorometer.

[0253] 2.1 DNA sequences used in the development of the androgen assay prototype 2 In the following experiments, AR or ERα is used as an example of an SHR, and ARE or ERE is used as an example of an HRE.

[0254] The key step behind T7-mediated in vitro transcription is to recognize its promoter sequence within the DNA template. To then measure that T7 transcription has occurred, the DNA sequence may code for a reporter enzyme (protein) or a reporter RNA (e.g., an adaptomer). In the following example, the DNA sequence coded for a reporter RNA (Mango II).

[0255] Using a commercial DNA fragment synthesiser, we generated a series of DNA templates encoding the Mango II RNA aptamer containing (1) the T7 initiator sequence, (2) the ARE, and (3) the F30 scaffold. These DNA fragments were cloned into plasmids and amplified using transformed E. coli. Subsequent plasmid extraction, purification, and linearization provided the final DNA templates for the prototype assay. Other examples in which transcription factors blocked T7 activity have shown that approximately 15 bp between the T7 initiator sequence and the transcription factor site is optimal for blocking T7 progression. Therefore, a 15 bp filler sequence was included in the DNA fragments. [Table 2]

[0256] 2.2 Testosterone-activated AR can suppress T7-mediated expression of the RNA aptamer, Mango II The SHR-HRE-RNA aptamer reaction to detect SHR ligands relies on the blockage of T7 transcription by SHR bound to a hormone response element. In the following examples, AR and ARE were used to represent SHR and HRE. [Table 3]

[0257] Reactions were assembled and initiated by adding T7 RNA polymerase and incubated at 37°C for 150 min. During this time, the RNA Mango II aptamer was generated. Detection of Mango II was by addition of a fluorophore, thiazole orange (TO1), and measurement of the output using a fluorometer, excitation 510 nm, emission 535 nm. Figure 5 shows that testosterone-activated AR is capable of reducing the amount of T7-generated RNA aptamer Mango II in a dose-dependent manner. Testosterone represents the most abundant endogenous circulating androgen in the body. Testosterone can be converted to dihydrotestosterone (DHT) in peripheral tissues (e.g., gonads). DHT was also found to activate the AR-regulated reduction in T7-generated Mango II.

[0258] 2.3 Steroid hormone receptor titration As above, in the following experiments, the AR was used as an example of a steroid hormone receptor.

[0259] In the above experiments, the initial AR concentrations were based on previous cell-free assays established in the inventors' lab, as shown in Table 3. The T7-mediated reduction in Mango II production depends on there being enough AR to block all T7 enzyme molecules currently bound to the DNA template. This means that both the ratio of AR to T7 and the ratio of AR to DNA template are important. However, the level of AR must be considered in the context of optimal levels of T7 and / or DNA template that support sufficient Mango II production required to detect a change in fluorescence.

[0260] In the next set of experiments, the concentration of AR per reaction was varied to show its effect on Δ[Mango II]. [Table 4]

[0261] Using a 50 ng AR reaction as the "standard" reaction, the molecular weight of AR is 2.737e 11 (454.55 fmol or 22.72 nM), the number of DNA molecules is 3.798 e 10 (63.06 fmol or 3.15 nM), resulting in an AR:DNA excess ratio of 7.2:1. Doubling the AR concentration to 100 ng doubles the ratio to 14.4:1. Halving the AR concentration to 25 ng halves the ratio to 3.6:1, and then again to 1.8:1 at 14.2 ng AR.

[0262] The data in Figure 6 show that AR:DNA ratios of 7.2:1 and above result in higher ΔMango II. Lower ratios also show ΔMango II, but at a reduced magnitude of effect. Notably, a rapid increase in the ratio from 7.2 to 14.4 shows no improvement in the magnitude of the effect of ΔMango II, suggesting that an excess of 7.2:1 AR to DNA is sufficient to block T7 activity, with further excesses resulting in redundancy.

[0263] Since excess HSP90 blocks activation of SHR, especially at low concentrations of ligand, whereas insufficient HSP90 allows autoactivation of SHR, the ratio of HSP90 to SHR should also be examined when considering activation of SHR by steroid hormones.In the next set of experiments, again using AR as a representative SHR, the ratio of HSP90 to AR was varied to probe the effect of testosterone on T7-produced Mango II. [Table 5]

[0264] FIG. 7 shows that a standard reaction of 50 ng AR and 100 ng HSP90 with an HSP90:AR ratio of 2.44:1 was optimal, however, other ratios could achieve the same level of ΔMango II. For example, 6.69e 11 100 ng of HSP90 corresponding to the molecule (1.11 pmol or 55.5 nM), and 5.47 e11 100 ng of AR, corresponding to the molecule (909.09 fmol or 45.5 nM), or a ratio of 1.22:1, also showed good inhibition of T7-mediated Mango II production. Similarly, 1.37 e 11 Molecular weight (227.27 fmol or 11.4 nM) and 6.69 e 11 AR (25 ng) and HSP90 (100 ng), representing a molecular weight of 1.11 pmol or 55.5 nM, or a ratio of 4.88:1, showed a ΔMangoII that was not different from the ratio of 2.44:1. However, a ratio of 9.76:1 showed a reduction in ΔMangoII, as did a ratio of 1.22:1 when AR concentrations were <100 ng.

[0265] Importantly, the data in Figures 6 and 7 highlight the unique ability to stoichiometrically define biological reactions.

[0266] At AR:DNA ratios of ≥ 7.2: 1, AR is most effective at binding to the ARE and blocking T7 progression. At HSP90:AR ratios of 1.22: 1 to 4.88: 1, AR is most effective at ligand activation and binding to the ARE.

[0267] 2.4 HRE Operation Previous data have used a 3X ARE sequence, which is commonly used in cell-based AR bioassays (see Table 2). However, the primary ARE identified is of the sequence AGAACAGCCTGTTCT. Given the function of this assay in which the T7 enzyme is physically blocked by AR, the presence of a 3X ARE sequence may not be necessary. In the following studies, a single, but primary sequence ARE was cloned into the T7 DNA template. Figure 8 clearly shows that a single ARE is as effective as a 3X ARE sequence in blocking activated AR to T7 RNA polymerase.

[0268] 2.5 Titration of DNA template The DNA template is a critical component of the assay and must be at a concentration that supports T7 transcription, but not in excess such that the number of AR molecules present can sterically hinder transcription of the reporter construct by the T7 enzyme.

[0269] In the next series of experiments, AR and T7 were held constant and the DNA template was titrated. This provided insight into the number of DNA molecules required to support transcription and maintain AR blockade. The data in Figure 9 show that when the concentration of AR was 50 ng (2.737 e 11 molecule, 454.55 fmol or 22.72 nM, and DNA concentration was 100 ng (3.798 e 10 , 63.06 fmol or 3.15 nM) indicates good detection of ΔMango II. Excessing the amount of AR relative to DNA by lowering the DNA concentration to test ratios of 14.4:1, 17.28:1, and 28.8:1 did not affect the improvement of ΔMango II. Thus, an excess ratio of 7.2:1 achieves the greatest effect. There was a dramatic decrease in T7-mediated fluorescence output, so by increasing the DNA template to 6.46 e 9 or 3.398e 9 Note that reducing the concentration to 9.495e affected ΔMango II (data not shown). 9 Molecular double-stranded DNA is the minimum level required for a successful reaction, but the excess AR:DNA must be maintained above 7.2: 1. Adding more AR above 7.2 creates redundancy, but increasing the ratio by decreasing DNA puts T7-mediated transcription at risk.

[0270] The data from FIG. 9 continue to define a biologically effective, yet synthetically achieved, SHR response. Through stoichiometric analysis of the individual components, it was experimentally determined that the AR was most effective at binding to the ARE and blocking T7 progression when the AR:DNA ratio was ≥ 7.2:1. However, constructing this ratio required a DNA template concentration of at least 9.495e 9The molecule must be fixed into double-stranded DNA or basal levels of transcription will be compromised.

[0271] 2.5 Titration of T7 polymerase The final component of the androgen assay prototype 2 that needs to be considered to allow for a fully defined stoichiometric reaction that can mimic the biology of steroid hormone receptors is the T7 enzyme itself. In these examples, T7 RNA polymerase is used in this reaction to generate a reporter that is an RNA aptamer, Mango II.

[0272] The amount of T7 enzyme is important to keep the fluorescence reading within the spectrum that will allow for the optimal dynamic range. Since T7 is an enzyme, the key factor is not only the concentration, but also the activity. The next set of experiments showed the effect of changing T7 activity on ΔMango II.

[0273] In Figure 10, the data shows the fluorescence levels of T7-produced MangoII:TO1B titrated from 50 U to 10 U of T7 units. Note that with all measurements near 200,000, showing a clear baseline of detection, there is no obvious difference in the fluorescence measured in the 40-10 U enzyme range, and the baseline is not sensitive enough to measure changes in output. This suggests that in order to measure ΔMangoII, fluorescence measurements must be above 200,000.

[0274] To further demonstrate the effect of minimum fluorescence levels, T7 (50U) or T7 (100U) were used to generate Mango II RNA aptamer in reactions blocked with testosterone-induced AR or with ethanol as a control. The data in Figure 11 show that when 50U was used, the fluorescence was approximately 250,000-300,000, indicating testosterone activation is approximately 9% in ΔMango II, whereas the same reaction shows approximately 16% ΔMango II when the fluorescence is in the range of >600,000. Thus, the data highlights that T7 activity needs to be in the range to generate >300,000 MangoII-TO1B fluorescence. The exact activity or units will depend on batch-to-batch and / or supplier-to-supplier differences in the specific activity of recombinant T7 RNA polymerase.

[0275] Example 3: Estrogen Assay Prototype 3: Assay Architecture and Results In the above examples, AR / ARE was used as an example of SHR / HRE. In the following series of experiments, the reaction stoichiometry established and defined for AR / ARE is used to demonstrate the applicability of the study to other SHR, in this case ERα. The results presented below demonstrate that estradiol-activated ERα can suppress T7-mediated expression of the RNA aptamer, Mango II. [Table 6]

[0276] Standard AR / ARE conditions that proved successful in the testosterone detection test were used, however, AR was replaced by ERα and the DNA template encoding a single ERE was replaced by an ARE DNA template (Table 6). Figure 12 shows that replacing AR with ERα (50 ng) combined with HSP90 (100 ng) and activating with 5 μM estradiol (E2) resulted in a reduction in the output of MangoII:TO1. ΔMango II was about 60%. Considering the ratio, ERα at 68 kDa is smaller than AR (110 kDa), therefore the number of molecules added to the weight was 4.428e11 (735.20 fmol or 36.8 nM). Thus, the ratio of HSP90:ERα was 6.69e 11 :4.428e 11 or 1.51:1, with an ERα:DNA ratio of 4.428e 11 :3.798e 10 or 11.66:1, both of which were within the range found to be successful ratios for detecting androgens in the AR version of the SHR / HRE test. [Table 7]

[0277] The importance of the ERα:ERE response for estrogen detection is two-fold. First, it demonstrates the ease with which the essential test components can be switched from an AR / ARE DNA template to an ER / ERE DNA template. Second, it demonstrates an established, defined stoichiometric response to the AR / ARE that mimics androgen biology by allowing ligand binding to the androgen receptor, displacing HSP90, and binding to the ARE, which can be translated into a second steroid hormone receptor / steroid response element combination.

[0278] The data show that it is possible to reproduce the biology of steroid hormones in a cell-free manner and in such a way that all components can be defined, i.e. a true in situ test. This is different from the in vitro situation when using cell-based bioassays or cell-free bioassays based on nuclear extracts that provide the holoenzyme RNA polymerase II. In the case of cell-based bioassays, the levels of SHR, HSP90, DNA template, and RNA polymerase II cannot be defined at all, as they are affected by the expression patterns of the cells. Cell-free bioassays based on nuclear extracts can partially define the stoichiometry of the reaction by describing the SHR, HSP90, and HRE levels, however, it is not possible to define the RNA polymerase levels. RNA polymerase II is a holoenzyme, composed of several subunits or proteins, and therefore can only be supplied in the form of a nuclear extract. Nuclear extracts do not define which other proteins are present. In this single polypeptide RNA polymerase form of the assay, the stoichiometry of the reaction can be fully defined, and the data show that such reactions can be synthetically engineered to mimic the natural biology of steroid hormone receptors.

[0279] Example 4 Ligand-SHR / HRE stoichiometric reaction for prototype assay The data presented in Examples 2 and 3 reveal a defined stoichiometry that mimics steroid hormone receptor biology, the classical steroid hormone genomic response in which a ligand binds to a specific receptor, which displaces the receptor from HSP90 and binds to a steroid response element. In nature, SHR will activate or repress the expression of a target gene. In the prototype assay described herein, binding of the coordinated SHR represses the expression of a reporter molecule. [Table 8] [Table 9]

[0280] Example 5 Androgen Assay Prototype 2 detects androgen molecules Androgenic molecules are steroid hormones by nature. Testosterone and dihydrotestosterone are the most abundant endogenous androgens. Based on their structures, synthetic androgenic anabolic steroid hormones (AAS) have been designed and are available on the market. AAS are the most commonly abused performance enhancing drugs in athletes, humans, animals, etc. Another class of synthetically derived androgenic molecules are selective androgen receptor modulators or SARMs. Similar to AAS, SARMs are abused by athletes. Both AAS and SARMs are structurally distinct, with a wide variety of different side groups and backbones. In this next set of experiments, we tested whether the AR / HSP90-ARE prototype assay is capable of detecting different AAS and SARMs. [Table 10]

[0281] FIG. 13 shows that the assay was capable of detecting a variety of AAS and SARMs.

[0282] Example 6 Androgen Assay Prototype 2 detects androgen molecules in biological matrices Next, we tested the Androgen Assay Prototype 2 for its ability to detect testosterone when present in biological matrices such as serum or plasma. First, we needed to demonstrate that T7 RNA polymerase continued to function in the presence of serum, i.e., serum itself did not suppress the efficacy of T7 in generating the Mango II aptamer. Figure 14 shows that in the presence of horse serum or fetal calf serum (FCS), T7 RNA polymerase continued to generate Mango II.

[0283] There was no evidence that serum incidentally suppressed T7 activity. We next tested whether, in the presence of serum, the AR continued to respond to testosterone as an example ligand. The reaction was established as above, except this time the water component was replaced by serum spiked with testosterone (or ethanol as vehicle). Figure 15 shows that the reaction is not impaired when serum is present as a reaction component. This result is highly significant, as it shows that the assay is capable of detecting androgen levels in biologically relevant samples, for example in clinical or sports doping applications.

[0284] The next stage of testing involved testing the Androgen Assay Prototype 2 for its ability to detect endogenous androgens isolated and extracted from equine urine samples. Racehorse urine samples were collected on race day and steroids were isolated and extracted using standard processes. Extracted steroids were resuspended in ethanol and subjected to the assay.

[0285] Figure 16 shows that the Androgen Assay Prototype 2 was able to detect high levels of androgens in urine samples from foals (male horses), but not from geldings (castrated male horses). Gelded urinary testosterone and added trenbolone (AAS) were used as controls.

[0286] The data from Figures 15 and 16 demonstrate that the assay is capable of detecting androgen molecules in biological matrices including serum and urine.

[0287] Although the present invention has been described by way of example, it should be understood that variations and modifications can be made without departing from the scope of the invention as defined in the claims. Furthermore, where known equivalents exist for specific features, such equivalents are incorporated as if specifically referred to herein.

[0288] All patents, publications, scientific articles, websites, and other documents and materials referenced or mentioned herein are indicative of the level of skill of those skilled in the art to which the invention pertains, and each such referenced document and material is individually incorporated by reference in its entirety or is incorporated by reference herein to the same extent as if its entirety were set forth herein. Applicants reserve the right to physically incorporate into this specification any and all materials and information from any such patents, publications, scientific articles, websites, electronically available information, and other reference materials or documents.

[0289] The terms and expressions which have been employed are used as terms of description rather than of limitation, and the use of such terms and expressions is not intended to exclude any equivalents of the features shown and described or portions thereof, but it is recognized that various modifications are possible within the scope of the invention as claimed. Thus, while the invention has been specifically disclosed by preferred embodiments and optional features, it will be understood that modifications and variations of the concepts disclosed herein may be employed by those skilled in the art, and that such modifications and variations are considered to be within the scope of the invention as described herein and defined by the appended claims.

[0290] The invention has been described broadly and generically herein. Each of the narrower species and subgeneric groupings falling within the generic disclosure also form part of the invention. This includes the generic description of the invention with a provisos removing any subject matter from the genus, or a negative limitation, regardless of whether the removed material is specifically recited herein.

[0291] Other examples are within the scope of the following claims. Additionally, when features or aspects of the invention are described in terms of a Markush group, those skilled in the art will recognize that the invention is also thereby described in terms of any individual members or subgroup members of the Markush group.

Claims

1. 1. An assay method for detecting a ligand in a sample, wherein the ligand is capable of inducing a steroid hormone genomic response, comprising: (i) subjecting a sample to (a) a steroid hormone receptor that forms a ligand-receptor complex with a ligand from the sample; (b) a nucleic acid molecule comprising: (1) a polymerase promoter sequence, (2) a response element bound by the ligand-receptor complex, and (3) comprising a reporter construct; a nucleic acid molecule, wherein the response element (2) is located between the promoter sequence (1) and the reporter construct (3), and (1), (2), and (3) are operably linked; (c) a polymerase consisting of a single polypeptide; (d) contacting with a nucleoside triphosphate; (ii) measuring the reduction or inhibition of transcription of the reporter construct caused by binding of the ligand-receptor complex to the response element; An assay method wherein a measured reduction or inhibition of transcription of said reporter construct is indicative of the detection of a ligand in said sample.

2. heat shock protein 90 (HSP90), a complex of HSP90 and heat shock protein 70 (HSP70); a complex of HSP90, HSP70, and heat shock protein 40 (HSP40); a complex of HSP90, HSP70, HSP40, and p23; a complex of HSP90, HSP70, HSP40, p23, and heat shock protein organizing protein (Hop); HSP90, HSP70, HSP40, p23, Hop, and 48 kD 2. The assay method of claim 1, further comprising contacting the sample with a steroid hormone receptor cofactor selected from a complex of Hip protein (Hip); a complex of HSP90, HSP70, HSP40, p23, Hop, Hip, and p60; and a complex of HSP90, HSP70, HSP40, p23, Hop, Hip, p60, and FKBP52.

3. 3. The assay method of claim 2, wherein the ratio (mol / mol) of HSP90 to steroid hormone receptor is x:1, where x is the amount of HSP90 and is defined as [1.0≦x≦5.0].

4. 4. The assay method according to claim 1, wherein the ratio (mol / mol) of steroid hormone receptor to nucleic acid molecule is y:1, where y is the amount of steroid hormone receptor and is defined as [7.0≦y≦10.0].

5. The assay method according to any one of claims 1 to 4, wherein the polymerase is T7 RNA polymerase.

6. The assay method of claim 5 , wherein the polymerase promoter sequence is defined by SEQ ID NO:

1.

7. The assay method according to any one of claims 1 to 6, wherein the reporter construct comprises a sequence encoding an RNA aptamer capable of binding to a fluorophore.

8. 8. The assay method of claim 7, wherein the RNA aptamer is selected from Mango I, Mango II, Mango III and Mango IV, Spinach, iSpinach, baby Spinach, Broccoli and Malachite Green.

9. The assay method of claim 7, wherein the RNA aptamer is Mango II and comprises an F30 scaffold.

10. 10. The assay method according to any one of claims 1 to 9, wherein the steroid hormone receptor is selected from the group consisting of androgen receptor (AR), estrogen receptor alpha (ER-α) and estrogen receptor beta (ER-β), progesterone receptor A (PRA) and progesterone receptor B (PRB), mineralocorticoid receptor (MR), and glucocorticoid receptor (GR).

11. The response element is a. an androgen response element (ARE) comprising the sequence 5'-AGAACAnnnTGTTCT-3' (SEQ ID NO: 4), where n is A, T, G, or C; b. an estrogen response element (ERE) comprising the sequence 5'-AGGTCAnnnTGACCT-3' (SEQ ID NO:8), where n is A, T, G, or C; c. a progesterone response element (PRE) comprising the sequence 5'-GGTACAAAACTGTTCT-3' (SEQ ID NO: 10); d. a mineralocorticoid response element (MRE) comprising the sequence 5'-AGAACAnAATGTTCT-3' (SEQ ID NO: 12), where n is A, T, G, or C; and / or e. A glucocorticoid response element (GRE) comprising a sequence of 5'-AGAACAnAATGTTCT-3' (SEQ ID NO: 12), where n is A, T, G, or C.

12. (i) configured to detect a ligand that binds to an androgen receptor, wherein the nucleic acid molecule comprises the sequence defined by SEQ ID NO: 14; (ii) configured to detect a ligand that binds to an estrogen receptor, wherein the nucleic acid molecule comprises the sequence defined by SEQ ID NO: 15; (iii) configured to detect a ligand that binds to a progesterone receptor, wherein the nucleic acid molecule comprises the sequence defined by SEQ ID NO: 16; (iv) configured to detect a ligand that binds to a mineralocorticoid receptor, wherein the nucleic acid molecule comprises the sequence defined by SEQ ID NO: 17; or (v) detecting a ligand that binds to a glucocorticoid receptor, wherein the nucleic acid molecule comprises a sequence defined by SEQ ID NO: 18; The assay method according to any one of claims 1 to 11.

13. The assay method according to any one of claims 1 to 11, wherein the nucleic acid molecule comprises any of the sequences defined by SEQ ID NOs: 19 to 73.

14. A method for determining the doping status of an athlete, comprising subjecting a sample obtained from the athlete to the assay method of any one of claims 1 to 13 to ascertain whether the sample contains a ligand sufficient to bind to and activate a steroid hormone receptor and cause a reduction or inhibition in transcription of the reporter construct, wherein a reduction or inhibition in transcription of the reporter construct provides information about the doping status of the athlete.

15. 15. The method of claim 14, wherein the athlete is selected from human athletes, equine athletes, canine athletes, and camel athletes.

Images