Compositions and methods for expressing CRISPR guide RNA using the H1 promoter

Abstract

To provide compositions and methods for expression of CRISPR guide RNA using H1 promoter.SOLUTION: The disclosed subject matter provides a composition and a method for the expression of a CRISPR guide RNA using H1 promoter. In particular, a composition and a method are provided for the use of H1 promoter to express CRISPR guide RNA (gRNA) with altered specificity of the 5' nucleotide, as well as for the use of the H1 promoter sequence as a bidirectional promoter to express Cas9 nuclease and gRNA simultaneously. A composition and a method are also provided for the expression and expression regulation of gRNA in vivo through the use of an RNA ribozyme and a regulatable aptazyme.SELECTED DRAWING: None

Description

[Technical field]

[0001] CITED RELATED APPLICATIONS This application is the benefit of U.S. Provisional Application No. 62 / 012,802, filed June 16, 2014. The benefit of this application is claimed, which is incorporated herein by reference in its entirety.

[0002] Incorporation by reference of electronically submitted material This application contains a sequence listing. The sequence listing is located at: xt" in ASCII text files and stored on electronic media via EFS-Web. The sequence listing is 14,827 bytes in size and was submitted on June 2, 2015. The Sequence Listing is incorporated herein by reference in its entirety. [Background technology]

[0003] background C together with cas (CRISPR-associated) genes RISPR(clustered regularly interspaced sh ort palindromic repeat) is an invasive exon in bacteria and archaea. The acquired immune system provides acquired resistance to nucleic acids (Barrangou et al., 2007). ), Science, vol. 315: pp. 1709-12). CRISPR uses a spacer , similarly sized, unique and variable DNA sequences, such as phage DNA or plasmid DNA. A series of short, conserved repeats interspersed with DNA sequences that are often derived from DNA (Barrangou et al. (2007), Science 315:1709-12; Bolotin (2005), Microbiology, 151:2551-61; Mojica et al. (2005) ), J. Mol. Evol., 60:174-82). The CRISPR-Cas system is The insertion of the SPR region into phages and plasmids carrying matching sequences Acquisition of a short piece of foreign DNA (spacer) that confers immunity against subsequent exposure (Barrangou et al., 2007, Science 315:1709-12; Brouns et al. (2008) Science 321:960-64. It is this CRISPR-Cas interference / immunity that enables A-mediated silencing. (Horvath and Barrangou, 2010, Science 327:167-70; Devéa (2010), Annu. Rev. Microbiol. 64:475-93; Marraffini et al. and Sontheimer (2010), Nat. Rev. Genet. 11:181-90; Bhaya (2011), Annu. Rev. Genet., 45:273-97; Wiedenheft et al. (2 2012), Nature, 482:331-338).

[0004] Nucleotide sequence of Cas9 protein coupled with synthetic guide RNA (gRNA) CRISPR constructs relying on cleavage activity (Makarova et al., 2011, Nat. Rev. Mit. Crobiol. 9:467-77) has revolutionized genome engineering in recent years, allowing the CRISPR / Cas9 constructs are easy to synthesize and They are rapid and can be multiplexed. However, their relative ease of synthesis is unclear. Despite its ease of use, CRISPR has limitations, including the properties of Cas9 itself and the synthesis of its gRNA. The techniques for their access to targetable genomic space are a function of both There are technical limitations.

[0005] CRISPR cleavage occurs within a 20-nucleotide DNA sequence and 3′ to the target site. The essential protospacer adjacent motif ( PAM) (Jinek et al., 2012, Science 337:816-821). In theory, CRISPR technology could be used to , any unique N 20 -PAM sequence can be targeted. The DNA binding specificity of the PAM sequence varies depending on the species from which the specific Cas9 is derived. Currently, Cas is the least restrictive and most commonly used. 9 protein is derived from S. pyogenes, which recognizes the sequence NGG, thus Any unique 21-nucleotide sequence in the genome followed by two guanosine nucleotides (N 20 NGG) can be targeted by the protein component. The expansion of the available targeting space has led to the development of novel Cas9 proteins with altered PAM requirements. Discovery and Use of Proteins (Cong et al., 2013, Science 339:819-823) Hou et al. (2013), Proc. Natl. Acad. Sci. USA, 110(39):1 5644-9), or the ongoing creation of novel Cas9 variants, Alternatively, their creation may be limited to via directed evolution.

[0006] A second technical limitation of the CRISPR system is that it is a 5′ guanosine-initiated gene that initiates the transcription of the gR gene. Expression of NA results from the use of type III class of RNA polymerase III promoters. showed that these short non-coding transcripts have well-defined ends and contain 1+ nucleotides. All elements necessary for transcription, except for the nucleotide sequence, are contained within the upstream promoter region. It is particularly suitable for expressing gRNAs. However, the commonly used U6 promoter is Since the initiation of transcription requires a guanosine nucleotide, the use of the U6 promoter The targeting site of Nomu is GN 19 Further constrained by NGG (Mali et al., 2013 ), Science, 339:823-826; Ding et al. (2013), Cell Stem Cell 12: 393-394). T7 promoter, T3 promoter, or SP6 promoter Alternative methods, such as in vitro transcription with a guanosine nucleoside promoter, also have been used to This would require initiation with a chitide (Adhya et al. (1981) Proc. Natl. Acad. Sc i. USA, 78:147-151; Melton et al. (1984), Nucleic Acids Re s., 12:7035-7056; Pleiss et al. (1998), RNA, 4:1313- 1317 pages). [Prior art documents] [Non-patent literature]

[0007] [Non-Patent Document 1] Barrangou et al. (2007), Science 315:1709-12. [Non-Patent Document 2] Bolotin et al. (2005) Microbiology 151:2551-61 [Non-Patent Document 3] Mojica et al. (2005), J. Mol. Evol. 60:174-82. [Non-Patent Document 4] Brouns et al. (2008), Science 321:960-64 [Non-Patent Document 5] Horvath and Barrangou (2010), Science, 327:167-70. [Non-Patent Document 6] Deveau et al. (2010), Annu. Rev. Microbiol. 64:475-93. [Non-Patent Document 7] Marraffini and Sontheimer (2010), Nat. Rev. Genet. 11:181-90. [Non-Patent Document 8] Bhaya et al. (2011), Annu. Rev. Genet. 45:273-97 [Non-Patent Document 9] Wiedenheft et al. (2012), Nature 482:331-338 [Non-Patent Document 10] Makarova et al. (2011), Nat. Rev. Microbiol. 9:467-77 [Non-Patent Document 11] Jinek et al. (2012), Science, 337:816-821 [Non-Patent Document 12] Cong et al. (2013), Science, 339:819-823 [Non-Patent Document 13] Hou et al. (2013), Proc. Natl. Acad. Sci. USA, 110(39):15644-9. [Non-Patent Document 14] Mali et al. (2013), Science 339:823-826 [Non-Patent Document 15] Ding et al. (2013), Cell Stem Cell, 12:393-394 [Non-Patent Document 16] Adhya et al. (1981), Proc. Natl. Acad. Sci. USA, 78:147-151. [Non-Patent Document 17] Melton et al. (1984), Nucleic Acids Res. 12:7035-7056 [Non-Patent Document 18] Pleiss et al. (1998), RNA, 4:1313-1317. Summary of the Invention [Means for solving the problem]

[0008] overview Practice of the present invention is within the skill of the art, unless otherwise indicated. Conventional techniques within the scope of the present invention include those of cell biology, cell culture, molecular biology, transgenesis, and the like. biochemistry, microbiology, recombinant nucleic acid (e.g., DNA) technology, immunology, and RNA interference Typically, the techniques used in this study include RNA interference (RNAi). Non-limiting examples of such methods are described in the following publications: Ausubel, F. et al. (eds.), Current Protocols in Molecular Biology, Current Protocols in Immunology, Current Protocols in Protein Science, and Current Protocols in Cell Biology, 2008. As of December, all published by John Wiley & Sons, NY; Sambrook, Russell and Sambrook. ook, Molecular Cloning. A Laboratory Manual, 3rd edition, Cold Spring Harbor L Aboratory Press, Cold Spring Harbor, 2001;Harlow, E and Lane, D., A ntibodiies - A Laboratory Manual, Cold Spring Harbor Laboratory Press, Co ld Spring Harbor, 1988; Freshney, RI, “Culture of Animal Cells,” A Manual of Basic Technique”, 5th edition, John Wiley & Sons, Hoboken, NJ. Non-limiting information regarding therapeutic agents and human diseases can be found in Go odman and Gilman's The Pharmacological Basis of Therapeutics, 11th edition, M cGraw Hill, 2005, Katzung, B. (Ed.), Basic and Clinical Pharmacology. , McGraw-Hill / Appleton & Lange, 10th ed. (2006) or 11th ed. (200 Non-limiting information regarding genes and genetic disorders can be found in McKinley et al. sick, VA, Mendelian Inheritance in Man. A Catalog of Human Genes a nd Genetic Disorders, Baltimore: Johns Hopkins University Press, 1998. (12th edition), or as of May 1, 2010, World Wide Web: http: / / www.worldwideweb.org / Available at: http: / / www.ncbi.nlm.nih.gov / omim / More recent online database: Online Mendelian Inheritance tance in Man, OMIM(TM), McKusick-Nathans I Institute of Genetic Medicine, Johns Hopki ns University (Baltimore, Md.) and National Center for Biotechnology Information, Nat. ional Library of Medicine (Bethesda, Md.), and on the World Wide Web: http: / / omia.angis.org The animal species (other than human and mouse) available at Online Genetics, a database of genes, genetic disorders, and traits in e Mendelian Inheritance in Animals(OMIA) All patents, patent applications, and other publications mentioned herein are incorporated by reference in their entirety. (e.g., journal articles, books, websites, and databases) are incorporated by reference. Between this specification and any of the incorporated references, If a conflict of interest arises in any respect, such conflict of interest may be based on the (including as amended). Nothing herein indicates otherwise. To the extent possible, standard meanings of terms used herein are accepted in the art. , standard abbreviations are used for various terms.

[0009] The subject matter disclosed herein uses the H1 promoter to generate CRISPR-guided RNA. The present invention provides compositions and methods for expressing A. The subject matter disclosed herein includes one or more and providing a non-naturally occurring CRISPR-Cas system comprising a vector or vectors, The CRISPR-Cas system is a) a gene encoding the guide RNA (gRNA) of the CRISPR-Cas system; an H1 promoter operably linked to at least one nucleotide sequence comprising The gRNA hybridizes to a target sequence on a DNA molecule in the cell, and the DNA molecule is and b) an H1 promoter encoding one or more gene products that are expressed in the A regulatory element operable in a Cas9 vector comprising a nucleotide sequence encoding a Cas9 protein. and a regulatory element operably linked to the sequence, wherein components (a) and (b) are The gRNA is placed on the same or a different vector and targets the target sequence. and hybridizes to it, whereupon the Cas9 protein cleaves the DNA molecule to form one or In some embodiments, the target sequence is a nucleotide sequence A N 19 N.G.G., G.N. 19 N.G.G., C.N. 19 NGG, or TN 19 Including NGG. In embodiments, the cell is a eukaryotic cell. In some embodiments, the eukaryotic cell is a mammalian cell or In some aspects, the eukaryotic cell is a retinal photoreceptor cell. In some embodiments, the Cas9 protein is codon-optimized for expression in cells. In some embodiments, the Cas9 protein is a type II Cas9 protein. In some embodiments, the expression of one or more gene products is reduced. In some embodiments, the system is a single adeno-associated virus (AAV) Packaged into particles.

[0010] In some aspects, the subject matter disclosed herein provides a non-naturally occurring CRISPR-Cas system. This non-naturally occurring CRISPR-Cas system provides: a) a method for detecting the presence of a CRISPR-Cas system operably coupled to at least one nucleotide sequence encoding a guide RNA (gRNA); a gRNA linked to a target sequence of a DNA molecule in a eukaryotic cell; The hybridization results in a DNA molecule encoding one or more gene products that are expressed in a eukaryotic cell. b) a regulatory element operable in a eukaryotic cell, A regulatory element operably linked to a nucleotide sequence encoding a type II Cas9 protein. and one or more vectors containing the components (a) and (b), The gRNA is placed in the same or a different vector and targets the target sequence. , hybridizing thereto, and the Cas9 protein cleaves the DNA molecule, forming one or more In another embodiment, the target sequence is a nucleotide sequence selected from the group consisting of nucleotides A, B, C, D, E ... 19 N.G.G., G.N. 19 N.G.G., C.N. 19 NGG, or TN 19 In another embodiment, the compound includes NGG. In addition, the Cas9 protein is codon-optimized for expression in cells. In embodiments, the Cas9 protein is codon-optimized for expression in eukaryotic cells. In a further aspect, the eukaryotic cell is a mammalian cell or a human cell. The expression of one or more gene products is reduced.

[0011] The presently disclosed subject matter also provides methods for altering the expression of one or more gene products in a cell. The present invention provides a method for producing a cell comprising the steps of: The method includes introducing into the cell a non-naturally occurring CRISPR-Cas system. This non-naturally occurring CRISPR-Cas system is a) a guide for the CRISPR-Cas system; operably linked to at least one nucleotide sequence encoding a gene encoding a RNA (gRNA) The H1 promoter, wherein the gRNA hybridizes with a target sequence of the DNA molecule. a) a regulatory element operable in the cell, the Cas9 transcript being and a regulatory element operably linked to a nucleotide sequence encoding a protein. or a plurality of vectors, wherein components (a) and (b) are the same or different vectors of the system. The gRNA is placed in a vector that targets the target sequence and hybridizes with the target sequence. The Cas9 protein cleaves the DNA molecule, allowing expression of one or more gene products. In some embodiments, the target sequence is a nucleotide sequence A, B, C, D, E ... 19 NG G, G.N. 19 N.G.G., C.N. 19 NGG, or TN 19 In some embodiments, The cell is a eukaryotic cell. In some aspects, the eukaryotic cell is a mammalian cell or a human cell. In some aspects, the eukaryotic cell is a retinal photoreceptor cell. 9 protein is codon-optimized for expression in cells. The as9 protein is a type II Cas9 protein. In some embodiments, one or more In some embodiments, the expression of one or more gene products is reduced. In some embodiments, the system is a pusin that is expressed in a single adeno-associated virus (AAV) particle. Packaging.

[0012] In some aspects, the subject matter disclosed herein provides a method for detecting the production of one or more genes in a eukaryotic cell. The present invention provides a method for altering expression of a gene encoding one or more gene products, the method comprising: The method includes introducing a non-naturally occurring CRISPR-Cas system into a cell. the non-naturally occurring CRISPR-Cas system comprising: a) a CRISPR- At least one nucleotide sequence encoding a guide RNA (gRNA) for the Cas system an H1 promoter operably linked thereto, wherein the gRNA is haptented with a target sequence of the DNA molecule; b) a regulatory element operable in a eukaryotic cell; operably linked to a nucleotide sequence encoding a type II Cas9 protein. and a regulatory element, The gRNA is placed in the same or a different vector of the system and targets the target sequence. The Cas9 protein hybridizes to the DNA molecule and cleaves it. In another embodiment, the target sequence is a nucleotide sequence AN 19 N.G.G., G.N. 19 N.G.G., C.N. 19 NGG, or TN 19 Including NGG. Another In embodiments, the Cas9 protein is codon-optimized for expression in a cell. In yet another embodiment, the Cas9 protein is codon-optimized for expression in eukaryotic cells. In a further aspect, the eukaryotic cell is a mammalian cell or a human cell. In such cases, expression of one or more gene products is reduced.

[0013] The presently disclosed subject matter also includes non-human ovarian cancer cells, including vectors that include a bidirectional H1 promoter. A naturally occurring CRISPR-Cas system is provided, in which the bidirectional H1 promoter is a) CRI At least one nucleotide sequence encoding a guide RNA (gRNA) for the SPR-Cas system A control element that provides for the transcription of a D gene sequence in one direction, wherein the gRNA is The DNA molecule hybridizes to the target sequence of the NA molecule and is expressed in the cell. a) a gene product encoding the Cas9 protein; and b) a gene product encoding the Cas9 protein. and a control element that provides for transcription of the nucleotide sequence in the opposite direction, The Cas9 protein targets and hybridizes to the sequence, and then binds the DNA molecule. In some embodiments, the target sequence is , nucleotide sequence A N 19 N.G.G., G.N. 19 N.G.G., C.N. 19 NGG, or TN 19 In some embodiments, the cell is a eukaryotic cell. In some embodiments, the eukaryotic cell is In some aspects, the eukaryotic cell is a retinal photoreceptor cell. In some embodiments, the Cas9 protein is codon-optimized for expression in a cell. In some embodiments, the Cas9 protein is a type II Cas9 protein. In some embodiments, the expression of one or more gene products is reduced. Or the multiple gene products are rhodopsin. In some embodiments, the system is It is packaged into associated virus (AAV) particles.

[0014] In some embodiments, the subject matter disclosed herein comprises a bidirectional H1 promoter. The present invention provides a non-naturally occurring CRISPR-Cas system comprising a vector, wherein the bidirectional H1 promoter is a) a small promoter encoding a guide RNA (gRNA) for a CRISPR-Cas system; A control element that provides transcription in one direction of at least one nucleotide sequence. The gRNA hybridizes to a target sequence of a DNA molecule in a eukaryotic cell, and the DNA molecule a) a regulatory element that encodes one or more gene products that are expressed in a eukaryotic cell; Restriction of transcription of nucleotide sequences encoding type II Cas9 proteins in opposite directions The gRNA comprises a control element and is capable of targeting and hybridizing to a target sequence. The Cas9 protein cleaves the DNA molecule and inhibits the expression of one or more gene products. In another embodiment, the target sequence is the nucleotide sequence AN 19 N.G.G., G.N. 19 NG G, C.N. 19 NGG, or TN 19 In yet another embodiment, the Cas9 tandem The protein is codon-optimized for expression in eukaryotic cells. The nuclear cell is a mammalian cell or a human cell. The expression of the substance is reduced.

[0015] The presently disclosed subject matter also provides methods for altering the expression of one or more gene products in a cell. The present invention provides a method for the production of a gene for a cell comprising the steps of: and the method further comprises: introducing into the cell a non-autonomous vector comprising a vector comprising a bidirectional H1 promoter. The method includes introducing a naturally occurring CRISPR-Cas system into a vector comprising: a) at least one gene encoding a guide RNA (gRNA) for a CRISPR-Cas system; a control element that provides for transcription in one direction of a nucleotide sequence, a) a control element that hybridizes to a target sequence of the DNA molecule; and b) a Cas9 protein. and control elements providing for transcription in opposite directions of the nucleotide sequence encoding the protein. The gRNA targets and hybridizes to the target sequence, and then binds to the Cas9 protein. Proteins cut DNA molecules, altering the expression of one or more gene products in the cell. In some embodiments, the target sequence is the nucleotide sequence AN 19 N.G.G., G.N. 19 N.G.G.,C. N 19 NGG, or TN 19 In some embodiments, the cell is a eukaryotic cell. In some aspects, the eukaryotic cell is a mammalian cell or a human cell. The eukaryotic cell is a retinal photoreceptor cell. In some embodiments, the Cas9 protein is In some embodiments, the Cas9 protein is codon-optimized for expression of I In some embodiments, the Cas9 protein is a type I Cas9 protein. In some embodiments, the one or more gene products is rhodopsin. In a similar manner, the system is packaged into a single adeno-associated virus (AAV) particle.

[0016] The presently disclosed subject matter also provides methods for modifying the expression of one or more gene products in eukaryotic cells. The present invention provides a method for modifying a cell, the method comprising: A molecule, and the method includes, in the cell, a vector comprising a bidirectional H1 promoter. The method includes introducing a non-naturally occurring CRISPR-Cas system, The target gene includes at least one gene encoding a guide RNA (gRNA) for the CRISPR-Cas system. A control element that provides for transcription in one direction of another nucleotide sequence, a) a control element, which hybridizes with a target sequence of a DNA molecule; and b) type II C Regulatory elements that mediate transcription in opposite directions of the nucleotide sequence encoding the as9 protein and a gRNA that targets and hybridizes to a target sequence, The as9 protein cleaves DNA molecules and alters the expression of one or more gene products. In another embodiment, the target sequence is the nucleotide sequence AN 19 N.G.G., G.N. 19 N.G.G., C.N. 19 NGG, or TN 19 In yet another embodiment, the Cas9 protein comprises In a further aspect, the eukaryotic cell is codon-optimized for expression in a eukaryotic cell. In another embodiment, the cell is a mammalian cell or a human cell. is reduced.

[0017] The presently disclosed subject matter also provides an aptamer-regulated ribozyme, A mer-regulated ribozyme comprises a) a catalytic core extending from which are helix I, helix II, The double-stranded region of helix II and helix III is a cis-acting hammerhead linker. a phosphozyme comprising a double-stranded region of helix II and a double-stranded region of helix III; Each contains a loop region on either side of the catalytic core, and the double-stranded region of helix II is ligated to the a) a cis-acting hammerhead ribozyme that contains an aptamer that binds to the CR A nucleotide sequence encoding a guide RNA (gRNA) of an ISPR-Cas system. The gRNA hybridizes to a target sequence of a DNA molecule in a eukaryotic cell, and the DNA molecule A nucleotide sequence encoding one or more gene products that are expressed in a eukaryotic cell, the nucleotide sequence being 5' the 5' end of the nucleotide sequence is a duplex of helix III and a nucleotide sequence directly coupled to the region, undergoes autocleavage between the 5' end of the tide sequence and the double-stranded region of helix III. Binding of a ligand to an aptamer leads to a conformational change within the ribozyme. (i) When transcribed into RNA, it produces gRNA, which then binds to the aptamer-regulated ligand. (ii) a coding sequence that provides a phosphodiesterase that regulates the transcription of RNA in eukaryotic cells; Also provided is an expression construct comprising the transcriptional regulatory sequence or sequences. Cells are also provided. Methods for altering expression of one or more gene products in eukaryotic cells are also provided. wherein the cells contain DNA molecules encoding one or more gene products, and the method comprises: Introducing the expression construct into a cell and isolating the cell from a ligand and a ribozyme to modify activity. and contacting the cells in an amount sufficient to induce cell proliferation in a mammalian or human subject. Also provided is a method, in which the ligand is a cell in a mammal.

[0018] The presently disclosed subject matter also relates to a method for treating a neurodegenerative disease of the eye in a subject in need of such treatment. The present invention provides a method for treating an ocular neurodegenerative disease in a body, the method comprising: (a) administering to the subject a neurodegenerative disease comprising administering to the subject a neurodegenerative disease of the eye; At least one nucleotide sequence encoding a guide RNA (gRNA) for the RISPR-Cas system. a gRNA comprising an H1 promoter operably linked to a nucleotide sequence, The DNA molecule hybridizes to a target sequence in the cell, and the DNA molecule becomes one or more of the target sequences that are expressed in the cell. ii) a regulatory promoter operable within a cell, which encodes multiple gene products; An element operably linked to a nucleotide sequence encoding a Cas9 protein. and one or more vectors containing a non-naturally occurring CRISPR -Cas system, wherein components (i) and (ii) are in the same vector or in different vectors of the system. The gRNA is placed in a vector and hybridizes with the target sequence. The Cas9 protein cleaves the DNA molecule to inhibit the expression of one or more gene products. (b) administering to the subject an effective amount of the system. In some embodiments, the dysfunction of retinal photoreceptor cells and / or In some embodiments, the ocular neurodegenerative disease is glaucoma. In some embodiments, the ocular nerve is selected from the group consisting of retinal degeneration, retinal degeneration, and age-related macular degeneration. The degenerative disease is retinitis pigmentosa (RP). In some embodiments, the cells are retinal photoreceptor cells. In some embodiments, the one or more gene products is rhodopsin. In some embodiments, the H1 promoter is bidirectional. Prior to replication, the system is packaged into a single adeno-associated virus (AAV) particle. In some aspects, the step of administering to the subject is performed by subretinal injection. The subject is a human. In some embodiments, the Cas9 protein is a type II Cas9 protein. In some embodiments, the target sequence is the nucleotide sequence AN 19 N.G.G., G.N. 19 N.G.G., C.N. 19NGG, or TN 19 In some embodiments, the Cas9 tandem The protein is codon-optimized for expression in a cell. The method disclosed in the present application comprises administering an expression construct and a ligand in an amount that alters the activity of the ribozyme. In some aspects, the ligand is theophylline.

[0019] While the specification above has set forth certain aspects of the subject matter disclosed herein, which are addressed in whole or in part by the subject matter disclosed herein, other aspects will become apparent as the description proceeds and when taken in conjunction with the accompanying examples and figures, as best described hereinafter. In certain embodiments, for example, the following are provided: (Item 1) 1. A non-naturally occurring CRISPR-Cas system, comprising: a) an H1 promoter operably linked to at least one nucleotide sequence encoding a guide RNA (gRNA) of a CRISPR-Cas system, said gRNA hybridizing to a target sequence of a DNA molecule in a cell, said DNA molecule encoding one or more gene products to be expressed in said cell; b) a regulatory element operable in the cell, the regulatory element being operably linked to a nucleotide sequence encoding a Cas9 protein; and one or more vectors comprising A system, wherein components (a) and (b) are placed on the same or different vectors of the system, wherein the gRNA targets and hybridizes to the target sequence, and the Cas9 protein cleaves the DNA molecule to alter expression of the one or more gene products. (Item 2) The target sequence is a nucleotide sequence A 19 N.G.G., G.N. 19 N.G.G., C.N. 19NGG, or TN 19 2. The system according to item 1, comprising NGG. (Item 3) 2. The system of item 1, wherein the Cas9 protein is codon-optimized for expression in the cell. (Item 4) 2. The system of claim 1, wherein the Cas9 protein is a type II Cas9 protein. (Item 5) 2. The system according to item 1, wherein the cell is a eukaryotic cell. (Item 6) 6. The system according to item 5, wherein the eukaryotic cell is a mammalian cell or a human cell. (Item 7) 6. The system according to item 5, wherein the eukaryotic cells are retinal photoreceptor cells. (Item 8) 2. The system described in item 1, wherein the one or more gene products is rhodopsin. (Item 9) 2. The system of item 1, wherein the expression of the one or more gene products is reduced. (Item 10) 2. The system of item 1, wherein the system is packaged in a single adeno-associated virus (AAV) particle. (Item 11) 1. A method of altering expression of one or more gene products in a cell, the cell comprising a DNA molecule encoding the one or more gene products, the method comprising introducing into the cell a non-naturally occurring CRISPR-Cas system, the system comprising: a) an H1 promoter operably linked to at least one nucleotide sequence encoding a guide RNA (gRNA) of a CRISPR-Cas system, wherein the gRNA hybridizes to a target sequence of the DNA molecule; b) a regulatory element operable in said cell, said regulatory element being operably linked to a nucleotide sequence encoding a Cas9 protein; and one or more vectors comprising wherein components (a) and (b) are placed in the same or different vectors of the system, the gRNA targets and hybridizes to the target sequence, and the Cas9 protein cleaves the DNA molecule to alter expression of the one or more gene products. (Item 12) The target sequence is a nucleotide sequence A 19 N.G.G., G.N. 19 N.G.G., C.N. 19 NGG, or TN 19 12. The method of claim 11, comprising NGG. (Item 13) 12. The method of claim 11, wherein the Cas9 protein is codon-optimized for expression in the cell. (Item 14) 12. The method of claim 11, wherein the Cas9 protein is a type II Cas9 protein. (Item 15) 12. The method of claim 11, wherein the cell is a eukaryotic cell. (Item 16) 16. The method of claim 15, wherein the eukaryotic cell is a mammalian cell or a human cell. (Item 17) 16. The method of claim 15, wherein the cells are retinal photoreceptor cells. (Item 18) 12. The method of claim 11, wherein the one or more gene products is rhodopsin. (Item 19) 12. The method of claim 11, wherein the expression of the one or more gene products is reduced. (Item 20) 12. The method of claim 11, wherein the system is introduced into the cells using a single adeno-associated virus (AAV) particle. (Item 21) A non-naturally occurring CRISPR-Cas system comprising a vector comprising a bidirectional H1 promoter, the bidirectional H1 promoter comprising: a) a control element that provides for transcription in one direction of at least one nucleotide sequence encoding a guide RNA (gRNA) of a CRISPR-Cas system, said gRNA hybridizing to a target sequence of a DNA molecule in a cell, said DNA molecule encoding one or more gene products to be expressed in said cell; b) control elements that provide for transcription in opposite directions of the nucleotide sequence encoding the Cas9 protein; Including, A CRISPR-Cas system, wherein the gRNA targets and hybridizes to the target sequence and the Cas9 protein cleaves the DNA molecule to alter expression of the one or more gene products. (Item 22) The target sequence is a nucleotide sequence A 19 N.G.G., G.N. 19 N.G.G., C.N. 19 NGG, or TN 19 22. The system according to item 21, comprising NGG. (Item 23) 22. The system of claim 21, wherein the Cas9 protein is codon-optimized for expression in the cell. (Item 24) 22. The system of claim 21, wherein the Cas9 protein is a type II Cas9 protein. (Item 25) 22. The system according to item 21, wherein the cell is a eukaryotic cell. (Item 26) 26. The system according to item 25, wherein the eukaryotic cell is a mammalian cell or a human cell. (Item 27) 26. The system of item 25, wherein the eukaryotic cells are retinal photoreceptor cells. (Item 28) 22. The system according to item 21, wherein the one or more gene products is rhodopsin. (Item 29) 22. The system of item 21, wherein the expression of the one or more gene products is reduced. (Item 30) 22. The system of item 21, wherein the system is packaged in a single adeno-associated virus (AAV) particle. (Item 31) 1. A method of altering expression of one or more gene products in a cell, the cell comprising a DNA molecule encoding the one or more gene products, the method comprising introducing into the cell a non-naturally occurring CRISPR-Cas system comprising a vector comprising a bidirectional H1 promoter, the bidirectional H1 promoter comprising: a) a control element that provides for transcription in one direction of at least one nucleotide sequence encoding a guide RNA (gRNA) of a CRISPR-Cas system, said gRNA hybridizing to a target sequence of said DNA molecule; b) control elements that provide for transcription in opposite directions of the nucleotide sequence encoding the Cas9 protein; Including, wherein the gRNA targets and hybridizes to the target sequence and the Cas9 protein cleaves the DNA molecule to alter expression of the one or more gene products in the cell. (Item 32) The target sequence is a nucleotide sequence A 19 N.G.G., G.N. 19 N.G.G., C.N. 19 NGG, or TN 19 32. The method of claim 31, comprising NGG. (Item 33) 32. The method of claim 31, wherein the Cas9 protein is codon-optimized for expression in the cell. (Item 34) 32. The method of claim 31, wherein the Cas9 protein is a type II Cas9 protein. (Item 35) 32. The method of claim 31, wherein the cell is a eukaryotic cell. (Item 36) 36. The method of claim 35, wherein the eukaryotic cell is a mammalian cell or a human cell. (Item 37) 36. The method of claim 35, wherein the eukaryotic cells are retinal photoreceptor cells. (Item 38) 32. The method of claim 31, wherein the one or more gene products is rhodopsin. (Item 39) 32. The method of claim 31, wherein the expression of the one or more gene products is reduced. (Item 40) 32. The method of claim 31, wherein the system is introduced into the cell using a single adeno-associated virus (AAV) particle. (Item 41) An aptamer-regulated ribozyme, comprising: a) a cis-acting hammerhead ribozyme comprising a catalytic core and extending therefrom a helix I, helix II, and helix III duplex region, wherein the helix II duplex region and the helix III duplex region each comprise a loop region on opposite sides of the catalytic core, and the helix II duplex region comprises an aptamer that binds to a ligand; b) Nucleotide sequence encoding guide RNA (gRNA) of the CRISPR-Cas system a nucleotide sequence, wherein the gRNA hybridizes to a target sequence of a DNA molecule in a eukaryotic cell, the DNA molecule encoding one or more gene products to be expressed in the eukaryotic cell, the nucleotide sequence comprising a 5' end and a 3' end, the 5' end of the nucleotide sequence being directly coupled to the duplex region of helix III; Including, wherein binding of the ligand to the aptamer results in a conformational change in the ribozyme such that the ribozyme undergoes self-cleavage between the 5' end of the nucleotide sequence and the double-stranded region of helix III, releasing the gRNA. (Item 42) 42. The aptamer-regulated ribozyme of claim 41, wherein the ligand is theophylline. (Item 43) (a) a coding sequence which, when transcribed into RNA, results in the aptamer-regulated ribozyme described in item 41; (b) one or more transcriptional regulatory sequences that regulate transcription of said RNA in a cell; An expression construct comprising: (Item 44) A eukaryotic cell comprising an expression construct according to item 43. (Item 45) 1. A method for altering expression of one or more gene products in a cell, comprising: the cell comprises a DNA molecule encoding the one or more gene products; 44. The method of claim 43, comprising introducing into the cell an expression construct according to claim 43 and contacting the cell with the ligand in an amount that alters the activity of the ribozyme. (Item 46) 46. ​​The method of claim 45, wherein the cell is a eukaryotic cell. (Item 47) 46. ​​The method of claim 45, wherein the cell is in a subject. (Item 48) 46. ​​The method of claim 45, wherein the subject is a human. (Item 49) 46. ​​The method of claim 45, wherein the ligand is theophylline. (Item 50) 1. A method for treating an ocular neurodegenerative disease in a subject in need thereof, comprising: (a) providing a non-naturally occurring CRISPR-Cas system, the CRISPR-Cas system comprising: i) an H1 promoter operably linked to at least one nucleotide sequence encoding a guide RNA (gRNA) of a CRISPR-Cas system, said gRNA hybridizing to a target sequence of a DNA molecule in a cell of the subject, said DNA molecule encoding one or more gene products to be expressed in said cell; ii) a regulatory element operable in the cell, the regulatory element being operably linked to a nucleotide sequence encoding a Cas9 protein; and one or more vectors comprising wherein components (i) and (ii) are placed in the same or different vectors of the system, the gRNA targets and hybridizes to the target sequence, and the Cas9 protein cleaves the DNA molecule to alter expression of the one or more gene products; (b) administering to the subject an effective amount of the system; The method includes: (Item 51) 51. The method of item 50, wherein retinal photoreceptor cell dysfunction and / or death has been observed in the subject. (Item 52) 51. The method of claim 50, wherein the ocular neurodegenerative disease is selected from the group consisting of glaucoma, retinal degeneration, and age-related macular degeneration. (Item 53) 51. The method of claim 50, wherein the ocular neurodegenerative disease is retinitis pigmentosa (RP). (Item 54) 51. The method of claim 50, wherein the cells are retinal photoreceptor cells. (Item 55) 51. The method of item 50, wherein the one or more gene products is rhodopsin. (Item 56) 51. The method of claim 50, wherein the H1 promoter is bidirectional. (Item 57) 51. The method of claim 50, wherein the system is packaged into a single adeno-associated virus (AAV) particle prior to administering to the subject. (Item 58) 51. The method of claim 50, wherein the step of administering to the subject is performed by subretinal injection. (Item 59) 51. The method of claim 50, wherein the subject is a human. (Item 60) 51. The method of claim 50, wherein the Cas9 protein is a type II Cas9 protein. (Item 61) The target sequence is a nucleotide sequence A 19 N.G.G., G.N. 19 N.G.G., C.N. 19 NGG, or TN 19 51. The method of item 50, comprising NGG. (Item 62) 51. The method of claim 50, wherein the Cas9 protein is codon-optimized for expression in the cell. (Item 63) 51. The method of claim 50, further comprising administering the expression construct of claim 43 and the ligand in an amount that alters the activity of the ribozyme. (Item 64) 64. The method of claim 63, wherein the ligand is theophylline.

[0020] Having thus generally described the subject matter disclosed herein, reference is now made to the appended claims. Reference is made to the accompanying drawings, which are not necessarily drawn to scale. [Brief description of the drawings]

[0021] [Figure 1A]Figure 1A, Figure 1B, Figure 1C, and Figure 1D show the assessment of the ability to direct CRISPR targeting through gRNA synthesis by the H1 promoter. An exemplary schematic diagram depicting the expression construct of gRNA is shown in Figure 1A. In the upper diagram, the U6 promoter expresses only gRNA with +1 guanosine nucleotide, and in the lower diagram, the H1 promoter can drive the expression of gRNA that starts with a purine (adenosine or guanosine) nucleotide. In the lower diagram, a pictorial depiction of Cas9 protein with gRNA targeting genomic sequence AN19NGG (sequence shown is SEQ ID NO: 30). The location of +1A is indicated. An overview of eGFP targeting interference assay is shown in Figure 1B. eGFP fluorescence is interrupted by error-prone NHEJ-mediated repair following CRISPR targeting, resulting in a frameshift mutation that interrupts the coding sequence, resulting in a loss of fluorescence. FIG. 1C shows microscopy images demonstrating successful CRISPR targeting with gRNA expressed from the U6 or H1 promoter. H7 ES cells were stained to visualize colonies showing nuclei (left, magenta), eGFP fluorescence (middle, green), and a merged image (right) indicating GFP fluorescence mosaic areas within the colonies. On the right, quantification of eGFP fluorescence loss by flow cytometry for each construct is shown. The bottom figure shows a high magnification of an H7 colony targeted by gRNA expressed from H1, showing expression mosaic. Scale bar is 50 μM. Surveyor assay-based quantification of NHEJ frequency is shown in FIG. 1D. Bioanalyzer gel images depicting control (first lane), gRNA expressed from U6 (second lane), gRNA expressed from H1 (third lane), and marker (fourth lane). The indel % (calculated by the ratio of the uncut (u) band to the cut (c) band) is indicated in the figure below. [Figure 1B-C]Figure 1A, Figure 1B, Figure 1C, and Figure 1D show the assessment of the ability to direct CRISPR targeting through gRNA synthesis by the H1 promoter. An exemplary schematic diagram depicting the expression construct of gRNA is shown in Figure 1A. In the upper diagram, the U6 promoter expresses only gRNA with +1 guanosine nucleotide, and in the lower diagram, the H1 promoter can drive the expression of gRNA that starts with a purine (adenosine or guanosine) nucleotide. In the lower diagram, a pictorial depiction of Cas9 protein with gRNA targeting genomic sequence AN19NGG (sequence shown is SEQ ID NO: 30). The location of +1A is indicated. An overview of eGFP targeting interference assay is shown in Figure 1B. eGFP fluorescence is interrupted by error-prone NHEJ-mediated repair following CRISPR targeting, resulting in a frameshift mutation that interrupts the coding sequence, resulting in a loss of fluorescence. FIG. 1C shows microscopy images demonstrating successful CRISPR targeting with gRNA expressed from the U6 or H1 promoter. H7 ES cells were stained to visualize colonies showing nuclei (left, magenta), eGFP fluorescence (middle, green), and a merged image (right) indicating GFP fluorescence mosaic areas within the colonies. On the right, quantification of eGFP fluorescence loss by flow cytometry for each construct is shown. The bottom figure shows a high magnification of an H7 colony targeted by gRNA expressed from H1, showing expression mosaic. Scale bar is 50 μM. Surveyor assay-based quantification of NHEJ frequency is shown in FIG. 1D. Bioanalyzer gel images depicting control (first lane), gRNA expressed from U6 (second lane), gRNA expressed from H1 (third lane), and marker (fourth lane). The indel % (calculated by the ratio of the uncut (u) band to the cut (c) band) is indicated in the figure below. [Figure 1D]Figure 1A, Figure 1B, Figure 1C, and Figure 1D show the assessment of the ability to direct CRISPR targeting through gRNA synthesis by the H1 promoter. An exemplary schematic diagram depicting the expression construct of gRNA is shown in Figure 1A. In the upper diagram, the U6 promoter expresses only gRNA with +1 guanosine nucleotide, and in the lower diagram, the H1 promoter can drive the expression of gRNA that starts with a purine (adenosine or guanosine) nucleotide. In the lower diagram, a pictorial depiction of Cas9 protein with gRNA targeting genomic sequence AN19NGG (sequence shown is SEQ ID NO: 30). The location of +1A is indicated. An overview of eGFP targeting interference assay is shown in Figure 1B. eGFP fluorescence is interrupted by error-prone NHEJ-mediated repair following CRISPR targeting, resulting in a frameshift mutation that interrupts the coding sequence, resulting in a loss of fluorescence. FIG. 1C shows microscopy images demonstrating successful CRISPR targeting with gRNA expressed from the U6 or H1 promoter. H7 ES cells were stained to visualize colonies showing nuclei (left, magenta), eGFP fluorescence (middle, green), and a merged image (right) indicating GFP fluorescence mosaic areas within the colonies. On the right, quantification of eGFP fluorescence loss by flow cytometry for each construct is shown. The bottom figure shows a high magnification of an H7 colony targeted by gRNA expressed from H1, showing expression mosaic. Scale bar is 50 μM. Surveyor assay-based quantification of NHEJ frequency is shown in FIG. 1D. Bioanalyzer gel images depicting control (first lane), gRNA expressed from U6 (second lane), gRNA expressed from H1 (third lane), and marker (fourth lane). The indel % (calculated by the ratio of the uncut (u) band to the cut (c) band) is indicated in the figure below. [Diagram 2]Figure 2 shows Surveyor analysis and quantification of NHEJ in HEK-293 cells. A schematic of eGFP is shown at the top with arrows pointing to the targeting sites. Positive strand target sites point to the right, negative strand targets point to the left, blue arrows point to the H1 promoter gRNA, and orange arrows point to the U6 promoter gRNA. A Bioanalyzer gel from the Surveyor assay is shown at the bottom. Target site coordinates are listed above and calculated % indels are shown below. [Figure 3A] Figures 3A, 3B, and 3C show targeting and homologous recombination at the AAVS1 locus. Surveyor analysis for three gRNAs expressed by the H1 promoter (AAVS1-1a to AAVS-1-3a), three gRNAs expressed by the U6 promoter (AAVS-1-1 to AAVS-1-3), and a control non-targeting gRNA is shown in Figure 3A. Figure 3B shows a schematic diagram for the AAVS-1 targeting donor vector (shown above the AAVS1 locus (labeled "AAVS1")) and cell imaging for a GFP-positive H7 ES cell colony following electroporation with the H1::AAVS1-3a gRNA and AAVS-1 targeting vector. Sanger sequencing of the targeting junction region indicating correct integration by homologous recombination is shown in Figure 3C (sequence shown is SEQ ID NO: 31). [Figure 3B-C]Figures 3A, 3B, and 3C show targeting and homologous recombination at the AAVS1 locus. Surveyor analysis for three gRNAs expressed by the H1 promoter (AAVS1-1a to AAVS-1-3a), three gRNAs expressed by the U6 promoter (AAVS-1-1 to AAVS-1-3), and a control non-targeting gRNA is shown in Figure 3A. Figure 3B shows a schematic diagram for the AAVS-1 targeting donor vector (shown above the AAVS1 locus (labeled "AAVS1")) and cell imaging for a GFP-positive H7 ES cell colony following electroporation with the H1::AAVS1-3a gRNA and AAVS-1 targeting vector. Sanger sequencing of the targeting junction region indicating correct integration by homologous recombination is shown in Figure 3C (sequence shown is SEQ ID NO: 31). [Figure 4A] Figure 4A, Figure 4B, Figure 4C, and Figure 4D show bioinformatics analysis of GN19NGG and AN19NGG sites in genome. Circos plots depicting the frequency of CRISPR sites in the human genome are shown in Figure 4A. The outer circle depicts the designation symbols of human chromosomes. Moving inward, the frequency of GN19NGG (orange), AN19NGG (blue), and RN19NGG (purple) CRISPR sites is indicated along the chromosome. Inside the circle, human exon density (black) and OMIM disease loci (blue) are plotted. The frequency of CRISPR sites in the genome and the distance between them are shown in Figure 4B. Bar plots are shown for the frequency and distance of adjacent GN19NGG (orange), AN19NGG (blue) sites in genome. Mean and median values ​​are inserted into the plot containing RN19NGG sites. Figure 4C shows a bar plot quantifying the frequency of GN19NGG sites versus AN19NGG sites in human genes (left) or OMIM disease loci (right). Figure 4D shows a bar plot quantifying the frequency of GN19NGG versus AN19NGG in six genomes: human, cow, mouse, rat, chicken, and zebrafish. [Figure 4B]Figure 4A, Figure 4B, Figure 4C, and Figure 4D show bioinformatics analysis of GN19NGG and AN19NGG sites in genome. Circos plots depicting the frequency of CRISPR sites in the human genome are shown in Figure 4A. The outer circle depicts the designation symbols of human chromosomes. Moving inward, the frequency of GN19NGG (orange), AN19NGG (blue), and RN19NGG (purple) CRISPR sites is indicated along the chromosome. Inside the circle, human exon density (black) and OMIM disease loci (blue) are plotted. The frequency of CRISPR sites in the genome and the distance between them are shown in Figure 4B. Bar plots are shown for the frequency and distance of adjacent GN19NGG (orange), AN19NGG (blue) sites in genome. Mean and median values ​​are inserted into the plot containing RN19NGG sites. Figure 4C shows a bar plot quantifying the frequency of GN19NGG sites versus AN19NGG sites in human genes (left) or OMIM disease loci (right). Figure 4D shows a bar plot quantifying the frequency of GN19NGG versus AN19NGG in six genomes: human, cow, mouse, rat, chicken, and zebrafish. [Figure 4C]Figure 4A, Figure 4B, Figure 4C, and Figure 4D show bioinformatics analysis of GN19NGG and AN19NGG sites in genome. Circos plots depicting the frequency of CRISPR sites in the human genome are shown in Figure 4A. The outer circle depicts the designation symbols of human chromosomes. Moving inward, the frequency of GN19NGG (orange), AN19NGG (blue), and RN19NGG (purple) CRISPR sites is indicated along the chromosome. Inside the circle, human exon density (black) and OMIM disease loci (blue) are plotted. The frequency of CRISPR sites in the genome and the distance between them are shown in Figure 4B. Bar plots are shown for the frequency and distance of adjacent GN19NGG (orange), AN19NGG (blue) sites in genome. Mean and median values ​​are inserted into the plot containing RN19NGG sites. Figure 4C shows a bar plot quantifying the frequency of GN19NGG sites versus AN19NGG sites in human genes (left) or OMIM disease loci (right). Figure 4D shows a bar plot quantifying the frequency of GN19NGG versus AN19NGG in six genomes: human, cow, mouse, rat, chicken, and zebrafish. [Figure 4D]Figure 4A, Figure 4B, Figure 4C, and Figure 4D show bioinformatics analysis of GN19NGG and AN19NGG sites in genome. Circos plots depicting the frequency of CRISPR sites in the human genome are shown in Figure 4A. The outer circle depicts the designation symbols of human chromosomes. Moving inward, the frequency of GN19NGG (orange), AN19NGG (blue), and RN19NGG (purple) CRISPR sites is indicated along the chromosome. Inside the circle, human exon density (black) and OMIM disease loci (blue) are plotted. The frequency of CRISPR sites in the genome and the distance between them are shown in Figure 4B. Bar plots are shown for the frequency and distance of adjacent GN19NGG (orange), AN19NGG (blue) sites in genome. Mean and median values ​​are inserted into the plot containing RN19NGG sites. Figure 4C shows a bar plot quantifying the frequency of GN19NGG sites versus AN19NGG sites in human genes (left) or OMIM disease loci (right). Figure 4D shows a bar plot quantifying the frequency of GN19NGG versus AN19NGG in six genomes: human, cow, mouse, rat, chicken, and zebrafish. [Figure 5A]Figure 5A, Figure 5B, Figure 5C, Figure 5D, Figure 5E, and Figure 5F show bioinformatics analysis of GN19NGG and AN19NGG sites in the genome. Three panels depict the density of each gRNA site in the human genome: GN19NGG (Figure 5A), AN19NGG (Figure 5B), and RN19NGG (Figure 5C). Within each plot, the density of CRISPR sites is plotted along each chromosome. The density curves, calculated as a smooth Gaussian kernel, are overlaid semi-transparently (orange, blue, or purple). The dotted line indicates the 35 bp standard (on average, TALEN targeting sites are estimated to occur every 35 base pairs and ZFN sites every few hundred base pairs (Sander et al. (2011) Nature Methods 8:67-69; Cermak et al. (2011) Nucleic Acids Res. 39(12):e82)). A bar plot of the cumulative average CRISPR targeting density per human chromosome is shown in Figure 5D. GN19NGG (orange), AN19NGG (blue), and RN19NGG (purple) indicate the respective CRISPR sites. The dotted line indicates the 35 bp standard. Figure 5E shows the frequency of adjacent CRISPR sites in the genome and the distance between them. A bar plot of the frequency and distance of adjacent GN19NGG (orange) and AN19NGG (blue) sites in the genome is shown. Mean and median values ​​are inset into the plot. The SeqLogo for all GN19NGG (top left), AN19NGG (top right), and RN19NGG (bottom) sites in the human genome is shown in Figure 5F. [Figure 5B]Figure 5A, Figure 5B, Figure 5C, Figure 5D, Figure 5E, and Figure 5F show bioinformatics analysis of GN19NGG and AN19NGG sites in the genome. Three panels depict the density of each gRNA site in the human genome: GN19NGG (Figure 5A), AN19NGG (Figure 5B), and RN19NGG (Figure 5C). Within each plot, the density of CRISPR sites is plotted along each chromosome. The density curves, calculated as a smooth Gaussian kernel, are overlaid semi-transparently (orange, blue, or purple). The dotted line indicates the 35 bp standard (on average, TALEN targeting sites are estimated to occur every 35 base pairs and ZFN sites every few hundred base pairs (Sander et al. (2011) Nature Methods 8:67-69; Cermak et al. (2011) Nucleic Acids Res. 39(12):e82)). A bar plot of the cumulative average CRISPR targeting density per human chromosome is shown in Figure 5D. GN19NGG (orange), AN19NGG (blue), and RN19NGG (purple) indicate the respective CRISPR sites. The dotted line indicates the 35 bp standard. Figure 5E shows the frequency of adjacent CRISPR sites in the genome and the distance between them. A bar plot of the frequency and distance of adjacent GN19NGG (orange) and AN19NGG (blue) sites in the genome is shown. Mean and median values ​​are inset into the plot. The SeqLogo for all GN19NGG (top left), AN19NGG (top right), and RN19NGG (bottom) sites in the human genome is shown in Figure 5F. [Figure 5C]Figure 5A, Figure 5B, Figure 5C, Figure 5D, Figure 5E, and Figure 5F show bioinformatics analysis of GN19NGG and AN19NGG sites in the genome. Three panels depict the density of each gRNA site in the human genome: GN19NGG (Figure 5A), AN19NGG (Figure 5B), and RN19NGG (Figure 5C). Within each plot, the density of CRISPR sites is plotted along each chromosome. The density curves, calculated as a smooth Gaussian kernel, are overlaid semi-transparently (orange, blue, or purple). The dotted line indicates the 35 bp standard (on average, TALEN targeting sites are estimated to occur every 35 base pairs and ZFN sites every few hundred base pairs (Sander et al. (2011) Nature Methods 8:67-69; Cermak et al. (2011) Nucleic Acids Res. 39(12):e82)). A bar plot of the cumulative average CRISPR targeting density per human chromosome is shown in Figure 5D. GN19NGG (orange), AN19NGG (blue), and RN19NGG (purple) indicate the respective CRISPR sites. The dotted line indicates the 35 bp standard. Figure 5E shows the frequency of adjacent CRISPR sites in the genome and the distance between them. A bar plot of the frequency and distance of adjacent GN19NGG (orange) and AN19NGG (blue) sites in the genome is shown. Mean and median values ​​are inset into the plot. The SeqLogo for all GN19NGG (top left), AN19NGG (top right), and RN19NGG (bottom) sites in the human genome is shown in Figure 5F. [Figure 5D]Figure 5A, Figure 5B, Figure 5C, Figure 5D, Figure 5E, and Figure 5F show bioinformatics analysis of GN19NGG and AN19NGG sites in the genome. Three panels depict the density of each gRNA site in the human genome: GN19NGG (Figure 5A), AN19NGG (Figure 5B), and RN19NGG (Figure 5C). Within each plot, the density of CRISPR sites is plotted along each chromosome. The density curves, calculated as a smooth Gaussian kernel, are overlaid semi-transparently (orange, blue, or purple). The dotted line indicates the 35 bp standard (on average, TALEN targeting sites are estimated to occur every 35 base pairs and ZFN sites every few hundred base pairs (Sander et al. (2011) Nature Methods 8:67-69; Cermak et al. (2011) Nucleic Acids Res. 39(12):e82)). A bar plot of the cumulative average CRISPR targeting density per human chromosome is shown in Figure 5D. GN19NGG (orange), AN19NGG (blue), and RN19NGG (purple) indicate the respective CRISPR sites. The dotted line indicates the 35 bp standard. Figure 5E shows the frequency of adjacent CRISPR sites in the genome and the distance between them. A bar plot of the frequency and distance of adjacent GN19NGG (orange) and AN19NGG (blue) sites in the genome is shown. Mean and median values ​​are inset into the plot. The SeqLogo for all GN19NGG (top left), AN19NGG (top right), and RN19NGG (bottom) sites in the human genome is shown in Figure 5F. [Figure 5E]Figure 5A, Figure 5B, Figure 5C, Figure 5D, Figure 5E, and Figure 5F show bioinformatics analysis of GN19NGG and AN19NGG sites in the genome. Three panels depict the density of each gRNA site in the human genome: GN19NGG (Figure 5A), AN19NGG (Figure 5B), and RN19NGG (Figure 5C). Within each plot, the density of CRISPR sites is plotted along each chromosome. The density curves, calculated as a smooth Gaussian kernel, are overlaid semi-transparently (orange, blue, or purple). The dotted line indicates the 35 bp standard (on average, TALEN targeting sites are estimated to occur every 35 base pairs and ZFN sites every few hundred base pairs (Sander et al. (2011) Nature Methods 8:67-69; Cermak et al. (2011) Nucleic Acids Res. 39(12):e82)). A bar plot of the cumulative average CRISPR targeting density per human chromosome is shown in Figure 5D. GN19NGG (orange), AN19NGG (blue), and RN19NGG (purple) indicate the respective CRISPR sites. The dotted line indicates the 35 bp standard. Figure 5E shows the frequency of adjacent CRISPR sites in the genome and the distance between them. A bar plot of the frequency and distance of adjacent GN19NGG (orange) and AN19NGG (blue) sites in the genome is shown. Mean and median values ​​are inset into the plot. The SeqLogo for all GN19NGG (top left), AN19NGG (top right), and RN19NGG (bottom) sites in the human genome is shown in Figure 5F. [Figure 5F]Figure 5A, Figure 5B, Figure 5C, Figure 5D, Figure 5E, and Figure 5F show bioinformatics analysis of GN19NGG and AN19NGG sites in the genome. Three panels depict the density of each gRNA site in the human genome: GN19NGG (Figure 5A), AN19NGG (Figure 5B), and RN19NGG (Figure 5C). Within each plot, the density of CRISPR sites is plotted along each chromosome. The density curves, calculated as a smooth Gaussian kernel, are overlaid semi-transparently (orange, blue, or purple). The dotted line indicates the 35 bp standard (on average, TALEN targeting sites are estimated to occur every 35 base pairs and ZFN sites every few hundred base pairs (Sander et al. (2011) Nature Methods 8:67-69; Cermak et al. (2011) Nucleic Acids Res. 39(12):e82)). A bar plot of the cumulative average CRISPR targeting density per human chromosome is shown in Figure 5D. GN19NGG (orange), AN19NGG (blue), and RN19NGG (purple) indicate the respective CRISPR sites. The dotted line indicates the 35 bp standard. Figure 5E shows the frequency of adjacent CRISPR sites in the genome and the distance between them. A bar plot of the frequency and distance of adjacent GN19NGG (orange) and AN19NGG (blue) sites in the genome is shown. Mean and median values ​​are inset into the plot. The SeqLogo for all GN19NGG (top left), AN19NGG (top right), and RN19NGG (bottom) sites in the human genome is shown in Figure 5F. [Figure 6A]Figure 6A, Figure 6B, Figure 6C, Figure 6D, Figure 6E, and Figure 6F show AT / GC genome content and CRISPR site frequency. AT percent (blue) or GC percent (orange) is indicated for human genome, bovine genome, mouse genome, rat genome, chicken genome, and zebrafish genome (Figure 6A). GN19NGG site (orange) and AN19NGG site (blue) frequency normalized according to AT / GC content is indicated (Figure 6B). CRISPR site frequency for GN19NGG site (left), AN19NGG site (middle), and RN19NGG site (right) is shown by strand in Figure 6C. Positive strand (left bar) is indicated in blue-green, and negative strand (right bar) is indicated in purple-red. The frequency of GN19NGG sites (orange) and AN19NGG sites (blue) in Drosophila, C. elegans, and S. cerevisiae is indicated in Figure 6D. Figure 6E shows the percent AT content (blue) or percent GC content (orange), and Figure 6F shows the normalized CRISPR site frequency. [Figure 6B] Figure 6A, Figure 6B, Figure 6C, Figure 6D, Figure 6E, and Figure 6F show AT / GC genome content and CRISPR site frequency. AT percent (blue) or GC percent (orange) is indicated for human genome, bovine genome, mouse genome, rat genome, chicken genome, and zebrafish genome (Figure 6A). GN19NGG site (orange) and AN19NGG site (blue) frequency normalized according to AT / GC content is indicated (Figure 6B). CRISPR site frequency for GN19NGG site (left), AN19NGG site (middle), and RN19NGG site (right) is shown by strand in Figure 6C. Positive strand (left bar) is indicated in blue-green, and negative strand (right bar) is indicated in purple-red. The frequency of GN19NGG sites (orange) and AN19NGG sites (blue) in Drosophila, C. elegans, and S. cerevisiae is indicated in Figure 6D. Figure 6E shows the percent AT content (blue) or percent GC content (orange), and Figure 6F shows the normalized CRISPR site frequency. [Figure 6C]Figure 6A, Figure 6B, Figure 6C, Figure 6D, Figure 6E, and Figure 6F show AT / GC genome content and CRISPR site frequency. AT percent (blue) or GC percent (orange) is indicated for human genome, bovine genome, mouse genome, rat genome, chicken genome, and zebrafish genome (Figure 6A). GN19NGG site (orange) and AN19NGG site (blue) frequency normalized according to AT / GC content is indicated (Figure 6B). CRISPR site frequency for GN19NGG site (left), AN19NGG site (middle), and RN19NGG site (right) is shown by strand in Figure 6C. Positive strand (left bar) is indicated in blue-green, and negative strand (right bar) is indicated in purple-red. The frequency of GN19NGG sites (orange) and AN19NGG sites (blue) in Drosophila, C. elegans, and S. cerevisiae is indicated in Figure 6D. Figure 6E shows the percent AT content (blue) or percent GC content (orange), and Figure 6F shows the normalized CRISPR site frequency. [Figure 6D] Figure 6A, Figure 6B, Figure 6C, Figure 6D, Figure 6E, and Figure 6F show AT / GC genome content and CRISPR site frequency. AT percent (blue) or GC percent (orange) is indicated for human genome, bovine genome, mouse genome, rat genome, chicken genome, and zebrafish genome (Figure 6A). GN19NGG site (orange) and AN19NGG site (blue) frequency normalized according to AT / GC content is indicated (Figure 6B). CRISPR site frequency for GN19NGG site (left), AN19NGG site (middle), and RN19NGG site (right) is shown by strand in Figure 6C. Positive strand (left bar) is indicated in blue-green, and negative strand (right bar) is indicated in purple-red. The frequency of GN19NGG sites (orange) and AN19NGG sites (blue) in Drosophila, C. elegans, and S. cerevisiae is indicated in Figure 6D. Figure 6E shows the percent AT content (blue) or percent GC content (orange), and Figure 6F shows the normalized CRISPR site frequency. [Figure 6E]Figure 6A, Figure 6B, Figure 6C, Figure 6D, Figure 6E, and Figure 6F show AT / GC genome content and CRISPR site frequency. AT percent (blue) or GC percent (orange) is indicated for human genome, bovine genome, mouse genome, rat genome, chicken genome, and zebrafish genome (Figure 6A). GN19NGG site (orange) and AN19NGG site (blue) frequency normalized according to AT / GC content is indicated (Figure 6B). CRISPR site frequency for GN19NGG site (left), AN19NGG site (middle), and RN19NGG site (right) is shown by strand in Figure 6C. Positive strand (left bar) is indicated in blue-green, and negative strand (right bar) is indicated in purple-red. The frequency of GN19NGG sites (orange) and AN19NGG sites (blue) in Drosophila, C. elegans, and S. cerevisiae is indicated in Figure 6D. Figure 6E shows the percent AT content (blue) or percent GC content (orange), and Figure 6F shows the normalized CRISPR site frequency. [Figure 6F] Figure 6A, Figure 6B, Figure 6C, Figure 6D, Figure 6E, and Figure 6F show AT / GC genome content and CRISPR site frequency. AT percent (blue) or GC percent (orange) is indicated for human genome, bovine genome, mouse genome, rat genome, chicken genome, and zebrafish genome (Figure 6A). GN19NGG site (orange) and AN19NGG site (blue) frequency normalized according to AT / GC content is indicated (Figure 6B). CRISPR site frequency for GN19NGG site (left), AN19NGG site (middle), and RN19NGG site (right) is shown by strand in Figure 6C. Positive strand (left bar) is indicated in blue-green, and negative strand (right bar) is indicated in purple-red. The frequency of GN19NGG sites (orange) and AN19NGG sites (blue) in Drosophila, C. elegans, and S. cerevisiae is indicated in Figure 6D. Figure 6E shows the percent AT content (blue) or percent GC content (orange), and Figure 6F shows the normalized CRISPR site frequency. [Figure 7A-B]Figure 7A, Figure 7B, Figure 7C, and Figure 7D show the targeting of AN19NGG in endogenous gene (MERTK) in H7 ES cells by CRISPR. Schematic diagram of MERTK locus and various protein domains is shown in Figure 7A. Target site in exon 2 is shown at large scale below, and CRISPR AN19NGG target site is indicated (sequence shown is SEQ ID NO: 32). Quantification of CRISPR targeting in exon 2 by Surveyor assay is shown in Figure 7B. CRISPR site in exon 2 is depicted above with various primers (arrows) used in Surveyor assay, but both F1:R1 and F2:R2 span the target site, while control PCR product F3:R3 is just outside the target site. Gel from Surveyor assay is shown below with three control products shown on the left, and targeting is shown on the right. Indel % frequency is indicated below. Figure 7C shows Sanger sequencing for mutant cell lines. Clonal cell lines were isolated and sequenced, indicating that CRISPR targeting at the AN19 NGG site results in mutagenesis in this region. Chromatogram alignment shows six unique mutations cloned (wt is SEQ ID NO: 33; Δ12 is SEQ ID NO: 34; Δ1 is SEQ ID NO: 35; Δ2, +2 is SEQ ID NO: 36; Δ6 is SEQ ID NO: 37; Δ7 is SEQ ID NO: 38). Figure 7D shows Western blot analysis of Mertk expression in H7-derived RPE cells. Lanes 1, 3, and 4 indicate knockout cell lines, and lane 2 indicates expression from a heterozygous cell line. [Figure 7C-D]Figure 7A, Figure 7B, Figure 7C, and Figure 7D show the targeting of AN19NGG in endogenous gene (MERTK) in H7 ES cells by CRISPR. Schematic diagram of MERTK locus and various protein domains is shown in Figure 7A. Target site in exon 2 is shown at large scale below, and CRISPR AN19NGG target site is indicated (sequence shown is SEQ ID NO: 32). Quantification of CRISPR targeting in exon 2 by Surveyor assay is shown in Figure 7B. CRISPR site in exon 2 is depicted above with various primers (arrows) used in Surveyor assay, but both F1:R1 and F2:R2 span the target site, while control PCR product F3:R3 is just outside the target site. Gel from Surveyor assay is shown below with three control products shown on the left, and targeting is shown on the right. Indel % frequency is indicated below. Figure 7C shows Sanger sequencing for mutant cell lines. Clonal cell lines were isolated and sequenced, indicating that CRISPR targeting at the AN19 NGG site results in mutagenesis in this region. Chromatogram alignment shows six unique mutations cloned (wt is SEQ ID NO: 33; Δ12 is SEQ ID NO: 34; Δ1 is SEQ ID NO: 35; Δ2, +2 is SEQ ID NO: 36; Δ6 is SEQ ID NO: 37; Δ7 is SEQ ID NO: 38). Figure 7D shows Western blot analysis of Mertk expression in H7-derived RPE cells. Lanes 1, 3, and 4 indicate knockout cell lines, and lane 2 indicates expression from a heterozygous cell line. [Figure 8A-B]Figure 8A, Figure 8B, Figure 8C, and Figure 8D show the analysis of off-target hits induced by gRNA expressed from U6 or H1 at on-target and off-target sites. qRT-PCR analysis of VEGFA T1 gRNA expression levels by titration of H1 promoter (blue) or U6 promoter (orange) is shown in Figure 8A. On-target and off-target analysis for VEGFA T1 is shown in Figure 8B. Surveyor analysis is shown on the left, and target sequences are shown in red on the right with mismatches (T1, SEQ ID NO: 20; OT1-3, SEQ ID NO: 21; OT1-4, SEQ ID NO: 22; OT1-6, SEQ ID NO: 23; OT1-11, SEQ ID NO: 24). FIG. 8C is the same as FIG. 8B, but for VEGFA T3 target (VEGFA T3, SEQ ID NO:25; OT3-1, SEQ ID NO:26; OT3-2, SEQ ID NO:27; OT3-4, SEQ ID NO:28; OT3-18, SEQ ID NO:29). On-target specificity versus off-target specificity for VEGFA T1 is shown in FIG. 8D. The ratio of on-target mutagenesis / off-target mutagenesis for H1 promoter (blue) or U6 promoter (orange) is shown. Values ​​below the dotted line of 1.0 indicate that off-target mutagenesis exceeds on-target mutagenesis. For all parts, on-target and off-target sites are labeled as in Fu et al. ((2013), Nat. Biotechnol., 31(9):822-6) and Cho et al. ((2014), Genome Research, 24:132-141). [Figure 8C-D]Figure 8A, Figure 8B, Figure 8C, and Figure 8D show the analysis of off-target hits induced by gRNA expressed from U6 or H1 at on-target and off-target sites. qRT-PCR analysis of VEGFA T1 gRNA expression levels by titration of H1 promoter (blue) or U6 promoter (orange) is shown in Figure 8A. On-target and off-target analysis for VEGFA T1 is shown in Figure 8B. Surveyor analysis is shown on the left, and target sequences are shown in red on the right with mismatches (T1, SEQ ID NO: 20; OT1-3, SEQ ID NO: 21; OT1-4, SEQ ID NO: 22; OT1-6, SEQ ID NO: 23; OT1-11, SEQ ID NO: 24). FIG. 8C is the same as FIG. 8B, but for VEGFA T3 target (VEGFA T3, SEQ ID NO:25; OT3-1, SEQ ID NO:26; OT3-2, SEQ ID NO:27; OT3-4, SEQ ID NO:28; OT3-18, SEQ ID NO:29). On-target specificity versus off-target specificity for VEGFA T1 is shown in FIG. 8D. The ratio of on-target mutagenesis / off-target mutagenesis for H1 promoter (blue) or U6 promoter (orange) is shown. Values ​​below the dotted line of 1.0 indicate that off-target mutagenesis exceeds on-target mutagenesis. For all parts, on-target and off-target sites are labeled as in Fu et al. ((2013), Nat. Biotechnol., 31(9):822-6) and Cho et al. ((2014), Genome Research, 24:132-141). [Figure 9A-B]Figure 9A and Figure 9B show the characteristics of the U6 promoter versus the H1 promoter in expressing gRNA for CRISPR targeting. The top diagram of Figure 9A shows the endogenous human U6 promoter and transcription start site (SEQ ID NO: 39). The bottom diagram of Figure 9A indicates the use of the U6 promoter to drive gRNAs with different +1 nucleotides. Because U6 requires a G (top left) to start, panels that start with an A (top right), C (bottom left), or T (bottom right) will likely start at the first G downstream, resulting in a truncated gRNA (U6:GN19NGG is SEQ ID NO: 40; U6:AN19NGG is SEQ ID NO: 41; U6:CN19NGG is SEQ ID NO: 42; U6:TN19NGG is SEQ ID NO: 43). The top diagram of Figure 9B shows the endogenous human H1 promoter and transcription start site (SEQ ID NO: 44). The bottom diagram in Figure 9B indicates the use of the H1 promoter to drive gRNAs with different +1 nucleotides. H1 can initiate at G (top left) or A (top right), resulting in full-length gRNAs. H1 has also been reported to allow initiation of transcription at C and T nucleotides, allowing full-length transcripts for any +1 nucleotide downstream of the H1 promoter (H1:GN19NGG is SEQ ID NO:45; H1:AN19NGG is SEQ ID NO:46; H1:CN19NGG is SEQ ID NO:47; H1:TN19NGG is SEQ ID NO:48). [Figure 10A-B]Figure 10A, Figure 10B, Figure 10C, Figure 10D, and Figure 10E show the use of the H1 promoter as a bidirectional promoter to simultaneously express Cas9 protein and guide RNA. The bidirectional H1 promoter is shown to express Cas9 (minus strand) as a pol II transcript to the left, and guide RNA (plus strand) as a pol III transcript to the right (Figure 10A). The entire expression cassette is approximately 4.4 kb. Figure 10B shows the construct used to test for the ability to direct CRISPR-mediated cleavage from the bidirectional H1 construct. The bidirectional construct using a gRNA targeting eGFP was cloned into a plasmid and expressed in human stem cells expressing GFP. Loss of GFP was visually detected (middle panel, arrow), indicating successful expression and targeting of GFP by the expression construct (Figure 10C). Successful CRISPR targeting is also shown via Surveyor assay with the presence of two bands in lanes 2 and 3 (Figure 10D). A bidirectional CRISPR construct using the H1 promoter to generate a compact targeting cassette of approximately 4.75b within the packaging domain of adeno-associated virus is shown in Figure 10E. The SV40 terminator is shown in orange, and the construct is flanked by inverted terminal repeat (ITR) sequences required for virus production. [Figure 10C-D]Figure 10A, Figure 10B, Figure 10C, Figure 10D, and Figure 10E show the use of the H1 promoter as a bidirectional promoter to simultaneously express Cas9 protein and guide RNA. The bidirectional H1 promoter is shown to express Cas9 (minus strand) as a pol II transcript to the left, and guide RNA (plus strand) as a pol III transcript to the right (Figure 10A). The entire expression cassette is approximately 4.4 kb. Figure 10B shows the construct used to test for the ability to direct CRISPR-mediated cleavage from the bidirectional H1 construct. The bidirectional construct using a gRNA targeting eGFP was cloned into a plasmid and expressed in human stem cells expressing GFP. Loss of GFP was visually detected (middle panel, arrow), indicating successful expression and targeting of GFP by the expression construct (Figure 10C). Successful CRISPR targeting is also shown via Surveyor assay with the presence of two bands in lanes 2 and 3 (Figure 10D). A bidirectional CRISPR construct using the H1 promoter to generate a compact targeting cassette of approximately 4.75b within the packaging domain of adeno-associated virus is shown in Figure 10E. The SV40 terminator is shown in orange, and the construct is flanked by inverted terminal repeat (ITR) sequences required for virus production. [Figure 10E]Figure 10A, Figure 10B, Figure 10C, Figure 10D, and Figure 10E show the use of the H1 promoter as a bidirectional promoter to simultaneously express Cas9 protein and guide RNA. The bidirectional H1 promoter is shown to express Cas9 (minus strand) as a pol II transcript to the left, and guide RNA (plus strand) as a pol III transcript to the right (Figure 10A). The entire expression cassette is approximately 4.4 kb. Figure 10B shows the construct used to test for the ability to direct CRISPR-mediated cleavage from the bidirectional H1 construct. The bidirectional construct using a gRNA targeting eGFP was cloned into a plasmid and expressed in human stem cells expressing GFP. Loss of GFP was visually detected (middle panel, arrow), indicating successful expression and targeting of GFP by the expression construct (Figure 10C). Successful CRISPR targeting is also shown via Surveyor assay with the presence of two bands in lanes 2 and 3 (Figure 10D). A bidirectional CRISPR construct using the H1 promoter to generate a compact targeting cassette of approximately 4.75b within the packaging domain of adeno-associated virus is shown in Figure 10E. The SV40 terminator is shown in orange, and the construct is flanked by inverted terminal repeat (ITR) sequences required for virus production. [Figure 11A]11A, 11B, and 11C show hammerhead ribozymes that create the 5' end of guide RNA. A depiction of the 5' cis hammerhead ribozyme (SEQ ID NO: 49) and gRNA (SEQ ID NO: 50) is shown in FIG. 11A. The sequence of the hammerhead ribozyme is indicated, and nucleotides important for catalysis are indicated (critical nucleotides in red, important nucleotides in orange). The location of cleavage is indicated by an arrow. Upon cleavage by the ribozyme (bottom), the resulting gRNA is released without being constrained by the nucleotide at the newly formed 5' position. A construct expressing the hammerhead-gRNA is shown in FIG. 11B. A promoter, typically a pol III promoter such as U6, H1, or T7, can be used to express the 5' cis hammerhead ribozyme, which will release the gRNA after self-cleavage. Targeting of the two loci is shown in the Surveyor assay (HH1=SEQ ID NO:51; HH2=SEQ ID NO:52), along with successful cleavage (arrows) by the 5' cis hammerhead ribozyme (FIG. 11C). [Figure 11B]11A, 11B, and 11C show hammerhead ribozymes that create the 5' end of guide RNA. A depiction of the 5' cis hammerhead ribozyme (SEQ ID NO: 49) and gRNA (SEQ ID NO: 50) is shown in FIG. 11A. The sequence of the hammerhead ribozyme is indicated, and nucleotides important for catalysis are indicated (critical nucleotides in red, important nucleotides in orange). The location of cleavage is indicated by an arrow. Upon cleavage by the ribozyme (bottom), the resulting gRNA is released without being constrained by the nucleotide at the newly formed 5' position. A construct expressing the hammerhead-gRNA is shown in FIG. 11B. A promoter, typically a pol III promoter such as U6, H1, or T7, can be used to express the 5' cis hammerhead ribozyme, which will release the gRNA after self-cleavage. Targeting of the two loci is shown in the Surveyor assay (HH1=SEQ ID NO:51; HH2=SEQ ID NO:52), along with successful cleavage (arrows) by the 5' cis hammerhead ribozyme (FIG. 11C). [Figure 11C]11A, 11B, and 11C show hammerhead ribozymes that create the 5' end of guide RNA. A depiction of the 5' cis hammerhead ribozyme (SEQ ID NO: 49) and gRNA (SEQ ID NO: 50) is shown in FIG. 11A. The sequence of the hammerhead ribozyme is indicated, and nucleotides important for catalysis are indicated (critical nucleotides in red, important nucleotides in orange). The location of cleavage is indicated by an arrow. Upon cleavage by the ribozyme (bottom), the resulting gRNA is released without being constrained by the nucleotide at the newly formed 5' position. A construct expressing the hammerhead-gRNA is shown in FIG. 11B. A promoter, typically a pol III promoter such as U6, H1, or T7, can be used to express the 5' cis hammerhead ribozyme, which will release the gRNA after self-cleavage. Targeting of the two loci is shown in the Surveyor assay (HH1=SEQ ID NO:51; HH2=SEQ ID NO:52), along with successful cleavage (arrows) by the 5' cis hammerhead ribozyme (FIG. 11C). [Figure 12] Figure 12 shows a regulatable CRISPR construct that uses an aptazyme to process gRNA in the presence of a specific aptamer. In particular, Figure 12 depicts a theophylline aptamer (orange) fused to helix II of a hammerhead ribozyme, which is 5' to the gRNA (blue), forming a theophylline aptazyme. The binding of theophylline stabilizes helix II, which then allows hammerhead self-cleavage, releasing the gRNA (SEQ ID NO: 50). Here, the gRNA can be targeted for cleavage by the CRISPR system with Cas9. Hammerhead ribozyme, SEQ ID NO: 55. [Figure 13] Figure 13 shows the genomic organization of the H1RNA and PARP-2 loci. Representations drawn to scale for the right-transcribed PARP-2 gene (blue) and the left-transcribed H1RNA gene (orange) are shown at the top. At the bottom are enlarged regions of the promoter regions of both genes. [Figure 14] Figure 14 shows an eGFP reporter for H1 pol II activity. The human H1 promoter sequence is oriented for rightward transcription of eGFP by pol II. The three components that are optimized are indicated in italics. [Figure 15] Figure 15 shows expression of the eGFP reporter, the top panel indicates the endogenous H1 promoter and the bottom panel indicates expression driven by the Kozak sequence. [Figure 16A-B] Figure 16A and Figure 16B show bidirectional expression of Cas9 and gRNA. A schematic diagram of the bidirectional targeting construct is shown in Figure 16A. A comparison of cleavage at two different loci using standard two-vector delivery (lanes 2 and 5) or single targeting plasmid delivery (lanes 3 and 6) is shown in Figure 16B. The % genome modification determined by T7EI assay is indicated below each lane. [Figure 17] Figure 17 shows the rhodopsin locus from hRho:GFP knock-in mice. At the top, the respective mouse and human sequences are indicated (drawn to scale) above a schematic of the rho promoter region to the end of the 3'UTR. At the bottom, a magnified region is shown (arrowhead) indicating the location of P23 and gRNA. [Figure 18A-B]Figures 18A, 18B, and 18C show specific targeting of the P23H allele in vivo. FIG. 18A shows targeting of P23 (WT (C57BL / 6J, SEQ ID NO: 56; P23H (CCC→CAC), SEQ ID NO: 57; WT (CAST / EiJ), SEQ ID NO: 58). FIG. 18B shows sequencing for rhodopsin from two wild-type mouse strains, with SNPs indicated by arrows (C57BL / 6J DNA sequence, SEQ ID NO: 56; C57BL / 6J protein sequence, SEQ ID NO: 59; CAST / EiJ+ / + DNA sequence, SEQ ID NO: 58; CAST / EiJ+ / + protein sequence, SEQ ID NO: 59). FIG. 18C shows the P23H crossbreeding scheme. P23H homozygous mice (black) are crossed with WT Cast (white) and the resulting heterozygous pups (grey) are treated with subretinal delivery of AAV5. [Figure 18C] Figures 18A, 18B, and 18C show specific targeting of the P23H allele in vivo. FIG. 18A shows targeting of P23 (WT (C57BL / 6J, SEQ ID NO: 56; P23H (CCC→CAC), SEQ ID NO: 57; WT (CAST / EiJ), SEQ ID NO: 58). FIG. 18B shows sequencing for rhodopsin from two wild-type mouse strains, with SNPs indicated by arrows (C57BL / 6J DNA sequence, SEQ ID NO: 56; C57BL / 6J protein sequence, SEQ ID NO: 59; CAST / EiJ+ / + DNA sequence, SEQ ID NO: 58; CAST / EiJ+ / + protein sequence, SEQ ID NO: 59). FIG. 18C shows the P23H crossbreeding scheme. P23H homozygous mice (black) are crossed with WT Cast (white) and the resulting heterozygous pups (grey) are treated with subretinal delivery of AAV5. [Figure 19] Figure 19 shows allele-specific targeting of the rhodopsin locus. A comparison of the cleavage of the C57BL / 6J (P23H) allele is shown versus the cleavage of a single base mismatch (Cast). The percent genome modification determined by T7EI assay is indicated below. DETAILED DESCRIPTION OF THE PREFERRED EMBODIMENTS

[0022] The patent or application file contains at least one drawing executed in color. Copies of this patent or patent application publication with any drawings are available upon request and payment of the necessary fee. For example, they are provided by the Patent Office.

[0023] Detailed Description Hereinafter, the subject matter disclosed herein will be described with reference to the accompanying drawings. However, the present disclosure is not intended to be limiting, and is not intended to be limiting, but rather to be limiting. , some embodiments are shown. Like numbers refer to like elements throughout. The subject matter disclosed herein may be embodied in many different forms, and may be The present invention should not be construed as being limited to the embodiments shown, but rather as being limited to the embodiments shown. The embodiments are provided so that this disclosure will satisfy applicable regulatory requirements. Those skilled in the art to which the subject matter pertains will recognize that the present invention is Those skilled in the art having the benefit of the teachings set forth herein will readily appreciate that the subject matter disclosed herein is Numerous modifications and other embodiments of the present invention will be apparent to those skilled in the art. The subject matter is not limited to the specific embodiments disclosed and may be modified and implemented in other ways. It is understood that embodiments are intended to fall within the scope of the appended claims. sea ​​bream.

[0024] Zinc finger nucleases (ZFNs) (Porteus and Baltimore, 2003; Sc ience, 300:763; Miller et al. (2007), Nat. Biotechnol., 25:7 78-785; Sander et al. (2011), Nature Methods, 8:67-69; Woo d et al. (2011), Science 333:307) and transcription activator-like effectors -nuclease (TALEN) (Wood et al. (2011), Science 333:307 Boch et al. (2009), Science 326:1509-1512; Moscou and Bog danove (2009), Science, 326:1501; Christian et al. (2010), Genetics, 186:757-761; Miller et al. (2011), Nat. Biotechnol. , 29:143-148; Zhang et al. (2011), Nat. Biotechnol., 29:1 49-153; Reyon et al. (2012), Nat. Biotechnol. 30:460-465 Genome editing technologies such as genomic DNA engineering (see page 1) have enhanced the ability to create targeted genome modifications. These techniques have been developed to provide the potential for precise correction of disease mutations. Although effective, both ZFN and TALEN pairs have limited ability to target a given DNA target site. This requires the synthesis of large, unique recognition proteins for each gene, which is hampered by practical limitations. Several groups have recently demonstrated the use of engineered type II CRISPR / Cas9 systems. We propose a novel approach to genome editing that circumvents these key limitations. (Cong et al. (2013), Science, 339:819-823; J Inek et al. (2013), eLife, vol. 2: e00471; Mali et al. (2013), Science , 339:823-826; Cho et al. (2013), Nat. Biotechnol., 31:2 30-232; Hwang et al. (2013), Nat. Biotechnol. 31:227-229 Unlike ZFNs and TALENs, which are relatively time-consuming and labor-intensive to create, Cas9 protein nuclease coupled with guide RNA (gRNA) Activity-dependent CRISPR constructs are simple and fast to synthesize and can be multiplexed However, despite their relative ease of synthesis, CRISP R has the potential to enhance targeting, which is a function of both the properties of Cas9 itself and the synthesis of its gRNA. There are technical limitations regarding their access to the addressable genomic space.

[0025] CRISPR cleavage occurs within a 20-nucleotide DNA sequence and 3′ to the target site. The essential protospacer adjacent motif ( PAM) (Jinek et al., 2012, Science 337:816-821). In theory, CRISPR technology could be used to , any unique N 20 -PAM sequence can be targeted. The DNA binding specificity of the PAM sequence varies depending on the species from which the specific Cas9 is derived. Currently, Cas is the least restrictive and most commonly used. 9 protein is derived from S. pyogenes, which recognizes the sequence NGG, thus Any unique 21-nucleotide sequence in the genome followed by two guanosine nucleotides (N 20 NGG) can be targeted by the protein component. The expansion of the available targeting space has led to the development of novel Cas9 proteins with altered PAM requirements. Discovery and Use of Proteins (Cong et al., 2013, Science 339:819-823) Hou et al. (2013), Proc. Natl. Acad. Sci. USA, 110(39):1 5644-9), or the ongoing creation of novel Cas9 variants, A second technical limitation of the CRISPR system is that This results from expression of the gRNA, which initiates at the 5' guanosine nucleotide. The use of the type III class of enzyme III promoters allows these short non-coding transcripts to be expressed sufficiently and all elements required for transcription, except for 1+ nucleotides, are It is particularly suitable for expressing gRNA because it is contained within the upstream promoter region. The commonly used U6 promoter requires a guanosine nucleotide to initiate transcription. Therefore, the use of the U6 promoter allows the targeting site in the genome to be 19 N Further constrained by GG (Mali et al. (2013) Science 339:823-826 Ding et al. (2013), Cell Stem Cell, 12:393-394). In vitro transcription using the motor, T3 promoter, or SP6 promoter Alternative approaches, such as those described above, would also require initiation with a guanosine nucleotide (Adhy a et al. (1981), Proc. Natl. Acad. Sci. USA, 78:147-151; Melton et al. (1984), Nucleic Acids Res. 12:7035-7056; Plei (1998), RNA, 4:1313-1317).

[0026] The subject matter disclosed herein is a method for expressing a guide RNA (gRNA or sgRNA). The use of the H1 promoter has improved the accuracy of CRISPR / Cas9 systems in many genomes. , regarding the discovery that the specificity of the 5' nucleotide is increased beyond doubling. The H1 promoter driving the gRNA is used to express endogenous genes and The ability to 19 NGG genomic sites and GN 19 Target any of the NGG genomic sites It can also be used for targeting. 19 NGG sites are found in the human genome , G.N. 19 The increased targeting space, occurring at a high frequency of over 15%, also It also enhances human genes and disease loci. Thus, the subject matter disclosed herein , expanding the targeting space within the human genome and within other eukaryotic species beyond doubling. This modification enhances the versatility of CRISPR technology. In the genome, existing CRISPR, TALEN, or zinc finger technologies This allows for higher resolution targeting.

[0027] The presently disclosed subject matter also provides a bidirectional vector that simultaneously expresses Cas9 and gRNA. The use of the H1 promoter sequence as a virulent promoter results in a compact and A functional expression cassette that can be inserted and delivered by a viral vector. This invention also relates to the discovery that it is possible to create sets.

[0028] The presently disclosed subject matter also provides methods for expressing gRNAs in vivo and in RNA ribozymes and regulatable approaches to regulate gRNA expression in vivo It also concerns the use of Tazyme.

[0029] I. Expression of CRISPR guide RNA using the H1 promoter A. Composition

[0030] In some embodiments, the subject matter disclosed herein provides a) a method for the detection of CRISPR-Cas systems. operably linked to at least one nucleotide sequence encoding a gene encoding a target RNA (gRNA). a gRNA hybridizing to a target sequence of a DNA molecule in a cell; and the DNA molecule encodes one or more gene products that are expressed in the cell. a) a regulatory element operable in the cell to regulate the expression of the Cas9 protein; and a regulatory element operably linked to a nucleotide sequence encoding a protein. A non-naturally occurring CRISPR-Cas system comprising a plurality of vectors, comprising component (a) and (b) are placed in the same or different vectors of the system, and the gRNA is The Cas9 protein targets and hybridizes to the sequence, and then binds the DNA molecule. The present invention provides a CRISPR-Cas system that alters the expression of one or more gene products by cleaving a gene that is a target gene. Provide.

[0031] In some embodiments, the subject matter disclosed herein provides a) a method for the detection of CRISPR-Cas systems. operably linked to at least one nucleotide sequence encoding a gene encoding a target RNA (gRNA). a gRNA that binds to a target sequence of a DNA molecule in a eukaryotic cell; The hybridization results in a DNA molecule encoding one or more gene products that are expressed in eukaryotic cells. b) a regulatory element operable in a eukaryotic cell, A regulatory element operably linked to a nucleotide sequence encoding a type I Cas9 protein. and one or more vectors comprising the Thus, components (a) and (b) are placed in the same or different vectors of the system. The gRNA targets and hybridizes to the target sequence and binds to the Cas9 protein. CRISP, a process in which a protein cleaves a DNA molecule and alters the expression of one or more gene products. The R-Cas system is provided. In one embodiment, the target sequence is any nucleotide, e.g., N2 In some embodiments, the target sequence may be a sequence beginning with the nucleotide ONGG. Array AN 19 In some embodiments, the target sequence comprises the nucleotide sequence GN1 In some embodiments, the target sequence comprises the nucleotide sequence CN 19 NGG In some embodiments, the target sequence comprises the nucleotide sequence TN 19 Including NGG. In one embodiment, the target sequence is the nucleotide sequence AN 19 NGG or GN 19 NGG In another embodiment, the Cas9 protein is codon-optimized for expression in a cell. In another embodiment, the Cas9 protein is codon-optimized for expression in eukaryotic cells. In a further aspect, the eukaryotic cell is a mammalian cell or a human cell. In yet another embodiment, the expression of one or more gene products is reduced.

[0032] The presently disclosed subject matter also includes non-human ovarian cancer cells, including vectors that include a bidirectional H1 promoter. A naturally occurring CRISPR-Cas system, comprising: a) a bidirectional H1 promoter; At least one nucleotide sequence encoding a guide RNA (gRNA) for the SPR-Cas system a control element that provides for the transcription of a gene sequence in one direction, The DNA molecule hybridizes to a target sequence and the DNA molecule is expressed in a eukaryotic cell. a) a regulatory element encoding a gene product or products; and b) a type II Cas9 protein. and control elements providing for transcription in opposite directions of the nucleotide sequence encoding The RNA targets and hybridizes to the target sequence, inducing the Cas9 protein CRISPR- Cas systems are also provided. In one embodiment, the target sequence is any nucleotide, e.g., N 20 N The target sequence may be a sequence beginning with GG. In some embodiments, the target sequence is the nucleotide sequence AN 19 In some embodiments, the target sequence comprises the nucleotide sequence GN 19 N In some embodiments, the target sequence comprises the nucleotide sequence CN 19 Contains NGG In some embodiments, the target sequence is the nucleotide sequence TN 19 Including NGG. In an embodiment, the target sequence is the nucleotide sequence AN 19 NGG or GN 19 Contains NGG In another embodiment, the Cas9 protein is codon-optimized for expression in a cell. In another embodiment, the Cas9 protein is codon-optimized for expression in eukaryotic cells. In a further aspect, the eukaryotic cell is a mammalian cell or a human cell. In another embodiment, the expression of one or more gene products is reduced.

[0033] In some embodiments, the CRISPR complex is detected in the nucleus of a cell (e.g., a eukaryotic cell). One or more nuclear sites long enough to drive accumulation of a viable amount of CRISPR complexes Without wishing to be bound by theory, nuclear localization sequences include those found in eukaryotic cells. Although not required for CRISPR complex activity in the system, the inclusion of such sequences enhances It is believed that the activity of the nucleus-specific nucleic acid molecule is enhanced by the nucleus-specific nucleic acid molecule targeting activity. In some embodiments, the CRISPR enzyme is a type II CRISPR enzyme. In some embodiments, the CRISPR enzyme is a Cas9 enzyme. The as9 enzyme is specific for S. pneumoniae, S. pyogenes, or S. thermophilus. mophilus Cas9 and may include mutant Cas9s derived from these organisms. The enzyme can be a homolog or ortholog of Cas9.

[0034] Generally, and throughout this specification, the term "vector" refers to a vector that is linked to another A vector is a nucleic acid molecule capable of transporting nucleic acids. A vector can be a single-stranded nucleic acid molecule, a double-stranded A nucleic acid molecule that is a single strand or partially double stranded; nucleic acid molecules that contain no free ends (e.g., circular); nucleic acid molecules that contain DNA; a nucleic acid molecule comprising a NA, or a nucleic acid molecule comprising both; and A variety of other polynucleotides, including but not limited to, one type of vector Additional DNA segments may be inserted, such as by standard molecular cloning techniques. Another type of vector is a "plasmid", which refers to a circular double stranded DNA loop. vectors, in which the viral DNA or RNA sequences are viruses (e.g., retroviruses, replication defective retroviruses, adenoviruses, replication defective adenoviruses, present in vectors for packaging into adenoviruses, adenoviruses, and adeno-associated viruses Viral vectors also contain vectors that are used to transfect host cells. It also includes polynucleotides carried by

[0035] Certain vectors are capable of autonomous replication in a host cell into which they are introduced (e.g., (e.g., bacterial vectors with a bacterial origin of replication and episomal mammalian vectors). The vector (e.g., a non-episomal mammalian vector) when introduced into a host cell can They integrate into the genome of the host cell and are thus replicated along with the host genome. Certain vectors are capable of directing the expression of genes to which they are operatively linked. In the present specification, such vectors are referred to as "expression vectors." Common expression vectors of use in the methods are often in the form of plasmids.

[0036] A recombinant expression vector is a vector for expressing a nucleic acid of the presently disclosed subject matter in a host cell. The nucleic acid may be in a form suitable for expression of the nucleic acid, such as a recombinant expression vector, One or more regulatory elements, which may be selected based on the host cell to be used, "Regulatory elements" refers to those regulatory elements operably linked to the nucleic acid sequence that they express.

[0037] "Operably linked" in a recombinant expression vector means that the nucleotide sequence of interest is Expression of the nucleotide sequence (e.g., expression in an in vitro transcription / translation system or expression in a vector) When the target gene is introduced into a host cell, the target gene is substituted with a regulatory element in a manner that allows expression in the host cell. The term "connected" is intended to mean that the link is connected to a

[0038] The term "regulatory element" includes promoters, enhancers, and internal ribosomal invasion sites. Intra-receptor insertion site (IRES), and other expression control elements (e.g., polyadenylation signals Such regulatory elements are intended to include transcription termination signals, such as a poly U sequence. For example, see Goeddel (1990), Gene Expression Technology: Methods in Enzymology, Vol. 185, Academic Press, San Diego, Calif. Regulatory elements direct the constitutive expression of nucleotide sequences in many types of host cells. Regulatory elements that direct and regulate expression of a nucleotide sequence only within a particular host cell. and a regulatory element (e.g., a tissue-specific regulatory sequence) that directs the expression of a tissue-specific promoter. The target is primarily a desired tissue of interest, e.g., muscle, neurons, bone, skin, blood, specific Direct expression within a target organ (e.g., liver, pancreas) or specific cell type (e.g., lymphocytes) Regulatory elements can also be added in a cell cycle-dependent or developmental stage-dependent manner. It is expressed in a time-dependent manner, including a tissue-specific manner, and may be tissue-type specific. May be non-type specific, may be cell type specific, may be non-cell type specific Expression can also be directed.

[0039] In some embodiments, the vector comprises one or more pol III promoters, or multiple pol II promoters, one or more pol I promoters, or combinations thereof. Examples of pol III promoters include the U6 promoter and Examples of pol II promoters include, but are not limited to, the pol II and H1 promoters. , the long terminal repeat promoter of the retrovirus Rous sarcoma virus (RSV) (optional with RSV enhancer), cytomegalovirus (CMV) promoter (optional With the CMV enhancer selected (e.g., Boshart et al., 1985, Cell, 41 Vol.: 521-530), SV40 promoter, dihydrofolate reductase promoter -, β-actin promoter, phosphoglycerol kinase (PGK) promoter, and the EF1α promoter, but are not limited to these.

[0040] The term "regulatory element" also includes WPRE; CMV enhancer; HTLV- The R-U5' segment in the LTR of I (Takebe et al. (1988), Mol. Cell. Biol., 8:466-472); SV40 enhancer; and rabbit β-globin exon The intron sequence between exon 2 and exon 3 (O'Hare et al. (1981), Proc. Natl. Ac. ad. Sci. USA., vol. 78(3): pp. 1527-31) Those skilled in the art will appreciate that the design of an expression vector depends on the selection of the host cell to be transformed, It will be appreciated that the degree of expression may depend on factors such as the level of expression desired. and introducing the fusion protein encoded by the nucleic acid described herein into the cell. Proteins or fusion peptides (e.g., CRISPR (clustered regular ly interspersed short palindromic repeat ) transcripts, CRISPR proteins, CRISPR enzymes, their mutant forms, and their fusions A transcript, protein, or peptide can be produced, including a transcript, protein, or peptide (e.g., a peptide that is a Advantageous vectors include lentiviruses and adeno-associated viruses. The type of target can also be selected to target specific cell types. .

[0041] "Polynucleotide," "Nucleotide," "Nucleic Acid," and The terms "oligonucleotides" are used interchangeably. Nucleotides of any length that are nucleotides or ribonucleotides, or analogs thereof. Polynucleotides refer to the polymeric form of a nucleic acid. Polynucleotides can have any three-dimensional structure. and may perform any known or unknown function. Typical examples are: coding or non-coding regions of genes or gene fragments, Multiple loci (single locus), exons, introns, messengers -RNA (mRNA), transfer RNA, ribosomal RNA, small interfering RNA (siRNA) , short hairpin RNA (shRNA), microRNA (miRNA), ribozyme, c DNA, recombinant polynucleotides, branched polynucleotides, plasmids, vectors, any isolated DNA of any sequence, isolated RNA of any sequence, nucleic acid probes, and primers. A nucleotide may be one or more nucleotides, such as methylated nucleotides and nucleotide analogs. If present, the modification to the nucleotide structure may be It can be applied before the assembly of the polymer or after the assembly of the polymer. The sequence of nucleotides may be interrupted by non-nucleotide components. Polynucleotides can be modified by polymerisation, such as by conjugation with labelling components. It can be further modified later.

[0042] In an embodiment of the subject matter disclosed herein, "chimeric RNA," "chimeric guide RNA," The terms "guide RNA," "single guide RNA," and "synthetic guide RNA" are used interchangeably herein. The term "guide sequence" is used interchangeably to refer to a polynucleotide sequence that comprises a guide sequence. The term "guide" refers to a sequence of approximately 20 bp within the guide RNA that specifies the target site. or "spacer."

[0043] The term "wild type" as used herein refers to a wild type variant of a gene that is in the art as understood by those of skill in the art. The term refers to a typical form of an organism, strain, gene, or characteristic that occurs in nature, It refers to a form that is distinguished from a mutant or variant form.

[0044] As used herein, the term "variant" refers to a variant that deviates from naturally occurring. "The term "non-linear" is to be understood as meaning the display of a pattern of properties that deviate from the linear pattern.

[0045] The terms "non-naturally occurring" and "engineered" are used interchangeably and do not refer to any human intervention. The term when referring to a nucleic acid molecule or a polypeptide refers to a nucleic acid molecule or polypeptide. The peptides are at least one other component with which they are naturally associated and found in nature. It means that it is absent or at least substantially absent.

[0046] "Complementarity" refers to any combination of conventional Watson-Crick base pairing or other non-conventional base pairing. Percent complementarity refers to the ability of a nucleic acid to form hydrogen bonds with another nucleic acid sequence. , capable of forming hydrogen bonds (e.g., Watson-Crick base pairing) with a second nucleic acid sequence. Indicates the percentage of residues in an acid molecule (e.g., 5, 6, 7, 8, 9 out of 10) , 10, it is 50%, 60%, 70%, 80%, 90%, and 100% complementary. "Perfectly complementary" means that all contiguous residues of a nucleic acid sequence have the same number of identical residues as in a second nucleic acid sequence. "Substantially complementary" as used herein means that the adjacent residues will hydrogen bond with each other. , 8, 9, 10, 11, 12, 13, 14, 15, 16, 17, 18, 19, 20, 21 , 22, 23, 24, 25, 30, 35, 40, 45, 50 or more At least 60%, 65%, 70%, 75%, 80%, 85% over the entire area of ​​the leotide , 90%, 95%, 97%, 98%, 99%, or 100% complementarity. It refers to two nucleic acids that hybridize under stringent conditions or that bind to one another.

[0047] As used herein, "stringent conditions" for hybridization refer to conditions under which In this method, nucleic acids having complementarity to a target sequence hybridize primarily to the target sequence, while non-target sequences hybridize primarily to the target sequence. Stringent conditions are generally sequence-dependent. and varies depending on a number of factors. In general, the longer the sequence, the more likely it is that the sequence will be able to bind to its target sequence. A non-limiting example of stringent conditions is described in Tijssen et al. (1993), Laboratory Techniques In Biochemistry And Molecular Biolog y-Hybridization With Nucleic Acid Probes, Part 1, Chapter 2, “Overview of princi ples of hybridization and the strategy of nucleic acid probe assay" It is described in detail in Elsevier, NY.

[0048] "Hybridization" refers to the reaction of one or more polynucleotides to form a nucleic acid. This refers to a reaction that forms a complex that is stabilized through hydrogen bonds between the bases of the leucine residues. Binding may occur by Watson-Crick base pairing or by Hoogsteen binding. The complex may occur in a sequence-specific manner or in any other sequence-specific manner. Two chains forming a structure, three or more chains forming a multichain complex, self-binding Hybridization may include single stranded, hybridized, or any combination thereof. A PCR reaction is a more extensive process, such as initiating a PCR or cleaving a polynucleotide with an enzyme. The steps may include: selecting sequences capable of hybridizing to a given sequence from a given It is referred to as the "complement" of a given sequence.

[0049] As used herein, "expression" refers to the synthesis of a polynucleotide from a DNA template (such as an mRNA or other RNA transcripts, and / or The process by which the transcript is subsequently translated into a peptide, polypeptide, or protein. The polypeptide and the encoded polypeptide are collectively referred to as the "gene product." If the nucleotide is derived from genomic DNA, expression is via splicing of the mRNA in eukaryotic cells. It may include

[0050] As used herein, the terms "polypeptide," "peptide," and "protein" are used interchangeably. Used interchangeably, to refer to a polymer of amino acids of any length. A polymer can be linear or They may be branched, may contain modified amino acids, and may contain non-amino acid intermediates. The term also refers to modified amino acid polymers, e.g., those having disulfide bonds. synthesis, glycosylation, lipidation, acetylation, phosphorylation, or conjugation with labeling moieties. The present invention also encompasses amino acid polymers that have been subjected to any other manipulations, such as gating.

[0051] As used herein, the term "amino acid" refers to glycine, as well as the D optical isomers and Natural amino acids, including both the R and L optical isomers, as well as amino acid analogs and peptidomimetics. amino acids and / or unnatural or synthetic amino acids.

[0052] Practice of the subject matter disclosed herein is not limited to the disclosed embodiments, unless otherwise indicated. Conventional techniques within the skill of the art, including immunology, biochemistry, chemistry, molecular biology, , microbiology, cell biology, genomics, and recombinant DNA techniques (Sambrook, Fritsch, and Maniatis (1989), Molecular Cloning: A Laboratory Manual, 2nd edition; Ausubel et al. (1987), Current Protocols in Molecular Biology; MacPherson (1995), Methods in Enzymology (Academic Press, Inc.), PCR 2: A Practical Approach; edited by Harlow and Lane (1988), Antibodies, A Laboratory The present invention is based on the Laboratory Manual of Animal Cell Culture (ed. Freshney, 1987).

[0053] Some embodiments of the presently disclosed subject matter include vectors comprising one or more vectors. Vectors are vectors that are used to express CR in prokaryotic or eukaryotic cells. ISPRs are designed for expression of transcripts (e.g., nucleic acid transcripts, proteins, or enzymes). For example, CRISPR transcripts can be expressed in Escherichia coli. in bacterial cells such as yeast and yeast strains, in insect cells (using baculovirus expression vectors), The vector can be expressed in either intracellular or mammalian cells. For suitable host cells, see Go eddel (1990), Gene Expression Technology: Methods in Enzymology, 1 85, Academic Press, San Diego, Calif. In particular, the recombinant expression vector can comprise, for example, a T7 promoter regulatory sequence and a T7 polymerase It can also be transcribed and translated in vitro using.

[0054] The vector can be introduced into and propagated in prokaryotes. In some embodiments, prokaryotes are used to amplify copies of a vector that is introduced into a eukaryotic cell. or intermediate vectors in the preparation of vectors to be introduced into eukaryotic cells (e.g., Used as part of a virus vector packaging system (to amplify plasmids) In some embodiments, the prokaryotic organism is one or more of a vector for delivery to a host cell or host organism. By amplifying copies of the vector, such as by providing multiple sources of protein, one or more Used to express nucleic acids. Expression of proteins in prokaryotes can be achieved using fusion proteins or is a constitutive or inducible promoter directing expression of a non-fusion protein This is best performed in Escherichia coli, with vectors containing many.

[0055] Fusion vectors are used to express the amino terminus of a recombinant protein or other protein encoded therein. Such fusion vectors can be used to (i) express recombinant proteins (ii) to increase the solubility of the recombinant protein; and and (iii) by acting as a ligand in affinity purification. The fusion expression vector may serve one or more purposes, such as to aid in the purification of the protein. In the laboratory, the purification of the fusion protein is followed by separation of the recombinant protein from the fusion moiety. To this end, a proteolytic cleavage site may be provided at the junction of the fusion moiety and the recombinant protein. Such enzymes, and their cognate recognition sequences, are often introduced into the Examples of fusion expression vectors include glutathione, thrombin, and enterokinase. Glycoproteinase (GST), maltose binding protein, or proteinase Each of the vectors A and B is fused to a target recombinant protein, pGEX (Pharmaceutical a Biotech Inc; Smith and Johnson (1988), Gene 67:31 ~40 pages), pMAL (New England Biolabs, Beverly, M. ass.), and pRIT5 (Pharmacia, Piscataway, NJ ).

[0056] An example of a suitable inducible non-fusion E. coli expression vector is pTrc (Amran et al., 1988). (1990), Gene 69:301-315) and pET 11d (Studier et al. (1990), (2013), Gene Expression Technology: Methods in Enzymology, Vol. 185, Academic Press, San Diego, Calif.

[0057] In some embodiments, the vector is a yeast expression vector. An example of a vector for expression in romyces cerivisae is pYepSec 1 (Baldari et al., 1987, EMBO J. 6:229-234), pMFa (Kuija n and Herskowitz (1982), Cell 30:933-943), pJRY88 (Schultz et al., 1987, Gene, 54:113-123), pYES2 (Inv Nitrogen Corporation, San Diego, Calif., and and picZ (InVitrogen Corp, San Diego, Calif.). include.

[0058] In some embodiments, the vector is expressed in a mammalian cell using a mammalian expression vector. Examples of mammalian expression vectors include , pCDM8 (Seed (1987), Nature, 329:840) and pMT2PC (Kaufman et al. (1987), EMBO J. 6:187-195). When used in cells, the control functions of the expression vector are controlled by one or more regulatory elements. For example, commonly used promoters are Viruses, Adenovirus 2, Cytomegalovirus, Simian Virus 40, and From other viruses as disclosed herein and known in the art. For other expression systems suitable for both recombinant and eukaryotic cells, see, e.g., Sambrook et al. (1989); lecular Cloning: A Laboratory Manual, 2nd edition, Cold Spring Harbor Laborato ry, Cold Spring Harbor Laboratory Press, Cold Spring Harbor, NY. See Chapter 17.

[0059] In some embodiments, the recombinant mammalian expression vector directs expression of the nucleic acid in a particular cell type. and preferentially directing (e.g., using tissue-specific regulatory elements) the nucleic acid to be expressed. Tissue-specific regulatory elements are known in the art. A non-limiting example of a suitable tissue-specific promoter is the albumin promoter (liver-specific; Pinkert et al. (1987) Genes Dev. 1:268-277) ROMOTE (Calame and Eaton (1988) Adv. Immunol. 43:235-2 75), in particular the T cell receptor (Winoto and Baltimore (1989), EMBO J., 8 Vol.: 729-733) and immunoglobulins (Baneiji et al. (1983), Cell, 33 Queen and Baltimore (1983), Cell, 33:741- 748), neuron-specific promoters (e.g., neurofilament promoters), Byrne and Ruddle (1989), Proc. Natl. Acad. Sci. USA, vol. 86: 5473-5477), pancreatic specific promoter (Edlund et al. (1985), Science 230:912-916), as well as mammary gland-specific promoters (e.g., whey protein Motors; U.S. Pat. No. 4,873,316 and European Patent Publication No. 264,166 Also included are developmentally regulated promoters, such as mouse hox promoters (Kessel and and Gruss (1990), Science 249:374-379) and α-fetotane Protein promoters (Campes and Tilghman (1989), Genes Dev. 3:53 (pp. 7-546) is also included.

[0060] In some embodiments, the gene is a gene that is capable of driving expression of one or more elements of a CRISPR system. Thus, the regulatory element is operably linked to one or more elements of the CRISPR system. Generally, SPIDR (spacer interspersed direct CRISPR (clustered random access memory) rly interspaced short palindromic repeat ) constitute a family of DNA loci that are usually specific to a particular bacterial species. The PR locus is a member of the E. coli (Ishino et al. (1987) J. Bacteriol. 169: 5429-5433; and Nakata et al. (1989), J. Bacteriol. 171:3 pp. 553-3556) and related genes. Similar interspersed SSRs include a significantly different class of SSRs. Haloferax mediterranei, Streptococcus p. yogenes, Anabaena spp., and Mycobacterium tuber It has also been identified in B. culosis (Groenen et al. (1993), Mol. Microbiol. ., vol. 10:1057-1065; Hoe et al. (1999), Emerg. Infect. Dis., 5 Volume: pp. 254-263; Masepohl et al. (1996), Biochim. Biophys. Acta, 130 7:26-30; and Mojica et al. (1995), Mol. Microbiol. 17:85 ~93 pages. CRISPR loci are classified into short regularly spaced sequences (SRSRs). The repeat structure, called "paced repeat," is what distinguishes it from other SSRs. This is typical (Janssen et al., 2002, OMICS J. Integ. Biol. 6:2 3-33; and Mojica et al. (2000), Mol. Microbiol. 36:244-24 (p. 6). In general, repeats are regular repeats with unique intervening sequences that are substantially constant in length. These are short elements that occur in clusters separated by (I. Microbiol., vol. 36:244-246). The repeat sequence is highly conserved among strains. However, the number of interspersed repeats and the sequence of the spacer region typically vary among strains. (van Embden et al., 2000, J. Bacteriol. 182:2393-2394) CRISPR loci have been identified in over 40 prokaryotes (e.g., Jansen et al. (2013)). 02), Mol. Microbiol., 43:1565-1575; and Mojica et al. (200 5), J. Mol. Evol., vol. 60: 174-82), and the genus Aeropyrum , Pyrobaculum sp., Sulfolobus sp., Archaeoglobus sp. , Halocarcula spp., Methanobacteriumn spp., Methano coccus, Methanosarcina, Methanopyrus, Py rococcus sp., Picrophilus sp., Thermoplasma sp., Cor ynebacterium spp., Mycobacterium spp., Streptomyce Genus S, Genus Aquifrex, Genus Porphyromonas, Genus Chlorobium, Thermus sp., Bacillus sp., Listeria sp., Staphylococcus cus, Clostridium, Thermoanaerobacter, My genus coplasma, genus Fusobacterium, genus Azarcus, Chromo bacterium spp., Neisseria spp., Nitrosomonas spp., Desu Genus lfovibrio, Genus Geobacter, Genus Micrococcus, Campy lobacter spp., Wolinella spp., Acinetobacter spp., Erwi nia, Escherichia, Legionella, Methylococ cus, Pasteurella, Photobacterium, Salmon ella spp., Xanthomonas spp., Yersinia spp., Treponema spp. and Thermotoga spp., which have been identified in prokaryotes including, but not limited to, is.

[0061] Generally, the term "CRISPR system" refers collectively to a set of sequences that encode Cas genes. , which are involved in the expression of CRISPR-associated ("Cas") genes or inhibit their activity. Directing transcripts, and other elements, guide sequences (in the context of endogenous CRISPR systems) (also referred to as "spacer"), or other sequences derived from the CRISPR locus. and transcripts. In some embodiments, one or more elements of a CRISPR system are derived from type I CRISPR systems, type II CRISPR systems, or type III CRISPR systems In some embodiments, one or more elements of the CRISPR system are selected from the group consisting of Strep CRISPR-derived markers originate from certain organisms that contain endogenous CRISPR systems, such as Tococcus pyogenes. In general, CRISPR systems rely on the formation of CRISPR complexes at the site of the target sequence. Elements that promote synthesis (also known as protospacers in the context of endogenous CRISPR systems) It is characterized by

[0062] In the context of CRISPR complex formation, a "target sequence" refers to the sequence to which the guide sequence is directed. A sequence designed to have complementarity between the target sequence and the guide sequence. This refers to a sequence that promotes the formation of the CRISPR complex upon hybridization. Sufficient complementarity to induce hybridization and promote CRISPR complex formation Absolute complementarity is not necessarily required, provided that there is some degree of complementarity present. The nucleic acid sequence may be any polynucleotide, such as a DNA polynucleotide or an RNA polynucleotide. In some embodiments, the target sequence is located in the nucleus or cytoplasm of a cell. In some embodiments, the target sequence is located within an organelle of a eukaryotic cell, e.g., a mitochondrion. The targeted locus may be located within the target nucleus or within the chloroplast. A sequence or template that can be used for recombination into a locus that contains a sequence is referred to as an "editing template" or The subject matter disclosed herein is referred to as an "edited polynucleotide" or an "edited sequence." In an embodiment, the exogenous template polynucleotide can be referred to as an editing template. In aspects of the disclosed subject matter, the recombination is homologous recombination.

[0063] In some embodiments, the vector contains restriction endonuclease recognition sequences ("cloning In some embodiments, the nucleic acid sequence includes one or more insertion sites, such as a nucleotide sequence (also referred to as a "nucleotide sequence"), or multiple insertion sites (e.g., about 1, 2, 3, 4, 5, 6, 7, 8, 9, 10, or more insertion sites) in one or more or a plurality of vectors, upstream and / or downstream of one or more sequence elements. If multiple different guide sequences are used, a single expression construct can be used to PR activity can be targeted to multiple distinct, corresponding target sequences within a cell. For example, a single vector can contain approximately 1, 2, 3, 4, 5, 6, 7, 8 , 9, 10, 15, 20 or more guide sequences or In some embodiments, the amino acid sequence may include about 1, 2, 3, 4, 5, 6, 7 one, eight, nine, ten or more such guide sequence-containing vectors, and provides guide sequence-containing vectors beyond these, which can be optionally delivered to cells. can.

[0064] In some embodiments, the vector encodes a CRISPR enzyme, such as a Cas protein. The Cas protein comprises a regulatory element operably linked to an enzyme coding sequence. Non-limiting examples are Cas1, Cas1B, Cas2, Cas3, Cas4, Cas5, Ca s6, Cas7, Cas8, Cas9 (also known as Csn1 and Csx12) ), Cas10, Csy1, Csy2, Csy3, Cse1, Cse2, Csc1, C sc2, Csa5, Csn2, Csm2, Csm3, Csm4, Csm5, Csm6, C mr1, Cmr3, Cmr4, Cmr5, Cmr6, Csb1, Csb2, Csb3, C sx17, Csx14, Csx10, Csx16, CsaX, Csx3, Csx1, Cs x15, Csf1, Csf2, Csf3, Csf4, their homologs, or their modifications These enzymes include those known in the art, such as the S. pyogenes Cas9 enzyme. The amino acid sequence of this protein is listed in the SwissProt database under the accession number Q99. ZW2. In some embodiments, an unmodified CRIS such as Cas9. In some embodiments, the CRISPR enzyme has DNA cleavage activity. s9, Cas9 derived from S. pyogenes or S. pneumoniae It is possible.

[0065] In some embodiments, the CRISPR enzyme is located within and / or complementary to the target sequence. It directs the cleavage of one or both strands at the location of the target sequence, e.g., in the body. In embodiments, the CRISPR enzyme is derived from the first or last nucleotide of the target sequence. , about 1, 2, 3, 4, 5, 6, 7, 8, 9, 10, 15, 20, 25 , 50, 100, 200, 500, or more base pairs on one or both strands In some embodiments, the mutated CRISPR enzyme directs cleavage of the target sequence. so as to lack the ability to cleave one or both strands of a target polynucleotide containing the sequence. The vectors encode CRISPR enzymes that are mutated relative to the corresponding wild-type enzymes. do.

[0066] In some embodiments, the enzyme coding sequence encoding the CRISPR enzyme is , and are codon-optimized for expression in specific cells. Eukaryotic cells include human, mouse, Mammals, including but not limited to rats, rabbits, dogs, or non-human primates. In general, codon optimization may be used to identify a particular organism, such as a mammalian cell, a mammalian animal, or a mammalian cell derived from a particular organism. refers to the process of modifying a nucleic acid sequence to enhance expression in a host cell of interest. While maintaining the natural amino acid sequence, at least one codon of the natural sequence (e.g., about one , 2, 3, 4, 5, 10, 15, 20, 25, 50 or more codons) more frequently and / or more frequently in the genes of the host cell. refers to the process of modifying a nucleic acid sequence by substituting the most frequently used codons. Different species exhibit specific biases for certain codons of certain amino acids. Codon bias (differences in codon usage between organisms) is a factor in determining the amount of codons used by messenger RNA (mRNA). ), which in turn, among other things, correlates with the efficiency of translation. It depends on the characteristics of the codon being used and the availability of specific transfer RNA (tRNA) molecules. It is believed that the predominance of tRNAs selected within cells is generally due to the A gene is a reflection of the most frequently used codons. Therefore, genes are optimized based on codon optimization. Based on this, it is possible to tailor optimal gene expression in a given organism. Codon usage tables are readily available, for example at the "Codon Usage Database" and these The table can be adapted in a number of ways. Nakamura et al. (2000), Nucl. Aci See, e.g., ds Res. 28:292. Also, for expression in certain host cells, A computer algorithm for optimizing codons for a particular sequence, comprising: Algorithms such as Forge (Aptagen; Jacobus, Pa.) are also available In some embodiments, one or more codons within the sequence encoding the CRISPR enzyme are Dong (e.g. 1, 2, 3, 4, 5, 10, 15, 20, 25, 50, or codons (codons greater than or equal to this number) are the most frequently used codons for a particular amino acid. The codons correspond to those

[0067] Generally, a guide sequence is a sequence that hybridizes with a target sequence and directs the CRISPR complex to the target region. Complementarity with a target polynucleotide sequence sufficient to direct sequence-specific binding to the sequence In some embodiments, the polynucleotide sequence is any polynucleotide sequence having the appropriate alignment: The guide sequence and its corresponding target sequence, when optimally sequenced using the algorithm. The degree of complementarity with the sequence is approximately 50%, 60%, 75%, 80%, 85%, 90%, and 95%. , 97.5%, 99%, or more. The algorithm may be any suitable algorithm for sequencing, non-limiting examples of which include Smith et al. -Waterman algorithm, Needleman-Wunsch algorithm, Burrows-Hoy algorithm Algorithms based on the Lawrence transform (e.g., Burrows Wheeler Alig ner), ClustalW, Clustal X, BLAT, Novoalign(N ovocraft Technologies, ELAND (Illumina, San Diego, Calif.), SOAP(soap.genomics.org.cn (available at ) and Maq (available at maq.sourceforge.net) In some embodiments, the guide sequence can be determined using an algorithm comprising: is about 5, 10, 11, 12, 13, 14, 15, 16, 17, 18, 19, 20, 21 , 22, 23, 24, 25, 26, 27, 28, 29, 30, 35, 40, 45, 50, 75 or more nucleotides in length or In some embodiments, the guide sequence is about 75, 50, 45, 40, 35, 3 0, 25, 20, 15, 12 or fewer nucleotides in length, or The length of the nucleic acid is less than 10 nucleotides.

[0068] The ability of guide sequences to direct sequence-specific binding of the CRISPR complex to its target sequence The amount of the gene that is the target of the test can be evaluated by any suitable assay. For example, The components of the CRISPR system that are sufficient to form a RISPR complex are the CRISPR sequence Following transfection with a vector encoding the components of the By assessing preferential cleavage within the target sequence, such as via the Surveyor assay The target polynucleotides can be administered to a host cell that has the corresponding target sequence. Cleavage of the guide sequence cleaves the target sequence, components of the CRISPR complex including the test guide sequence, and A control guide sequence different from the test guide sequence is prepared, and the test guide sequence reaction mixture and the control guide sequence are mixed. The binding or cleavage rate at the target sequence is compared between the test sequence reaction and the control sequence reaction. Other assays are possible and will occur to those of skill in the art. It would be.

[0069] The guide sequence can be selected to target any target sequence. In some embodiments, the target sequence is a sequence within the genome of a cell. Exemplary target sequences are The target sequence comprises a unique target sequence within the target genome.

[0070] In some embodiments, the CRISPR enzyme comprises one or more heterologous protein domains. The portion of the fusion protein that contains (e.g., about one, two, three, or more of the CRISPR enzyme plus 4, 5, 6, 7, 8, 9, 10 or more domains or The fusion protein of the CRISPR enzyme may contain any additional It may include a protein sequence and, optionally, a linker sequence between any two domains. Examples of protein domains that can be fused to CRISPR enzymes include, without limitation, enzyme The pitope tag, reporter gene sequence, and the following activities: methylase activity, demethylase activity ase activity, transcription activation activity, transcription repression activity, transcription release factor activity, histone modification activity, RNase activity, transcription activation activity, transcription repression activity, transcription release factor activity, histone modification activity, A protein domain having one or more of the following activities: A cleavage activity, and nucleic acid binding activity. Non-limiting examples of epitope tags include histidine (His) tags, V5 tags, FLAG tags, and the like. Tag, influenza hemagglutinin (HA) tag, Myc tag, VSV-G tag, and and thioredoxin (Trx) tags. Examples of reporter genes include glutathione-5- Transferase (GST), horseradish peroxidase (HRP), chloramphenicol Nicole acetyltransferase (CAT), beta-galactosidase, beta- Glucuronidase, luciferase, green fluorescent protein (GFP), HcRed, Ds Red, cyan fluorescent protein (CFP), yellow fluorescent protein (YFP), and blue These include, but are not limited to, autofluorescent proteins, including bioluminescent proteins (BFPs). RISPR enzymes are proteins that bind to DNA or other intracellular molecules. Proteins or protein fragments, such as maltose binding protein (MBP), S-protein , Lex A DNA binding domain (DBD) fusion, GAL4A DNA binding domain Main fusions and herpes simplex virus (HSV) BP16 protein fusions. Gene sequences encoding proteins or fragments of proteins, including but not limited to It can form part of a fusion protein that includes a CRISPR enzyme. Further domains are described in US20110059502, which is incorporated herein by reference. In some embodiments, a tagged CRISPR enzyme is used. to identify the location of the target sequence.

[0071] In an embodiment of the presently disclosed subject matter, glutathione-5-transferase (GS T), horseradish peroxidase (HRP), chloramphenicol acetyltransferase ferase (CAT), beta-galactosidase, beta-glucuronidase, lucif Fluorescence enzyme, green fluorescent protein (GFP), HcRed, DsRed, cyan fluorescent protein Chloroform protein (CFP), yellow fluorescent protein (YFP), and blue fluorescent protein (BFP) Reporter genes, including but not limited to autofluorescent proteins, The gene product is used as a marker to measure the alteration or modification of the expression of the gene. In accordance with further embodiments of the present invention, the present invention can be implemented in a cell. In an embodiment, the DNA molecule encoding the gene product is introduced into the cell via a vector. In a preferred embodiment of the presently disclosed subject matter, the gene product is In further embodiments of the presently disclosed subject matter, the expression of the gene product is The present is reduced.

[0072] In general, promoter embodiments of the presently disclosed subject matter include: 1) a TATA box promoter; The complete sequence of the nucleotide sequence, including the nucleotide sequence, the proximal sequence element (PSE), and the distal sequence element (DSE) a Pol III promoter; and 2) fused in reverse orientation to the 5' end of the DSE. A second basal Pol III promoter containing a modified PSE and TATA box was The TATA box, named for its nucleotide sequence, is a structural component of Pol II. The TATA box is usually located nt 1 from the transcribed sequence. Located between positions -23 and -30, it is the primary determinant of the start of the transcribed sequence. The PSE is usually located between nt.-45 and -66. The DSE is located at the base of Pol II. In the H1 promoter, a gap exists between the PSE and DSE. There is no backup.

[0073] A bidirectional promoter contains 1) three external control elements: DSE, PSE, and T A conventional fully unidirectional Pol III promoter containing an ATA box; and 2) PSE and TATA boxes fused in reverse orientation to the 5' end of the DSE It consists of a second basal Pol III promoter, which contains the TATA-binding protein. The TATA box is recognized by the TATA domain to recruit Pol III to the promoter region. TATA-binding protein binding to the TATA box is essential for SNAP c is stabilized by its interaction with the PSE. It also positions Pol III properly so that it can transcribe the sequence to be expressed. SEs are also essential for full activity of the Pol III promoter (Murphy et al., 1992 ), Mol. Cell Biol., vol. 12:3247-3261; Mittal et al. (1996), M ol. Cell Biol., 16:1955-1965; Ford and Hernandez (1997 ), J. Biol. Chem., 272:16048-16055; Ford et al. (1998), Gene s Dev., 12:3528-3540; Hovde et al. (2002), Genes Dev., 16 Transcription is mediated by the transcription factors Oct-1 and / or SBF / Staf interactions with those motifs in the DSE are enhanced up to 100-fold (Kunkel and Hixon (1998) Nucl. Acid Res. 26:1536-1 (p. 543). The basal promoters in forward and reverse orientation are double-stranded DNA A basal promoter oriented in reverse, since it directs transcription of sequences on the reverse strand of the template The plus strand of is added to the 5' end of the minus strand of DSE under the control of the H1 promoter. The expressed transcript is terminated by an uninterrupted sequence of four or five T's.

[0074] Within the H1 promoter, the DSE is flanked by a PSE and a TATA box (Myslin (2001) Nucl. Acid Res. 29:2502-2509). To minimize replication, reverse transcription is performed using the PSE and By adding a TATA box to the promoter, a hybrid promoter was created. This made the promoter bidirectional. Construction of the bidirectional H1 promoter To facilitate the synthesis of the nucleotide sequence, a small spacer sequence was also inserted into the base promoter in a reverse orientation. It can be inserted between the PLC and the DSE.

[0075] B. Method In some embodiments, the subject matter disclosed herein also provides methods for detecting one or more genes in a cell. A method for altering expression of a gene product, comprising: The method further comprises: introducing into the cell a) a guide RNA (g) of the CRISPR-Cas system; operably linked to at least one nucleotide sequence encoding an H1 promoter (RNA) A motor, wherein the gRNA hybridizes with a target sequence of a DNA molecule, H1 promoter a) a motor; and b) a regulatory element operable within a cell to encode the Cas9 protein. and a regulatory element operably linked to the nucleotide sequence that encodes the A non-naturally occurring CRISPR-Cas system comprising a vector, comprising components (a) and (b). b) is placed in the same or a different vector of the system, and the gRNA targets the target sequence. The Cas9 protein targets and hybridizes to the target DNA molecule, cleaving it. The method involves introducing a CRISPR-Cas system to alter the expression of one or more gene products. Also provided is a method comprising the steps of:

[0076] In some embodiments, the subject matter disclosed herein also comprises one or more A method for altering expression of a gene product, comprising: a) a guide RNA for the CRISPR-Cas system, H1 operably linked to at least one nucleotide sequence encoding a (gRNA) A promoter, wherein the gRNA hybridizes with a target sequence of the DNA molecule, H1 a) a promoter; and b) a regulatory element operable in a eukaryotic cell, the regulatory element being a type II Cas9. and a regulatory element operably linked to the nucleotide sequence encoding the protein. A non-naturally occurring CRISPR-Cas system comprising one or more vectors, (a) and (b) are placed in the same or different vectors of the system, and the gRNA The Cas9 protein targets and hybridizes to the target sequence, and CRISPR-Cas systems that cleave the A molecule and alter the expression of one or more gene products In one aspect, the target sequence is any nucleotide. For example, N 20 In some embodiments, the target sequence may be a sequence beginning with NGG. is the nucleotide sequence A 19 In some embodiments, the target sequence comprises a nucleotide Otide sequence GN 19 In some embodiments, the target sequence comprises the nucleotide sequence CN 19In some embodiments, the target sequence comprises the nucleotide sequence TN 19 N In some embodiments, the target sequence comprises the nucleotide sequence AN 19 NGG or GN 19 In another embodiment, the Cas9 protein comprises a coding sequence for expression in a cell. In yet another embodiment, the Cas9 protein is optimized for expression in eukaryotic cells. In a further aspect, the eukaryotic cell is a mammalian cell or or a human cell. In another embodiment, the expression of one or more gene products is reduced.

[0077] The presently disclosed subject matter also provides methods for modifying the expression of one or more gene products in eukaryotic cells. A method of modifying a cell, the method comprising the steps of: The method further comprises: introducing into a cell a non-naturally occurring CR vector comprising a bidirectional H1 promoter. The ISPR-Cas system, wherein the bidirectional H1 promoter is a) CRISPR-Cas At least one nucleotide sequence encoding a guide RNA (gRNA) of the system A control element that controls transcription in a directional manner, in which the gRNA binds to a target sequence in a DNA molecule. a) a nucleic acid encoding a type II Cas9 protein; and a control element that provides for transcription in the opposite direction of the nucleic acid sequence of the target sequence. The Cas9 protein targets the sequence, hybridizes to it, and binds the DNA molecule. Introducing a CRISPR-Cas system that cuts and alters the expression of one or more gene products In one aspect, the target sequence is any nucleotide, e.g. Ba, N 20In some embodiments, the target sequence may be a nucleotide sequence beginning with NGG. Retide sequence AN 19 In some embodiments, the target sequence comprises the nucleotide sequence Column GN 19 In some embodiments, the target sequence comprises the nucleotide sequence CN 19 In some embodiments, the target sequence comprises the nucleotide sequence TN 19 Including NGG In another embodiment, the target sequence is the nucleotide sequence AN 19 NGG or GN 19 NGG In another embodiment, the Cas9 protein is codon-optimized for expression in a cell. In yet another embodiment, the Cas9 protein is encoded by a coding region for expression in a eukaryotic cell. In a further aspect, the eukaryotic cell is a mammalian cell or a human cell. In another embodiment, the expression of one or more gene products is reduced.

[0078] In some aspects, the subject matter disclosed herein comprises one or more of the compounds described herein. one or more polynucleotides, one or more transcription products thereof, and and / or one or more proteins transcribed therefrom into a host cell. In some aspects, the subject matter disclosed herein further comprises the steps of: Cells produced by such methods, and organisms (animals, plants, etc.) containing such cells, In some embodiments, the present invention provides a method for the production of a cell of a mammalian animal, such as a mammalian cell line, a mammalian cell line (e.g., a mammalian cell line, a fungus, etc.) or an organism produced from such a cell. is a CRI in combination with (and optionally complexed with) a guide sequence The SPR enzyme is delivered to cells. Conventional viral-based gene transfer methods and non-viral A space-based gene transfer method is used to introduce nucleic acids into mammalian cells or target tissues. Such methods can be used to express nucleotidic acid sequences encoding the components of the CRISPR system. The acid can be administered to cells in culture or within a host organism. Delivery systems can include DNA plasmids, RNA (e.g., transcripts of the vectors described herein), These include nucleic acids, naked nucleic acids, and nucleic acids complexed with delivery vehicles such as liposomes. Vector delivery systems include DNA and RNA viruses, which are used to deliver vectors to cells. Following delivery, the genome is either episomal or integrated. See Anderson (1992), Science 256:808-813; Nabel and and Felgner (1993), TIBTECH, 11:211-217; Mitani and Caskey ( 1993), TIBTECH, Vol. 11: 162-166; Dillon (1993), TIBTECH, 11:167-175; Miller (1992), Nature, 357:455-460 pp. Van Brunt (1998), Biotechnology, Vol. 6 (Issue 10): 1149~1154 Vigne (1995), Restorative Neurology and Neuroscience, 8:35- 36; Kremer and Perricaudet (1995), British Medical Bulletin, 51 Vol. (1): 31-44; Haddada et al. (1995), Current Topics in Microbio logy and Immunology, Doerfler and Bohm (eds.); and Yu et al. (1994), Gen e Therapy, vol. 1:13-26.

[0079] Non-viral methods for delivery of nucleic acids include lipofection, nucleofection, and microinjection. injection, gene gun, virosome, liposome, immunoliposome, polycation or lipid:nucleic acid conjugates, naked DNA, artificial virions, and DNA Lipofection includes drug-enhanced uptake of the medicament described in, for example, U.S. Patent No. 5,049,388. Nos. 6, 4,946,787; and 4,897,355. Lipofection reagents are commercially available (e.g., Transfectam (USA)). and Lipofectin™. Efficient receptor recognition of polynucleotides. Cationic and neutral lipids suitable for lipofection are described in detail in the literature by Felgner. Contains cationic and neutral lipids (WO91 / 17424; WO91 / 16024) Delivery can be to a cell (e.g., in vitro or ex vivo administration). In some cases, the delivery may be to a target tissue (eg, in vivo administration).

[0080] Preparation of lipid:nucleic acid complexes, including targeted liposomes such as immunolipid complexes are well known to those skilled in the art (see, for example, Crystal (1995), Science, Vol. 270:404). ~410; Blaese et al. (1995), Cancer Gene Ther. 2:291-297 Behr et al. (1994), Bioconjugate Chem. 5:382-389; Remy et al. (1 994), Bioconjugate Chem. 5:647-654; Gao et al. (1995), Ge ne Therapy, 2:710-722; Ahmad et al. (1992), Cancer Res., 52 pp. 4817-4820; U.S. Pat. Nos. 4,186,183 and 4,217,344 , No. 4,235,871, No. 4,261,975, No. 4,485,054, No. 4,501,728, No. 4,774,085, No. 4,837,028, and and No. 4,946,787).

[0081] Viral RNA-based or viral DNA-based systems for delivery of nucleic acids It involves targeting the virus to specific cells in the body and delivering the viral payload. Viral vectors exploit highly evolved processes for trafficking to the nucleus. It can be administered directly to the patient (in vivo) or in vitro. The modified cells can also be used to treat cells in a variety of ways, and optionally, the modified cells can be administered to a patient ( Conventional virus-based systems can be used for gene transfer. Retroviral vectors, lentiviral vectors, adeno-associated viral vectors, and herpes simplex virus vectors. Viral and adeno-associated virus-based gene transfer methods allow integration into the host genome and often results in long-term expression of the inserted transgene. In addition, increased transduction efficiency in many different cell types and target tissues has been observed. There are.

[0082] Retroviral cytotropism involves the incorporation of foreign envelope proteins and the infiltration of target cells. This can be modified by expanding the potential target population. transduces or infects non-dividing cells and typically produces high viral titers Thus, the retroviral vector The choice of gene transfer system will depend on the target tissue. Retroviral vectors are The cis-acting long repeat (LTR) has a maximum packaging capacity of 6-10 kb. The replication and packaging of the vector requires A small cis-acting LTR is sufficient and can then be used to target a therapeutic gene. It is a widely used retroviral vector that integrates into cells and results in permanent transgene expression. The virus vectors are murine leukemia virus (MuLV), gibbon ape leukemia virus (GAV), aLV), simian immunodeficiency virus (SIV), human immunodeficiency virus (HIV), and Retroviral vectors based on these combinations (e.g., Buchscher et al., 1992) , J. Virol., 66:2731-2739; Johann et al. (1992), J. Virol. 66:1635-1640; Sommnerfelt et al. (1990), J. Virol., 176 :58~59; Wilson et al. (1989), J. Virol., 63:2374~2378 ; Miller et al. (1991), J. Virol., 65:2220-2224; PCT / US For applications where transient expression is preferred, adenovirus-based Adenovirus-based vectors have been shown to be effective in the expression of endothelial cells in many cell types. These vectors allow for extremely high transduction efficiency and do not require cell division. This vector allows for the production of large numbers of vectors in a relatively simple system. Adeno-associated virus ("AAV") vectors can also be produced in large quantities, e.g. Transducing cells with target nucleic acids for in vitro production of nucleic acids and peptides It can also be used to treat in vivo and ex vivo gene therapy. It can also be used in therapeutic procedures (see, for example, West et al. (1987), Virology, vol. 160). pp. 38-47; U.S. Pat. No. 4,797,368; WO 93 / 24641; Kotin (1 Muzyczka (1994), Human Gene Therapy, 5:793-801; , J. Clin. Invest., 94:1351. For construction of recombinant AAV vectors, see , U.S. Patent No. 5,173,414; Tratschin et al. (1985), Mol. Cell. Biol. 5:3251-3260; Tratschin et al. (1984), Mol. Cell. Biol., 4 Vol.: 2072-2081; Hermonat and Muzyczka (1984), Proc. Natl. Ac. Ad. Sci. USA 81:6466-6470; and Samulski et al. (1989 ), J. Virol., 63:03822-3828. is.

[0083] Packaging cells are used to form viral particles capable of infecting host cells. Typically, such cells are 293 cells that package adenovirus. and ψ2 cells or PA317 cells that package the retrovirus. Viral vectors used in gene therapy usually contain a nucleic acid vector within a viral particle. The vector is produced by generating a cell line that packages the vector into a packaging vector. Typically, they contain the minimal viral sequences required for replication and subsequent integration into the host. The other viral sequences are expression cassettes for expressing the polynucleotide. The missing viral functions are provided in trans by the packaging cell line. For example, AAV vectors used in gene therapy are ITR sequences derived from the AAV genome, which are responsible for packaging and integration into the host genome. Typically, viral DNA contains only the ITR sequences required for the replication of other A viruses. The AV genes, i.e., rep and cap, encode but lack the ITR sequences, The plasmid is packaged into a cell line that also contains helper and The helper virus can also infect the AAV vector. It promotes replication of AAV vectors and expression of AAV genes from the helper plasmid. The plasmid is not packaged in significant amounts due to the lack of ITR sequences. Viral contamination can be prevented, for example, by heat treatment, to which adenoviruses are more sensitive than AAVs. Additional methods for delivering nucleic acids to cells are known to those of skill in the art. See, e.g., US20030087817, which is incorporated herein by reference. I want to be.

[0084] In some embodiments, a host cell is transfected with one or more vectors described herein. In some embodiments, the subject is transfected either transiently or permanently. Transfect naturally occurring cells. In some embodiments, the transfected The cells are harvested from a subject. In some embodiments, the cells are harvested from a subject, such as a cell line. A wide variety of cell lines for tissue culture are known in the art. Examples of cell lines include C8161, CCRF-CEM, MOLT, mIMCD-3, and NH DF, HeLa-S3, Huh1, Huh4, Huh7, HUVEC, HASMC, HE Kn, HEKa, MiaPaCell, Panel, PC-3, TF1, CTLL-2, C1R, Rat6, CV1, RPTE, A10, T24, J82, A375, ARH-7 7, Calu1, SW480, SW620, SKOV3, SK-UT, CaCo2, P3 88D1, SEM-K2, WEHI-231, HB56, TIB55, Jurkat, J 45.01, LRMB, Bcl-1, BC-3, IC21, DLD2, Raw264.7 , NRK, NRK-52E, MRC5, MEF, Hep G2, HeLa B, HeLa T4, COS, COS-1, COS-6, COS-M6A, BS-C-1 monkey kidney epithelium , BALB / 3T3 mouse embryo fibroblasts, 3T3 Swiss, 3T3-L1, 132-d5 Human fetal fibroblasts; 10.1 Mouse fibroblasts, 293-T, 3T3, 721, 9L, A278 0, A2780ADR, A2780cis, A172, A20, A253, A431, A -549, ALC, B16, B35, BCP-1 cells, BEAS-2B, bEnd.3, BHK-21, BR 293, BxPC3, C3H-10T1 / 2, C6 / 36, Cal -27, CHO, CHO-7, CHO-IR, CHO-K1, CHO-K2, CHO-T , CHO Dhfr- / -, COR-L23, COR-L23 / CPR, COR-L23 / 5010, COR-L23 / R23, COS-7, COV-434, CML T1, C MT, CT26, D17, DH82, DU145, DuCaP, EL4, EM2, EM3 , EMT6 / AR1, EMT6 / AR10.0, FM3, H1299, H69, HB54 , HB55, HCA2, HEK-293, HeLa, Hepa1c1c7, HL-60, HMEC, HT-29, Jurkat, JY cells, K562 cells, Ku812, KCL2 2, KG1, KYO1, LNCap, Ma-MeI1-48, MC-38, MCF-7, MCF-10A, MDA-MB-231, MDA-MB-468, MDA-MB-435 , MDCK II, MDCK II, MOR / 0.2R, MONO-MAC6, MTD- 1A, MyEnd, NCI-H69 / CPR, NCI-H69 / LX10, NCI-H6 9 / LX20, NCI-H69 / LX4, NIH-3T3, NALM-1, NW-145 , OPCN / OPCT cell lines, Peer, PNT-1A / PNT2, RenCa, RIN -5F, RMA / RMAS, Saos-2 cells, Sf-9, SkBr3, T2, T-47 D, T84, THP1 cell line, U373, U87, U937, VCaP, Vero cells, WM39, WT-49, X63, YAC-1, YAR, and their transgenic Cell lines can be obtained from a variety of sources known to those of skill in the art, including, but not limited to, the subspecies , the American Type Culture Collection(AT Some implementations are available from the National Institute of Standards and Technology (NIST) at www.national.gov / science / science / manassus / va. In the form of a cell transfected with one or more vectors described herein. The method is used to establish new cell lines containing one or more vector-derived sequences. In embodiments, the components of the CRISPR system described herein are transiently transfected. Transfected (transient transfection of one or more vectors or transfection of RNA transfection) to create cells that have been modified through the activity of the CRISPR complex. The resulting cell line is then used to generate new cell lines, including cells containing the modification but lacking any other exogenous sequences. In some embodiments, one or more of the vectors described herein are Transiently or permanently transfected cells or derived from such cells Such cell lines are used in the evaluation of one or more test compounds.

[0085] In some embodiments, one or more of the vectors described herein are used to generate non-human In some embodiments, the transgenic animals are In certain embodiments, the organism is a mammal, such as a mouse, a rat, or a rabbit. Alternatively, the subject is a plant. Methods for transfecting cells are known and generally include methods for transfecting cells, such as the cell transfection methods described herein. Begin with the cell transfection method.

[0086] In one aspect, the presently disclosed subject matter provides a method for modifying a target polynucleotide in a eukaryotic cell. The method may be an in vivo method or an ex vivo method. In some embodiments, the method includes: Sampling a cell or cell population from a human or non-human animal; and modifying the plurality of cells. The culturing may be performed ex vivo at any stage. The cell or cells may also be reintroduced into the non-human animal.

[0087] In one aspect, the presently disclosed subject matter provides a method for modifying a target polynucleotide in a eukaryotic cell. In some embodiments, the method comprises: The target polynucleotide is then bound to the target nucleotide, thereby effecting cleavage of the target polynucleotide. Modifying nucleotides, wherein the CRISPR complex modifies the target polynucleotide. A CRISPR enzyme complexed with a guide sequence hybridized to a target sequence in the The method includes the steps of:

[0088] In one aspect, the presently disclosed subject matter provides a method for modifying expression of a polynucleotide in a eukaryotic cell. In some embodiments, the method further comprises: The CRISPR complex is then coupled to a polynucleotide sequence that results in an increase or decrease in wherein the CRISPR complex binds to a target sequence within the polynucleotide. A step containing the CRISPR enzyme complexed with a guide sequence hybridized to the array. Includes

[0089] In one aspect, the subject matter disclosed herein provides a method for the detection of one or more elements of a CRISPR system. The subject matter disclosed herein also provides methods for using the CRISPR complexes. The present invention provides an effective means for modifying a target polynucleotide. The subject CRISPR complexes are capable of modifying target polynucleotides in multiple cell types. For example, deletion, insertion, translocation, inactivation, activation Thus, the subject matter disclosed herein has a wide variety of utilities, including the ability to The CRISPR complexes are useful for, e.g., gene therapy, drug screening, disease diagnosis, and Exemplary CRISPR complexes are widely applied in the diagnosis and prognosis of cancer. CRISPR enzyme complexed with a guide sequence hybridized to a target sequence within the octide. Contains elements.

[0090] The target polynucleotide of the CRISPR complex may be endogenous or exogenous to the eukaryotic cell. For example, the target polynucleotide may be any polynucleotide that is The target polynucleotide may be a polynucleotide present in the nucleus of a cell. It may be a coding sequence (e.g., a protein) or a non-coding sequence (e.g., a regulatory Polynucleotides or junk DNA). Without wishing to be bound by theory, In this regard, the target sequence is a PAM (protospacer adjacent motif), i.e., CRI It is believed that the exact sequence of the PAM and the short sequence recognized by the SPR complex are related. The sequence and length requirements vary depending on the CRISPR enzyme used, but the PAM is Typically, it is a sequence of 2-5 base pairs adjacent to the pacer (i.e., the target sequence). Examples of PAM sequences are provided in the Examples section below, however, those of skill in the art will appreciate that PAM sequences may be used in conjunction with a given CRISPR It may also be possible to identify additional PAM sequences for use with enzymes.

[0091] Examples of target polynucleotides include sequences associated with biochemical pathways for signal transduction, e.g. For example, it includes genes or polynucleotides associated with a biochemical pathway for signal transduction. Examples of target polynucleotides include disease-associated genes or disease-associated polynucleotides. A "disease-associated" gene or "disease-associated" polynucleotide is derived from a diseased tissue. Abnormal levels or abnormal morphology of transcription factors in cells compared with non-diseased control tissues or cells "Disease" refers to any gene or polynucleotide that produces a transcription or translation product. "Related" genes can be genes that are expressed at abnormally high levels, or genes that are expressed at abnormally low levels. In some cases, the altered expression of the gene correlates with the onset and / or progression of the disease. A disease-associated gene also refers to a gene that is directly responsible for the etiology of a disease or that is involved in the etiology of a disease. It also refers to a gene that carries a mutation or genetic variation that is in linkage disequilibrium with the offspring. The translated product may be a known product or an unknown product, and may be expressed at normal levels. Sometimes it's low, sometimes it's at abnormal levels.

[0092] Embodiments of the subject matter disclosed herein also include gene knockouts, gene amplifications, and the repair of certain mutations associated with DNA repeat instability and neurological disorders. Methods and compositions for the treatment of cancer (Robert D. Wells, Tetsuo Ashizawa, Genetic Instability s and Neurological Diseases, 2nd Edition, Academic Press, October 13, 2011 Specific aspects of the tandem repeat sequences are also described in more than 20 human It has been found to contribute to disease (McIvor et al. (2010), RNA Biol., vol. 7 ( 5, pp. 551-8). Using the CRISPR-Cas system, These deficiencies can be corrected.

[0093] In yet another embodiment of the presently disclosed subject matter, the CRISPR-Cas system is used to , Traboulsi (Ed.) (2012), Genetic Diseases of the Eye, 2nd ed., Oxford Un The results are from several genetic mutations, which are further described in the iversity press. Ocular defects can be corrected.

[0094] Some further aspects of the subject matter disclosed herein relate to a wide range of genetic disorders. For example, genetic brain diseases include adrenoleukodystrophy , Agenesis of the corpus callosum, Ecardi syndrome, Alpers' disease, Alzheimer's disease Alzheimer's Disease, Barth Syndrome, Batten Disease, CADASIL, Cerebellar Degeneration Sex, Fabry disease, Gerstmann-Sträussler-Scheinker disease, Huntington's disease, and other triplet repeat disorders, Leigh disease, Lesch-Nyhan syndrome, and Menkes disease , mitochondrial myopathy, and NINDS colpocephaly, but these may include Not limited to.

[0095] In some embodiments, the condition may be a neoplasm. In some embodiments, the condition may be aging. In some embodiments, the condition may be macular degeneration. In some embodiments, the condition may be schizophrenia. In some embodiments, the condition may be a trinucleotide repeat disorder. In some embodiments, the condition may be fragile X syndrome. In some embodiments, the condition is a secretase-associated disorder. In some embodiments, the condition may be a prion-associated disorder. In some embodiments, the condition can be ALS. In some embodiments, the condition can be drug addiction. In some embodiments, the condition may be autism. In some embodiments, the condition may be Heimer's disease. In some embodiments, the condition may be inflammation. In this case, the condition may be Parkinson's disease.

[0096] Examples of proteins associated with Parkinson's disease are α-synuclein, DJ-1, and LRRK. 2, including PINK1, Parkin, UCHL1, synphilin 1, and NURR1 But not limited to these.

[0097] Examples of addiction-related proteins may include, for example, ABAT.

[0098] Examples of inflammation-related proteins include, for example, the monocyte chemotactic protein encoded by the Ccr2 gene. CC chemokine receptor 5, encoded by the Ccr5 gene, and MCP1 type (CCR5), IgG receptor IIB encoded by the Fcgr2b gene (CD32 FcI (also called FCGR2b), or FcI encoded by the Fcer1g gene It may contain the Psilon R1g (FCER1g) protein.

[0099] Examples of cardiovascular disease-related proteins include, for example, IL1B (interleukin 1 beta), XDH (xanthine dehydrogenase), TP53 (tumor protein p53), PTGI S (prostaglandin 12 (prostacyclin) synthase), MB (myoglobin) ), IL4 (Interleukin 4), ANGPT1 (Angiopoietin 1), ABCG8 (ATP-binding cassette subfamily G (WHITE) member 8), or CTSK (cathepsin K).

[0100] Examples of Alzheimer's disease-related proteins include, for example, those encoded by the VLDLR gene. The very low density lipoprotein receptor protein (VLDLR), which is encoded by the UBA1 gene The ubiquitin-like modifier activating enzyme 1 (UBA1) or UBA3 gene is upregulated by The encoded NEDD8-activating enzyme E1 catalytic subunit protein (UBE1C) It may include.

[0101] Examples of proteins associated with autism spectrum disorders include, for example, the BZRAP1 gene. Benzodiazepine receptor (peripheral)-associated protein 1 (BZRAP1), encoded by The AF4 / FMR2 familial fusion protein is encoded by the AFF2 gene (also called MFR2). Amino acid member 2 protein (AFF2), encoded by the FXR1 gene (fragile X mental retardation autosomal homolog 1) protein, or FXR2 ( fragile X mental retardation autosomal h omolog 2) may contain protein.

[0102] Examples of proteins associated with macular degeneration include, for example, A, encoded by the ABCR gene. TP-binding cassette subfamily A (ABC1) member 4 protein (ABCA4) Apolipoprotein E protein (APOE), which is encoded by the APOE gene, or chemokine (CC motif) ligand 2 protein encoded by the CCL2 gene It may contain a protein (CCL2).

[0103] Examples of proteins associated with schizophrenia include NRG1, ErbB4, CPLX1, and TPH 1, TPH2, NRXN1, GSK3A, BDNF, DISC1, GSK3B, and It may include combinations of these.

[0104] Examples of proteins involved in tumor suppression include, for example, ATM (ataxia telangiectasia var. iectasia mutated), ATR(ataxia telangiecta sia and Rad3 related), EGFR (epidermal growth factor receptor), ER BB2(v-erb-b2 erythroblastic leukemia vir al oncogene homolog 2), ERBB3(v-erb-b2 er ythroblastic leukemia viral oncogene hom olog 3), ERBB4(v-erb-b2 erythroblastic le ukemia viral oncogene homolog 4), Notch 1 , Notch2, Notch 3, or Notch 4.

[0105] Examples of proteins associated with secretase disorders include, for example, PSENEN (presenilin Enhancer 2 homolog (C. elegans), CTSB (cathepsin B), PSEN 1 (presenilin 1), APP (amyloid beta (A4) precursor protein), APH 1B(anterior pharynx defective 1 homolog B (C. elegans)), PSEN2 (Presenilin 2 (Alzheimer's disease 4)), or BACE1 (beta-site APP-cleaving enzyme 1 ).

[0106] An example of a protein associated with amyotrophic lateral sclerosis is SOD1 (superoxide dismutase 1). mutase 1), ALS2 (amyotrophic lateral sclerosis 2), FUS (fused in sar coma), TARDBP (TAR DNA-binding protein), VAGFA (vascular endothelial Growth factor A), VAGFB (vascular endothelial growth factor B), and VAGFC (vascular endothelial growth factor C), and any combination thereof.

[0107] An example of a protein associated with prion disease is SODI (superoxide dismutase 1), ALS2 (amyotrophic lateral sclerosis 2), FUS (fused in sarcoma ), TARDBP (TAR DNA-binding protein), VAGFA (vascular endothelial growth factor A), VAGFB (vascular endothelial growth factor B), and VAGFC (vascular endothelial growth factor C), As well as any combination thereof.

[0108] Examples of proteins involved in neurodegenerative conditions in prion disorders include, for example, A2M (Alpha2 kinase). AATF (apoptosis antagonist) ng transcription factor), ACPP (prostatic acid phosphatase ACTA2 (aortic smooth muscle actin alpha 2), ADAM22 (ADAM metastasis) ropeptidase domain), ADORA3 (adenosine A3 receptor), or ADRA1 D (alpha-1D adrenergic receptors, which are an alternative to alpha-1D adrenergic receptors) The composition may include the following:

[0109] Examples of proteins associated with immunodeficiencies include, for example, A2M [alpha-2-macroglobulin purine];AANAT [arylalkylamine N-acetyltransferase];A BCA1 [ATP-binding cassette subfamily A (ABC1) member 1]; ABCA 2 [ATP-binding cassette subfamily A (ABC1) member 2]; or ABCA 3 [ATP-binding cassette subfamily A (ABC1) member 3].

[0110] Examples of proteins associated with trinucleotide repeat disorders include, for example, AR (androgen receptor antagonist), FMR1 (fragile x mental retardation receptor) n 1), HTT (huntingtin), or DMPK (myotonic dystrophy protein These include endothelial cell kinase), FXN (frataxin), and ATXN2 (ataxin 2).

[0111] Examples of proteins associated with impaired neurotransmission include, for example, SST (somatostatin), NO S1 (nitric oxide synthase 1 (neuronal)), ADRA2A (adrenergic alpha 2A receptor), ADRA2C (adrenergic alpha 2C receptor), TACR1 ( Tachykinin receptor 1), or HTR2c (5-hydroxytryptamine (serotonin ) receptor 2C).

[0112] Examples of sequences related to neurogenesis include, for example, A2BP1 (ataxin 2 binding protein 1), AADAT (aminoadipate aminotransferase), AANAT (allyl ABAT (4-aminobutyric acid aminotransferase), transferase), ABCA1 (ATP-binding cassette subfamily A (ABC1 ) member 1), or ABCA13 (ATP-binding cassette subfamily A (ABC 1) Includes 13 members.

[0113] A further example of a preferred condition treatable by the present system is Aicardi-Goutières syndrome. ;Alexander disease;Allan-Herndon-Dudley syndrome;POLG-related disorders;Alf Amannosidosis (types II and III); Alström syndrome; Angelman syndrome; ataxia telangiectasia; neuronal ceroid lipofuscinosis; beta-thalassemia ;Bilateral optic atrophy and (infantile) type 1 optic atrophy;Retinoblastoma (bilateral);Cavan disease ;Cerebro-oculofacial-skeletal syndrome 1 (COFS1);Cerebrotendinous xanthomatosis;Cornelia de Lange syndrome;MA PT-related disorders; inherited prion diseases; Dravet syndrome; early-onset familial Alzheimer's disease; Reich's ataxia [FRDA]; Frins' syndrome; Fucosidosis; Fukuyama-type congenital myelopathy dystrophy;galactosialidosis;Gaucher disease;organic acidemia;hemophagocytic lymphoma Histiocytosis; Hutchinson-Gilford progeria syndrome; Mucolipidosis type II; Infantile play Azosialic acid storage disease; PLA2G6-associated neurodegeneration; Jervell-Lange-Nielsen syndrome ;Junctional epidermolysis bullosa;Huntington's disease;Krabbe disease (infantile);Mitochondrial DNA Related Leigh syndrome and NARP; Lesch-Nyhan syndrome; LIS1-associated alisyllabi; U syndrome; Maple syrup urine disease; MECP2 duplication syndrome; ATP7A-related copper transport disorder; LAMA2-associated muscular dystrophy; arylsulfatase A deficiency; mucopolysaccharidosis type I, Mucopolysaccharidosis type II or type III; Peripheral to the Zellweger syndrome spectrum Oxysome biogenesis disorder; Neurodegeneration with impaired brain iron storage; Acid sphingomyelinase deficiency;Niemann-Pick disease type C;Glycine encephalopathy;ARX-related disorders;Urea cycle disorders; COL1A 1 / 2-related osteogenesis imperfecta; mitochondrial DNA deletion syndrome; PLP1-related Disorders; Perry syndrome; Phelan-McDermid syndrome; Glycogen storage disease type II (Pompe disease) (infant sex);MAPT-related disorder;MECP2-related disorder;Rhizome chondrodysplasia punctata type 1;Robert Syndrome; Sandhoff disease; Schindler disease type 1; Adenosine deaminase deficiency; Smith-Lehman syndrome Murio-Opitz syndrome; spinal muscular atrophy; infantile-onset spinocerebellar ataxia; hexosa Minidase A deficiency; thanatophoric skeletal dysplasia type 1; type VI collagen-related disorder; I Usher syndrome; congenital muscular dystrophy; Wolf-Hirschhorn syndrome; Leishman syndrome endothelial cell carcinoma (ECC); endothelial cell carcinoma (ECC); and xeroderma pigmentosum.

[0114] II. Expressing gRNA in vivo and characterizing gRNA in vivo RNA ribozymes and regulatable aptazymes for regulating expression

[0115] The presently disclosed subject matter also provides methods for expressing gRNAs in vivo and in RNA ribozymes and regulatable approaches to regulate gRNA expression in vivo Use of TAZYMEs, in particular, to regulate the cis-regulation of guide RNAs with a first non-restrictive nucleotide specificity. 5' hammerhead ribozyme for ribozyme processing and in vivo The present invention also relates to the use of RNA aptazyme-mediated regulation of gRNA function in

[0116] Thus, the presently disclosed subject matter also includes a) a catalytic core and The cis-acting region includes a double-stranded region of helix I, helix II, and helix III. A hammerhead ribozyme comprising a double-stranded region of helix II and a double-stranded region of helix III. Each of the double-stranded regions of helix III contains a loop region on either side of the catalytic core, and The double-stranded region of I contains an aptamer that binds to a ligand, forming a cis-acting hammerhead a) a nucleic acid encoding a ribozyme and b) a nucleic acid encoding a guide RNA (gRNA) for the CRISPR-Cas system. A nucleotide sequence, wherein the gRNA hybridizes with a target sequence of a DNA molecule in a eukaryotic cell. The DNA molecule encodes one or more gene products that are expressed in a eukaryotic cell and The nucleotide sequence includes a 5' end and a 3' end, and the 5' end of the nucleotide sequence is and a nucleotide sequence directly coupled to the double-stranded region of ribozyme III. A ptamer-regulated ribozyme, comprising a ribozyme having a 5' end of a nucleotide sequence and a helix The ligand is then attached to the aptamer via autocleavage between the double-stranded region of ribozyme III and the aptamer. Binding leads to a conformational change in the ribozyme, resulting in the production of gRNA. Also provided is an aptamer-regulated ribozyme, which (i) when transcribed into RNA, (ii) a coding sequence that provides a tamerstimulatory ribozyme; and (iii) a coding sequence that regulates the transcription of RNA in eukaryotic cells. Also provided are expression constructs comprising one or more transcriptional regulatory sequences that regulate the expression of the gene. Also provided are eukaryotic cells containing the constructs. Also provided are methods for expressing one or more gene products in eukaryotic cells. The method comprises the steps of: The method includes the steps of introducing an expression construct into a cell, and infecting the cell with a ligand and a ribozyme. and contacting the cells with an amount that alters the activity of the gene, particularly when the cells are in a mammalian subject or Also provided is a method in which the ligand is a theofol. It is Irin.

[0117] Ribozymes are RNA molecules that catalyze various chemical reactions, such as self-cleavage or ligation. A molecule (Long and Uhlenbeck (1993), FASEB J. 7:25-30). A variety of naturally occurring ribozymes have been identified in viruses, viroids, and protozoa. One of the first catalytic RNAs was the tobacco ringspot viroid (sTRV). SV) (De la Pena et al., 2003, EMBO J., 22:5561-70). In vivo, this pathogenic viroid: It has been shown that they act in cis and self-cleave during replication. To date, natural ribozymes, including hairpin ribozymes and hammerhead ribozymes, have been Various classes have been identified and extensively characterized.

[0118] Hammerhead ribozymes (hRz) are among the most extensively studied ribozymes. (Long and Uhlenbeck (1993), Faseb J., 7:25-30; Pl (1994), Nature 372:68-74; Hammann et al. (2001), Proc. c. Natl. Acad. Sci. USA, 98:5503-8; Blount and Uhlenbeck (20 05), Annu. Rev. Biophys. Biomol. Struct., vol. 34: pp. 415-40). h Rz consists of three helices that converge into a highly conserved catalytic core of 11 nucleotides (nt). The rix domain (Khvorova et al. (2003) Nat. Struct. Biol. 10:70 8-12; Salehi-Ashtiani and Szostak (2001), Nature, 414:82- Cleavage is sequence specific, resolving a 5'-NUX-3' triplet, where N is any base, U is uracil, and X is any base except guanine. The best NUX for efficient and rapid cleavage is GUC. Ribozyme Cleavage by cleavage of the 2' hydroxyl group derived from X is immediately 3' to the cleavage site. The 2' hydroxyl group of the cleavage site is deprotonated. It attacks the cleavable phosphate and forms the 5' and 3' products via a pentacoordinate trigonal bipyramidal transition state. (Blount and Uhlenbeck (2005), Annu. Rev. Biophys. Biology. omol. Struct., 34:415-40).

[0119] Folding of hRz into its active conformation requires double divalent ion binding. It is hypothesized that the binding process proceeds through a series of events. High affinity binding events occur at 50 This occurs at 0 μM, resulting in the first set of tertiary interactions. Addition of ions occurs at 10 mM, and helix I folds away from helix III. Reorient the hRz stem so that it moves away from the helix and interacts with helix II. (Hammann et al. (2001) Proc. Natl. Acad. Sci. USA 98:5503-8 hRz with a conserved catalytic core that does not maintain a specific stem loop The above is called minimal hammerhead ribozyme (mhRz). At high concentrations (10 mM), it is active, but at low concentrations, it is virtually inactive (De La Pena et al. (2003), EMBO J., 22:5561-70; Khvorova et al. (20 (2003), Nat. Struct. Biol., vol. 10:708-12). The crystal structure of native hRz is a "Y" shaped protein in which two of the stem loops interact as "kissing loops". A type molecule is depicted (Pley et al. (1994), Nature 372:68-74). These tertiary interactions between unpaired bases within the loop are essential for the formation of a catalytically active conformation. The researchers propose that this could stabilize the cation and eliminate the need for highly doubly charged ions. By re-integrating the loop into the mhRz design, In vitro catalytic activity was restored at biologically relevant divalent ion concentrations of (De la Pena et al., 2003, EMBO J., vol. 22:5561.) ~70 pages; Khvorova et al. (2003), Nat. Struct. Biol., vol. 10: 708-12 Canny et al. (2004), J. Am. Chem. Soc., 126:10848-9; Pened o et al. (2004), RNA 10:880-8; Saksmerprome et al. (2004), RNA , vol. 10: 1916-24; Weinberg and Rossi (2005), FEBS Lett., 57 9:1619-24). Here, we design Elucidating the regulations will set the stage for hRz to be an effective regulator of gene expression.

[0120] Therefore, hammerhead ribozymes consist of a core and three stems extending from the core. As used herein, the terms "stem" and "helix" are used interchangeably. Therefore, in this specification, the three stems extending from the core are referred to as stem I. , stem II, and stem III (or helix I, helix II, and helix The second structure is called "sequence III" and has at least one loop located at the opposite end of the stem from the core. In an embodiment of a cis-acting ribozyme, the ribozyme is, on the one hand, a stem II (or The other is located at the end of stem III (or helix II). I) and contains two loops located at the ends of the

[0121] As used herein, a "cis-cleaving hammerhead ribozyme" refers to a cis-cleaving ribozyme that is A hammerhead ribozyme that contains a single polynucleotide in the cis-cleaving region. Merhead-type ribozymes are capable of self-cleavage.

[0122] A stem (or helix) is a nucleic acid motif that extends from the ribozyme core. In certain embodiments, the nucleic acid motif is a double-stranded nucleic acid motif, at least a portion of which is double-stranded. A loop is placed at the opposite end of the stem from the bosenzyme core, and this loop allows the double-stranded stem to be In certain embodiments, the stem is a sequence of 2 to 20 complementary bases. In certain embodiments, the stem comprises 3, 4, 5, 6, 7, 8, or 9 complementary base pairs.

[0123] In certain embodiments, at least 30% of the nucleotides in the stem are complementary The remaining base pairs may be mismatched non-complementary base pairs. In certain embodiments, the nucleotides in the stem are At least 40% are portions of complementary base pairs. In certain embodiments, At least 50% of the nucleotides are part of a complementary base pair. In this configuration, at least 60% of the nucleotides in the stem are part of a complementary base pair. In certain embodiments, at least 70% of the nucleotides in the stem are In certain embodiments, the nucleotides in the stem are complementary to each other. At least 80% are portions of complementary base pairs. In certain embodiments, At least 90% of the nucleotides are part of a complementary base pair. In this configuration, at least 95% of the nucleotides in the stem are part of a complementary base pair. In certain embodiments, at least 99% of the nucleotides in the stem are In certain embodiments, the nucleotides in the stem are complementary to each other. 100% is the portion of complementary base pairs.

[0124] A loop is a sequence of nucleotides that is not paired with the other strand and is located opposite the core. In certain embodiments, the loop is 1 to 20 nucleotides long. In certain embodiments, the loop is between 2 and 10 nucleotides in length. In certain embodiments, the loop is between 3 and 8 nucleotides in length. The loops are numbered according to the stem to which they join. Thus, loop I is Loop II is located at the end of stem I, opposite the core, and loop III is located at the end of stem I, opposite the core. The core is located at the end of stem II, and loop III is located at the end of stem III, opposite the core. will be placed in.

[0125] As used herein, a "stem / loop" refers to any bulges within the stem, and Refers to the entire stem (or helix) together with the loop at the end of the stem. For example, , stem / loop II is a stem II including any bulge within stem II, and a loop II If a stem lacks a loop, the stem / loop may be any As used herein, a "bulge" refers to a nucleic acid that is not paired with another strand. In certain embodiments, the nucleic acid sequence is a sequence of nucleotides flanked on either side by double-stranded nucleic acid sequences. In the case where the bulge is located within the stem, the bulge The nucleotide is considered to be part of the stem. In certain embodiments, the hammerhead A head-type ribozyme contains more than one bulge. In certain embodiments, The bulge is located 2 base pairs from the core. In certain embodiments, one of the stem strands One or both contain a bulge.

[0126] As used herein, nucleotides encoding gRNAs of a CRISPR-Cas system The sequence includes a 5' end and a 3' end, and the 5' end of the nucleotide sequence is a helix I The double-stranded region of II is directly coupled to the double-stranded region of The loop is amplified by two residues in the loop compared to the active ribozyme structure in the absence of the aptamer. Only one backbone phosphodiester bond between the groups is interrupted, and the backbone phosphodiester The bonds are replaced with phosphodiester bonds to the 5' and 3' ends of the aptamer. In the active form of the aptamer-regulated ribozyme, the otherwise interrupted In order to preserve the structure of the loop that is to be transferred, the 5' and 3' residues of the information transfer domain are They base pair with each other to form a double-stranded region.

[0127] As used herein, a "ligand" or "analyte" or grammatical equivalents refers to any molecule that is to be detected. any molecule or compound of interest, designed and / or selected as described herein. It is intended to refer to a molecule or compound that can interact with the aptamer being tested. Ligands or analytes include pesticides, insecticides, toxins, therapeutic drugs, and drugs of abuse, hormones, and the like. Environmental chemicals or substances, including but not limited to drugs, antibiotics, antibodies, organic materials, etc. These include small chemicals such as clinical chemicals, pollutants, or biomolecules. Suitable biomolecules include, but are not limited to, proteins (enzymes, immunoglobulins, and glycoproteins). proteins), nucleic acids, lipids, lectins, carbohydrates, hormones, whole cells (prokaryotes (pathogenic including bacteria, eukaryotic cells (including mammalian tumor cells), viruses, spores, etc. Exemplary analytes that are proteins include, but are not limited to, enzymes; drugs; cells; Body; antigens; cell membrane antigens and cell membrane receptors (neuroreceptors, hormone receptors, nutrient receptors) , and cell surface receptors) or their natural ligands.

[0128] Hammerhead ribozymes (hRz) are ribozymes that bind phosphodiester bonds in trans. cis-acting RNA motifs capable of sustaining cleavage at or in cis. Hammerhead ribozymes (chRz) are ribozymes that undergo self-cleavage of their own backbone to form 2 It is a catalytic RNA that produces two RNA products. The zyme contains a three base-paired stem and a highly conserved core of residues required for cleavage. The cleavage reaction is carried out at the same residue by the 2' hydroxyl oxygen of cytosine, which is the catalytic site. The attack proceeds via an attack on the phosphorus atom attached to the 3' carbon of the sugar phosphate The backbone is broken down to produce a 2',3' cyclic phosphate.

[0129] The minimal hammerhead sequences required for the self-cleavage reaction are mostly found in canonical DNA. Approximately 13 conserved "core" nucleotides that are not involved in the formation of Watson-Crick base pairs in the chromosome The core region generally contains the canonical or invariant "core" nucleotides. Watson-Crick base pairs, but are otherwise unconstrained in terms of sequence. Stem I, stem II, and stem III are adjacent.

[0130] The cleavage specificity of the trans-acting hammerhead ribozyme (thRz) is complementary to the substrate. Ribozymes that anneal in a selective manner and direct cleavage of scissile phosphodiester bonds This activity is controlled by the hybridizing arm of the first triplet of the cleavage moiety. It is specifically oriented to occur after 3 nucleotides.

[0131] The presently disclosed subject matter provides aptamer-regulated trans-acting hammerhead ribonuclease (HRI) antibodies. The present invention provides an aptamer-regulated cis-acting hammerhead ribozyme and an aptamer-regulated cis-acting hammerhead ribozyme. The aptamer-regulated thRz and chRz of They can be easily engineered to be responsive to various conditions, making them versatile and useful in many applications. Ribozyme class. For example, aptamer-regulated thRz and aptamer-regulated c hRz modulates the activity of targeted genes in a ligand-dependent manner. can be designed to regulate the expression of endogenous or heterologous genes. It is useful to modulate

[0132] The ribozyme domain (herein also the effector domain) is in the "off" state and and the "on" state, It undergoes autocleavage in the case of thRz or cleavage of the target sequence in the case of thRz. The conformational state may be defined by the activity level (e.g., reaction rate) of the The effector domain of the presently disclosed subject matter acts as a ligand for the aptamer domain. In response to dopamine binding, they change between their “on” and “off” conformational states. Thus, the subject matter disclosed herein can be switched between a Aptamer-regulated ribozymes are designed to activate and activate the ribozyme in response to ligand binding. In certain embodiments, the ribozyme domain acts as a switch that is turned "off." The function of the aptamer is significantly dependent on the presence or absence of a ligand or on the aptamer itself. -A larger dose-response-like dependence on the concentration of ligand available for binding to the domain It can be shown that:

[0133] Selection of the ligand to which the aptamer binds and thus regulates the ribozyme In certain cases, the ligand is a small molecule with a molecular weight of less than 2500 amu. These include, by way of example only, peptides, small organic molecules (drugs and Natural products, including certain metabolites and intermediates, cofactors, etc., and metal ions The molecule may be naturally occurring or non-naturally occurring. Suitable ligands include, without limitation, drugs, metabolites, intermediates, cofactors, transition state analogs, Aptamers include small molecules such as ions, metals, nucleic acids, and toxins. Peptides, nucleic acids, polysaccharides, glycoproteins, hormones, receptors, and cell walls and membranes It can also bind to natural and synthetic polymers, including cell surfaces such as R Binding of the ligand to the aptamer, a NA, alters base pairing with the signaling domain, This carries over into the structural changes of the ribozyme domain, leading to cleavage of the phosphodiester bond. This alters the ability of the ligase to mediate cleavage (either by self-cleavage or by cleavage of the target sequence). Binding of the endonucleases may, for example, mediate gene inactivation, transcription, translation, or otherwise The ability of the effector domain to interfere with the normal activity of a target gene or target mRNA Affects.

[0134] Aptamers most typically employ in vitro assays for binding to a target molecule. However, in vivo aptamer selection may also be possible. Aptamers form complexes with their intended target molecules in the environment. A specific binding domain capable of binding to a nucleic acid, and in the same environment, other substances do not complex with the nucleic acid. The specificity of the binding is determined by the ability of the aptamer to bind to other materials or non-materials in the environment. Comparative dissociation constants of aptamers to their ligands compared to the dissociation constants of related molecules in general Discrete constant (K d The ligand is defined in terms of the relationship between the ligand and the non-related material. A ligand that binds to an aptamer with sufficient affinity. Typically, the aptamer K for that ligand d The binding of aptamers to unrelated materials or materials present in the environment On the other hand, K dEven more preferably, K d Is less Both are about 50 times lower, more preferably at least about 100 times lower, and most preferably Aptamers typically have a length of about 10 to about 300 nucleotides. More typically, aptamers will be between about 30 and about 100 nucleotides in length. It is probably the length between the dots.

[0135] Aptamers can be readily engineered to bind to a wide variety of molecules. Using the methods of the disclosed subject matter, each of these molecules can be synthesized by isolating the associated ribozyme module. For example, organic molecules, nucleotides, amino acids, polymers, etc. Ligands include peptides, target features on cell surfaces, ions, metals, salts, and sugars. It has been shown that the method is suitable for isolating aptamers capable of specifically binding to H. Organic dyes such as oechst33258 have been shown to be useful in in vitro aptamer selection. It has been successfully used as a targeting ligand for ), Science, Vol. 282, pp. 296-298. Also, dopamine, theophylline, sulphur Other small organic molecules, such as phorophoric acid B and cellulose, have also been shown to be effective in isolating aptamers. It is also used as a ligand for kanamycin A, lividomycin, and tobramycin. cin, neomycin B, viomycin, chloramphenicol, and streptomycin Aptamers that recognize small molecules such as cyclosporine have also been isolated. For theory, see Famulok (1999), Science 9:324-9.

[0136] In certain embodiments, the aptamer-regulated ribozymes of the presently disclosed subject matter The ligands of aptamers are cell-permeable small organic molecules. Small organic molecules that have no detrimental effect are preferred as ligands. Small molecules also have the potential to inhibit the desired level of translation. It is also preferred that the compound exhibit sufficient persistence in vivo to achieve inhibition of Molecules can also be screened to assess bioavailability, e.g., after oral administration. In certain embodiments of the subject matter disclosed herein, a molecule that exhibits The ligand is non-toxic. The ligand is optionally a drug, including, for example, a steroid. However, in some methods of regulating gene expression, the ligand is pharmacologically ineffective. In some embodiments, the ligand is a ligand whose presence in a cell is indicative of a disease. In another embodiment, the aptamer is a polypeptide indicative of a disease or pathological condition. The ligand is an antibiotic, such as chloramphenicol. The ligand of the mer is an organic dye such as Hoeschst dye 33258. In embodiments, the ligand may be a metal ion. In specific embodiments, an aptamer The aptamer domain of the regulatory nucleic acid is responsible for binding to caffeine.

[0137] In vivo or in vitro (most typically in vitro) The selection technique known as SELEX (Ellington et al., 1990, Nature, Vol. 346) , pp. 818-22; and Tuerk et al. (1990), Science, vol. 249, pp. 505-10. ) is used to develop aptamers that bind to specific ligands. Methods for producing aptamers are also described in, for example, U.S. Patent No. 5,582,981; PCT Publication No. WO00 / 20040; U.S. Patent No. 5,270,163; Lorsch and Szostak (1994) Biochemistry 33:973; Mannironi et al. (1997) , Biochemistry, 36:9726; Blind (1999), Proc. Natl. Acad. Sc i. USA, 96:3606-3610; Huizenga and Szostak (1995), B iochemistry, vol. 34: 656-665; PCT Publication No. WO99 / 54506, WO99 / 27133, WO97 / 42317; and U.S. Pat. No. 5,756,633. This is also described in US Pat. No. 291.

[0138] Generally, in their most basic form, in vivo methods for identifying aptamers are used. The selection technique in vitro involves first generating a large pool of oligonucleotides of the desired length. A pool containing at least some of the regions that have been randomized or mutagenized. For example, a general oligonucleotide sequence for aptamer selection may be prepared. A dopool is a region of 20-100 randomized nucleotides, with is a region of about 15-25 nucleotides in length that is useful for binding PCR primers and has a defined The selected nucleic acid sequence may contain regions flanked by regions of sequence that have been determined with confidence. Any means that can efficiently amplify the nucleic acid may be used, but an oligonucleotide pool may be used. The DNA pool is then amplified using standard PCR techniques. ro to produce RNA transcripts, which can then be used to produce other molecules (e.g., proteins). allows for the selection of nucleic acids based on their ability to specifically bind to a target molecule (such as a protein or any target molecule) The RNA transcripts are preferably subjected to affinity chromatography, although any suitable protocol may be used. In the case of affinity chromatography, the transcripts can be The target ligand can be immobilized on magnetic beads or passed through a column. Most typically, the RNA molecules in the pool that are bound to the ligand are The sequences that are retained on the column or beads but do not bind are then washed away. The RNA molecules that bind to the ligand are reverse transcribed and amplified again by PCR (usually by elution The selected pool sequences are then subjected to another round of the same type of selection. Pool sequences are typically subjected to a total of about 3-10 iterative rounds of the selection procedure. The sequence of the RNA molecule capable of acting as an aptamer for the target ligand is then determined. Identify, amplify, clone, and sequence the cDNA using standard procedures. Once the aptamer sequence has been successfully identified, the mutagenized aptamer sequence is By carrying out further rounds of selection, starting from a pool of oligonucleotides containing The aptamer can be further optimized by the above method. For use, the aptamers are incubated in the presence of salt concentrations and temperatures that mimic normal physiological conditions. and preferably selects for binding to a ligand.

[0139] In general, appropriate resources are provided without mentioning whether the aptamer is still available. In most cases, one of skill in the art will be able to select a ligand of choice. The inherent nature of the in vitro selection process allows the production of aptamers that bind to the target protein. The criteria are based on prior knowledge of what types of structures can bind to the desired ligand. However, there is a complete lack of suitable aptamers that bind to the desired ligand. This allows for separation.

[0140] For an aptamer to be suitable for use in the presently disclosed subject matter, it must meet the criteria set forth herein. The aptamer-regulated ribozymes of the disclosed subject matter are controlled between an "on" state and an "off" state. To switch or tune the functional level of aptamer-regulated ribozymes In addition, the binding affinity of the aptamer for the ligand must be sufficiently large. In addition, the structure formed by an aptamer when bound to its ligand is also meaningful. It must be.

[0141] The association constant for an aptamer and a ligand to be associated therewith is the amount of binding that occurs when the ligand functions to bind to the aptamer. The concentration of ligand that is obtained when the ligand is administered and binds to the tamer produces the desired effect. For in vivo use, for example, The association constant is determined by the concentration of ligand that is sufficiently low that binding can be achieved in serum or other tissues. The association constant should be such that the binding occurs at a concentration that is equal to or greater than the in vivo binding concentration. The ligand concentrations required for such use are also concentrations that may have undesirable effects on the organism. It is also a concentration below 100%.

[0142] Thus, certain embodiments include one or more preselected ligands or or a given ligand. The subject aptamer-regulated ribozymes also provide methods for screening and selecting for their cleavage. The exchange behavior of the protein can also be "tuned" to be generally responsive to ligand binding. Aptamer-regulated ribozymes can also be used to regulate the binding affinity of the aptamer domain. It is also possible to "tune" a tee to be generally sensitive to its ligand. For example, intramolecular duplex formation within aptamer-regulated ribozymes, as well as other secondary Structural and tertiary structure thermodynamic properties indicate that the aptamer domain is capable of binding to the ligand. , i.e., the dissociation constant (K d ) or other reaction rate parameters (K o n Velocity and K off The speed, etc.) can be varied as may be manifested in the , hybridization, and secondary and tertiary structures of the ribozyme domain. The allosteric interactions of the ribozyme domains are maintained even if other intramolecular interactions that may lead to The change may be generally responsive to binding to a ligand. Forward engineering strategies to alter thermodynamic properties are well known. Increased complementary nucleic acid pairing increases the stability of the ribozyme or aptamer domain It can be done.

[0143] III. Methods for Treating Neurodegenerative Diseases The subject matter disclosed herein also relates to a method for treating a neurodegenerative disease, disorder, or condition. In some embodiments, the subject matter disclosed herein comprises a method for treating 1. A method for treating an ocular neurodegenerative disease in a subject in need thereof, comprising: i) at least one encoding a guide RNA (gRNA) for a CRISPR-Cas system; a gRNA comprising a H1 promoter operably linked to a nucleotide sequence of It hybridizes with the target sequence of a DNA molecule in the cells of the body, and the DNA molecule becomes expressed in the cell. ii) a gene product or products that can be activated in the cell; A regulatory element operable in a nucleotide sequence encoding a Cas9 protein. and one or more vectors comprising a non-naturally occurring CR operably linked regulatory element. An ISPR-Cas system, wherein components (i) and (ii) are contained in the same vector or The gRNA is placed in a different vector and targets the target sequence, which is then hybridized with the gRNA. The Cas9 protein then cleaves the DNA molecule to produce one or more gene products. (b) providing a CRISPR-Cas system that modifies expression of the and administering an amount of the system.

[0144] "Neurodegenerative disease, disorder, or condition" means a neurodegenerative disorder or condition that affects neurons or retinal optic nerves. Diseases, disorders, or conditions associated with the degeneration or dysfunction of other neural cells, such as receptor cells Neurodegenerative disease, neurodegenerative disorder, or neurodegenerative condition (including neuropathy) The condition may be characterized by a decrease or dysfunction of neurons, or by the activation of neurons or other neural cells. The disease may be any disease, disorder, or condition in which loss of cells may occur.

[0145] Such diseases, disorders, or conditions include glaucoma, and amyotrophic lateral sclerosis (ALS). ), trigeminal neuralgia, glossopharyngeal neuralgia, Bell's palsy, myasthenia gravis, muscular dystrophy, progressive myofascialgia atrophy, primary lateral sclerosis (PLS), pseudobulbar palsy, progressive bulbar palsy, spinal muscular atrophy, Hereditary muscular atrophy, intervertebral disc syndrome, cervical spondylosis, plexopathy, thoracic outlet syndrome, peripheral neuropathy, Porphyria, Alzheimer's disease, Huntington's disease, Parkinson's disease, Parkinson's disease, multiple system atrophy, progressive supranuclear palsy, corticobasal degeneration, Dementia with Bea bodies, frontotemporal dementia, demyelinating diseases, Guillain-Barre syndrome, multiple sclerosis , Charcot-Marie-Tooth disease, prion disease, Creutzfeldt-Jakob disease, Gersh GSS, Fatal Familial Insomnia (FFI) ), bovine spongiform encephalopathy (BSE), Pick's disease, epilepsy, and the AIDS-dementia complex. Neurodegenerative diseases, disorders, or conditions of the nervous system, or associated therewith including, but not limited to, neurodegenerative diseases, disorders, or conditions of the nervous system do not have.

[0146] Also, alcoholism, Alexander disease, Alpers disease, and ataxia-telangiectasia Batten disease (also known as Spielmeyer-Vogt-Sjögren-Batten disease) Also known as Canavan disease, Cockayne syndrome, diabetic neuropathy, frontotemporal neuropathy Degeneration, HIV-associated dementia, Kennedy's disease, Krabbe's disease, neuroborreliosis, Machado-Di Joseph's disease (Spinocerebellar ataxia type 3), wet macular degeneration or dry macular degeneration, Niemann-Pick disease, Pelizaeus-Merzbacher disease, retinitis pigmentosa and related disorders photoreceptor degenerative diseases, Refsum disease, Sandhoff disease, Schilder disease, and subacute myelopathy secondary to pernicious anemia Sexually-associated spinal degeneration, Spielmeyer-Voght-Sjögren-Batten disease (Batten disease) Also known as Kettmann's disease), spinocerebellar ataxia (multiple types with diverse features) Neurological disorders such as encephalopathy, Steele-Richardson-Olszewski disease, and tabes dorsalis. Other neurodegenerative diseases, disorders, or conditions, or neurodegenerative disorders associated therewith Also included are other neurodegenerative diseases, disorders, or conditions of the system.

[0147] Examples of eye-related neurodegeneration include glaucoma, lattice dystrophy, retinitis pigmentosa, and age-related macular degeneration. (AMD), photoreceptor degeneration associated with wet or dry AMD, pigmented retinal Other retinal degenerations such as retinal parenchyma (RP), optic nerve drusen, optic neuropathy, and multiple sclerosis In some embodiments, the optic neuritis includes, but is not limited to, optic neuritis, such as optic neuritis resulting from The ocular neurodegenerative disease is selected from the group consisting of glaucoma, retinal degeneration, and age-related macular degeneration. In some embodiments, the ocular neurodegenerative disease is retinitis pigmentosa (RP).

[0148] The different types of glaucoma that can be prevented or treated according to the subject matter disclosed herein include, but are not limited to, Typical examples are primary glaucoma (primary open-angle glaucoma, chronic open-angle glaucoma, chronic simplex glaucoma, etc.) Glaucoma (also known as glaucoma parenchymal, glaucoma parenchymal, and glaucoma simplex), low tension glaucoma, primary angle-closure glaucoma (primary angle-closure glaucoma) Primary closed-angle glaucoma, narrow-angle glaucoma acute occlusion glaucoma, pupillary block glaucoma, and acute congestive glaucoma, Angle-closure glaucoma, chronic angle-closure glaucoma, intermittent angle-closure glaucoma, chronic open-angle glaucoma c open-angle closure glaucoma), pigmentary glaucoma, exfoliation glaucoma (pseudoexfoliation glaucoma or glaucoma), developmental glaucoma (e.g., primary congenital glaucoma, and infantile glaucoma), secondary glaucoma (e.g., inflammatory glaucoma (e.g., uveitis and glaucoma) glaucoma (e.g., angle-closure glaucoma with mature cataract, Phacoemulsification glaucoma secondary to rupture of the lens capsule, and clogging of the trabecular meshwork due to phacotoxicity glaucoma secondary to intraocular hemorrhage (e.g., cataracts, lens subluxation, and cataracts) , hyphema and erythroclastic glaucoma Also known as hemolytic glaucoma, traumatic glaucoma (e.g., recession glaucoma, traumatic recession of the anterior chamber angle, postoperative glaucoma, aphakic pupillary block glaucoma), neovascular glaucoma, drug-induced glaucoma (e.g., colitis, glaucoma, and ciliary block glaucoma). typhoid-induced glaucoma and alpha-chymotrypsin glaucoma), toxic glaucoma, as well as intraocular tumors, retinal detachment, severe chemical burns to the eye, and glaucoma associated with iris atrophy. In certain embodiments, the neurodegenerative disease, disorder, or condition is hyperactivity. A disease, disorder, or condition that is not associated with excessive angiogenesis, e.g., glaucoma that is not neovascular glaucoma It is an internal obstruction.

[0149] As used herein, the term "disorder" generally refers to an identified target or pathway that Any condition that would benefit from treatment with a compound directed against one of the identified targets. or one of the pathways by an effective amount of a compound, or a pharma- ceutically acceptable salt thereof. It refers to a condition, including any disease, disorder, or condition, that can be treated.

[0150] As used herein, the term "treating" refers to the any disease, disorder, or condition, or any one or more of such diseases, disorders, or conditions It can cause multiple symptoms or symptoms (e.g., dysfunction and / or death of retinal photoreceptor cells). to reverse, alleviate, inhibit the progression of, or prevent a disease or disorder that causes In some embodiments, treatment can include preventing or reducing the likelihood of and reduces dysfunction and / or death of retinal photoreceptor cells. Dysfunction and / or death of membrane photoreceptor cells in subjects prior to treatment or after treatment Compared with retinal photoreceptor cell dysfunction and / or death in subjects without At least 5%, 10%, 15%, 20%, 25%, 30%, 33%, 35%, 40%, 45% %, 50%, 55%, 60%, 66%, 70%, 75%, 80%, 85%, 90%, 91 %, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99%, or any combination of these In some embodiments, the treatment can reduce retinal photic dysfunction in the subject. completely inhibits the dysfunction and / or death of receptor cells. "Photoreceptor cells" are a specialized type of neuron found in the retina that converts light signals into light. In some embodiments, the at least one gene product is a neuron capable of transmitting It is rhodopsin.

[0151] In some embodiments, the system is administered to a subject as a single adeno-associated virus prior to the step of administration. In some embodiments, the antigen-binding protein (AAV) is packaged into an antigen-binding protein (AAV) particle for administration to a subject. The step is administered by subretinal injection. The treatment, administration, or therapy may be continuous or intermittent. Continuous treatment, continuous administration, or continuous therapy means at least daily Intermittent treatment refers to treatment on a regular basis without interruption of one or more days during treatment. Intermittent administration, or intermittent treatment or administration, refers to treatment that is cyclical rather than continuous. Treatment according to the methods disclosed herein may result in complete relief from the disease, disorder, or condition. or may result in a cure, which may result in the treatment of one or more of the diseases, disorders, or conditions. It may result in partial relief of symptoms, may be a temporary fix, or may be permanent. The term "treatment" also encompasses prophylaxis, therapy, and cure. It is also intended.

[0152] The term "effective amount" or "therapeutically effective amount" refers to an amount that achieves beneficial or desired results. A therapeutically effective amount refers to an amount of drug sufficient to treat the subject being treated, which can be readily determined by one of skill in the art. The body mass and disease state of the subject, the weight and age of the subject, the severity of the disease state, the mode of administration, etc. The term may vary depending on one or more of the imaging methods described herein. The present invention also applies to doses that provide an image for detection by any one of the following: The amount will depend on the particular agent selected, the dosing regimen followed, and when administered in combination with other compounds. Whether or not, the number of doses, the tissue being imaged, and the physical delivery system being used It may vary depending on one or more.

[0153] As used herein, the terms "subject" and "patient" are used interchangeably. In many embodiments, the subject treated by the methods disclosed herein is a human subject. Preferably, the subject is a human subject, but the methods described herein do not include the term "subject." It is understood that the present invention is effective with respect to all vertebrate species that are intended to be included in the present invention. Thus, a "subject" is a subject in need of treatment for an existing condition or disease, or for preventing the onset of a condition or disease. This may include human subjects for medical purposes, such as prophylactic treatment to prevent disease, This may also include animal subjects for veterinary, medical or development purposes. Long-legged animals, e.g., humans, monkeys, apes, etc.; Bovine animals, e.g., cattle, draft cattle, etc.; Sheep sika deer, such as sheep; caprine deer, such as goats; swine deer, such as pigs; Pigs, including adult pigs; equines, including horses, donkeys, zebras, etc.; wild and domestic cats Felidae; canines, including dogs; lagomorphs, including rabbits, hares, etc.; and mice. Mammals, including but not limited to rodents, including mice, rats, etc. In some embodiments, the subject may be a fetal subject, a newborn subject, or a transgenic animal. Includes, but is not limited to, child subjects, infant subjects, adolescent subjects, and adult subjects. A "subject" is a human subject. Additionally, a "subject" refers to a patient suffering from a condition or disease, or may include a patient suspected of having a condition or disease.

[0154] IV.General Definitions Certain terms are used herein, but they are intended to be generic and descriptive only. These terms are used in this document and are not intended to be limiting unless otherwise specified. Unless otherwise stated, all technical and scientific terms used herein are defined as follows: have the same meaning as commonly understood by a person skilled in the art to which the subject matter described belongs. do.

[0155] In accordance with long-standing patent law practice, the terms "a," "an," and "the" are used interchangeably. The terms "one or more" as used in this application, including the claims. Thus, for example, a reference to "the object" may be made without the context making clear the contrary. To the extent that (e.g., a plurality of objects), it includes a plurality of objects, etc.

[0156] Throughout this specification and the claims, the words "comprise" and "include The terms "comprises" and "including" are used interchangeably depending on the context. Unless otherwise required, the word "list" is used in a non-exclusive sense. A listing of an item may include other similar items that may substitute for the listed item. may be added to the term "including" so as not to exclude similar items. The term "use") and grammatical variations thereof are also intended to be non-limiting.

[0157] For purposes of this specification and the appended claims, unless otherwise indicated, In amounts, sizes, dimensions, ratios, shapes, formulations, parameters, percentages All numbers expressing rates, parameters, quantities, characteristics, and the like, as well as any other terms used in this specification, and other numerical values ​​used in the claims are expressly incorporated by reference in their entirety unless the term "about" is used to denote a value, amount, or range. In all cases, even if not expressly stated with a range, the term "about" shall apply. Therefore, unless indicated to the contrary, In this regard, the numerical parameters set forth in the following specification and appended claims are given precisely It is not a numerical value, but it does not have to be, and is a desired value that is sought to be obtained by the subject matter disclosed herein. Depending on the characteristics of the device, tolerances, conversion factors, rounding errors, measurement errors, etc., and other factors known to those skilled in the art may be included. may be rounded and / or larger, as desired, to reflect various factors. For example, the term "about" when referring to a value means The variations are suitable for carrying out the disclosed methods or incorporating the disclosed compositions. Therefore, in some embodiments, the range is ±100%, and in some embodiments, ±100% from the specified amount. ±50%, in some embodiments ±20%, in some embodiments ±10%, in some embodiments ±10%. In some embodiments, the range is ±5%, in some embodiments, ±1%, in some embodiments, ±0.5%, Some embodiments may be intended to encompass a variance of ±0.1%.

[0158] Additionally, the use of "about" when used in connection with one or more numbers or numerical ranges. The term should be understood to refer to all such numbers, including all numbers within a range, and as set forth herein. Modify a range by extending the upper and lower numerical limits. A recitation of a range includes all numbers within that range and any range within that range, e.g., Includes all integers, including their fractions (e.g., the enumeration 1 to 5 includes 1, 2, 3, 4, and 5). as well as fractions thereof, e.g. 1.5, 2.25, 3.75, 4.1, etc.) EXAMPLES

[0159] The following examples provide guidance for practicing representative embodiments of the subject matter disclosed herein. The present disclosure and general techniques in the art are incorporated herein for the purpose of providing the same to those skilled in the art. In light of this level, those of skill in the art will appreciate that the following examples are intended to be illustrative only. Numerical changes, modifications, and variations are possible without departing from the scope of the subject matter disclosed herein. It is understood that variations and modifications may be incorporated herein by reference. The specific examples and examples are intended for illustrative purposes only and are not intended to be limiting of the scope of the present disclosure. The methodology used herein is not to be construed as limiting in any way.

[0160] Example 1 method Plasmid construction: H1 gRNA expression construct (see Tables 1, 2, and 3 below) To generate the desired gene, overlapping oligonucleotides were assembled to generate a 76-bp gRNA. The H1 promoter was created in fusion with the A scaffold and pol III termination signal. 1. Incorporating a BamHI site between the promoter and the gRNA scaffold to facilitate targeting The sequence was then inserted into the H1::gRNA scaffold::pol III terminator. The target sequence was inserted into pCR4-Blunt (Invitrogen, Carlsbad, CA). The resulting vector was cloned into a genomic DNA fragment and sequenced and verified. The vector is in the reverse orientation (see below). To generate RNA, overlapping oligonucleotides are annealed to prepare a two-step amplification kit. Phusion Flash DNA polymerase (Thermo Fisher Scientific The DNA was amplified by PCR using a PCR kit (Centific, Rockford, IL) and then Carboxylat mixed with 2 volumes of 25% PEG and 1.5M NaCl e-Modified Sera-Mag Magnetic Beads(Therm The purified DNA was then purified using a ELISA kit (Fisher Scientific). The PCR products were resuspended in HO and purified using a NanoDrop 1000 (Thermo F The gRNA expression constructs were quantified using a U 6. For expression, digest the plasmid with AflII (#41824, Addgene, C ambridge MA), or for H1 expression, by BamHI as described immediately above. Gibson Assembly (New E) with some modifications to plasmid digestion ngland Biolabs, Ipswich, MA) (Gibson et al. (2009), Na The total reaction volume was 20 μl. The volume was reduced from 1 μl to 2 μl.

[0161] Cell culture: hESC cell line H7 and IMR-90 iPS cells (WiCell, M adison WI) according to a previously described protocol (Walker et al. (2010) Nat. Commun., 1:71; Maruotti et al. (2013), Stem Cells Translational Medicine Ink with 10% CO2 / 5% O2 according to the Japanese Society of Clinical Chemistry, Vol. 2: 341-354. The cells were incubated in a centrifuge in mTeSR1 medium (Stem Cell Technologies, V ancouver, BC), Growth Factor Reduced Matr. on igel (BD Biosciences, Franklin Lakes, NJ). For subculture, hESC colonies were first subcultured in mTes 5 μM blebbistatin (Sigma-Aldrich, St. Louis, MO) was added to R1. O) and then Accutase (Sigma-Aldrich The cells were harvested after treatment with 5-10 min. The cell clumps were gently dissociated into a single cell suspension. hPSCs were then incubated with mTe with blebbistatin and pelleted by centrifugation. Resuspend in SR1 and collect at 1 cm 2 Approximately 1,000 to 1,500 cells were seeded per well. Two days after passage, the medium was replaced with mTeSR1 (without blebbistatin) and Exchanged days.

[0162] Human embryonic kidney (HEK) cell line 293T (Life Technologies, Grand Island, NY) with 10% fetal bovine serum (Gibco, Life Sciences, NY). Technologies, Grand Island, NY) and 2 mM Glut Dulbecco's modified Eagle's medium (DMEM) supplemented with aMAX (Invitrogen) (Invitrogen) at 37°C with 5% CO2 / 20% O2.

[0163] Gene targeting in H7 cells: hESC cells were incubated with 10 μl of PBS 24 h prior to electroporation. M Rho Kinase inhibitor (DDD00033325, EMD Millipor Electroporation was performed according to the manufacturer's instructions using N Electroporation was performed using the eon kit (Invitrogen). On the day of incubation, hESCs were incubated with Accutase ( Importantly, colonies were digested into single cell suspensions. After picking the colonies, the wet pellet was placed on ice for 1 min. The plate was then incubated for 15 minutes and then electroporated with the gene targeting plasmid. The electroporation parameters were as follows: voltage: 1400 ms; interval: 30 Following electroporation, cell colonies were treated with 10 μM Rho Slowly transfer the cells to mTeSR1 medium containing kinase inhibitors and then store at room temperature for 2 h. After keeping for 0 minutes, the cells were seeded on Matrigel-coated dishes. Further culture was performed.

[0164] To analyze clonally derived colonies, electroporated hESCs were cultured in vitro. The cells were grown to subconfluency and subcultured as described in the previous paragraph, and then placed in a 35 mm The cells were seeded at a density of 500 cells per dish. Single colonies were then isolated by hand. It was isolated by harvesting and further cultured.

[0165] For transfection of 293T cells, approximately 100,000 cells per well 24 hours before transfection, 100 cells were transferred to a 24-well plate (Falcon, The cells were cultured in 100-well plates (Corning, NY) according to the manufacturer's recommended protocol. Lipofectamine LTX Plus Reagent (Invitroge Each well of a 24-well plate was transfected in quadruplicate using 4 00 ng of Cas9 plasmid and 200 ng of gRNA plasmid in 0.5 μl of Plus Reagent and 1.5 μl Lipofectamine LTX Reagent and mixed.

[0166] Generation of constitutively expressing GFP ESC cell lines: H7 human ESC cell line (WiCel l) was cultured on a Matrigel substrate using mTeSR1 (Stem Cell Technology Before subculturing the cells, the cells were treated with blebbistatin. A brief pretreatment with Accutase (>5 min) increased cell viability and The cells were treated for 1 min, mixed into a single cell suspension, and quenched with an equal volume of mTesR. Pellet at 80 x g for 5 min and resuspend in mTesR containing blebbistatin. Suspended cells 1 x 10 6 The cells were pelleted, the medium was carefully removed, and the cells were incubated at 10 Place on ice for .about.15 min. Homology to the AAVS1 safe harbor locus 10 μg of AAV-CAGGSEGFP donor vector (#22212, A ddgene) plus 5 μg of hAAVS1 1R+L TALE in R buffer N (#35431 and 35432, Addgene) (Hockemeyer et al. (2009), Nat. Biotechnol., 27:851-857; Sanjana et al. (2012), Nature Pr otocols, vol. 7: 171-192) with the following parameters: 1500 V, per pulse 20 ms per pulse and 1 pulse per 100 ms, using the Neon Transfection System. Electrode placement was performed using a 100μl chip using Life Technologies The cells were then gently added to 1 ml of medium and incubated at room temperature for 15 min. The cells were then incubated in a 200-mL culture medium containing mTeSR and 5 μM blebbistatin. After 2 days, the cells were plated on 35 mm dishes coated with 35% rigel. 1 x 10 cells per mm dish 4 The cells were seeded at a density of 100,000 cells / ml and then stabilized over time. Various clonal sublines were manually isolated using a fluorescence-equipped Nikon TS100 epifluorescence microscope. Selected for business.

[0167] Surveyor assay and sequencing analysis for genome modification: Surveyor For eyor analysis, cells were extracted with QuickExtract solution (Epicentre, Madison, WI) and incubated at 65° C. for 15 minutes. Genomic DNA was then extracted by incubating at 98°C for 10 minutes. The extract solution was purified using DNA Clean and Concentrator (Zym o Research, Irvine, CA) and NanoDrop Quantification was performed using CRISP (Thermo Fisher Scientific). The genomic region surrounding the target site was subjected to Phusion DNA polymerase (New E The PCR products were amplified from 100 ng of genomic DNA using a PCR kit (Grand Biolabs). Multiple independent PCR reactions were pooled and PCR was performed according to the manufacturer's protocol (Qiagen, Vale). The Qiagen MinElute Spin Column was used according to the protocol of the National Institute of Clinical Chemistry, CA. The product was purified using 12.5 mM Tris-HCl (pH 8.8), 62.5 mM 400 ng of PCR product in 1.875 mM KCl and MgCl2. Denature a volume of 8 μl slowly: 95 °C for 10 min with a gradient of -1.0 °C per second. 95°C to 85°C, 85°C for 1 second, 85°C to 75°C with a gradient of -1.0°C per second °C, 75 °C for 1 second, 75 °C to 65 °C with a gradient of -1.0 °C per second, 65 °C for 1 second 65°C to 55°C for 1 second with a gradient of -1.0°C per second, 55°C for 1 second, 55°C to 45°C with a gradient of -1.0°C for 1 second at 45°C, gradient of -1.0°C per second 45°C to 35°C with a gradient of -1.0°C per second, 35°C to 25°C with a gradient of -1.0°C per second The DNA was reannealed at 3° C. and then kept at 4° C. to allow heteroduplex formation. Surveyor Enhancer and 1 μl of Surveyor Nuclease (T Ransgenomic (Omaha, NE) was added to each reaction and incubated at 42° C. for 60 min. After incubation for 1 h, 1 μl of Stop Solution was added to the reaction. DNA 1000 chip (Agilent, Santa Clara, CA) 1 μl of the reaction was quantified on a 2100 Bioanalyzer using the Gel For the analysis, 6x loading buffer (New England Biolabs) was used. 2 μl of ethidium bromide was added to the remaining reaction and incubated with 3% agarose gel containing ethidium bromide. The gels were loaded onto a Gel Logic 200 Imaging System. (Kodak, Rochester, NY) and visualized using ImageJ v.1.46 NHEJ frequency was quantified using the binomial derived equation:

number

[0168] Flow cytometry: Following blebbistatin treatment, subconfluent hESC colonies were cultured. Ronnies were harvested by Accutase treatment, dissociated into a single cell suspension, and pelleted. The cells were then stained with Vybrant DyeCycle ruby ​​stain ( Live Cell Solution (Invitrogen) The cells were then resuspended in 100 mM NaCl (Progen) and analyzed by an Accuri C6 flow cytometer (BD Biosciences). The data were analyzed using the IEEE International Conference on Biological Chemistry (ICC) and the IEEE International Conference on Biological Chemistry (BJC).

[0169] Quantitative real-time qPCR: 293T cells were incubated for 24 hours prior to transfection. , 250,000 cells per well in a 12-well plate (Falcon). Cells were seeded with 6 dose titrations of gRNA plasmid: 0 ng, 31.25 ng, 40 ng, 50 ng, 60 ng, 70 ng, 80 ng, 90 ng, 100 ng, 120 ng, 160 ng, 180 ng, 20 ng, 30 ng, 40 ng, 50 ng, 60 ng, 7 ng, 62.5ng, 125ng, 250ng, or 500ng, as recommended by the manufacturer Lipofectamine LTX with Plus was used according to the protocol provided in the The cells were transfected in triplicate using Invitrogen Reagent. 48 hours after transfection, total RNA was purified using RNAzol RT (Molecula The samples were isolated using a 100% glycerol (100% glycerol) antibody from the rDNA-binding protein 1 (RDNA-binding protein 1, rDNA-binding protein 1, and rDNA-binding protein 2) from the rDNA-binding protein 1 (RDNA-binding protein 1, rDNA-binding protein 2, and rDNA-binding protein 2) from the rDNA-binding protein 1 (RDNA-binding protein 1, rDNA-binding protein , and purified using Direct-zol RNA MiniPrep (Zymo). Five hundred nanograms of total RNA was purified using dsDNase (ArticZymes; Plymouth Meeting, PA USA) to remove residual genomic DNA contamination, and Superscript III reverse transcriptase (Invitrogen) was used as recommended by Reverse transcription was performed in 20 μl reactions using 0.1 μM of the following oligonucleotides: Nucleotide; gRNA scaffold - [ka] Each reaction was primed using the same sequence as in Example 1. The underlined scaffold sequence indicates the stability of the transcript. Each qPCR reaction was performed in a volume of 10 μl with 250 SsoAdvanced™ Unicontains nM of oligonucleotide primers Versal SYBR® Green Supermix (Biorad) , and 1 microliter of the RT reaction product at a 1:15 dilution ratio as described above. The reaction was run on a rad CFX 96 real-time PCR machine. The reaction was run at 95°C for denaturation. A 40-series PCR reaction was performed with a 54°C annealing step, a 54°C annealing step, and a 60°C extension step. The following primers were used: F1for-GTTTTAGAGCTAG AAATAGCAAGTTAA (SEQ ID NO: 3) and guideRNAscaffrev -AAGCACCGACTCGGTGCCAC (SEQ ID NO: 4) and U6snRNAF- CTCGCTTCGGCAGCACATATACT (SEQ ID NO: 5) and U6 snRNA Rev-ACGCTTCACGAATTTGCGTGTC (SEQ ID NO: 6) A and reference genes were used to detect each of the guide RNA samples. Relative normalized expression and sem were measured using Biorad's integrated CFX Manager software. The calculation was performed using software.

[0170] Bioinformatics: Determining all potential CRISPR sites in the human genome To achieve this, a custom Perl script was used to generate the 23-mer CRISPR sequence site, Ru, GN 19 NGG or AN 19Both strands of NGG and occurrences of duplications were searched. Distance To calculate the mean and median values, predicted CRISPR excision sites were First, it was defined that it occurs between the third and fourth bases upstream of the PAM sequence. After the gRNAs were extracted, the distance between all adjacent gRNAs in the genome was then calculated. The data was imported into R to calculate mean and median statistics and plot the data. To calculate the average density, the gRNA excision sites were plotted across the genome. The results were rebinned and the occurrence frequency was calculated. The data was plotted in R using s to generate circular plots (Krzywins (2009), Genome Research, 19:1639-1645. Human Genes Utilities in BEDTools to calculate incidence in or at disease loci The bioinformatics service IntersectBED (Quinlan and Hall, 2010; Bioinformatics ics, vol. 26:841-842) using UCSC Genome Browser. RefSeq BED file read from r or OMIM (Online Me ndelian Inheritance in Man, OMIM, McKusick -Nathans Institute of Genetic Medicine, J ohns Hopkins University (Baltimore, MD), 20 We found some overlaps between the BED files read from the 2013 BED database and the BED files used in this study. The genomes studied are human (hg19), mouse (mm10), rat (rn5), and bovine (bos Tau7), chicken (galGal4), zebrafish (dr7), Drosophila fly (dm3), C. elegans (ce10), and S. cerevisiae ( sacCer3).

[0171] [Table 1]

[0172] [Table 2]

[0173] [Table 3]

[0174] result To extend the current limitations of CRISPR / Cas9 targeting, U6 p H1 pol III, rather than H1 pol III, can be used as an alternative promoter. (Baer et al., 1990, Nucleic Acids Res., vol. 18: (pp. 97-103). H1 has one of the purines (nucleotide R) at the +1 position. To express the transcript, S. pyogenes Cas9 was used in combination with AN 19 NGG YobiGN 19 By allowing cleavage at both NGG sites, It was hypothesized that the targeting space could be expanded (Figure 1A). To demonstrate site-specific cleavage by , we used 100% cleavage mediators in the H7 human embryonic stem cell line (hESC; Fig. 1B ). CRISPR-mediated ablation of an integrated GFP target gene at the AAVS-1 locus We developed a reporter assay to measure the expression of β-lactamase (Hockemeyer et al., 2009, Nat. Biotech. Mol., 27:851-857). The frequency of error-prone non-homologous end joining (NHEJ) As a surrogate indicator of the degree of transcription, the loss of GFP fluorescence due to the interruption of the coding sequence was measured ( In-frame mutations or indels that do not interfere with GFP fluorescence will not be detected. It is noteworthy that the assay underestimates NHEJ (Figure 1B and 1C). 7. Electroporation of Cells with Equimolar Ratio of Cas9-expressing Plasmid and gRNA-expressing Plasmid After colony formation, the cells were visualized for GFP fluorescence. In contrast, all tested gRNA constructs from the U6 and H1 promoters The construct shows mosaic loss of GFP signal in cells that have undergone targeted mutations. The total cell number was quantified by nuclear staining using a flow cytometer. This allows cell-based analysis of GFP fluorescence by chromatometry. Although 100% of the constructs resulted in NHEJ, as demonstrated by the loss of The range of efficiencies varied for both the U6 and H1 constructs (Figure 1C, right and left). (Data shown). Expressing gRNA from the U6 or H1 promoter This suggests that mutagenesis of the GFP gene is a GN 19 NGG or AN 19 NGG It is demonstrated that this can occur at each of the sites.

[0175] To confirm these results and extend them in other cell lines, we performed A HEK-293 cell line expressing GFP was targeted with the same gRNA construct as above. Surveyor analysis (Qiu et al. (2004), BioTechniques, 36:70 2-707), depending on the type of promoter and the location of targeting. A range of editing efficiencies was detected (Figure 1D and Figure 2). By using human induced pluripotent stem cells (hiPSCs), Ability to modify endogenous genes by targeting the AAVS-1 locus We also confirmed that targeted cleavage by gRNA driven by H1 and U6 was , with an efficiency comparable to that measured by the Surveyor assay ( Fig. 3A , Figures 3B and 3C).

[0176] To determine the potential expansion of the targeting space, bioinformatics analysis was performed. To assess the available CRISPR sites in the human genome, 19 NGG site GN 19 Although it might be expected that these sites would occur approximately as frequently as NGG sites, in reality, AN 19 NGG sites were found to be 15% more abundant (Figure 4A, Figure 4B, Figure 4C, Figure 4D, Figure 5A, 5B, 5C, 5D, 5E, and 5F), thus improving specificity of GN 19 NG From G, RN 19 By changing it to NGG, the number of available sites is more than doubled. Increased (approximately 115% increase). With a few exceptions (chr16, chr17, chr19 , chr20, and chr22) except for AN 19 NGG sites are located in each chromosome: GN 19 They are more frequent than NGG sites. For comparison, the average distance between adjacent CRISPR sites in the genome was calculated using the GN 19 NG G(59bp), AN 19 NGG(47bp), and RN 19 NGG site (26bp) (Figure 4B) was calculated. In addition, AN 19 NGG sites are involved in the human genome Even further enrichment was observed in the target region. 19 N A 20% increase in GG sites and a 10% increase in disease loci from the OMIM database AN 19 A 21% increase in NGG sites was found (Figure 4C). We also examined 1165 miRNA genes that are involved in 1 or more AN 19 Can be targeted via NGG sites, but GN 19 NGG club It was found that targeting via the 5'-terminal site was not possible (data not shown). Given that the efficiency of excision is negatively correlated with increasing distance from the excision site, H1 promoter The use of CRISPR targets allows for more precise targeting of the genome. (Ran et al., 2013, Cell 6:1 (pp. 380-1389).

[0177] CRISPR technology is increasingly being used to engineer genomes across a wide range of model organisms. As this is being investigated, we determined the potential impact of using the H1 promoter in other genomes. This analysis also reveals that the H1 promoter is highly conserved in five other vertebrates. (mouse; rat; chicken; bovine; and zebrafish) genomes. In all cases, GN19 A higher number of AN compared to NGG sites 19 NGG part:+9 % cattle; +14% chicken; +19% rats; +21% mice; and +32% One explanation for this abundance is that AT-rich This may be due to the amount (Figures 6A, 6B, 6C, 6D, 6E, and 6F). In the human genome, GN 19 NGG sites and AN 19 The occurrence of NGG sites was compared with the AT content. When normalized across genomes, the frequencies approach equality, but this is not true for all genomes. (Figure 6A and Figure 6F). However, this is due to the fact that the C The RISPR targeting space was increased beyond doubling in all other genomes tested. This demonstrates the utility of using the H1 promoter, which similarly increases the expression of H1 at the same time.

[0178] Next, AN expression in endogenous genes using the H1 promoter construct was 19 Targeting the NGG site Using H7 cells, we demonstrated the ability to induce retinal pigment epithelial and macrophage proliferation. MERT is a gene involved in endothelial phagocytosis and, when mutated, causes retinal degeneration. The second exon of the K locus was targeted (D'Cruz et al., 2000, Human M Olecular Genetics, 9:645-651 (Figures 7A and 7B). To estimate the targeting efficiency, DNA was harvested from the electroporated cell population and purified using Su A RVEYOR assay was performed. The region surrounding the target site was amplified in two independent PCR reactions. and calculated indel frequencies of 9.5% and 9.7% (Figure 7B). Randomly selected clones were isolated and analyzed for mutations by Surveyor analysis. Sequencing revealed that 7 of 42 cases (16.7%) were positive for the genotype. However, clustered mutations within 3–4 nucleotides upstream of the target PAM site Six of the seven clones were found to have unique mutations (clone Three of these were predicted MERTK null alleles (one was redundant). This is a biallelic frameshift mutation resulting in This was confirmed by staining blot analysis (Fig. 7C and 7D). The results showed that AN placed at the endogenous locus 19 Ability to effectively target NGG sites Demonstrate power.

[0179] Off-target mutations caused by CRISPR-Cas9 systems are of increasing concern As this is becoming increasingly clear, we used the GFP gRNA construct described above as a model system. Therefore, we would like to discuss how the use of the H1 promoter affects off-targeting. Surveyor analysis was used to investigate the off- Three genomic loci predicted to be target sites (GFP_11-33, We investigated GFP_219-197 and GFP_315-293). Two of the constructs (GFP_219–197, and GFP_315–293) were GN, which allows expression from either promoter 19 NGG target site. AN 19 One NGG site (GFP_11~33) adds a 5'-G nucleotide The three off-target loci examined were expressed from the U6 promoter using the In both cases, no off-target cleavage was detected (data not shown). However, the lack of detectable off-targets indicates that the site selection is consistent with the targeting of other genomic loci. This could also result from an initial selection of GFP gRNA targets based on low homology. Thus, a more stringent challenge is the ability to induce high levels of off-target hits. Targeting moieties that are known to be structurally similar to those described in Fu et al. (2013), Nat. Biotechnol., 31 Vol.:822-826; Pattanayak et al. (2013), Nat. Biotechnol., 31(9 No.):839-43; Cho et al. (2014), Genome Research, 24:132-1 On page 41, they described the expression of gRNA from the H1 promoter and the expression from the U6 promoter. We reasoned that it would be useful to compare the expression of gRNA with that of the 5' H1 promoter. The flexibility of nucleotides allows GN 19 Identical gRN targeting NGG sites A direct comparison between the U6 and H1 promoters was also possible. Two sites were previously reported by Fu et al. (2013): VEGFA site 1 (T1 ) and VEGFA site 3 (T3) were examined (Table 4, Figures 8A, 8B, 8C, and and Figure 8D) (Fu et al. (2013), Nat. Biotechnol. 31:822-826; (2014), Genome Research, 24:132-141). gRNA concentration and It was shown that increasing the concentration of Cas9 resulted in an increase in off-target hits. (Fu et al. (2013), Nat. Biotechnol., 31:822-826; Pat Tanayak et al. (2013), Nat. Biotechnol., 31(9):839-43; Hsu (2013), Nat. Biotechnol., 31(9):827-32), H1 Reduces the expression level of gRNA from the promoter (Boden et al., 2003, Nucle Acids Res., 31:5033-5038; An et al. (2006), Molecular Th erapy: The Journal of the American Society of Gene Therapy, Volume 14:4 pp. 94-504; Makinen et al. (2006), The Journal of Gene Medicine, Vol. 8 qR Using T-PCR, VEGFA T1 gRNA and U6 from the H1 promoter By examining the relative levels of VEGFA T1 gRNA from the promoter, The predicted reduction in expression levels from the H1 promoter was confirmed (Figure 8A). For the FA T1 site, in addition to the on-target locus, four off-target genes were identified. The efficiency of excision at the locus was also examined. Excision in the foci was comparable or slightly reduced, whereas excision in the H1 promoter gRNAs expressed from are more stringent at the off-target loci examined, It is noteworthy that the results indicated greater specificity (compared to off-target 1:25%). Off-target 2: undetectable vs. 20%; and Off-target 4: 26%. 9% compared to 10.9% (Table 4, Figures 8A, 8B, 8C, and 8D). Equivalent targeting (26%) between the two promoter constructs was detected at three sites. Again, the H1 promoter showed low levels of off-target excision. The H1 promoter was found to be involved in the expression of β-lactamase (Table 4, Fig. 8A, Fig. 8B, Fig. 8C, and Fig. 8D). Further studies on gRNAs expressed from the U6 promoter and U7 promoter are currently underway. Although further studies need to be performed, the data suggest that specificity is achieved by expressing gRNA from H1. This suggests that it is probably larger.

[0180] Further off-targeting related benefits of using the H1 promoter approach have been demonstrated in recent A promising approach has been described, in which the D10A Cas9 mutant acts as a cooperative agonist. A method to mitigate potential off-target effects using offset nicking (Ran et al. (2013) 013), Cell, 6:1380-1389; Mali et al. (2013), Nat. Biotech Mol. 31(9):833-8. This method involves the use of a counter-strand oriented, Identification of two flanking CRISPR sites within approximately 20 bp of the excision site. This requires strict targeting (Ran et al. (2013), Cell, 15 4(6):1380-9. The use of the H1 promoter allows for high targeting density. It would be expected that an increase in the number of sequences would aid in the identification of suitable flanking sites.

[0181] In vitro and in vivo characterization of S. pyogenes Cas9 Accumulating evidence for targeting suggests that recognition by Cas9 gRNA occurs at a 20 base pair site. First, in vitro For gRNA specificity in >10 12 In examining significantly different mutants of found that the +1 nucleotide plays a role in target recognition. The calculation of position specificity based on this data indicates that the 5' nucleotide plays a key role in target recognition. This indicates that the 3' adjacent nucleotide plays a larger role in CRIS The "seed" model for PR specificity oversimplifies the contribution of PAM-proximal nucleotides. (Pattanayak et al. (2013), Nat. Biotechnol. 31(9):839-4328). Second, the purpose of the CRISPR system is to suppress transcription. Alternative uses such as CRISPR interference (CRISPRi) have led to the use of gRNA 5' truncation of the 5' region of the 5' extension due to a mismatch of G bases for expression may also reduce the silencing efficiency. Therefore, both the length (20 nt) and the 5' nucleotide context were This suggests that the nucleotide sequence of the nucleotide sequence is important for proper Cas9 targeting (Ran et al., 2013). ), Cell, vol. 154(6): p. 1380-9; Mali et al. (2013), Nat. Biotec hnol., vol. 31(9): pp. 833-8; Larson et al. (2013), Nature Protocols, 8:2180-2196; Qi et al. (2013), Cell, 152:1173-118 3; Shan et al. (2013), Nat. Biotechnol. 31:686-688). In order to achieve this, significant contact is made between the 5' nucleotide of the gRNA and the 3' end of the target DNA. Therefore, the crystal structure data further supports the experimental data and the importance of the 5' nucleotide in Cas9. This supports the idea that (2014), Cell, vol. 156: pp. 935-949).

[0182] To increase the targeting space, N. meningitides and S. As in the case of C. thermophiles, the use of alternative Cas9 proteins may also be effective. (Hou et al. (2013), Proc. Natl. Acad. Sci. USA, 1 Volume 10(39): 15644-9; Esvelt et al. (2013), Nature Methods, 1 0(11):116-21). However, the potential of these alternative proteins Despite the possibility, reported limitations of other type II PAMs do not require strict requirements. (data not shown; Cong et al. (2013), Science 339:819-8 23; Hou et al. (2013), Proc. Natl. Acad. Sci. USA, vol. 110 (no. 39) In contrast, the expression of gRNA using the H1 promoter The modification allows targeting by any Cas9 protein, regardless of the PAM difference. This would be expected to greatly expand the partion of orthologous Cas9 proteins. For quality, we used the respective gRNA targets (GN2 for N. meningitides AN vs. 3NNNNGATT 23 NNNNGATT, and S. thermoph N about ilus 17 AN Contrasted with NNAGAAW 17 Quantify NNAGAAW The results showed that 64% and 69% of gRNA sites with 5'-A nucleotides Use of the H1 promoter with an alternative Cas9 protein was found to increase These results indicate an even greater expansion of the targeting space via the As suggested in the study, the use of different promoters expands the frequency of CRISPR sites. The U6 promoter is restricted to 5' guanosine nucleotides, whereas the The U3 promoter from the mouse is restricted to 5' adenosine nucleotides. However, in different systems, different promoters can be targeted to increase the targeting space. This further emphasizes the need to 86-688). AN 19 NGG sites and GN 19 NGG sites (and possibly CN 19 NGG sites or TN 19 NGG site (Tuschl (2002), Nat. Biotechnol., 20:446-448) It is convenient to use only the H1 promoter to express the ribosomal protein (Fig. 9A and Fig. 9B). This has been used to modify the current Cas9 variants and site restrictions. The targeting space of any future Cas9 variants can be expanded.

[0183] Careful site selection, improved Cas9 mutants, optimized gRNA architecture, or Enhancement of CRISPR targeting through additional cofactors results in targeted transcription. Increased specificity through the binding sequence, with 5' nucleotide identity being important This is likely to be a useful tool for investigations, as it allows for greater accuracy while minimizing confounding mutations. To enable large-scale genome manipulation and future clinical applications, high-fidelity target recognition and High coupled targeting density is paramount to deliver safe and effective therapeutic agents Let it be.

[0184] [Table 4]

[0185] [Table 5]

[0186] Consideration Expanding the CRISPR targeting space and reducing the potential for off-target effects This reduction has broad implications for engineering the genome. For this purpose, S. thermophilus (NNAGAAW) and N. meningit As in ides(NNNNGATT), the use of alternative Cas9 proteins is also effective. However, other type II PAMs reported to date have not been Restrictions have strict requirements and therefore, when used alone, are of limited use in targeting. Reduce the available sequence space (data not shown, but Cong et al. (2013), Science, 3 39:819-823; Hou et al. (2013), Proc. Natl. Acad. Sci. USA , vol. 110(no. 39): 15644-9). In contrast, the use of the H1 promoter Modulation of expression of gRNAs by any Cas9 protein targeting repertoire In plants, the U6 promoter is expected to significantly expand the 5' The rice-derived U3 promoter is restricted to cytosine nucleotides, whereas the rice-derived U4 promoter is restricted to As has been suggested recently, both promoters The use of CRISPR genomic DNA fragments could expand the frequency of CRISPR sites in plant genomes (Shan et al. (2013), Nat. Biotechnol., 31:686-688). AN in vertebrate genomes via the 19 NGG sites and GN 19 NGG site It is convenient to only use the H1 promoter for targeting. This will be used to guide the development of current Cas9 variants and future Cas9 variants with modified site restrictions. The targeting space of any of the nine mutants can be expanded.

[0187] As with ZFN or TALEN technologies, potential off-target effects are mitigated One approach to this is to use a Cas9 mutant (D10A) to induce cooperative offset nicotinamide adenine dinucleotide cleavage. One possible approach would be to use the techniques of the ELISA kit (Mali et al. (2013) Nat. Biotechnol., 2013). 31(9):833-8; Ran et al. (2013), Cell, 154(6):13 (pp. 80-9). This required the identification of two flanking CRISPR sites on the reverse strand. , A.N. 19 The increased targeting density afforded by the NGG moieties strengthens this approach. A further advantage over the U6 promoter is that it reduces the risk of miscleavage. Another possible mechanism is to reduce fragmentation (several groups have reported that increasing gRNA and Cas9 concentrations reported that increasing the degree of mutation correlates with an increased propensity for off-target mutations (Pa ttanayak et al. (2013), Nat. Biotechnol., 31(9):839-43; Hsu (2013), Nat. Biotechnol., 31(9):827-32; Fu et al. (20 13), Nat. Biotechnol., 31(9):822-6), H1 promoter The reduced expression level provided by the -1 gene also results in reduced off-target excision. In addition, Pattanayak et al. showed that recognition by Cas9:gRNA is They also reported that the 20-base pair targeting site was spread throughout (Pattanayak et al. (2013), Nat. Biotechnol., 31(9):839-43). About the opposite sex, >10 12 In examining significantly different mutants of We found that the tides contribute to target recognition, which provides insight into CRISPR specificity. The "seed" model for PAM-proximal nucleotides is an oversimplification. This indicates that careful site selection, improved Cas9 mutants, and gRNA architecture are key. This could result in enhanced CRISPR targeting through optimization of the targeting domain or additional cofactors. The result is increased specificity through the 23 bp targeting sequence, which enhances the 5' nucleotide sequence. The identity of the protease is likely to be important because, as a research tool, it is unlikely to be confounded. It allows for handling of larger genomes while minimizing mutations, and is suitable for future clinical applications. To achieve this, high targeting density coupled with high fidelity target recognition is essential to ensure safe and effective This will be of paramount importance for delivering therapeutic agents.

[0188] Example 2 FIG. 10A, FIG. 10B, FIG. 10C, FIG. 10D, and FIG. 10E show the Cas9 protein and The H1 promoter acts as a bidirectional promoter to simultaneously express the gene and guide RNA. The bidirectional H1 promoter is used to direct Cas9 as a left-directed pol II transcript. (minus strand), and guide RNA as a right-directed pol III transcript (plus strand). It has been shown that the expression cassette is approximately 4.4 kb in length (Figure 1). 10A). Ability to direct CRISPR-mediated cleavage from bidirectional H1 constructs To investigate this, a bidirectional construct using a gRNA targeting eGFP was The plasmid was cloned into the GFP-expressing human stem cells and expressed in GFP-expressing human stem cells (Figure 10B ) Loss of GFP was detected visually (Fig. 10C; middle panel, arrowhead). Successful expression and targeting of GFP by the expression construct is indicated. Successful R targeting was also demonstrated with the presence of two bands in lanes 2 and 3. This was also shown via surveyor assay (Figure 10D). Bidirectional CRISPR using the H1 promoter to generate a targeting cassette The construct is within the packaging range of the adeno-associated virus (Figure 10E). The invertase inhibitors are shown in orange. The construct contains the ITRs (invertase inhibitors) required for virus production. It is sandwiched between two substituted terminal repeat (RST) sequences.

[0189] method Plasmid construction: Human codons were optimized to create the H1 bidirectional construct. The Cas9 gene and SV40 terminator were inserted into the SV40 pol II transcript found endogenously. (minus strand) and fused to the 230 bp H1 promoter (SEQ ID NO: 54). 1. An AvrII site was engineered between the promoter and the gRNA scaffold to insert the targeting sequence. It is now possible to insert columns. Then, SV40[rev]::hcas9[rev]::H1 ::gRNA scaffold::pol III terminator sequence was amplified by NdeI / XbaI digestion. The digests were cloned into the pUC19 vector. To generate RNA, overlapping oligonucleotides are annealed to prepare a two-step amplification kit. Phusion Flash DNA polymerase (Thermo Fisher Scientific The DNA was amplified by PCR using a PCR kit (Centific, Rockford, IL) and then Carboxylat mixed with 2 volumes of 25% PEG and 1.5M NaCl e-Modified Sera-Mag Magnetic Beads(Therm The purified DNA was then purified using a ELISA kit (Fisher Scientific). The PCR products were resuspended in HO and purified using a NanoDrop 1000 (Thermo F The gRNA expression constructs were quantified using a ELISA kit (Fujitsu Scientific). The modified Gibson Assembly (New England Biolab s, Ipswich, MA) (Gibson et al. (2009), Nature Methods, 6:34 3-345) The total reaction volume was reduced from 20 μl to 2 μl.

[0190] Cell culture: hESC cell line H7 and IMR-90 iPS cells (WiCell, M adison WI) according to a previously described protocol (Walker et al. (2010) Nat. Commun., 1:71; Maruotti et al. (2013), Stem Cells Translational Medicine Ink with 10% CO2 / 5% O2 according to the Japanese Society of Clinical Chemistry, Vol. 2: 341-354. The cells were incubated in a centrifuge in mTeSR1 medium (Stem Cell Technologies, V ancouver, BC), Growth Factor Reduced Matr. on igel (BD Biosciences, Franklin Lakes, NJ). For subculture, hESC colonies were first isolated from mTes 5 μM blebbistatin (Sigma-Aldrich, St. Louis, MO) was added to R1. O) and then Accutase (Sigma-Aldrich The cells were harvested after treatment with 5-10 min. The cell clumps were gently dissociated into a single cell suspension. hPSCs were then incubated with mTe with blebbistatin and pelleted by centrifugation. Resuspend in SR1 and collect at 1 cm 2 Approximately 1,000 to 1,500 cells were seeded per well. Two days after passage, the medium was replaced with mTeSR1 (without blebbistatin) and Exchanged days.

[0191] Human embryonic kidney (HEK) cell line 293T (Life Technologies, Grand Island, NY) with 10% fetal bovine serum (Gibco, Life Sciences, NY). Technologies, Grand Island, NY) and 2 mM Glut Dulbecco's modified Eagle's medium (DMEM) supplemented with aMAX (Invitrogen) (Invitrogen) at 37°C with 5% CO2 / 20% O2.

[0192] Gene targeting in H7 cells: hESC cells were incubated with 10 μl of PBS 24 h prior to electroporation. M Rho Kinase inhibitor (DDD00033325, EMD Millipor Electroporation was performed according to the manufacturer's instructions using N Electroporation was performed using the eon kit (Invitrogen). On the day of incubation, hESCs were incubated with Accutase ( Importantly, colonies were digested into single cell suspensions. After picking the colonies, the wet pellet was placed on ice for 1 min. The plate was then incubated for 15 minutes and then electroporated with the gene targeting plasmid. The electroporation parameters were as follows: voltage: 1400 mS; interval: 30 Following electroporation, cell colonies were treated with 10 μM Rho Slowly transfer the cells to mTeSR1 medium containing kinase inhibitors and then store at room temperature for 2 h. After keeping for 0 minutes, the cells were seeded on Matrigel-coated dishes. Further culture was performed.

[0193] To analyze clonally derived colonies, electroporated hESCs were cultured in vitro. The cells were grown to subconfluency and subcultured as described in the previous paragraph, and then placed in a 35 mm The cells were seeded at a density of 500 cells per dish. Single colonies were then isolated by hand. It was isolated by harvesting and further cultured.

[0194] Generation of constitutively expressing GFP ESC cell lines: H7 human ESC cell line (WiCel l) was cultured on a Matrigel substrate using mTeSR1 (Stem Cell Technology Before subculturing the cells, the cells were treated with blebbistatin. A brief pretreatment with Accutase (>5 min) increased cell viability and The cells were treated for 1 min, mixed into a single cell suspension, and quenched with an equal volume of mTesR. Pellet at 80 x g for 5 min and resuspend in mTesR containing blebbistatin. Suspended cells 1 x 10 6 The cells were pelleted, the medium was carefully removed, and the cells were incubated at 10 Place on ice for .about.15 min. Homology to the AAVS1 safe harbor locus 10 μg of AAV-CAGGSEGFP donor vector (#22212, A ddgene) plus 5 μg of hAAVS1 1R+L TALE in R buffer N (#35431 and 35432, Addgene) (Hockemeyer et al. (2009), Nat. Biotechnol., 27:851-857; Sanjana et al. (2012), Nature Pr otocols, vol. 7: 171-192) with the following parameters: 1500 V, per pulse 20 ms per pulse and 1 pulse per 100 ms, using the Neon Transfection System. Electrode placement was performed using a 100μl chip using Life Technologies The cells were then gently added to 1 ml of medium and incubated at room temperature for 15 min. The cells were then incubated in a 200-mL culture medium containing mTeSR and 5 μM blebbistatin. After 2 days, the cells were plated on 35 mm dishes coated with 35% rigel. 1 x 10 cells per mm dish 4 The cells were seeded at a density of 100,000 cells / ml and then stabilized over time. Various clonal sublines were manually isolated using a fluorescence-equipped Nikon TS100 epifluorescence microscope. Selected for business.

[0195] Surveyor assay and sequencing analysis for genome modification: Surveyor For eyor analysis, cells were extracted with QuickExtract solution (Epicentre, Madison, WI) and incubated at 65° C. for 15 minutes. Genomic DNA was then extracted by incubating at 98°C for 10 minutes. The extract solution was purified using DNA Clean and Concentrator (Zym o Research, Irvine, CA) and NanoDrop Quantification was performed using CRISP (Thermo Fisher Scientific). The genomic region surrounding the target site was subjected to Phusion DNA polymerase (New E The PCR products were amplified from 100 ng of genomic DNA using a PCR kit (Grand Biolabs). Multiple independent PCR reactions were pooled and PCR was performed according to the manufacturer's protocol (Qiagen, Vale). The Qiagen MinElute Spin Column was used according to the protocol of the National Institute of Clinical Chemistry, CA. The product was purified using 12.5 mM Tris-HCl (pH 8.8), 62.5 mM 400 ng of PCR product in 1.875 mM KCl and MgCl2. Denature a volume of 8 μl slowly: 95 °C for 10 min with a gradient of -1.0 °C per second. 95°C to 85°C, 85°C for 1 second, 85°C to 75°C with a gradient of -1.0°C per second °C, 75 °C for 1 second, 75 °C to 65 °C with a gradient of -1.0 °C per second, 65 °C for 1 second 65°C to 55°C for 1 second with a gradient of -1.0°C per second, 55°C for 1 second, 55°C to 45°C with a gradient of -1.0°C for 1 second at 45°C, gradient of -1.0°C per second 45°C to 35°C with a gradient of -1.0°C per second, 35°C to 25°C with a gradient of -1.0°C per second The DNA was reannealed at 3° C. and then kept at 4° C. to allow heteroduplex formation. Surveyor Enhancer and 1 μl of Surveyor Nuclease (T Ransgenomic (Omaha, NE) was added to each reaction and incubated at 42° C. for 60 min. After incubation for 1 h, 1 μl of Stop Solution was added to the reaction. DNA 1000 chip (Agilent, Santa Clara, CA) 1 μl of the reaction was quantified on a 2100 Bioanalyzer using the Gel For the analysis, 6x loading buffer (New England Biolabs) was used. 2 μl of ethidium bromide was added to the remaining reaction and incubated with 3% agarose gel containing ethidium bromide. The gels were loaded onto a Gel Logic 200 Imaging System. (Kodak, Rochester, NY) and visualized using ImageJ v.1.46 NHEJ frequency was quantified using the binomial derived equation:

number

[0196] Example 3 FIG. 11A, FIG. 11B, and FIG. 11C show hammer fragments that generate the 5′ end of a guide RNA. Head-type ribozymes are shown. 5'-cis hammerhead ribozyme (SEQ ID NO: 49) and gRNA (SEQ ID NO: 50) are depicted in Figure 11A. Hammerhead Ribozyme It points to the sequence of the nucleotides that are important for catalysis (critical nucleotides). The cleavage site is indicated by an arrow. When cleaved by , the resulting gRNA binds to the newly formed 5′ site. Hammerhead-gRNA is released without being restricted by the nucleotide at the position. Constructs that have been shown to be effective are shown in FIG. 11B. In general, U6, H1, or T7 5' cis-hammer using a promoter that is a pol III promoter A head-type ribozyme can be expressed, which after self-cleavage releases the gRNA Targeting of the two loci is shown in Figure 11C and the Surveyor uptake Sei (HH1 + CGG PAM sequence = SEQ ID NO: 51; HH2 + AGG PAM sequence = SEQ ID NO: No. 52), along with successful cleavage by the 5' cis-hammerhead ribozyme (arrow). show.

[0197] FIG. 12 shows the use of aptazymes to process gRNA in the presence of specific aptamers. In particular, FIG. 12 shows a regulatable CRISPR construct using the theophylline approach. Theofol fused to helix II of the hammerhead ribozyme to form the TAzyme. The theophylline aptamer (orange) is located 5' of the gRNA (blue). The binding of theophylline stabilizes helix II, which then The head-type self-cleavage allows the release of gRNA. Here, gRNA binds to Cas9 and Both allow for targeted cleavage by the CRISPR system.

[0198] method Plasmid construction: U6, H1, or T7 promoters To generate a more driven 5' cis hammerhead construct, Type sequence (GTACGTTTCCTCTGATGAGTCCCAAATAGGACGAAA CGCGCTTCGGTGCGTC; SEQ ID NO: 53) downstream of the promoter, The gRNA was placed upstream of the gRNA target and scaffold to form helix I. 10 nucleotides complementary to the target sequence are placed 5' to the hammerhead sequence, then , which was bound to a complementary sequence found within the gRNA (Figure 12). To generate multiple gRNAs, overlapping oligonucleotides were annealed and split into two sequences. Phusion Flash DNA polymerase (Thermo Fischer) for TEP amplification Amplification by PCR using 100% ribosomal RNA (Sherr Scientific, Rockford, IL) The Carboxylic Acid was diluted with 100% PEG and then mixed with 2 volumes of 25% PEG and 1.5 M NaCl. boxylate-Modified Sera-Mag Magnetic Bead The product was purified using Thermo Fisher Scientific. The purified PCR products were resuspended in H2O and transferred to a NanoDrop 1000 (T gRNA expression was quantified using Hermo Fisher Scientific. The current structure is a slightly modified Gibson Assembly (New England Biolabs, Ipswich, MA) (Gibson et al. (2009), Nature Methods The total reaction volume was 20 μl to 2 μl. was reduced to.

[0199] Cell culture: hESC cell line H7 and IMR-90 iPS cells (WiCell, M adison WI) according to a previously described protocol (Walker et al. (2010) Nat. Commun., 1:71; Maruotti et al. (2013), Stem Cells Translational Medicine Ink with 10% CO2 / 5% O2 according to the Japanese Society of Clinical Chemistry, Vol. 2: 341-354. The cells were incubated in a centrifuge in mTeSR1 medium (Stem Cell Technologies, V ancouver, BC), Growth Factor Reduced Matr. on igel (BD Biosciences, Franklin Lakes, NJ). For subculture, hESC colonies were first isolated from mTes 5 μM blebbistatin (Sigma-Aldrich, St. Louis, MO) was added to R1. O) and then Accutase (Sigma-Aldrich The cells were harvested after treatment with 5-10 min. The cell clumps were gently dissociated into a single cell suspension. hPSCs were then incubated with mTe with blebbistatin and pelleted by centrifugation. Resuspend in SR1 and collect at 1 cm 2 Approximately 1,000 to 1,500 cells were seeded per well. Two days after passage, the medium was replaced with mTeSR1 (without blebbistatin) and Exchanged days.

[0200] Human embryonic kidney (HEK) cell line 293T (Life Technologies, Grand Island, NY) with 10% fetal bovine serum (Gibco, Life Sciences, NY). Technologies, Grand Island, NY) and 2 mM Glut Dulbecco's modified Eagle's medium (DMEM) supplemented with aMAX (Invitrogen) (Invitrogen) at 37°C with 5% CO2 / 20% O2.

[0201] Gene targeting in H7 cells: hESC cells were incubated with 10 μl of PBS 24 h prior to electroporation. M Rho Kinase inhibitor (DDD00033325, EMD Millipor Electroporation was performed according to the manufacturer's instructions using N Electroporation was performed using the eon kit (Invitrogen). On the day of incubation, hESCs were incubated with Accutase ( Importantly, colonies were digested into single cell suspensions. After picking the colonies, the wet pellet was placed on ice for 1 min. The plate was then incubated for 15 minutes and then electroporated with the gene targeting plasmid. The electroporation parameters were as follows: voltage: 1400 ms; interval: 30 Following electroporation, cell colonies were treated with 10 μM Rho Slowly transfer the cells to mTeSR1 medium containing kinase inhibitors and then store at room temperature for 2 h. After keeping for 0 minutes, the cells were seeded on Matrigel-coated dishes. Further culture was performed.

[0202] To analyze clonally derived colonies, electroporated hESCs were cultured in vitro. The cells were grown to subconfluency and subcultured as described in the previous paragraph, and then placed in a 35 mm The cells were seeded at a density of 500 cells per dish. Single colonies were then isolated by hand. It was isolated by harvesting and further cultured.

[0203] Generation of constitutively expressing GFP ESC cell lines: H7 human ESC cell line (WiCel l) was cultured on a Matrigel substrate using mTeSR1 (Stem Cell Technology Before subculturing the cells, the cells were treated with blebbistatin. A brief pretreatment with Accutase (>5 min) increased cell viability and The cells were treated for 1 min, mixed into a single cell suspension, and quenched with an equal volume of mTesR. Pellet at 80 x g for 5 min and resuspend in mTesR containing blebbistatin. Suspended cells 1 x 10 6 The cells were pelleted, the medium was carefully removed, and the cells were incubated at 10 Place on ice for .about.15 min. Homology to the AAVS1 safe harbor locus 10 μg of AAV-CAGGSEGFP donor vector (#22212, A ddgene) plus 5 μg of hAAVS1 1R+L TALE in R buffer N (#35431 and 35432, Addgene) (Hockemeyer et al. (2009), Nat. Biotechnol., 27:851-857; Sanjana et al. (2012), Nature Pr otocols, vol. 7: 171-192) with the following parameters: 1500 V, per pulse 20 ms per pulse and 1 pulse per 100 ms, using the Neon Transfection System. Electrode placement was performed using a 100μl chip using Life Technologies The cells were then gently added to 1 ml of medium and incubated at room temperature for 15 min. The cells were then incubated in a 200-mL culture medium containing mTeSR and 5 μM blebbistatin. After 2 days, the cells were plated on 35 mm dishes coated with 35% rigel. 1 x 10 cells per mm dish 4 The cells were seeded at a density of 100,000 cells / ml and then stabilized over time. Various clonal sublines were manually isolated using a fluorescence-equipped Nikon TS100 epifluorescence microscope. Selected for business.

[0204] Surveyor assay and sequencing analysis for genome modification: Surveyor For eyor analysis, cells were extracted with QuickExtract solution (Epicentre, Madison, WI) and incubated at 65° C. for 15 minutes. Genomic DNA was then extracted by incubating at 98°C for 10 minutes. The extract solution was purified using DNA Clean and Concentrator (Zym o Research, Irvine, CA) and NanoDrop Quantification was performed using CRISP (Thermo Fisher Scientific). The genomic region surrounding the target site was subjected to Phusion DNA polymerase (New E The PCR products were amplified from 100 ng of genomic DNA using a PCR kit (Grand Biolabs). Multiple independent PCR reactions were pooled and PCR was performed according to the manufacturer's protocol (Qiagen, Vale). The Qiagen MinElute Spin Column was used according to the protocol of the National Institute of Clinical Chemistry, CA. The product was purified using 12.5 mM Tris-HCl (pH 8.8), 62.5 mM 400 ng of PCR product in 1.875 mM KCl and MgCl2. Denature a volume of 8 μl slowly: 95 °C for 10 min with a gradient of -1.0 °C per second. 95°C to 85°C, 85°C for 1 second, 85°C to 75°C with a gradient of -1.0°C per second °C, 75 °C for 1 second, 75 °C to 65 °C with a gradient of -1.0 °C per second, 65 °C for 1 second 65°C to 55°C for 1 second with a gradient of -1.0°C per second, 55°C for 1 second, 55°C to 45°C with a gradient of -1.0°C for 1 second at 45°C, gradient of -1.0°C per second 45°C to 35°C with a gradient of -1.0°C per second, 35°C to 25°C with a gradient of -1.0°C per second The DNA was reannealed at 3° C. and then kept at 4° C. to allow heteroduplex formation. Surveyor Enhancer and 1 μl of Surveyor Nuclease (T Ransgenomic (Omaha, NE) was added to each reaction and incubated at 42° C. for 60 min. After incubation for 1 h, 1 μl of Stop Solution was added to the reaction. DNA 1000 chip (Agilent, Santa Clara, CA) 1 μl of the reaction was quantified on a 2100 Bioanalyzer using the Gel For the analysis, 6x loading buffer (New England Biolabs) was used. 2 μl of ethidium bromide was added to the remaining reaction and incubated with 3% agarose gel containing ethidium bromide. The gels were loaded onto a Gel Logic 200 Imaging System. (Kodak, Rochester, NY) and visualized using ImageJ v.1.46 NHEJ frequency was quantified using the binomial derived equation:

number

[0205] Example 4 overview Retinitis pigmentosa (RP) is a condition caused by the dysfunction and death of retinal photoreceptor cells (rods and cones). RP is an inherited retinal degenerative disease that can lead to vision loss and potentially blindness. There are two types of ARR: autosomal recessive and autosomal dominant. In ARRP, both copies of the gene that contributes to the disease are (For most genes, one copy of the gene is inherited from the mother and the other Paternal inheritance of a mutation is seen in the ARRP-associated disease-causing mutations. The mutations generally result in a loss of function of the involved genes, i.e., retinal degeneration occurs when the normal function of the genes is lost. In such cases, at least theoretically, This will need to be done to develop appropriate treatments (those that need to replace the lost gene function). An elegant example of this technique is Leber congenital amaurosis (LCA). ), an ongoing human treatment study that examines the defective RPE Adeno-associated virus (AAV)-based gene therapy is used to replace the function of 65 genes. It is used.

[0206] In ADRP, which is now known as ARRP, only one of the two copies of the disease-causing gene In the majority of cases, this single mutated gene is functionally nonfunctional. Rather than causing retinal degeneration to damage the rod and / or cone photoreceptor cells, Genes that have acquired a new function that is toxic or detrimental to photoreceptor cells. Mutations that result in the production of gene products that cause disease. Introduction of functional genes This situation makes gene replacement strategies more complicated, since it is not sufficient to treat is a way to eliminate the expression of "bad" gene products produced by genes with toxic mutations. The aim is to develop methods to identify genes that are not mutated, what geneticists call the "wild-type" (WT) gene. (This requires both the maintenance of function of the original gene copy and the maintenance of function of the original gene copy).

[0207] Currently, there are no FDA-approved treatments for ADRP. The majority of laboratory and animal studies in 2) by eliminating the function of both the offspring and WT gene copies, and then Through V-mediated gene therapy, a new, “less functional” form of the WT gene was and are resistant to the treatment used in the first step to disrupt the endogenous WT gene. The methodology adopted is to introduce form.

[0208] The subject matter disclosed herein is a novel strategy for treating ADRP, comprising CRISP Using R / Cas9 gene editing, we can precisely target the editing of information in the genome of living organisms. That is, the subject matter disclosed herein provides a strategy for targeting the genetic makeup of living organisms. The methods disclosed herein allow for therapeutic modulation of the WT gene. The mutant copy of the disease-causing gene exerts its toxic effects while leaving the expression of the We used CRISPR / Cas9 gene editing to block the expression of the virion gene product. By specifically altering the mutated copy of a disease-causing gene, e.g., the rhodopsin gene, Specifically targeting mutant forms associated with ADRP(P23H). It is possible to modify the sequence of a toxic gene product by binding to the cytoplasmic endonuclease, so that the toxic gene product is no longer expressed. In some embodiments, the CRISPR / Cas9 constructs can be expressed in a single AAV viral particle. The system can deliver ADRP-derived P23H rhodopsin mouse receptors to the eye. These studies have demonstrated that IFN-γ-γ-γ-γ-α is a potent agonist for treating ADRP. The study aims to explore a new approach for gene therapy based on specific genetic manipulation of retinal cells. The subject matter disclosed herein is directed to the treatment of various forms of ADRP, as well as other autosomal dominant genes. It is also applicable to hereditary retinal dystrophies.

[0209] Specific goals

[0210] Autosomal dominant form of retinitis pigmentosa (ADRP) accounts for approximately 30–40% of all cases of RP. The most commonly mutated RP-related gene in ADRP patients, accounting for 40% of all cases, is the rhabditis pallidum gene. This gene encodes the visual pigment rhodopsin (Dryja et al., 1990, The New w England Journal of Medicine, vol. 323, pp. 1302-1307; Dryja et al. (19 90), Nature, Vol. 343, pp. 364-366). Using ISPR / Cas9 gene editing technology to treat ADRP method (Doudna and Charpentier (2014), Science, volume 346, pages 1258096; Hsu et al. (2014), Cell, vol. 157, pp. 1262-1278), Cas9 endonuclease is integrated into a customizable small guide RNA (gRNA) In combination with Error-prone non-homologous end joining (NHEJ) affects normal alleles. knock out the expression of the mutant allele specifically without any need for constructs. The gene is a single AAV serotype with documented performance in mammalian rods. 5 delivers only 50% of wild-type levels of rhodopsin to photoreceptors. We demonstrate that expression of β-actin is sufficient to provide clinically useful rod function. The biological data suggest that (Liang et al., The Journal of Biological Chemistry, 279 Vol., pp. 48189-48196).

[0211] CRISPR targeting of disease mutations through mouse and other animal studies has been shown to be effective in vitro and in vivo, All current approaches are still far from clinical use, due in large part to delivery limitations. AAV vectors are the most frequently used viral vectors in ocular gene therapy. (Dalkara and Sahel (2014) Comptes Rendus Biologies, vol. 337, no. 1 pp. 85-192; Day et al. (2014), Advances in Experimental Medicine and Biology, vol. 801, pp. 687-693; Willett and Bennett (2013), Frontier rs in Immunology, vol. 4, p. 261; Dinculescu et al. (2005), Human Gene The rapy, Vol. 16, pp. 649-663). It is a non-pathogenic virus that attacks dividing and non-dividing cells. The expression of the virus infects any cell type and persists for a long period of time, making it particularly useful for clinical trials. Notable for its history of safety, efficacy, and general lack of toxicity, several features include: In addition, the ability to target photoreceptor cells after intravitreal injection makes AAV an attractive choice. Mutant AAV serotype and promoter combinations that are effective for inducing However, in their current state, these vectors induce an immune response and cause disease in humans. lack of efficient pan-retinal cytotropism to photoreceptors in eyes of this size (Kotterman et al. (2015), Gene Therapy, 22, 116-126; Mowat et al. (2014), Gene Therapy, vol. 21, pp. 96-105; Dalkara et al. (2013), Science Transla (Report on Medical Science, Vol. 5, pp. 189-176), so the focus is already on subretinal injections. The focus will be on well-characterized uses of AAV5 vectors, as provided herein.

[0212] The AAV genome is a single-stranded DNA molecule of 4.7 kb, which contains a recombinant DNA molecule of up to 5.2 kb. Although it can be engineered to carry NA, pushing this limit can result in low packaging efficiency. This results in deletions and insertions of the insert (Berns et al., 1986, Fundamental Viro logy, edited by BN Fields and Knipe, DM, pp. 545-562, Raven Press. The gene encoding the Cas9 protein used (4.1 kb) is large in size. To achieve this, delivery with gRNA is required for expression via a single viral vector. Promoter sequence, terminator sequence, viral ITR (inverted term Currently, delivery of AAV containing the primordial repeat sequence is not possible using this AAV packaging technique. Indeed, reconstitution of active CRISPR complexes is essential for co-transduction. Although essential, this is less efficient than single transduction. In addition, this is This would also require increased doses of the drug, potentially inducing increased immune responses and associated toxicities. Additionally, delivery of a second viral vector in human trials remains a long-term goal for FDA approval. It is likely that this could pose further challenges.

[0213] The development of CRISPR / Cas9 technology is revolutionizing the field of gene editing. Zinc nucleases (ZFNs) and transcription activator-like effector nucleases (TA Early methods of genome editing, such as LEN, allowed targeted genome modification. The enhanced ability to generate these genes offers the potential for precise correction of disease mutations. Although these techniques are effective, both ZFN and TALEN pairs have limited potential for a given DNA fragment. A: This requires the synthesis of a large, unique recognition protein for the target site. Many groups have recently developed engineered type II CRISPR / C Highly efficient genome editing through the use of the as9 system circumvents these key limitations Genome editing has been reported (Jinek et al. (2012), Science, Vol. 337, p. 816 ~821; Cong et al. (2013), Science, vol. 339, pp. 819-823; Mali et al. ( (2013), Science, vol. 339, pp. 823-826). The CRISPR / Cas9 system A guide RNA (guRNA) is used to target the Cas9 nuclease to a sequence-specific DNA. CRISPR / Cas9 genome editing is a method for targeting genomes. For this purpose, the DNA-binding domain in the nuclease is required for ZFN and TALEN. ZFN and TALEN are not unique combinations of genes, but rely on short synthetic gRNAs. This eliminates the time-consuming and laborious process of creating constructs necessary for expression of CR The generation of constructs for the ISPR / Cas9 system is simple and rapid, allowing for multiplex targeting. CRISPR cleavage can be achieved by inserting a 20-nucleotide DNA sequence into a target gene. The essential protonema is a short nucleotide motif found in the nucleotide sequence and 3' of the target site. The gRNA is required to complementarily pair with the spacer adjacent motif (PAM). To identify any unique N 20 -PAM sequence Currently the least restrictive and most commonly used. The Cas9 protein, derived from S. pyogenes, recognizes the sequence NGG. Thus, the CRISPR targeting sequence 20 It becomes NGG. [ka]

[0214] CRIS required for targeting the rhodopsin gene in vivo PR / Cas9 effector molecules for subretinal administration of appropriately engineered AAV5 vectors Serotype 5 vectors are used in non-human primates (Mancuso et al., 200 9), Nature, vol. 461, pp. 784-787) photoreceptors and canines (Beltran (2012), Proceedings of the National Academy of Sciences of the United States of America, Vol. 109, pp. 2132-2137) It is also highly efficient in transducing retinal cells and is capable of mediating retinal therapy. It has been shown that capsid-modified AAV vectors can be delivered from the vitreous to mice. (Petrs-Silva et al. (2011) Molecular Therapy: The Journal of ournal of the American Society of Gene Therapy, vol. 19, pp. 293-301 ), but so far no similar penetration has been achieved in dogs or non-human primates. (observations not published).

[0215] A key challenge in AAV-mediated delivery of Cas9 and guide RNA is the lack of robustness in both constructs. The DNA required to express the element is typically 5 kb (promoter, approximately 500bp; spCas9, 4,140bp; Pol II terminator, approximately 250bp p; U6 promoter, approx. 315 bp; and gRNA, approx. 100 bp), but This exceeds the packaging limit of AAV, which is approximately 4.7 to 4.9 kb. Swiech et al. (2015, Nature Biotechnology, vol. 33, pp. 102-106) Two-vector approach: one AAV vector to deliver Cas9 and one to deliver gRNA. This issue was addressed by using another AAV vector, The dual AAV approach in this study is particularly useful for the detection of low-level genes that are expressed in retinal cells but not in rods. The mouse Mecp2 promoter, a promoter of the gene encoding the 2-aminobutyric acid nucleotide, was used (Song et al., 201 4), Epigenetics & Chromatin, vol. 7, p. 17; Jain et al. (2010), Pediatric Neurology, vol. 43, pp. 35-40). Thus, even if this system is constructed, The subject matter disclosed herein is directed to the development of gene editing in the retina. A single vector approach for increasing efficiency and specifically targeting photoreceptors and provide a single vector approach that reduces potential toxicity from delivery of the viral load. .

[0216] result Directs transcription of gRNA and nearly maximizes the available CRISPR gene targeting space The H1 promoter, rather than the U6 promoter used previously, allows the (Ranganathan et al. (2014), Nature Communications, 5 In particular, a reduced tendency towards off-target excision was detected. These studies suggest that the H1 promoter may be more suitable for therapeutic approaches. In this study, we investigated the expression of the endogenous H1RNA gene and the protein-coding gene adjacent to it in the genome (PARP -2) was noted (Baer et al. (1990), Nucleic Acids Research, Vol. 18 , pp. 97-103; Myslinski et al. (2001), Nucleic Acids Research, vol. 29, (pp. 2502-2509). The start of H1RNA (pol III RNA transcript) and PA The sequence between the start of the RP-2 gene (pol II transcript) is 230 bp (Figure 13). Therefore, this relatively small sequence functions as a compact bidirectional promoter. This indicates that both pol II and pol III transcripts may be involved. It is the only bidirectional promoter sequence in the mammalian genome that can direct both Size hurdles for packaging CRISPR components into a single AAV It is believed that this can be used to overcome the above problems.

[0217] Bidirectional pol II / III promoter for dual expression of Cas9 / gRNA To exploit the use of H1 as a promoter, and its pol III activity is already sufficient, The eG FP reporter constructs were created (Figure 14). In human (HEK293) and mouse cells Initial results in (NIH3T3) demonstrated weak but clearly detectable GFP fluorescence. These results suggest that the H1 promoter can direct pol II expression, albeit weakly. Using this GFP reporter system, we have demonstrated that three variable configurations within the system can be expressed. Elements: By assessing promoter sequences, 5'UTR, and terminator sequences. , increased pol II expression while maintaining promoter compactness. When we investigated the H1 promoter sequence derived from an organism, we found that the mouse (176 bp) sequence and rat (207 bp) sequences, both of which showed stronger GFP expression than the human H1 promoter. It was shown that it is possible to drive the 1000 Hz and 1000 Hz (approximately 7 times and 6 times, respectively). However, the goal is to derive a system for use with human cells in vivo. Therefore, human promoter sequences were used where possible. To assess the sequence, seven different sequences were examined. Terminator sequence and 49 bp synthetic poly(A) sequence (SPA) (Levitt et al. (198 9) and Genes & Development, vol. 3, pp. 1019-1025) both report the development of GFP expression. The results showed that the 5'UTR was modified to optimize translation efficiency. We improved reporter expression by using the 5'UTR sequence of beta-globin. It was found that the insertion of a 50 bp sequence corresponding to the 50 bp sequence significantly improved reporter expression. The 9 bases encoding the strong Kozak sequence (Kozak (1987), Nucleic Acids Research, Vol. 15, pp. 8125-8148) (5'-GCCGCCACC-3') The fact that simply inserting the This corresponds to:

[0218] Based on the information derived from these GFP-based optimization experiments, the Cas9 protein The human H1 promoter sequence was used to simultaneously express the GFP and targeting gRNA. These bidirectional constructs were used to generate targeting constructs that induce cleavage in cells. To test for transfection ability, NIH3T3 cells were transfected with 500 ng / ml of 500 ng / ml plasmid using a standard two-plasmid technique. (pCAAGS:Cas9 and H1:gRNA) or a single vector expressing both components The plasmid was electroporated with 100 ng / ml of ... Genomic DNA was collected 48 hours after electroporation and purified with T7 Endo I (T7EI ) assay (Ran et al. (2013), Nature Protocols, 8, 2281-2308) was performed to quantify the level of genomic alterations. It has been reported that the conventional Surveyor assay The T7EI assay was used instead of the ELISA kit. Using a compact bidirectional system that is within the cloning capacity of these It was found that the two loci of the ribosome-specific marker gene could be effectively targeted (FIG. 16A and FIG. 1 6B). We further explore the applicability and relevance of this targeting strategy in human cells. As demonstrated, data on Cas9 targeting in the human H7 embryonic stem cell line are available. It uses the mouse H1 promoter instead of the human sequence and has the SV40 terminator. By using the SPA terminator rather than the target sequence, theoretically The size of the coding construct can be further reduced by 200 bp. This reduction also allows for more efficient packaging and blocks the expression of the Cas9 system. Sequence modifications that may enhance, reduce, or even modulate ; further space for modifications that may be important to reduce potential off-target effects The AAV Helper-free System ( The frankinyltransferase (Frankinyltransferase) is a nucleotide sequence that can be easily cloned into an ITR-containing vector (Agilent) A simple targeting procedure was performed using the Gibson cloning method (NEB) with the NotI site. Bidirectional plasmids have been engineered with unique restriction sites to allow targeted insertion.

[0219] Cas9 and gRNA promoters, RNA processing, and structural elements The nucleotides are efficiently expressed from a single AAV vector system and delivered in a suitable GMP-like preclinical vector. Design and optimize to produce

[0220] A combination of bidirectional H1 promoters simultaneously driving the expression of Cas9 and gRNA, Through optimization efforts, we have narrowed the size of CRISPR delivery to within the AAV packaging capacity. Substantial progress has already been made in reducing the amount of , 5' / 3'UTR modifications, and various combinations with different gRNAs are available for targeting It provides a toolkit for exploring the potential spectrum of efficiencies.

[0221] Once the constructs have been further optimized with respect to size, expression, and excision efficiency, they will be 2. Using AAV Vectors for In Vitro and In Vivo Studies The constructs used for optimization studies can be used to generate vectors for AAV production. Flanking NotI sites to allow cloning into ITR-containing vector plasmids It also contains unique restriction sites that allow for easy insertion of targets. High titer GMP-like preclinical AAV5 vectors for mouse studies are available from an independent vector production laboratory. The cells were produced using a helper-free plasmid transfection method in a laboratory setting. The technique previously developed (Dryja et al., 1990, The New England Journal of Medicine e, vol. 323, pp. 1302-1307; Dryja et al. (1990), Nature, vol. 343, pp. 36 Each virus preparation can be purified by the method described below. pDGmi eliminates WT adenovirus and replication-competent AAV contaminants This can be done using the ni-Ad plasmid DNA helper system. Purify by Q column FPLC chromatography followed by dixanol gradient centrifugation. To establish AAV vector stock solutions of GMP-like purity, each vector was purified using standardized A battery of physical and biological assays to measure purity, bioburden, Bactericidal, DNA-containing particle titer, infectious titer, particle-to-infectivity ratio, and replication-competent AA The test can be subjected to a battery of tests including an evaluation for possible contamination by V.

[0222] Recent studies with the H1 promoter indicate low levels of off-target effects (Ranganathan et al. (2014), Nature Communications, Vol. 5, p. 4516) However, as the construct is being developed with the goal of eventual clinical use, potential off-target Get activity should be carefully monitored (Wu et al., 2014, Quantitative To this end, we pursue several complementary approaches. Using bioinformatics techniques, the 23-mer CRISPR sequence was identified. A custom Perl script was used to search both strands of the sequence and occurrences of duplications. Using this method, all potential CRISPR sites in the human and mouse genomes were determined. (Ranganathan et al., draft in preparation, 2015). For example, in the human genome, After filtering out the columns, 137,409,562 CRISPR sites were identified. An initial set of primers was identified. Then, the primers were sequenced to either the 3' end or the PAM end (seed region). A custom algorithm is used to assign values ​​based on the uniqueness of the 23-base sequence, biased by According to the method described in Jinek et al. (2012), Science, 337:816-821, each part was Finally, a maximum of three base mismatches were allowed throughout the targeting sequence. Bowtie (Lang Mead et al. (2009), Genome Biology, vol. 10, p. R25) The propensity of each site to exhibit off-target effects was calculated. Using the predictions from the set, each gRNA can be examined for any mistargeting. PCR primers flanking predicted potential off-target sites can be used to identify genomic regions. The cleavage efficiency of the PCR product can be evaluated by a T7EI assay. This can be investigated both in vitro and in vivo. This will allow monitoring of targeting accuracy for optimization experiments. Aim for target excision of less than 0.5%, but less than 5% is acceptable.

[0223] The focus is on standard Cas9 targeting, but also alternative PAM sequences. Alternative approaches are also being explored, including targeting of the canonical NGG sequence. In addition, it has been reported that it also targets PAM motifs involving NAG (Hs u et al. (2013), Nature Biotechnology, doi:10.1038 / nbt.264 7) Two CRISPR sequences in the human genome and three targeting sequences in the mouse genome. The overlap with the sequence in which the P23H mutation was identified allows for further targeting. NAG PAM sites may provide more targeted targeting than NGG sites. The coupling efficiency is predicted to be low (Zhang et al. (2014), Scientific Reports, Vol. 4 , p. 5405), which may provide a mechanism for titrating the dosage. This mechanism can be valuable if one determines that an agent has significant off-target effects. First, five sequences that use the NAG PAM site were synthesized using Gibson assembly (NE B) can be cloned into pH1v126 using the following sequence: Co-transfected with Cas9 plasmid into 293 cells (Lipofectam ine 3000), whereas the mouse plasmid, together with the Cas9 plasmid, H3T3 cells can be electroporated (Invitrogen, Neon). To detect NA activity, we used the canonical NGG as well as the non-canonical NAG sites. However, the proportion of indel mutations introduced by NHEJ at the Cas9 cleavage site was It can be quantified.

[0224] Also, an alternative therapeutic approach known as CRISPRi involves the use of Cas9 nuclear transcription factors. Using dCas9, we developed a therapeutic strategy to specifically suppress the expression of the P23H allele. Therapeutic methods can also be used (Qi et al. (2013), Cell, 152, 1173-1179). 183; Gilbert et al. (2013), Cell, 154, 442-451; Larson et al. ( 2013), Nature Protocols, vol. 8, pp. 2180-2196; Fuller et al. (2014 Advances in Experimental Medicine and Biology, Vol. 801, 773-78 Instead of inducing cleavage, dCas9 remains tightly bound to the DNA sequence and remains active. When targeting the inside of a gene that is transcribed in the responsive state, the po Inhibition of lII progression can result in efficient transcriptional repression without inducing DNA breaks. By achieving therapeutic inhibition of P23H without constitutive expression of AAV, By utilizing this technology, AAV5-mediated delivery of transcription inhibitors has been shown to overcome gene therapy and regulatory hurdles. The repression of transcription by CRISPRi may be advantageous from both the viewpoints of rhodopsin and rhodopsin. Using qRT-PCR to measure allele-specific expression of the gene, Cut.

[0225] In vitro analysis was performed using primary photoreceptor cultures derived from P23H mice. The AAV5 vector developed expresses the mutant rhodopsin allele and expresses it in vivo. Validate the ability to knock out expression

[0226] Use primary mouse photoreceptor cell cultures in vitro before proceeding to animal studies. The targeting construct can be verified in animals aged 2-10 days. To isolate cells for targeting assays, mouse retinas were harvested and The constructs were transfected into human (h)Rho:GFP mice (Chan et al., 2004). ), Proceedings of the National Academy of Sciences of the United St. By searching in the American Journal of Biology, Vol. 101, pp. 9109-9114, Further optimization of syn-targeting may be possible. Quinn mice have a knock-in of the mouse rhodopsin open reading frame This partially humanized mouse contains a human rhodopsin-GFP fusion (Figure 17). Allows targeting of human-specific sequences in receptor cells. Targeting human rho sequences The loss of GFP from photoreceptors can then be quantified. Although rhodopsin is being targeted, the GFP reporter is fused in-frame. Thus, loss of fluorescence indicates error-prone NHEJ upstream of the target site. It is used as a simple surrogate indicator. 10-20% of retinal cells are transfected by electroporation. Although high purification efficiencies are routinely achieved, To do this, the transfected population is sorted based on the intensity of the Cas9 fluorescent reporter. Several Cas9s fused to various P2A:reporter proteins can be used to A construct that allows monitoring of fluorescence activity without compromising Cas9 activity. The s9 construct was generated using retinal cultures derived from Rho:GFP mice. 9: P2A: Electroporation of mCherry reporter and targeting gRNA After 24 hours of culture, double-positive cells can be isolated, After 48 hours, the cells were enriched for transfected photoreceptors. The genomic DNA was extracted by resuspending in QuickExtract buffer (Epicentre). DNA can be harvested and assayed for genomic modifications by T7EI assay. Similarly, targeting of rhodopsin mutations was performed in primary rhodopsin cells derived from P23H mice. Photoreceptor cultures can be used to validate that the targeting efficiency of the construct is 10%. If the levels of transfection exceed 100, which is consistent with earlier results, then the level of transfection is low (10 %), genome editing can still be detected using the T7EI assay In addition, the use of AAV5 vectors should result in significantly higher transduction efficiencies. .

[0227] In addition, high resolution and Highly sensitive, site-specific deep sequencing analysis is also performed. We used a gene encoding enzyme (NEB, Phusion) to identify off-target regions predicted to be CRISPR target sites. The genomic sequence flanking the target site was amplified for 15 cycles and then DNA Cl It can be purified using ean & Concentrator-5 (Zymo). The purified PCR products were amplified for 5 cycles and PCR was performed using an Illumina P5 Adapters and sample-specific barcodes are spliced ​​in and purified again, then SYBR Green The results were quantified by fluorescence and analyzed on a BioAnalyzer, and finally pooled in equimolar ratios. Then, sequence using the MiSeq Personal Sequencer. To analyze the sequencing data, Illumina MiSe q Reporter software was used to generate 300bp paired-end MiSeq fragments. Following demultiplexing of the reads, the raw reads were adapter / quality trimmed. Alignment is performed on all reads against the wild-type sequence to determine the NHEJ frequency. The frequency is calculated as 100 × (number of indel reads / number of indel reads + number of WT reads). Calculate.

[0228] Following subretinal injection into P23H mice, SA2-derived retinal markers were detected in vivo. Improved vector excises mutant rhodopsin allele and knocks out its expression Verify the ability to get out

[0229] The next step will be to in vivo targeting of the P23H rhodopsin mutation in mice. This will demonstrate the ability to A high-scoring CRISPR targeting site overlapping the mouse P23 codon was identified It is being done. 20 The CRISPR site in the form of NGG is the reverse strand: [ka] Unfortunately, the location of the mouse P23H mutation within the CRISPR site is within the targeting region. The N in the NGG PAM motif is the only position in the sequence where the bp identity is unknown. This is because CRISPR directed to the P23H sequence distinguishes between the wild-type sequence and the P23H sequence. It is not possible to distinguish between the two alleles, and therefore targeting does not involve the selection of either allele. This means that the gene is predicted to produce a genomic variant that is highly likely to cause a genomic disorder, so an alternative approach based on the occurrence of single nucleotide polymorphisms (SNPs) is Laws are being developed.

[0230] There are approximately 17 million SNPs (single nucleotide variants, indels, STRs, and MNs) in the human genome. P, etc.) (approximately one every 180 bp) have been reported in the context of personalized genomic medicine. This mutation is extremely important. The present invention provides a method for specifically...

Claims

1. A non-naturally occurring CRISPR-Cas system comprising a vector comprising a bidirectional promoter, the bidirectional promoter comprising: a) a control element that provides for transcription in one direction of at least one nucleotide sequence encoding a guide RNA (gRNA) of a CRISPR-Cas system, wherein the gRNA hybridizes with a target sequence of a DNA molecule; b) control elements that provide for the transcription of the nucleotide sequence encoding the CRISPR enzyme in opposite directions; wherein the system further comprises a 5'UTR and / or a terminator sequence.

2. The system of claim 1 , wherein the bidirectional promoter is an H1 bidirectional promoter.

3. The target sequence is a nucleotide sequence A １９ N.G.G., G.N. １９ N.G.G., C.N. １９ NGG or TN １９ The system of claim 1 comprising NGG.

4. 2. The system of claim 1, wherein the CRISPR enzyme is a Cas9 protein.

5. The system of claim 4, wherein the Cas9 protein is a type II Cas9 protein.

6. The system of claim 1 , wherein the target sequence is present within a cell.

7. 7. The system of claim 6, wherein the nucleotide sequence encoding the CRISPR enzyme is codon optimized for expression in the cell.

8. The system of claim 6 , wherein the cell is a eukaryotic cell.

9. The system according to claim 8, wherein the eukaryotic cell is a mammalian cell or a human cell.

10. The system of claim 6 , wherein the DNA molecule encodes one or more gene products expressed in the cell.

11. 11. The system of claim 10, wherein the CRISPR enzyme cleaves the DNA molecule to alter expression of the one or more gene products.

12. The system of claim 11 , wherein the expression of the one or more gene products is reduced.

13. The system of claim 1 , wherein the system is packaged in a single adeno-associated virus (AAV) particle.

14. The system according to any one of claims 1 to 13 for treating a neurodegenerative disease of the eye in a subject.

15. 1. An in vitro method of altering expression of one or more gene products in a cell, said cell comprising a DNA molecule encoding said one or more gene products, said method comprising introducing into said cell a non-naturally occurring CRISPR-Cas system comprising a vector comprising a bidirectional promoter, said bidirectional promoter comprising: a) a control element that provides for transcription in one direction of at least one nucleotide sequence encoding a guide RNA (gRNA) of a CRISPR-Cas system, said gRNA hybridizing to a target sequence of said DNA molecule; b) control elements that provide for the transcription of the nucleotide sequence encoding the CRISPR enzyme in opposite directions; Including, wherein the gRNA targets and hybridizes to the target sequence, and the CRISPR enzyme cleaves the DNA molecule to alter expression of the one or more gene products in the cell, and the system further comprises a 5'UTR and / or a terminator sequence.

16. The target sequence is a nucleotide sequence A １９ N.G.G., G.N. １９ N.G.G., C.N. １９ NGG or TN １９ 16. The method of claim 15 comprising NGG.

17. 16. The method of claim 15, wherein the CRISPR enzyme is codon optimized for expression in the cell.

18. 16. The method of claim 15, wherein the CRISPR enzyme is a Cas9 protein.

19. 20. The method of claim 18, wherein the Cas9 protein is a type II Cas9 protein.

20. 20. The method of claim 19, wherein the cell is a eukaryotic cell.

21. 21. The method of claim 20, wherein the eukaryotic cell is a mammalian cell or a human cell.

22. 16. The method of claim 15, wherein the expression of the one or more gene products is reduced.

23. The method of claim 15, wherein the system is introduced into the cell using a single AAV particle.

Images