Peptides for use as cell membrane penetrating peptides

Abstract

The present invention relates to a novel peptide that can be used as a cell membrane-permeable peptide, which comprises the amino acid sequence LL-[X]n-LL (wherein X is selected from R, L, and W, n=10-12, and [X]n comprises 4 R, 4 L, and 2-4 W). The present invention also relates to nanoparticles comprising the peptide of the present invention and a cargo molecule, and uses thereof.

Description

[Technical field]

[0001] The present invention relates to a non-naturally occurring peptide that can be used as a cell membrane penetrating peptide. More specifically, the peptide of the present invention can self-assemble with a cargo molecule, such as siRNA, to form a peptide-based nanoparticle for transfecting the cargo molecule into cells. The present invention also relates to a pharmaceutical composition comprising said nanoparticle, and a method for delivering the cargo molecule into cells. [Background technology]

[0002] RNA interference (RNAi) in mammalian cells has opened up new research opportunities to exploit this mechanism for the treatment of various diseases. Short interfering RNA (siRNA) is a double-stranded RNA molecule with a length of 20-25 base pairs containing two nucleotide overhangs at each 3' end. The antisense strand of siRNA, which has a sequence complementary to the target mRNA, can induce sequence-specific gene silencing. siRNA has been shown to be a potential candidate drug for many difficult-to-treat diseases such as viral infections and cancer.

[0003] Such oligonucleotides have outstanding potential as future drugs due to their design versatility and high specificity. However, limitations such as low cell membrane permeability and fast endo- / lysosomal degradation after entry into cells may be overcome by the use of specific carriers. Numerous delivery technologies based on cationic lipids, polymers, dendrimers and peptides have been developed. Among such non-viral carrier materials, cell membrane penetrating peptides (CPPs) have attracted increasing interest due to their diversity of sequences and functions. CPPs are usually short (up to 30 amino acids) peptides derived from various sources (e.g., human, murine, viral or purely synthetic). Based on their structural characteristics, CPPs can be classified into two classes: arginine-rich CPPs and amphipathic CPPs.

[0004] Amphipathic CPPs contain both hydrophilic and hydrophobic domains, which are necessary for cell internalization and interaction with cargo. In early amphipathic CPPs, the domains are arranged according to their position along the peptide chain, as seen in pVEC (A. Elmquist et al. VE-Cadherin-Derived Cell-Penetrating Peptide, pVEC, with Carrier Functions, Exp. Cell Res. 269 (2001) 237-244), MPG and Pep-1 (S. Deshayes et al., (2005) Cell-penetrating peptides: tools for intracellular delivery of therapeutics, Cell. Mol. Life Sci. CMLS. 62, 1839-1849). Second-generation amphipathic CPPs are another large class of peptides in which the separation of hydrophilic and hydrophobic domains occurs through the formation of secondary structures such as α-helices or β-sheets.Many of the most commonly used CPPs are members of this class, such as penetratin (D. Derossi et al., (1994) The third helix of the Antennapedia homeodomain translocates through biological membranes., J. Biol. Chem. 269(14) 10444-50), tansportan (M. Pooga et al., (1998) Cell penetration by transportan, FASEB J. 12, 67-77), hCT variant (human calcitonin) (J. Hoyer et al., (2012) Knock-down of a G protein-coupled receptor through efficient peptide-mediated siRNA delivery, J. Control. Release Off. J. Control. Release Soc. 161(3), 826-834), RICK (A. Vaissiere et al., (2017) A retro-inverso cell-penetrating peptide for siRNA delivery, J Nanobiotechnology. 15(1), 34), or C6M1 (M. Jafari et al., (2014) Serum stability and physicochemical characterization of a novel amphipathic peptide C6M1 for siRNA delivery, PLoS ONE. 9(5):e97797).

[0005] There are two main methods to vectorize oligonucleotides using CPPs: by directly conjugating oligonucleotides to CPPs (covalent conjugation method) and by forming non-covalent conjugates between CPPs and oligonucleotides (nanoparticle-based method). The formation of non-covalent nanoparticles (NPs) is particularly effective in CPP-mediated delivery of oligonucleotides that have multiple negative charges and can therefore form electrostatic complexes with cationic peptides. Moreover, peptide-based nanoparticles are a one-step process that is very easy to implement, since they do not require chemical modification to allow the assembly of NPs. Thus, the formation of electrostatic complexes has become the most common method for CPP-mediated siRNA delivery.

[0006] However, to date, the NPs developed have shown several drawbacks, including low stability, low membrane permeability, low effective silencing ability of target genes, cytotoxicity, and so on.

[0007] Therefore, there is still a need for improved cell membrane-permeable peptides that overcome the above limitations, particularly cell membrane-permeable peptides that allow efficient delivery of compounds, such as therapeutic agents, to target cells without significant cytotoxicity and / or immunogenicity. Summary of the Invention

[0008] By studying previously developed CPPs and their shortcomings, the inventors have identified three essential amino acids that must be present at specific positions in the sequence to positively affect peptide solubility, secondary structure, low cytotoxicity, and high uptake efficiency. More specifically, the inventors have developed a novel CPP consisting exclusively of leucine (L), arginine (R) and tryptophan (W) residues, which at least partially overcomes the shortcomings of conventional CPPs. In the novel short amphipathic peptides, also called WRAP for W- and R-rich Amphipathic Peptide, the tryptophan residues can be distributed throughout the sequence or clustered in one domain of the sequence. The peptides of the present invention generally exhibit higher overall transfection efficiency and a lower degree of cytotoxicity.

[0009] It is therefore an object of the present invention to provide a non-naturally occurring peptide comprising the amino acid sequence LL-[X]-LL, where X is selected from R, L and W, n=10-12, and [X] comprises 4 R, 4 L, and 2-4 W.

[0010] In one embodiment, the peptide comprises the amino acid sequence LL-[X]m-RLL, where m=9-11.

[0011] In one embodiment, [X]n or [X]m contains 2 to 4 W present either clustered or dispersed throughout the amino acid sequence.

[0012] Alternatively or additionally, [X]n or [X]m may comprise at least one cluster of LL, preferably two clusters of LL.

[0013] In one embodiment, the peptide comprises LLWRLWRLLWRLWRLL (SEQ ID NO:1 - CPP1), LLRLLRWWWRLLRLL (SEQ ID NO:2 - CPP2), LLRLLRWWRLLRLL (SEQ ID NO:3 - CPP3), and LLRLLRWWWWRLLRLL (SEQ ID NO:4 - CPP4) The amino acid sequence may be selected from the group consisting of:

[0014] The peptides of the present invention are particularly useful as cell membrane penetrating peptides (CPPs). The peptides of the present invention are suitable for penetrating the plasma membrane of mammalian cells and for use as transfection reagents.

[0015] A further object of the present invention is to provide a nanoparticle comprising the peptide of the present invention and a cargo molecule. The cargo molecule may be selected from the group consisting of a nucleic acid, a peptide, a protein, a lipid, a small molecule, a pharmaceutical active substance, and any mixture thereof. Preferably, the cargo molecule is a nucleic acid selected from the group consisting of a DNA molecule, an RNA molecule, a PNA molecule, a siRNA molecule, a PMO molecule, an antisense molecule, an LNA molecule, an mcDNA molecule, an miRNA molecule, a CRISPR / Cas9 molecule, a plasmid, a ribozyme, an aptamer, a spiegelmer, and a decoy molecule.

[0016] The nanoparticles of the present invention may be used for the manufacture of a pharmaceutical composition. The present invention also provides a pharmaceutical composition comprising the nanoparticles and a pharma- ceutically acceptable carrier.

[0017] Another object of the present invention is to provide a method for delivering a cargo molecule to cells in vitro and / or to tissues and / or organs ex vivo, comprising the step of contacting said cells with nanoparticles of the present invention comprising said cargo molecule.

[0018] The nanoparticles of the invention may also be used in a method of delivering a cargo molecule in an animal comprising administering to the animal a nanoparticle of the invention comprising the cargo molecule. [Brief description of the drawings]

[0019] [Figure 1]PEPstrMOD prediction of the 3D structure of the amphipathic peptide used in hydrophilic conditions. Surface and ribbon representation of the peptide. The surface representation shows two views, one along the axis from N-terminus to C-terminus and one rotated by 90 degrees to confirm the amphipathic nature. Tryptophan residues are shown in red, arginines in blue, and the rest in yellow. [Diagram 2] Assessment of the ability of peptide amphiphiles to form complexes in the presence of siRNA. (A) Preformed CPP:siRNA complexes were analyzed by electrophoresis on an agarose gel (1% wt / vol) stained with GelRed. Data represent the mean ± SD for n=3. (B) Transmission electron microscopy (TEM) images of CPP1 and CPP2-based nanoparticles. Images of CPP:siRNA nanoparticles in ultrapure water (R=20, 40 μM CPP). Scale bars correspond to 500 nm and 100 nm in the enlarged images. [Diagram 3] Evaluation of the ability of amphiphilic peptides to form complexes in the presence of plasmids. A) Graph showing migration of plasmid pGL3 in an agarose gel. Preformed CPP:pGL3 complexes were prepared at various charge ratios (CR) and analyzed by electrophoresis on agarose gels (0.5% wt / vol) stained with GelRed. Data represent mean ± SD for n=2. Dose-dependent luciferase expression after CPP2:pGL3 transfection in MEF cells (B) or MCF-7 cells (C). Based on the gel mobility of CPP2:pGL3, nanoparticles were prepared at CR1 and three different plasmid concentrations (62.5 ng, 125 ng and 250 ng). NT = untreated cells. Data represent mean ± SD for n=2. [Figure 4]Cellular evaluation of knockdown effect of CPP:siRNA nanoparticles. (A) Relative Luc activity (%FLuc / NLuc) and relative toxicity (LDH amount) in U87 cells after transfection with CPP:siFLuc complexes at various molar ratios R at a constant siFLuc concentration of 20 nM. (B) Relative Luc activity (%FLuc / NLuc) over the total transfection time (24 and 36 hours) in U87 cells. (C) Relative Luc activity (%FLuc / NLuc) and relative toxicity (LDH amount) in U87 cells after transfection with CPP:siFLuc nanoparticles (constant molar ratio R=20) at various siFLuc concentrations. Lipofectamine® RNAiMAX is used as instructed by the supplier to deliver siFLuc at 20 nM (RNAi lane in the "Control" panel). Abbreviations: R = molar ratio, siFLuc = siRNA FLuc, siSCR = scrambled siRNA, NT = untreated cells, Ctrl = control, nd = not determined. [Diagram 5] Graph showing the concentration-dependent reduction of firefly luciferase expression in U87 cells with siRNA vectored with CPP2 isoform L (CPP2[L]) or isoform D (CPP2[D]). FLuc / NLuc values ​​are normalized to the condition of untreated cells (NT). [Figure 6] Graph showing firefly luciferase silencing depending on the concentration of siRNA vectored by CPP1 or CPP2. For all siRNA concentrations, the delivery method is also effective in the presence of 10% serum (U87 cells). FLuc / Luc values ​​are normalized to the condition of untreated cells (NT). [Figure 7] Graph showing reduction of firefly luciferase expression (U87 cells) assessed by different methods in different laboratories. FLuc / NLuc values ​​are normalized to the condition of untreated cells (NT). [Figure 8]Comparison of CPP:siRNA with C6M1:siRNA or other induced CPPs. (A) Graph showing the knockdown effect of firefly luciferase expression after CPP:siFluc transfection in comparison to C6M1:siFLuc in U87 cells. Incubation conditions: 5000 cells / well, nanoparticles with 200 nM peptide and 10 nM siRNA (vol:vol configuration), incubation time 1 h 30. FLuc / NLuc values ​​normalized to the condition of untreated cells (NT). n=2 independent experiments in triplicate. (B) Graph showing the knockdown effect of firefly luciferase expression after CPP:siFluc transfection (vol:vol configuration) in comparison to induced CPP nanoparticles with mutations at the leucine "doublet" (see Table 1) in U87 cells. Incubation conditions: 5000 cells / well, CPP:siRNA ratio=20:1 at the indicated siRNA concentrations, incubation time 1 h 30. FLuc / NLuc values ​​are normalized to the condition of untreated cells (NT). n=2 independent experiments in triplicate. (C) Graph showing the knockdown effect of firefly luciferase expression after siFluc-loaded CPP:siFluc transfection (dilution preparation) in comparison with induced CPP2 nanoparticles with mutations (see Table 1) in U87 cells. Incubation conditions: 5000 cells / well, CPP:siRNA ratio = 20:1 at the indicated siRNA concentrations, incubation time 1h30. FLuc / NLuc values ​​are normalized to the condition of untreated cells (NT). n=3 independent experiments in triplicate. [Figure 9]Evaluation of CPP1:siRNA and CPP2:siRNA PBN activity. (A) Relative FLuc activity (%) after CPP:siFLuc PBN transfection at the indicated siRNA-FLuc concentrations in various cell lines: U87: human glioblastoma cell line, KB: Hela-derived keratinocyte cell line, HuH7: human hepatoma cell line), RM1: mouse prostate cancer cell line, Neuro2a: mouse neuroblastoma cell line, MCF7: human breast cancer cell line, MDA-MB-231: human breast adenocarcinoma cell line, MEF-RAS: Ras-modified mouse embryonic fibroblasts, A549: human alveolar basal adenocarcinoma cells, HT29: human colon cancer cell line, CMT93: rectal cancer cell line, GL261: mouse glioblastoma cell line. (B) CDK4 silencing after CPP:siRNA nanoparticle transfection at the indicated siRNA-CDK4 concentrations in U87 cells. Abbreviations: siSCR = scrambled siRNA, NT = untreated cells. (C) Comparison of CPP1:siCDK4 nanoparticle activity with that of Lipofectamine® RNAiMAX as an siRNA transfection reagent on endogenous CDK4 protein expression in U87 cells. Black dashed line = no toxicity, red dashed line = dose-dependent toxicity. (D) Colony formation assay to evaluate the cytotoxicity of CPP2 nanoparticles compared to Lipofectamine® RNAiMAX. Different CPP2:siRNA nanoparticles (ratio 20, siRNA concentration 50 nM) were incubated with MEF-Ras cells (14 days) and compared to CPP2 peptide alone (100 nM) or RNAi:siRNA (siRNA concentration 20 nM) conditions. (E) CDK4 silencing after CPP:siRNA nanoparticle transfection in U87 cells after 3 days of culture with a single dose of siCDK4 (20 nM), two doses of siCDK4 (20 nM + 20 nM), or three doses of siCDK4 (20 nM + 20 nM + 20 nM). Abbreviations: siSCR = scrambled siRNA, NT = untreated cells. [Figure 10]Internalization kinetics of CPPP:siRNA nanoparticles. (A) Relative FLuc activity (%) after CPP:siFLuc nanoparticle transfection at 20 nM siRNA-FLuc concentration with different incubation times (min) in U87 cells. (B) CDK4 silencing after CPP:siRNA nanoparticle transfection at 20 nM siRNA-CDK4 concentration with different incubation times (min) in U87 cells. (C) Images of intracellular distribution of Cy5-labeled siRNA vectored with CPP1 or CPP2 nanoparticles (siRNA-Cy5=20 nM, R=20) in live cells of U87 cell line. Nuclei were labeled with Hoechst 33342 dye. White bar represents 20 μm. (D) Comparison of CPP1:siRNA-Cy3b and CPP2:siRNA-Cy3b internalization kinetics by spinning disk (siRNA-Cy3b=20nM, R=20). Images were recorded every 5 seconds for 1200 seconds. The percentage of the mean gray value was then plotted against time (mean ± SD; 2–5 individual counted cells from 2–3 independent experiments). [Figure 11] Nanoparticles induced a decrease in firefly luciferase expression in xenograft mouse tumor models in vivo. (A) Images showing dual bioluminescence (Fluc and Nluc) and tumor fluorescence (U87-CMV-Fluc-CMV-iRFP-IRES) at the indicated time points after injection of CPP2 nanoparticles:siFluc. (B) Quantitative analysis of Fluc and Nluc luciferase directly after intratumoral injection of CPP2 nanoparticles:siFluc (15 μg siRNA). Statistical analysis (mean ± SEM, n=11): One-way ANOVA and Dunnett's post-test against 0 h (=control), *p<0.05. (C) Quantitative analysis of Fluc mRNA directly after intratumoral injection of CPP2 nanoparticles:siFluc (20 μg siRNA). Statistical analysis (mean ± SD, n=4): t-test against 0 h (=control), ***p=0.0009. Fluc mRNA levels are expressed as the ratio of GAPDH protein to GAPDH mRNA (Fluc / GAPDH). [Figure 12]Vectorization of siRNA cocktails by CPP nanoparticles. (A) Co-transfection of two siRNAs by PBN: [CPP2:siCDK4 / siCycB1] mixture shows a dose-dependent reduction in endogenous CDK4 and cyclin B1 protein expression in U87 cells. (B) Transfection of various amounts of two siRNAs by PBN: [CPP1:siCDK4 / siCycB1] mixture shows an inverse proportional reduction in endogenous CDK4 and cyclin B1 (U87 cells) protein expression with respect to the amount of each siRNA. [Figure 13] Development of multiply grafted nanoparticles. (A) Dose-dependent relative FLuc activity (%) after siFluc transfection with RGD-Ahx-CPP2 peptide (R-CPP2, R=20). (B) CPP2:RGD-Ahx-CPP mixtures (CPP2:R-CPP2 ratios of 100%:0% or 0%:100%) did not affect the silencing of Fluc luciferase activity (R=20 at 20 nM siFluc). (C) Effect of PEGylation rate of CPP1 nanoparticles on Fluc luciferase activity (R=20 at 20 nM siFluc). (D) Effect of multiply grafted CPP2 nanoparticles on Fluc luciferase activity (R=20 at 20 nM siFluc). (E) Schematic representation of peptide nanoparticles produced by simple mixing of different components. [Figure 14] Figure 1. Firefly luciferase silencing in U87 cells according to the applied preparation conditions. U87 cells were seeded in P96-well plates (5000 cells / well). Nanoparticles were prepared in "vol:vol" conditions (final concentrations CPP:siRNA 100nM:5nM; 200nM:10nM and 400nM:20nM) or at high concentration (CPP[10μM]:siRNA[0.5μM]) and subsequently diluted (= "diluted" conditions). Incubation time of nanoparticles was 1h30 in serum-free medium. After addition of serum, cells were incubated for 36h before luciferase assay. FLuc / NLuc values ​​normalized to the condition of untreated cells (NT). n=2 independent experiments in triplicate. [Figure 15]Evaluation of CPP1:siRNA and CPP2:siRNA PBN activity on cell suspensions. (A) Dose-dependent relative FLuc activity (%) after CPP:siFLuc nanoparticle transfection in U87 cell suspensions (siRNA = 10 nM, 20 nM and 50 nM). Incubation conditions: 10000 cells / well, CPP:siRNA ratio 20:1 at the indicated siRNA concentrations, incubation time 1.5 h in serum-free medium. FLuc / NLuc values ​​normalized to the condition of untreated cells (NT). Abbreviations: siSCR = scrambled siRNA, siFLuc = firefly luciferase specific siRNA. n = 2 independent experiments in triplicate. (B) Dose-dependent relative FLuc activity (%) after CPP:siFLuc nanoparticle transfection in U87 cell suspensions (siRNA = 10 nM, 20 nM and 50 nM). Incubation conditions: 10000 cells / well, CPP:siRNA ratio 20:1 at the indicated siRNA concentrations, incubation time 1.5 h in 10% serum-containing medium. FLuc / NLuc values ​​normalized to the condition of untreated cells (NT). Abbreviations: siSCR = scrambled siRNA, siFLuc = firefly luciferase-specific siRNA. n = 2 independent experiments in triplicate. (C) Dose-dependent relative FLuc activity (%) after CPP:siFLuc nanoparticle transfection in U937 human macrophage suspensions stably transfected with firefly luciferase (siRNA = 10 nM, 20 nM and 50 nM). Incubation conditions: 10000 cells / well, CPP:siRNA ratio 20:1 at the indicated siRNA concentrations (or siRNA alone), incubation time 1.5 h in serum-free medium. FLuc normalized to the condition of untreated cells (NT). n = 2 independent experiments in triplicate. [Figure 16]Evaluation of MBBO and plasmid co-transfection in the context of cystic fibrosis. (A) Preformed CPP1:MBBO complexes were analyzed by electrophoresis on agarose gels (1% wt / vol) stained with GelRed. Data represent the mean ± SD for n=2. (B) Measurement of the average size of CPP1:MBBO complexes (R=5, 10 μM CPP1) by dynamic light scattering (DLS). (C) Bronchial Beas-2b cells were transfected with 1 μg of CFTR-encoding plasmid using Lipofectamin™ RNAiMAX, JetPEI® (PJ) or CPP2, and with 100 nM MBBO using RNAiMAX or CPP1. The amount of CFTR transcript and housekeeping gene GAPDH was measured by qPCR. CFTR values ​​were first normalized to GAPDH and then to the control condition using MBBO without 3'-UTR binding (MBBO-Ctrl=1). DETAILED DESCRIPTION OF THE PREFERRED EMBODIMENTS

[0020] definition As used herein, the term "peptide" or "peptide molecule" refers to any naturally occurring or non-naturally occurring (e.g., produced by chemical synthesis or recombinant DNA technology) linear polymer comprising multiple natural or modified amino acid residues linked by peptide bonds.

[0021] The term "amino acid residue" as used herein refers to any of the 20 "standard" amino acids that naturally constitute peptides. Amino acids are represented herein by one-letter or three-letter codes according to the following nomenclature: A: alanine (Ala); C: cysteine ​​(Cys); D: aspartic acid (Asp); E: glutamic acid (Glu); F: phenylalanine (Phe); G: glycine (Gly); H: histidine (His); I: isoleucine (Ile); K: lysine (Lys); L: leucine (Leu); M: methionine (Met); N: asparagine (Asn); P: proline (Pro); Q: glutamine (Gln); R: arginine (Arg); S: serine (Ser); T: threonine (Thr); V: valine (Val); W: tryptophan (Trp); and Y: tyrosine (Tyr). Amino acid residues in the peptides of the invention typically exist as L- or D-forms. As used herein, the term "unnatural amino acid residue" refers to a non-encoded or non-proteinogenic amino acid that is not naturally encoded or found in the genetic code of an organism. As used herein, the term "modified amino acid residue" refers to a non-standard amino acid, such as an amino acid that has been post-translationally modified. Examples of post-translational modifications include phosphorylation, glycosylation, acylation (e.g., acetylation, myristoylation, palmitoylation), alkylation, carboxylation, hydroxylation, glycosylation, biotinylation, ubiquitination, alterations in chemical properties (e.g., β-elimination, deimidation, deamidation), and structural alterations (e.g., formation of disulfide bridges).

[0022] Cell membrane penetrating peptides The present invention relates to novel non-naturally occurring peptides comprising the amino acid sequence LL-[X]-LL, where X is selected from R, L and W, n=10-12, and [X] contains 4 R, 4 L, and 2-4 W, preferably 3-4 W.

[0023] The inventors have surprisingly found that said peptides, referred to herein as the peptides of the invention, are suitable to act as cell membrane penetrating peptides (CPPs) and are therefore capable of delivering cargo molecules into the cytoplasm of a cell, preferably across the plasma membrane of a mammalian cell.

[0024] The peptides of the invention have a length of 14-16 amino acid residues, all selected from R, L and W. The inventors have discovered that a certain distribution of such three amino acid residues in the amino acid sequence of the peptide results in peptides of particular interest as CPPs. Indeed, the peptides have a high capacity to be taken up by cells and do not exhibit significant cytotoxic and / or immunogenic effects on the target cells after internalization (i.e., the peptides do not impair the viability of the cells, at least at concentrations sufficient to mediate the transfection and / or penetration of the cells). The expression "not significant" as used herein is understood to mean that less than 30%, in particular less than 20% or 10% of the target cells die after internalization of the peptides of the invention. Methods for measuring the cytotoxicity of a compound and / or the viability of the target cells to which such a compound has been applied are known to the skilled person (see also, for example, Ausubel, FM et al. (2001) Current Protocols in Molecular Biology, Wiley & Sons, Hoboken, NJ, USA).

[0025] The term "ability to be taken up by a cell" as used herein refers to the ability of a peptide to pass through the membrane of a cell (i.e., plasma membrane), endosomal membrane, and membrane of the endoplasmic reticulum) and / or to cause the passage of a cargo molecule through the membrane of such a cell (i.e., its transfection potential). A peptide having the ability to pass through the membrane of the cell is referred to herein as a "cell membrane penetrating peptide" or "CPP". Numerous methods are established in the art for determining the internalization behavior and / or transfection ability of a peptide, for example, by attaching a detectable label (e.g., a fluorescent dye) to the peptide (and / or the cargo molecule to be transfected) or fusing the peptide with a reporter molecule, thereby allowing detection, for example, by FACS analysis or specific antibodies, when cellular uptake of the peptide occurs (see, for example, Ausubel, FM et al. (2001) Current Protocols in Molecular Biology, Wiley & Sons, Hoboken, NJ, USA). The skilled artisan will also recognize how to select the peptide to use in such methods, and, if applicable, the concentration range of the cargo, which may depend on the nature of the peptide, the size of the cargo, the type of cell used, etc.

[0026] In one embodiment, the peptide of the invention comprises the amino acid sequence LL-[X]m-RLL, where m=9-11.

[0027] Preferably, [X]n or [X]m comprises a cluster consisting of WW, WWW or WWWW. Preferably, such a cluster is central, i.e. there is an equal number of amino acid residues following each end of the tryptophan cluster.

[0028] In one embodiment, [X]n or [X]m comprises at least one cluster consisting of LL, preferably two clusters consisting of LL.

[0029] Preferably, the peptides of the invention have a net positive charge of 5.

[0030] In one embodiment, the peptide comprises LLWRLWRLLWRLWRLL (SEQ ID NO: 1), LLRLLRWWWRLLRLL (SEQ ID NO:2), LLRLLRWWRLLRLL (SEQ ID NO:3), and LLRLLRWWWWRLLRLL (SEQ ID NO:4) The amino acid sequence may be selected from the group consisting of:

[0031] In one embodiment, the peptide comprises an L-amino acid, a D-amino acid, an unnatural amino acid, a modified amino acid, a cysteamide, a thiol, an amide, a carboxyl, an optionally substituted linear or branched C1-C6 alkyl, a primary or secondary amine, covalently attached to the C-terminus of said amino acid sequence. Osid and / or the peptide further comprises one or more components selected from among derivatives, lipids, phospholipids, fatty acids, cholesterol, polyethylene glycol, nuclear localization signals and / or targeting molecules, and / or the peptide further comprises one or more components selected from among L-amino acids, D-amino acids, non-natural amino acids, modified amino acids, amines, acetyl, optionally substituted linear or branched C1-C6 alkyl, primary or secondary amines, Osid The composition further comprises one or more chemical moieties selected from among derivatives, lipids, phospholipids, fatty acids, cholesterol, polyethylene glycol, nuclear localization signals and / or targeting molecules.

[0032] Nanoparticles The present invention further provides a nanoparticle comprising at least one peptide of the present invention complexed with at least one cargo molecule. Such cargo molecule can be any cargo molecule defined herein. In one embodiment, the nanoparticle can comprise more than one peptide of the present invention. In particular, the nanoparticle can comprise multiple peptides, which are the same or different. Also, the nanoparticle can comprise more than one cargo molecule. In particular, the nanoparticle can comprise multiple cargo molecules, which are the same or different.

[0033] Preferably, the size of the nanoparticles is from 50 to 300 nm, preferably from 100 to 200 nm.

[0034] In one embodiment, the complex between the peptide and the cargo molecule may be formed based on non-covalent bonds, which may be ionic bonds, hydrogen bonds or hydrophobic interactions, or a combination thereof.

[0035] Alternatively, the conjugate between the peptide and the cargo molecule may be formed by a covalent bond. Such a covalent bond is preferably formed between a suitable reactive group of the peptide and the cargo, more preferably between the terminus of the peptide of the present invention and the cargo molecule. Depending on the chemical nature or cargo molecule, the moiety or group that forms such a covalent bond will vary, and such a bond is within the skill of the art.

[0036] Preferably, the cargo molecule is selected from the group consisting of nucleic acids, peptides, proteins, lipids, small molecules, pharma- ceutical active agents, and any mixtures thereof.

[0037] The peptide of the present invention is particularly suitable for complexing with nucleic acid molecules.Therefore, one object of the present invention is to provide nanoparticles comprising the peptide of the present invention and a nucleic acid molecule selected from the group consisting of DNA molecules, RNA molecules, PNA molecules, siRNA molecules, PMO molecules, antisense molecules, LNA molecules, mcDNA molecules, miRNA molecules, CRISPR / Cas9 molecules, plasmids, ribozymes, aptamers, spiegelmers and decoy molecules, or any mixture thereof.

[0038] The term "miRNA molecule" (or "miRNA") as used herein refers to an endogenous RNA molecule derived from a gene locus that is processed from a transcript capable of forming a local RNA precursor miRNA structure. Mature miRNAs are usually 20, 21, 22, 23, 24 or 25 nucleotides in length, but can also exist with other numbers of nucleotides, e.g., 18, 19, 26 or 27 nucleotides.

[0039] As used herein, the term "shRNA molecule" (i.e., short hairpin RNA molecule) refers to an artificial single-stranded interfering RNA molecule that contains both the sense and antisense strands of an "siRNA duplex" in a stem-loop or hairpin structure, where the stem of the hairpin structure is typically 19-29 nucleotides in length and the loop is typically 4-15 nucleotides in length.

[0040] The term "siRNA molecule" refers to a short interfering RNA against a target nucleic acid, preferably an mRNA, that codes for a target molecule. siRNA is a double-stranded RNA, typically having a length of about 21-23 nucleotides. The sequence of one of the two RNA strands corresponds to the sequence of the target nucleic acid to be degraded. Thus, knowing the nucleic acid sequence, preferably the mRNA sequence, of a target molecule, a double-stranded RNA can be designed in which one of the two strands is complementary to the mRNA of the target molecule, and applying the siRNA to a system containing the gene can degrade the corresponding target nucleic acid, thus reducing the level of the corresponding protein.

[0041] The term "ribozyme" refers to a catalytically active nucleic acid, preferably consisting essentially of RNA, which comprises two moieties: the first part exhibits catalytic activity and the second part is involved in specific interaction with a target nucleic acid.

[0042] The term "aptamer" refers to single- or double-stranded D-nucleic acids that specifically interact with target molecules. Aptamers are currently used as therapeutic agents.

[0043] The term "spiegelmer" refers to L-nucleic acids, i.e. composed of L-nucleotides. Spiegelmers are characterized by the fact that they have a very high stability in biological systems and show a specific interaction with the intended target molecule, comparable to aptamers.

[0044] In another embodiment, the cargo molecule is a peptide consisting of at least two amino acids covalently linked by a covalent bond, preferably a peptide bond. In one embodiment, the peptide consists of L-amino acids, D-amino acids, unnatural amino acids, or mixtures thereof. Alternatively, the cargo molecule is a protein.

[0045] In another embodiment, the cargo molecule is a small molecule, preferably with a molecular weight of 1000 Da or less. In particular, the small molecule is a drug or a drug candidate.

[0046] In another embodiment, the cargo molecule is a pharma- ceutical active agent.

[0047] In another embodiment, the cargo molecule is a lipid.

[0048] In another embodiment, the cargo molecule is an antibody or a protein.

[0049] Pharmaceutical Compositions A further object of the present invention is to provide a pharmaceutical composition comprising the nanoparticles of the present invention (i.e. at least one peptide conjugated to at least one cargo molecule) and one or more pharma- ceutically acceptable carriers. Indeed, the nanoparticles of the present invention may be advantageously used for the manufacture of pharmaceutical compositions.

[0050] The term "pharmaceutical composition" used herein refers to a composition for administration to a subject, preferably a human patient.The pharmaceutical composition of the present invention includes any pharmaceutical dosage form established in the art, such as capsule, microcapsule, cachet, pill, tablet, powder, pellet, multiparticulate formulation (e.g., beads, granules or crystals), aerosol, spray, foam, solution, dispersion, tincture, syrup, elixir, suspension, water-in-oil emulsion (e.g., ointment), and oil-in-water emulsion (e.g., cream, lotion, balm, skin patch, drops, paste, and suppository.

[0051] Pharmaceutical compositions of the present invention include formulations suitable for oral, rectal, nasal, topical (including buccal and sublingual), peritoneal and parenteral (including intramuscular, subcutaneous and intravenous) administration, or by inhalation or insufflation. Administration can be local or systemic.

[0052] Another aspect of the invention is the use of said nanoparticles as medicines and as markers or imaging agents.

[0053] The present invention also relates to a method of delivering a molecule to a cell in vitro, comprising contacting said cell with said nanoparticles or pharmaceutical composition.The present invention also relates to a method of delivering a molecule to a tissue and / or organ ex vivo, comprising contacting said tissue and / or organ with said nanoparticles or pharmaceutical composition.

[0054] A method according to the present invention, comprising an administration step of contacting said animal with a nanoparticle comprising a cargo molecule according to any one of claims 13 to 17, said nanoparticle delivering said cargo molecule in vivo.

[0055] For example, the present disclosure provides the following embodiments. [1] A non-naturally occurring cell membrane-permeable peptide having a length of 14 to 16 amino acid residues, comprising the amino acid sequence LL-[X]n-LL, where X is selected from R, L and W, and n=10 to 12, and [X]n includes 4 R, 4 L, and 2 to 4 W. [2] The peptide according to 1 above, comprising the amino acid sequence LL-[X]m-RLL, where m is 9 to 11. [3] The peptide according to claim 1 or 2, wherein [X]n or [X]m comprises a W motif present in a cluster or dispersedly. [4] The peptide according to any one of 1 to 3 above, wherein [X]n or [X]m contains at least one, preferably two, clusters consisting of LL. [5] The peptide according to any one of 1 to 4, comprising an amino acid sequence selected from LLWRLWRLLWRLWRLL (sequence number 1), LLRLLRWWWRLLRLL (sequence number 2), LLRLLRWWRLLRLL (sequence number 3), and LLRLLRWWWWRLLRLL (sequence number 4). [6] The peptide according to any one of 1 to 5 above, wherein the peptide contains L-amino acids and / or D-amino acids. [7] The peptide according to any one of 1 to 6 above, wherein the peptide has a net positive charge of 5. [8] The peptide according to any one of 1 to 7 above, wherein the peptide further comprises one or more moieties selected from L-amino acids, D-amino acids, non-natural amino acids, cysteamide, thiol, amide, carboxyl, optionally substituted linear or branched C1-C6 alkyl, primary or secondary amines, osidic derivatives, lipids, phospholipids, fatty acids, cholesterol, polyethylene glycol, nuclear localization signals and / or targeting molecules covalently attached to the C-terminus of the amino acid sequence, and / or the peptide further comprises one or more chemical moieties selected from L-amino acids, D-amino acids, non-natural amino acids, amines, acetyl, optionally substituted linear or branched C1-C6 alkyl, primary or secondary amines, osidic derivatives, lipids, phospholipids, fatty acids, cholesterol, polyethylene glycol, nuclear localization signals and / or targeting molecules covalently attached to the N-terminus of the amino acid sequence. [9] Use of the peptide according to any one of 1 to 8 above as a cell membrane-permeable peptide (CPP).

[10] Use of the peptide according to claim 9, wherein the cell membrane penetrating peptide (CPP) is suitable for penetrating the plasma membrane of a mammalian cell.

[11] Use of the peptide according to any one of 1 to 8 above as a transfection reagent.

[12] A nanoparticle comprising the peptide according to any one of 1 to 8 above and a cargo molecule.

[13] The nanoparticle according to claim 12, wherein the cargo molecule is selected from the group consisting of nucleic acids, peptides, proteins, lipids, small molecules, pharma- ceutical active substances, and any mixtures thereof, preferably a nucleic acid selected from the group consisting of DNA molecules, RNA molecules, PNA molecules, siRNA molecules, PMO molecules, antisense molecules, LNA molecules, mcDNA molecules, miRNA molecules, CRISPR / Cas9 molecules, plasmids, ribozymes, aptamers, spiegelmers and decoy molecules.

[14] The nanoparticle according to claim 12 or 13, wherein the size of the nanoparticle is 50 to 300 nm, preferably 100 to 200 nm, and / or the cargo molecule is bound to the peptide by a covalent or non-covalent bond.

[15] A pharmaceutical composition comprising the nanoparticle according to any one of 12 to 14 above and a pharma- ceutically acceptable carrier.

[16] A method for delivering a cargo molecule to a cell in vitro, comprising the step of contacting the cell with a nanoparticle comprising the cargo molecule as described in any one of 12 to 14 above.

[17] A method for delivering a cargo molecule to a tissue and / or organ ex vivo, comprising the step of contacting the tissue and / or organ with a nanoparticle comprising the cargo molecule as described in any one of 12 to 14 above. Certain aspects of the present invention are further defined in the following examples and illustrated by the figures, which are described in the examples. EXAMPLES

[0056] material and method material Dioleylphosphatidylglycerol (DOPG) and dioleylphosphatidylcholine (DOPC) phospholipids, cholesterol (Chol), and sphingomyelin (SM) were purchased from Avanti Polar Lipids. Large unilamellar vesicles (LUVs) were prepared by extrusion from a lipid mixture of DOPC / SM / Chol (2:2:1) as previously reported (A. Vaissiere et al., (2017) A retro-inverso cell-penetrating peptide for siRNA delivery, J Nanobiotechnology. 15(1), 34).

[0057] Various siRNA sequences (unlabeled and Cy5-labeled) were purchased from Eurogentec. Cy3b-labeled siRNA was purchased from BioSynthesis. The following siRNAs were used: anti-firefly luciferase (siFLuc): 5'-CUU-ACG-CUG-AGU-ACU-UCG-AdTdT-3' (SEQ ID NO: 5) (sense strand) and the corresponding scrambled version of anti-luciferase (siSCR): 5'-CAU-CAU-CCC-UGC-CUC-UAC-UdTdT-3' (SEQ ID NO: 6) (sense strand), as well as anti-cyclin-dependent kinase 4 (siCDK4) siRNA based on 5'-CAG-AUC-UCG-GUG-AAC-GAU-GdTdT-3' (SEQ ID NO: 7) (antisense strand) and a scrambled version: 5'-AAC-CAC-UCA-ACU-UUU-UCC-CAA-dTdT-3' (SEQ ID NO: 8) (antisense strand).

[0058] siRNA stock solutions were prepared in RNase-free water, and peptide stock solutions and CPP:siRNA complexes were prepared as previously described (Konate K, et al. (2016) Optimisation of vectorisation property: a comparative study for a secondary amphipathic peptide. Int J Pharm. 509, 71-84).

[0059] Peptide synthesis and modification Peptides were either purchased from LifeTein or synthesized in the inventors' laboratory using standard Fmoc chemistry and purified by HPLC / MS (purity >95%) (sequences are shown in Table 1). Purified CPPs bearing a cysteine ​​residue at the N-terminus were grafted with a PEG moiety using a 4 molar excess of PEG Maleimide 2000 (Nanocs) for 23 h at room temperature. CPPs bearing aminohexanoic acid as a linker at the N-terminus were grafted with an RGD targeting sequence during synthesis.

[0060] Peptide structure prediction To predict the tertiary structure of WRAP, the PEPstrMOD server was used (http: / / osddlinux.osdd.net / raghava / pepstrmod / ) (H. Kaur, et al., (2007) Protein Pept. Lett. 14, 626-630; S. Singh, et al., (2015) Biol. Direct. 10, 73).

[0061] Circular dichroism (CD) measurements CD spectra were recorded on a Jasco 810 (Japan) circular dichroismometer in a quartz suprasil cell (Hellma) with a path length of 1 mm for the peptides in solution or in the presence of liposomal globules. The peptides were used at the same concentration (40 μM) for each condition. Spectra were obtained from three accumulations between 190 nm and 260 nm with a data pitch of 0.5 nm, a bandwidth of 1 nm, and standard sensitivity.

[0062] Agarose gel shift assay CPP:siRNA complexes were formed in 5% glucose at various ratios and preincubated for 30 min at room temperature. Each sample was analyzed by agarose gel (1% w / v) electrophoresis stained with GelRed (Interchim) for UV detection as described in the literature.

[0063] Dynamic Light Scattering (DLS) and Zeta Potential (ZP) CPP:siRNA nanoparticles were evaluated for average size (Z-average), particle distribution and uniformity (PdI) using a Zetasizer NanoZS (Malvern). Zeta potential was measured in 5% glucose + 5 mM NaCl. All results were obtained from three independent measurements (each measurement was performed in triplicate at 25°C).

[0064] Transmission Electron Microscopy (TEM) For transmission electron microscopy (TEM), a 5 μl drop of the suspension was applied to a carbon-coated 300 mesh grid for 1 min, the liquid removed by dabbing with filter paper, and then a drop of 2% uranyl acetate solution was applied. After 1 min, excess stain was removed by dabbing the edge with filter paper, the grid was dried at room temperature for a few minutes, and examined using a Jeol 1200EX2 transmission electron microscope at an accelerating voltage of 100 kV. Data were acquired using a SIS Olympus Quemesa CCD camera.

[0065] Culture conditions U87MG human glioblastomas (Aldrian G et al., J. Control. Release 2017) stably transfected with plasmids encoding firefly and Nanoluc luciferase (FLuc-NLuc) were cultured in the following complete medium: DMEM supplemented with GlutaMAX™ (Life Technologies), penicillin / streptomycin (Life Technologies), 10% heat-inactivated fetal bovine serum (FBS, PAA), non-essential amino acid NEAA 1X (LifeTechnologies). Additionally, hygromycin B (Invitrogen, 50 μg / ml) was added as an antibiotic for selection.

[0066] A Hela-derived keratinocyte cell line (KB), a mouse neuroblastoma cell line (Neuro2a), a human hepatoma cell line (HuH7), a human breast carcinoma cell line (MCF7), and a human alveolar basal adenocarcinoma cell line (A549) were cultured in the same complete medium without the addition of selection antibiotics.

[0067] A mouse prostate cancer cell line (RM1) was cultured in the same complete medium with the addition of blasticidin S (Invitrogen, 10 μg / mL), and a human colon cancer cell line (HT29), a rectal cancer cell line (CMT93), and a mouse glioblastoma cell line (GL261) were cultured with the addition of hygromycin B (Invitrogen, 1400 μg / ml, 500 μg / ml, and 150 μg / ml, respectively) as the selection antibiotic.

[0068] Human breast adenocarcinoma (MDA-MB-231) was cultured in the same complete medium supplemented with G418 (Invitrogen, 100 μg / ml) selection antibiotic.

[0069] The immortalized human bronchial epithelial cell line BEAS-2B, obtained from ATCC, was cultured in Dulbecco's modified Eagle's medium (DMEM, Fisher Scientific) supplemented with 5% fetal bovine serum (FBS) (Eurobio), 1% Ultroser G (Pall BioSepra), 1% antibiotic-antimycotic (Life Technologies SAS) and 1% L-glutamine (Life Technologies SAS). T-large immortalized mouse embryonic fibroblasts (MEFs) were cultured in DMEM / F12 medium (Life Technologies) supplemented with penicillin / streptomycin (Life Technologies) and 10% heat-inactivated fetal bovine serum (FBS, PAA).

[0070] All cells were maintained in a humidified incubator at 5% CO2 and 37°C.

[0071] Cell culture and transient transfection 200000 Beas-2b cells were seeded in 6-well plates as described in the literature (Viart V et al. Eur Respir J. 2015). Cells were transfected with 1 μg pm-cDNA-CFTR-3'UTR using JetPEI® or CPP2, and with 100 nM MBBO using RNAiMAX or CPP1.

[0072] RNA extraction and RT-qPCR Total RNA was extracted, reverse transcribed and amplified as described (Viart V et al. Eur J Hum Genet 2012). Reverse transcription was performed with 1 μg of total RNA and MMLV reverse transcriptase, and qPCR was performed with a 1:10 dilution of first strand DNA. Relative expression levels were calculated by the comparative DDCt method with GAPDH mRNA as an endogenous control.

[0073] Colony formation assay MEF cells were seeded in 6-well plates (250 cells / well). 24 h after seeding, cells were incubated with nanoparticles (R=20, 50 nM siRNA) for 14 days. For colony visualization, cells were fixed with a solution of methanol:acetic acid (3:1) for 20 min at 4°C and labeled with a solution of Giemsa (Sigma Aldrich) / H2O (3.5:10) for 20 min at room temperature. Residual staining solution was removed with water and plates were allowed to dry for several hours. Each well was photographed and total colonies were counted.

[0074] Transfection experiments For luciferase assay, various cells (5000 cells / well) were seeded in 96-well plates with the corresponding medium described above 24 hours before the experiment. The next day, nanoparticles were formed by mixing siRNA and CPP (equal volume) in 5% glucose water and then incubating at 37°C for 30 minutes ("siRNA on CPP"). Meanwhile, the growth medium covering the cells was replaced with 70 μl of fresh serum-free DMEM pre-warmed. 30 μl of nanoparticle solution was added directly to the cells and incubated at 37°C for 1.5 hours. After the addition of DMEM supplemented with 20% FBS (FBS final concentration = 10%), the cells were incubated for another 36 hours and finally lysed for luciferase detection. For transfection in the presence of serum, the cells were incubated with nanoparticles in DMEM + 10% FBS for 1.5 hours at 37°C, then DMEM supplemented with 10% FBS was added to the cells and incubated for another 36 hours and finally the cells were lysed for luciferase detection.

[0075] For Western blot assay, U87 cells were seeded at 75000 cells / ml in each well of a 24-well plate 24 hours prior to the experiment using the corresponding medium as described above. For standard incubation, cells were incubated with 175 μl pre-warmed fresh serum-free DMEM + 75 μl nanoparticle solution. After 1.5 hours of incubation, 250 μl DMEM + 20% FBS was added to each well without removing the transfection reagent, and cells were incubated for another 24 hours. The experimental procedure was designed to test peptide:siRNA nanoparticles with siRNA concentrations of 5, 10 and 20 nM in a final volume of 500 μl, with a peptide:siRNA molar ratio of R = 20. After the addition of DMEM + 20% FBS (FBS final concentration 10%), cells were incubated for another 24 hours and finally lysed for CDK4 Western blot detection.

[0076] For microscopy experiments, 300,000 U87 cells were seeded on glass-bottom dishes (FluoroDish, World Precision Instruments) 24 hours before imaging. Before the experiment, the cells were washed twice with D-PBS and covered with 1600 μl of complete medium. Then, 400 μl of NPs (peptide:siRNA; R=20, siRNA=20 nM) prepared in 5% glucose water solution were added directly to the cells.

[0077] Measurement of cytotoxicity Nanoparticle-induced cytotoxicity was measured in 50 μl of supernatant using the Cytotoxicity Detection Kit. Plus (LDH, Roche Diagnostics) was used according to the manufacturer's instructions.

[0078] Luciferase reporter gene silencing assay siRNA delivery using the different vectors was assessed by measuring the residual firefly luciferase (FLuc) activity in cell lysates. Briefly, after 36 h, the medium covering the cells was carefully removed and replaced with 50 μl of 0.5X Passive Lysis Buffer (PLB; Promega). After shaking for 30 min at 4°C, the plate with cells was centrifuged (10 min, 1800 rpm, 4°C) and 5 μl of each cell lysate supernatant was finally transferred to a white 96-well plate. For U87-FLuc-NLuc cells, both luciferase activities were quantified in a plate-reading luminometer (POLARstar Omega, BMG Labtech) using the dual luciferase assay reagent (Promega) diluted in half as described in the literature (G. Aldrian, et al., (2017) J. Control. Release Off. J. Control. Release Soc. 256, 79-91). Results were first normalized to untreated cells (%FLuc and %NLuc) and then expressed as a percentage of the relative light units (RLU) for each luciferase normalized to the %NLuc value to obtain relative Luc activity (%FLuc / %NLuc).

[0079] For other cell lines with only Fluc expression, luciferase activity was quantified in a plate-reading luminometer using half-diluted luciferase assay reagent (Promega). Results were expressed as a percentage of relative light units (RLU) normalized to untreated cells (%Fluc).

[0080] Western blotting Transfected cells were washed with PBS and lysed in RIPA buffer [50 mM Tris pH 8.0, containing 150 mM sodium chloride, 1% Triton X-100, 0.1% SDS (sodium dodecyl sulfate, Sigma-Aldrich), protease inhibitors (SigmaFAST, Sigma-Aldrich)]. Cells were incubated with 130 μl / 24 wells of lysis buffer for 5 min on ice. Cells were then scraped and transferred to 1.5 ml tubes. After 5 min on ice, cell lysates were centrifuged (10 min, 13400 rpm, 4°C), supernatants were collected, and protein concentrations were measured by Pierce BCA protein assay (ThermoFisher). Cell extracts (0.25–0.38 μg / μl) were resolved on 4–20% Mini-PROTEAN® TGX™ precast gels (Bio-Rad). After electrophoresis, the samples were transferred to Trans-Blot® Turbo™ Mini PVDF membrane (Bio-Rad). Antibodies used were anti-cyclin B1 mouse mAb V152, anti-CDK4 rabbit mAb D9G3E, anti-vinculin rabbit mAb E1E9V, anti-mouse IgG HRP, and anti-rabbit IgG HRP (all from Cell Signaling). Blots were displayed using Pierce ECL plus Western blotting substrate (ThermoFisher) on an Amersham Imager 600 (GE Healthcare Life Science). The signal intensity of the blots was quantified by Image J.

[0081] Confocal microscopy For cell imaging by confocal microscopy, an inverted LSM780 multiphoton microscope (Zeiss) was used. After NP addition, cells were incubated for 1 h in a humidified incubator at 5% CO2 and 37 °C. Ten minutes before the end of incubation, Hoechst 33342 dye was added to the cells for nuclear labeling. Then, cells were washed twice with D-PBS and covered with FluoroBrite DMEM medium (Life Technologies). Confocal images were displayed and processed with ImageJ software.

[0082] For spinning disk experiments, an inverted microscope (Nikon Ti Eclipse) coupled with a spinning disk (ANDOR) system was used to study the kinetics of NPs internalization inside living cells. After addition of NPs, cells were kept at 37 °C in a cage incubator (Okolab) and images were recorded directly every 5 s for 1200 s with an EM-CCD camera (iXon Ultra) and projected using Andor IQ3 software. Control experiments were performed to ensure that no emission bleed-through was observed between the different channels. All images were processed with ImageJ software.

[0083] In vivo mouse experiments Immunodeficient NOG (NOD / SCID / IL-2Rγnull) mice aged 6–10 weeks were housed in the University of Bordeaux animal facility. Mice were maintained under specific pathogen-free conditions and kept under standard conditions with a 12-h light / dark cycle with free access to water and food. Anesthesia was achieved with 2% isoflurane in air (Belamont, Nicholas Piramal Limited, London, UK). The area of ​​the mice to be imaged was pre-shaved using clippers and hair removal cream.

[0084] Inject U87-FRT-CMV-Fluc-CMV-Nluc cells (2 × 10 6 Subcutaneous tumors were generated by injection of 100 μL of cells / 100 μL PBS. Subcutaneous tumors were imaged 4 weeks after implantation.

[0085] mRNA extraction and quantitative RT-PCR Total mRNA was isolated from U87 cells using Trizol (Thermo Fisher Scientific). cDNA synthesis was performed using 1 mg of total RNA using NucleoSpin RNA (Macherey-Nagel). Quantitative PCR was performed using Fast SYBR Green Master Mix (Invitrogen) using MyIq Quantitative (Bio-Rad). Primers for Fluc amplification were: Fluc-Fw: TCCATTCCATCACGGTTTTGG (SEQ ID NO: 9), Fluc-Rv: GCTATGTCTCCAGAATGTC (SEQ ID NO: 10), GAPDH-Fw: GCCAAGGTCATCCATGACAAC (SEQ ID NO: 11), GAPDH-Rv: GAGGAGTGGGTGTCGCTGTTG (SEQ ID NO: 12).

[0086] Reactions were performed in triplicate in three independent experiments. Expression data were normalized to the geometric mean of the housekeeping gene GAPDH to control for variability in expression levels and were multiplied by 2. DDCt The analysis was carried out using the method.

[0087] result 1. Peptide Characterization In this experiment, several amphiphilic peptides were tested and compared for their ability to form peptide-based nanoparticles (PBNs) for the delivery of therapeutic molecules (Table 1). Peptides CPP1-CPP4 belong to the peptides of the present invention and consist of residues of the three amino acids leucine, arginine and tryptophan. The peptides are 15-16 amino acids in length and have a C-terminal portion with an amide group (-CONH2) and an amine (-NH2) at the N-terminal portion. All peptides of the present invention have a net positive charge of +5 alone (or +4 if there is a component coupled to the N-terminal portion).

[0088] [Table 1] Footnote: CPP AA = number of amino acids in the CPP sequence

[0089] To investigate the structural properties of the CPPs, we first performed in silico prediction of the 3D structure of each peptide. The sequences of CPP1-CPP4 were submitted to the PepStrMOD server in a hydrophilic environment. The peptide models generated by PepstrMOD after calculations showed that all peptides adopt an α-helical structure (Figure 1). CPP1 and CPP2 were predicted to adopt a more pronounced helical structure than the other models.

[0090] The predicted structures were then compared to those determined experimentally. Circular dichroism spectra were recorded for the free peptides in solution, then for the peptides in the presence of siRNA, and then after addition of liposomes. As shown in Table 2, all peptides (CPP1, CPP2, CPP3, and CPP4) adopt an α-helical structure in the presence of siRNA molecules, and also in the presence of neutral or negatively charged lipids ("large unilamellar vesicles" (LUVs)).

[0091] [Table 2] Footnote: The random coil (rc) conformation has a positive band at 212 nm and a negative band near 195 nm. The helical conformation is characterized by two maxima at 207 nm and 222 nm and one maximum near 191 nm. The turn-like structure has two maxima at 200 nm and 228 nm. At a CPP:siRNA molar ratio of R20 and a CPP:lipid of r10, the CPP concentration was 40 μM.

[0092] 2. Colloidal properties of amphiphilic peptides The conformational changes exhibited by CD suggested that almost all CPPs interacted with siRNA. To assess siRNA complexation, the formation of CPP:siRNA complexes was examined by agarose shift assay (Fig. 2). siRNA alone could migrate in agarose gel (=100% signal), but when complexed with CPPs, the peptides inhibited oligonucleotide migration in a molar ratio-dependent manner. Apparently, CPP1, CPP2, CPP3 and CPP4 could complex with siRNA in a similar manner, and the complexation was optimal at peptide:siRNA molar ratios of R=20 and R=40.

[0093] The colloidal properties of the CPP:siRNA complexes (5% glucose, R = 20) were characterized in terms of nanoparticle size and uniformity by dynamic light scattering (DLS). Intensity measurements (%) showed that CPP1, CPP2, CPP3 and CPP4 formed PBNs with diameters between 80 nm and 200 nm, with a polydispersity index (PdI) of approximately 0.3 (Table 3). Number-based nanoparticle size distributions (%) suggested the presence of smaller nanoparticles in addition to those indicated by the intensity-based size distributions. The diameters of such smaller particles ranged from 20 nm to 50 nm for the four CPP:siRNA species (Table 3). More importantly, both measured size values ​​did not change significantly after storage at 4 °C for 72 h (data not shown).

[0094] PBNs composed of CPP1:siRNA or CPP2:siRNA have both a positively charged surface (zeta potential measurements, Table 3) and a spherical shape as shown by transmission electron microscopy (FIG. 2B).

[0095] [Table 3] Footnote: All CPP:siRNA complexes were formulated with R=20 and siRNA concentration of 500 nM in 5% glucose in water for average size acquisition and 5% glucose in water with 5 mM NaCl for ZP assessment. n>2 of independent formulations (3 determinations per run). nd: not determined. * ZP measurements were performed in 5% glucose containing 1 mM NaCl.

[0096] 3. Preparation-dependent Effect of siRNA-loaded CPP Nanoparticles The effect of siRNA-loaded CPP nanoparticles, which depends on the applied concentration during preparation, was evaluated. Two different preparations were compared: 1) Dilution conditions: Complexes were prepared at high concentrations (eg, CPP[10 μM]:siRNA[0.5 μM]) and then diluted to give final siRNA concentrations of 5 nM, 10 nM and 20 nM for cell culture assays. 2) Volume: Volume conditions: Solutions of CPP and siRNA were prepared separately and then mixed to give final siRNA concentrations of 5 nM, 10 nM and 20 nM for the cell culture assays.

[0097] The knockdown effect of nanoparticles could be increased depending on the applied preparation procedure, as illustrated by the preparation performed with CPP2 (Figure 14). Dilute conditions seem to induce a higher knockdown effect (2-fold increase). This is particularly interesting for the transfection of cells that are known to be "difficult" to transfect.

[0098] 4. Amphipathic peptides can be used in the preparation of plasmids: CPP1 and CPP2 peptides formed complexes when associated with oligonucleotides such as plasmids (Figure 3). Complex formation was visualized using agarose gels (0.5%) as described above for CPP-siRNA complex formation. Plasmids were complexed with CPPs at a charge ratio (CR) corresponding to a neutral charge (CR=1) between the CPP (positively charged) and the plasmid (negatively charged). The bulky CPP:plasmid complexes could no longer migrate in the agarose gel.

[0099] The intensity of the plasmid band alone was normalized to 100%. Successively increasing CPP:plasmid charge ratios resulted in complexation of the pGL3 plasmid (6.56 kbp) with proportionally reduced migration in agarose gels (0.5%).

[0100] To analyze the transfection capacity of plasmid-loaded CPP nanoparticles, MCF7 (human breast cancer) and MEF (mouse embryonic fibroblast) cells were transfected with a plasmid (pGL3) encoding firefly luciferase. After 24 h of incubation with CPP2:pGL3 (CR=1), cells were lysed and expression of firefly luciferase was quantified by addition of its substrate (Promega kit). As shown in Figures 3B and 3C, a dose-dependent increase in firefly luciferase activity was observed compared to untreated cells, which correlated with increased protein expression.

[0101] In conclusion, BPN could also be used to transfect plasmids, as previously shown with siRNA.

[0102] 5. Characterization of the cellular activity of CPP:siRNA nanoparticles by luciferase screening assay The cellular activity of CPP-based nanoparticles was evaluated in a luciferase screening assay as described in the literature (LN Patel, et al., (2007) Pharm. Res. 24, 1977-1992; A. Elmquist, et al., (2001) Exp. Cell Res. 269, 237-244). The knockdown effect of various CPP:siRNA nanoparticles was performed in a U87 cell line stably transfected for constitutive expression of the FLuc / NLuc reporter gene (U87-FRT-CMV / Fluc-CMV / iRFP-IRES-NLuc).

[0103] We first investigated the optimal molar ratio of peptide to siRNA (at a constant concentration of 20 nM) required for effective luciferase knockdown (Figure 4A). For CPP1, CPP2, CPP3 and CPP4, we observed significant luciferase knockdown of over 70% at R=20, with a small increase at R=40. In parallel, no relative cytotoxicity was observed (LDH measurement) for all nanoparticle treatments.

[0104] Very encouraging firefly luciferase knockdown results were observable 36 h after total transfection, as well as 24 h after total transfection, which is of great benefit to the experimenter: at molar ratios R20 and R40 for CPP2:siRNA and CPP4:siRNA, the relative reduction of luciferase signal was the same in all conditions (~60-80%), regardless of the applied transfection time (Figure 4B).

[0105] The optimal siRNA concentration was then explored using an optimal peptide:siRNA molar ratio R=20 (Figure 4C). Three PBNs (CPP1, CPP2 and CPP4) showed significant knockdown effects with IC50 values ​​of approximately 7.5 nM, with very good dose-dependent correlation. Again, no cytotoxicity was observed in all conditions used.

[0106] Finally, the inventors could observe that the nanoparticles of the present invention induced an equivalent luciferase knockdown reduction at the same siRNA concentrations used as Lipofectamine® RNAiMAX (a product currently available from ThermoFisher for siRNA transfection), however, under these conditions, the inventors observed a significant cytotoxicity with Lipofectamine® RNAiMAX vectorization, amounting to 21% (Figure 4C).

[0107] For repeated or long-term application of nanoparticles, it is preferable to use a CPP of isoform D to reduce its degradation by extracellular or intracellular proteases. In this context, the effect of CPP2:siRNA nanoparticles was evaluated using peptides of L or D configuration.

[0108] Examination of the colloidal properties showed that peptide CPP2 of isoform D (CPP2[D]) formed nanoparticles of the same size as CPP2[L], as confirmed by DLS (I%=70±11 nm, Nb%=31±1 nm, PdI=0.302±0.024, see Table 3 for CPP2[L]).

[0109] In parallel, a decrease in firefly luciferase expression was observed at constant ratios of R20 in a dose-dependent manner (1 nM–20 nM siRNA) and therefore regardless of peptide isomerization (CPP2[D] and CPP2[L]) (Figure 5).

[0110] To facilitate in vivo application, the nanoparticles were incubated in the presence of serum to mimic interactions with serum proteins that may occur upon administration by intravenous injection. The presence of serum (10%) did not significantly adversely affect the activity of the nanoparticles with respect to firefly luciferase silencing with 15 and 20 nM siRNA for CPP1 and 10-20 nM siRNA for CPP2 (Figure 6). In the presence of 10% serum, a reduction in luciferase activity of approximately 70% was observed, which corresponds to serum-free conditions.

[0111] Finally, the inventors showed that siRNA transfection with CPPs is reproducible across laboratories and regardless of the detection method used. In this comparison, U87 cells were incubated with CPP2:siRNA nanoparticles at three siRNA concentrations (5 nM, 10 nM and 20 nM). After incubation, cells were lysed and firefly luciferase and NanoLuc activities were quantified in cell lysates transferred to 96-well plates (Dual Luciferase Kit, Promega with PolarStar measurement, BMG) or in tubes (Luciferase Assay Reagent and Nano-Glo Luciferase Assay, Promega with Lumat LB 9507 measurement, Berthold Technologies). In both cases, the values ​​were the same, showing a dose-dependent decrease in firefly luciferase expression (Figure 7).

[0112] 6. Comparison of CPP:siRNA activity with other CPPs with similar sequences Two peptides, CPP1 and CPP2, with similar but distinct sequences were synthesized to demonstrate the importance of amino acid positions (CPP1 vs. C6M1) and the role of leucine residues (CPP2 vs. CPP2-1 to CPP2-3, Table 1).

[0113] To show that the CPPs of the present invention have a better effect on siRNA transfection than the C6M1 peptide described in Jafari et al. (2013), a direct comparison was performed, including the C6M1-L sequence, which is a C6M1 analogue lacking a leucine in the leucine doublet at the N-terminal part of the peptide sequence (Table 1 and Figure 8A).

[0114] Human glioblastoma cells (U87) overexpressing firefly luciferase were incubated with siRNA-encapsulated nanoparticles (siFluc or siSCR as a negative control) prepared with four vector peptides: CPP1, C6M1, C6M1-L and CPP2. These preparations were carried out in parallel in the same manner and at the same concentrations for all peptides (CPP = 200 nM, siRNA = 10 nM). Afterwards, to avoid bias between incubations, all solutions were incubated for 1.5 h in P96 plates containing 5000 cells in each well.

[0115] By measuring luciferase activity, we clearly demonstrated that CPP1:siRNA and CPP2:siRNA were able to induce a 90% reduction in luciferase expression. In contrast, we observed only 60% luciferase knockdown by C6M1:siRNA and only 40% by C6M1-L:siRNA (Figure 8A).

[0116] In conclusion, the CPP1 peptide was 3-fold more active than C6M1 and 6-fold more active than C6M1-L in reducing luciferase expression (p=**** for both comparisons, one-way ANOVA with Tukey's post-test). Furthermore, the inventors were able to show that the CPP2 peptide was also more effective than C6M1 (2-fold) and C6M1-L (3.5-fold).

[0117] To understand the importance of the leucine "doublet" in the peptide sequence, analogs were made in which leucine residues were deleted at various positions (see Table 1). When only the middle of the CPP2 sequence (CPP2-1) or all "doublets" (CPP2-2) were replaced with a single leucine residue, the inventors observed that the nanoparticles were completely inactive in the luciferase assay (Figure 8B).

[0118] In a second step, we wanted to analyze the importance of a "doublet" in the N- and C-terminal parts of the CPP1 and CPP2 sequences (CPP1-1 and CPP2-3, respectively). This deletion also affected the activity of nanoparticles (siRNA-FLuc) in cellulo (Figure 8B): · The nanoparticle CPP2-3:siFLuc showed no activity in terms of luciferase silencing compared to that observed with CPP2:siFluc PBN. · Nanoparticles CPP1-1:siFLuc showed lower inhibitory activity, especially at 10 nM and 20 nM siRNA concentrations, corresponding to 3- and 5-fold lower PBN activity compared to CPP1:siFLuc nanoparticles at the same concentrations.

[0119] In a third step, we wanted to confirm the consensus sequences of the CPPs we developed and their behavior in comparison with C6M1 and C6M1-L. Therefore, we synthesized peptide sequences with additional arginine residues at the peptide sequence ends (N-terminus and C-terminus) (see CPP1-6R and CPP2-6R sequences in Table 1).

[0120] However, the addition of two arginines in the sequence can also increase the total net charge of the peptide. Two additional peptides were designed with N- and C-terminal arginine residues but lacking the two non-terminal arginine residues to yield the same net charge as the parent peptide (CPP1-4R and CPP2-4R, Table 1). In all cases, the addition of arginines at both ends of the peptide reduced the activity of the nanoparticles (siRNA-FLuc) in cellulo (Figure 8B): Nanoparticles CPP1-4R:siFLuc showed no activity in terms of luciferase silencing compared to that observed with CPP1:siFluc PBN. Nanoparticles CPP1-6R:siFLuc showed a 4-fold (5 nM siRNA) and 3-fold (10 nM and 20 nM siRNA) lower inhibitory activity as PBN compared to the same concentration of CPP1:siFLuc nanoparticles. The nanoparticles CPP2-4R:siFLuc and CPP2-6R showed 3-4-fold lower inhibitory activity as PBN compared to CPP2:siFLuc nanoparticles at all siRNA concentrations. Furthermore, CPP2-4R showed some variability in luciferase activity measurements, which may be due to some cytotoxic effect of nanoparticle incubation. · The obtained results were explained by DLS measurements (Table 3): CPP1-4R:siRNA was better aggregated than the parent nanoparticles, CPP1-6R:siRNA particles were larger and more polydisperse than CPP1:siRNA, and CPP2-4R:siRNA and CPP2-6R:siRNA appeared to form smaller nanoparticles but more polydisperse than CPP2:siRNA.

[0121] In conclusion, both CPP1 and CPP2 have the best amino acid combinations that enable stable nanoparticle formation with the highest knockdown efficacy.

[0122] 7. Example of transfection effect of CPP:siRNA nanoparticles As they showed the best transfection efficiency, CPP1 and CPP2 were selected for further cell testing and development. Both peptides were tested against various cell lines to evaluate their potential as general transfection agents. Using 20 nM siRNA, 50%-80% FLuc gene silencing was detected in U87 (human glioblastoma), KB (Hela-derived keratinocytes), HuH7 (human hepatoma) and Neuro2a (mouse neuroblastoma), MCF7 (human breast cancer), and MDA-MB-231 (human breast adenocarcinoma) cells; using 50 nM siRNA, CMT93 (rectal cancer), MEF-RAS:Ras-modified mouse embryonic fibroblasts, A549:human alveolar basal epithelial adenocarcinoma cells, HT29 (human colon cancer), and RM1 (mouse prostate cancer) cells; and using 100 nM siRNA, GL261 (mouse glioblastoma) cells. These results indicate that some cell lines require higher siRNA doses to achieve comparable knockdown effects (Figure 9A).

[0123] We also applied CPP1- and CPP2-based NPs to target cyclin-dependent kinase 4 (CDK4), an endogenous protein known to be overexpressed in glioblastoma (DW Parsons et al., (2008) An integrated genomic analysis of human glioblastoma multiforme, Science. 321, 1807-1812). Significant CDK4 knockdown was observed with both peptides, with CDK4 expression suppression corresponding to 30%, 60% and 80% at 5 nM, 10 nM and 20 nM, respectively. CPP1:siCDK4 seemed to show a slightly higher CDK knockdown effect than CPP2:siCDK4 (Figure 9B).

[0124] A direct comparison with Lipofectamine® RNAiMAX (a commercially available lipid transfection molecule from ThermoFisher) clearly demonstrated the superiority of our PBN transfection system (Figure 9C). Although both transfection systems were effective with significant CDK4 knockdown, the Lipofectamine® RNAiMAX condition showed significant cytotoxicity already at low concentrations. Cytotoxicity could be observed by Western blot with an internal standard (vinculin expression: dark grey bars) or by total protein concentration (measured with the BCA kit, values ​​in red).

[0125] At a concentration of 50 nM siCDK4, CPP1 induced >80% CDK4 knockdown without cytotoxicity, whereas when siRNA was delivered using Lipofectamine® RNAiMAX Reagent, knockdown was similar but was accompanied by a significant reduction in total cellular protein and vinculin levels, indicating that this transfection reagent was significantly cytotoxic (dashed red line).

[0126] Cytotoxicity of CPP2 was also observed in comparison to both RNAiMAX conditions, which showed a high toxicity profile on cell viability and proliferation by colony formation assay (Figure 9D). None of the other CPP2 conditions affected cell viability or proliferation compared to untreated cells. As expected, the control condition using siRNA against the cell cycle-related cyclin D1 protein showed a 50% decrease in cell viability.

[0127] The effect of CPP2-based NPs on the endogenous protein CDK4 was also evaluated after three consecutive administrations of NPs over a 3-day period after culture (Figure 9E). Although significant CDK4 knockdown was detected in all conditions, a clear cumulative effect was observed with three consecutive administrations of 20 nM siRNA (administration 3) compared to a single administration (administration 1), suggesting a possible cumulative effect of CPP2-based NPs over time.

[0128] 8. Example of transfection effect of CPP:siRNA nanoparticles on cell suspension: To evaluate the transfection effect of siRNA-loaded CPP nanoparticles on non-adherent cells (suspension), so-called reverse transfection was performed on U87 cells. In "standard" transfection conditions, cells were seeded in microtiter plates at the desired concentration and, after adhesion to the well bottom (6 h to 24 h), the cells were transfected with nanoparticles. In "reverse" transfection, nanoparticles were transferred to the microtiter plates and then trypsinized cells resuspended in medium with or without serum were added to the nanoparticles (see Figure 15A and B).

[0129] In both cases, CPP1:siFLuc and CPP2:siFLuc showed dose-dependent luciferase gene silencing, which was specific since CPP:siSCR nanoparticles showed no knockdown effect. This silencing specificity was observed equally in serum-containing and serum-free medium. However, the silencing effect of reverse transfection required a slightly higher dose of siRNA (50 nM instead of 20 nM) to achieve 80-90% knockdown equivalent to "standard" transfection.

[0130] We next evaluated the transfection efficacy of CPP2:siFLuc in non-adherent cells such as U937 human macrophages stably transfected with firefly luciferase (Figure 15C). CPP2:siFLuc nanoparticles showed dose-dependent luciferase gene silencing, which was specific to the transfection, since siFLuc alone showed no knockdown effect. Silencing efficacy was determined to be 40%, 80% and 100% at siRNA concentrations of 10nM, 20nM and 50nM, respectively.

[0131] 9. Co-transfection of CPP1:MBBO and CPP2:plasmids in the context of cystic fibrosis Cystic fibrosis (CF) is a genetic disease that primarily affects the lungs, but also the pancreas, liver, kidneys and intestines. It is caused by the presence of mutations in both copies of the gene for the cystic fibrosis transmembrane conductance regulator (CFTR) protein. CFTR has recently been found to be posttranscriptionally regulated by micorRNAs, such as miR-145 and miR-494 (Gillen AE et al. Biochem J. 2011; Megiorni F et al. Plos One, 2011; Ramachandran S et al. PNAS, 2012, Viart V et al. Eur Respir J. 2015). Several miRNAs, including miR-145, are expressed in primary human airway epithelial cells in which CFTR is silenced (Gillen AE et al. Biochem J , 2011) or are deregulated in CF patients (Oglesby IK et al. J Immunol, 2013; Ramachandran S et al. AJRCMB . 2013).

[0132] Dr. M. Taulan-Cardars' group designed target site blockers (TSBs, also called miRNA binding blocker oligonucleotides (MBBOs)) that inhibited the binding of several miRNAs, including miR-101, miR-600, miR-145 and miR-384, to the CFTR gene 3'-UTR (PCT / EP2014 / 069522). This MBBO could be encapsulated with CPP1 in a molar ratio-dependent manner, and was fully complexed at R=5 (Figure 16A). Using this molar ratio, the inventors obtained nanoparticles with an average size of 180 nm as measured by dynamic light scattering (DLS) (Figure 16B).

[0133] The inventors then evaluated the effect of MBBO transfection on CFTR transcript abundance in bronchial Beas-2b cells in comparison with different transfection reagents (Figure 16C). In co-transfection experiments, a plasmid encoding CFTR (pm-cDNA-CFTR-3'UTR, 11.8 kbp) was introduced together with various MBBOs (19-28 pb). CFTR transcript levels were first normalized to the housekeeping gene GAPDH (glyceraldehyde-3-phosphate dehydrogenase) and then to the control MBBO (MBP-Ctrl, which has no 3'-UTR binding). Three different transfection reagent combinations were analyzed: - Lipofectamin™ RNAiMAX for both CFTR plasmid and MBBO transfection - JetPEI® in transfection with CFTR plasmid, and CPP1 in transfection with MBBO - CPP2 in transfection with CFTR plasmid and CPP1 in transfection with MBBO

[0134] As shown in Figure 16C, the amount of CFTR transcript after transfection with CPP2:plasmid / CPP1:MBBO in bronchial Beas-2b cells was 2-3 fold higher compared to transfection with JetPEI®:plasmid / CPP1:MBBO and 10-12 fold higher compared to JetPEI®:plasmid / RNAiMAX:MBBO conditions. This increase in CFTR transcription correlates with the higher transfection efficiency with plasmid and MBBO over CPP1 and CPP2 peptide-based transfection.

[0135] 10. Evaluation of Internalization Kinetics of siRNA-loaded PBN CPP1 and CPP2-based nanoparticles showed remarkable effects in gene silencing, suggesting optimal siRNA delivery. Therefore, we attempted to evaluate their time-dependent cellular internalization. siRNA-loaded PBN (20 nM siFLuc) was applied to human U87 cells for various incubation times ranging from 5 min to 90 min, and then the PBN solution was replaced with 10% FBS-containing medium for 36 h. The results showed that CPP1 and CPP2 nanoparticles were able to induce a 40% decrease in FLuc activity already after 5 min of incubation, suggesting a rapid and significant protein knockdown (Figure 10A). Moreover, maximal and saturable FLuc silencing without cytotoxicity was observed after 60 min of incubation with both peptides. Compared to Figure 4C, the maximum knockdown effect at 60 min was a little lower, which may be due to i) the absence of an additional incubation time of 30 min and ii) the PBN solution was replaced but not filled with supplemented medium.

[0136] Similar time-dependent experiments performed with siCDK4-loaded PBN showed similar results by Western blot assessment, confirming the transfection effect at short times (Figure 10B): again, the initial knockdown effect could be observed after 5 min of incubation, and the silencing effect was maximum at 60 min.

[0137] To obtain more information about the internalization of CPP-based nanoparticles, confocal microscopy experiments were performed. Images depicting siRNA cellular distribution showed a compartmentalized pattern after 1 h of incubation similar to that observed with other PBNs (Figure 10C) (A. Vaissiere, et al., (2017) A retro-inverso cell-penetrating peptide for siRNA delivery, J. Nanobiotechnology. 15, 34.; G. Aldrian, et al., (2017) PEGylation rate influences peptide-based nanoparticles mediated siRNA delivery in vitro and in vivo, J. Control. Release Off. J. Control. Release Soc. 256, 79-91.; A. Rydstroem, et al., (2011) Direct translocation as major cellular uptake for CADY self-assembling peptide-based nanoparticles, PloS One. 6, e25924.). The inventors then performed spinning disk experiments to evaluate the internalization kinetics of both CPP-based nanoparticles based on the intracellular accumulation of Cy3-labeled siRNA (Figure 10D). As shown in the graph, it was observed that the siRNA delivered by both PBNs reached a maximum in fluorescence (90% ± 5%) after approximately 15 min of incubation (900 s–945 s). IC50 values ​​for internalization (50%) were obtained after 240 s and 185 s of incubation by CPP1 and CPP2 nanoparticles, respectively.This internalization was extremely fast compared to previously analyzed PBNs, such as RICK:siRNA or 20%PEG-RICK:siRNA, which reached a maximum internalization after 120 min of incubation (A. Vaissiere, et al., (2017) A retro-inverso cell-penetrating peptide for siRNA delivery, J. Nanobiotechnology. 15, 34.; G. Aldrian, et al., (2017) PEGylation rate influences peptide-based nanoparticles mediated siRNA delivery in vitro and in vivo, J. Control. Release Off. J. Control. Release Soc. 256, 79-91.). Taken together, the fast siRNA internalization kinetics observed for both CPP-based nanoparticles may explain the knockdown effect observed even after 5 min of incubation (Figures 10A and 10B).

[0138] 11. In vivo evaluation of nanoparticles (mouse xenograft model) To evaluate the in vivo efficacy of the nanoparticles, they were injected into subcutaneous tumors (mouse U87-CMV-FLuc-CMV-iRFP-IRES-NLuc cells). For tumor formation, U87 cells (2.10 6 Cells / 100 μl) were injected subcutaneously into the right leg of B6 albino mice. After tumor growth, CPP2:siFluc nanoparticles (20 μl) were injected into the center of the tumor. Bioluminescence imaging (BLI) was performed on a Vivoptic (UMS 3767 - University of Bordeaux) using Lumina LT software (Perkin Elmer Inc.). After administration of anesthesia solution (2% isoflurane), mice were injected intraperitoneally with D-luciferin and images were obtained at 8 min post-injection.

[0139] Images showing "dual" bioluminescence (Fluc and Nluc) and fluorescence (iRFP) show a drop in visible firefly luciferase at 24 hours (Figure 11A). This phenomenon was more pronounced in the average of a larger number of animals (n=11), showing a 70% drop in luciferase signal at 24 hours (*p<0.05) (CPP2:siFluc at 15 μg siFluc, R=20) (Figure 11B). More importantly, the percentage of mRNA-Fluc was reduced by 80% at 48 hours after CPP2:siFluc nanoparticle injection (***p=0.0009) (Figure 11C).

[0140] 12. Vectorization of siRNA "cocktails" with CPP nanoparticles CPP-based nanoparticles may also enable the delivery of "cocktails" of multiple different siRNAs targeting different proteins, as exemplified below for a cocktail of two siRNAs (in the same ratio) targeting Cyclin B1 and CDK4 proteins (FIG. 12A) and a cocktail of two siRNAs (in different ratios) targeting Cyclin B1 and CDK4 proteins (FIG. 12B):

[0141] 13. Evaluation of highly modular nanoparticles (grafted PBN): Targeting of nanoparticles has become a prerequisite to reduce the internalization of therapeutic molecules in healthy tissues and to prevent unwanted side effects. For several years, targeting molecules such as peptides or sugars have been grafted onto nanoparticles that recognize overexpressed receptors in certain tissues or cell types (F. Danhier et al., (2012) Mol Pharm. 9(11):2961-73.; 22.; DM Copolovici et al., (2014) ACS Nano. 8(3):1972-94.; D. Arosio et al., (2017) Recent Pat Anticancer Drug Discov. 12(2):148-168.).

[0142] In the context of cancer, the triple targeting sequence (RGD) is the most widely studied to increase the specificity of a single therapeutic molecule or vector (UK Marelli UK, et al., (2013) Front Oncol. 3:222.). This peptide is known to specifically interact with the αvβ3 integrin receptor, which is overexpressed on the surface of cancer cells.

[0143] To perform a proof-of-concept for nanoparticle modulation, a linear sequence of RGD (with an aminohexanoic acid linker Ahx) was grafted onto the N-terminal end of the peptide CPP2.

[0144] The extension of the CPP2 peptide by four residues did not seem to affect the formation of nanoparticles, as observed by luciferase assay (Figure 13A). Comparable to the case of naked PBN, luciferase expression was reduced by about 70% (Figure 4). Regardless of the percentage of grafted peptide used (the ratio of CPP2 alone to RGD-Ahx-CPP2), the level of luciferase silencing remained constant (Figure 13B).

[0145] The main limitation in the use of peptide-based nanoparticles is their short life span in the bloodstream. However, thanks to many peptide chemistries, PBN can be modified with functional moieties to improve its pharmacological properties (T. Lehto, et al., (2016) Drug Deliv. Rev. 106(Pt A), 172-182). In this direction, PEGylation has been widely used to improve stability in vivo and to prevent recognition by the mononuclear phagocyte system (MPS) in the liver and spleen as well as interaction with blood components. For example, Genexol-PM [methoxy-PEG-poly(D,L-lactide) Taxol] is the first polymer-based micellar nanoparticle that has achieved real success in phase II clinical trials in the United States.

[0146] In this context, the proof of concept demonstrated that the peptide nanoparticles of the present invention can be grafted with PEG moieties, even multiply (Figure 13C). The addition of 20% PEG-CPP did not significantly affect the activity of the nanoparticles. Only the condition of 100% PEG-CPP completely suppressed it. Such results correlated with the data obtained with PEG-RICK (G. Aldrian, et al., (2017) J. Control. Release Off. J. Control. Release Soc. 256, 79-91).

[0147] Furthermore, when the addition of PEG-CPP did not exceed 20%, the formation of a ternary mixture by insertion of a targeted RGD peptide sequence (CPP2: 20% RGD-Ahx-CPP2: 20% PEG-CPP2) showed the same luciferase activity-reducing effect as the naked nanoparticles (CPP2) ( Figure 13D ).

Claims

1. A peptide consisting of an amino acid sequence selected from LLWRLWRLLWRLWRLL (SEQ ID NO: 1), LLRLLRWWWRLLLL (SEQ ID NO: 2), and LLRLLRWWWWRLLRLL (SEQ ID NO: 4).

2. The peptide of claim 1 , wherein the peptide comprises L-amino acids and / or D-amino acids.

3. 3. The peptide of claim 1 or 2, wherein the peptide has a net positive charge of 5.

4. The peptide comprises a cysteamide, thiol, amide, carboxyl, optionally substituted linear or branched C-terminus covalently attached to the C-terminus of said amino acid sequence. １ -C ６ and / or the peptide further comprises one or more moieties selected from among alkyl, primary or secondary amines, oxalic acid derivatives, lipids, phospholipids, fatty acids, cholesterol, polyethylene glycol, nuclear localization signals and / or targeting molecules, and / or the peptide further comprises one or more moieties selected from among amine, acetyl, optionally substituted linear or branched C, optionally substituted ... １ -C ６ The peptide according to any one of claims 1 to 3, further comprising one or more chemical moieties selected from among alkyl, primary or secondary amines, osidic derivatives, lipids, phospholipids, fatty acids, cholesterol, polyethylene glycol, nuclear localization signals and / or targeting molecules.

5. 5. Use of a peptide according to any one of claims 1 to 4 as a cell membrane penetrating peptide (CPP) ex vivo or in vitro.

6. 6. Ex vivo or in vitro use of a peptide according to claim 5, wherein the cell membrane penetrating peptide (CPP) is suitable for penetrating the plasma membrane of a mammalian cell.

7. 5. Use of a peptide according to any one of claims 1 to 4 as a transfection reagent ex vivo or in vitro.

8. A nanoparticle comprising a peptide according to any one of claims 1 to 4 and a cargo molecule.

9. 9. The nanoparticle of claim 8, wherein the cargo molecule is selected from the group consisting of a nucleic acid, a peptide, a protein, a lipid, a small molecule, a pharma- ceutical active agent, and any mixture thereof.

10. The nanoparticle of claim 9, wherein the cargo molecule is a nucleic acid selected from the group consisting of a DNA molecule, an RNA molecule, a PNA molecule, an siRNA molecule, a PMO molecule, an antisense molecule, an LNA molecule, an mcDNA molecule, an miRNA molecule, a CRISPR / Cas9 molecule, a plasmid, a ribozyme, an aptamer, a spiegelmer and a decoy molecule.

11. The nanoparticle according to any one of claims 8 to 10, wherein the nanoparticle has a size of 50 to 300 nm and / or the cargo molecule is covalently or non-covalently bound to the peptide.

12. The nanoparticles according to claim 11, wherein the size of the nanoparticles is between 100 and 200 nm.

13. A pharmaceutical composition comprising the nanoparticles according to any one of claims 8 to 12 and a pharma- ceutically acceptable carrier.

14. A method for delivering a cargo molecule to a cell in vitro, comprising the step of contacting said cell with a nanoparticle according to any one of claims 8 to 12, comprising said cargo molecule.

15. A method for delivering a cargo molecule to a tissue and / or organ ex vivo, comprising contacting said tissue and / or organ with a nanoparticle described in any one of claims 8 to 12 comprising said cargo molecule.

Images