Vaginal gel formulation and method for preparing same

Abstract

The present invention provides a vaginal gel formulation and a method for preparing the same. The vaginal gel formulation comprises a carrier and a therapeutic gene. The vaginal gel formulation further comprises a hydrophilic polymer material modified montmorillonite, and the carrier comprises a cationic polymer. The vaginal gel formulation of the present invention can sufficiently stabilize the structure of nanoparticles, has high transfection efficiency, good therapeutic effect, high safety, and can be administered locally to the vagina. The vaginal gel formulation of the present invention has a simple preparation process and flexible reagent formulation.

Description

[Technical field]

[0001] The present application relates to the field of gene therapy, and in particular to vaginal gel formulations and methods for preparing same. [Background technology]

[0002] Genome editing has already shown promising success in the treatment of genetic diseases. However, one of the keys to the success of gene therapy is the delivery vehicle of genetic engineering. Polymeric nanoparticles (NPs) have already realized efficient delivery of gene therapy due to their nanometer size, low toxicity, long cycle time and excellent plasticity.

[0003] Based on the specific therapeutic goal and pharmacokinetics, gene therapy can be performed systemically or locally. The vagina has several characteristics that facilitate the delivery of therapeutic molecules, including DNA, RNA, and proteins. The vaginal route has sufficient blood supply, high contact area, and suitable permeability to some substances, allowing systemic and local administration. It also avoids the first-pass effect of the liver and the fluids of the gastrointestinal tract encountered during oral administration. In addition, some local diseases, such as lesions caused by human papillomavirus (HPV) infection and cervical cancer, can both be treated by local vaginal administration. Compared with systemic administration, local vaginal administration has unique advantages in treating reproductive tract infections. For example, the use of genome editing tools locally to treat HPV infection can enhance therapeutic efficacy and minimize off-target side effects. However, several important hurdles need to be overcome before the technology can be translated into clinical medicine. One of the main difficulties in developing vaginal gene therapy drugs is that the foreign genetic material is easily degraded by local microorganisms and has low efficiency when passing through vaginal and cervical mucus. Therefore, protecting the gene from degradation and enhancing its mucus penetration ability are key issues in developing a vaginal gene delivery system. In addition, in order to avoid leakage from the open reproductive tract, the formulation needs to be prepared in the form of suppositories, gels, tablets, vaginal rings, etc. to achieve the purpose of retention and long-term release in the reproductive tract. However, in these formulations, whether the structure of the gene delivery nanoparticles can be kept stable is a major challenge. The composition of vaginal and cervical mucus is complex. If the nanoparticles cannot maintain structural stability (e.g., decomposition into cationic polymer and gene) in the formulation, they will be susceptible to the influence of proteins / enzymes, bacterial secretions, inorganic salts, etc. in the mucus after release, and therefore will not be able to self-assemble into a gene-cationic polymer nanoparticle structure with high transfection efficiency, thus affecting gene transfection and subsequent therapeutic effects. Therefore, developing a formulation that can keep the nanoparticle structure stable is an important part of the vaginal gene delivery system. Summary of the Invention [Problem to be solved by the invention]

[0004] An object of the present invention is to provide a vaginal gel formulation suitable for vaginal administration and capable of effectively delivering exogenous genes, and a method for preparing the same. [Means for solving the problem]

[0005] In order to achieve the above-mentioned objectives, the technical solution used in the present invention provides a vaginal gel formulation comprising a carrier and a therapeutic gene, the vaginal gel formulation further comprising a hydrophilic polymeric material modified montmorillonite, and the carrier comprises a cationic polymer.

[0006] Preferably, the hydrophilic polymer material modified montmorillonite is obtained by modifying montmorillonite with one or more modifiers selected from chitosan, chitooligosaccharides, cellulose derivatives, starch derivatives, gelatin, shellac, tragacanth, gum arabic, pectin, xanthan gum, povidone, polyvinyl alcohol, and polyoxyethylene.

[0007] Further, the mass ratio of the hydrophilic polymer material to the montmorillonite in the hydrophilic polymer material-modified montmorillonite is preferably 0.1 to 1:1, and more preferably 0.1 to 5:1.

[0008] The unmodified montmorillonite raw material used in the present invention is preferably natural montmorillonite, which contains 16.54% Al2O3, 4.65% MgO, and 50.95% SiO2 and has the structural formula (Al, Mg)2[SiO 10 ](OH)2·nH2O and is monoclinic.

[0009] Preferably, said hydrophilic polymeric material modified montmorillonite further comprises a sodium salt.

[0010] More preferably, the sodium salt is one or more of sodium bicarbonate, disodium hydrogen phosphate, disodium hydrogen citrate and sodium acetate.

[0011] More preferably, the mass ratio of the sodium salt to the montmorillonite is 0.001 to 0.05:1, and preferably 0.005 to 0.05:1.

[0012] Preferably, the mass ratio of the cationic polymer to the hydrophilic polymeric material-modified montmorillonite is 1:1-1000, more preferably 1:1-100, and even more preferably 1:1-40.

[0013] Preferably, the method for preparing the vaginal gel formulation comprises the steps of preparing nanoparticles using the carrier and the therapeutic gene, and mixing the nanoparticles, the hydrophilic polymeric material modified montmorillonite and water.

[0014] Also, the mass ratio of the carrier to the therapeutic gene in the nanoparticles is preferably 10 to 150:1, more preferably 10 to 100:1, and even more preferably 10 to 80:1.

[0015] Moreover, the particle size of the nanoparticles is preferably in the range of 10 to 1000 nm, and more preferably 200 to 400 nm.

[0016] Also preferably, the surface of the nanoparticles is charged.

[0017] Preferably, the cationic polymer is one or more of poly-β-aminoester (PBAE), polylysine (PLL), polyethyleneimine (PEI), polyamido-amine (PAMAM).

[0018] Also preferably, the poly-β-aminoester is composed of 1,4-butanediol diacrylate monomers, 5-amino-1-pentanol monomers, and 1-(3-aminopropyl)-4-methylpiperazine monomers.

[0019] Also preferably, the poly-β-amino ester has the following general structural formula: [ka] Here, m is a number between 5 and 200, and preferably between 15 and 30.

[0020] The number average molecular weight of the poly-β-amino ester is preferably 1,500 to 60,000, and more preferably 5,000 to 8,000.

[0021] Also, preferably, the method for preparing the poly-β-aminoester comprises first reacting 1,4-butanediol diacrylate with 5-amino-1-pentanol at 80 to 100° C. for 30 to 40 hours, and then obtaining an intermediate by post-treatment, and then reacting the intermediate with 1-(3-aminopropyl)-4-methylpiperazine at 10 to 40° C. for 20 to 30 hours, and then obtaining the poly-β-aminoester by post-treatment.

[0022] More preferably, the molar ratio of the 1,4-butanediol diacrylate to the 5-amino-1-pentanol as raw materials is 1:0.8-1.2, and the molar ratio of the intermediate to the 1-(3-aminopropyl)-4-methylpiperazine as raw materials is 1:4-6.

[0023] Preferably, the therapeutic gene is one or more of a plasmid, DNA and RNA.

[0024] Also preferably, the therapeutic gene is a plasmid composed of DNA capable of being transcribed into sgRNA of the target PERV-Pol gene and SpCas9.

[0025] More preferably, the sequence of the DNA capable of being transcribed into the sgRNA is shown in SEQ ID NO.1 and / or SEQ ID NO.2.

[0026] More preferably, the SpCas9 is SpCas9-HF1 and / or eSpCas9.

[0027] According to a specific preferred embodiment, the therapeutic gene is SpCas9-sgRNA-1 and / or SpCas9-sgRNA-3, the sequence of which is shown in SEQ ID NO. 3 and the sequence of which is shown in SEQ ID NO. 4.

[0028] Preferably, the pH of the vaginal gel preparation is 4 to 8, more preferably 4.5 to 5.5.

[0029] In the present invention, the vaginal gel formulation comprises nanoparticles.

[0030] The vaginal gel formulation of the present invention further comprises an acidic buffer, said acidic buffer being one or more of a citrate buffer, an acetate buffer and a phosphate buffer.

[0031] More preferably, the pH of the acidic buffer solution is 4-6.

[0032] In the present invention, the concentration and amount of the acidic buffer used and the amount of the water used can be adjusted based on the required viscosity of the gel formulation.

[0033] A second aspect of the invention provides a vaginal gel formulation comprising a matrix and nanoparticles, said matrix comprising a hydrophilic polymeric material modified montmorillonite and said nanoparticles comprising a cationic polymer and a therapeutic gene.

[0034] The hydrophilic polymer material modified montmorillonite, cationic polymer and therapeutic gene in this technical solution are the same as the raw materials of the vaginal gel preparation provided in the first aspect of the present invention, and will not be described here repeatedly.

[0035] According to a specific preferred embodiment, the hydrophilic polymeric material modified montmorillonite is obtained by modifying montmorillonite with one or more modifiers selected from chitosan, chitooligosaccharides, chitosan derivatives, cellulose derivatives, starch derivatives, gelatin, shellac, tragacanth, gum arabic, pectin, xanthan gum, povidone, polyvinyl alcohol, and polyoxyethylene.

[0036] The cationic polymer is a poly-β-amino ester, the general structural formula of which is as follows: In addition, m is a number between 5 and 200, the therapeutic gene is a plasmid formed by SpCas9-HF1 and / or eSpCas9 and DNA that can be transcribed into sgRNA-1 and / or DNA that can be transcribed into sgRNA-3, the sequence of the DNA that can be transcribed into sgRNA-1 is TTCGAATGGAGAGATCCAGG, and the sequence of the DNA that can be transcribed into sgRNA-3 is GGTGACCCTCCTCCAGTACG.

[0037] A third aspect of the present invention provides a method for preparing the vaginal gel formulation, comprising the steps of: causing the carrier and the therapeutic gene to form nanoparticles in an acidic buffer solution to obtain a mixture containing nanoparticles; and directly mixing the mixture containing nanoparticles with the hydrophilic polymeric material modified montmorillonite to prepare the vaginal gel formulation, or dispersing the hydrophilic polymeric material modified montmorillonite in water and / or an acidic buffer solution and then mixing it with the mixture containing nanoparticles.

[0038] Preferably, the preparation method further comprises a step of preparing hydrophilic polymeric material modified montmorillonite, in which montmorillonite and hydrophilic polymeric material are added to water, sodium salt is selectively added, mixed and stirred, and then pH is adjusted to 4-6, stirred and allowed to stand, and then the upper layer of colloidal liquid is dried and pulverized to obtain the hydrophilic polymeric material modified montmorillonite.

[0039] Preferably, the mixing and stirring is carried out at a temperature of 50 to 90° C. for a time of 1 to 10 hours.

[0040] Also, preferably, after the pH has been adjusted, the mixture is stirred at a constant temperature of 50 to 90° C. for 0.5 to 2 hours, then cooled, water is added, the mixture is stirred uniformly, and the mixture is allowed to stand.

[0041] Also preferably, the pH is adjusted with an acid, the acid being one or more of phosphoric acid, citric acid and acetic acid.

[0042] According to a specific preferred embodiment, in the preparation method of the hydrophilic polymer material modified montmorillonite, the montmorillonite and the sodium salt are added to water and mixed uniformly, then the hydrophilic polymer material is added, and stirring is continued. With sealing and stirring, the temperature is increased to 50-90°C, and maintained for 1-10 hours, the pH is adjusted to 4-6 with acid, and the mixture is stirred at a certain temperature for 0.5-2 hours, cooled to room temperature, water is added and stirred uniformly, and the mixture is allowed to stand for 30-60 minutes. The upper layer of the colloidal liquid is then removed, dried and pulverized to obtain the hydrophilic polymer material modified montmorillonite.

[0043] Preferably, in the specific method of the step (3), the hydrophilic polymeric material-modified montmorillonite is mixed with water, and then an acidic buffer solution is added, and the nanoparticles are added, and then the mixture is stirred uniformly.

[0044] A fourth aspect of the present invention provides a method for vaginal delivery of a therapeutic gene, which comprises first preparing a therapeutic gene and a carrier into nanoparticles, then mixing the nanoparticles with a hydrophilic polymeric material modified montmorillonite to prepare a gel formulation, and administering the gel formulation into the vagina.

[0045] A fifth aspect of the present invention provides a method of administration, comprising topically administering the vaginal gel formulation to the vagina.

[0046] A sixth aspect of the present invention provides the application of said vaginal gel formulation in gene therapy of vaginal / cervical diseases.

[0047] Specifically, the diseases include cervical lesions associated with HPV infection, cervical cancer, herpes simplex virus (HSV) infection, and the like.

[0048] The vaginal gel formulation of the present invention only needs to be stored at about 18-25° C., and the formulation is self-administered, which is convenient for patients and physicians. Effect of the Invention

[0049] By applying the above technical solution, the present invention has the following advantages over the prior art: The vaginal gel preparation of the present invention can fully stabilize the structure of nanoparticles, has high transfection efficiency, good therapeutic effect, high safety, and can be administered locally to the vagina. The vaginal gel preparation of the present invention has a simple preparation process and a flexible reagent formulation. [Brief description of the drawings]

[0050] [Figure 1] FIG. 1 shows the characterization results of PBAE polymer and PBAE-plasmid polymer NPs. [Diagram 2] FIG. 2 shows scanning electron microscope images of each substrate or gel. [Diagram 3] FIG. 3 shows the results of the release of NPs from the NPs-mMMT gel. [Figure 4] Figure 4 shows in vivo imaging of a mouse. [Diagram 5] FIG. 5 is a comparison of transfection efficiency results of gel formulations prepared with different cationic polymers. [Figure 6] FIG. 6 is a comparison of the transfection efficiency results of gel preparations made with mMMT and HTT. [Figure 7] FIG. 7 shows the percentage of positive GFP+ cells in vaginal smears. [Figure 8] FIG. 8 shows the experimental results of the fourth embodiment. [Figure 9] FIG. 9 shows the experimental results of the fifth embodiment. [Figure 10] FIG. 10 shows the results of immunochemical detection of the inflammatory cytokines IFN-γ and TNF-α. DETAILED DESCRIPTION OF THE PREFERRED EMBODIMENTS

[0051] The present invention will be further described below with reference to the embodiments shown in the drawings. However, the present invention is not limited to the following embodiments. The operating conditions used in the embodiments can be further adjusted based on different requirements of specific applications, and the operating conditions not described are normal conditions in the art.

[0052] The main raw materials used in the following embodiments are as follows:

[0053] 1,4-Butanediol diacrylate (BDD) and 5-amino-1-pentanol (AP) were purchased from TCI (Shanghai, China).

[0054] 1-(3-aminopropyl)-4-methylpiperazine (AMP) was purchased from Alfa Aesar (L04876, USA).

[0055] Polyethylenimine 25kD (PEI 25kD) (Cat, 28968) was purchased from Polyscience (400 Valley Road, Warrington).

[0056] Polylysine was purchased from Aladdin Reagents.

[0057] PAMAM was purchased from Weihai Chen Yuan, Shandong.

[0058] pMAX-GFP (CAS:8603168) was purchased from Bio Vector NTCC (Beijing, China).

[0059] Plasmids encoding Cas9 and sgRNA (CRISPR / Cas9 plasmids) were purchased from Addgene (#58778).

[0060] Three sgRNAs against the target PERV-pol gene (Accession No. AJ279056.1) were designed according to the method of Mali et al. (Mali P, Yang L, Esvelt KM, Aach J, Guell M, DiCarlo JE, et al. RNA-guided human genome engineering via Cas9. Science. 2013;339(6121):823-6) and synthesized by GENEWIZ (Jiangsu, China).

[0061] The specific sequence of the double-stranded oligonucleotide tag (Tsai SQ, Zheng Z, Nguyen NT, Liebers M, Topkar VV, Thapar V, et al. GUIDE-seq enables genome-wide profiling of off-target cleavage by CRISPR-Cas nucleases. Nature biotechnology. 2015;33(2):187-97) is as follows: forward, 5'G * T *TTAATTGAGTTGTCATATGTTAATAACGGT * A * T 3', Reverse, 5'A * T * ACCGTTATTAACATATGACAACTCAATTAA * A * C3'( * indicates phosphorylation). The method for making the "oligonucleotide tag" is as follows: Dissolve two oligonucleotides in STE buffer (10 mM Tris pH 8.0, 50 mM NaCl, 1 mM EDTA) to a concentration of 2OD / 100uL, mix in equimolar amounts, incubate at 94°C for 5 minutes, and cool to room temperature. All sgRNAs used in the present invention are shown in Table 1.

[0062] (First embodiment) Preparation of gel formulation 1. Synthesis of PBAE polymer BDD, AP and AMP are used to prepare the PBAE polymer by the following method. First, BDD (stabilized with p-hydroxyanisole MEHQ) and AP are mixed in a 1:1 molar ratio and stirred for 36 hours at 90°C in a N2 atmosphere with a magnetic stirring plate. After the reaction, the mixture is diluted with dimethylformamide (DMF), precipitated and washed with cold ether. After removing the ether by vacuum drying, the intermediate product (i-PBAE) is dried at room temperature. Next, i-PBAE is dissolved in anhydrous DMF and reacted with 5 times the molar amount of AMP by stirring at room temperature for 24 hours, and then the reaction product is precipitated with cold anhydrous diethyl ether. Finally, the final polymer (PBAE) is washed three times with diethyl ether, dried in vacuum for 48 hours and stored at room temperature until use. The synthetic scheme for the PBAE polymer is shown in Figure 1A.

[0063] 1The structures of i-PBAE and PBAE were characterized by H-NMR spectroscopy (Bruker AVANCE III 400MHz NMR spectrometer, solvent: CDCl3), and Figure 1B shows the spectrum. The peak with a chemical shift value of 4.062 ppm belongs to the hydrogen signal peak of -COOCH2- of the BDD unit of PABE and i-PABE, the 1.32-1.53 ​​ppm region is the hydrogen signal peak of the methylene -CH2- of AP, while the peaks at 2.42, 2.65 and 2.85 ppm are the hydrogen signal peaks of -N(CH2)2-, -NCH2CHOCO and -NCH2CHOCO-, and the 5.80-6.40 ppm region of the i-PABE spectrum is the hydrogen signal peak of the allyl end group, which was not detected in the synthesized PABE spectrum, indicating that the reaction between the C-C double bond and AMP was successful.

[0064] The number average molecular weight (Mn) of the PBAE prepared in this embodiment is 6980 Da, and it was tested by gel permeation chromatography (GPC, Waters-2410 system), Waters 2414 refractive index detector (mobile phase: DMF, standard: narrow dispersion polystyrene), and the sample was dissolved in dimethylformamide (DMF) with a concentration of 0.3 wt%, and Figure 1C shows the test result.

[0065] The structures of i-PBAE and PBAE were characterized by Fourier transform infrared spectroscopy (FTIR, PerkinElmer Spectrum Two, 32 repeated scan settings). Figure 1D shows the spectrum, with a peak at 1730 cm -1 The peaks in the above table are especially those of fatty esters of the BDD chains of i-PABE and PBAE, i.e., -CH 2- It is derived from COO-CH2-. Also, 3200~3500cm -1 The broad peak between 1639 and 1620 cm indicates the presence of –OH in the main chain, whereas the characteristic peaks of i-PBAE are at 1639 and 1620 cm -1 The peak is a hydrocarbon stretching vibration peak of a C-C double bond, and it also disappears in the PBAE spectrum. 1This is consistent with the H-NMR results, indicating that PBAE was successfully synthesized.

[0066] II. Preparation and characterization of PBAE-plasmid polymer NPs To prepare PBAE-plasmid polymer NPs, PBAE is dissolved in citrate buffer with pH 5.0 and dissolved by sonication to obtain a polymer solution (with a concentration of 20 mg / mL). The polymer solution and plasmid are mixed uniformly according to a weight ratio of PBAE to plasmid of 75:1, vortexed, and incubated at room temperature for 30 min to obtain PBAE-plasmid polymer NPs.

[0067] The PBAE-plasmid polymer NPs were characterized using dynamic light scattering (DLS, Zetaplus, Brookhaven, USA) and transmission electron microscopy (Hitachi HT7700, Japan). Figures 1E and 1F show the test results, and Figure 1G shows the results of scanning electron microscopy (TEM).

[0068] As can be seen from the study, the optimal ratio of PBAE to pDNA is 75:1, at which the average particle size is 317.1±5.3 nm, the PDI is 0.267 (FIG. 1E), and the surface charge is 34.9±6.5 mV (FIG. 1F), as can be seen from FIG. 1E and FIG. 1F.

[0069] The carrier material PBAE and pDNA are compressed by electrostatic interaction, so the NPs are compressed and densely charged. The morphology of the composite NPs can be observed by transmission electron microscopy (TEM), as shown in Figure 1G. As can be seen from the electron microscope photograph, the composite NPs formed by PBAE are all spherical particles with sizes distributed around 240 nm, and have excellent dispersion properties, which are smaller than the results of the DLS test. This phenomenon is caused by the dehydration and shrinkage of the polycomposite NPs.

[0070] In the case of PEI-plasmid polymer NPs, polylysine-plasmid polymer NPs, PAMAM-plasmid polymer NPs, etc., instead of PBAE, PEI, polylysine, PAMAM, etc. can be used to mix with the plasmid, and the plasmid DNA and 25 kda liner PEI are mixed according to a mass ratio of 10:1, and the mass ratio of the remaining cationic polymer to the plasmid is still 75:1.

[0071] 3. Preparation of vaginal gel formulation For the preparation of NPs-HTT gel, 66.65 mg of hectorite (HTT) and 1 mL of water were mixed in a magnetic stirrer at 1000-1500 rpm and dispersed for 20-30 min, then added to 0.11 mL 10x citrate buffer (citric acid: 1 mol / L, sodium citrate: 1 mol / L, pH value: 4.7), and then 1 mL PBAE-plasmid polymer NPs (containing 250 μg of plasmid DNA and 100 μg of oligonucleotide tags) were added until homogeneous mixing, and the pH of the gel was 5.0.

[0072] Preparation of NPs-mMMT gel: 1. Preparation of modified montmorillonite mMMT Mix 100mg of medicinal natural montmorillonite with 1mg of disodium hydrogen citrate and 20mg of water, stir evenly, add 10mg of methylcellulose modifier and continue stirring, slowly increase the temperature to 70°C while sealing and stirring, maintain for 5 hours, adjust the pH to 5 with citric acid, stir at a constant temperature for 1 hour, cool to room temperature, add 250mg of water, stir evenly, and leave to stand for 40 minutes, then dry and grind the upper layer of the colloidal liquid to obtain mMMT.

[0073] 2. Preparation of NPs-mMMT gel Mix 60mg mMMT and 1mL water in a magnetic stirrer at 1000-1500rpm for 20-30min to disperse. Add 0.11mL 10x citrate buffer (citric acid: 1mol / L, sodium citrate: 1mol / L, pH value: 4.7), add 1mL PBAE-plasmid polymer NPs (containing 250 micrograms of plasmid DNA and 100μg of oligonucleotide tags), and stir uniformly to obtain a gel with a pH of 5.0.

[0074] The preparation of NPs-F127 gel was the same as the preparation of the two gels mentioned above, except that the thermosensitive gel Pluronic F127 was used instead of HTT or mMMT, and the pH of the gel was 5.0.

[0075] Other cationic polymer gels can be used by replacing the PBAE-plasmid composite nanoparticles with corresponding polymer-plasmid composite nanoparticles, for example, by replacing the PBAE-plasmid composite nanoparticles with PEI-plasmid composite nanoparticles, polylysine-plasmid composite nanoparticles, PAMAM-plasmid composite nanoparticles, etc., hereinafter referred to as NPs or composite nanoparticles.

[0076] Using a scanning electron microscope (SEM, Hitachi SU8010, Japan), the PBAE-plasmid composite nanoparticles (i.e., the composite nanoparticles in FIG. 2), the modified montmorillonite gel substrate (i.e., the substrate prepared without adding 1 mL of PBAE-plasmid multimer NPs when preparing the NPs-mMMT gel), the NPs-mMMT gel (i.e., the composite nanoparticles-modified montmorillonite gel in FIG. 2), the hectorite gel substrate (i.e., the substrate prepared without adding 1 mL of PBAE-plasmid polymer NPs when preparing the NPs-HTT gel), the NPs-HTT gel (i.e., the composite nanoparticles-hectorite gel in FIG. 2), the F127 gel substrate (i.e., the substrate prepared without adding 1 mL of PBAE-plasmid polymer NPs when preparing the NPs-F127), and the NPs-F127 gel (i.e., the composite nanoparticles-F127 gel substrate in FIG. 2) were observed at 2 kV, and FIG. 2 shows the test results. Prior to testing, the samples were fixed to silicon wafers in the form of coatings and sprayed with gold. To observe the stability of the formulations, the gels were stored at room temperature for 3 days and then observed under SEM.

[0077] The NPs-mMMT gel was diluted with 4 volumes of citrate buffer and filtered through a 0.45 μm filter to test the release of NPs from the gel. The solution was tested by DLS to test the diameter of the NPs released from the gel, and the size of the NPs was tested by the same method after different storage times (1 day and 3 days) at room temperature. Figure 3 shows the test results.

[0078] As can be seen from Figures 2 and 3, the NPs in the mMMT gel do not change and can maintain the stability of the NP structure, and can be directly released in the form of nanoparticles from the gel matrix after dilution, and have good storage stability, and the diameter of the released nanoparticles remains unchanged after storage at room temperature for 3 days. Meanwhile, in the HTT gel and the thermosensitive gel Pluronic F127, the NPs are relatively affected by the matrix and cannot maintain the nanoparticle structure.

[0079] (Second embodiment) Mouse in vivo experiment We evaluated the intravaginal retention ability of NPs-mMMT gel in Kunming mouse model by bioimaging technology. During the preparation of composite nanoparticles, fluorescent dye Ce-6 was mixed into the composite nanoparticles at a mass ratio of 1% of the total mass of the composite nanoparticles to obtain Ce-6-labeled NPs, and then Ce-6-labeled PBAE-plasmid composite nanoparticle gel (NPs-mMMT gel) was prepared based on the technical proposal of the first embodiment. Then, the free fluorescent dye Ce-6 and the Ce-6-labeled PBAE-plasmid composite nanoparticle gel were respectively placed into the mouse vagina. Figure 4 shows the test results, and the signal of the free fluorescent dye (Ce-6) disappeared within a day. In the case of mMMT gel, strong fluorescence was observed on the third day. As can be seen from these results, mMMT gel has good intravaginal retention ability and can improve the action time of gene drugs in the vagina.

[0080] (Third embodiment) Pig experiment (1) Comparison of transfection efficiency of different cationic polymers In order to evaluate the transfection efficiency of the vaginal gel formulation, in the preparation process of the PBAE-plasmid composite nanoparticles, PEI-plasmid composite nanoparticles, and PAMAM-plasmid composite nanoparticles of the first embodiment, when the composite nanoparticles are prepared by the method of the second embodiment, the plasmid (reporter gene) is green fluorescent protein particle (GFP).

[0081] Because the pig genome is very close to the human genome, we chose pigs, a large mammal, as our experimental subjects; the pigs were ordinary domestic pigs aged one month.

[0082] At the time of administration, each pig was administered with either GFP-labeled PBAE-plasmid complex nanoparticles, PEI-plasmid complex nanoparticles, or PAMAM-plasmid complex nanoparticles, with a dose of 2 mL, and the vaginal gel was spread evenly on the pig's vaginal surface, cervical surface, and posterior vaginal fornix. We administered on days 1 and 4, collected cervical cells with a brush (similar to a Papanicolaou smear) on day 7, stored the sampled cervical cells in cervical cell preservation solution, and collected by centrifugation at 715 g for 5 minutes. Then, we resuspended the cells in the same volume of PBS, analyzed directly after staining with DAPI, and calculated the total number of collected cells by counting the number of cells in a certain volume with a cytometer. For each group, we obtained approximately 2.5 × 10 4 The cells were harvested and subjected to fluorescence microscopy and flow cytometry for detection, and then the transfection effect of each group was detected by fluorescence microscopy (Leica DMI8) and flow cytometry (C6, BD, USA). Figure 5 shows the test results. The cells in the blank group had almost no green fluorescence, and the GFP-mMMT without cationic polymer also had almost no GFP expression, while the GFP-PBAE mMMT, GFP-PEI mMMT and GFP-PAMAMmMMT groups showed obvious GFP expression, which were 57.0%, 41.5% and 24.9%, respectively. Obviously, a higher percentage of GFP-positive cells can be obtained when preparing vaginal gel using mMMT + cationic material PBAE, and efficient intravaginal gene delivery can be achieved.

[0083] (2) Comparison of transfection efficiency between mMMT and HTT In the preparation process of PBAE-plasmid polymer NPs of the first embodiment, when preparing composite nanoparticles by the method of the second embodiment, green fluorescent protein (GFP) is mixed into the composite nanoparticles at a mass ratio of 1% of the total mass of the composite nanoparticles, and PBAE-GFP NPs-mMMT and PBAE-GFP NPs-HTT are prepared using mMMT and HTT as substrates, respectively, according to the technical solution of the first embodiment.

[0084] The preparation of GFP-HTT and GFP-mMMT was almost the same as that of PBAE-GFP NPs-mMMT and PBAE-GFP NPs-HTT, except that PBAE was omitted.

[0085] Then, the transfection efficiency was tested in the same manner as in the first part of this embodiment, and Figure 6 shows the test results.

[0086] In addition, the cervix and organs (ovaries, urethra, vagina and uterus) were collected and rinsed with PBS to remove any attached fat or any other extraneous tissue, then fixed in 4% paraformaldehyde, cut into slices with a thickness of 3-5 μm, and used for H&E staining and IHC staining, and Figure 7 shows the test results. In addition, three groups of repeats were performed to count the percentage of GFP+ cells in the vaginal smears, and the results were 0.30% ± 0.05% for the blank group, 1.41% ± 0.28% for the GFP-HTT group, 1.80% ± 0.24% for the GFP-mMMT group, 25.79% ± 1.56% for the PBAE-GFP NPs-HTT group, and 51.12% ± 1.23% for the PBAE-GFP NPs-mMMT group, respectively.

[0087] Apparently, the percentage of GFP-positive cells was much higher when the vaginal gel was prepared with mMMT material (p-value < 0.0001). Also, the delivery without PBAE had a lower transfection efficiency, implying the need for the cationic polymer PBAE as a gene delivery carrier. Overall, the data show that the PBAE-GFP NPs-mMMT gel can perform more efficient in vivo vaginal DNA delivery than the PBAE-GFP NPs-HTT gel.

[0088] (Fourth embodiment) Removal of vaginal viruses by gel system Porcine endogenous retroviruses (PERVs) integrate into the genome of all pigs and are released as infectious particles. In some conditions, they can infect human cells and have similarities to human sexually transmitted viruses. Therefore, in this study, we selected PERVs as a therapeutic target and tested the ability of a gel system to remove viral integration fragments in a large mammal, the pig.

[0089] PERV is a retrovirus that can integrate its DNA into the pig genome to form a provirus, which is mainly composed of three genes, PERV-gag, pol, and env, and can replicate together with the host genome.

[0090] Previous studies have demonstrated that the copy number of the pol gene in tissues is higher than that of the gag and env genes, so we designed sgRNAs targeting the PERV-pol gene. Based on the ZHANG laboratory website (Doench JG, Fusi N, Sullender M, Hegde M, Vaimberg EW, Donovan KF, et al. Optimized sgRNA design to maximize activity and minimize off-target effects of CRISPR-Cas9.Nature biotechnology. 2016;34(2):184-91), we selected the three sgRNAs with the highest scores and constructed SpCas9-sgRNA plasmids (SpCas9-sgRNA-1, SpCas9-sgRNA-2, SpCas9-sgRNA-3). Then, prepare vaginal MMMT gels containing the corresponding PBAE plasmid NPs (the preparation method is the same as in the first embodiment). Our previous experiments have shown that the editing efficiency of the CRISPR / Cas9 system is affected when the target is mutated. Therefore, before the animal experiment, we routinely perform Sanger sequencing on PERV DNA to confirm whether the PERV sequence is mutated (Figure 8A shows the test result). As can be seen from the results, the target DNA of sgRNA-2 has one base mutation, which may affect the editing efficiency of the CRISPR / Cas9 system (Figure 8B shows the test result). Therefore, we select sgRNA-1 and sgRNA-3 for further experiments.

[0091] At the time of administration, each pig was administered 2mL of PBAE-CRISPR / Cas9 plasmid mMMT gel (containing 250ug of CRISPR / Cas9 gene editing system plasmid) (i.e., NPs-mMMT gel prepared in the first embodiment) and uniformly distributed on the vaginal surface, cervical surface and posterior vaginal fornix of the one-month-old pig. Administration was performed on the first and fourth days, and cells were collected on the seventh day. Then, the brush was rotated around the entrance of the sow's cervix three times to obtain cells (this is very similar to the Papanicolaou smear collection method of human patients). Cervical cells were collected and placed in cervical cell preservation solution and centrifuged at 715g for 5 minutes. Then, the cells were resuspended in the same volume of PBS, the number of cells in a certain volume was counted with a cell counter, and the total number of collected cells was calculated. Approximately 2.5×10 cells were collected from each group. 4 Cells are harvested and analyzed.

[0092] DNA extraction and PCR DNA is extracted using DNeasy Blood&Tissue Kit 69506, Qiagen, Germany reagent test kit. PCR reactions are performed by warm starting the High Precision 2X Master Mix (M0494S, NEW ENGLAND BioLabs, USA) in Q5. Table 1 shows the primers used. qPCR is performed on a Bio-Rad CFX96 instrument using PowerUpSYBRGreen Master Mix (A25742, Applied Biosystems, USA). The experiment is performed in three biological replicates, and the porcine GAPDH gene is used as an internal reference gene to calculate the relative phenotypic change of PERV copy number with the 2-ΔΔCT method. Table 1 shows the primers used. [Table 1] We were able to demonstrate that the PBAE NPs-based mMMT gel efficiently delivered the CRISPR / Cas9 system into the porcine vaginal epithelium, targeted PERV at the site, and significantly reduced the viral copy number. After the PBAE-SpCas9 / sgRNA-1 NPs-mMMT vaginal gel was applied to the porcine vagina, the viral copy number of PERV could be reduced ( Figure 8E ).

[0093] When SpCas9 cleaves PERV DNA in the vagina in vivo, the oligo is inserted into the cleavage site. By performing PCR reactions (one primer is in the oligo and the other primer is in the genome site close to the target) on the insertion site genome and oligo DNA, the correct size of about 200 bp is obtained (Figure 8C shows the test result). As expected, Sanger-Sequencings show that the SpCas9-PERV sgRNA plasmid efficiently cleaves the PERV DNA sequence in the epithelial cells of the pig cervix in vivo, and the oligo is correctly inserted (Figure 8C). Further qPCR also shows a reduction in the copy number of PERV in the PBAE-SpCas9 NPs gel-treated group. Compared to before treatment, the copy number of PERV in the sgRNA-1 group is reduced by 34%, and the copy number of PERV in the sgRNA-3 group is reduced by 17%, indicating that the cleavage efficiency of sgRNA-1 is superior to that of sgRNA-3 (Figure 8E).

[0094] To reduce off-target sites without compromising genome editing efficiency, the specificity of SpCas9 nuclease can be enhanced by two variants, eSpCas9 and SpCas9-HF1. Therefore, in this study, we further tested the effectiveness of eSpCas9 and eSpCas9-HF1 and sgRNA-1 in mMMT gel. Compared with the control group, the PERV copy number was reduced by about 42% in the SpCas9-HF1 group and 34% in the eSpCas9 group, indicating that the SpCas9-HF1-based vaginal gel was more effective (P<0.05, Figure 8F). Because plasmid delivery may cause an inflammatory response that affects the copy number of PBAE, we added the experimental group PBAE-SpCas9-HF1 (without sgRNA) NPs-mMMT gel as another control group to observe this phenomenon. We found that the copy number of PERV in the SpCas9-HF1 group without sgRNA treatment did not change compared to before treatment ( Figure 8F ), meaning that plasmid delivery did not induce an immune response that affected the copy number of PERV.

[0095] Collectively, these data indicate that PBAE-Cas9 NPs-mMMT vaginal gel-based in vivo DNA delivery achieved efficient local genome editing.

[0096] (Fifth embodiment) Safety evaluation of gel After euthanasia, the pigs were isolated and fixed (4% paraformaldehyde) from their cervix, ovaries, urethra, vagina, and uterus. Paraffin-embedded sections (5 mm) were stained for IHC according to Proteintech protocols (http: / / www.ptgcn.com / support / protocols).

[0097] We first evaluated the biodistribution of the delivery system. The CRISPR / Cas9 plasmid in our system contains a Flag tag, so when the plasmid is delivered to a certain location in the pig's organs and successfully transfected, Flag is expressed. We used immunohistochemistry (IHC) method to stain the expression of Flag labeling in different organs, such as the vagina, urethra, cervix, ovary, and uterus. We found that only the tissues of the vagina and cervix had Flag expression, with the vagina being the strongest. The labeling was not expressed in other organ tissues. This means that our system works locally in the vagina and cervix and has not spread to nearby organs (Figure 9A). Next, we performed general blood tests and blood biochemistry tests on the pigs treated with NPs-mMMT gel to evaluate its toxicity. The blood tests reflect the normal metabolism of multiple systems throughout the body, including the hematopoietic system and immune system. Among the blood biochemical indicators, alanine aminotransferase (ALT), aspartate aminotransferase (AST) and alkaline phosphatase (ALP) are related to liver function, while alanine aminotransferase (BUN) is an important indicator of the kidney. On the 1st and 4th days, general mMMT gel was administered, and blood and serum were collected. On the day before and the 7th day of treatment, blood tests and blood biochemical tests were performed. Indicators such as WBC and RBC in the general blood tests were not significantly different from those before administration (P<0.05, Figure 9B). Similar results were obtained in the blood biochemical tests (Figure 9C). In addition, hematoxylin-eosin staining (H&E) was performed on the cervix, ovary, urethra, vagina and uterus to evaluate the toxicity of the drug. The results showed that there was no abnormal morphology, pathological edema, inflammatory necrosis and apoptotic bodies (Figure 9D).

[0098] We also performed immunochemical tests for inflammatory cytokines IFN-γ and TNF-α in the vagina, cervix, and urethra lumen of the PBAE-SpCas9 / sgRNA NPs-mMMT treatment group and the control group to verify the results. No obvious inflammatory cytokine staining was observed (Figure 10). The data showed that our administration formulation was relatively safe and had the characteristics of local vaginal biodistribution and low toxicity, which is also favorable for the future application of the gel system in clinical trials.

[0099] All quantitative data from the above statistical analyses are expressed as the mean ± SD of at least three parallel determinations. Statistical analyses were performed using single factor ANOVA with post-hoc tests and T-tests performed with GraphPad Prism software (GraphPad Prism 8), with P < 0.05 considered to indicate significant differences.

[0100] The above-mentioned embodiments are intended to explain the technical concepts and features of the present application, and are intended to enable those skilled in the art to understand and implement the contents of the present application, without limiting the scope of the patent rights of the present application. Any equivalent changes or modifications made based on the spirit of the present application shall fall within the scope of patent protection of the present application.

Claims

1. 1. A vaginal gel formulation comprising: A substrate and nanoparticles, the nanoparticles comprise a cationic polymer and a therapeutic gene; the substrate comprises a hydrophilic polymeric material modified montmorillonite; The hydrophilic polymeric material-modified montmorillonite is obtained by modifying it with a hydrophilic cellulose derivative, 10. A vaginal gel formulation, wherein the cationic polymer is selected from one or more of poly-β-aminoesters, polyethyleneimines, polyamido-amines.

2. 2. The vaginal gel formulation of claim 1, wherein the hydrophilic cellulose derivative is methylcellulose.

3. 2. The vaginal gel formulation according to claim 1, wherein the mass ratio of the hydrophilic polymeric material to the montmorillonite in the hydrophilic polymeric material modified montmorillonite is 0.1-1:

1.

4. 2. The vaginal gel formulation of claim 1, wherein the hydrophilic polymeric material modified montmorillonite further comprises a sodium salt.

5. 5. The vaginal gel formulation of claim 4, wherein the sodium salt is one or more of sodium bicarbonate, disodium hydrogen phosphate, disodium hydrogen citrate, and sodium acetate.

6. 2. The vaginal gel formulation according to claim 1, wherein the mass ratio of the cationic polymer to the hydrophilic polymeric material modified montmorillonite is 1:1-1000.

7. The vaginal gel formulation according to claim 1, wherein the mass ratio of the cationic polymer to the therapeutic gene is 10-150:

1.

8. 2. The vaginal gel formulation of claim 1, wherein the surface of the nanoparticles is charged.

9. 2. The vaginal gel formulation of claim 1, wherein the therapeutic gene is one or more of a plasmid, DNA, and RNA.

10. The vaginal gel formulation of claim 1, characterized in that the pH is 4.0 to 8.

0.

11. The present invention comprises a substrate and nanoparticles, the substrate comprising a hydrophilic polymeric material modified montmorillonite, the nanoparticles comprising a cationic polymer and a therapeutic gene, the hydrophilic polymeric material modified montmorillonite being obtained by modifying montmorillonite with a hydrophilic cellulose derivative, the cationic polymer being a poly-β-amino ester, the general structural formula of which is: 【Chemistry 1】 wherein m is a number between 5 and 200; the therapeutic gene is a plasmid formed by SpCas9-HF1 and / or eSpCas9 and DNA that can be transcribed into sgRNA-1 and / or DNA that can be transcribed into sgRNA-3; the sequence of the DNA that can be transcribed into sgRNA-1 is TTCGAATGGAGAGATCCAGG, and the sequence of the DNA that can be transcribed into SGRNA-3 is GGTGACCCTCCTCCCAGTACG.

12. 12. The vaginal gel formulation of claim 11, wherein the hydrophilic cellulose derivative is methylcellulose.

13. allowing the cationic polymer and the therapeutic gene to form nanoparticles in an acidic buffer to obtain a mixture containing nanoparticles; The method for preparing a vaginal gel formulation according to any one of claims 1 to 12, further comprising the steps of: directly mixing the mixture containing nanoparticles with the hydrophilic polymeric material modified montmorillonite to prepare the vaginal gel formulation; or dispersing the hydrophilic polymeric material modified montmorillonite in water and / or an acidic buffer solution and then mixing it with the mixture containing nanoparticles.

14. 14. The method for preparing a vaginal gel formulation according to claim 13, further comprising a step of preparing the hydrophilic polymeric material modified montmorillonite, in which montmorillonite and hydrophilic polymeric material are added to water, selectively adding sodium salt, mixing and stirring, then adjusting pH to 4-6, stirring and standing, and then drying and grinding the upper layer of colloidal liquid to obtain the hydrophilic polymeric material modified montmorillonite.

15. The method for preparing a vaginal gel formulation according to claim 14, characterized in that the temperature of the mixing and stirring is 50-90°C, the time is 1-10 hours, and after the pH is adjusted, the mixture is stirred at a constant temperature of 50-90°C for 0.5-2 hours, then cooled, water is added, the mixture is stirred uniformly, and the mixture is allowed to stand.

16. A vaginal gel formulation according to any one of claims 1 to 12, for use in gene therapy of vaginal and / or cervical diseases.

Images