Prefabricated microparticles for detecting analytes - Patent Application 20070123633

Abstract

Providing prefabricated microparticles for analyte detection. [Solution] The present invention relates to prefabricated microparticles for performing analyte detection, preferably digital detection and / or quantification. It also relates to the detection and / or quantification of multiple analytes using the prefabricated microparticles. It also relates to collections of such prefabricated microparticles and the use of such microparticle(s) and / or such collections. Furthermore, the present invention also relates to methods for performing analyte detection and / or quantification in a sample, in which microparticles or collections of microparticles are used. In one embodiment, in a collection of microparticles, individual microparticles are tailored for the detection of specific analytes and can be distinguished from one another by specific labels indicative of the respective analytes for which the individual microparticles are specific.

Description

[Technical field]

[0001] The present invention relates to prefabricated microparticles for performing detection and / or quantification of an analyte. It further relates to the detection and / or quantification of multiple analytes by the prefabricated microparticles. It also relates to a collection of such prefabricated microparticles and the use of such microparticle(s) and / or such collection. Preferably, the detection is digital detection. Furthermore, the present invention also relates to a method for performing detection and / or quantification of an analyte or multiple analytes in a sample, in which a microparticle or a collection of microparticles is used. In one embodiment, in the collection of microparticles, the individual microparticles are tailored for the detection of a specific analyte and can be distinguished from each other by a specific label indicative of the respective analyte for which the individual microparticles are specific. [Background technology]

[0002] Numerous techniques and methods have been devised for the detection of analytes in samples. Sensitive quantitative detection of analytes would, in an ideal world, be digital. For this purpose, the sample is distributed into several reaction spaces, with at most one analyte molecule in each reaction space. In this way, despite an overall small amount of analyte, a high analyte concentration is reached with respect to the background, thus increasing the efficiency of the reaction. The generated signal is concentrated in a small, limited space and can therefore be easily detected. As early as 1961, the activity of individual enzyme molecules was measured in aqueous droplets in oil (Rotman, 1961, PNAS, vol. 47: 1891-1991). This demonstrated the feasibility of detecting the activity of single enzyme molecules and thus the possibility of performing digital assays. With the development and increasing distribution of molecular amplification processes, the concept of "limiting dilution" paved its way in nucleic acid analytics (Sykes et al., 1992, Biotechniques, vol. 13: 444-449). Partitioning was originally achieved by dividing the sample solution containing the analyte / target molecules into individual reaction spaces in a microtiter plate. Later, by using capillaries and microstructured substrates, a significantly larger number of reaction spaces was achieved (Kalinina et al., 1997, Nucleic Acids Research, vol. 25, pp. 1999-2004). Similarly, primer oligonucleotides immobilized on microparticles were used in combination with water / oil immersion (Vogelstein et al., 1999, PNAS, vol. 96: pp. 9236-9241). There are also formats available for performing digital immunoassays in which microstructured substrates are used that allow the generation of small volumes of aqueous solutions, thus resulting in multiple reaction spaces (Rissin et al., 2006, Nanolett., vol. 6: pp. 520-523). In essence, the methodologies available today for performing the detection of analytes usually involve complex devices for generating microscopic reaction spaces or for performing the respective detection tests. It was therefore an object of the present invention to provide a methodology for performing detection, preferably digital detection, of an analyte in a sample that is easy to handle and can be performed without undue efforts on the part of the device used.It is also an object of the present invention to provide a methodology that is versatile and can be adjusted for different analytes, but can also be used universally and easily adapted to different analytes.Furthermore, it is an object to provide a detection method that does not require adjustment of the final volume of the detection reaction and allows the concentration of analytes from different volumes of liquid. [Prior art documents] [Non-patent literature]

[0003] [Non-Patent Document 1] Rotman, 1961, PNAS, vol. 47: pp. 1891-1991. [Non-Patent Document 2] Sykes et al., 1992, Biotechniques, 13:444-449 [Non-Patent Document 3] Kalinina et al., 1997, Nucleic Acids Research, Vol. 25, 1999-2004 [Non-Patent Document 4] Rissin et al., 2006, Nanolett., 6:520-523. Summary of the Invention [Means for solving the problem]

[0004] In one aspect, the present invention provides a method for performing detection, preferably digital detection, of an analyte in a sample, comprising the steps of: a) providing pre-fabricated microparticles having a surface and including a void volume for receiving an aqueous solution, said microparticles being dispersible in a non-aqueous medium and, upon dispersion in the non-aqueous medium, providing a defined reaction space in such non-aqueous medium in which a chemical or biochemical reaction indicative of the presence of an analyte can be carried out, said pre-fabricated microparticles including a capture agent surrounding said pre-fabricated microparticles and, upon exposure of said microparticles to a sample containing an analyte, selectively and specifically binds to the analyte to be detected and forms a complex between said capture agent and said analyte upon binding of said analyte to said capture agent, said capture agent binds to an analyte from a sample surrounding said pre-fabricated microparticles, said pre-fabricated microparticles further including a detection agent that is specific for said analyte or the complex between said capture agent and said analyte and binds to said analyte or the complex between said capture agent and said analyte; b) exposing the prefabricated microparticles to an aqueous sample suspected of containing the analyte to be detected, thus allowing the capture agent, if present, to selectively and specifically bind to the analyte to be detected; c) placing the prefabricated microparticles in a non-aqueous phase, e.g., an oil phase, and measuring the void volume of the prefabricated microparticles to determine whether a chemical or biochemical reaction indicative of the presence of an analyte occurs; d1) detecting a detection agent bound to the analyte or to the complex between the capture agent and the analyte; or d2) amplifying said analyte, if present, by an amplification reaction and detecting the product thus amplified by said detection agent, wherein said analyte is a nucleic acid and said amplification reaction is a nucleic acid amplification reaction, such as, for example, PCR, TMA, NASBA, LAMP, 3SR, SDA, RCA, LCR, RPA, NEAR, etc. or d3) carrying out a signal amplification reaction, e.g. a nucleic acid amplification, if a nucleic acid is part of or forms part of the detection agent, or an enzyme-based amplification of a signal, e.g. in the form of a label, such as a dye or fluorophore, if an enzyme is part of or forms part of the detection agent, and detecting the signal thus amplified. and using the reaction space as defined by any one of the following steps: The present invention relates to a method comprising the steps of:

[0005] In one embodiment, the prefabricated microparticles are provided as dry, preferably lyophilized, prefabricated microparticles. In one embodiment, the prefabricated microparticles are not microparticles that are fabricated in situ, and preferably are not microparticles that are fabricated in situ at or during the time, or in situ during, the analyte detection reaction.

[0006] In one embodiment, the prefabricated microparticles are porous microparticles.

[0007] In one embodiment, the prefabricated microparticles have interstitial pore space that allows the microparticles to receive or take up a liquid, such as an aqueous sample, and any solutes therein, if present, e.g., analytes.

[0008] In one embodiment, the capture agent is located primarily on the surface of the prefabricated microparticle, such that the prefabricated microparticle is capable of concentrating and concentrating analytes located on the exterior of the microparticle.

[0009] In one embodiment, said prefabricated microparticles are preferably reconstituted in an aqueous solution during either step a) or step b) and upon reconstitution receive such aqueous solution in their void volume.

[0010] In one embodiment, the detection agent is included in the prefabricated microparticles during the prefabrication process or in the aqueous solution of the invention, and thus becomes part of the prefabricated microparticles upon reconstitution.

[0011] In one embodiment, the prefabricated microparticles are made of a gel former, which is preferably liquefiable upon application of heat or light, or upon a change in pH, redox potential, ionic strength, temperature, magnetic field or electromagnetic radiation, or upon exposure to an enzyme, or, if the gel former itself comprises an enzyme, to a substrate for such enzyme, or any combination of the foregoing.

[0012] In one embodiment, the gel forming agent forms a matrix that defines the surface and the void volume of the microparticles, hi one embodiment, the matrix is ​​a porous matrix.

[0013] In one embodiment, the gel forming agent is a) synthetic polymers prepared from methyl acrylate and its corresponding monomers such as acrylates, acrylamides and methacrylamides, cyclic lactams, styrene-based monomers, etc.; b) Silicon-based polymers, such as polydimethylsiloxane and its copolymers; c) polysaccharides, such as agarose, chitin, chitosan, alginates, carrageenan, cellulose, fucoidan, laminaran; gums selected from xanthan gum, gum arabic, ghatti gum, guar gum, locust bean gum, tragacanth gum, karaya gum and inulin; naturally occurring polymers selected from polypeptides, such as albumin, collagen, gelatin, polynucleotides and combinations thereof. The compound is selected from the group consisting of:

[0014] In one embodiment, the capture agent is selected from an antibody or antibody fragment, a nucleic acid including an aptamer, a Spiegelmer; a receptor, a receptor fragment, an affinity protein, a non-antibody protein capable of specifically binding to the analyte or analyte complex, such as, for example, streptavidin.

[0015] In one embodiment, said detection agents are selected from antibodies or antibody fragments, nucleic acids including aptamers, spiegelmers; receptors, receptor fragments, affinity proteins, non-antibody proteins such as, for example, streptavidin, each of which is optionally labeled with a suitable reporter molecule, for example, a dye, an enzyme, a chemical catalyst or a mixture of reagents capable of initiating a chemical reaction resulting in an optically or otherwise detectable signal indicative of the presence of said analyte to be detected.

[0016] In one embodiment, the prefabricated microparticles are specifically labeled.

[0017] In one embodiment, the invention is practiced using a collection of pre-fabricated microparticles, said pre-fabricated microparticles as defined in any of the embodiments of the invention.

[0018] In one embodiment, in the collection of prefabricated microparticles, the prefabricated microparticles differ from one another in that they are specific for different analytes to be detected, and each prefabricated microparticle is specifically labeled such that different prefabricated microparticles and their corresponding analytes to be detected can be distinguished by the specific label of the prefabricated microparticle.

[0019] In one embodiment, the method comprises the use of pre-fabricated microparticles, or a collection of pre-fabricated microparticles, as defined in the present invention for performing digital detection of an analyte or analytes in a sample, or for concentrating and concentrating a plurality of analytes in a plurality of defined volumes, preferably all of said defined volumes in said plurality of defined volumes being equivalent.

[0020] In one embodiment, said exposing step b) is followed by one or several washing steps.

[0021] In one embodiment, in step a), the prefabricated microparticles are provided in a dried form, and in step b), the prefabricated microparticles are reconstituted in an aqueous solution and then exposed to a sample suspected of containing the analyte to be detected, optionally with one or several washing steps after the reconstitution step.

[0022] In one embodiment, in step b), the number of prefabricated microparticles and the number of analyte molecules in the sample are maintained and adjusted as necessary such that the binding of a single analyte molecule per prefabricated microparticle follows a Poisson distribution, preferably such that, on average, no more than one analyte molecule is bound per microparticle, thus allowing the detection of a single analyte molecule per prefabricated microparticle.

[0023] In one embodiment, during step c), if present, said prefabricated microparticles or said collection of prefabricated microparticles are suspended in said non-aqueous phase and / or located on a solid substrate that separates each prefabricated microparticle from other prefabricated microparticles, preferably said solid substrate is a substrate having a pattern of filters, sieves, wells, recesses, grooves, channels, trenches, craters, holes, pillars or any combination of the foregoing.

[0024] In one embodiment, during or after step c), said gel former is preferably liquefied through the application of heat or light, or by change in pH, redox potential, ionic strength, temperature, magnetic field or electromagnetic radiation, or upon exposure to an enzyme, or, if said gel former itself comprises an enzyme, to a substrate for such enzyme, or any combination of the foregoing, resulting in aqueous droplets in a non-aqueous phase.

[0025] In one embodiment, the reaction space in which the chemical or biochemical reaction indicative of the presence of an analyte is carried out is defined by the void volume of the prefabricated microparticles and is not substantially larger than the void volume of the prefabricated microparticles.

[0026] In a further aspect, the present invention provides a method for performing detection, preferably digital detection, of an analyte in a sample, comprising the steps of: a) providing pre-fabricated microparticles having a surface and comprising a void volume for receiving an aqueous solution, said microparticles being dispersible in a non-aqueous medium and, upon dispersion in the non-aqueous medium, providing a defined reaction space in such non-aqueous medium in which a chemical or biochemical reaction indicative of the presence of an analyte can be carried out, said pre-fabricated microparticles being preferably porous microparticles, which, upon exposure of said microparticles to a sample surrounding said pre-fabricated microparticles and containing an analyte, bind to and / or immobilize and / or receive in the pores of said microparticles said analyte from a sample surrounding said pre-fabricated microparticles by incorporating a portion of said sample into said pores; the capture agent binds to an analyte from a sample that surrounds the prefabricated microparticles; the prefabricated microparticles further comprising a detection agent that is specific to and binds to the analyte; b) exposing said prefabricated microparticles to an aqueous sample suspected of containing the analyte to be detected, thus allowing said prefabricated microparticles to bind and / or immobilize and / or receive said analyte to be detected, if present; c) placing the prefabricated microparticles in a non-aqueous phase, e.g., an oil phase, and measuring the void volume of the prefabricated microparticles to determine whether a chemical or biochemical reaction indicative of the presence of an analyte occurs; d1) detecting a detection agent bound to the analyte; or d2) amplifying said analyte, if present, by an amplification reaction and detecting the product thus amplified by said detection agent, wherein said analyte is a nucleic acid and said amplification reaction is a nucleic acid amplification reaction, such as, for example, PCR, TMA, NASBA, LAMP, 3SR, SDA, RCA, LCR, RPA, NEAR, etc. or d3) carrying out a signal amplification reaction, e.g. a nucleic acid amplification, if a nucleic acid is part of or forms part of the detection agent, or an enzyme-based amplification of a signal, e.g. in the form of a label, such as a dye or fluorophore, if an enzyme is part of or forms part of the detection agent, and detecting the signal thus amplified. and using the reaction space as defined by any one of the following steps: The present invention relates to a method comprising the steps of:

[0027] In this aspect, it should be noted that according to the present invention, the presence of a capture agent on the prefabricated microparticle is not necessary, as long as the prefabricated microparticle is capable of capturing liquid from the surroundings to which it is exposed. For example, such a microparticle may be a porous microparticle, thus allowing the capture of liquid and analytes present in said liquid in the porous microparticle, i.e. in the space provided by the pores of said microparticle. Thus, according to this aspect of the present invention, the method works even if the prefabricated microparticle does not have a capture agent. Instead, any analytes present in the sample are received and captured by the prefabricated microparticle according to the present invention solely due to its ability to receive and capture liquid therein. The presence of a capture agent increases the specificity and / or selectivity of the prefabricated microparticle for said analytes, but is not absolutely necessary or essential for the prefabricated microparticle according to the present invention to function. However, the presence of a capture agent on the prefabricated microparticle may, in some embodiments, increase the ability of the microparticle to concentrate and / or focus an analyte from a sample.

[0028] In a further aspect, the present invention relates to prefabricated microparticles for performing detection, preferably digital detection, of an analyte in a sample, said microparticles having a surface and comprising a void volume for receiving an aqueous solution, said particles being dispersible in a non-aqueous medium and being suitable, upon dispersion in the non-aqueous medium, to provide a defined reaction space in such non-aqueous medium, in which a chemical or biochemical reaction can be performed that is indicative of the presence of the analyte.

[0029] In one embodiment, prefabricated microparticles according to the present invention are preferably storable for a period of at least 2 months, more preferably at least 6 months.

[0030] In one embodiment, prefabricated microparticles according to the present invention are dried, preferably lyophilized.

[0031] In one embodiment, prefabricated microparticles according to the present invention are not particles that are fabricated in-situ, and preferably are not particles that are fabricated in-situ at the site or in the reaction when or during analyte detection occurs.

[0032] In one embodiment, the prefabricated microparticles are porous microparticles.

[0033] Preferably, the prefabricated microparticles have interstitial pore space that allows the microparticles to receive or take up a liquid, e.g., an aqueous sample, and any solutes therein, if present, e.g., an analyte.

[0034] In one embodiment, the prefabricated microparticles include a capture agent that selectively and specifically binds to the analyte to be detected upon exposure of the microparticle to a sample surrounding the microparticle and containing the analyte, and upon binding of the analyte to the capture agent, forms a complex between the capture agent and the analyte, and the capture agent binds to the analyte from the sample surrounding the microparticle.

[0035] In one embodiment, the capture agent is located primarily on the surface of the microparticle, such that the microparticle is capable of concentrating and concentrating analytes located on the exterior of the microparticle.

[0036] In one embodiment, the prefabricated microparticles according to the present invention further comprise a detection agent that is specific for and binds to an analyte or the complex between the capture agent and the analyte.

[0037] In one embodiment, the prefabricated microparticles are reconstituted in an aqueous solution and upon reconstitution receive such aqueous solution in their void volume.

[0038] In one embodiment, the detection agent is included in the prefabricated microparticles during the prefabrication process or in the aqueous solution in which it is reconstituted, and thus becomes part of the microparticles upon reconstitution.

[0039] In one embodiment, the prefabricated microparticles are made of a gel former, which is preferably liquefiable upon application of heat or light, or upon a change in pH, redox potential, ionic strength, temperature, magnetic field or electromagnetic radiation, or upon exposure to an enzyme, or, if the gel former itself comprises an enzyme, to a substrate for such enzyme, or any combination of the foregoing.

[0040] In one embodiment, the gel forming agent forms a matrix that defines the surface and void volume of the microparticles, hi one embodiment, the matrix is ​​a porous matrix.

[0041] In one embodiment, the gel forming agent is a) synthetic polymers prepared from methyl acrylate and its corresponding monomers such as acrylates, acrylamides and methacrylamides, cyclic lactams, styrene-based monomers, etc.; b) Silicon-based polymers, such as polydimethylsiloxane and its copolymers; c) polysaccharides, such as agarose, chitin, chitosan, alginates, carrageenan, cellulose, fucoidan, laminaran; gums selected from xanthan gum, gum arabic, ghatti gum, guar gum, locust bean gum, tragacanth gum, karaya gum and inulin; naturally occurring polymers selected from polypeptides, such as albumin, collagen, gelatin, polynucleotides and combinations thereof. The compound is selected from the group consisting of:

[0042] In one embodiment, the capture agent is selected from an antibody or antibody fragment, a nucleic acid including an aptamer, a Spiegelmer; a receptor, a receptor fragment, an affinity protein, e.g. a non-antibody protein capable of specifically binding to the analyte or analyte complex, such as streptavidin.

[0043] In one embodiment, said detection agent is selected from an antibody or antibody fragment, a nucleic acid including an aptamer, a spiegelmer; a receptor, a receptor fragment, an affinity protein, e.g. a non-antibody protein such as streptavidin, each of which is optionally labeled with a suitable reporter molecule, e.g. a dye, an enzyme, a chemical catalyst or a mixture of reagents capable of initiating a chemical reaction resulting in an optically or otherwise detectable signal indicative of the presence of said analyte to be detected.

[0044] In one embodiment, the microparticles are specifically labeled.

[0045] In a further aspect, the present invention also relates to a collection of microparticles, said microparticles being as defined above.

[0046] In one embodiment, in the collection of prefabricated microparticles, the prefabricated microparticles differ from one another in that they are specific for different analytes to be detected, and each microparticle is specifically labeled such that different microparticles and their corresponding analytes to be detected can be distinguished by the specific label of the prefabricated microparticle.

[0047] In a further aspect, the present invention relates to the use of a microparticle according to the invention or a collection of microparticles according to the invention for performing digital detection of an analyte or analytes in a sample.

[0048] In a further aspect, the present invention relates to the use of a microparticle according to the present invention, or a collection of microparticles according to the present invention, for concentrating and concentrating an analyte in a defined volume, or for concentrating and concentrating a plurality of analytes in a plurality of defined volumes, preferably all of said defined volumes in said plurality of defined volumes being equivalent.

[0049] In a further aspect, the present invention provides a method for performing digital detection of an analyte in a sample, comprising the steps of: a) providing a collection of prefabricated microparticles according to the present invention; b) exposing said assembly to a sample suspected of containing the analyte to be detected, thus allowing said capture agent, if present, to selectively and specifically bind to said analyte to be detected, optionally with one or several washing steps after the reconstitution and / or exposing steps; c) placing the collection of microparticles in a non-aqueous phase, e.g., an oil phase; d1) detecting a detection agent bound to the analyte or to the complex between the capture agent and the analyte; or d2) amplifying said analyte, if present, by an amplification reaction and detecting the product thus amplified by said detection agent, wherein said analyte is a nucleic acid and said amplification reaction is a nucleic acid amplification reaction, such as, for example, PCR, TMA, NASBA, LAMP, 3SR, SDA, RCA, LCR, RPA, NEAR, etc. or d3) carrying out a signal amplification reaction, e.g. a nucleic acid amplification, if a nucleic acid is part of or forms part of the detection agent, or an enzyme-based amplification of a signal, e.g. in the form of a label, such as a dye or fluorophore, if an enzyme is part of or forms part of the detection agent, and detecting the signal thus amplified. Any step of The present invention relates to a method comprising the steps of:

[0050] In one embodiment, in step a), the prefabricated microparticles are provided in a dried form, and in step b), the prefabricated microparticles are reconstituted in an aqueous solution and then exposed to a sample suspected of containing the analyte to be detected.

[0051] In one embodiment, in step b), the number of microparticles and the number of analyte molecules in the sample are maintained and adjusted as necessary so that the binding of a single analyte molecule per microparticle follows a Poisson distribution, preferably so that, on average, no more than one analyte molecule is bound per microparticle, thus allowing the detection of a single analyte molecule per microparticle.

[0052] In one embodiment, during step c), if present, said aggregates are suspended in said non-aqueous phase and / or located on a solid substrate that separates each microparticle from other microparticles, preferably said solid substrate is a substrate having a pattern of filters, sieves, wells, recesses, grooves, channels, trenches, craters, holes, pillars or any combination of the foregoing.

[0053] In one embodiment, during or after step c), said gel former is preferably liquefied through the application of heat or light, or by change in pH, redox potential, ionic strength, temperature, magnetic field or electromagnetic radiation, or upon exposure to an enzyme, or, if said gel former itself comprises an enzyme, to a substrate for such enzyme, or any combination of the foregoing, resulting in aqueous droplets in a non-aqueous phase.

[0054] In a further aspect, the present invention also relates to a method for producing a prefabricated microparticle according to the present invention, said method comprising the steps of: a) providing, in any order, an aqueous phase containing a gel forming agent and, separately from said aqueous phase, an oily phase; b) forming aqueous droplets of an aqueous phase containing a gel-forming agent within an oil phase, preferably by creating a stream of an oil phase and introducing a defined volume of an aqueous phase into said stream of oil phase; c) collecting the aqueous droplets thus produced within said oil phase and then separating said aqueous droplets from said oil phase by mechanical separation such as centrifugation, sieving or filtration. Includes. DETAILED DESCRIPTION OF THE PREFERRED EMBODIMENTS

[0055] The inventors have devised a methodology in and for performing detection in which, in contrast to the prior art, prefabricated microparticles themselves define and limit the reaction space in which the detection takes place. In other words, according to an embodiment of the present invention, a prefabricated microparticle or microparticles are provided and used as a detection compartment. The dimensions of the microparticle or microparticles of the present invention thus define and limit the dimensions of the compartment in which the detection takes place. In contrast, according to the prior art, solid beads are often used with capture agents attached to their surface, and these beads themselves act to capture, immobilize or capture the analyte, but for the subsequent detection reaction, these beads or particles are incorporated into a droplet or reaction space that is much larger than the beads or particles. In contrast, according to an embodiment of the present invention, the prefabricated microparticles themselves define and limit the dimensions of the reaction space in which the detection reaction takes place. The dimensions of the prefabricated microparticles according to the present invention are therefore the dimensions of the reaction space in which the detection of the analyte takes place. Without wishing to be bound by any theory, the inventors therefore consider their methodology to be the first and only microparticle-mediated compartmentalization for detection reactions. This distinguishes the present invention from all of the above prior art methodologies. Thus, according to embodiments of the present invention, the prefabricated microparticles, after exposure to an aqueous sample suspected of containing the analyte to be detected, are not subsequently incorporated into a larger aqueous droplet surrounded by an oil phase. Similarly, according to embodiments of the present invention, the prefabricated microparticles, after exposure to an aqueous sample suspected of containing the analyte to be detected, are not placed into a larger compartment, such as a well or microreactor, where they are combined with other components of an aqueous solution containing a volume of water to form aqueous droplets that are significantly larger than the microparticles themselves. Instead, according to embodiments of the present invention, the prefabricated microparticles themselves define and limit the reaction space / compartment in which the detection of the analyte takes place.

[0056] Thus, according to an embodiment of the present invention, the prefabricated microparticle(s) of the present invention provide a scaffold defined by a volume that is filled or becomes filled with an aqueous solution to such an extent that the total void volume of the prefabricated microparticle or only a portion thereof is filled. In other words, according to an embodiment of the present invention, the total volume of the reaction space in which the detection of an analyte takes place is limited at the upper end by the maximum volume provided by the prefabricated microparticle, and is effectively limited by the total volume of the liquid or liquid sample taken up by the prefabricated microparticle. Thus, when the liquid-filled prefabricated microparticle is incorporated into a non-aqueous phase, the liquid-filled volume of the prefabricated microparticle corresponds to and serves as the reaction space in which the detection reaction of an analyte takes place.

[0057] Such compartmentalization of a reaction space by prefabricated microparticles, which themselves act as volume scaffolds to provide such a reaction space, has not been described previously.

[0058] Microdroplet generating devices for carrying out such methods and for generating aqueous droplets exist and can be easily adapted to the present invention. For example, a device useful for the present invention is a dosing device manufactured by Dolomite Microfluidics, UK. Such devices are also further described in WO2002 / 068104 and WO2005 / 089921. The devices described herein can be adapted to generate aqueous microdroplets in an oil phase according to embodiments of the present invention. In a further embodiment, the separate aqueous droplets generated by the above method, in particular after step c), may be washed using an aqueous solution or water. Furthermore, they may then be dried, for example freeze-dried. According to the present invention, the aqueous droplets thus produced are prefabricated microparticles according to the present invention. In one embodiment, a gel former may be used to form the aqueous droplets / prefabricated microparticles, such gel former being as further defined above. In one embodiment, the aqueous droplets containing the gel former are dried, preferably freeze-dried. Alternatively, any other suitable means of removing the solvent may be used. Once the solvent has been removed and the aqueous droplets / produced microparticles are dried, they may be stored as a powder. The inventors have surprisingly found that by providing prefabricated microparticles according to the invention, it is possible to provide miniaturized and defined reaction spaces that can be used in a very versatile way for detection reactions, for example for performing digital detection of analytes in a sample. The prefabricated microparticles, according to embodiments of the invention, can be individually adapted by selecting a suitable capture agent that surrounds the microparticle and selectively and specifically binds the analyte to be detected when exposed to a sample containing the analyte. Due to their defined size, the microparticles take up a defined volume of liquid and thus make it possible to perform any (detection) reaction in a defined volume of liquid. In effect, the particles provide an efficient and easy means of dividing a sample suspected of containing the analyte to be detected into well-defined small volumes.Microparticles according to embodiments of the present invention also provide a facile means of selectively concentrating and / or concentrating the analyte to be selectively detected on the surface of the microparticle. If necessary, they further allow the achievement of a uniform standardized concentration of the analyte resulting from different samples having different volumes and different starting concentrations of the analyte. Different microparticles can be specific for different analytes to be detected by the selection of the appropriate capture agent(s). Furthermore, different microparticles can be specifically labeled according to embodiments of the present invention according to their respective specificities of the analyte to be detected, so that different microparticles and their corresponding detected analytes can be distinguished by the specific labeling of the microparticles. Such specific labeling and the distinction that can be achieved thereby are sometimes referred to herein as "encoding". "Encoded" microparticles are microparticles that have been made specific with respect to their binding ability to a particular analyte and thus also specifically marked or labeled. According to one embodiment, the prefabricated microparticles are made of a gel-forming agent. In one embodiment, the gel-forming agent can exist in two different states, one state being a solid or semi-solid state and the other state being a liquid state. In one embodiment, in the solid or semi-solid state, the gel former is present in the form of a gel that forms a matrix, and with such gel, the microparticles can be in the form of a suspension, for example, in which the microparticles comprise a volume of aqueous solution and are dispersed in a non-aqueous medium, such as an oil medium. In effect, in this state, the microparticles represent aqueous droplets reinforced by the matrix formed by the gel former / gel. As further outlined above, such a matrix defines the surface and void volume of the microparticles. In a further embodiment, the gel former can be transferred from a solid / semi-solid state to a liquid state upon application of a suitable stimulus. Such a stimulus can be, for example, the application of heat or light, or can include changes in pH, redox potential, ionic strength, temperature, magnetic field or electromagnetic radiation.Alternatively, such an external stimulus may be exposure to an enzyme (e.g., capable of digesting the matrix formed by the gel former), or, if the gel former itself contains an enzyme, such a stimulus may be exposure to a substrate for such an enzyme. Also, a combination of any of the aforementioned stimuli is envisioned. When the gel former is transferred from a solid / semi-solid state to a liquid state, it results in aqueous droplets in a non-aqueous medium (e.g., oil). As long as the gel former is in a solid / semi-solid state, the microparticles are in the form of a suspension of such solid / semi-solid particles in a non-aqueous phase. When the gel former is liquefied, the microparticles are in the form of an emulsion of an aqueous phase in a non-aqueous phase.

[0059] Prefabricated microparticles according to embodiments of the present invention are particularly storable in a dry or desiccated state, preferably for a period of at least 2 months, more preferably for a period of at least 6 months. In one embodiment, they are storable for a period of at least 1 year. In one embodiment, prefabricated microparticles according to the present invention may contain one or several stabilizers that help preserve the microparticles. Examples of such stabilizers are cyclodextrins (e.g., Cavasol®), trehalose, sucrose, lactose, mannose, glucose, galactose, mannitol, myo-inositol, poly(alkylene oxides), in particular poly(ethylene glycol) and their derivatives. The term "prefabricated" is used herein to distinguish the microparticle(s) according to the present invention from other microparticles obtained from the prior art that may possibly be used for detection purposes, in that the prefabricated microparticle(s) according to the present invention are not particles(s) that are made at the time and / or place of their intended use. Thus, the prefabricated microparticles according to the present invention are not particles that are generated in situ, i.e., particles that are not generated in the course of a reaction, e.g., an analytical assay, in which they are intended to be used. In particular, they are not generated at the place or time or reaction at or during when analyte detection is performed. The term "in-situ generated" is intended herein to refer to a material or particle that is generated from one or more precursors at the place and / or time of the intended use of such material or particle. Furthermore, the prefabricated microparticles according to the present invention are not particles that are manufactured to include or contain or incorporate or entrap an analyte-containing sample at the time of generation. Rather, the prefabricated microparticles according to the present invention are first generated and, if necessary, further processed, e.g., washed, dried, reconstituted, etc., and only after their generation, the prefabricated microparticles according to the present invention are then exposed to a sample that contains or is suspected to contain an analyte.

[0060] The term "microparticle" is intended herein to refer to particles having an average dimension in the micrometer range. In one embodiment, the microparticles according to the invention have an average size or average dimension or average diameter of approximately 5 μm to 200 μm, preferably 5 μm to 150 μm, more preferably 10 μm to 100 μm. In one embodiment, the microparticles according to the invention are spherical or ovoid or ellipsoidal, preferably spherical, and the above dimensions refer to the average diameter of such spherical, ovoid or ellipsoidal microparticles. In one embodiment, the microparticles according to the invention have the shape of a (spherical) droplet. In another embodiment, the microparticles according to the invention are spherical or quasi-spherical, i.e. have the shape of a sphere (or nearly so), and such spheres have an average diameter of the above dimensions. In one embodiment, the microparticles according to the invention are porous. In a further embodiment, the microparticles according to the invention, in particular the porous microparticles, have a surface that is available to accommodate the capture agent, in that the capture agent is mainly located on the surface of the microparticle. In one embodiment, the surface of a porous spherical microparticle according to the invention having a defined diameter is x times that of a non-porous microparticle having the same diameter, where x is selected from at least 2, at least 5, at least 10, at least 50, at least 100 or at least 500. In such porous spherical microparticles according to the invention, the density of capture agent per microparticle is greatly enhanced, allowing a particularly efficient concentration of the analyte to be detected at the surface of the microparticle, since the density of capture agent on the surface of the microparticle is also particularly high.

[0061] The microparticle(s) according to the embodiments of the present invention are also characterized by the fact that, when made or when used, they do not incorporate or contain or include biological cells. Similarly, when made or when used, they also do not contain or incorporate or include analytes within them. Rather, any analyte to be detected by the prefabricated microparticles according to the present invention is selectively and specifically bound by the prefabricated microparticles at their surface, the analyte being located in or originating from the sample surrounding the prefabricated microparticles. Thus, in one embodiment, the microparticles according to the present invention contain a capture agent that selectively and specifically binds the analyte to be detected when the microparticles are exposed to a sample that surrounds the microparticles and contains the analyte, and the capture agent binds the analyte from the sample surrounding the microparticles (but not the analyte from the sample located within the particle). In one embodiment, the microparticles contain a capture agent that is primarily located on the surface of the microparticles, and as a result, the microparticles are therefore capable of concentrating and concentrating the analyte located outside the microparticles. The term "predominantly located", when used in conjunction with a capture agent located on the surface of a microparticle, is intended to refer to a scenario in which the majority of such capture agent molecules are located on the surface of the microparticle rather than in its interior. As used herein, the term "surface" is intended to refer to the portion of the microparticle that is accessible from the outside of the microparticle. Similarly, as used herein, the term "interior of the microparticle" is intended to refer to the portion of the microparticle that is not accessible from the outside of the microparticle. In one embodiment according to the present invention, the microparticles according to the present invention do not encapsulate or contain an analyte or biological cell or microorganism, e.g., bacteria, and therefore do not contain such analyte in their interior.

[0062] According to an embodiment of the present invention, microparticles have an inherent (limited) capacity to contain or accommodate capture agents. Thus, in one embodiment of a collection of microparticles, preferably, each microparticle will have approximately the same density of capture agents, i.e., the same number of capture agents per unit surface of the microparticle. This allows the microparticles to concentrate and concentrate analytes to approximately the same concentration, even when various samples with different concentrations of analytes are used. Thus, the prefabricated microparticles according to an embodiment of the present invention also preferably allow the generation of multiple identical reaction spaces / volumes with uniform concentration of analytes on the surface of the microparticles after the microparticles are exposed to a sample containing analytes.

[0063] As used herein, the term "digital detection", when used with microparticles according to the present invention, refers to a scenario in which the ratio of the number of microparticles to the number of analyte molecules is adjusted so that the bound single analyte molecule per microparticle is maximal and the binding of single analyte molecules per microparticle follows a Poisson distribution. Alternatively or additionally, the term "digital detection", when used with microparticles according to the present invention, refers to a scenario in which a sample is divided by a collection of microparticles according to the present invention, such that each microparticle provides the same reaction volume and reaction conditions, and preferably also contains approximately or exactly the same number of analyte molecules. In the latter scenario, the microparticles thus serve to create multiple similar reaction spaces (e.g. detection spaces) for each analyte species to be detected, in which the individual concentrations of the analytes are preferably identical (or nearly identical within a tolerance) between the various microparticles. Thus, the microparticles, according to an embodiment of the present invention, allow the generation of multiple identical reaction microspaces in which, for each type of microparticle, preferably, identical or nearly identical analyte concentrations and / or reaction conditions are achieved. The latter scenario is particularly interesting under conditions when the concentration of the analyte in the sample is sufficiently high. The former scenario (at most one analyte bound per microparticle) is particularly applicable when the concentration of analyte in the sample is rather low. In one embodiment, the present invention also relates to the use of prefabricated microparticles as further defined above for providing multiple identical or nearly identical reaction spaces, providing identical reaction volumes and identical reaction conditions, e.g., for carrying out detection reactions.

[0064] In one embodiment, in a collection of prefabricated microparticles according to the present invention, all microparticles are of the same size, and therefore each such prefabricated microparticle provides and defines the same reaction volume, which serves as, for example, a reaction space for a detection reaction. In one embodiment, in a collection of prefabricated microparticles according to the present invention, all microparticles are of the same type and are specific for the detection of one analyte. In another embodiment, in such a collection of prefabricated microparticles according to the present invention, there are various types of microparticles, each type being specific for the detection of a different analyte. The latter collection of microparticles according to the present invention is particularly useful for the detection of multiple (different) analytes in one or several samples. In this specification, the term "prefabricated microparticles" may also be used interchangeably with the term "digital amplification beads" (also abbreviated as "DAB"). In one embodiment, in a collection of prefabricated microparticles according to the present invention, such prefabricated microparticles exist as entities that are completely spatially separated from each other. In one embodiment, in such a collection of prefabricated microparticles according to the present invention, such collection is therefore monodisperse. If necessary, such a collection of monodisperse prefabricated microparticles may be provided with the prefabricated microparticles located on or associated with a substrate. For example, such a substrate may be a sieve with individual wells providing just enough space to accommodate a single prefabricated microparticle per well. Alternatively, such a substrate may be a substrate with regularly arranged recesses or channels or grooves for accommodating each prefabricated microparticle. In one embodiment, such a substrate may be a filter. In one embodiment, the prefabricated microparticles containing an aqueous solution and dispersed / suspended in a non-aqueous phase may be subjected to one or several washing steps. To this extent, they may be maintained on the above-mentioned types of substrates. Alternatively and / or additionally, the prefabricated microparticles according to the present embodiment may then be exposed to a sample containing or suspected to contain an analyte.A suitable capture agent present on the prefabricated microparticles allows the analyte originating from the sample surrounding the microparticle to bind to the microparticle and then be detected. The purpose of the capture agent is to locally concentrate and concentrate the analyte outside the microparticle. The purpose of the detection agent is to bind to the analyte or the complex between the capture agent and the analyte, thus making such analyte detectable alone or in complex with the capture agent. In one embodiment, such detection occurs by detecting the detection agent bound to the analyte or to the complex between the capture agent and the analyte. In another embodiment, the analyte is amplified by an amplification reaction and the thus amplified product is detected by the detection agent, which is particularly preferred when the analyte is a nucleic acid and the amplification reaction is a nucleic acid amplification reaction. Examples of such nucleic acid amplification reactions include polymerase chain reaction (PCR), transcription-mediated amplification (TMA), nucleic acid sequence-based amplification (NASBA), loop-mediated isothermal amplification (LAMP), self-sustained sequence replication (3SR), strand displacement amplification (SDA), rolling circle amplification (RCA), ligase chain reaction (LCR), recombinase polymerase amplification (RPA) and nicking enzyme amplification reaction (NEAR). Those skilled in the art are familiar with any of these amplification reactions and can perform them as needed. In a further embodiment, detection of the analyte can occur by first performing a signal amplification reaction and then detecting the signal thus amplified. In the latter embodiment, the signal is amplified only if there is a signal initially, i.e., the signal occurs only if there is an analyte to be detected, and the signal amplification reaction can be, for example, a nucleic acid amplification where a nucleic acid is or forms part of the detection agent. Alternatively, the signal amplification reaction can be an enzyme-based amplification of the signal where an enzyme is or forms part of the detection agent.

[0065] In a preferred embodiment of the method for carrying out digital detection of an analyte in a sample, a collection of prefabricated microparticles according to the present invention is exposed to a sample suspected of containing the analyte to be detected, and in such an exposure step, the number of microparticles and the number of analyte molecules in the sample are maintained and adjusted as necessary so that the binding of a single analyte molecule per microparticle preferably follows a Poisson distribution. In a preferred embodiment of this method, on average, no more than one analyte molecule is bound per microparticle. This allows the detection of a single analyte molecule per microparticle. In another embodiment, the number of analyte molecules per microparticle is maintained and adjusted as necessary so that, on average, in each microparticle, there is the same number of analyte molecules bound per microparticle. In this latter embodiment, the microparticles thus serve to create a plurality of similar detection spaces for carrying out the detection reaction. Reference is now made to the drawings. [Brief description of the drawings]

[0066] [Figure 1] FIG. 1 shows a schematic diagram of a prefabricated microparticle according to an embodiment of the present invention. Panel A shows an external view of a prefabricated microparticle (large grey circle) on which some capture agent molecules (small filled circles) are immobilized. The prefabricated microparticle has a matrix capable of capturing an aqueous solution containing reaction reagents for any reaction in which the prefabricated microparticle according to the present invention is to be used. Panel B shows an embodiment of a prefabricated microparticle having pores. Panel B shows an embodiment in which the prefabricated microparticle according to the present invention is porous with some pores, some of which are accessible from the outside and some of which are not. Again, the capture agent molecules are shown as small filled circles. The capture agent molecules are mainly located on the surface of the microparticle, such surface referring to the part of the microparticle that is accessible from the outside of the microparticle. According to an embodiment of the present invention, such term "accessible" refers to the accessibility by or to the analyte to be detected. The prefabricated microparticle according to the present invention may be used in detection or quantification reactions, for example digital detection reactions.

[0067] [Diagram 2] FIG. 2 shows a schematic flow diagram of a detection reaction according to the invention. A sample liquid containing an analyte is added to a vessel containing prefabricated microparticles according to the invention (such prefabricated microparticles are shown in the figure as white circles at the bottom of a reaction vessel). Prefabricated microparticles according to the invention (sometimes referred to herein as digital amplification beads, "DAB") are exposed to an analyte (optionally labeled) and then transferred to a new reaction vessel after binding the analyte by a capture agent. Prefabricated microparticles according to an embodiment of the invention contain a suitable capture agent, e.g., streptavidin, capable of binding to an analyte of interest, in this example a biotinylated analyte of interest. Prefabricated microparticles according to the invention are placed on a sieve or filter on top of a reaction vessel and washed with an appropriate wash buffer to remove unbound analyte. Prefabricated microparticles according to the invention thus contain an aqueous solution and, if the capture agent of the prefabricated microparticles according to the invention has bound the analyte, also contain the corresponding analyte on the surface. The prefabricated microparticles according to the present invention remaining on the sieve or filter are then immersed in an oil phase, e.g., immersion oil. The sieve or filter is then turned upside down and the prefabricated microparticles containing the aqueous phase with the analyte are washed with additional immersion oil to produce a suspension of prefabricated microparticles (containing an aqueous solution with the analyte) in an oil phase, in this case the immersion oil, which is used for washing the prefabricated microparticles from the sieve or filter. The microparticles according to the present embodiment also contain a detection agent that allows for the detection of the analyte in a subsequent detection reaction. Such a subsequent detection reaction is then carried out, as a result of which certain microparticles indicate the presence of the analyte, while others do not. The microparticles indicating the presence of the analyte are shown in the figures as dark filled circles, while the microparticles indicating a negative result are shown as open circles.

[0068] [Diagram 3]FIG. 3 shows a similar reaction to that shown in FIG. 2, but at the level of individual microparticles. On the left side, prefabricated microparticles according to an embodiment of the present invention are shown, which are shown as open circles. There are capture agent molecules located mainly on the surface of the microparticle and on the outside surrounding the microparticle, and there are nucleic acids (squiggly lines), some of which are labeled with a suitable agent, for example, biotin (squares). The capture agent molecules contain another complementary agent, in this embodiment, for example, streptavidin (the negative type of the square shown on the "pearl" capture agent decorated on the surface of the microparticle), and the nucleic acid labeled with biotin (square) binds to the respective capture agent. Biotin and streptavidin may also be exchanged, i.e. it is clear that biotin is contained by the capture agent and streptavidin is attached to the nucleic acid. Unlabeled nucleic acids do not bind and can be washed away in a subsequent washing step (see FIG. 2). Each microparticle containing solution is then mixed with oil, and any aqueous solution that is not embedded in the particle is removed from the oil phase. Thus, a suspension of particles in a non-aqueous matrix (shown in the figure as a square box) remains. In this embodiment, the material that makes the prefabricated microparticles according to the present invention can also be liquefied, and when such liquefaction occurs (see the right square box in the figure), after placing the microparticles in a suitable oil phase, it generates a micro-reaction space that contains an aqueous solution containing the analyte to be detected and a detection reaction in the oil phase (the right square box in Figure 3).

[0069] [Figure 4]FIG. 4 shows different color-coded / labeled prefabricated microparticles (or digital amplification beads, "DAB") that are marked with different dyes. Such differential labeling may be achieved by choosing either different dye types or different dye concentrations for the different prefabricated microparticles. This is shown diagrammatically in the right panel (B) by showing different microparticles according to the invention that have different amounts of dye and are specific for different analytes. Such "coding" may be related to the capture agent specificity or detection agent specificity of the individual microparticles.

[0070] [Diagram 5] 5 shows examples of prefabricated microparticles according to the present invention. Panel A shows a 5x magnified transmission image of prefabricated microparticles containing an aqueous phase in an oil phase. Panel B shows a 5x magnified transmission image of prefabricated microparticles containing an aqueous phase in a phosphate buffer saline solution (PBS). In both panels, it can be seen that the prefabricated microparticles are uniform in size, providing multiple identical reaction volumes / reaction spaces for carrying out detection reactions.

[0071] [Figure 6] FIG. 6 shows a 5× magnified fluorescent image (with an excitation wavelength of 490 nm and an emission wavelength of 510 nm) of prefabricated microparticles in the oil phase after PCR amplification reaction has been carried out. The prefabricated microparticles were produced as described in embodiment 2 of the examples herein. As can be clearly seen, there are prefabricated microparticles with bright fluorescent signals, and there are other prefabricated microparticles that show low flux fluorescent signals. In the microparticles with bright fluorescent signals, successful amplification of the analyte has occurred, in the case of this nucleic acid, as indicated by the bright fluorescent signal. In the other microparticles, no amplification reaction has occurred, as indicated by the absence of fluorescence or a relatively low (lower) fluorescent signal resulting from background fluorescence of the probe (e.g., TaqMan probe) used here. EXAMPLES

[0072] Additionally, reference is now made to the following specific examples, which are given to illustrate but not to limit the invention.

[0073] Example 1: Creation of monodisperse digitally amplified beads (DABs) Preparation of DAB mix Component 1: Deionized water, nuclease free Ultra-low gelling agarose (Sigma-Aldrich, no. A5030), biotinylated 2% (w / v)

[0074] To prepare biotin-labeled agarose, ultra-low gelling temperature agarose was first activated and then coupled to EZ-Link™ Amine-PEG11 biotin. Alternatively, activation may be performed by cyanogen bromide modification, mild oxidation (creating aldehyde groups), carbonyldiimidazole (CDI), di- or trichlorotriazine compounds, or other known methods. Alternatively, reactive biotin compounds, such as biotin-monochlorotriazine, may be directly coupled to agarose. The optimal biotin coverage is determined by titration in preliminary tests to maximize streptavidin binding capacity while maintaining the matrix properties of agarose (melting and gelling behavior, low non-specific binding).

[0075] The components of component 1 are pipetted together, briefly shaken on a vortex mixer, and centrifuged. The mixture is then incubated in a thermoshaker at 65° C. and 1500 rpm to melt the ultra-low gelling agarose and obtain a homogenous agarose amplification mixture. The component 1 mixture is then cooled to 35° C. and mixed with an equal volume of component 2 maintained at the same temperature.

[0076] Component 2 consists of 2x Platinum™ Hot Start PCR Master Mix (Invitrogen, number 13000012. The DAB mixture is then kept at 35°C until further use.

[0077] Preparation of monodisperse DABs with the Dolomite μEncapsulator system 5 mL of emulsion reagent PicoSurf™ 5% in Novec7500 oil (Dolomite Microfluidics) is filtered through a 0.2 μm filter and transferred to a clean 20 ml glass tube (Fisher Scientific, no. 12353317) and placed into the reservoir of the pump that controls the flow of the oil phase (oil phase pump). Two other pumps that control the flow of the agarose phase (DAB mix pumps) are filled with an inert "drive fluid" HFE-7500 (Dolomite Microfluidics, no. 3200425).

[0078] The "Reagent Droplet Chip" (50 μm, fluorophilic Dolomite Microfluidics, no. 3200445) and the "Sample Reservoir Chip" (Dolomite Microfluidics, no. 3200444) are placed into the μEncapsulator 1 system. The setpoint temperature of the Temperature Control Unit (TCU) is set to 35° C. A volume of 100 μl of DAB mix is ​​added to each reservoir of the sample reservoir chip. Droplets are generated using a flow rate of approximately 2 μl / min for both DAB mix pumps and approximately 50 μl / min for the oil phase pump. Parameters are monitored using Dolomite Flow Control Advanced software. The generated DAB has a volume of approximately 65 pl. The material is collected in Eppendorf tubes on ice and then stored at 2-8° C.

[0079] DAB migration into the aqueous phase and exclusion of non-compliant particles The DAB is extracted from the oil phase by centrifugation through the sieve structure. Thus, beads of abnormal size are removed. For this purpose, the DAB emulsion is first applied to a tube with SEFAR PETEX® fabric (w=44 μm) and centrifuged at 300×g. The oil phase and undersized DAB are displaced through the sieve while the larger DAB remain on the SEFAR fabric. To completely remove the oil phase, the DAB is resuspended in a washing buffer and filtered again through the SEFAR sieve. The washing buffer used consists of 1× Taq DNA polymerase PCR buffer [20 mM Tris HCl (pH 8.4), 50 mM KCl] (Invitrogen, no. 18067017) and 1% TritonX100 (Sigma-Aldrich, no. X100). This washing step is repeated five times until the oil phase is completely removed. Two further washing steps are carried out with 1× Taq DNA polymerase buffer without detergent. The DAB is collected by applying the filter unit in the opposite orientation in a suitable centrifuge tube. The wash buffer is applied to the back side of the filter (the side facing away from the particles) from the top. The filtration unit is centrifuged at 1.000 x g for 1 minute. This step is repeated several times to collect all the particles. Oversized DAB is filtered out by pipetting the entire volume onto a filter with SEFAR PETEX® tissue, mesh width w=59 μm (SEFAR AG, 07-59 / 33). The unit is centrifuged briefly at 300 x g. The material that passed through the filter is collected and contains the DAB of the desired size.

[0080] Coating of DAB with streptavidin Coating of the DAB with streptavidin is accomplished in the previously used washing buffer. The concentration of streptavidin is selected so that no accessible biotin remains on the surface of the DAB. In any case, streptavidin is applied in excess to avoid cross-linking of the DAB. The optimal streptavidin concentration has been determined in preliminary tests with labeled streptavidin by determining the plateau surface coverage. After coupling with streptavidin, the DAB is washed several times with washing buffer without streptavidin on a 44 μm SEFAR PETEX centrifugation unit. The concentration of the DAB is then determined by counting under a microscope in a DHC-N01 (Neubauer Improved) counting chamber (INCYTO) or cytometrically on a CytoFlex flow cytometer (Beckman Coulter).

[0081] The DAB is aliquoted into units containing approximately 100,000 beads and mixed with 100 mM trehalose. After removing excess buffer volume, the DAB is lyophilized.

[0082] Example 2: Application of monodisperse amplification beads (DAB) to perform digital PCR Enrichment of HIV-1 (subtype O) targets with DAB and incubation of these beads with the amplification mix Purified HIV-1 RNA (subtype O), labeled with biotin by reverse transcription, is enriched on streptavidin-modified digital amplification beads. The entire volume of the reverse transcription reaction is added to a defined amount of lyophilized DAB. The DAB absorbs part of the applied liquid and swells. The beads are carefully resuspended. Ultrasonication may be used to avoid clumping. The suspension is then applied to a centrifuge tube equipped with a SEFAR PETEX® tissue (w=44 μm). The supernatant is removed by centrifugation of the column at 300×g. For washing, the washing buffer used previously is added to the column without detergent and is centrifuged at 300×g as well. The washing is repeated several times and the DAB is finally incorporated into component 3. In this embodiment, the DAB incorporates all the components necessary for PCR by diffusion. Component 3 consists of the following reagents (final concentrations): 1x Platinum™ Hot Start PCR Master Mix (Invitrogen, product code 13000012) 0.2 μM sense primer: GCAGTGGCGCCGAACAGG (Metabion international AG) ○0.2μM antisense primer 1:ACTGACGCTCTCGCACCCATCT (Metabion international AG) 0.2 μM antisense primer 2: TGACGCTCTCGCACCCATCTCTC (Metabion international AG) 1x SYBR® Green I Nucleic Acid Gel Stain (Sigma-Aldrich, no. S9430) or 1x EvaGreen® Fluorescent DNA dye (Jena Bioscience, no. PCR-352)

[0083] Compartmentalization by dispersing DAB in oil Microcompartments with defined volumes are created by dispersing DAB in a fluorocarbon oil, e.g., PicoSurf™ 5% dispersed in Novec 7500 oil (Dolomite Microfluidics, no. 3200214). Instead of heavy fluorocarbon oil, a light mineral oil with an emulsifier may be applied, e.g., mineral oil with 5% (w / w) Span 80 (Sigma Aldrich, no. 85548) (Sigma-Aldrich, no. M5904 Sigma).

[0084] The complete aqueous phase is contacted with excess oil in an Eppendorf tube. Ultrasonication is applied for 1 min. Both the DAB loaded with HIV-1 subtype O targets and the supernatant of component 3 are dispersed and emulsified in the oil phase. The generated aqueous droplets of the supernatant of component 3 and the DAB differ significantly in their volume, with the droplets having a much smaller volume. The generated emulsion is pipetted onto a SEFAR PETEX® tissue with a mesh width of 44 μm. Smaller droplets that may not contain DAB as well as larger droplets are removed by mild centrifugation. All liquid droplets are removed by repeated washing with the same oil. The concentrated DAB is extracted from the sieve by introducing the filter unit in the opposite orientation into a suitable centrifuge tube. The oil with DAB is removed by centrifugation through approximately 2 cm. 2 The beads are transferred to a detection chamber with an area of ​​100 nm and a layer thickness of approximately 1 mm. Both sides of the chamber are made of transparent hydrophobic material. When fluorocarbon oil is used, the DAB assemble as a monolayer (close-packed) on the hydrophobic upper surface due to the density difference between the beads and the oil. When mineral oil is applied, the DAB accumulates on the lower surface. The DAB thus provide a microreaction vessel for the subsequent digital PCR.

[0085] Amplification reactions in DAB microcompartments DAB suspended in oil is subjected to temperature cycling in the same chamber with a PELTIER element 30x30x4.7mm, 19.3W (Quick-Ohm, Kupper&Co. GmbH, no. QC-71-1.4-3.7M). The captured cDNA is internalized upon melting of the agarose and conversion of the DAB into liquid droplets. Amplification of individual cDNA molecules occurs in the resulting microreaction compartments. The applied thermal conditions are as follows:

[0086] Initial denaturation at 95°C for 2 min, followed by 45 cycles of denaturation at 95°C for 15 s, annealing at 65°C for 15 s and extension at 72°C for 30 s. Upon completion of the thermal protocol, the chamber contents are imaged at 21°C in fluorescence mode with transmitted white light and excitation λexc=470 nm and long pass emission >496 nm. The total number of DABs and the number of those with a fluorescent signal above a defined intensity threshold are determined. The threshold is derived from a template-free amplification reaction previously performed. The number of templates in the reaction is determined by applying Poisson statistics to the determined number of positive and negative droplets.

[0087] Example 3: Establishment of a digital ELISA Here, we describe the process of establishing a digital immunoassay for the detection of human cTnI. The assay uses a digital format of immuno-PCR: a DNA-labeled detection antibody and a streptavidin-labeled capture antibody form a sandwich complex with an antigen in solution. This complex is captured on biotin-coated agarose particles in which the reagents for carrying out PCR amplification are embedded. Appropriate washing steps remove the unbound detection antibody and therefore the DNA label. The agarose particles are suspended in oil, so that separate reaction compartments are formed. In a subsequent droplet PCR, the bound DNA label is detected.

[0088] Detection antibody The cTnI detection antibody (clone 3H9, SDIX) is labeled and then purified using the Thunder-Link® PLUS Oligo Conjugation System (Innova Bioscience) according to the manufacturer's protocol. The following sequence is coupled to the antibody: 5'GCGTCAGACCCCGTAGAAAAGATCAAAGGATCTTCTTGAGATCCTTTTTTTCTGCGCGTAATCTGCTGCTTGCAAACAAAAAAACCACCGCTACCAGCGGTGGTTTGTTTGCCGGATCAAGAGCT3'

[0089] Capture antibody: Clone TPC-110 (SDIX) was used as the capture antibody, which was then coupled with Lightning link streptavidin (Innova) according to the manufacturer's protocol. The chromosomes were marked by the National Institute of Biosciences.

[0090] Preparation of DAB DAB was prepared according to the method described in Example 1, with the following modifications: In an exemplary embodiment, biotin-labeled agarose particles are transferred to the aqueous phase, and after excluding unsuitable particle sizes, the particles are collected in 1×PCR buffer. The particle concentration is adjusted to about 4.000 / μl. The particles are aliquoted in 25 μl portions.

[0091] Immune complex formation and capture: Reaction mix: Human plasma 80μl TBS(K) pH8.4 (20mM Tris, 50mM KCl pH8.4), 0.5% TritonX-100, 10mg / ml BS 10μl HBR-Plus (Scantibodies) 10μl DNA-labeled detection antibody x μl Streptavidin-labeled capture antibody yμl

[0092] Optimize antibody concentration: The optimal concentration of detection and capture antibodies is determined by conventional immuno-PCR. The concentration of the two antibodies is systematically varied, and immune complexes are prepared using troponin-free plasma (negative control) and troponin-free plasma with a defined amount of added troponin I. These are captured on particles, washed, and subjected to conventional PCR. The optimal concentration of each antibody is indicated by the lower limit of detection and the widest dynamic measurement range.

[0093] Immune complex generation and capture: Prepare 25 μl of reaction mixture (see above) using previously determined optimal concentrations of the two antibodies. Incubate the reaction mixture for 10 min at 800 rpm and 37° C. in an Eppendorf Thermomixer. Then mix with an aliquot of DAB particles (100,000 particles in 25 μl of 1×Taq polymerase buffer).

[0094] The mixture is incubated for 5 min at 800 rpm and 25° C. in a thermomixer. During this time, binding of the streptavidin-labeled capture antibody containing the immune complex with the DAB is achieved. The liquid is applied to a filter with SEFAR PETEX® tissue (w=44 μm) and centrifuged at 300×g. Five washing steps are performed with 500 μl TBS(K) pH 8.4 (20 mM Tris, 50 mM KCl pH 8.4), 0.05% TritonX-100, 1 mg / ml BSA. Then, two further washing steps are performed with 1×Taq DNA polymerase PCR buffer [20 mM Tris HCl (pH 8.4), 50 mM KCl].

[0095] Prepare a PCR reaction mixture (volume 25 μl) with the following composition: 500 nM fw-primer (5'AGCTCTTGATCCGGCAAACA3') 500 nM rev-primer (5'GCGTCAGACCCCGTAGAAAA3') SYBR® Green I Nucleic Acid Gel Stain (Sigma-Aldrich, no. S9430) 1:25000 12,5 μl 2x PCR-Master Mix PCR grade water

[0096] The DAB is recovered from the sieve by placing the filter in an opposite orientation in a tube. The PCR reaction mix is ​​applied to the filter. The unit is then centrifuged at 1000 x g for 1 minute. The DAB is collected at the bottom of the centrifuge tube and then incubated in the PCR reaction mix for 10 minutes at 800 rpm and 25 °C in a thermomixer.

[0097] Performing the PCR reaction DAB is transferred to the oil phase as described in embodiment 2. PCR amplification is carried out for 40 cycles with the following parameters: Cycle 1: 5 minutes 95℃ 30 seconds 65℃ 30 seconds 72℃ Cycles 2-40: 30 seconds 94℃ 30 seconds 65℃ 30 seconds 72℃

[0098] After completing the amplification, the SYBR green signal of individual particles is detected by fluorescence microscopy. Data analysis is performed according to established algorithms for digital PCR.

[0099] Determining the optimal dynamic measurement range The non-specific binding of DNA-labeled detection antibodies to DAB represents a critical parameter that limits the applicability of digital immuno-PCR. Non-specifically bound labels result in false-positive DAB after amplification. Therefore, in digital immuno-PCR, quantification of the analyte is achieved by determining the difference between the positive sample and the negative control.

[0100] In one extreme scenario, non-specific binding of the detection antibody may lead to a large proportion of DABs having false positive signals in control reactions without analyte. This is mitigated by reducing the effective concentration of the detection antibody, either by gradually reducing the concentration of the detection antibody in the assay, or by maintaining the antibody concentration by increasing the dilution of the DNA-labeled detection antibody with the same antibody without the DNA label.

[0101] Further modifications of the preferred embodiments are possible without departing from the scope of the invention, which is defined solely by the claims.

[0102] The features of the invention disclosed in the specification, the claims and / or the accompanying drawings may, both separately and in any combination thereof, be material for the realization of the invention in diverse forms thereof. In an embodiment of the present invention, for example, the following items are provided: (Item 1) 1. A method for performing detection, preferably digital detection, of an analyte in a sample, comprising: a) providing pre-fabricated microparticles having a surface and including a void volume for receiving an aqueous solution, said microparticles being dispersible in a non-aqueous medium and, upon dispersion in the non-aqueous medium, providing a defined reaction space in such non-aqueous medium in which a chemical or biochemical reaction indicative of the presence of an analyte can be carried out, said pre-fabricated microparticles including a capture agent surrounding said pre-fabricated microparticles and, upon exposure of said microparticles to a sample containing an analyte, selectively and specifically binds to the analyte to be detected and forms a complex between said capture agent and said analyte upon binding of said analyte to said capture agent, said capture agent binds to an analyte from a sample surrounding said pre-fabricated microparticles, said pre-fabricated microparticles further including a detection agent that is specific for said analyte or the complex between said capture agent and said analyte and binds to said analyte or the complex between said capture agent and said analyte; b) exposing the prefabricated microparticles to an aqueous sample suspected of containing the analyte to be detected, thus allowing the capture agent, if present, to selectively and specifically bind to the analyte to be detected; c) placing the prefabricated microparticles in a non-aqueous phase, e.g., an oil phase, and measuring the void volume of the prefabricated microparticles to determine whether a chemical or biochemical reaction indicative of the presence of an analyte occurs; d1) detecting a detection agent bound to the analyte or to the complex between the capture agent and the analyte; or d2) amplifying said analyte, if present, by an amplification reaction and detecting the product thus amplified by said detection agent, wherein said analyte is a nucleic acid and said amplification reaction is a nucleic acid amplification reaction, such as, for example, PCR, TMA, NASBA, LAMP, 3SR, SDA, RCA, LCR, RPA, NEAR, etc. or d3) carrying out a signal amplification reaction, e.g. a nucleic acid amplification, if a nucleic acid is part of or forms part of the detection agent, or an enzyme-based amplification of a signal, e.g. in the form of a label, such as a dye or fluorophore, if an enzyme is part of or forms part of the detection agent, and detecting the signal thus amplified. and using the reaction space as defined by any one of the following steps: A method comprising: (Item 2) 2. The method of claim 1, wherein said prefabricated microparticles are provided as dried, preferably lyophilized, prefabricated microparticles. (Item 3) 3. The method according to any of items 1 to 2, wherein said prefabricated microparticles are not in situ generated microparticles, preferably not in situ generated microparticles at or during the time when analyte detection is performed or in situ generated in the reaction. (Item 4) 20. The method of any preceding claim, wherein the capture agent is located primarily on the surface of the prefabricated microparticles such that the prefabricated microparticles are capable of concentrating and focusing analytes located outside the microparticles. (Item 5) 5. The method according to any of items 2 to 4, wherein said prefabricated microparticles are preferably reconstituted in an aqueous solution during either step a) or step b) and receive such aqueous solution in their void volume upon reconstitution. (Item 6) 6. The method of any of the preceding items, wherein the detection agent is included in the prefabricated microparticles during a prefabrication process or is included in the aqueous solution of item 5 and thus becomes part of the prefabricated microparticles upon reconstitution. (Item 7) The method of any of the preceding claims, wherein the prefabricated microparticles are made of a gel former, which is preferably liquefiable upon application of heat or light, or upon a change in pH, redox potential, ionic strength, temperature, magnetic field or electromagnetic radiation, or upon exposure to an enzyme, or, if the gel former itself comprises an enzyme, to a substrate for such enzyme, or any combination of the foregoing. (Item 8) 8. The method of claim 7, wherein the gel forming agent forms a matrix that defines the surface and the void volume of the microparticles. (Item 9) The gel forming agent is a) synthetic polymers prepared from methyl acrylate and its corresponding monomers such as acrylates, acrylamides and methacrylamides, cyclic lactams, styrene-based monomers, etc.; b) Silicon-based polymers, such as polydimethylsiloxane and its copolymers; c) polysaccharides, such as agarose, chitin, chitosan, alginates, carrageenan, cellulose, fucoidan, laminaran; gums selected from xanthan gum, gum arabic, ghatti gum, guar gum, locust bean gum, tragacanth gum, karaya gum and inulin; naturally occurring polymers selected from polypeptides, such as albumin, collagen, gelatin, polynucleotides and combinations thereof. 9. The method according to any of items 7 to 8, selected from the group comprising: (Item 10) The method of any of the preceding items, wherein the capture agent is selected from an antibody or antibody fragment, a nucleic acid including an aptamer, a Spiegelmer; a receptor, a receptor fragment, an affinity protein, e.g. a non-antibody protein capable of specifically binding to the analyte or analyte complex, such as streptavidin. (Item 11) The method according to any of the preceding items, wherein said detection agent is selected from an antibody or antibody fragment, a nucleic acid including an aptamer, a spiegelmer; a receptor, a receptor fragment, an affinity protein, e.g. a non-antibody protein such as streptavidin, each of which is optionally labelled with a suitable reporter molecule, e.g. a dye, an enzyme, a chemical catalyst or a mixture of reagents capable of initiating a chemical reaction resulting in an optically or otherwise detectable signal indicative of the presence of said analyte to be detected. (Item 12) 2. The method of any preceding claim, wherein the prefabricated microparticles are specifically labeled. (Item 13) 13. The method of any of the preceding items, carried out using a collection of prefabricated microparticles, said prefabricated microparticles being as defined in any of the preceding items. (Item 14) Item 14. The method of item 13, wherein in the collection of prefabricated microparticles, the prefabricated microparticles differ from one another in that they are specific for different analytes to be detected, and each prefabricated microparticle is specifically labeled such that different prefabricated microparticles and their corresponding analytes to be detected can be distinguished by the specific label of the prefabricated microparticle. (Item 15) The method of any of the preceding items comprising the use of a pre-fabricated microparticle or a collection of pre-fabricated microparticles according to any of the preceding items for performing digital detection of an analyte or analytes in a sample, or for concentrating and concentrating a plurality of analytes in a plurality of defined volumes, preferably all of said defined volumes in said plurality of defined volumes being equivalent. (Item 16) 2. The method according to any of the preceding items, wherein the exposing step b) is followed by one or several washing steps. (Item 17) The method according to any of the preceding items, wherein in step a) the prefabricated microparticles are provided in a dried form and in step b) the prefabricated microparticles are reconstituted in an aqueous solution and then exposed to a sample suspected of containing the analyte to be detected, optionally with one or several washing steps after the reconstitution step. (Item 18) The method according to any of the preceding items, wherein in step b) the number of prefabricated microparticles and the number of analyte molecules in the sample are maintained and adjusted as necessary such that the binding of a single analyte molecule per prefabricated microparticle follows a Poisson distribution, preferably such that on average no more than one analyte molecule is bound per microparticle, thus allowing the detection of a single analyte molecule per prefabricated microparticle. (Item 19) The method according to any of the preceding items, wherein during step c), if present, the prefabricated microparticles or the collection of prefabricated microparticles are suspended in the non-aqueous phase and / or located on a solid substrate isolating each prefabricated microparticle from other prefabricated microparticles, preferably the solid substrate is a substrate having a pattern of filters, sieves, wells, recesses, grooves, channels, trenches, craters, holes, pillars or any combination of the foregoing. (Item 20) The method according to any of the preceding items, wherein during or after step c), the gel former is preferably liquefied through the application of heat or light, or by a change in pH, redox potential, ionic strength, temperature, magnetic field or electromagnetic radiation, or upon exposure to an enzyme, or, if the gel former itself comprises an enzyme, to a substrate for such enzyme, or any combination of the foregoing, resulting in aqueous droplets in a non-aqueous phase. (Item 21) 2. The method of any preceding claim, wherein the reaction space in which the chemical or biochemical reaction indicative of the presence of an analyte is carried out is defined by, and is not substantially larger than, the void volume of the prefabricated microparticles.

Claims

1. 1. A method for performing detection of an analyte in a sample, comprising: a) providing a prefabricated microparticle having a surface and comprising a void volume for receiving an aqueous solution, said microparticle being dispersible in a non-aqueous medium and upon dispersion in such non-aqueous medium providing a defined reaction space in such non-aqueous medium in which a chemical or biochemical reaction indicative of the presence of an analyte can be carried out, said prefabricated microparticle being free of a capture agent, said microparticle being a porous microparticle allowing for uptake of a liquid and an analyte present in said liquid from the surroundings to which said microparticle is exposed, said prefabricated microparticle further comprising a detection agent specific for said analyte, said detection agent binding to said analyte; b) exposing said prefabricated microparticles to an aqueous sample suspected of containing the analyte to be detected, thus allowing the capture of liquid and of the analyte present in said liquid in said porous microparticles, i.e. in the space provided by the pores of said microparticles; c) placing the prefabricated microparticles in a non-aqueous phase and measuring the void volume of the prefabricated microparticles to determine whether a chemical or biochemical reaction indicative of the presence of an analyte occurs; d1) detecting a detection agent bound to the analyte; or d2) amplifying said analyte, if present, by an amplification reaction and detecting the product thus amplified by said detection agent, said analyte being a nucleic acid and said amplification reaction being a nucleic acid amplification. or d3) carrying out a signal amplification reaction and detecting the thus amplified signal; and using the reaction space as defined by any one of the following steps: Including, the reaction space in which the chemical or biochemical reaction indicative of the presence of an analyte is carried out is defined by and is no larger than the void volume of the prefabricated microparticles; The method, wherein said prefabricated microparticles are made of a gel forming agent.

2. 2. The method of claim 1, wherein the non-aqueous phase in step c) is an oil phase.

3. 3. The method according to claim 1 or 2, wherein the nucleic acid amplification in step d2) is selected from PCR, TMA, NASBA, LAMP, 3SR, SDA, RCA, LCR, RPA and NEAR, and the signal amplification reaction in step d3) is a nucleic acid amplification, in which a nucleic acid is part of or forms part of the detection agent, or the signal amplification reaction in step d3) is an enzyme-based amplification of a signal.

4. 4. The method according to claim 3, wherein the signal in step d3) is in the form of a label which is a dye or a fluorophore when an enzyme is or forms part of the detection agent.

5. The method of any of claims 1 to 4, wherein the prefabricated microparticles are provided as dry prefabricated microparticles.

6. The method of claim 5 , wherein the prefabricated microparticles are provided as lyophilized prefabricated microparticles.

7. The method of claim 1 , wherein the prefabricated microparticles are not in situ fabricated microparticles.

8. The method of claim 7 , wherein the prefabricated microparticles are not microparticles that are made in situ at or during the time or reaction when analyte detection occurs.

9. 9. The method of claim 5, wherein the prefabricated microparticles are reconstituted in an aqueous solution and receive such aqueous solution in their void volume upon reconstitution.

10. 10. The method of claim 9, wherein the prefabricated microparticles are reconstituted in an aqueous solution during either step a) or step b).

11. 11. A method according to any of claims 1 to 10, wherein the detection agent is included in the prefabricated microparticles during the prefabrication process or in the aqueous solution of claim 9, and thus becomes part of the prefabricated microparticles upon reconstitution.

12. 12. The method of any one of claims 1 to 11, wherein the gel former is liquefiable upon application of heat or light, or upon change in pH, redox potential, ionic strength, temperature, magnetic field or electromagnetic radiation, or upon exposure to an enzyme or, if the gel former itself comprises an enzyme, to a substrate for such enzyme, or any combination of the foregoing.

13. The method of claim 1 , wherein the gel forming agent forms a matrix that defines the surface and the void volume of the microparticles.

14. The gel forming agent is a) a synthetic polymer prepared from its corresponding monomer; b) a silicon-based polymer; c) a naturally occurring polymer selected from: a polysaccharide; a polypeptide; a polynucleotide, and combinations thereof.

14. The method of any of claims 1 to 13, wherein the compound is selected from the group comprising:

15. 15. The method of claim 14, wherein the polymer of a) is selected from methyl acrylates and acrylates, acrylamides and methacrylamides, cyclic lactams, and styrene-based monomers; the silicon-based polymer is selected from polydimethylsiloxanes and copolymers thereof; the naturally occurring polymer is selected from agarose, chitin, chitosan, alginates, carrageenan, cellulose, fucoidan, laminaran; gums selected from xanthan gum, gum arabic, gum ghatti, guar gum, locust bean gum, tragacanth gum, karaya gum, and inulin; albumin, collagen, and gelatin; and combinations thereof.

16. 16. The method of any of claims 1 to 15, wherein the prefabricated microparticles are specifically labeled.

17. 17. The method of any of claims 1 to 16, carried out using a collection of prefabricated microparticles, said prefabricated microparticles being as defined in any of claims 1 to 16.

18. 18. The method of claim 17, wherein in the collection of prefabricated microparticles, the prefabricated microparticles differ from one another in that they contain detection agents that are specific for different analytes to be detected, and each prefabricated microparticle is specifically labeled such that different prefabricated microparticles and their corresponding analytes to be detected can be distinguished by the specific label of the prefabricated microparticle.

19. A method according to any one of claims 1 to 18, comprising the use of a prefabricated microparticle, or a collection of prefabricated microparticles, according to any one of claims 1 to 18, for performing digital detection of an analyte or analytes in a sample, or for concentrating and concentrating multiple analytes in multiple defined volumes.

20. 20. The method of claim 19, wherein all of the defined volumes in the plurality of defined volumes are equivalent.

21. 21. The method according to any of the preceding claims, wherein the exposing step b) is followed by one or several washing steps.

22. 22. The method of any of claims 1 to 21, wherein in step a) the prefabricated microparticles are provided in dried form and in step b) the prefabricated microparticles are reconstituted in an aqueous solution and then exposed to a sample suspected of containing the analyte to be detected, optionally with one or several washing steps after the reconstitution step.

23. 23. A method according to any of claims 1 to 22, wherein in step b) the number of prefabricated microparticles and the number of analyte molecules in the sample are maintained and adjusted as necessary such that the binding of a single analyte molecule per prefabricated microparticle follows a Poisson distribution.

24. 24. The method of claim 23, wherein in step b) the number of prefabricated microparticles and the number of analyte molecules in the sample are maintained and adjusted as necessary such that, on average, no more than one analyte molecule is bound per microparticle, thus allowing detection of a single analyte molecule per prefabricated microparticle.

25. 25. The method of any of claims 1 to 24, wherein during step c), the prefabricated microparticles or the collection of prefabricated microparticles, if present, are suspended in the non-aqueous phase and / or are located on a solid substrate that separates each prefabricated microparticle from other prefabricated microparticles.

26. 26. The method of claim 25, wherein the solid substrate is a substrate having a pattern of filters, sieves, wells, depressions, grooves, channels, trenches, craters, holes, pillars, or any combination of the foregoing.

27. 27. The method of any of claims 1 to 26, wherein during or after step c), the gel forming agent is liquefied resulting in aqueous droplets in a non-aqueous phase.

28. 28. The method according to claim 27, wherein during or after step c), the gel former is liquefied through the application of heat or light, or by a change in pH, redox potential, ionic strength, temperature, a magnetic field or electromagnetic radiation, or upon exposure to an enzyme, or, if the gel former itself comprises an enzyme, to a substrate for such an enzyme, or any combination of the foregoing, resulting in aqueous droplets in a non-aqueous phase.

29. 29. The method of any of claims 1 to 28, wherein the method for performing detection of an analyte in a sample is a method for performing digital detection of the analyte.

Images