RNAi drugs for hepatitis B virus infection

Abstract

To provide compositions and methods for inhibiting gene expression of Hepatitis B virus infection.SOLUTION: Described are compositions and methods for inhibition of Hepatitis B virus gene expression. RNA interference (RNAi) agents for inhibiting the expression of Hepatitis B virus gene are described. The HBV RNAi agents disclosed herein may be targeted to cells, such as hepatocytes, for example, by using conjugated targeting ligands. Pharmaceutical compositions comprising one or more HBV RNAi agents optionally with one or more additional therapeutics are also described. Delivery of the described HBV RNAi agents to infected liver in vivo provides for inhibition of HBV gene expression and treatment of diseases and conditions associated with HBV infection.SELECTED DRAWING: None

Description

[Technical field]

[0001] (CROSS REFERENCE TO RELATED APPLICATIONS) This application is a joint venture of U.S. Provisional Patent Application No. 62 / 540,639 (filed August 3, 2017) and U.S. Provisional Patent Application No. 62 / 540,639 (filed August 3, 2017). No. 2 / 534,733 (July 20, 2017) and No. 62 / 370,754 (July 20, 2017) No. 6,313,633, filed on Aug. 4, 2016, the entire contents of each of which are incorporated herein by reference. This is incorporated herein by reference.

[0002] FIELD OF THEINVENTION Disclosed herein are methods for inhibiting gene expression of Hepatitis B virus using RNA interferences. The present invention relates to HBV interfering (RNAi) agents, compositions comprising the HBV RNAi agents, and methods of use thereof. [Background technology]

[0003] Hepatitis B virus (HBV) is a double-stranded DNA-containing virus with strict hepatotropic properties. DNA is the genetic material, and during the replication cycle, pregenomic RNA is copied into DNA. The hepatitis B virus is a member of the hepadnavirus family. Hepatitis B virus is classified as a pathogen and belongs to the family Hepadnaviridae. Primary infection in humans causes organ inflammatory symptoms, fever, jaundice, and an increase in liver transaminases in the blood. Patients who are unable to overcome the viral infection may suffer from chronic hepatitis for many years. This leads to chronic disease over time, increasing the risk of developing cirrhosis and liver cancer. Perinatal transmission from infected mothers to their newborns can also lead to chronic hepatitis.

[0004] Once taken up by hepatocytes, the nucleocapsid translocates to the nucleus and the DNA is released. Here, DNA strand synthesis is completed, the gap is repaired, and a 3.2 kb covalently closed circular (c cc) produces supercoiled DNA. This cccDNA is composed of five major viral mRNAs. The transcripts of NA (which are 3.5, 3.5, 2.4, 2.1, and 0.7 kb in length) All mRNAs are capped at the 5' end and polynucleotides at the 3' end. All five mRNAs share sequence overlap at their 3' ends.

[0005] A single 3.5 kb mRNA contains the core protein and a template for polymerase production. The same transcripts also act as pre-genome replication intermediates, thereby The viral polymerase can then initiate reverse transcription into DNA. The core protein is The other 3.5 kb mRNA is required for nucleocapsid formation. In the absence of replication inhibitors, it encodes the precore of the hepatitis B antigen (HBeAg). Antigen abundance correlates with hepatitis B virus replication in the liver and can be used to monitor disease progression. This will be an important diagnostic marker for targeting.

[0006] The 2.4 kb and 2.1 kb mRNAs encode the large, medium, and small surface antigens of the virus. The open reading frames ("ORFs") preS1, preS2 and preS3 for expression of The S antigen is associated with the infectious, intact particle. The blood of The function of these particles is not fully understood. Detectable S antigen in blood Complete and sustained depletion of hepatitis B virus is a reliable indicator of clearance. It is thought that.

[0007] The 0.7 kb mRNA encodes the X protein. This gene product is expressed in the viral genome. Important for efficient transcription of genes and acts as a transcriptional activator for host gene expression The latter activity appears to be important for hepatocyte transformation during the development of liver cancer. can be.

[0008] Detectable S antigen, e antigen, and / or viral DNA in blood for more than 6 months Patients with this condition are considered to be chronically infected. Creoside analogues are typically the first treatment option for many patients. Administration of rifavir, tenofovir, and / or entecavir has been shown to improve liver function and reduce the severity of typically The study also found that the reduction in liver inflammation, sometimes to undetectable levels, was associated with a significant benefit. However, complete and sustained remission after treatment has not been achieved. Furthermore, only a small proportion of patients achieve this goal. As infections progress, resistance to drugs develops. This is especially true for hepatitis B and human immunodeficiency virus (HIV). ), which is difficult for patients who are coinfected with both viruses. It is sensitive to nucleoside analogue drugs and may develop resistance at the same time.

[0009] The second treatment option is the administration of interferon alpha. Here, patients are High doses of interferon alpha are administered for a period of time. The Asian genotype B has a high response rate. Very low. Coinfection with hepatitis D virus (HDV) or human immunodeficiency virus (HIV) is It has been shown to completely inactivate terpenes. It causes severe liver damage and severe fibrosis. Patients with inflammatory conditions are ineligible for interferon-alpha therapy.

[0010] Certain hepatitis B virus-specific RNA interference (RNAi) drugs inhibit HBV gene expression. It has been shown that the compound inhibits No. 05793 (Chin et al.), which is incorporated herein by reference in its entirety. The antibody was developed to inhibit the expression of the Hepatitis B virus gene by using a specific double-stranded ribonucleic acid (ds The present invention discloses a method for the preparation of a nucleic acid molecule comprising the steps of: Summary of the Invention [Means for solving the problem]

[0011] Can selectively and efficiently inhibit the expression of Hepatitis B virus (HBV) genes , a new hepatitis B virus (HBV)-specific RNA interference (RNAi) drug (referred to herein as There is a need for RNAi drugs, RNAi triggers, or triggers. In addition, new HBV-specific RhoA inhibitors have been developed for the treatment of HBV infection and the prevention of HBV-related diseases. There is a need for combinations of NAi drugs.

[0012] Described herein are methods for selectively and efficiently reducing the expression of HBV genes. The HBV RNAi drugs described are HBV gene-specific RNAi drugs that can The present invention can be used in methods for the therapeutic treatment and / or prevention of symptoms of V. infection and associated diseases. This includes chronic liver disease / injury, inflammation, fibrotic conditions, proliferative disorders (including cancers such as hepatocellular carcinoma), These include, but are not limited to, hepatitis D virus (HDV) infection, and acute HBV infection. In some embodiments, the HBV RNAi agent is used to treat chronic HBV infection. and / or for the therapeutic treatment and / or prevention of symptoms and diseases associated with HDV infection. Such methods can be used in combination with one or more of the HBV R It involves administering an NAi agent to a subject (eg, a human or animal subject).

[0013] Also described herein are methods for selectively and efficiently reducing the expression of HBV genes. The present invention is a composition comprising one or more of the disclosed HBV RNAi agents, which can be used to treat HBV infection. The composition comprising one or more HBV RNAi agents is intended to treat symptoms and conditions associated with HBV infection. Administering to a subject (e.g., a human or animal subject) for the treatment and / or prevention of a disease can be done.

[0014] The HBV RNAi agents disclosed herein comprise at least one sense strand and one agonist. The sense strand and the antisense strand may be partially, substantially, or completely The sense and antisense strands of the RNAi agents described herein can be complementary to each other. The length of each of the strands may be 16 to 30 nucleotides. In some cases, the sense and antisense strands are independently 17 to 26 nucleotides in length. In this embodiment, the sense strand and the antisense strand are independently 19 to 26 nucleotides in length. In some embodiments, the sense strand and the antisense strand are independently 21 to 26 nucleotides. In some embodiments, the sense strand and the antisense strand are independently The sense and antisense strands are of the same or different lengths. The HBV RNAi agents disclosed herein can be any length of any known HBV At least partially in a sequence in the HBV genome that is conserved across the majority of V serotypes The nucleic acid sequence is designed to include an antisense strand sequence that is complementary to the nucleic acid sequence described herein. The RNAi agents described above, when delivered to cells expressing HBV, have been shown to inhibit HBV expression in vivo or in vivo. itro inhibit the expression of one or more HBV genes.

[0015] The HBV RNAi agent comprises a sense strand (also called a passenger strand) that contains a first sequence. and an antisense strand (also called a guide strand) that includes a second sequence. The sense strand of the HBV RNAi drug is designed to target at least 16 nucleotides in the HBV mRNA. having at least about 85% identity to the nucleotide sequence of the consecutive nucleotides of In some embodiments, the sequence in the HBV mRNA comprises the core stretch. The sense strand core nucleotide stretch has at least about 85% identity to 16, 17, 18, 19, 20, 21, 22, or 23 nucleotides in length. The antisense strand of the RNAi drug targets a sequence in the HBV mRNA and the corresponding sense strand. over a core stretch of at least 16 consecutive nucleotides, In some embodiments, the HB V mRNA or the corresponding sense strand sequence. The antisense strand core nucleotide sequence is 16, 17, 18, 19, 20, 21, 22, or 23 nucleotides in length.

[0016] Sense and antisense strands of HBV RNAi drugs that can be used for HBV RNAi drugs Examples of HBV RNAi drug duplexes are provided in Tables 3 and 4. 5. Sense and antisense HBV RNAi agents disclosed herein Examples of 19 nucleotide core stretch sequences consisting of or contained in the strand are shown in Table Provided at 2.

[0017] In some embodiments, the one or more HBV RNAi agents are those described in the art. Any of the well known oligonucleotide delivery techniques may be used for delivery to the target cell or tissue. Nucleic acid delivery methods include encapsulation in liposomes and iontophoresis. or other vehicles (e.g., hydrogels, cyclodextrins, biodegradable nanocapsules, etc. (e.g., bioadhesive microspheres, proteinaceous vectors, or Dynamic Pol However, these are not limited to the above. (See, for example, International Publication Nos. WO 2000 / 053722 and WO 2008 / 00223) See also No. 09, No. 2011 / 104169 and No. 2012 / 083185. each of which is incorporated herein by reference. In some embodiments, BV RNAi agents are directed to target cells or tissues by covalently attaching the RNAi agent to a targeting group. In some embodiments, the targeting group is delivered to the asialoglycoprotein In some embodiments, the ligands may include cell receptor ligands, such as ASGPr ligands. In one embodiment, the ASGPr ligand comprises or is composed of a galactose derivative cluster. In some embodiments, the galactose derivative cluster comprises N-acetylglucosamine. It contains N-acetylgalactosamine trimer or N-acetylgalactosamine tetramer. In an embodiment, the galactose derivative cluster is an N-acetyl-galactosamine trimer. or N-acetyl-galactosamine tetramer.

[0018] The targeting group is attached to the 3' or 5' end of the sense or antisense strand of the HBV RNAi agent. In some embodiments, the targeting group is attached to the 3' or 5' end of the sense strand. In some embodiments, the targeting group is linked to the 5' end of the sense strand. In some embodiments, the targeting group is linked to the RNAi agent via a linker.

[0019] The targeting group may be any of the sensors disclosed in Tables 2, 3, and 4, with or without a linker. The linker may be attached to the 5' or 3' end of the sense strand and / or the antisense strand. Any of the sense strands and / or antisense strands disclosed in Tables 2, 3, and 4, with or without a group. It can be attached at the 5' or 3' end of the sense strand.

[0020] In some embodiments, described herein are duplexes disclosed in Table 5. The composition comprises one or more HBV RNAi agents having a HBV RNAi sequence.

[0021] In some embodiments, the present disclosure provides methods for detecting nucleotide sequences that differ in A composition comprising a combination or cocktail of at least two HBV RNAi agents having In some embodiments, two or more different HBV RNAi agents each have a different In some embodiments, two or more different targeting groups are linked to the targeting group. The HBV RNAi drugs, each with a targeting group consisting of N-acetyl-galactosamine, In some embodiments, two or more RNAi agents are included in the composition. In some embodiments, each of the RNAi agents is linked to the same targeting group. In certain embodiments, when two or more RNAi agents are included in the composition, each of the RNAi agents are linked to different targeting groups (e.g., targeting groups having different chemical structures).

[0022] In some embodiments, the targeting group can be H without the use of an additional linker. In some embodiments, the targeting group is linked to an HBV RNAi agent. It is designed to have a pre-existing linker to facilitate linking to an RNAi agent. In some embodiments, when more than one RNAi agent is included in a composition, the two The above RNAi agents can be linked to the targeting group using the same linker. In certain embodiments, when two or more RNAi agents are included in the composition, the two or more RNAi agents are linked to the targeting group using different linkers.

[0023] In some embodiments, described herein are at least one amplicon having different sequences. Each of the compositions comprises a combination of two HBV RNAi agents, The drugs target different locations or different regions of the HBV gene. Described herein is a combination of at least two HBV RNAi agents. and each HBV RNAi agent is adapted to target a different HBV transcript. (e.g., in a composition that includes two HBV RNAi agents, the first HBV RNAi agent is Ai drugs bind at least partially to a nucleotide sequence located in the S ORF of the HBV gene. The second HBV RNAi agent comprises an antisense strand that is complementary to the HBV gene. An antisense oligonucleotide that is at least partially complementary to a nucleotide sequence located in the X ORF of As used herein, a sequence of nucleotides located in an S ORF may include at least one nucleotide sequence. The RNAi agent comprises an antisense strand that is at least partially complementary to the HBV genotype of SEQ ID NO:1. The target region is a portion of positions 1-1307 and 3185-3221 of the ribozyme. When the X ORF is inserted, an antisense oligonucleotide sequence that is at least partially complementary to the nucleotide sequence located in the X ORF is inserted. The RNAi agent includes a portion of positions 1308-1930 of the HBV genome in SEQ ID NO:1. The target is.

[0024] HBV mRNA is known to be polycistronic, which means that it contains multiple polypeptides. The polypeptides are translated and each mRNA overlaps in its RNA sequence. A single gene-targeted RNAi drug results in inhibition of most or all HBV transcripts However, without being bound by theory, it is possible that Compositions that include two or more HBV RNAi agents that target a location or region (particularly, two or more In the above HBV RNAi drugs, one HBV RNAi drug targets the S ORF and the second (if the HBV RNAi drug targets the X ORF), only a single HBV RNAi drug It is hypothesized that these compositions may provide additional advantages over compositions containing For example, (a) ensuring that all HBV viral transcripts are targeted (i.e. 3.5 kb pregenomic RNA, 3.5 kb precore mRNA, 2.4 kb preS1 mRNA, 2.1 kb pre-S2 / S mRNA, 0.7 kb X mRNA, and (b) any S antigen expressing mRNA produced from the HBV DNA embedded in the Expanding genotypic coverage to potentially address a larger patient population and / or (c) the viral replication cascade caused by mutations in the siRNA binding site. and potentially reducing resistance to ruthenium.

[0025] In some embodiments, described herein are HBV RNA SORs. One HBV RNAi drug targets F (i.e., S transcripts (S, preS1, and proS2) S2), pregenomic RNA (core and polymerase), and the precore of the HBV genome transcript (with an antisense strand targeting HBeAg) and HBV RNA One HBV RNAi drug targeting the X ORF (i.e., the X transcript of the HBV genome) , S transcripts (S, pre-S1, and pre-S2), pregenomic RNA (core and polymerase ), as well as an antisense strand targeting the precore transcript of the HBV genome (HBeAg). In some embodiments, the composition includes a combination of the The compositions described herein include at least one HBV-specific polypeptide that contains a sequence targeting the S ORF of the HBV gene. One HBV RNAi drug and a second one containing a sequence targeting the X ORF of the HBV gene Includes HBV RNAi drugs.

[0026] Disclosed herein is a method for inhibiting expression of an HBV gene, the method comprising: The method comprises: transfecting one or more HBV antibodies with an antisense strand comprising any one of the sequences in Table 3; administering an RNAi agent.

[0027] Disclosed herein is a method for inhibiting expression of an HBV gene, the method comprising: The method comprises administering to a subject a nucleic acid sequence comprising one or more HBV RNA fragments having a sense strand comprising any one of the sequences in Table 4. This includes administering Ai drugs.

[0028] Disclosed herein is a method for inhibiting expression of an HBV gene, the method comprising: The method comprises: an antisense strand containing any one of the sequences in Table 3; and a nucleic acid sequence corresponding to the antisense strand. and a sense strand comprising a sequence of any of the sequences in Table 4 that is at least partially complementary to the sequence of any of the sequences in Table 4. The method includes administering one or more HBV RNAi agents.

[0029] Disclosed herein is a method for inhibiting expression of an HBV gene, the method comprising: The method comprises the steps of: preparing an antisense strand having any one of the sequences shown in Table 3; and preparing a nucleic acid sequence corresponding to the antisense strand. and a sense strand having a sequence of any one of the sequences in Table 4 that is at least partially complementary to the sequence of the nucleic acid ... The method includes administering one or more HBV RNAi agents to the patient.

[0030] Disclosed herein is a method for inhibiting expression of an HBV gene in a cell. The method comprises the step of: This includes administering medication.

[0031] Disclosed herein are methods for treating HBV infection or for treating diseases or conditions resulting from HBV infection. or a method for preventing a condition, comprising administering to said patient an antibody having a sequence according to any one of the sequences in Table 3. The method includes administering one or more HBV RNAi agents having a sense strand.

[0032] Disclosed herein are methods for treating HBV infection or for treating diseases or conditions resulting from HBV infection. or a method for preventing a condition, the method comprising a sequence comprising any one of the sequences in Table 4. The method includes administering one or more HBV RNAi agents having the following strands:

[0033] Disclosed herein are methods for treating HBV infection or for treating diseases or conditions resulting from HBV infection. or a method for preventing a condition, comprising administering to said patient an antibody having a sequence according to any one of the sequences in Table 3. A sense strand and any one of the sequences of Table 4 at least partially complementary to the antisense strand. and administering one or more HBV RNAi agents having a sense strand comprising the sequence of Includes.

[0034] Disclosed herein are methods for treating HBV infection or for treating diseases or conditions resulting from HBV infection. or a method for preventing a symptom, the method comprising administering to the patient an antigen comprising any one of the sequences in Table 3. a sense strand and any of the sequences listed in Table 4 that are at least partially complementary to the antisense strand and a sense strand consisting of a sequence of This includes:

[0035] Disclosed herein are methods for treating HBV infection or for treating diseases or conditions resulting from HBV infection. or a method for preventing a condition, comprising administering to said patient one or more of the following compounds having a duplex structure according to Table 5: involves administering multiple HBV RNAi agents.

[0036] Disclosed herein is a method for inhibiting expression of an HBV gene, the method comprising: The method includes: (i) generating an antisense oligonucleotide comprising or consisting of a sequence of any one of the sequences in Table 2 or Table 3; and (ii) an HBV RNAi agent having a sequence similar to that of Table 2 or Table 3. and a second HBV RNAi agent having an antisense strand comprising or consisting of This includes:

[0037] Disclosed herein are methods for treating HBV infection or for treating diseases or conditions resulting from HBV infection. or a method for preventing a condition, comprising: (i) administering to a patient a sequence selected from the group consisting of a sequence of any of Tables 2 or 3; (ii) an HBV RNAi agent having an antisense strand comprising or consisting of a sequence; The antisense strand comprises or consists of any of the sequences of Table 2 or Table 3. and a second HBV RNAi agent that inhibits HBV expression.

[0038] Disclosed herein is a method for inhibiting expression of an HBV gene, the method comprising: The method includes: (i) a first HBV RNAi agent having a sequence selected from the sequence of any of Tables 2 or 3; and an antisense strand of the first HBV RNAi drug comprising or consisting of A sequence of any one of Tables 2 or 4 that is at least partially complementary to the sense strand. and (ii) a first HBV RNAi agent having a sense strand comprising or consisting of a HBV RNAi agent according to any one of the preceding claims, comprising or comprising a sequence according to any one of the sequences in Table 2 or Table 3. The antisense strand of this compound and the antisense strand of the second HBV RNAi drug or a sequence of any of the sequences of Table 2 or Table 4 which is at least partially complementary to and a second HBV RNAi agent having a sense strand consisting of:

[0039] Disclosed herein are methods for treating HBV infection or for treating diseases or conditions resulting from HBV infection. or a method for preventing a symptom, the method comprising: (i) a first HBV RNAi agent, an antisense strand comprising or consisting of a sequence of any one of the sequences of Table 2 or Table 3; A sequence at least partially complementary to the antisense strand of the first HBV RNAi agent. 2 or any of the sequences of Table 4, and a sense strand comprising or consisting of the sequence of any of the sequences of Table 2 or Table 4. (i) an HBV RNAi agent selected from the group consisting of an HBV RNAi agent as set forth in Table 1 and an HBV RNAi agent selected from the group consisting of an HBV RNAi agent as set forth in Table 2 or Table 3; and an antisense strand comprising or consisting of any one of the sequences of V. Any of Tables 2 or 4 that is at least partially complementary to the antisense strand of an RNAi agent and a sense strand comprising or consisting of any of the sequences of The present invention includes administering an NAi drug.

[0040] In some embodiments, the HBV RNAi agents disclosed herein are Including: a. From the sequence (5'→3') AUUGAGAGAAGUCCACCAC (SEQ ID NO: 7) an antisense strand that comprises a nucleobase sequence that differs by 0, 1, 2 or 3 nucleobases; and , the sequence (5'→3') GUGGUGGACUUCUCUCAAU (SEQ ID NO: 34) to 0 a sense strand that contains a nucleobase sequence that differs by one, one, two or three nucleobases; or b. From the sequence (5' to 3') UUUGAGAGAAGUCCACCAC (SEQ ID NO: 8) an antisense strand that comprises a nucleobase sequence that differs by 0, 1, 2 or 3 nucleobases; and , the sequence (5'→3') GUGGUGGACUUCUCUCAAA (SEQ ID NO: 35) to 0 a sense strand that contains a nucleobase sequence that differs by one, one, two or three nucleobases; or c. The sequence (5'→3') AAUUGAGAGAAGUCCACCA (SEQ ID NO: 12) an antisense strand comprising a nucleobase sequence differing by 0, 1, 2 or 3 nucleobases from the and from the sequence (5'→3') UGGUGGACUUCUCUCAAUU (SEQ ID NO:39) a sense strand that contains a nucleobase sequence that differs by 0, 1, 2 or 3 nucleobases; or d. The sequence (5'→3') UAUUGAGAGAAGUCCACCA (SEQ ID NO: 13) an antisense strand comprising a nucleobase sequence differing by 0, 1, 2 or 3 nucleobases from the and from the sequence (5'→3') UGGUGGACUUCUCUCAAUA (SEQ ID NO: 40) a sense strand that contains a nucleobase sequence that differs by 0, 1, 2 or 3 nucleobases; or e. The sequence (5' to 3') AGAAAAUUGAGAGAAGUCC (SEQ ID NO: 17) an antisense strand comprising a nucleobase sequence differing by 0, 1, 2 or 3 nucleobases from the and from the sequence (5'→3') GGACUUCUCUCAAUUUUCU (SEQ ID NO: 44) a sense strand that contains a nucleobase sequence that differs by 0, 1, 2 or 3 nucleobases; or f. The sequence (5' to 3') UGAAAAUUGAGAGAAGUCC (SEQ ID NO: 18) an antisense strand comprising a nucleobase sequence differing by 0, 1, 2 or 3 nucleobases from the and from the sequence (5'→3') GGACUUCUCUCAAUUUUCA (SEQ ID NO: 45) a sense strand that contains a nucleobase sequence that differs by 0, 1, 2 or 3 nucleobases; or g. The sequence (5' to 3') ACCAAUUUAUGCCUACAGC (SEQ ID NO: 22) an antisense strand comprising a nucleobase sequence differing by 0, 1, 2 or 3 nucleobases from the and from the sequence (5'→3') GCUGUAGGCAUAAAUUGGU (SEQ ID NO: 49) a sense strand that contains a nucleobase sequence that differs by 0, 1, 2 or 3 nucleobases; or h. The sequence (5' to 3') UCCAAUUUAUGCCUACAGC (SEQ ID NO: 23) an antisense strand comprising a nucleobase sequence differing by 0, 1, 2 or 3 nucleobases from the and from the sequence (5'→3') GCUGUAGGCAUAAAUUGGA (SEQ ID NO:50) a sense strand that contains a nucleobase sequence that differs by 0, 1, 2 or 3 nucleobases; or i. The sequence (5' to 3') GACCAAUUUAUGCCUACAG (SEQ ID NO: 27) an antisense strand comprising a nucleobase sequence differing by 0, 1, 2 or 3 nucleobases from the and from the sequence (5'→3') CUGUAGGCAUAAAUUGGUC (SEQ ID NO:54) a sense strand that contains a nucleobase sequence that differs by 0, 1, 2 or 3 nucleobases; or j. The sequence (5' to 3') AACCAAUUUAUGCCUACAG (SEQ ID NO: 28) an antisense strand comprising a nucleobase sequence differing by 0, 1, 2 or 3 nucleobases from the and from the sequence (5'→3') CUGUAGGCAUAAAUUGGUU (SEQ ID NO:55) a sense strand that contains a nucleobase sequence that differs by 0, 1, 2 or 3 nucleobases; or k. The sequence (5' to 3') UACCAAUUUAUGCCUACAG (SEQ ID NO: 29) an antisense strand comprising a nucleobase sequence differing by 0, 1, 2 or 3 nucleobases from the and from the sequence (5'→3') CUGUAGGCAUAAAUUGGUA (SEQ ID NO:56) A sense strand which contains a nucleobase sequence that differs by 0, 1, 2 or 3 nucleobases.

[0041] In some embodiments, the present invention provides a method for the detection of HBV genes in cells. A composition for inhibiting expression, the composition comprising an HBV RNAi agent.

[0042] In some embodiments, the present invention provides a method for the detection of HBV genes in cells. A composition for inhibiting expression of HBV, the composition comprising two or more HBV RNAi agents. The first HBV RNAi drug is: i) the sequence (5'→3') AAUUGAGAGAAGUCCACCA (SEQ ID NO: 12) an antisense strand comprising a nucleobase sequence differing by 0, 1, 2 or 3 nucleobases from the and from the sequence (5'→3') UGGUGGACUUCUCUCAAUU (SEQ ID NO:39) a sense strand that contains a nucleobase sequence that differs by 0, 1, 2 or 3 nucleobases; or ii) the sequence (5'→3') UAUUGAGAGAAGUCCACCA (SEQ ID NO: 13) an antisense strand comprising a nucleobase sequence differing by 0, 1, 2 or 3 nucleobases from and the sequence (5'→3') UGGUGGACUUCUCUCAAUA (SEQ ID NO: 40) a sense strand comprising a nucleobase sequence differing by 0, 1, 2 or 3 nucleobases from Including any of the following: The second HBV RNAi drug is: i) the sequence (5' to 3') GACCAAUUUAUGCCUACAG (SEQ ID NO: 27) an antisense strand comprising a nucleobase sequence differing by 0, 1, 2 or 3 nucleobases from the and from the sequence (5'→3') CUGUAGGCAUAAAUUGGUC (SEQ ID NO:54) a sense strand that contains a nucleobase sequence that differs by 0, 1, 2 or 3 nucleobases; or ii) the sequence (5'→3') AACCAAUUUAUGCCUACAG (SEQ ID NO: 28) an antisense strand comprising a nucleobase sequence differing by 0, 1, 2 or 3 nucleobases from And the sequence (5'→3') CUGUAGGCAUAAAUUGGUU (SEQ ID NO:55) a sense strand that contains a nucleobase sequence that differs by 0, 1, 2 or 3 nucleobases from the iii) the sequence (5' to 3') UACCAAUUUAUGCCUACAG (SEQ ID NO: 29 ) an antisense strand containing a nucleobase sequence that differs from , and the sequence (5'→3') CUGUAGGCAUAAAUUGGUA (SEQ ID NO:56) a sense strand comprising a nucleobase sequence differing by 0, 1, 2 or 3 nucleobases from Includes any of the following.

[0043] In some embodiments, the present invention provides a method for the detection of HBV genes in cells. A composition for inhibiting expression of HBV, the composition comprising two or more HBV RNAi agents. The first HBV RNAi drug is: i) the sequence (5'→3') AGAAAAUUGAGAGAAGUCC (SEQ ID NO: 17) an antisense strand comprising a nucleobase sequence differing by 0, 1, 2 or 3 nucleobases from the and from the sequence (5'→3') GGACUUCUCUCAAUUUUCU (SEQ ID NO: 44) a sense strand that contains a nucleobase sequence that differs by 0, 1, 2 or 3 nucleobases; or ii) the sequence (5'→3') UGAAAAUUGAGAGAAGUCC (SEQ ID NO: 18) an antisense strand comprising a nucleobase sequence differing by 0, 1, 2 or 3 nucleobases from And the sequence (5'→3') GGACUUCUCUCAAUUUUCA (SEQ ID NO: 45) a sense strand comprising a nucleobase sequence differing by 0, 1, 2 or 3 nucleobases from Including any of the following: The second HBV RNAi drug is: i) the sequence (5' to 3') GACCAAUUUAUGCCUACAG (SEQ ID NO: 27) an antisense strand comprising a nucleobase sequence differing by 0, 1, 2 or 3 nucleobases from the and from the sequence (5'→3') CUGUAGGCAUAAAUUGGUC (SEQ ID NO:54) a sense strand that contains a nucleobase sequence that differs by 0, 1, 2 or 3 nucleobases; or ii) the sequence (5'→3') AACCAAUUUAUGCCUACAG (SEQ ID NO: 28) an antisense strand comprising a nucleobase sequence differing by 0, 1, 2 or 3 nucleobases from And the sequence (5'→3') CUGUAGGCAUAAAUUGGUU (SEQ ID NO:55) a sense strand that contains a nucleobase sequence that differs by 0, 1, 2 or 3 nucleobases from the iii) the sequence (5' to 3') UACCAAUUUAUGCCUACAG (SEQ ID NO: 29 ) an antisense strand containing a nucleobase sequence that differs from , and the sequence (5'→3') CUGUAGGCAUAAAUUGGUA (SEQ ID NO:56) a sense strand comprising a nucleobase sequence differing by 0, 1, 2 or 3 nucleobases from Includes any of the following.

[0044] In some embodiments, the present invention provides a method for the detection of HBV genes in cells. A composition for inhibiting expression of HBV, the composition comprising two or more HBV RNAi agents. The first HBV RNAi drug is: i) the sequence (5'→3') AAUUGAGAGAAGUCCACCA (SEQ ID NO: 12) an antisense strand comprising a nucleobase sequence differing by 0, 1, 2 or 3 nucleobases from the and from the sequence (5'→3') UGGUGGACUUCUCUCAAUU (SEQ ID NO:39) a sense strand that contains a nucleobase sequence that differs by 0, 1, 2 or 3 nucleobases; or ii) the sequence (5'→3') UAUUGAGAGAAGUCCACCA (SEQ ID NO: 13) an antisense strand comprising a nucleobase sequence differing by 0, 1, 2 or 3 nucleobases from and the sequence (5'→3') UGGUGGACUUCUCUCAAUA (SEQ ID NO: 40) a sense strand comprising a nucleobase sequence differing by 0, 1, 2 or 3 nucleobases from Including any of the following: The second HBV RNAi agent binds at least partially to a portion of the X ORF of the HBV mRNA. The antisense strand has a sequence which is specifically complementary to the antisense strand.

[0045] In some embodiments, the present invention provides a method for the detection of HBV genes in cells. A composition for inhibiting expression of HBV, the composition comprising two or more HBV RNAi agents. The first HBV RNAi drug is: i) the sequence (5'→3') AGAAAAUUGAGAGAAGUCC (SEQ ID NO: 17) an antisense strand comprising a nucleobase sequence differing by 0, 1, 2 or 3 nucleobases from the and from the sequence (5'→3') GGACUUCUCUCAAUUUUCU (SEQ ID NO: 44) a sense strand that contains a nucleobase sequence that differs by 0, 1, 2 or 3 nucleobases; or ii) the sequence (5'→3') UGAAAAUUGAGAGAAGUCC (SEQ ID NO: 18) an antisense strand comprising a nucleobase sequence differing by 0, 1, 2 or 3 nucleobases from And the sequence (5'→3') GGACUUCUCUCAAUUUUCA (SEQ ID NO: 45) a sense strand comprising a nucleobase sequence differing by 0, 1, 2 or 3 nucleobases from Including any of the following: The second HBV RNAi agent binds at least partially to a portion of the X ORF of the HBV mRNA. The antisense strand has a sequence which is specifically complementary to the antisense strand.

[0046] In some embodiments, the present invention provides a method for the detection of HBV genes in cells. A composition for inhibiting expression of HBV, the composition comprising two or more HBV RNAi agents. The first HBV RNAi drug targets at least a portion of the S ORF of HBV mRNA. and a second HBV RNAi agent comprising an antisense strand having a sequence partially complementary to: i) the sequence (5' to 3') GACCAAUUUAUGCCUACAG (SEQ ID NO: 27) an antisense strand comprising a nucleobase sequence differing by 0, 1, 2 or 3 nucleobases from the and from the sequence (5'→3') CUGUAGGCAUAAAUUGGUC (SEQ ID NO:54) a sense strand that contains a nucleobase sequence that differs by 0, 1, 2 or 3 nucleobases; or ii) the sequence (5'→3') AACCAAUUUAUGCCUACAG (SEQ ID NO: 28) an antisense strand comprising a nucleobase sequence differing by 0, 1, 2 or 3 nucleobases from And the sequence (5'→3') CUGUAGGCAUAAAUUGGUU (SEQ ID NO:55) a sense strand that contains a nucleobase sequence that differs by 0, 1, 2 or 3 nucleobases from the iii) the sequence (5' to 3') UACCAAUUUAUGCCUACAG (SEQ ID NO: 29 ) an antisense strand containing a nucleobase sequence that differs from , and the sequence (5'→3') CUGUAGGCAUAAAUUGGUA (SEQ ID NO:56) a sense strand comprising a nucleobase sequence differing by 0, 1, 2 or 3 nucleobases from Includes any of the following.

[0047] In some embodiments, the HBV RNAi agents disclosed herein are : a. Sequence (5'→3') UACCAAUUUAUGCCUACAGGCCUUAU Column number 149) contains a nucleic acid sequence that differs by 0, 1, 2 or 3 nucleic acid bases antisense strand, or b. Sequence (5' to 3') UACCAAUUUAUGCCUACAGGCCU (SEQ ID NO: 150) containing a nucleic acid sequence that differs by 0, 1, 2, or 3 nucleic acid bases. Sense chain, or c. The sequence (5' to 3') UACCAAUUUAUGCCUACAGGC (SEQ ID NO: 15 1) Antisense containing a nucleic acid base sequence that differs from the nucleic acid base sequence by 0, 1, 2, or 3 nucleic acid bases Chain, or d. The sequence (5' to 3') UGAAAAUUGAGAGAAGUCCUU (SEQ ID NO: 15 2) Antisense containing a nucleic acid base sequence that differs from the nucleic acid base sequence by 0, 1, 2, or 3 nucleic acid bases Chain, or e. The sequence (5' to 3') UACCAAUUUAUGCCUACAGUU (SEQ ID NO: 15 4) Antisense containing a nucleic acid base sequence that differs from the nucleic acid base sequence by 0, 1, 2, or 3 nucleic acid bases Chain, or f. The sequence (5' to 3') UAUUGAGAGAAGUCCACCACG (SEQ ID NO: 16 0) to an antisense nucleic acid sequence that differs by 0, 1, 2, or 3 nucleic acid bases. Chain, or g. The sequence (5' to 3') UACCAAUUUAUGCCUACAGCC (SEQ ID NO: 16 2) Antisense containing a nucleic acid base sequence that differs from the nucleic acid base sequence by 0, 1, 2, or 3 nucleic acid bases Chain, or h. Sequence (5' to 3') UACCAAUUUAUGCCUACAGCCUU (SEQ ID NO: 163) containing an antisense nucleic acid sequence that differs by 0, 1, 2, or 3 nucleic acid bases. Sense chain, or i. The sequence (5' to 3') UAUUGAGAGAAGUCCACCACGA (SEQ ID NO: 1 70) antisense oligonucleotides that contain nucleobase sequences that differ by 0, 1, 2, or 3 nucleobases Chain, or j. The sequence (5' to 3') AGAAAAUUGAGAGAAGUCCAC (SEQ ID NO: 17 1) Antisense containing a nucleic acid base sequence that differs from the nucleic acid base sequence by 0, 1, 2, or 3 nucleic acid bases Chain, or k. The sequence (5' to 3') UACCAAUUUAUGCCUACAGCUU (SEQ ID NO: 1 72) antisense oligonucleotides containing nucleic acid sequences that differ by 0, 1, 2, or 3 nucleic acid bases Chain, or l. The sequence (5' to 3') UACCAAUUUAUGCCUACAGCCU (SEQ ID NO: 1 73) antisense oligonucleotides containing nucleic acid sequences that differ by 0, 1, 2, or 3 nucleic acid bases Chain, or m. sequence (5'→3') UAUUGAGAGAAGUCCACCAUU (SEQ ID NO: 17 4) Antisense containing a nucleic acid base sequence that differs from the nucleic acid base sequence by 0, 1, 2, or 3 nucleic acid bases Chain, or n. Sequence (5'→3') UAUUGAGAGAAGUCCACCACUU (SEQ ID NO: 1 75) antisense oligonucleotides that contain nucleotide sequences that differ by 0, 1, 2, or 3 nucleotides Chain, or o. The sequence (5' to 3') AGAAAAUUGAGAGAAGUCCUU (SEQ ID NO: 17 8) Antisense containing a nucleic acid base sequence that differs from the nucleic acid base sequence by 0, 1, 2, or 3 nucleic acid bases. Chain, or p. sequence (5'→3') AGAAAAUUGAGAGAAGUCCACUU (sequence number 179) containing an antisense oligonucleotide sequence that differs by 0, 1, 2, or 3 nucleotides. Sense chain, or q. The sequence (5'→3') AGAAAAUUGAGAGAAGUCCACC (SEQ ID NO: 1 80) containing nucleobase sequences that differ by 0, 1, 2, or 3 nucleobases. Chain, or r. The sequence (5' to 3') UGAAAAUUGAGAGAAGUCCAC (SEQ ID NO: 18 1) Antisense containing a nucleic acid base sequence that differs from the nucleic acid base sequence by 0, 1, 2, or 3 nucleic acid bases Chain, or s. sequence (5'→3') ACCAAUUUAUGCCUACAGCUU (SEQ ID NO: 18 2) Antisense containing a nucleic acid base sequence that differs from the nucleic acid base sequence by 0, 1, 2, or 3 nucleic acid bases Chain, or t. sequence (5'→3') ACCAAUUUAUGCCUACAGCCUU (SEQ ID NO: 1 83) containing nucleobase sequences that differ by 0, 1, 2, or 3 nucleobases. Chain, or u. Sequence (5'→3') ACCAAUUUAUGCCUACAGCCUC (SEQ ID NO: 1 84) containing nucleobase sequences that differ by 0, 1, 2, or 3 nucleobases. Chain, or v. sequence (5'→3') UCCAAUUUAUGCCUACAGCUU (SEQ ID NO: 18 5) Antisense containing a nucleic acid base sequence that differs from the nucleic acid base sequence by 0, 1, 2, or 3 nucleic acid bases. Chain, or w. sequence (5'→3') UCCAAUUUAUGCCUACAGCCUU (SEQ ID NO: 1 86) containing nucleobase sequences that differ by 0, 1, 2, or 3 nucleobases. Chain, or x. sequence (5' to 3') UACCAAUUUAUGCCUACAGCU (SEQ ID NO: 18 7) Antisense containing a nucleic acid base sequence that differs from the nucleic acid base sequence by 0, 1, 2, or 3 nucleic acid bases Chain, or y. The sequence (5' to 3') UACCAAUUUAUGCCUACAGCG (SEQ ID NO: 18 8) Antisense containing a nucleic acid base sequence that differs from the nucleic acid base sequence by 0, 1, 2, or 3 nucleic acid bases. Chain, or z. The sequence (5' to 3') AACCAAUUUAUGCCUACAGCC (SEQ ID NO: 18 9) Antisense containing a nucleic acid base sequence that differs from the nucleic acid base sequence by 0, 1, 2, or 3 nucleic acid bases Chain, or aa. sequence (5'→3') ACCAAUUUAUGCCUACAGCCU (SEQ ID NO: 1 90) antisense oligonucleotides that contain nucleobase sequences that differ by 0, 1, 2, or 3 nucleobases Chain, or bb. Sequence (5'→3') UCCAAUUUAUGCCUACAGCCU (SEQ ID NO: 1 91) containing nucleobase sequences that differ by 0, 1, 2, or 3 nucleobases. Chain, or cc. sequence (5'→3') ACCAAUUUAUGCCUACAGCCG (SEQ ID NO: 1 92) antisense oligonucleotides that contain nucleotide sequences that differ by 0, 1, 2, or 3 nucleotides Chain, or dd. Sequence (5'→3') UCCAAUUUAUGCCUACAGCCG (SEQ ID NO: 1 93) containing nucleobase sequences that differ by 0, 1, 2, or 3 nucleobases. Chain, or ee. The sequence (5' to 3') UACCAAUUUAUGCCUACAGGG (SEQ ID NO: 1 94) antisense oligonucleotides containing nucleic acid sequences that differ by 0, 1, 2, or 3 nucleic acid bases Chain, and the HBV RNAi agent comprises an at least partially complementary antisense strand for each antisense strand. It further comprises a complementary sense strand.

[0048] In some embodiments, the HBV RNAi agents disclosed herein are : a. Sequence (5'→3') UACCAAUUUAUGCCUACAGGCCUUAU Column number 149) consists of a nucleic acid base sequence in which 0, 1, 2 or 3 nucleic acid bases differ the antisense strand, or b. Sequence (5' to 3') UACCAAUUUAUGCCUACAGGCCU (SEQ ID NO: 150) and an antigen comprising a nucleic acid base sequence that differs by 0, 1, 2, or 3 nucleic acid bases. the sense strand, or c. The sequence (5' to 3') UACCAAUUUAUGCCUACAGGC (SEQ ID NO: 15 1) Antisense oligonucleotides consisting of nucleic acid base sequences that differ from each other by 0, 1, 2, or 3 nucleic acid bases. Chain, or d. The sequence (5' to 3') UGAAAAUUGAGAGAAGUCCUU (SEQ ID NO: 15 2) Antisense oligonucleotides consisting of nucleic acid base sequences that differ from each other by 0, 1, 2, or 3 nucleic acid bases. Chain, or e. The sequence (5' to 3') UACCAAUUUAUGCCUACAGUU (SEQ ID NO: 15 4) Antisense oligonucleotides consisting of nucleic acid base sequences that differ from each other by 0, 1, 2, or 3 nucleic acid bases. Chain, or f. The sequence (5' to 3') UAUUGAGAGAAGUCCACCACG (SEQ ID NO: 16 0) to 0, 1, 2, or 3 nucleobases of the nucleobase sequence that differs Chain, or g. The sequence (5' to 3') UACCAAUUUAUGCCUACAGCC (SEQ ID NO: 16 2) Antisense oligonucleotides consisting of nucleic acid base sequences that differ from each other by 0, 1, 2, or 3 nucleic acid bases. Chain, or h. Sequence (5' to 3') UACCAAUUUAUGCCUACAGCCUU (SEQ ID NO: 163) and an antisense oligonucleotide having a nucleic acid base sequence that differs by 0, 1, 2, or 3 nucleic acid bases. the sense strand, or i. The sequence (5' to 3') UAUUGAGAGAAGUCCACCACGA (SEQ ID NO: 1 70) and antisense oligonucleotides consisting of nucleic acid sequences that differ by 0, 1, 2, or 3 nucleic acid bases. Sense chain, or j. The sequence (5' to 3') AGAAAAUUGAGAGAAGUCCAC (SEQ ID NO: 17 1) Antisense oligonucleotides consisting of nucleic acid base sequences that differ from each other by 0, 1, 2, or 3 nucleic acid bases. Chain, or k. The sequence (5' to 3') UACCAAUUUAUGCCUACAGCUU (SEQ ID NO: 1 72) and antisense oligonucleotides consisting of nucleic acid base sequences differing by 0, 1, 2 or 3 nucleic acid bases. Sense chain, or l. The sequence (5' to 3') UACCAAUUUAUGCCUACAGCCU (SEQ ID NO: 1 73) and antisense oligonucleotides consisting of nucleic acid base sequences differing by 0, 1, 2 or 3 nucleic acid bases. Sense chain, or m. sequence (5'→3') UAUUGAGAGAAGUCCACCAUU (SEQ ID NO: 17 4) Antisense oligonucleotides consisting of nucleic acid base sequences that differ from each other by 0, 1, 2, or 3 nucleic acid bases. Chain, or n. Sequence (5'→3') UAUUGAGAGAAGUCCACCACUU (SEQ ID NO: 1 75) and antisense oligonucleotides consisting of nucleic acid sequences that differ by 0, 1, 2, or 3 nucleic acid bases. Sense chain, or o. The sequence (5' to 3') AGAAAAUUGAGAGAAGUCCUU (SEQ ID NO: 17 8) Antisense oligonucleotides consisting of nucleic acid base sequences that differ from each other by 0, 1, 2, or 3 nucleic acid bases. Chain, or p. sequence (5'→3') AGAAAAUUGAGAGAAGUCCACUU (sequence number 179) and an antisense oligonucleotide consisting of a nucleic acid base sequence that differs by 0, 1, 2, or 3 nucleic acid bases. the sense strand, or q. The sequence (5'→3') AGAAAAUUGAGAGAAGUCCACC (SEQ ID NO: 1 80) and antisense oligonucleotides consisting of nucleic acid base sequences that differ by 0, 1, 2, or 3 nucleic acid bases. Sense chain, or r. The sequence (5' to 3') UGAAAAUUGAGAGAAGUCCAC (SEQ ID NO: 18 1) Antisense oligonucleotides consisting of nucleic acid base sequences that differ from each other by 0, 1, 2, or 3 nucleic acid bases. Chain, or s. sequence (5'→3') ACCAAUUUAUGCCUACAGCUU (SEQ ID NO: 18 2) Antisense oligonucleotides consisting of nucleic acid base sequences that differ from each other by 0, 1, 2, or 3 nucleic acid bases. Chain, or t. sequence (5'→3') ACCAAUUUAUGCCUACAGCCUU (SEQ ID NO: 1 83) and antisense oligonucleotides consisting of nucleic acid sequences differing by 0, 1, 2 or 3 nucleic acid bases. Sense chain, or u. Sequence (5'→3') ACCAAUUUAUGCCUACAGCCUC (SEQ ID NO: 1 84) containing nucleobase sequences that differ by 0, 1, 2, or 3 nucleobases. Chain, or v. sequence (5'→3') UCCAAUUUAUGCCUACAGCUU (SEQ ID NO: 18 5) Antisense oligonucleotides consisting of nucleic acid base sequences that differ from each other by 0, 1, 2, or 3 nucleic acid bases. Chain, or w. sequence (5'→3') UCCAAUUUAUGCCUACAGCCUU (SEQ ID NO: 1 86) and antisense oligonucleotides consisting of nucleic acid base sequences that differ by 0, 1, 2, or 3 nucleic acid bases. Sense chain, or x. sequence (5' to 3') UACCAAUUUAUGCCUACAGCU (SEQ ID NO: 18 7) Antisense oligonucleotides consisting of nucleic acid base sequences that differ from each other by 0, 1, 2 or 3 nucleic acid bases. Chain, or y. The sequence (5' to 3') UACCAAUUUAUGCCUACAGCG (SEQ ID NO: 18 8) Antisense containing a nucleic acid base sequence that differs from the nucleic acid base sequence by 0, 1, 2, or 3 nucleic acid bases. Chain, or z. The sequence (5' to 3') AACCAAUUUAUGCCUACAGCC (SEQ ID NO: 18 9) Antisense oligonucleotides consisting of nucleic acid base sequences that differ from each other by 0, 1, 2 or 3 nucleic acid bases. Chain, or aa. sequence (5'→3') ACCAAUUUAUGCCUACAGCCU (SEQ ID NO: 1 90) and antisense oligonucleotides consisting of nucleic acid sequences that differ by 0, 1, 2, or 3 nucleic acid bases. Sense chain, or bb. Sequence (5'→3') UCCAAUUUAUGCCUACAGCCU (SEQ ID NO: 1 91) and antisense oligonucleotides consisting of nucleic acid sequences that differ by 0, 1, 2, or 3 nucleic acid bases. Sense chain, or cc. sequence (5'→3') ACCAAUUUAUGCCUACAGCCG (SEQ ID NO: 1 92) and antisense oligonucleotides consisting of nucleic acid base sequences that differ by 0, 1, 2, or 3 nucleic acid bases. Sense chain, or dd. Sequence (5'→3') UCCAAUUUAUGCCUACAGCCG (SEQ ID NO: 1 93) containing nucleobase sequences that differ by 0, 1, 2, or 3 nucleobases. Chain, or ee. The sequence (5' to 3') UACCAAUUUAUGCCUACAGGG (SEQ ID NO: 1 94) and antisense oligonucleotides consisting of nucleic acid base sequences that differ by 0, 1, 2, or 3 nucleic acid bases. Chain, and the HBV RNAi agent comprises an at least partially complementary antisense strand for each antisense strand. It further comprises a complementary sense strand.

[0049] In some embodiments, the HBV RNAi agents disclosed herein are : i. Sequence (5'→3') usAfscCfaAfuUfuAfuGfcCfuAfcA 0, 1, 2 or 3 nucleotides from fgGfccsusuAu (SEQ ID NO: 61) an antisense strand containing a sequence different from that of the ii. Sequence (5'→3') usAfscCfaAfuUfuAfuGfcCfuAfc 0, 1, 2 or 3 nucleotides from AfgGfcscsu (SEQ ID NO: 62) an antisense strand containing a different sequence, or iii. Sequence (5'→3') usAfscsCfaAfuUfuAfuGfcCfuA 0, 1, 2 or 3 nucleotides from fcAfgGfccsu (SEQ ID NO: 63) or an antisense strand comprising a sequence different from iv. Sequence (5'→3') usAfscsCfaAfuUfuAfuGfcCfuAf cAfgGfsc (SEQ ID NO: 64) differs by 0, 1, 2 or 3 nucleotides. an antisense strand containing a sequence v. Sequence (5'→3') usAfscsCfaAfuUfuAfuGfcCfuAfc A sequence differing by 0, 1, 2 or 3 nucleotides from Afgusu (SEQ ID NO:68) an antisense strand containing the sequence, or vi. Sequence (5'→3') usAfscscaauUfuAfuGfcCfuacag csc (SEQ ID NO: 85) that differs by 0, 1, 2 or 3 nucleotides. the antisense strand, or vii. Sequence (5'→3') usAfsusugagAfgAfaGfuCfcacc A sequence differing from acsg (SEQ ID NO: 94) by 0, 1, 2 or 3 nucleotides or viii. Sequence (5'→3') usAfsusUfgAfgAfgAfaGfuCfc 0, 1, 2 or 3 nucleotides from AfcCfaCfgsa (SEQ ID NO:98) or an antisense strand comprising a sequence different from ix. Sequence (5'→3') usAfscsCfaAfuuuauGfcCfuAfcA A sequence differing by 0, 1, 2 or 3 nucleotides from fgcsc (SEQ ID NO: 102) an antisense strand containing the sequence, or x.Sequence (5'→3') usAfscsCfaAfuuuauGfcCfuAfcAf A sequence that differs from gcusu (SEQ ID NO: 103) by 0, 1, 2 or 3 nucleotides an antisense strand containing the sequence, or xi. Sequence (5'→3') usAfscsCfaAfuuuauGfcCfuAfcA differs by 0, 1, 2 or 3 nucleotides from fgccsu (SEQ ID NO: 104) an antisense strand comprising the sequence, or xii. Sequence (5'→3') usAfscsCfaAfuuuauGfcCfuAfc Afgccusu (SEQ ID NO: 105) differs from 0, 1, 2 or 3 nucleotides or an antisense strand comprising the sequence xiii. Sequence (5'→3') cPrpusAfscsCfaAfuUfuAfuGf 0, 1, 2 or 3 nucleotides from cCfuAfcAfgusu (SEQ ID NO: 107) an antisense strand containing a sequence with a different octide; or xiv. Sequence (5'→3') cPrpusAfsusUfgAfgAfgAfaGfu CfcAfcCfaCfsg (SEQ ID NO: 108) with 0, 1, 2 or 3 nucleotides an antisense strand containing a sequence with a different octide; or xv. Sequence (5'→3') usAfsusUfgAfgagaaGfuCfcAfcC A sequence that differs from fausu (SEQ ID NO: 109) by 0, 1, 2, or 3 nucleotides an antisense strand containing the sequence, or xvi. Sequence (5'→3') usAfsusUfgAfgagaaGfuCfcAfc differs from Cfacsg (SEQ ID NO: 110) by 0, 1, 2 or 3 nucleotides an antisense strand comprising the sequence, or xvii. Sequence (5'→3') usAfsusUfgAfgagaaGfuCfcAf 0, 1, 2 or 3 nucleotides from cCfacsusu (SEQ ID NO: 111) an antisense strand containing a different sequence, or xviii. Sequence (5'→3') usAfsusUfgAfgagaaGfuCfcA 0, 1, 2 or 3 nucleotides from fcCfacsgsa (SEQ ID NO: 112) or an antisense strand comprising a sequence different from xix. Sequence (5'→3') usAfsusUfgAfgagaaGfuCfcAfc Cfacusu (SEQ ID NO: 120) differs from 0, 1, 2 or 3 nucleotides. an antisense strand containing a sequence xx.Sequence (5'→3') asGfsasAfaAfuUfgAfgAfgAfaGf uCfcusu (SEQ ID NO: 125) differs by 0, 1, 2 or 3 nucleotides. an antisense strand containing a sequence xxi. Sequence (5'→3') asGfsasAfaAfuUfgAfgAfgAfaG fuCfcasc (SEQ ID NO: 126) differs from 0, 1, 2 or 3 nucleotides. or an antisense strand comprising the sequence xxii. Sequence (5'→3') asGfsasAfaAfuUfgAfgAfgAfa 0, 1, 2 or 3 nucleotides from GfuCfcacusu (SEQ ID NO: 127) an antisense strand containing a sequence different from that of the xxiii. Sequence (5'→3') asGfsasAfaAfuUfgAfgAfgAf 0, 1, 2 or 3 nucleotides from aGfuCfcacsc (SEQ ID NO: 128) an antisense strand containing a sequence different from that of the xxiv. Sequence (5'→3') usGfsasAfaAfuUfgAfgAfgAfa 0, 1, 2 or 3 nucleotides from GfuCfcusu (SEQ ID NO: 129) an antisense strand containing a different sequence, or xxv. Sequence (5'→3') usGfsasAfaAfuUfgAfgAfgAfaG fuCfcasc (SEQ ID NO: 130) differs from 0, 1, 2 or 3 nucleotides. or an antisense strand comprising the sequence xxvi.Array(5'→3')asCfscsAfaUfuUfaUfgCfcUfa 0, 1, 2 or 3 nucleotides from CfaGfcusu (SEQ ID NO: 131) an antisense strand containing a different sequence, or xxvii. Sequence (5'→3') asCfscsAfaUfuUfaUfgCfcUf aCfaGfccusu (SEQ ID NO: 132) with 0, 1, 2 or 3 nucleotides an antisense strand containing a sequence different from that of the xxviii.Sequence (5'→3')asCfscsAfaUfuUfaUfgCfcU 0, 1, 2 or 3 nucleotides from faCfaGfccusc (SEQ ID NO: 133) an antisense strand containing a sequence different from the xxix.Array(5'→3')usCfscsAfaUfuUfaUfgCfcUfa 0, 1, 2 or 3 nucleotides from CfaGfcusu (SEQ ID NO: 134) an antisense strand containing a different sequence, or xxx.Sequence (5'→3') usCfscsAfaUfuUfaUfgCfcUfaC 0, 1, 2 or 3 nucleotides from faGfccusu (SEQ ID NO: 135) an antisense strand containing a different sequence, or xxxi. Sequence (5'→3') cPrpusAfscsCfaAfuUfuAfuGf 0, 1, 2 or 3 nucleotides from cCfuAfcAfgcsc (SEQ ID NO: 136) an antisense strand containing a sequence with a different octide; or xxxii. Sequence (5'→3') usAfscsCfaAfuUfuAfuGfcCf 0, 1, 2 or 3 nucleotides from uAfcAfgscsc (SEQ ID NO: 137) an antisense strand containing a sequence different from that of the xxxiii. Sequence (5'→3') cPrpusAfscsCfaAfuUfuAfu 0, 1, 2 or 3 of GfcCfuAfcAfgscsc (SEQ ID NO: 138) an antisense strand that contains a sequence that differs in nucleotides; or xxxiv. Sequence (5'→3') usAfscsCfaAfuUfuAfuGfcCf 0, 1, 2 or 3 nucleotides from uAfcAfgcsu (SEQ ID NO: 139) or an antisense strand comprising a sequence different from xxxv. Sequence (5'→3') usAfscsCfaAfuUfuAfuGfcCfu 0, 1, 2 or 3 nucleotides from AfcAfgcsg (SEQ ID NO: 140) an antisense strand containing a different sequence, or xxxvi. Sequence (5'→3') asAfscsCfaAfuUfuAfuGfcCf 0, 1, 2 or 3 nucleotides from uAfcAfgcsc (SEQ ID NO: 141) or an antisense strand comprising a sequence different from xxxvii. Sequence (5'→3') usAfscsCfaAfuUfUfAfuGfc 0, 1, 2 or 3 nucleotides from CfuAfcAfgusu (SEQ ID NO: 142) an antisense strand containing a sequence different from the xxxviii. Sequence (5'→3') usAfscsCfaAfuUfuAfuGfc CfuAfcAfgCfsc (SEQ ID NO: 143) with 0, 1, 2 or 3 nucleotides an antisense strand containing a sequence with a different octide; or xxxix.Array(5'→3')asCfscAfaUfuUfaUfgCfcUfa 0, 1, 2 or 3 nucleotides from CfaGfcCfsu (SEQ ID NO: 144) or an antisense strand comprising a sequence different from xl.Sequence (5'→3') usCfscAfaUfuUfaUfgCfcUfaCfa GfcCfsu (SEQ ID NO: 145) differs from 0, 1, 2 or 3 nucleotides. an antisense strand containing a sequence xli.Sequence (5'→3') asCfscAfaUfuUfaUfgCfcUfaCf aGfccsg (SEQ ID NO: 146) differs by 0, 1, 2 or 3 nucleotides. an antisense strand containing a sequence xlii. Sequence (5'→3') usCfscAfaUfuUfaUfgCfcUfaC faGfccsg (SEQ ID NO: 147) differs from 0, 1, 2 or 3 nucleotides. or an antisense strand comprising the sequence xliii. Sequence (5'→3') usAfscsCfaAfuUfuAfuGfcCf 0, 1, 2 or 3 nucleotides from uAfcAfggsg (SEQ ID NO: 148) an antisense strand comprising a sequence different from that of wherein a, g, c and u are 2'-O-methyl (2'-OMe) modified nucleotides. Af, Cf, Gf, and Uf are 2'-fluoro modified nucleotides, and s is phosphorothioate. ethenonucleoside linkages, and the remaining nucleotide monomers are phosphodiester bonds The cPrpu is linked to the 5'-cyclopropylphosphonate-2'-O-methyl modified The HBV RNAi agent contains at least one nucleotide sequence for each antisense strand. It further comprises a sense strand which is partially complementary to the sense strand.

[0050] In some embodiments, the HBV RNAi agents disclosed herein are : i. Sequence (5'→3') usAfscCfaAfuUfuAfuGfcCfuAfcA An antisense strand consisting of fgGfccsusuAu (SEQ ID NO: 61), or ii. Sequence (5'→3') usAfscCfaAfuUfuAfuGfcCfuAfc An antisense strand consisting of AfgGfcscsu (SEQ ID NO: 62); or iii. Sequence (5'→3') usAfscsCfaAfuUfuAfuGfcCfuA an antisense strand consisting of fcAfgGfccsu (SEQ ID NO: 63); or iv. Sequence (5'→3') usAfscsCfaAfuUfuAfuGfcCfuAf An antisense strand consisting of cAfgGfsc (SEQ ID NO: 64), or v. Sequence (5'→3') usAfscsCfaAfuUfuAfuGfcCfuAfc An antisense strand consisting of Afgusu (SEQ ID NO: 68); or vi. Sequence (5'→3') usAfscscaauUfuAfuGfcCfuacag an antisense strand consisting of csc (SEQ ID NO: 85); or vii. Sequence (5'→3') usAfsusugagAfgAfaGfuCfcacc An antisense strand consisting of acsg (SEQ ID NO: 94), or viii. Sequence (5'→3') usAfsusUfgAfgAfgAfaGfuCfc An antisense strand consisting of AfcCfaCfgsa (SEQ ID NO: 98), or ix. Sequence (5'→3') usAfscsCfaAfuuuauGfcCfuAfcA An antisense strand consisting of fgcsc (SEQ ID NO: 102), or x.Sequence (5'→3') usAfscsCfaAfuuuauGfcCfuAfcAf An antisense strand consisting of gcusu (SEQ ID NO: 103), or xi. Sequence (5'→3') usAfscsCfaAfuuuauGfcCfuAfcA An antisense strand consisting of fgccsu (SEQ ID NO: 104), or xii. Sequence (5'→3') usAfscsCfaAfuuuauGfcCfuAfc An antisense strand consisting of Afgccusu (SEQ ID NO: 105), or xiii. Sequence (5'→3') cPrpusAfscsCfaAfuUfuAfuGf An antisense strand consisting of cCfuAfcAfgusu (SEQ ID NO: 107), or xiv. Sequence (5'→3') cPrpusAfsusUfgAfgAfgAfaGfu An antisense strand consisting of CfcAfcCfaCfsg (SEQ ID NO: 108), or xv. Sequence (5'→3') usAfsusUfgAfgagaaGfuCfcAfcC An antisense strand consisting of fausu (SEQ ID NO: 109), or xvi. Sequence (5'→3') usAfsusUfgAfgagaaGfuCfcAfc An antisense strand consisting of Cfacsg (SEQ ID NO: 110), or xvii. Sequence (5'→3') usAfsusUfgAfgagaaGfuCfcAf An antisense strand consisting of cCfacsusu (SEQ ID NO: 111), or xviii. Sequence (5'→3') usAfsusUfgAfgagaaGfuCfcA an antisense strand consisting of fcCfacsgsa (SEQ ID NO: 112); or xix. Sequence (5'→3') usAfsusUfgAfgagaaGfuCfcAfc An antisense strand consisting of Cfacusu (SEQ ID NO: 120), or xx.Sequence (5'→3') asGfsasAfaAfuUfgAfgAfgAfaGf An antisense strand consisting of uCfcusu (SEQ ID NO: 125); xxi. Sequence (5'→3') asGfsasAfaAfuUfgAfgAfgAfaG an antisense strand consisting of fuCfcasc (SEQ ID NO: 126); or xxii. Sequence (5'→3') asGfsasAfaAfuUfgAfgAfgAfa An antisense strand consisting of GfuCfcacusu (SEQ ID NO: 127), or xxiii. Sequence (5'→3') asGfsasAfaAfuUfgAfgAfgAf an antisense strand consisting of aGfuCfcacsc (SEQ ID NO: 128); or xxiv. Sequence (5'→3') usGfsasAfaAfuUfgAfgAfgAfa An antisense strand consisting of GfuCfcusu (SEQ ID NO: 129), or xxv. Sequence (5'→3') usGfsasAfaAfuUfgAfgAfgAfaG an antisense strand consisting of fuCfcasc (SEQ ID NO: 130); or xxvi.Array(5'→3')asCfscsAfaUfuUfaUfgCfcUfa An antisense strand consisting of CfaGfcusu (SEQ ID NO: 131), or xxvii. Sequence (5'→3') asCfscsAfaUfuUfaUfgCfcUf an antisense strand consisting of aCfaGfccusu (SEQ ID NO: 132); or xxviii.Sequence (5'→3')asCfscsAfaUfuUfaUfgCfcU an antisense strand consisting of faCfaGfccusc (SEQ ID NO: 133); or xxix.Array(5'→3')usCfscsAfaUfuUfaUfgCfcUfa An antisense strand consisting of CfaGfcusu (SEQ ID NO: 134), or xxx.Sequence (5'→3') usCfscsAfaUfuUfaUfgCfcUfaC an antisense strand consisting of faGfccusu (SEQ ID NO: 135); or xxxi. Sequence (5'→3') cPrpusAfscsCfaAfuUfuAfuGf An antisense strand consisting of cCfuAfcAfgcsc (SEQ ID NO: 136), or xxxii. Sequence (5'→3') usAfscsCfaAfuUfuAfuGfcCf an antisense strand consisting of uAfcAfgscsc (SEQ ID NO: 137); or xxxiii. Sequence (5'→3') cPrpusAfscsCfaAfuUfuAfu An antisense strand consisting of GfcCfuAfcAfgscsc (SEQ ID NO: 138), or xxxiv. Sequence (5'→3') usAfscsCfaAfuUfuAfuGfcCf an antisense strand consisting of uAfcAfgcsu (SEQ ID NO: 139); or xxxv. Sequence (5'→3') usAfscsCfaAfuUfuAfuGfcCfu An antisense strand consisting of AfcAfgcsg (SEQ ID NO: 140), or xxxvi. Sequence (5'→3') asAfscsCfaAfuUfuAfuGfcCf an antisense strand consisting of uAfcAfgcsc (SEQ ID NO: 141); or xxxvii. Sequence (5'→3') usAfscsCfaAfuUfUfAfuGfc An antisense strand consisting of CfuAfcAfgusu (SEQ ID NO: 142), or xxxviii. Sequence (5'→3') usAfscsCfaAfuUfuAfuGfc An antisense strand consisting of CfuAfcAfgCfsc (SEQ ID NO: 143), or xxxix.Array(5'→3')asCfscAfaUfuUfaUfgCfcUfa An antisense strand consisting of CfaGfcCfsu (SEQ ID NO: 144), or xl.Sequence (5'→3') usCfscAfaUfuUfaUfgCfcUfaCfa An antisense strand consisting of GfcCfsu (SEQ ID NO: 145), or xli.Sequence (5'→3') asCfscAfaUfuUfaUfgCfcUfaCf An antisense strand consisting of aGfccsg (SEQ ID NO: 146), or xlii. Sequence (5'→3') usCfscAfaUfuUfaUfgCfcUfaC an antisense strand consisting of faGfccsg (SEQ ID NO: 147); or xliii. Sequence (5'→3') usAfscsCfaAfuUfuAfuGfcCf An antisense strand consisting of uAfcAfggsg (SEQ ID NO: 148); wherein a, g, c and u are 2'-O-methyl (2'-OMe) modified nucleotides. Af, Cf, Gf, and Uf are 2'-fluoro modified nucleotides, and s is phosphorothioate. ethenonucleoside linkages, and the remaining nucleotide monomers are phosphodiester bonds The cPrpu is linked to the 5'-cyclopropylphosphonate-2'-O-methyl modified The HBV RNAi agent contains at least one nucleotide sequence for each antisense strand. It further comprises a sense strand which is partially complementary to the sense strand.

[0051] In some embodiments, the HBV RNAi agents disclosed herein are : a. Sequence (5'→3') UUGCCUGUAGGCAUAAAUUGGUAUT (sequence 275) containing nucleic acid sequences that differ by 0, 1, 2, or 3 nucleic acid bases. Chain, or b. Sequence (5'→3') UAUAUGCCUGUAGGCAUAAAUUGGUA Cells containing nucleic acid base sequences that differ from column 276 by 0, 1, 2 or 3 nucleic acid bases Sense chain, or c. The sequence (5' to 3') CUGUAGGCAUAAAUUGGUAUU (SEQ ID NO: 27 8), or a sense strand containing a nucleobase sequence that differs by 0, 1, 2 or 3 nucleobases from teeth d. The sequence (5' to 3') CGUGGUGGACUUCUCUCAAUU (SEQ ID NO: 28 5) a sense strand containing a nucleobase sequence that differs from the above by 0, 1, 2 or 3 nucleobases; or teeth e. The sequence (5' to 3') CGUGGUGGACUUCUCUCAAUA (SEQ ID NO: 28 9) a sense strand containing a nucleobase sequence that differs by 0, 1, 2 or 3 nucleobases from teeth f. The sequence (5' to 3') CUGUAGGCAUAAAUUGGUA (SEQ ID NO: 292) a sense strand comprising a nucleobase sequence that differs by 0, 1, 2 or 3 nucleobases from g. The sequence (5' to 3') GGCUGUAGGCAUAAAUUGGUA (SEQ ID NO: 29 4) a sense strand containing a nucleobase sequence that differs by 0, 1, 2 or 3 nucleobases from teeth h. The sequence (5' to 3') UCGUGGUGGACUUCUCUCAAUU (SEQ ID NO: 3 00), a sense strand comprising a nucleobase sequence that differs by 0, 1, 2 or 3 nucleobases; or i. The sequence (5' to 3') GUGGACUUCUCUCAAUUUUCU (SEQ ID NO: 30 2) a sense strand containing a nucleobase sequence that differs from the nucleobase sequence by 0, 1, 2, or 3 nucleobases; or teeth j. The sequence (5' to 3') GCUGUAGGCAUAAAUUGGUAUU (SEQ ID NO: 3 03), a sense strand comprising a nucleobase sequence differing by 0, 1, 2 or 3 nucleobases from or k. sequence (5'→3') GGCUGUAGGCAUAAAUUGGUAUU (sequence number 304) a sense strand containing a nucleobase sequence that differs by 0, 1, 2, or 3 nucleobases or l. The sequence (5' to 3') UGGUGGACUUCUCUCAAUAUU (SEQ ID NO: 30 6), or a sense strand containing a nucleobase sequence that differs by 0, 1, 2 or 3 nucleobases from teeth m. sequence (5'→3') GUGGUGGACUUCUCUCAAUAUU (SEQ ID NO:3 07), a sense strand comprising a nucleobase sequence differing by 0, 1, 2 or 3 nucleobases from or n. Sequence (5'→3') AAUGGUGGACUUCUCUCAAUAUU (SEQ ID NO: 308) a sense strand containing a nucleobase sequence that differs by 0, 1, 2, or 3 nucleobases or o. Sequence (5' to 3') GGACUUCUCUCAAUUUUCU (SEQ ID NO: 318) a sense strand comprising a nucleobase sequence that differs by 0, 1, 2 or 3 nucleobases from p. sequence (5'→3') GGUGGACUUCUCUCAAUUUUCU (SEQ ID NO: 3 19), a sense strand comprising a nucleobase sequence differing by 0, 1, 2 or 3 nucleobases from or q. Sequence (5'→3') GGACUUCUCUCAAUUUUCA (SEQ ID NO: 320) a sense strand comprising a nucleobase sequence that differs by 0, 1, 2 or 3 nucleobases from r. sequence (5'→3') GUGGACUUCUCUCAAUUUUCA (SEQ ID NO: 32 a sense strand containing a nucleobase sequence that differs from 1) by 0, 1, 2 or 3 nucleobases; or teeth s. sequence (5'→3') GCUGUAGGCAUAAAUUGGU (SEQ ID NO: 322) a sense strand comprising a nucleobase sequence that differs by 0, 1, 2 or 3 nucleobases from t. sequence (5'→3') GGCUGUAGGCAUAAAUUGGU (sequence number 323 ), or a sense strand comprising a nucleobase sequence that differs by 0, 1, 2 or 3 nucleobases from u. Sequence (5'→3') GAGGCUGUAGGCAUAAAUUGGU (SEQ ID NO:3 24), a sense strand comprising a nucleobase sequence differing by 0, 1, 2 or 3 nucleobases from or v. sequence (5'→3') GCUGUAGGCAUAAAUUGGA (SEQ ID NO: 325) a sense strand comprising a nucleobase sequence that differs by 0, 1, 2 or 3 nucleobases from w. sequence (5'→3') GGCUGUAGGCAUAAAUUGGA (sequence number 326 ), or a sense strand comprising a nucleobase sequence that differs by 0, 1, 2 or 3 nucleobases from x. sequence (5'→3') AGCUGUAGGCAUAAAUUGGUA (SEQ ID NO: 32 7) a sense strand containing a nucleobase sequence that differs by 0, 1, 2 or 3 nucleobases from teeth y. The sequence (5' to 3') CGCUGUAGGCAUAAAUUGGUA (SEQ ID NO: 32 8), or a sense strand containing a nucleobase sequence that differs by 0, 1, 2 or 3 nucleobases from teeth z. The sequence (5' to 3') GGCUGUAGGCAUAAAUUGGUU (SEQ ID NO: 32 9) a sense strand containing a nucleobase sequence that differs by 0, 1, 2 or 3 nucleobases from teeth aa. sequence (5'→3') AGGCUGUAGGCAUAAAUUGGU (SEQ ID NO: 3 30) antisense oligonucleotides containing nucleic acid sequences that differ by 0, 1, 2, or 3 nucleic acid bases Chain, or bb. Sequence (5'→3') AGGCUGUAGGCAUAAAUUGGA (SEQ ID NO: 3 31), a sense strand comprising a nucleobase sequence differing by 0, 1, 2 or 3 nucleobases from or cc. Sequence (5'→3') CGGCUGUAGGCAUAAAUUGGU (SEQ ID NO: 3 32), a sense strand comprising a nucleobase sequence differing by 0, 1, 2 or 3 nucleobases from or dd. Sequence (5'→3') CGGCUGUAGGCAUAAAUUGGA (SEQ ID NO: 3 33), a sense strand comprising a nucleobase sequence differing by 0, 1, 2 or 3 nucleobases from or ee. The sequence (5'→3') CCCUGUAGGCAUAAAUUGGUA (SEQ ID NO:3 34), a sense strand comprising a nucleobase sequence differing by 0, 1, 2 or 3 nucleobases from and the HBV RNAi agent comprises an at least partially complementary antisense strand for each antisense strand. It further comprises a complementary antisense strand.

[0052] In some embodiments, the HBV RNAi agents disclosed herein are : a. Nucleotide sequence (5'→3') UUGCCUGUAGGCAUAAAUUGGUAU A sense strand consisting of T (SEQ ID NO: 275), or b. Nucleotide sequence (5'→3') UAUAUGCCUGUAGGCAUAAAUUGG A sense strand consisting of UA (SEQ ID NO: 276), or c. Nucleotide sequence (5'→3') CUGUAGGCAUAAAUUGGUAUU (sequence No. 278), or d. Nucleotide sequence (5'→3') CGUGGUGGACUUCUCUCAAUU (sequence No. 285), or e. Nucleotide sequence (5'→3') CGUGGUGGACUUCUCUCAAUA (sequence No. 289), or f. Nucleotide sequence (5'→3') CUGUAGGCAUAAAUUGGUA (SEQ ID NO: 292), or g. Nucleotide sequence (5'→3') GGCUGUAGGCAUAAAUUGGUA (sequence No. 294), or h. Nucleotide base sequence (5'→3') UCGUGGUGGACUUCUCUCAAUU (sequence A sense strand consisting of sequence number 300), or i. Nucleotide sequence (5'→3') GUGGACUUCUCUCAAUUUUCU (sequence No. 302), or j. Nucleotide base sequence (5'→3') GCUGUAGGCAUAAAUUGGUAUU (sequence A sense strand consisting of sequence number 303), or K. Nucleotide sequence (5'→3') GGCUGUAGGCAUAAAUUGGUAUU ( SEQ ID NO: 304), or l. Nucleotide base sequence (5'→3') UGGUGGACUUCUCUCAAUAUU (sequence No. 306), or m. Nucleotide base sequence (5'→3') GUGGUGGACUUCUCUCAAUAUU (sequence A sense strand consisting of sequence number 307), or n. Nucleotide base sequence (5'→3') AAUGGUGGACUUCUCUCAAUAUU ( SEQ ID NO: 308), or o. Nucleotide sequence (5'→3') GGACUUCUCUCAAUUUUCU (SEQ ID NO: 318), or p. Nucleotide base sequence (5'→3') GGUGGACUUCUCUCAAUUUUCU (sequence A sense strand consisting of sequence number 319), or q. Nucleotide base sequence (5'→3') GGACUUCUCUCAAUUUUCA (sequence number 320), or r. Nucleotide sequence (5'→3') GUGGACUUCUCUCAAUUUUCA (sequence No. 321), or s. Nucleotide sequence (5'→3') GCUGUAGGCAUAAAUUGGU (SEQ ID NO: 322), or t. Nucleotide sequence (5'→3') GGCUGUAGGCAUAAAUUGGU (sequence no. No. 323), or u. Nucleotide base sequence (5'→3') GAGGCUGUAGGCAUAAAUUGGU (sequence A sense strand consisting of sequence number 324), or v. Nucleotide base sequence (5'→3') GCUGUAGGCAUAAAUUGGA (SEQ ID NO: 325), or Nucleotide sequence (5'→3') GGCUGUAGGCAUAAAUUGGA (sequence no. No. 326), or x. Nucleotide base sequence (5'→3') AGCUGUAGGCAUAAAUUGGUA (sequence No. 327), or y. Nucleotide base sequence (5'→3') CGCUGUAGGCAUAAAUUGGUA (sequence No. 328), or z. Nucleotide sequence (5'→3') GGCUGUAGGCAUAAAUUGGUU (sequence No. 329), or aa. Nucleotide base sequence (5'→3') AGGCUGUAGGCAUAAAUUGGU (sequence A sense strand containing the sequence number 330), or bb. Nucleotide base sequence (5'→3') AGGCUGUAGGCAUAAAUUGGA (sequence A sense strand consisting of sequence number 331), or cc. Nucleotide base sequence (5'→3') CGGCUGUAGGCAUAAAUUGGU (sequence A sense strand consisting of sequence number 332), or dd. Nucleotide base sequence (5'→3') CGGCUGUAGGCAUAAAUUGGA (sequence A sense strand consisting of sequence number 333), or ee. Nucleotide base sequence (5'→3') CCCUGUAGGCAUAAAUUGGUA 334) sense strand, and the HBV RNAi agent comprises an at least partially complementary antisense strand for each antisense strand. It further comprises a complementary antisense strand.

[0053] In some embodiments, the present invention provides a method for the detection of HBV genes in cells. A composition for inhibiting expression, the composition comprising two HBV RNAi agents, The first HBV RNAi agent has the sequence (5'→3')UAUUGAGAGAAGUCCAC A nucleobase differing from CACUU (SEQ ID NO: 175) by 0, 1, 2 or 3 nucleobases. The antisense strand contains the base sequence and the sequence (5'→3')GUGGUGGACUUCUC 0, 1, 2 or 3 nucleobases differ from UCAAUAUU (SEQ ID NO: 307) and a second HBV RNAi agent comprising a sense strand comprising the nucleobase sequence (5'→3') 0, 1, or 2 units from UACCAAUUUAUGCCUACAGUU (SEQ ID NO: 154) or an antisense strand containing a nucleobase sequence differing by three nucleobases, and ') 0, 1, or 2 of CUGUAGGCAUAAAUUGGUA (sequence number 292) or a sense strand which comprises a nucleobase sequence which differs by three nucleobases.

[0054] In some embodiments, the present invention provides a method for the detection of HBV genes in cells. A composition for inhibiting expression, the composition comprising two HBV RNAi agents, The first HBV RNAi drug has the nucleobase sequence (5'→3')UAUUGAGAGAAGU An antisense strand consisting of CCACCACUU (SEQ ID NO: 175) and a nucleic acid base sequence ( 5'→3')GUGGUGGACUUCUCUCAAUAUU (SEQ ID NO: 307) and the second HBV RNAi agent comprises a sense strand containing the nucleobase sequence (5'→3')UACC An antisense strand consisting of AAUUUAUGCCUACAGUU (SEQ ID NO: 154), and , the nucleic acid base sequence (5'→3') CUGUAGGCAUAAAUUGGUA (SEQ ID NO: 29 2) The sense strand comprises:

[0055] In some embodiments, the present invention provides a method for the detection of HBV genes in cells. A composition for inhibiting expression, the composition comprising two HBV RNAi agents, The first HBV RNAi agent has the sequence (5'→3')AGAAAAUUGAGAGAAGU A nucleobase that differs from CCAC (SEQ ID NO: 171) by 0, 1, 2 or 3 nucleobases and an antisense strand containing the sequence (5'→3')GUGGACUUCUCUCAA A nucleic acid that differs by 0, 1, 2 or 3 nucleobases from UUUUCU (SEQ ID NO: 302). and the second HBV RNAi agent comprises a sense strand comprising the sequence (5'→3')UA 0, 1, 2 or 3 of CCAAUUUAUGCCUACAGCG (SEQ ID NO: 188) an antisense strand containing a nucleobase sequence that differs by three nucleobases, and the sequence (5'→3') 0, 1, or 2 of CGCUGUAGGCAUAAAUUGGUA (SEQ ID NO: 328) or a sense strand which comprises a nucleobase sequence which differs by three nucleobases.

[0056] In some embodiments, the present invention provides a method for the detection of HBV genes in cells. A composition for inhibiting expression, the composition comprising two HBV RNAi agents, The first HBV RNAi drug has the nucleobase sequence (5'→3')AGAAAAUUGAGAG An antisense strand consisting of AAGUCCAC (SEQ ID NO: 171) and a nucleic acid base sequence (5 '→3')GUGGACUUCUCUCAAUUUUCU (SEQ ID NO: 302) and the second HBV RNAi agent comprises the nucleobase sequence (5'→3')UACCAA An antisense strand consisting of UUUAUGCCUACAGCG (SEQ ID NO: 188), and Acid-base sequence (5'→3') CGCUGUAGGCAUAAAUUGGUA (SEQ ID NO: 32 8).

[0057] In some embodiments, the present invention provides a method for the detection of HBV genes in cells. A composition for inhibiting expression, the composition comprising two HBV RNAi agents, The first HBV RNAi agent has the sequence (5'→3')AGAAAAUUGAGAGAAGU A nucleobase that differs from CCAC (SEQ ID NO: 171) by 0, 1, 2 or 3 nucleobases and an antisense strand containing the sequence (5'→3')GUGGACUUCUCUCAA A nucleic acid that differs by 0, 1, 2 or 3 nucleobases from UUUUCU (SEQ ID NO: 302). and the second HBV RNAi agent comprises a sense strand comprising the sequence (5'→3')UA 0, 1, 2 or 3 of CCAAUUUAUGCCUACAGCC (SEQ ID NO: 162) an antisense strand containing a nucleobase sequence that differs by three nucleobases, and the sequence (5'→3') 0, 1, or 2 of GGCUGUAGGCAUAAAUUGGUA (SEQ ID NO: 294) or a sense strand which comprises a nucleobase sequence which differs by three nucleobases.

[0058] In some embodiments, the present invention provides a method for the detection of HBV genes in cells. A composition for inhibiting expression, the composition comprising two HBV RNAi agents, The first HBV RNAi drug has the nucleobase sequence (5'→3')AGAAAAUUGAGAG An antisense strand consisting of AAGUCCAC (SEQ ID NO: 171) and a nucleic acid base sequence (5 '→3')GUGGACUUCUCUCAAUUUUCU (SEQ ID NO: 302) and the second HBV RNAi agent comprises the nucleobase sequence (5'→3')UACCAA An antisense strand consisting of UUUAUGCCUACAGCC (SEQ ID NO: 162), and Acid-base sequence (5'→3') GGCUGUAGGCAUAAAUUGGUA (SEQ ID NO: 29 4).

[0059] In some embodiments, the present invention provides a method for the detection of HBV genes in cells. A composition for inhibiting expression, the composition comprising two HBV RNAi agents, The first HBV RNAi agent has the sequence (5'→3')AGAAAAUUGAGAGAAGU A nucleobase that differs from CCAC (SEQ ID NO: 171) by 0, 1, 2 or 3 nucleobases and an antisense strand containing the sequence (5'→3')GUGGACUUCUCUCAA A nucleic acid that differs by 0, 1, 2 or 3 nucleobases from UUUUCU (SEQ ID NO: 302). and the second HBV RNAi agent comprises a sense strand comprising the sequence (5'→3')UA 0, 1, 2 or 3 of CCAAUUUAUGCCUACAGCC (SEQ ID NO: 162) an antisense strand containing a nucleobase sequence that differs by three nucleobases, and the sequence (5'→3') 0, 1, 2 from GUGGUGGACUUCUCUCAAUAUU (SEQ ID NO: 307) The sense strand comprises a nucleobase sequence that differs by one or three nucleobases.

[0060] In some embodiments, the present invention provides a method for the detection of HBV genes in cells. A composition for inhibiting expression, the composition comprising two HBV RNAi agents, The first HBV RNAi drug has the nucleobase sequence (5'→3')AGAAAAUUGAGAG An antisense strand consisting of AAGUCCAC (SEQ ID NO: 171) and a nucleic acid base sequence (5 '→3')GUGGACUUCUCUCAAUUUUCU (SEQ ID NO: 302) and the second HBV RNAi agent comprises the nucleobase sequence (5'→3')UACCAA An antisense strand consisting of UUUAUGCCUACAGCC (SEQ ID NO: 162), and Acid-base sequence (5'→3') GUGGUGGACUUCUCUCAAUAUU (SEQ ID NO: 3 07) is the sense strand.

[0061] In some embodiments, the present invention provides a method for the detection of HBV genes in cells. A composition for inhibiting expression, the composition comprising two HBV RNAi agents, All or substantially all of the nucleotides in the sense strand are modified and / or The first and / or second HBV RNAi agent may comprise all or a part of the antisense strand of the HBV RNAi agent. is substantially all modified nucleotides, and this first HBV RNAi agent has the sequence (5 '→3') UAUUGAGAGAAGUCCACCACUU (SEQ ID NO: 175) to 0 antisense strands containing nucleobase sequences differing by 1, 2 or 3 nucleobases; Sequence (5'→3')GUGGUGGACUUCUCUCAAUAUU (SEQ ID NO:307) a sense strand comprising a nucleobase sequence that differs by 0, 1, 2 or 3 nucleobases from The second HBV RNAi agent has the sequence (5'→3')UACCAAUUUAUGCCUA A nucleobase differing from CAGUU (SEQ ID NO: 154) by 0, 1, 2 or 3 nucleobases. The antisense strand contains the base sequence and the sequence (5'→3')CUGUAGGCAUAAAU Nucleic acid salts differing from UGGUA (SEQ ID NO: 292) by 0, 1, 2 or 3 nucleobases. It includes a sense strand that contains a base sequence.

[0062] In some embodiments, the present invention provides a method for the detection of HBV genes in cells. A composition for inhibiting expression, the composition comprising two HBV RNAi agents, All or substantially all of the nucleotides in the sense strand are modified and / or The first and / or second HBV RNAi agent may comprise all or a part of the antisense strand of the HBV RNAi agent. is substantially all modified nucleotides, and this first HBV RNAi agent has the sequence (5 '→3') AGAAAAUUGAGAGAAGUCCAC (SEQ ID NO: 171) - 0 an antisense strand containing a nucleobase sequence differing by one, two or three nucleobases; and (5'→3')GUGGACUUCUCUCAAUUUUCU (SEQ ID NO: 302) to 0 a sense strand comprising a nucleobase sequence that differs by one, one, two or three nucleobases, The HBV RNAi drug of 2 has the sequence (5'→3')UACCAAUUUAUGCCUACA A nucleobase sequence that differs from GCG (SEQ ID NO: 188) by 0, 1, 2 or 3 nucleobases. The antisense strand contains the sequence (5'→3')CGCUGUAGGCAUAAAU Nucleic acid salts differing from UGGUA (SEQ ID NO: 328) by 0, 1, 2 or 3 nucleobases. It includes a sense strand that contains a base sequence.

[0063] In some embodiments, the present invention provides a method for the detection of HBV genes in cells. A composition for inhibiting expression, the composition comprising two HBV RNAi agents, All or substantially all of the nucleotides in the sense strand are modified and / or The first and / or second HBV RNAi agent may comprise all or a part of the antisense strand of the HBV RNAi agent. is substantially all modified nucleotides, and this first HBV RNAi agent has the sequence (5 '→3') AGAAAAUUGAGAGAAGUCCAC (SEQ ID NO: 171) - 0 an antisense strand containing a nucleobase sequence differing by one, two or three nucleobases; and (5'→3')GUGGACUUCUCUCAAUUUUCU (SEQ ID NO: 302) to 0 a sense strand comprising a nucleobase sequence that differs by one, one, two or three nucleobases, The HBV RNAi drug of 2 has the sequence (5'→3')UACCAAUUUAUGCCUACA A nucleobase sequence that differs from GCC (SEQ ID NO: 162) by 0, 1, 2 or 3 nucleobases. The antisense strand contains the sequence (5'→3')GGCUGUAGGCAUAAAU Nucleic acid salts differing from UGGUA (SEQ ID NO: 294) by 0, 1, 2 or 3 nucleobases. It includes a sense strand that contains a base sequence.

[0064] In some embodiments, the present invention provides a method for the detection of HBV genes in cells. A composition for inhibiting expression, the composition comprising two HBV RNAi agents, All or substantially all of the nucleotides in the sense strand are modified and / or The first and / or second HBV RNAi agent may comprise all or a part of the antisense strand of the HBV RNAi agent. is substantially all modified nucleotides, and this first HBV RNAi agent has the sequence (5 '→3') AGAAAAUUGAGAGAAGUCCAC (SEQ ID NO: 171) - 0 an antisense strand containing a nucleobase sequence differing by one, two or three nucleobases; and (5'→3')GUGGACUUCUCUCAAUUUUCU (SEQ ID NO: 302) to 0 a sense strand comprising a nucleobase sequence that differs by one, one, two or three nucleobases, The HBV RNAi drug of 2 has the sequence (5'→3')UACCAAUUUAUGCCUACA A nucleobase sequence that differs from GCC (SEQ ID NO: 162) by 0, 1, 2 or 3 nucleobases. The antisense strand contains the sequence (5'→3')GUGGUGGACUUCUCUC A nucleic acid differing by 0, 1, 2 or 3 nucleobases from AAUAUU (SEQ ID NO: 307). It includes a sense strand that contains a base sequence.

[0065] In some embodiments, the present invention provides a method for the detection of HBV genes in cells. A composition for inhibiting expression, the composition comprising two HBV RNAi agents, All or substantially all of the nucleotides in the sense strand are modified and / or The first and / or second HBV RNAi agent may comprise all or a part of the antisense strand of the HBV RNAi agent. is substantially all modified nucleotides, and this first HBV RNAi agent has the sequence (5 '→3') UAUUGAGAGAAGUCCACCACUU (SEQ ID NO: 175) to 0 antisense strands containing nucleobase sequences differing by 1, 2 or 3 nucleobases; Sequence (5'→3')GUGGUGGACUUCUCUCAAUAUU (SEQ ID NO:307) a sense strand comprising a nucleobase sequence that differs by 0, 1, 2 or 3 nucleobases from The second HBV RNAi agent has the sequence (5'→3')UACCAAUUUAUGCCUA A nucleobase differing from CAGUU (SEQ ID NO: 154) by 0, 1, 2 or 3 nucleobases. The antisense strand contains the base sequence and the sequence (5'→3')CUGUAGGCAUAAAU Nucleic acid salts differing from UGGUA (SEQ ID NO: 292) by 0, 1, 2 or 3 nucleobases. a sense strand comprising a base sequence, and The sense strand of the drug is conjugated to a targeting ligand containing N-acetyl-galactosamine. It will be.

[0066] In some embodiments, the present invention provides a method for the detection of HBV genes in cells. A composition for inhibiting expression, the composition comprising two HBV RNAi agents, All or substantially all of the nucleotides in the sense strand are modified and / or The first and / or second HBV RNAi agent may comprise all or a part of the antisense strand of the HBV RNAi agent. is substantially all modified nucleotides, and this first HBV RNAi agent has the sequence (5 '→3') AGAAAAUUGAGAGAAGUCCAC (SEQ ID NO: 171) - 0 an antisense strand containing a nucleobase sequence differing by one, two or three nucleobases; and (5'→3')GUGGACUUCUCUCAAUUUUCU (SEQ ID NO: 302) to 0 a sense strand comprising a nucleobase sequence that differs by one, one, two or three nucleobases, The HBV RNAi drug of 2 has the sequence (5'→3')UACCAAUUUAUGCCUACA A nucleobase sequence that differs from GCG (SEQ ID NO: 188) by 0, 1, 2 or 3 nucleobases. The antisense strand contains the sequence (5'→3')CGCUGUAGGCAUAAAU Nucleic acid salts differing from UGGUA (SEQ ID NO: 328) by 0, 1, 2 or 3 nucleobases. a sense strand comprising a base sequence, and The sense strand of the drug is conjugated to a targeting ligand containing N-acetyl-galactosamine. It will be.

[0067] In some embodiments, the present invention provides a method for the detection of HBV genes in cells. A composition for inhibiting expression, the composition comprising two HBV RNAi agents, All or substantially all of the nucleotides in the sense strand are modified and / or The first and / or second HBV RNAi agent may comprise all or a part of the antisense strand of the HBV RNAi agent. is substantially all modified nucleotides, and this first HBV RNAi agent has the sequence (5 '→3') AGAAAAUUGAGAGAAGUCCAC (SEQ ID NO: 171) - 0 an antisense strand containing a nucleobase sequence differing by one, two or three nucleobases; and (5'→3')GUGGACUUCUCUCAAUUUUCU (SEQ ID NO: 302) to 0 a sense strand comprising a nucleobase sequence that differs by one, one, two or three nucleobases, The HBV RNAi drug of 2 has the sequence (5'→3')UACCAAUUUAUGCCUACA A nucleobase sequence that differs from GCC (SEQ ID NO: 162) by 0, 1, 2 or 3 nucleobases. The antisense strand contains the sequence (5'→3')GGCUGUAGGCAUAAAU Nucleic acid salts differing from UGGUA (SEQ ID NO: 294) by 0, 1, 2 or 3 nucleobases. a sense strand comprising a base sequence, and The sense strand of the drug is conjugated to a targeting ligand containing N-acetyl-galactosamine. It will be.

[0068] In some embodiments, the present invention provides a method for the detection of HBV genes in cells. A composition for inhibiting expression, the composition comprising two HBV RNAi agents, All or substantially all of the nucleotides in the sense strand are modified and / or The first and / or second HBV RNAi agent may comprise all or a part of the antisense strand of the HBV RNAi agent. is substantially all modified nucleotides, and this first HBV RNAi agent has the sequence (5 '→3') AGAAAAUUGAGAGAAGUCCAC (SEQ ID NO: 171) - 0 an antisense strand containing a nucleobase sequence differing by one, two or three nucleobases; and (5'→3')GUGGACUUCUCUCAAUUUUCU (SEQ ID NO: 302) to 0 a sense strand comprising a nucleobase sequence that differs by one, one, two or three nucleobases, The HBV RNAi drug of 2 has the sequence (5'→3')UACCAAUUUAUGCCUACA A nucleobase sequence that differs from GCC (SEQ ID NO: 162) by 0, 1, 2 or 3 nucleobases. The antisense strand contains the sequence (5'→3')GUGGUGGACUUCUCUC A nucleic acid differing by 0, 1, 2 or 3 nucleobases from AAUAUU (SEQ ID NO: 307). The first HBV RNAi agent and the second HBV RNAi agent include a sense strand that includes a base sequence. The sense strand of the Ai drug is conjugated to a targeting ligand containing N-acetyl-galactosamine. will be supported.

[0069] In some embodiments, disclosed herein are methods for treating HBV infection or A method for preventing a disease or condition caused by BV infection, the method comprising administering to the patient a and administering to a subject in need thereof an effective amount of AD04872 and an effective amount of AD05070. In some embodiments, the AD inhibitor administered to a subject in need thereof The ratio of AD04872 to AD05070 is about 2:1. The ratio of AD04872 to AD05070 administered to subjects in need thereof is approximately 3: 1. In some embodiments, the AD administered to a subject in need thereof The ratio of AD04872 to AD05070 is about 1:1. The ratio of AD04872 to AD05070 administered to subjects in need thereof is approximately 4: 1. In some embodiments, the AD administered to a subject in need thereof The ratio of AD04872 to AD05070 is about 5:1. The ratio of AD04872 to AD05070 administered to subjects in need thereof is approximately 1: The answer is 2.

[0070] In some embodiments, about 1 mg / kg (mpk) of AD04872 and about 1 mg 100 mg / kg of AD05070 is administered to a subject in need thereof. In the form of about 1.5 mg / kg AD04872 and about 1.5 mg / kg AD050 70 is administered to a subject in need thereof. In some embodiments, about 2 AD04872 at 0.0 mg / kg and AD05070 at approximately 1.0 mg / kg were required to In some embodiments, about 3.0 mg / kg of A D04872 and approximately 1.0 mg / kg AD05070 for those in need In some embodiments, about 3.2 mg / kg of AD04872 and about 0 .8mg / kg of AD05070 will be administered to subjects in need of these drugs. In some embodiments, about 2.7 mg / kg AD04872 and about 1.3 mg / kg A D05070 is administered to a subject in need thereof. Approximately 4.0 mg / kg of AD04872 and approximately 1.0 mg / kg of AD05070 were In some embodiments, about 3.3 mg / kg is administered to a subject in need thereof. kg of AD04872 and approximately 1.7 mg / kg of AD05070. In some embodiments, about 0.05 to about 5 mg / kg of AD is administered to a subject. 04872 and about 0.05 to about 5 mg / kg AD05070 are required. In some embodiments, about AD04872 and about AD0507 are administered to a subject. 0 are administered separately (e.g., in separate injections). Each dose of 04872 and each dose of AD05070 are administered together (e.g., in the same injection). In some embodiments, each dose of AD04872 and each dose of AD05070 The doses are prepared in a single pharmaceutical composition.

[0071] In some embodiments, disclosed herein are methods for treating HBV infection or A method for preventing a disease or condition caused by BV infection, the method comprising administering to the patient a and administering to a subject in need thereof an effective amount of AD04872 and an effective amount of AD04776. In some embodiments, the AD inhibitor administered to a subject in need thereof The ratio of AD04872 to AD04776 is about 2:1. The ratio of AD04872 to AD04776 administered to subjects in need thereof is approximately 3: 1. In some embodiments, the AD administered to a subject in need thereof The ratio of AD04872 to AD04776 is about 4:1. The ratio of AD04872 to AD04776 administered to subjects in need thereof is approximately 1: 1. In some embodiments, the AD administered to a subject in need thereof The ratio of AD04872 to AD04776 is about 5:1. The ratio of AD04872 to AD04776 administered to subjects in need thereof is approximately 1: The answer is 2.

[0072] In some embodiments, about 1 mg / kg (mpk) of AD04872 and about 1 mg 100 mg / kg of AD04776 is administered to a subject in need thereof. In the form of about 1.5 mg / kg AD04872 and about 1.5 mg / kg AD047 76 is administered to a subject in need thereof. In some embodiments, about 2 AD04872 at 0.0 mg / kg and AD04776 at approximately 1.0 mg / kg were required to In some embodiments, about 3.0 mg / kg of A D04872 and approximately 1.0 mg / kg AD04776 are available to those in need. In some embodiments, about 3.2 mg / kg of AD04872 and about 0 .8mg / kg of AD04776 will be administered to subjects in need of these. In some embodiments, about 2.7 mg / kg AD04872 and about 1.3 mg / kg A D04776 is administered to a subject in need thereof. Approximately 4.0 mg / kg of AD04872 and approximately 1.0 mg / kg of AD04776 were In some embodiments, about 3.3 mg / kg is administered to a subject in need thereof. kg of AD04872 and approximately 1.7 mg / kg of AD04776. In some embodiments, about 0.05 to about 5 mg / kg of AD is administered to a subject. AD04872 and about 0.05 to about 5 mg / kg AD04776 are required. In some embodiments, AD04872 and AD04776 are administered to a subject. Each dose is administered separately (e.g., in a separate injection). The doses of D04872 and AD04776 are administered together (eg, in the same injection). In some embodiments, each dose of AD04872 and AD04776 is administered as a single pharmaceutical agent. The composition is prepared.

[0073] In some embodiments, disclosed herein are methods for treating HBV infection or A method for preventing a disease or condition caused by BV infection, the method comprising administering to the patient a and administering to a subject in need thereof an effective amount of AD04872 and an effective amount of AD04982. In some embodiments, the AD inhibitor administered to a subject in need thereof The ratio of AD04872 to AD04982 is about 2:1. The ratio of AD04872 to AD04982 administered to subjects in need thereof is approximately 3: 1. In some embodiments, the AD administered to a subject in need thereof The ratio of AD04872 to AD04982 is about 4:1. The ratio of AD04872 to AD04982 administered to subjects in need thereof is approximately 1: 1. In some embodiments, the AD administered to a subject in need thereof The ratio of AD04872 to AD04982 is about 5:1. The ratio of AD04872 to AD04982 administered to subjects in need thereof is approximately 1: The answer is 2.

[0074] In some embodiments, about 1 mg / kg (mpk) of AD04872 and about 1 mg 100 mg / kg of AD04982 is administered to a subject in need thereof. In the form of about 1.5 mg / kg AD04872 and about 1.5 mg / kg AD049 82 is administered to a subject in need thereof. In some embodiments, about 2 AD04872 at 0.0 mg / kg and AD04982 at approximately 1.0 mg / kg were required to In some embodiments, about 3.0 mg / kg of A D04872 and approximately 1.0 mg / kg AD04982 for those in need. In some embodiments, about 3.2 mg / kg of AD04872 and about 0 .8mg / kg of AD04982 will be administered to subjects in need of these drugs. In some embodiments, about 2.7 mg / kg AD04872 and about 1.3 mg / kg A D04982 is administered to a subject in need thereof. Approximately 4.0 mg / kg of AD04872 and approximately 1.0 mg / kg of AD04982 were In some embodiments, about 3.3 mg / kg is administered to a subject in need thereof. kg of AD04872 and approximately 1.7 mg / kg of AD04982. In some embodiments, about 0.05 to about 5 mg / kg of AD is administered to a subject. AD04872 and about 0.05 to about 5 mg / kg AD04982 are required. In some embodiments, AD04872 and AD04982 are administered to a subject. Each dose is administered separately (e.g., in a separate injection). The doses of D04872 and AD04982 are administered together (eg, in the same injection). In some embodiments, each dose of AD04872 and AD04982 is administered as a single pharmaceutical agent. The composition is prepared.

[0075] In some embodiments, disclosed herein are methods for treating HBV infection or A method for preventing a disease or condition caused by BV infection, the method comprising administering to the patient a and administering to a subject in need thereof an effective amount of AD04580 and an effective amount of AD04585. In some embodiments, the AD inhibitor administered to a subject in need thereof The ratio of AD04580 to AD04585 is about 2:1. The ratio of AD04580 to AD04585 administered to subjects in need thereof is approximately 3: 1. In some embodiments, the AD administered to a subject in need thereof The ratio of AD04580 to AD04585 is about 4:1. The ratio of AD04580 to AD04585 administered to subjects in need thereof is approximately 5: 1. In some embodiments, the AD administered to a subject in need thereof The ratio of AD04580 to AD04585 is about 1:1. The ratio of AD04580 to AD04585 administered to subjects in need thereof is approximately 1: 2. In some embodiments, about 1 mg / kg (mpk) of AD04580 and Approximately 1 mg / kg of AD04585 is administered to a subject in need thereof. In some embodiments, about 1.5 mg / kg AD04580 and about 1.5 mg / kg A D04585 is administered to a subject in need thereof. About 0.05 to about 5 mg / kg of AD04580 and about 0.05 to about 5 mg / kg of A D04585 will be administered to subjects in need thereof.

[0076] In some embodiments, the HBV RNAi agents disclosed herein are AD05070 linked to (NAG37)s shown as a sodium salt with the structure Consisting of or including:

[0077] [ka]

[0078] [ka]

[0079] [ka]

[0080] [ka]

[0081] In some embodiments, the HBV RNAi agents disclosed herein are AD05070 linked to (NAG25)s shown as a sodium salt with the structure Consisting of or including:

[0082] [ka]

[0083] [ka]

[0084] [ka]

[0085] [ka]

[0086] In some embodiments, the HBV RNAi agents disclosed herein are The compound consists of AD05070 linked to (NAG37)s, shown as the free acid with the structure or contains:

[0087] [ka]

[0088] [ka]

[0089] [ka]

[0090] [ka]

[0091] In some embodiments, the HBV RNAi agents disclosed herein are AD04580 linked to (NAG31)s shown as the sodium salt with the structure Consisting of or including:

[0092] [ka]

[0093] [ka]

[0094] [ka]

[0095] [ka]

[0096] In some embodiments, the HBV RNAi agents disclosed herein are AD04585 linked to (NAG25)s shown as the sodium salt with the structure Consisting of or including:

[0097] [ka]

[0098] [ka]

[0099] [ka]

[0100] [ka]

[0101] In some embodiments, the HBV RNAi agents disclosed herein are AD04872 linked to (NAG37)s shown as the sodium salt with the structure Consisting of or including:

[0102] [ka]

[0103] [ka]

[0104] [ka]

[0105] [ka]

[0106] In some embodiments, the HBV RNAi agents disclosed herein are AD04872 linked to (NAG25)s shown as the sodium salt with the structure Consisting of or including:

[0107] [ka]

[0108] [ka]

[0109] [ka]

[0110] [ka]

[0111] In some embodiments, the HBV RNAi agents disclosed herein are The compound consists of AD04872 linked to (NAG37)s, shown as the free acid with the structure or contains:

[0112] [ka]

[0113] [ka]

[0114] [ka]

[0115] [ka]

[0116] In some embodiments, the described HBV RNAi agent(s) are Thus, it is often combined with one or more additional (i.e., second, third, etc.) treatments. The second treatment can be another HBV RNAi drug (e.g., an agent that targets another sequence in the HBV genome). Additional treatments include small molecule drugs, antibodies, antibody fragments, and The HBV RNAi agent may be administered in combination with one or more additional therapeutic agents, and / or a vaccine. and combining with one or more excipients to form a pharmaceutical composition. It is possible.

[0117] In some embodiments, the described HBV RNAi agent(s) are and / or one or more additional therapies, which additional therapies are nucleoside inhibitors. In some embodiments, the HBV inhibitor is an HBV inhibitor. The RNAi agent(s) are optionally combined with one or more additional therapeutics, Additional treatment options include entecavir, tenofovir, tenofovir alafenamide, and tenofovir disodium. Proxil, lamivudine, or other antiviral therapy. In accordance with the present invention, the HBV RNAi agent(s) described may optionally be combined with one or more additional In some embodiments, the additional treatment is interferon. In an embodiment, the described HBV RNAi agent(s) optionally comprise one or more and the additional treatment is interferon alpha. In one embodiment, the HBV RNAi agent(s) described optionally comprise one or in combination with an additional HBV treatment, where the additional treatment is an HBV vaccine. .

[0118] In some embodiments, the described HBV RNAi agent(s) are In one embodiment, the compound is combined with one or more additional therapeutic agents in a single dosage form (i.e., In some embodiments, the HBV R The NAi agent(s) may be administered separately from one or more optional additional therapeutics. In some embodiments, the described HBV RNAi agent(s) are administered subcutaneously. and administering to a subject in need thereof via injection, and optionally one or more follow-up Additional treatments are administered orally and together, they are used to treat diseases and conditions associated with HBV infection. In some embodiments, the therapeutic regimen is The Ai drug(s) are administered to a subject in need thereof via subcutaneous injection, and One or more optional additional therapeutics are administered via separate subcutaneous injections.

[0119] In some embodiments, disclosed herein is an HBV RNAi agent administered in A composition for delivery to a hepatocyte in vivo, the composition being conjugated to a targeting group. In some embodiments, the HBV RNAi agent is a conjugated or linked HBV RNAi agent. The targeting group is an asialoglycoprotein receptor ligand. In some embodiments, A composition for delivering HBV RNAi drugs to hepatocytes in vivo is described. The composition comprises an HBV RNAi linked to an N-acetyl-galactosamine targeting ligand. Including medicines.

[0120] In some embodiments, one or more of the described HBV RNAi agents: The compound is administered to a mammal in a pharma- ceutical carrier or diluent. This mammal is a human.

[0121] The use of Hepatitis B virus RNAi drug(s) may be used to treat diseases / disorders associated with HBV infection. Methods for therapeutic and / or prophylactic treatment are provided. Ai drugs mediate RNA interference to target a gene required for hepatitis B virus replication and / or pathogenesis. In particular, for example, HBV RNAi agents inhibit the expression of a gene or genes in cells, tissues, or or in mammals, viral polymerase, core protein, surface antigen, e antigen, and HBV RNAi agents can inhibit the expression of the HBV protein and / or the X protein. HBV RNAi drugs can also be used to treat chronic liver disease / injury associated with HBV infection, They can be used to treat or prevent inflammation, fibrotic conditions, and proliferative disorders, such as cancer. In some embodiments, the method further comprises detecting hepatitis D virus (HDV) in the subject. Such methods include the treatment of HBV in a human or animal infected with HBV. The method further comprises administering an HBV RNAi agent to hepatocytes in vivo. Compositions for delivery in vo are described.

[0122] Pharmaceutical compositions containing one or more HBV RNAi agents are useful in treating patients where local or systemic treatment is desired. Administration can be by a number of methods, depending on whether the drug is suitable for use or not. Intravenous administration, subcutaneous administration, intraperitoneal administration, subdermal administration (e.g., by using an implanted device) In some embodiments, the administration may be, but is not limited to, intravenous administration, intramuscular administration, and intraparenchymal administration. In one embodiment, the pharmaceutical compositions described herein are administered by subcutaneous injection.

[0123] The described HBV RNAi agents and / or compositions are useful for the therapeutic treatment of HBV infection, or The present invention can be used in a method for the therapeutic treatment of a disease or condition resulting from HBV infection. Such methods include administering an HBV RNAi agent described herein to a subject (e.g., a human or or animal subjects.

[0124] As used herein, the terms "oligonucleotide" and "polynucleotide" refer to means a polymer of linked nucleosides, each of which may be independently modified or unmodified. could be.

[0125] As used herein, an "RNAi agent" or "RNAi trigger" refers to a sequence-specific The method slows or inhibits translation of a target messenger RNA (mRNA) transcript. RNA or RNA-like (e.g., chemically modified RNA) oligonucleotide molecules that can As used herein, an RNAi agent refers to a composition that contains an RNA interference mechanism. mechanism (i.e., the RNA interference pathway machinery in mammalian cells (RNA-induced silencing complex) , which interacts with RISC (causing RNA interference) or through any surrogate RNAi drugs may act by an alternative mechanism(s) or pathway(s). As used herein, the term refers to a gene that is believed to act primarily via an RNA interference mechanism. However, the RNAi agents of the present disclosure are not constrained to any particular pathway or mechanism of action. The present invention is not limited to, and is not limited to, the RNAi The drugs contain a sense strand and an antisense strand, which can include short interfering RNA (siRNA), Stranded RNA (dsRNA), microRNA (miRNA), short hairpin RNA (shRNA) A), and Dicer substrates. The antisense strand of a drug is at least partially complementary to the targeted mRNA. Ai drugs contain modified nucleotides and / or one or more non-phosphodiester linkages. It can be seen.

[0126] As used herein, the terms "silence," "reduction," and "reducing" the expression of a given gene are used interchangeably. ", "inhibition," "downregulation," or "knockdown" means the reduction or elimination of expression of the gene. The expression level of RNA transcribed from a gene, or the cells in which the gene is transcribed, The expression of polypeptides, proteins, or polypeptides translated from mRNA in a cell population, tissue, organ, or subject The cell, cell population, or tissue is A tissue, organ, or subject is treated with an oligomeric compound, such as an RNAi agent, as described herein. When the cell is treated with the antibody, the cell is transferred to a second cell, group of cells, tissue, organ, or subject that has not been so treated. This means that it is reduced compared to

[0127] As used herein, the term "sequence" or "nucleotide sequence" refers to a nucleic acid sequence or It refers to a sequence or order of nucleotides and is written as a sequence of letters using standard nomenclature.

[0128] As used herein, a "nucleotide base" or "nucleobase" refers to a heterocyclic pyrimidine. Nucleotides are amino acid or purine compounds that are the standard building blocks of all nucleic acids. (adenine (A), guanine (G), cytosine (C), thymine (T), and uracil (U The nucleobases may be further modified, including universal salts. groups, hydrophobic bases, promiscuous bases, size-expanded bases, and fluorinated bases These include, but are not limited to:

[0129] As used herein, unless otherwise indicated, the term "complementary" refers to a first nucleotide A second nucleotide sequence is inserted into the target sequence (e.g., the sense strand of an RNAi agent or a target mRNA). A nucleic acid sequence (e.g., an antisense strand of an RNAi drug or a single-stranded antisense oligonucleotide) When used in conjunction with a nucleic acid sequence to describe an oligonucleotide that includes a first nucleotide sequence, The oligonucleotide or polynucleotide comprises a second nucleotide sequence. hybridizes to a polynucleotide under specific conditions (mammalian physiological conditions) (or similar in vitro conditions) to form base pair hydrogen bonds) to form duplexes. This means that the complementary sequences can form a double helix or a double helix structure. The hybridization may include at least one of the above hybridizations, such as Watson-Crick base pairs or non-Watson-Crick base pairs. Natural or modified nucleotides may be used as long as the required nucleotide sequence is met. Sequence identity or complementarity is independent of the modification. For example, a and Af are complementary to U (or T), and for the purpose of determining identity or complementarity, In terms of objective, it is identical to A.

[0130] As used herein, "perfectly complementary" or "fully complementary" refers to a first polynucleotide that is complementary to the first polypeptide. All (100%) of the bases in the contiguous sequence of nucleotides are identical to the bases in the contiguous sequence of the second polynucleotide. This means that the two sequences hybridize to the same number of bases in the sequence. It may comprise all or part of the nucleotide sequence of

[0131] As used herein, "partially complementary" refers to a hybridized nucleobase sequence that is In a pair of strings, at least but not all of the bases in a contiguous sequence of a first polynucleotide are 70% of the hybridization sequences hybridize to the same number of bases in a contiguous sequence of a second polynucleotide. This means that

[0132] As used herein, "substantially complementary" refers to a hybridized nucleobase sequence that is In a pair of strings, at least but not all of the bases in a contiguous sequence of a first polynucleotide are Approximately 85% of the hybridization sequences hybridize to the same number of bases in a contiguous sequence of a second polynucleotide. The terms "complementary," "fully complementary," and "substantially complementary" mean As used herein, the term "antisense strand of a double-stranded RNAi agent" refers to a strand of an RNAi agent that is a double-stranded RNAi agent. Between the antisense strand and the sequence of the target mRNA, or between the single-stranded antisense oligonucleotide It can be used in reference to base matching between the sequence of the target mRNA and the base of the target sequence.

[0133] As used herein, the terms "substantially identical" or "substantially identical" refer to nucleic acid sequences. When applied to an array, the nucleic acid sequence is preferably at least about 85% or more similar to the reference sequence. or at least 90%, at least 95%, or at least 99% sequence identity. The percentage of sequence identity is calculated by dividing the two most significant sequences by the number of sequences over the comparison window. This percentage is determined by comparing properly aligned sequences. The number of matching positions is obtained by counting the number of positions that occur in both sequences, and the number of matching positions is calculated. The number of positions in the window is divided by the total number of positions in the window and the result is multiplied by 100 to obtain the percentage of sequence identity. The invention disclosed herein is calculated by obtaining the following: and 4, which are substantially identical to the nucleotide sequences disclosed herein. In some embodiments, the sequences disclosed herein include those listed in Table 1, for example. , 2, 3 and 4, which are exactly the same as or at least Approximately 85%, 86%, 87%, 88%, 89%, 90%, 91%, 92%, 93%, 9 4%, 95%, 96%, 97%, 98% or 99% identical.

[0134] As used herein, the terms "treat," "treatment," and similar terms refer to a method of treating a subject. Reducing or alleviating the number, severity, and / or frequency of one or more symptoms of a disease or condition in "Method" refers to a method or process carried out to provide

[0135] As used herein, the phrase "introducing into a cell" in reference to an oligomeric compound means that the oligomeric compound is functionally delivered into the cell. The phrase "oligomeric compounds" refers to compounds that exhibit the desired biological activity (sequence-specific inhibition of gene expression). and delivering said oligomeric compounds into cells in a manner that allows said oligomeric compounds to have a therapeutic effect on the cell's ability to inhibit cell proliferation and cell death. means...

[0136] Unless otherwise stated, the symbols

[0137] [ka] The use of, as used herein, is in accordance with the scope of the invention described herein. It refers to any group or groups that can be linked to it.

[0138] As used herein, the term "isomers" refers to compounds that have the same molecular formula but differ in their origin. The term refers to compounds which differ in the nature or sequence of bonds between the atoms or in the arrangement of the atoms in space. Isomers that differ in the arrangement of their atoms in space are termed "stereoisomers." Stereoisomers that are not mirror images of each other are called "diastereomers" and are non-superimposable mirror images. Stereoisomers that are image-like structures are called "enantiomers" or sometimes optical isomers. The carbon atom bonded to the substituent is termed a "chiral center."

[0139] As used herein, a molecule specifically depicted in a structure as having a particular conformation. Unless otherwise specified, asymmetric centers may exist and thus enantiomers, diastereomers, For each structure in which stereoisomeric or other stereoisomeric configurations occur, each of the structures disclosed herein is The structures are intended to represent all such possible isomers, including their optically pure forms. For example, the structures disclosed herein may be in diastereomeric or racemic form. It is intended to include mixtures of mers as well as single stereoisomers.

[0140] When used in the claims of this application, the term "consisting of" shall mean any compound that is specific to the claim. "Excludes any element, step, or ingredient that is not essential to the invention." The phrase "becomes" refers to the materials or steps specified, as well as the basic and Limit the scope of the claims to those that do not materially affect the novel feature(s).

[0141] The compounds and compositions disclosed herein may be used in conjunction with the environment in which the compound or composition is placed. Depending on the It will be readily understood and appreciated by those skilled in the art that the present invention may be in a state where the As used herein, the structures disclosed herein may include those that incorporate certain functional groups (e.g., OH It is contemplated that the aryl, SH, or NH groups may be protonated or deprotonated. The disclosure provides, as can be readily understood by one of ordinary skill in the art, protonation based on the environment (e.g., pH). Regardless of the state of the art, the disclosed compounds and compositions are intended to be encompassed.

[0142] Unless otherwise defined, all technical and scientific terms used herein are understood to be within the skill of the art. The same meaning as that commonly understood by the United States and other countries is used in this specification. Although equivalent methods and materials can be used to practice or test the present invention, Suitable methods and materials are described below. All patents and other references are incorporated by reference in their entirety. Where applicable, the present specification, including definitions, applies. In addition, materials, methods, and practices The examples are merely illustrative and are not intended to be limiting.

[0143] Other features and advantages of the invention are described in the following detailed description, as well as in the claims. It will be clear from the scope of DETAILED DESCRIPTION OF THE PREFERRED EMBODIMENTS

[0144] Described herein is a method for inhibiting the expression of Hepatitis B virus (HBV) using a RNA-binding domain. Ai drugs (referred to herein as HBV RNAi drugs or HBV RNAi triggers) Each HBV RNAi drug contains a sense strand and an antisense strand. Each of the sense strands can be 16 to 30 nucleotides in length. In this case, the sense strand and the antisense strand may each be 17 to 26 nucleotides in length. The sense and antisense strands can be the same or different lengths. In some embodiments, the sense strand and the antisense strand each independently comprise 17 to 26 nucleotides. In some embodiments, the sense strand and the antisense strand each have a length of In some embodiments, the sense strand and the amplicons are independently 17 to 21 nucleotides in length. In some embodiments, both the antisense and antisense strands are 21 to 26 nucleotides in length. In this case, the sense strand is approximately 19 nucleotides long and the antisense strand is approximately 21 nucleotides long. In some embodiments, the sense strand is about 21 nucleotides in length and the antisense strand is about 21 nucleotides in length. In some embodiments, the sense strand and the antisense strand are about 23 nucleotides in length. In some embodiments, both strands of the RNase A are 26 nucleotides in length. The sense and antisense strands of the Ai drugs were independently determined as 17, 18, 19, 20, 21, In some embodiments, the nucleic acid sequence is 22, 23, 24, 25, or 26 nucleotides in length. In one embodiment, the double-stranded RNAi agent is a The duplex length between the sense and antisense strands is 1 nucleotide. The region of substantial complementarity typically has 15 to 25 (e.g., 15, 16, 17, 18, 19 , 20, 21, 22, 23, 24, or 25) nucleotides in length, which is This region occurs at or near the 5' end of the antisense strand (e.g., ' 0, 1, 2, 3, or 4 nucleotides from the end that are not completely or substantially complementary (They may be separated by this.)

[0145] The sense strand and the antisense strand each have a core strand length of 16 to 23 nucleic acid bases. The antisense strand core stretch sequence is present in the HBV mRNA target. For a nucleotide sequence that matches the target sequence (sometimes called a target sequence), ) or at least about 85% (substantially) complementary to the sense strand core stretch sequence. The sequence may be 100% (perfectly) complementary to the core stretch sequence of the antisense strand or The sense strand core stretch sequence is at least about 85% (substantially) complementary to H Completely identical or identical to the nucleotide sequence present in the BV mRNA target (target sequence) At least about 85% identical. The sense strand core stretch sequence is It may be the same length as the core sequence or may be a different length. In the present invention, the antisense strand core stretch sequence is In some embodiments, the sense strand core sequence is 1, 2, or 3 nucleotides in length. The stretch sequence is 16, 17, 18, 19, 20, 21, 22, or 23 nucleotides in length. It is.

[0146] Sense and antisense nucleotides used to form HBV RNAi drugs Examples of nucleotide sequences are provided in Tables 3 and 4. Examples of Ai drug duplexes are provided in Table 5.

[0147] The sense and antisense strands of the HBV RNAi drug anneal to form a duplex. The sense and antisense strands of the HBV RNAi agent form, in part, substantially In the complementary duplex region, the nucleotides may be partially or completely complementary to each other. The sense strand core stretch sequence is at least about 85% complementary, or 100% complementary. In some embodiments, the sense strand core The stretch sequences are the 16, 17, 18, and 1 stretch sequences corresponding to the antisense strand core stretch sequences. At least about 85% or 100% identical to the 9, 20, or 21 nucleotide sequence Complementary, at least 16, at least 17, at least 18, at least 19, A sequence of at least 20 or at least 21 nucleotides (i.e., HB V The sense strand and antisense core stretch sequences of the RNAi agent are at least 85% Base paired or 100% base paired, at least 16, at least 1 7, at least 18, at least 19, at least 20, or at least 21 nucleotide region of

[0148] In some embodiments, the antisense oligonucleotides of the HBV RNAi agents disclosed herein are The antisense strand may contain 0, 1, 2, or 3 nucleotides from either the antisense strand sequences in Table 2 or Table 3. In some embodiments, the HBV RNases disclosed herein have different nucleotides. The sense strand of the Ai drug is selected from 0, 1, 2, or 3 of the sense strand sequences in Table 2 or Table 4. nucleotides differ.

[0149] The lengths of the sense and antisense strands of the HBV RNAi agents described herein are determined independently. In some embodiments, the sense strand and the amplicon are 16 to 30 nucleotides in length. In some embodiments, the sense strands are independently 17 to 26 nucleotides in length. In some embodiments, the sense strand and the antisense strand are 19 to 26 nucleotides in length. In the described RNAi agents, the sense and antisense strands are independently The sense strand and the α strand are 20, 21, 22, 23, 24, 25, or 26 nucleotides in length. The antisense strands can be the same length or different lengths. In some cases, the sense and antisense strands are each 26 nucleotides long. In an embodiment, the sense strand is 23 nucleotides long and the antisense strand is 21 nucleotides long. In some embodiments, the sense strand is 22 nucleotides long and the antisense strand is 24 nucleotides long. The strand is 21 nucleotides in length. In some embodiments, the sense strand is 21 nucleotides in length. In some embodiments, the antisense strand is 21 nucleotides long. The sense strand is 19 nucleotides long and the antisense strand is 21 nucleotides long.

[0150] The sense strand and / or the antisense strand may optionally and independently be at the 3' end, 5' end, or 1, 2, 3, 4, 5, or 6 additional nucleotides at either end, or at both the 3' and 5' ends If there are additional nucleotides in the antisense strand, the HB V mRNA. If there are additional nucleotides in the sense strand, they are compared to the corresponding sequence in HBV mRNA. Additional nucleotides in the antisense strand may or may not be identical. If there is an additional nucleotide in the corresponding sense strand, it is complementary to this or may not be complementary.

[0151] As used herein, an extension refers to a sequence that includes a sense strand core stretch sequence and / or an antisense strand core stretch sequence. 1, 2, 3, 4, 5, or 6 at the 5' and / or 3' end of the sense strand core stretch sequence The extension nucleotides of the sense strand contain nucleotides equal to or greater than the corresponding nucleotides of the antisense strand. Nucleotides (either core stretch sequence nucleotides or extender nucleotides) It may or may not be complementary to the antisense strand. The extender nucleotides are the same as the corresponding nucleotides of the sense strand (the core stretch sequence nucleotides). nucleotides, or extension nucleotides) In some embodiments, the sense and antisense strands of an RNAi agent may be In some embodiments, both of the strands include a 3' and a 5' extension. One or more 3' extension nucleotides are linked to one or more 5' extension nucleotides of the other strand. In another embodiment, one or more 3' extension nucleotides of one strand are base-paired with the other nucleotides. The nucleotide does not base pair with one or more 5' extension nucleotides of the other strand. In some embodiments, the HBV RNAi agent is an antisense oligonucleotide having a 3' extension. The sense strand has a 5' extension.

[0152] In some embodiments, the HBV RNAi agent is a 1, 2, 3, 4, 5, or 6 nucleotide In another embodiment, the HB V RNAi agents are antisense strands with 3' extensions of 1, 2, or 3 nucleotides in length. In some embodiments, one or more of the antisense strand extension nucleotides The dots are uracil or thymidine nucleotides or corresponding HBV mRNA sequences. In some embodiments, the 3' antisense strand extension comprises a complementary nucleotide. The divisions are AUA, UGCUU, CUG, UG, UGCC, CUGCC, CGU, CUU, U GCCUA, CUGCCU, UGCCU, UGAUU, GCCUAU, T, TT, U, U U (each written 5'→3') .

[0153] In some embodiments, the 3' end of the antisense strand is provided with an additional abasic nucleoside. In some embodiments, the Ab or AbAb may comprise an antisense oligonucleotide. The 3′ end of the second strand may be added to the 3′ end of the second strand.

[0154] In some embodiments, an HBV RNAi agent comprises 1, 2, 3, 4, or 5 nucleotides. In another embodiment, the antisense strand comprises an HBV RNAi agents contain an antisense strand with a 5' extension of 1 or 2 nucleotides in length. In some embodiments, one or more of the antisense strand extension nucleotides are uracil or thymidine nucleotides or nucleotides complementary to the corresponding HBV mRNA sequence. In some embodiments, the 5' antisense strand extension comprises a UA, T Contains or consists of U, U, T, UU, TT, CUC (each written 5'→3') The antisense strand may be, but is not limited to, a 5' antisense strand extension as described. In combination with the 3' extension (if present), it may have any of the 3' extensions mentioned above.

[0155] In some embodiments, an HBV RNAi agent comprises 1, 2, 3, 4, or 5 nucleotides. In some embodiments, the sense strand comprises a 3' extension of 10 bp. The plurality of sense strand extension nucleotides are adenosine, uracil, or thymidine nucleotides. nucleotide, AT dinucleotide, or nucleotide corresponding to a nucleotide in the HBV mRNA sequence. In some embodiments, the 3' sense strand extension comprises a T, UT, TT, U Contains U, UUT, TTT, or TTTT (written 5'→3', respectively) The examples include, but are not limited to,

[0156] In some embodiments, the 3' end of the sense strand contains an additional abasic nucleoside. In some embodiments, UUAb, UAb, or Ab may comprise 3′-amino acids of the sense strand. In some embodiments, the 3′ end of the sense strand may be added to the 3′ end of the sense strand. One or more abasic nucleosides may be inverted (invAb). In an embodiment, one or more inverted abasic nucleosides are combined with a targeting ligand: In some embodiments, the nucleic acid sequence of the RNAi agent may be inserted between the nucleic acid sequence of the sense strand of the RNAi agent. In one embodiment, one or more inverted abasic nucleosides are attached to the end of the sense strand of the RNAi agent. Inclusion of a nucleotide sequence at or near a position that enhances the activity of an RNAi agent or provides other desirable properties Sexuality may become possible.

[0157] In some embodiments, the HBV RNAi agent is a 1, 2, 3, 4, 5, or 6 nucleotide In some embodiments, the sense strand comprises a nucleotide-length 5' extension. or a plurality of the sense strand extension nucleotides are uracil or adenosine nucleotides, or It contains nucleotides corresponding to nucleotides in the HBV mRNA sequence. In this embodiment, the sense strand 5' extension is CA, AUAGGC, AUAGG, AUAG, AU A, A, AA, AC, GCA, GGCA, GGC, UAUCA, UAUC, UCA, UA It can be, but is not limited to, U, U, UU (written 5'→3'). The strand can have a 3' extension and / or a 5' extension.

[0158] In some embodiments, the 5' end of the sense strand is provided with an additional abasic nucleoside ( In some embodiments, the nucleoside may comprise a base pair (AbAb) or a plurality of abasic nucleosides (AbAb). In the present invention, one or more abasic nucleosides added to the 5' end of the sense strand are reverse In some embodiments, one or more inverted bases may be A missing nucleoside is inserted between the targeting ligand and the nucleobase sequence of the sense strand of the RNAi agent. In some embodiments, one or more inverted abasic nucleosides may be inserted. by including a nucleotide sequence at or near the end(s) of the sense strand of the RNAi agent, Enhanced activity or other desirable properties of RNAi agents may be possible.

[0159] Examples of nucleotide sequences used to form HBV RNAi agents are shown in Table 3 and 4. In some embodiments, the antisense strand of an HBV RNAi agent is In some embodiments, the HB The antisense strand of the V RNAi agent can be any of the sequences in Table 3, 1-17, 2-15, 2- 17, 1-18, 2-18, 1-19, 2-19, 1-20, 2-20, 1-21, 2- 21, 1-22, 2-22, 1-23, 2-23, 1-24, 2-24, 1-25, 2- In some embodiments, the sequence comprises 25, 1-26, or 2-26 nucleotides. The sense strand of the HBV RNAi agent comprises the nucleotide sequence of any of the sequences in Table 4. In some embodiments, the sense strand of an HBV RNAi agent is any of the sequences in Table 4. 1-18, 1-19, 1-20, 1-21, 1-22, 1-23, 1-24, 1-25 , 1-26, 2-19, 2-20, 2-21, 2-22, 2-23, 2-24, 2-25 , 2-26, 3-20, 3-21, 3-22, 3-23, 3-24, 3-25, 3-26 , 4-21, 4-22, 4-23, 4-24, 4-25, 4-26, 5-22, 5-23 , 5-24, 5-25, 5-26, 6-23, 6-24, 6-25, 6-26, 7-24 , 7-25, 7-25, 8-25, and 8-26 of the nucleotide sequence.

[0160] In some embodiments, the sense and anti-strands of the RNAi agents described herein The sense strand contains the same number of nucleotides. The sense and antisense strands of a given RNAi agent contain different numbers of nucleotides. In some embodiments, the 5' end of the sense strand and the 3' end of the antisense strand of the RNAi agent. The ends form blunt ends. In some embodiments, the 3' end of the sense strand of the RNAi agent The end and the 5' end of the antisense strand form a blunt end. In some embodiments, the RNAi agent is blunt ended. None of the ends of the drug are blunt. As used herein, blunt ends refers to RNA At the ends of the Ai drug duplex, the terminal nucleotides of the two annealed strands are complementary (complementary base pairing). In some embodiments, the RNA The 5' end of the sense strand and the 3' end of the antisense strand of the drug are frayed ends. In some embodiments, the 3' end and amplicons of the sense strand of the RNAi agent are In some embodiments, the 5' end of the sense strand forms a frayed end. Both ends of the Ai agent form frayed ends. None of the ends are frayed ends. As used herein, a frayed end means: At the ends of the RNAi drug duplex, the terminal nucleotides of the two annealed strands form pairs (i.e., do not form an overhang) but are not complementary (i.e., non-complementary As used herein, an overhang means a pair of A stretch of one or more unpaired nucleotides at the end of one strand of an RNAi agent. The unpaired nucleotide may be on the sense or antisense strand and may be 3' or 5' In some embodiments, the RNAi agent forms either Blunt and frayed ends, blunt and 5' overhang ends, blunt and 3' overhang ends overhanging end, frayed end and 5' overhanging end, frayed end and a3' overhanging end, two 5' overhanging ends, two 3' overhanging ends, 5' overhanging end and 3' overhanging end, two frayed ends, or two Contains blunt ends.

[0161] A nucleotide base (nucleobase) is a heterocyclic pyrimidine or purine compound. are the building blocks of all nucleic acids and consist of adenine (A), guanine (G), cytosine (C), As used herein, the term "nucleotide" includes nucleotides such as cytosine (C), cytosine (D), cytosine (F), cytosine (G), cytosine (H), cytosine (K), cytosine (T), and uracil (U). "A" refers to a modified nucleotide (e.g., a nucleotide mimic, an abasic site (Ab), or Modified nucleotides may include a variety of polynucleotides or oligonucleotides. When used in nucleotide constructs, they increase the serum stability of the compound while simultaneously promoting its activity in cells. and further comprising a polynucleotide or oligonucleotide. Minimize the possibility of activating interferon activity in the human body when the construct is administered It is possible to do so.

[0162] In some embodiments, the HBV RNAi agent is administered as a salt, mixed salt, or free acid. In some embodiments, the HBV RNAi agent is a sodium salt. Such forms are within the scope of the invention disclosed herein.

[0163] Modified Nucleotides In some embodiments, the HBV RNAi agent comprises one or more modified nucleotides. As used herein, a "modified nucleotide" includes a ribonucleotide (2 In some embodiments, the nucleotide is a nucleotide other than a '-hydroxyl nucleotide. At least 50% (e.g., at least 60%, at least 70%, at least 80%) %, at least 90%, at least 95%, at least 97%, at least 98%, at least At least 99%, or 100%, of the nucleotides in the nucleic acid sequence are modified nucleotides. When used, modified nucleotides include deoxyribonucleotides, nucleotide mimics, abasic nucleotides (referred to herein as Ab), 2'-modified nucleotides tide, 3'-3' linked (inverted) nucleotides (referred to herein as invdN, invN , invn, invAb), nucleotides containing unnatural bases, bridged nucleotides , peptide nucleic acid (PNA), 2',3'-seco nucleotide mimics (unlocked Nucleobase analogues, as used herein, UNA or NUNA), Rocktonuk Reotide (referred to herein as N LNA or NLNA), 3'-O-methoxy (2' internucleoside linkage) nucleotide (referred to herein as 3'-O Men) ), 2'-F-arabinonucleotide (referred to herein as NfANA or Nf ANA and 5'-Me, 2'-fluoronucleotides (represented herein as 5Me-N f), morpholino nucleotides, vinyl phosphonate deoxyribonucleoside vpdN, a vinylphosphonate-containing nucleotide and cyclopropylphosphonate-containing nucleotides (cPrpN), which 2'-modified nucleotides (i.e., hydroxyl groups at the 2' position of the sugar ring) are not limited to the following: Nucleotides having a group other than a syl group include 2'-O-methyl nucleotides (as defined herein). (represented in nucleotide sequences as a lower case "n"), 2'-deoxy-2'- Fluoronucleotides (herein referred to as Nf, also referred to as 2'-fluoronucleotides) nucleotides (referred to herein as dN), 2'-deoxynucleotides (referred to herein as dN), 2'-methyl 2'-O-2-methoxyethyl nucleotides (referred to herein as N or 2'-MOE), 2'-amino nucleotides, and 2'-alkyl nucleotides. Modifications that uniformly modify all positions in a given compound include, but are not limited to, Conversely, multiple modifications may be combined into a single HBV RNAi agent, or even into a single HBV RNAi agent. The sense and antisense strands of HBV RNAi agents can be The sense strand can be synthesized and / or modified by methods well known in the art. A modification at one nucleotide is independent of the modification at another nucleotide.

[0164] Modified nucleobases include synthetic and natural nucleobases, including 5-substituted pyrimidines. 2-azapyrimidines, 6-azapyrimidines and N-2, N-6 and O-6 substituted purines, e.g. aminopropyladenine, 5-propynyluracil, or 5-propynylcytosine), 5- Methylcytosine (5-me-C), 5-hydroxymethylcytosine, xanthine, hypoxine Santhin, 2-aminoadenine, 6-alkyl (e.g., 6-methyl) adenine and guanine 6-ethyl, 6-isopropyl, or 6-n-butyl) derivatives, adenine and guanine 2-alkyl (e.g., 2-methyl, 2-ethyl, 2-isopropyl, or 2-n -butyl) and other alkyl derivatives, 2-thiouracil, 2-thiothymine, 2-thio Cytosine, 5-halouracil, cytosine, 5-propynyluracil, 5-propynylcytosine 6-Azo-uracil, 6-Azo-cytosine, 6-Azo-thymine, 5-uracil (pseudo Uracil), 4-thiouracil, 8-halo, 8-amino, 8-sulfhydryl, 8-thio Alkyl, 8-hydroxyl and other 8-substituted adenines and guanines, 5-halo (e.g. , 5-bromo), 5-trifluoromethyl, and other 5-substituted uracils and cytosines, 7 -methylguanine and 7-methyladenine, 8-azaguanine and 8-azaadenine, 7 -deazaguanine, 7-deazaadenine, 3-deazaguanine, and 3-deazaadenine Examples include:

[0165] In some embodiments, all or substantially all of the nucleotides of the RNAi agent are modified. As used herein, substantially all nucleotides are modified nucleotides. RNAi drugs, which are nucleotides, have sense and antisense strands that are ribonucleotides. In both cases, four or fewer (i.e., 0, 1, 2, 3, or 4) nucleotides are As used herein, an RNAi agent is an RNAi agent in which substantially all of the nucleotides are modified. The sense strand that is a ribonucleotide has two or less The sense strand has at least one (i.e., 0, 1, or 2) modified nucleotides. As used herein, an antisense oligonucleotide is an antisense oligonucleotide in which substantially all of the nucleotides are modified nucleotides. The sense strand has two or fewer (i.e., 0, 1, or is the antisense strand having two modified nucleotides. In one embodiment, one or more nucleotides of the RNAi agent are ribonucleotides.

[0166] Modified Internucleoside Linkages In some embodiments, one or more nucleotides of an HBV RNAi agent include: linked by non-standard linkages or backbone chains (i.e., modified internucleoside linkages or In some embodiments, the modified internucleoside linkages are phosphate-free. Modified internucleoside linkages or backbone chains include 5' - phosphorothioate groups (represented herein as lower case "s"), chiral phosphonates Phosphorothioate, thiophosphate, phosphorodithioate, phosphotriester, amine No. 1 alkyl-phosphotriesters, alkyl phosphonates (e.g., methyl phosphonates or 3'-alkylene phosphonate), chiral phosphonate, phosphinate, phosphoro Amidates (e.g., 3'-amino phosphoramidates, aminoalkyl phosphoramidates) thionoalkyl-phosphonates, thionoalkyl-phosphonates, or thionophosphoramidates boranophosphotriesters, morpholino linkages, and normal 3'-5' linkages 2'-5' linked analogs of boranophosphate, boranophosphate, or boranophosphate with reverse polarity. Sulfate (where the adjacent nucleoside pair units are 3'-5' to 5'-3' or 2'-5' In some embodiments, the modified amino acid sequence includes, but is not limited to, the 5'-2' amino acid sequence. The modified internucleoside linkage or backbone does not have a phosphorus atom. Intersugar linkages include short chain alkyl or cycloalkyl intersugar linkages, mixed heteroatoms and alkyl groups. an alkyl or cycloalkyl intersugar linkage, or one or more short chain heteroatoms or hetero In some embodiments, modifications include, but are not limited to, cyclic intersugar linkages. Internucleoside backbones include siloxane backbones, sulfide backbones, and sulfoxide backbones. , sulfone backbone chain, formacetyl and thioformacetyl backbone chain, methyleneformacetyl acetyl and thioformyl acetyl backbones, alkene-containing backbones, sulfamate backbones, methyl imino and methylenehydrazino backbones, sulfonate and sulfonamide backbones, Mido backbone, and N, O, S, and CH 2 Other backbone chains having moieties are also included. The present invention is not limited to these.

[0167] In some embodiments, the sense strand of an HBV RNAi agent is 1, 2, 3, 4, 5 or six phosphorothioate linkages, and the antisense strand of the HBV RNAi agent may may contain 1, 2, 3, 4, 5, or 6 phosphorothioate linkages, or the sense strand and Both antisense strands independently contain 1, 2, 3, 4, 5, or 6 phosphorothioate linkages. In some embodiments, the sense strand of an HBV RNAi agent may include 1, 2, The antisense strand of the HBV RNAi agent may contain 3 or 4 phosphorothioate linkages. may contain 1, 2, 3, or 4 phosphorothioate linkages, or the sense and anti Both sense strands can independently contain 1, 2, 3, or 4 phosphorothioate linkages.

[0168] In some embodiments, the sense strand of an HBV RNAi agent comprises at least two holonucleotides. In some embodiments, at least one of the nucleoside linkages is Two phosphorothioate internucleoside linkages are located at positions 1-3 from the 3' end of the sense strand. In some embodiments, at least two phosphorothioates are present between the nucleotides. The internucleoside linkages are at positions 1-3, 2-4, 3-5, and 4-6 from the 5' end of the sense strand. , 4-5, or 6-8 nucleotides from the HBV The antisense strand of the RNAi agent contains four phosphorothioate internucleoside linkages. In some embodiments, the four phosphorothioate internucleoside linkages are Between nucleotides 1 to 3 from the 5' end of the nucleotide strand and nucleotides 19 to 21 from the 5' end of the nucleotide strand , 20-22, 21-23, 22-24, 23-25, or 24-26 nucleotides In some embodiments, the HBV RNAi agent has at least two phosphorothioate internucleoside linkages in the antisense strand and three or four phosphorothioate internucleoside linkages in the antisense strand. and thioate internucleoside linkages.

[0169] In some embodiments, the HBV RNAi agent comprises one or more modified nucleotides. In some embodiments, the nucleoside linkage comprises one or more modified internucleoside linkages. The 2'-modified nucleoside is combined with a modified internucleoside linkage.

[0170] HBV RNAi drugs In some embodiments, the HBV RNAi agents disclosed herein are selected from the group consisting of those listed in the table below. The HBV gene is targeted at or near the location of the HBV genome shown in FIG. In some embodiments, the antisense strand of an HBV RNAi agent disclosed herein is HBV 19-mer sequences disclosed in Table 1. The stretch comprises a core stretch sequence that is at least partially complementary to the base pair.

[0171] [Table 1]

[0172] In some embodiments, the HBV RNAi agent is the antisense strand (5' to 3') Position 19 of the 19-mer target sequence is base-paired with position 1 of the 19-mer target sequence disclosed in Table 1. In some embodiments, the HBV RNAi agent comprises an antisense strand capable of: Position 1 of the antisense strand (5'→3') is the position of the 19-mer target sequence disclosed in Table 1. The antisense strand is capable of base pairing with position 19.

[0173] In some embodiments, the HBV RNAi agent is the antisense strand (5' to 3') Position 2 of the 19-mer target sequence is base-paired with position 18 of the 19-mer target sequence disclosed in Table 1. In some embodiments, the HBV RNAi agent comprises an antisense strand capable of: Positions 2-18 of the antisense strand (5'→3') are selected from the 19-mer target sequence disclosed in Table 1. Amino acids that can form base pairs with each of the complementary bases located at positions 18-2 of the sequence. Contains the sense strand.

[0174] In some embodiments, the HBV RNAi agent is a Core 19-m RNAi polypeptide as shown in Table 2 below. er nucleotide sequence.

[0175] [Table 2]

[0176] HBV RNAi agent sense strands comprising or consisting of the nucleotide sequences of Table 2 The antisense strand may contain modified or unmodified nucleotides. In an embodiment, the sense strand sequence comprises or consists of the nucleotide sequence of Table 2. The HBV RNAi agent has an antisense strand sequence that is entirely or substantially entirely modified nucleotides. This is the punch line.

[0177] In some embodiments, the antisense oligonucleotides of the HBV RNAi agents disclosed herein are The antisense strand may be selected from any of the antisense strand sequences in Table 2 by 0, 1, 2, or 3 nucleotides. In some embodiments, the HBV RNAi agents disclosed herein have different The sense strand may be selected from any of the sense strand sequences in Table 2, including 0, 1, 2, or 3 nucleotides. is different.

[0178] The modified HBV RNAi drug antisense strand sequences, as well as the underlying unmodified sequences, are shown in Table 1. 3. The sense strand of the modified HBV RNAi agent, as well as the underlying unmodified sequence In forming an HBV RNAi agent, the Each nucleotide in each of the unmodified sequences can be a modified nucleotide.

[0179] As used herein (including in Tables 3 and 4), modified nucleotides, targeting groups, and The following nomenclature is used to denote the linking groups. As will be readily understood by one of skill in the art, Unless otherwise indicated by the sequence, when present in an oligonucleotide, the monomer is -3'-phosphodiester bonds link them together. A = adenosine-3'-phosphate C=Cytidine-3'-phosphate G=guanosine-3'-phosphate U = uridine-3'-phosphate n = any 2'-OMe modified nucleotide a = 2'-O-methyladenosine-3'-phosphate as = 2'-O-methyladenosine-3'-phosphorothioate c = 2'-O-methylcytidine-3'-phosphate cs = 2'-O-methylcytidine-3'-phosphorothioate g = 2'-O-methylguanosine-3'-phosphate gs = 2'-O-methylguanosine-3'-phosphorothioate t=2'-O-methyl-5-methyluridine-3'-phosphate ts = 2'-O-methyl-5-methyluridine-3'-phosphorothioate u = 2'-O-methyluridine-3'-phosphate us = 2'-O-methyluridine-3'-phosphorothioate Nf = any 2'-fluoro modified nucleotide Af = 2'-fluoroadenosine-3'-phosphate Afs = 2'-fluoroadenosine-3'-phosphorothioate Cf = 2'-fluorocytidine-3'-phosphate Cfs = 2'-fluorocytidine-3'-phosphorothioate Gf = 2'-fluoroguanosine-3'-phosphate Gfs = 2'-fluoroguanosine-3'-phosphorothioate Tf = 2'-fluoro-5'-methyluridine-3'-phosphate Tfs = 2'-fluoro-5'-methyluridine-3'-phosphorothioate Uf = 2'-fluorouridine-3'-phosphate Ufs = 2'-fluorouridine-3'-phosphorothioate dN = any 2'-deoxyribonucleotide dT = 2'-deoxythymidine-3'-phosphate N UNA =2',3'-seco nucleotide mimetics (unlocked nucleobase analogues) N LNA = Locked nucleotide Nf ANA = 2'-F-arabinonucleotide NM = 2'-methoxyethyl nucleotide AM = 2'-methoxyethyl adenosine-3'-phosphate AMs = 2'-methoxyethyl adenosine-3'-phosphorothioate TM = 2'-methoxyethylthymidine-3'-phosphate TMs = 2'-methoxyethylthymidine-3'-phosphorothioate R=Ribitol (invdN) = any inverted deoxyribonucleotide (3'-3' linked nucleotide) D) (invAb) = inverted (3'-3' linked) abasic deoxyribonucleotide, Table 6 reference (invAb)s = inverted (3'-3' linked) abasic deoxyribonucleotide-5 '-phosphorothioate, see Table 6 (invn) = any inverted 2'-OMe nucleotide (3'-3' linked nucleotide) ) s=phosphorothioate linkage vpdN = vinylphosphonate deoxyribonucleotide (5Me-Nf) = 5'-Me, 2'-fluoro nucleotide cPrp = cyclopropylphosphonate, see Table 6 epTcPr=See Table 6 epTM=See Table 6

[0180] Those skilled in the art will recognize that the terminal nucleotide at the 3' end of a given oligonucleotide sequence is typically Specifically, ex vivo, instead of the phosphate moiety, each 3' It will be readily understood that the aryl group has a hydroxyl (-OH) group at the position of As shown in the structural representation of AD05070 above, the antisense The "g" modified nucleotide at the 3' end of the strand has a hydroxyl group at the 3' position. The HBV RNAi agents and compositions of the HBV RNAi agents disclosed herein are In the description, unless otherwise stated herein, such understanding by those skilled in the art will be used.

[0181] Targeting and linking groups include (PAZ), (NAG13), (NAG13)s, (NAG 18), (NAG18)s, (NAG24), (NAG24)s, (NAG25), (N AG25)s, (NAG26), (NAG26)s, (NAG27), (NAG27)s , (NAG28), (NAG28)s, (NAG29), (NAG29)s, (NAG3 0), (NAG30)s, (NAG31), (NAG31)s, (NAG32), (NA G32)s, (NAG33), (NAG33)s, (NAG34), (NAG34)s, (NAG35), (NAG35)s, (NAG36), (NAG36)s, (NAG37 ), (NAG37)s, (NAG38), (NAG38)s, (NAG39), (NAG 39)s, the chemical structures of which are provided in Table 6. The sense strand may have any of the targeting or linking groups described above, as well as other targeting or linking groups. These are conjugated to the 5' and / or 3' ends of the sequences.

[0182] [Table 3-1]

[0183] [Table 3-2]

[0184] [Table 3-3]

[0185] [Table 4-1]

[0186] [Table 4-2]

[0187] [Table 4-3]

[0188] The HBV RNAi agents described herein anneal the antisense strand with the sense strand. The sense strand containing the sequence described in Table 4 is formed by For any antisense strand containing the sequence, these two sequences are consecutively 16, 17, 18 , 19, 20, or 21 nucleotide sequences of at least about 85% complementarity. As long as they have the same region, they can hybridize.

[0189] In some embodiments, the antisense oligonucleotides of the HBV RNAi agents disclosed herein are The antisense strand may be selected from any of the antisense strand sequences in Table 3 by 0, 1, 2, or 3 nucleotides. In some embodiments, the HBV RNAi agents disclosed herein have different The sense strand may be selected from any of the sense strand sequences in Table 4, including 0, 1, 2, or 3 nucleotides. is different.

[0190] In some embodiments, the antisense strand of the HBV RNAi agent is In some embodiments, the HBV RNAi agent comprises any of the nucleotide sequences. The antisense strand of the sequence is 1-17, 2-17, 1-18, or 2-18 of any of the sequences in Table 3. , 1-19, 2-19, 1-20, 2-20, 1-21, 2-21, 1-22, 2-22 , 1-23, 2-23, 1-24, 2-24, 1-25, 2-25, 1-26, or 2- It contains a 26-nucleotide sequence (5' end to 3' end).

[0191] In some embodiments, the sense strand of an HBV RNAi agent has any of the sequences in Table 4. In some embodiments, the HBV RNAi agent comprises a nucleotide sequence of The sequence of the sequence of Table 4 may be any of 1-17, 2-17, 3-17, 4-17, 1-18, 2-18, 3-18, 4-18, 1-19, 2-19, 3-19, 4-19, 1-20, 2-20, 3-20, 4-20, 1-21, 2-21, 3-21, 4-21, 1-22, 2-22, 3-22, 4-22, 1-23, 2-23, 3-23, 4-23, 1-24, 2-24, 3-24, 4-24, 1-25, 2-25, 3-25, 4-25, 1-26, It contains the nucleotide sequence of 2-26, 3-26, or 4-26 (5' end to 3' end).

[0192] For the HBV RNAi agents disclosed herein, position 1 of the antisense strand (5' end The nucleotides at the 3' end of the HBV gene may be completely complementary to the HBV gene. In some embodiments, the antigen-binding domain may be non-complementary to an HBV gene. The nucleotide at position 1 (5' end to 3' end) of the sense strand is U, A, or dT. In some embodiments, the nucleotide at position 1 (5' end to 3' end) of the antisense strand The nucleotides form A:U or U:A base pairs with the sense strand.

[0193] In some embodiments, the antisense strand of an HBV RNAi agent is any of those listed in Table 3. The nucleotides 2-18 or 2-19 (5' end to 3' end) of the antisense strand sequence are In some embodiments, the sense strand of the HBV RNAi comprises the sequence of Table 4. Nucleotides 1-17 or 1-18 (5' end to 3' end) of either the sequence of the base strand Contains arrays.

[0194] In some embodiments, the HBV RNAi agent is (i) any of the antigens in Table 3. The sense strand sequence includes nucleotides 2-18 or 2-19 (5' end to 3' end). and (ii) an antisense strand comprising 1-17 or 1-18 of any of the sense strand sequences in Table 4. and a sense strand comprising a nucleotide sequence from the 5' end to the 3' end.

[0195] A sense strand containing a sequence listed in Table 4 can be used with any antisense strand containing a sequence listed in Table 3. The two sequences are repeated for 16, 17, 18, 19, 20, or 21 consecutive As long as the nucleotide sequence of the A representative sequence pair is shown in Table 5, duplex I. This is illustrated in number D.

[0196] In some embodiments, the HBV RNAi agent comprises a duplex as described herein. In some embodiments, the HBV RNAi agent is In some embodiments, the duplex ID number may be any of the duplex ID numbers shown in the specification. The HBV RNAi agent may comprise a sense strand of any of the duplex ID numbers set forth herein. and / or antisense strand nucleotide sequences. The V RNAi agent may be a combination of the sense strand and / or duplex ID numbers of any of the duplexes set forth herein. or the antisense strand nucleotide sequence and a targeting group and / or a linking group (the targeting group and and / or the linking group is covalently linked (i.e., conjugated) to the sense strand or the antisense strand. In some embodiments, the HBV RNAi agent comprises a The modified nucleoside of the sense strand and the antisense strand of any of the duplex ID numbers shown in In some embodiments, the HBV RNAi agent comprises a nucleotide sequence as set forth herein. Modified nucleosides of the sense and / or antisense strands of any duplex ID number a targeting group and / or a linking group (the targeting group and / or linking group may be in the sense strand or is covalently linked to the antisense strand.

[0197] In some embodiments, the HBV RNAi agent is an antisense The antisense strand and the sense strand having the nucleotide sequence of the antisense strand / sense strand duplex are and further comprising an asialoglycoprotein receptor ligand targeting group.

[0198] In some embodiments, the HBV RNAi agent is any of the duplexes in Table 5. The nucleotide sequence of either the antisense strand and / or the sense strand of the sequence and further comprising an antisense strand and a sense strand having the following structure: (PAZ), (NAG13), (N AG13)s, (NAG18), (NAG18)s, (NAG24), (NAG24)s , (NAG25), (NAG25)s, (NAG26), (NAG26)s, (NAG2 7), (NAG27)s, (NAG28), (NAG28)s, (NAG29), (NA G29)s, (NAG30), (NAG30)s, (NAG31), (NAG31)s, (NAG32), (NAG32)s, (NAG33), (NAG33)s, (NAG34 ), (NAG34)s, (NAG35), (NAG35)s, (NAG36), (NAG 36)s, (NAG37), (NAG37)s .

[0199] In some embodiments, the HBV RNAi agent is any of the duplexes in Table 5. The antisense and sense strand nucleotide sequences of the nucleic acid are modified. It includes both the antisense strand and the sense strand.

[0200] In some embodiments, the HBV RNAi agent is any of the duplexes in Table 5. Modified nucleotides in the antisense and / or sense strand nucleotide sequences of any of the sequences and an antisense strand having the sequence of the asialoglycoprotein receptor linker. The antibody contains a targeting group.

[0201] In some embodiments, the HBV RNAi agent is any of the duplexes in Table 5. Includes s.

[0202] In some embodiments, the HBV RNAi agent is any of the duplexes in Table 5. It consists of

[0203] [Table 5-1]

[0204] [Table 5-2]

[0205] In some embodiments, the HBV RNAi agent is administered as a salt, mixed salt, or free acid. The RNAi agents described herein are delivered to cells expressing HBV genes. Once achieved, they inhibit or knockdown the expression of one or more HBV genes in vivo. Oops.

[0206] Targeting Groups, Linking Groups, and Delivery Vehicles In some embodiments, the HBV RNAi agent comprises one or more non-nucleotides. The conjugated group may be a targeting group, a linking group, a delivery polymer, or a delivery vector. The non-nucleotide group may include, but is not limited to, a vehicle. Table 6 provides examples of targeting groups and linking groups. The non-nucleotide group may be located at the 3' end of either the sense strand and / or the antisense strand. and / or may be covalently linked to the 5' end. NAi agents contain a non-nucleotide group linked to the 3' and / or 5' end of the sense strand. In some embodiments, the non-nucleotide group is at least one of the 5'-nucleotide of the sense strand of the HBV RNAi agent. The non-nucleotide group is linked to the 'terminus. In some embodiments, the non-nucleotide group can be linked to an RNAi agent. The RNAi agent may be linked to the RNAi agent via a bond or linker that is cleavable, divisible, or reversible.

[0207] In some embodiments, the non-nucleotide group is an RNAi agent or conjugate ( Non-nucleotide groups can be attached to these to allow cell- or tissue-specific distribution and Improve the pharmacokinetic or biodistribution properties of the conjugate (improving cell-specific uptake of the conjugate) In some embodiments, the non-nucleotide group inhibits endocytic uptake of the RNAi agent. Improve system.

[0208] The targeting group or moiety may be used to mediate cell-specific distribution and function of the conjugate to which it is attached. and improve cell-specific uptake to enhance the pharmacokinetic or biodistribution properties of the conjugate. The targeting group may have a valence of one, two, three, four or more. Targeting groups include compounds that have affinity for cell surface molecules, cell receptor ligands, haptens, Antibodies, monoclonal antibodies, antibody fragments, and antibodies with affinity for cell surface molecules In some embodiments, the targeting group includes, but is not limited to, a mimetic. , linkers (e.g., PEG linkers, or 1, 2, or 3 abasic and / or or ribitol (abasic ribose) groups) to link to the RNAi agent. In an embodiment, the targeting group comprises a galactose derivative cluster.

[0209] The HBV RNAi agents described herein contain a reactive group (e.g., an amine group) at the 5' end. This reactive group can then be synthesized to have the formula: can be used to attach a targeting moiety.

[0210] In some embodiments, the targeting group comprises an asialoglycoprotein receptor ligand. In some embodiments, the asialoglycoprotein receptor ligand is one or more As used herein, galactose derivatives include or consist of The term tose derivative refers to the combination of galactose and its affinity for the asialoglycoprotein receptor. Galactose derivatives having affinity for galactose or higher. Galactose derivatives include galactose, galactosamine, N-formylgalactosamine, and N-formylgalactosamine. -Acetyl-galactosamine, N-propionyl-galactosamine, Nn-butanoyl -galactosamine, and N-iso-butanoylgalactosamine (e.g., Iobst , STand Drickamer, KJBC1996, 271, 6686 (See, but not limited to, Oligonucleotides for the Liver and Other Galactose derivatives and galactose derivatives useful for in vivo targeting of molecules of the present invention - Patents.com Clusters of these are well known in the art (e.g., Baenziger and F iete,1980,Cell,22,611~620;Connolly et al. ., 1982, J. Biol. Chem., 257, 939-945). The glycan derivative binds to the asialoglycoprotein receptor (ASGP), which is expressed on the surface of hepatocytes. r) to target molecules to liver cells in vivo. The binding of ASGPr ligands to the ASGPr(s) induces hepatocyte This promotes cell-specific targeting to the vesicles and endocytosis of the molecule into hepatocytes. The ASGPr ligands may be monomeric (e.g., having a single galactose derivative) or poly(Asp-galactose derivative). Galactose derivatives or Galactose derivative clusters can be synthesized by ligating RNAi vectors using methods well known in the art. The targeting group (e.g., galactosyltransferase) can be attached to the 3' or 5' end of a oligonucleotide. The preparation of the tose derivative clusters is described, for example, in U.S. Patent Application Serial No. 15 / 452,324 and and 15 / 452,423, the entire contents of both of which are incorporated herein by reference. To be incorporated.

[0211] As used herein, a galactose derivative cluster is a cluster of 2 to 4 terminal galactose derivatives. The terminal galactose derivative is linked via its C-1 carbon to In some embodiments, the galactose derivative cluster is attached to a molecule. galactose derivative trimers (tri-branched galactose derivatives or trivalent galactose derivatives) In some embodiments, the galactose derivative clusters In some embodiments, the galactose derivative comprises N-acetyl-galactosamine. The conductor cluster comprises three N-acetyl-galactosamines. In this case, the galactose derivative cluster is a galactose derivative tetramer (tetrabranched galactose derivative). (also called lactose derivatives, or tetravalent galactose derivatives). In this case, the galactose derivative cluster contains four N-acetyl-galactosamines.

[0212] As used herein, galactose derivative trimers are each linked to a central branch point. As used herein, galactose derivatives include the three galactose derivatives shown below. Each tetramer contains four galactose derivatives linked to a central branch point. The sugar derivatives can be attached to the central branch point through the C-1 carbon of the sugar. In an embodiment, the galactose derivative is linked to the branch point via a linker or spacer. In some embodiments, the linker or spacer is a PEG group, for example. is a flexible hydrophilic spacer (see, e.g., U.S. Pat. No. 5,885,968; Bi essen et al.J.Med.Chem.1995 Vol.39 p.153 In some embodiments, the PEG spacer is PEG. 3 Spe This branch point allows the attachment of three galactose derivatives and The branch point may be any small molecule such that it is possible to attach a branch point to an RNAi agent. Examples of branch point groups are di-lysine or diglutamate. Attachment of branch points to RNAi agents The linking can be via a linker or spacer. The linker or spacer may be a flexible hydrophilic spacer (e.g., a PEG spacer). In some embodiments, the linker includes, but is not limited to, In some embodiments, the galactose derivative comprises a rigid linker (e.g., a cyclic group). The conductor comprises or consists of N-acetyl-galactosamine. In the present invention, the galactose derivative cluster is composed of a galactose derivative tetramer, can be, for example, an N-acetyl-galactosamine tetramer.

[0213] In some embodiments, the HBV RNAi agent is delivered to hepatocytes in vivo. Such pharmaceutical compositions include, for example, galactose derivatives. Some embodiments may include an HBV RNAi drug conjugated to a conductor cluster. In an embodiment, the galactose derivative cluster is a galactose derivative trimer, which is For example, it may be an N-acetyl-galactosamine trimer, or a galactose derivative tetramer. The galactosamine tetramer is composed of a tetramer (which may be, for example, an N-acetyl-galactosamine tetramer).

[0214] The targeting groups include (PAZ), (NAG13), (NAG13)s, (NAG18), ( NAG18)s, (NAG24), (NAG24)s, (NAG25), (NAG25) s, (NAG26), (NAG26)s, (NAG27),(NAG27)s, (NAG 28),(NAG28)s,(NAG29),(NAG29)s,(NAG30),(N AG30)s, (NAG31), (NAG31)s, (NAG32), (NAG32)s , (NAG33), (NAG33)s, (NAG34), (NAG34)s, (NAG3 5), (NAG35)s, (NAG36), (NAG36)s, (NAG37), (NA G37)s, (NAG38), (NAG38)s, (NAG39), and (NAG39) Other targeting groups include, but are not limited to, galactose cluster targeting groups. Ligands) are well known in the art.

[0215] In some embodiments, a linking group is conjugated to the RNAi agent. The group may be a targeting group or a group that facilitates covalent attachment of the drug to a delivery polymer or delivery vehicle. The linking group is attached to the 3' or 5' end of the sense or antisense strand of the RNAi agent. In some embodiments, the linking group is linked to the sense strand of the RNAi agent. In some embodiments, the linking group is at the 5' or 3' end of the sense strand of the RNAi agent. In some embodiments, the linking group is conjugated to the sense strand of the RNAi agent. Examples of linking groups include reactive groups (e.g., primary amines) and alkynes), alkyl groups, abasic nucleosides, ribitol (abasic ribose) and / or PEG groups.

[0216] A linker or linking group is a group that connects a chemical group of interest (RNP) to a chemical group of interest by one or more covalent bonds. Ai drug, etc.) or segment to another chemical group of interest (e.g. a targeting group or delivery polymer). A flexible link is a connection between two atoms that connects a molecule or a segment. A flexible link includes a flexible bond. The linkage can optionally include a spacer that increases the distance between the two bond atoms. A spacer can add further flexibility and / or length to the link. The aryl group may be an alkyl group, an alkenyl group, an alkynyl group, an aryl group, an aralkyl group, an aralkyl group, an aryl ... These include, but are not limited to, alkenyl and aralkynyl groups. may contain one or more heteroatoms, heterocycles, amino acids, nucleotides, and sugars. Spacer groups are well known in the art and the above list is not intended to limit the scope of this specification. This does not mean that the

[0217] The nucleotide sequences of the HBV RNAi agents listed in Tables 3 and 4 may be either modified or unmodified. Regardless of whether the targeting group is 3' or 5', the targeting group may include a 3' or 5' targeting group and / or a linking group. and / or a sequence of any of the HBV RNAi agents described in Tables 3 and 4, including a linking group. may alternatively not include a 3' or 5' targeting group and / or linking group, Alternatively, alternative 3' or 5' targeting groups, including but not limited to those shown in Table 3, may be used. Any of the HBV RNAi drug duplexes described in Table 5 may include a linking group. The plex may further comprise a targeting group and / or a linking group, whether modified or unmodified; This includes, but is not limited to, those shown in Table 3, and further includes those targeting The group or linking group may be either the sense strand or the antisense strand of the HBV RNAi agent duplex. It can be attached at either the 3' or 5' end.

[0218] Table 6 provides examples of targeting groups and linking groups. Table 4 provides examples of targeting groups and linking groups linked to the 5' or 3' terminus. Several implementations of the sense strand of an HBV RNAi agent having a targeting group or linking group attached thereto. Provide a form.

[0219] [Table 6-1]

[0220] [Table 6-2]

[0221] [Table 6-3]

[0222] [Table 6-4]

[0223] [Table 6-5]

[0224] [Table 6-6]

[0225] [Table 6-7]

[0226] [Table 6-8]

[0227] [Table 6-9]

[0228] [Table 6-10]

[0229] [Table 6-11]

[0230] [Table 6-12]

[0231] [Table 6-13]

[0232] In each of the above structures in Table 6, in view of the above structures and the description provided herein, As will be appreciated by those skilled in the art, NAG is an N-acetylglucosamine derivative. For example, in some embodiments, the compounds in Table 6 include those in Table 6. The structure of the provided NAG can be expressed as follows:

[0233] [ka]

[0234] Each (NAGx) is linked via a phosphate group (e.g. (NAG25), (NAG30) , and (NAG31)), or via phosphorothioate groups (e.g. (NAG 25)s, (NAG29)s, (NAG30)s, (NAG31)s, or (NAG37 )s), or via another linking group, to the HBV RNAi agent. do.

[0235] [ka]

[0236] Other linking groups known in the art may also be used.

[0237] Delivery Vehicle In some embodiments, a delivery vehicle is used to deliver an RNAi agent to a cell or tissue. A delivery vehicle can be used to improve delivery of an RNAi agent to a cell or tissue. Delivery vehicles include polymers (e.g., amphiphilic polymers, membrane active polymer), peptide, melittin peptide, melittin-like peptide (MLP), lipid, reversible reversibly modified polymers or peptides, or reversibly modified membrane active polyamines; includes, but is not limited to, these.

[0238] In some embodiments, the RNAi agent is a lipid, a nanoparticle, a polymer, a liposome, , micelles, DPCs, or other delivery systems available in the art. RNAi agents can also be combined with targeting groups, lipids (cholesterol and cholesteryl derivatives), (including but not limited to), nanoparticles, polymers, liposomes, micelles, DPCs ( For example, International Publication Nos. 2000 / 053722, 2008 / 0022309, and 2008 / 0022309. 011 / 104169, 2012 / 083185, and 2013 / 0328 29 and 2013 / 158141, each of which is incorporated herein by reference. or chemically conjugated to other delivery systems available in the art. can be supported.

[0239] Pharmaceutical Compositions and Formulations The HBV RNAi agents disclosed herein can be prepared as pharmaceutical compositions or formulations. In some embodiments, the pharmaceutical composition comprises at least one HBV RNAi agent. These pharmaceutical compositions include those that target mRNAs in a target cell, cell population, tissue, or organism. This pharmaceutical composition is particularly useful for inhibiting the expression of NA. A disease or disorder that would benefit from reducing or inhibiting expression of a target gene. The pharmaceutical composition can be used to treat a subject having a target mRNA. A disease or condition that would be helped by reducing the levels or inhibiting expression of a target gene. The method can be used to treat a subject at risk of developing a disorder. In one embodiment, the method comprises administering to the patient an HBV RNAi linked to a targeting ligand, as described herein. In some embodiments, the method further comprises administering one or more of the following to a subject: Pharmaceutically acceptable excipients (including vehicles, carriers, diluents, and / or delivery polymers) The HBV RNAi agent may be added to a pharmaceutical composition suitable for in vivo delivery to humans. A pharmaceutical formulation is formed.

[0240] Pharmaceutical compositions and methods comprising the HBV RNAi agents disclosed herein include those described herein. administering to a subject a therapeutically effective amount of the HBV RNAi agent described herein. The levels of target mRNA in a cell population, tissue, or subject can be reduced, thereby This can inhibit the expression of a target mRNA in a subject.

[0241] In some embodiments, the described pharmaceutical compositions comprising an HBV RNAi agent are , are used to treat or manage clinical symptoms associated with HBV infection. In one embodiment, a therapeutically or prophylactically effective amount of one or more pharmaceutical compositions is administered to such The disclosed compositions are administered to a subject in need of treatment, prevention, or management. and administering to the subject a therapeutically effective amount of HBV RNAi therapy. The number, severity, and / or frequency may be reduced.

[0242] The described pharmaceutical compositions, including HBV RNAi agents, reduce the expression of HBV mRNA. At least one in a subject with a disease or disorder that would benefit from treatment with or inhibiting In some embodiments, the compound may be used to treat at least one of the following conditions: The subject is administered a therapeutically effective amount of one or more pharmaceutical compositions comprising an HBV RNAi agent. In another embodiment, the subject is administered a prophylactically effective amount of one or more Prevents at least one symptom by administering multiple HBV RNAi drugs .

[0243] The route of administration is the route by which the HBV RNAi agent is brought into contact with the body. Methods for administering drugs and nucleic acids for therapeutic purposes are well known in the art and are described herein. The HBV RNAi agents disclosed herein can be applied to the administration of compositions comprising: Administration can be via any suitable route with preparations appropriately tailored to the particular route. Thus, the pharmaceutical compositions described herein can be administered, for example, intravenously, intramuscularly, intradermally, subcutaneously, The administration can be by injection, such as intraarticular, intravenous, or intraperitoneal. In one embodiment, the pharmaceutical compositions described herein are administered via subcutaneous injection.

[0244] Pharmaceutical compositions containing the HBV RNAi agents described herein can be prepared using conventional methods well known in the art. To deliver to a cell, group of cells, tumor, tissue, or subject using oligonucleotide delivery technology Generally, any suitable method known in the art for delivering nucleic acid molecules can be used. (in vitro or in vivo) for use with the compositions described herein. For example, delivery can be by local administration (e.g., direct injection, implantation, local administration ), systemically, subcutaneously, intravenously, intraperitoneally, or parenterally; This includes intracranial (e.g., intraventricular, intraparenchymal, and intrathecal), intramuscular, percutaneous, and airway (endotracheal) routes. aerosol, nasal, oral, rectal, or topical (including buccal and sublingual) administration. In an embodiment, the composition is administered by subcutaneous or intravenous infusion or injection.

[0245] Thus, in some embodiments, the pharmaceutical compositions described herein comprise one or In some embodiments, the composition may include any of the pharma- ceutical acceptable excipients described herein. The described pharmaceutical compositions can be formulated for administration to a subject.

[0246] As used herein, a pharmaceutical composition or medicament includes a pharmacologically effective amount of at least The composition comprises one of the therapeutic compounds described herein and one or more pharma- ceutical acceptable excipients. A pharma- ceutically acceptable excipient (vehicle) is any ingredient intentionally included in a drug delivery system. An excipient is a substance other than a drug (API, therapeutic product, e.g., HBV RNAi drug). It does not, or is not intended to, have a therapeutic effect at the doses shown. Excipients are used to a) aid in the processing of the drug delivery system during manufacturing; b) to improve the stability, bioavailability, and / or bioavailability of the API; c) Assist in product identification, to protect, support, or enhance physical availability or patient acceptability; and / or d) improve the overall safety, efficacy, and delivery of the API during storage or use. Pharmaceutically acceptable excipients are inert substances that may act to enhance other attributes of a drug. It may be an inert material and need not be an inert material.

[0247] Excipients include absorption enhancers, anti-adhesive agents, anti-foaming agents, antioxidants, binders, buffers, carriers, Coating agents, colorants, delivery enhancers, delivery polymers, dextran, dextrose, Diluents, disintegrants, emulsifiers, extenders, fillers, flavorings, lubricants, moisturizers, lubricants, oils, poly mers, preservatives, saline, salts, solvents, sugars, suspending agents, sustained release matrices, sweeteners, These include, but are not limited to, viscosity enhancing agents, tonicity agents, vehicles, water repellents, and wetting agents.

[0248] Pharmaceutical compositions suitable for injectable use include sterile aqueous solutions (where water soluble) or dispersions, and and sterile powders for the extemporaneous preparation of sterile injectable solutions or dispersions. Suitable carriers include physiological saline, bacteriostatic water, Cremophor EL (trademark) (BASF, Parsippany, NJ), or phosphate buffered saline. It should be stable under the conditions of manufacture and storage and should be protected against the contaminating action of microorganisms such as bacteria and fungi. The carrier should be preserved against acidic and alkaline substances such as water, ethanol, polyols (e.g., glycerol, propylene glycol, and liquid polyethylene glycol), and The solvent or dispersion medium may contain a suitable mixture thereof. By using coatings, by maintaining the required particle size in the case of dispersions, and by using surfactants. By using it, it is possible to maintain the proper fluidity. In many cases, the composition contains, for example, sugars, Polyhydric alcohols such as mannitol and sorbitol, and isotonic agents such as sodium chloride It is preferable to include, for example, aluminum monostearate and gelatin in the composition. By including a substance that delays absorption, it is possible to achieve prolonged absorption of the injectable composition. It is possible to do so.

[0249] Sterile injectable solutions may be prepared by mixing the active compound in the required amount with one or more of the ingredients enumerated above, as required. is prepared by combining the above in a suitable solvent and sterilizing by filtration. Generally, dispersions can be prepared by mixing the active compound in a basic dispersion medium and any other required components as enumerated above. The ingredients are prepared by incorporating them into a sterile vehicle. In the case of bacterial powder, the method of preparation involves extracting the active ingredient and any optional additives from a previously sterile filtered solution thereof. Examples of suitable drying methods include vacuum drying and freeze drying, which result in a powder of the desired component.

[0250] Formulations suitable for intra-articular administration are in microcrystalline form, for example in the form of an aqueous microcrystalline suspension. The drug may be in the form of a sterile aqueous preparation of the drug. Liposomal formulations or biodegradable polymer systems may also be used. , can be used to administer drugs for both intra-articular and intraocular administration.

[0251] The active compound may be administered in a controlled release formulation, including implants and microencapsulated delivery systems. The compound can be formulated with a carrier that will protect it from rapid elimination from the body, such as Ethylene vinyl acetate, polyanhydride, polyglycolic acid, collagen, polyorthoester Biodegradable, biocompatible polymers such as styrene and polylactic acid can be used. Methods for preparing such formulations will be apparent to those skilled in the art. Liposomal suspensions are also suitable for use in pharmaceutical formulations. These can be used as carriers for the preparation of pharmaceutical compositions. It can be prepared according to methods well known to those skilled in the art, such as those described in US Pat. No. 1.

[0252] HBV RNAi drugs are available in unit dosage forms for ease of administration and uniformity of dosage. The dosage unit form can be formulated as a unitary dose for the subject to be treated. Refers to physically distinct units, each of which is capable of producing a desired therapeutic effect in association with the required pharmaceutical carrier. The dosage unit forms of the present disclosure include a predetermined amount of active compound calculated to produce The specifications are based on the specific properties of the active compound, the therapeutic effect to be achieved and the individual The limitations inherent in the art of formulating such active compounds for Remains.

[0253] The pharmaceutical composition may contain other additional components commonly found in pharmaceutical compositions. Such additional ingredients may include antipruritic agents, skin astringents, local anesthetics, or anti-inflammatory agents (e.g. (e.g., antihistamines, diphenhydramine, etc.) Also provided herein are cells, tissues or isolated samples that express or contain an RNAi agent as defined herein. It is also contemplated that the organ may be used as a "pharmaceutical composition." In this context, the term "pharmacologically effective amount," "therapeutically effective amount," or simply "effective amount" refers to a pharmacological, therapeutic, Or the amount of an RNAi agent that produces a preventative result.

[0254] In general, an effective amount of the active compound is about 0.1 to about 100 mg / kg of body weight / day, for example, about In some embodiments, the active ingredient ranges from 1.0 to about 50 mg / kg of body weight / day. The effective amount of the compound is in the range of about 0.25 to about 5 mg / kg of body weight per administration. In some embodiments, the effective amount of the active ingredient is about 0.5 to about 3 mg / dose. The dosage ranges from 100 mg to 1000 mg / kg of body weight. The dosage will depend on the overall health of the patient, the relative abundance of the compound being delivered, the biological potency, the drug formulation, the presence and type of excipients in the formulation, and the route of administration The initial dose administered is likely to depend on a number of variables, including the desired blood flow rate. The upper limit of the above levels may be increased to rapidly achieve a desired fluid or tissue level. It will be appreciated that the initial dosage may be less than optimal. cormorant.

[0255] for the treatment of a disease or for the formation of a medicament or composition for the treatment of a disease, The pharmaceutical compositions described herein that include an RNAi agent may further comprise an excipient or a second therapeutic agent or Therapeutics (second or other RNAi drugs, small molecule drugs, antibodies, antibody fragments, and / or vaccines) The present invention can be combined with other ingredients, including but not limited to cutin.

[0256] The described HBV RNAi agents are administered in a pharma- ceutical acceptable excipient or adjuvant. If provided, the compositions may be packaged in a kit, container, pack, or dispenser. The pharmaceutical compositions described herein are packaged in pre-filled syringes or vials. It may be possible.

[0257] Treatment and inhibition methods The HBV RNAi agents disclosed herein are useful for treating HBV infections that are difficult to treat by administering a compound. The method is for treating a subject (e.g., a human or mammal) having a disease or disorder that may be In some embodiments, the RNAi agents disclosed herein can be used and diseases or conditions that would benefit from reducing or inhibiting the expression of HBV mRNA. can be used to treat a subject (e.g., a human) with a disorder. The subject may be a human, a patient, or a combination of both. The subject may be a human patient. The subject may be an adult, an adolescent, a child, or an infant. The described pharmaceutical compositions containing drugs are used to provide a method for the therapeutic treatment of diseases. Such methods can include administering to a human or animal a pharmaceutical composition as described herein. This includes giving.

[0258] In some embodiments, the HBV RNAi agents described herein inhibit HBV. In some embodiments, the method is described in The HBV RNAi agent is intended to treat at least one symptom in a subject having an HBV infection. The subject is administered a therapeutically effective amount of any one or more of the described RNAi agents. is administered.

[0259] In some embodiments, the subject has both an HBV infection and an HDV infection. In some embodiments, the HBV RNAi agents described herein inhibit HBV and HD. In some embodiments, the method is used to treat a subject infected with both V. The HBV RNAi drugs that have been approved for use in patients with HBV or HDV infection have been shown to be effective in at least The subject may be administered any one or more of the described R A therapeutically effective amount of an NAi agent is administered.

[0260] In some embodiments, the HBV RNAi agent is administered to a subject in a clinical setting where the subject is infected with HBV. The subject may be administered one or more of the following: A therapeutic or effective amount of an HBV RNAi agent or a composition containing an HBV RNAi agent is administered. In some embodiments, the methods include administering an HBV RNAi agent described herein. The method includes administering a composition comprising the compound to a subject to be treated.

[0261] In some embodiments, in a subject to which a described HBV RNAi agent is administered The gene expression levels and / or mRNA levels of HBV genes were measured using HBV RNAi drugs. Compared to subjects before treatment or subjects not receiving the HBV RNAi drug, Each is approximately 5%, 10%, 15%, 20%, 25%, 30%, 35%, 40%, 45%, 50% %, 55%, 60%, 65%, 70%, 75%, 80%, 85%, 90%, 95%, 96 %, 97%, 98%, 99%, or greater than 99%. The levels of the polypeptide and / or mRNA are reduced in cells, cell populations, and / or tissues of the subject. In some embodiments, a subject to whom a described HBV RNAi agent is administered may The expression protein levels of HBV genes in the control group were compared to those before administration of the HBV RNAi drug. or subjects not receiving the HBV RNAi agent, %, 15%, 20%, 25%, 30%, 35%, 40%, 45%, 50%, 55%, 60 %, 65%, 70%, 75%, 80%, 85%, 90%, 95%, 96%, 97%, 98% %, 99%, or greater than 99%. The protein levels in the subject are reduced by the subject's cells, cells, or The amount of erythrocytes, tissues, blood, and / or other body fluids may be reduced. For example, some In embodiments, the hepatitis B syndrome in a subject to which a described HBV RNAi agent is administered is The amount or level of HBsAg may be determined in a subject prior to administration of an HBV RNAi drug, or HBV RNAi treatments are associated with at least approximately 5%, 10%, or 10% 5%, 20%, 25%, 30%, 35%, 40%, 45%, 50%, 55%, 60%, 6 5%, 70%, 75%, 80%, 85%, 90%, 95%, 96%, 97%, 98%, 9 In some embodiments, the HBV R The amount or level of hepatitis B e antigen (HBeAg) in a subject to whom an NAi drug is administered is Subjects before receiving HBV RNAi drugs or subjects who have not received HBV RNAi drugs Compared to elephants, at least about 5%, 10%, 15%, 20%, 25%, 30%, 35%, 4 0%, 45%, 50%, 55%, 60%, 65%, 70%, 75%, 80%, 85%, 9 Reduced by 0%, 95%, 96%, 97%, 98%, 99%, or more than 99%. In some embodiments, serum HBV levels in subjects administered the HBV RNAi agents described herein are The amount or level of HBV DNA may be determined in a subject prior to administration of an HBV RNAi agent or in a subject prior to administration of an HBV RNAi agent. At least about 5%, 10%, 15%, 20%, or 30% greater than subjects not receiving the RNAi agent. %, 25%, 30%, 35%, 40%, 45%, 50%, 55%, 60%, 65%, 70 %, 75%, 80%, 85%, 90%, 95%, 96%, 97%, 98%, 99%, or The presence of serum HBV DNA, HBV gene expression, and HBV mRNA were reduced by more than 99%. A, or a reduction in the amount or level of an HBV protein can be achieved by methods well known in the art. The amount or level of HBV mRNA, the amount or level of expressed protein, The reduction or decrease in the amount or level of HBV DNA, and / or serum HBV DNA, As used herein collectively, the term "reducing or decreasing HBV, or inhibiting or inhibiting expression of HBV" refers to a method for treating HBV-related disorders. is called a reduction.

[0262] Cells and tissues and non-human organisms Cells, tissues, and non-human HBV RNAi agents comprising at least one of the HBV RNAi agents described herein. The cells, tissues, or non-human organisms are contemplated. It is produced by delivering an RNAi agent to the

[0263] The above-mentioned embodiments and provisions will now be illustrated in the following non-limiting examples. EXAMPLES

[0264] Example 1. Synthesis of HBV RNAi Agents The HBV RNAi drug duplexes shown in Table 5 were synthesized according to the following procedure. A. Synthesis. Based on the phosphoramidite technique on solid phase used for oligonucleotide synthesis. Based on this, we synthesized the sense and antisense strands of the HBV RNAi drug. MerMade96E (registered trademark) (Bioautomation), a MerMad e12 (registered trademark) (Bioautomation), or OP Pilot 100 ( Controlled pore glass (CPG, 500 Å or ​​600Å, obtained from Prime Synthesis, Aston, PA, USA The synthesis was carried out on a solid support made of 2'-modified phosphoramidite. The test was conducted by Thermo Fisher Scientific (Milwaukee, WY). Specifically, the following 2'-O-methyl phosphoramidites were purchased from Used: (5'-O-dimethoxytrityl-N 6 -(benzoyl)-2'-O-methyl Adenosine-3'-O-(2-cyanoethyl-N,N-diisopropylamino)phosphatase Phosphoramidite, 5'-O-dimethoxy-trityl-N 4 -(Acetyl)-2'-O-methyl Tyl-cytidine-3'-O-(2-cyanoethyl-N,N-diisopropyl-amino)phosphatase Fluoramidite, (5'-O-dimethoxytrityl-N 2 -(isobutyryl)-2'- O-Methyl-guanosine-3'-O-(2-cyanoethyl-N,N-diisopropylamine) Phosphoramidite and 5'-O-dimethoxytrityl-2'-O-methyl-uridine Din-3'-O-(2-cyanoethyl-N,N-diisopropylamino)phosphoramid 2'-Deoxy-2'-fluoro-phosphoramidites are 2'-O-methylamino It had the same protecting group as 2'-dimethoxytrityl-2'-diamine. Oxyribose-5'-O-(2-cyanoethyl-N,N-diisopropylamino)phosphate Holoamidites were purchased from ChemGenes (Wilmington, MA, USA). The targeting ligand containing the phosphoramidite was added in anhydrous dichloromethane or anhydrous acetone. All other amidites were dissolved in anhydrous acetonitrile (50 mM), whereas all other amidites were dissolved in anhydrous acetonitrile ( 50 mM) and molecular sieves (3 Å) were added. (BTT, 250 mM in acetonitrile) or 5-ethylthio-1H-tetrazole (ETT, 250 mM in acetonitrile) was used as the activator solution. 12 min (RNA), 15 min (targeted ligand), 90 s (2'OMe), and 60 For the introduction of phosphorothioate linkages, 3-phenyl-1, 2,4-Dithiazolin-5-one (POS, PolyOrg, Inc., Leomins A 100 mM solution of 1,2-dichlorophenyl ether (obtained from Sigma-Aldrich, MA, USA) in anhydrous acetonitrile was used. B. Cleavage and deprotection of support-bound oligomers. After completing the solid-phase synthesis, the dried solid The support was prepared by dissolving 40% by weight methylamine in water and 28% ammonium hydroxide solution (Aldr The solution was evaporated and treated with a 1:1 volume solution of 1,2-dichlorophenyl ether (III) for 1.5 hours at 30° C. The solid residue was reconstituted in water (see below). C. Purification. TSKgel SuperQ-5PW 13 μm column and Shimadz The crude oligomers were purified by anion exchange HPLC using a u LC-8 system. Buffer A was 20 mM Tris, 5 mM EDTA, pH 9.0, with 20% acetonitrile. Buffer B was the same as Buffer A plus 1.5M sodium chloride. The UV trace was recorded at 260 nm. The appropriate fractions were pooled. Then, packed in Sephadex G-25 fine, GE Healthcare Run the samples through a size-exclusion HPLC system using a XK 26 / 40 column and rinse with filtered DI water or 100 ml M ammonium bicarbonate (pH 6.7) and 20% acetonitrile were used as the running buffer. It was used as such. D. Annealing. Complementary strands were annealed in 1× phosphate buffered saline (Corning, Ce Equimolar amounts of RNA solutions (sense and antisense) in llgro were mixed together, A portion of the RNAi drug was lyophilized and stored at -15 to -25°C. The solution absorbance was measured using a UV-Vis spectrometer in 1× phosphate buffered saline. The duplex concentration was calculated by measuring the absorbance of the solution at 260 nm. Duplex concentrations were calculated by multiplying by the conversion factor and dilution factor. The coefficients were all 0.037 mg / (mL cm). The conversion factor was calculated from the absorption coefficient obtained.

[0265] Example 2. pHBV model mice.

[0266] Six to eight week-old female NOD.CB17-Prkdscid / NcrCrl (NOD-SC ID) mice were transiently transfected in vivo with MC-HBV1.3. This was achieved by hydrodynamic tail vein injection (Yang PL et al., “Hydrodyn amic injection of viral DNA:a mouse mode l of acute hepatitis B virus infection,” PNAS USA 2002 Vol.99:p.13825~13830) MC-HBV1.3 was administered 30-45 days prior to administration of the HBV RNAi drug or control. is a plasmid-derived minicircle, which is a plasmid derived from the plasmid pHBV1.3 and HBV 1.3.32 transgenic mouse (GenBank accession number V0146 It contains the same terminally duplicated human hepatitis B virus sequence HBV1.3 as in Gui dotti LG et al., “High-level hepatitis B virus replication in transgenic mice,”J Virol 1995 Vol.69, p6158-6169). MC of 5 or 10 μg -HBV1.3 Ringer's solution was injected into the tail vein of mice in a total volume of 10% of the animal's body weight. The pHBV model of chronic HBV infection was formed by injecting 50 μg of HBV into the nucleus of the cytoplasm with a 27-gauge needle as previously described. The solution was injected over ~7 seconds (Zhang G et al., "High level ls of foreign gene expression in hepatoc ytes after tail vein injection of naked plasmid DNA.”Human Gene Therapy 1999 Vol. .10, p1735-1737). Before administration (either day 1, day -1, or day -2 before administration) The serum expression level of hepatitis B surface antigen (HBsAg) was measured by ELISA. Mice were grouped according to their mean HBsAg expression levels, as determined by A.

[0267] Analysis: Serum HBsAg, serum HBeAg at various time points before and after administration of HBV RNAi drugs HBV expression levels can be measured. Bell compares pre-treatment expression levels with control mice injected with phosphate buffered saline ("PBS"). Normalized against the mouse.

[0268] i) Serum collection: Anesthetize the mouse with 2-3% isoflurane and collect serum from the submandibular region into a serum separation tube (S Blood samples were sent to the Imagine Medical Center, ... The blood was allowed to clot at ambient temperature for 20 minutes. The tubes were then centrifuged at 8,000 x g for 3 min. The mixture was centrifuged for minutes, the serum was separated and stored at 4°C.

[0269] ii) Serum Hepatitis B surface antigen (HBsAg) level: Serum was collected and diluted with 5% skim milk powder. 10μg HBsAg expression plasmid pRc / ICR transfected with CMV-HBs (Aldevron, Fargo, ND) Serum from Harlan Sprague Dawley mice diluted in skim milk solution Secondary HBsAg standards were prepared using the GS HBsAg EIA. 3.0 kit (Bio-Rad Laboratories, Inc., Redmond, NY) HBsAg protein was measured using recombinant HBsAg protein (WA) according to the manufacturer's instructions. Protein (ayw subtype, also diluted with skim milk in PBS) was used as the primary standard. (Aldevron).

[0270] To account for non-treatment-related declines in MC-HBV1.3, HBs Ag expression was normalized to the PBS-injected control group of mice. The HBsAg level of each animal in the HBsAg group was divided by the pretreatment expression level of that animal to obtain the “pretreatment The ratio of expression normalized to pretreatment was then calculated for each individual animal. The “normalized” ratio was calculated as the “normalized” ratio relative to the mean “pre-treatment” ratio of all mice in the normal PBS control group. Expression at a particular time point was normalized to the control group by dividing by the “normalized” ratio.

[0271] iii) Serum hepatitis B e antigen (HBeAg) level: Dilute 4 to 20 times with 5% skim milk powder The serum was used and the HBeAg enzyme was assayed as described by the manufacturer (DiaSorin). HBeAg analysis was performed by enzyme-linked immunosorbent assay (ELISA). The amount of antigen was determined by the assay and HBeAg protein standard (Fitzgerald Industry, ries International,catalog # 30-AH18,Act on,MA).

[0272] To account for non-treatment-related declines in MC-HBV1.3, HBe in each animal was Ag expression was normalized to the PBS-injected control group of mice. To assess HBeAg, HBeAg is analyzed from pooled group or subgroup serum samples. First, the HBeAg levels of each pooled group or subgroup were compared with those of the same group or subgroup treatment. The expression ratio was calculated by dividing by the pre-treatment expression level. Expression of α- and β-blockers was normalized to the control group. This is the “normalized to pretreatment” expression of the group or subgroup. The ratios were normalized to the mean of all samples in the normal PBS control group before treatment. This was obtained by dividing the ratio.

[0273] iv) Serum HBV DNA levels: Equal volumes of serum from mice in groups or subgroups were The volume was pooled to 100 μL. QIAamp MinElute Virus Spi The PCR was performed using the Qiagen PCR Kit (Qiagen, Valencia, CA) according to the manufacturer's instructions. DNA was isolated from the serum samples. 0.9% sterile saline was added to each sample to obtain the final The volume was 200 μL. The serum sample was added to the tube containing the buffer and protease. Carrier RNA was added to aid in DNA isolation. 1 ng pHCR / UbC-SE AP plasmid DNA (Wooddell CI, et al. “Long-term RNA interference from optimized siRNA ex pression constructs in adult mice.”Bioch em Biophys Res Commun(2005)334,117~127) After incubation at 56°C for 15 min, the nucleic acids were purified with ethanol. After precipitation from the lysate, the entire solution was passed through the column. After washing, the sample was washed with 50 μL of Buffer AV Eluted in E.

[0274] HBV genome copy number in DNA isolated from serum of pHBV mouse model was measured by qPCR The S gene (nucleotides 353-777 of GenBank accession number V01460) was ) Plasmid pSEAP-HBV353 encoding a short segment of the HBV genome A six logarithmic standard curve was generated using -777. Based on the results, samples with DNA recovery two standard deviations below the mean were omitted. n Uses chemical primers and probes with fluor / ZEN / IBFQ.

[0275] 7500 Fast or StepOne Plus Real-Time PCR System qPCR assays were performed using a Life Technologies system. To assess HBV DNA, serum samples from pooled groups were purified using either single or double purification procedures. Quantification of HBV DNA and recovered control plasmid was performed in triplicate. The HBV and pHCR / UbC-SEAP were quantified using qPCR. A probe was included in each reaction.

[0276] Example 3. HBV RNAi drugs in pHBV model mice The pHBV mouse model described in Example 2 above was used. On day 1, each mouse was HBV RNAi drug 2 mg / kg (mp k) or HBV RNA used as a control. A single subcutaneous injection of 200 μL of drug-free phosphate buffered saline was administered. The RNAi agents are N-acetylglucosamine conjugated to the 5' end of the sense strand, as shown in Tables 4 and 5. The HBV RNAi drugs tested included tyrosine-galactosamine targeting ligands. The injections were administered in the neck and shoulder area, with the duplex numbers shown in Table 7 below. The injections were made through a loose skin patch between the skin and the muscle (i.e., subcutaneous injection). Three mice were injected into each group. The following three types of serotonin-dependent agonists were tested (n=3).

[0277] Serum was collected on days 8, 15, 22, and 29 and analyzed according to the procedure described in Example 2 above. Serum hepatitis B surface antigen (HBsAg) levels were measured according to the following procedure. As shown in the table below:

[0278] [Table 7]

[0279] RNAi drugs AD04178, AD04579, AD04580, AD04570, AD 04572, AD04573, AD04574, AD04575, AD04419, and AD04578 was cloned into the HBV genome at position 178 as shown in Tables 1 and 2 above, respectively. An antigen that is at least partially complementary to the X open reading frame from 1 to 1789 Each HBV RNAi drug was designed to have an antisense strand sequence. Across all time points, there was a substantial reduction in HBsAg compared to the PBS control. D04580 significantly increased S antigen levels at day 8 when normalized to pretreatment and PBS controls. The HBsAg levels in the control group were >95% lower (0.048±0.007).

[0280] In addition, serum HBV DNA levels were measured using 8, 15, and 20-mL HBV serum samples from 100 subjects in the same study area as described in Example 2 above. , PBS, AD04579 from serum samples taken on days 22, 29, 36, 43 and 50 Serum from each group was pooled and serum was collected in duplicate. DNA was isolated from the following strains. The data are shown in the table below:

[0281] [Table 8]

[0282] The data in Table 8 show that both RNAi drugs tested significantly increased HBV DNA levels compared to the PBS group. AD04580 substantially reduced the nadir with slightly less than 1 log knockdown. The results showed that the mean serum DNA level at day 15 was 0.0869 ± 0.0117. Bell).

[0283] Example 4. HBV RNAi drugs in pHBV model mice The pHBV mouse model described in Example 2 above was used. On day 1, each mouse was HBV RNAi drug 2 mg / kg (mp k) or HBV RNA used as a control. A single subcutaneous injection of 200 μL of drug-free phosphate buffered saline was administered. The NAi agents are N-acetylglucosamine conjugated to the 5' end of the sense strand, as shown in Tables 4 and 5. The HBV RNAi drugs administered included: The injections included those shown in Table 9 below. The injections were administered subcutaneously into loose skin over the neck and shoulder area. The injection was performed between the skin and the muscle (i.e. subcutaneous injection). Three mice were tested in each group (n=3). .

[0284] Serum was collected on days 8, 15, 22, and 29 and analyzed according to the procedure described in Example 2 above. Serum hepatitis B surface antigen (HBsAg) levels were measured according to the following procedure. As shown in the table below:

[0285] [Table 9]

[0286] RNAi drugs AD04010, AD04581, AD04591, AD04434, AD 04583, AD04584, AD04585, AD04586, AD04588, and AD04438 was synthesized by the S-linked nucleotide sequence of positions 257-275 of the HBV genome as shown in Tables 1 and 2. The antisense strand sequence is at least partially complementary to the open reading frame. Each of the HBV RNAi agents shown in Table 9 above was designed to have a total Across time points, there was a substantial reduction in HBsAg compared to the PBS control. AD04585 reduced HBsAg levels by approximately 90% at day 8, 95% at day 15, and 22% at day 16. There was a 97% reduction on the 28th day and a 95% reduction on the 29th day.

[0287] In addition, serum HBV DNA levels were measured using 8, 15, and 20-mL HBV serum samples from 100 subjects in the same study area as described in Example 2 above. PBS and AD0458 in serum samples taken on days 22, 29, 36, 43, and 50 Serum from each group was pooled and DNA was isolated from the serum in duplicate. The data are shown in the table below:

[0288] [Table 10]

[0289] The data shown in Table 10 demonstrate that the HBV RNAi drug AD04585 significantly improved H This resulted in a reduction in BV DNA levels.

[0290] Example 5. Dose response and combination of HBV RNAi drugs in pHBV model mice height. The pHBV mouse model described in Example 2 above was used. Mice were: The mice were administered 20 mg / kg / day of the drug according to the dosing regimen shown in Table 11. 0 μL subcutaneous injection was given.

[0291] [Table 11]

[0292] Each mouse received a single subcutaneous dose of 200 μL, which included the following: , a given amount of HBV RNAi drug formulated in phosphate-buffered saline, or H 200 μL of phosphate-buffered saline without BV RNAi drug was included. The RNAi agents are N-acetylglucosamine conjugated to the 5' end of the sense strand, as shown in Tables 4 and 5. The injection contained a galactosamine targeting ligand. The injections were given either on the exposed skin or between the skin and muscle (i.e., subcutaneous injection). Three mice were tested in each group. (n=3).

[0293] Days 8, 15, 22, 29, 36, 43, 50, and 57 Serum was collected from the eyes and serum hepatitis B surface antigen (HBs) was measured according to the procedure shown in Example 2 above. Ag) levels were measured. The data from the experiment are shown in the table below:

[0294] [Table 12]

[0295] HBV RNAi drugs AD04580 and AD04585 each showed All three individual antibodies showed a reduction in HBsAg compared to the HBsAg PBS control. Additionally, combined treatment with AD04585 and AD04580 also targets different regions of the HBV genome. As shown in the above examples, the PBS control was significantly higher than the control across all time points measured. In comparison, HBsAg was shown to be reduced.

[0296] In addition, serum HBV DNA levels were measured using 8, 15, and 20-mL HBV serum samples from 100 subjects in the same study area as described in Example 2 above. Serum samples taken on days 1, 22, 29 and 36 were measured for each of the groups in Table 11. Serum from each group was pooled and DNA was isolated from the serum in duplicate reactions. As shown in the table:

[0297] [Table 13]

[0298] The data in Table 13 show that the RNAi agents tested, both individually and in combination, were significantly lower than PBS The results show that re-administration or administration resulted in a reduction in HBV DNA levels compared to the control group. Increasing the dose resulted in further reductions in HBV DNA.

[0299] Example 6. HBV RNAi agents in pHBV mice: dose response and combination studies. The pHBV mouse model described in Example 2 above was used. Mice were: The mice were divided into various groups as shown, and each group received a single dose of A single 200 μL subcutaneous injection was administered.

[0300] [Table 14]

[0301] Each mouse received a single subcutaneous dose of 200 μL, which included the following: , a given amount of HBV RNAi drug formulated in phosphate-buffered saline, or H 200 μL of phosphate-buffered saline without BV RNAi drug was included. The RNAi agents are N-acetylglucosamine conjugated to the 5' end of the sense strand, as shown in Tables 4 and 5. The injection contained a galactosamine targeting ligand. The injections were given either on the exposed skin or between the skin and muscle (i.e., subcutaneous injection). Three mice were tested in each group. (n=3).

[0302] Day -1 before dosing, and then days 8, 15, 22, 29, and 36 Serum was collected at 0°C and serum HBsAg levels were measured according to the procedure described in Example 2 above. The data from the experiment are shown in Table 15 below. Mean HBsAg is the normalized mean of HBsAg. Reflects the average value:

[0303] [Table 15]

[0304] The HBV RNAi agents tested demonstrated a significant improvement over the PBS control across all time points measured. Furthermore, AD04872 (as shown in Tables 1 and 2) showed a reduction in HBsAg. Antisense oligonucleotides that are at least partially complementary to the S ORF at positions 261-279 of the genome. and either AD04981 or AD04963 (both of which are in Table As shown in 1 and 2, a small number of X ORFs were identified at positions 1781 to 1799 of the HBV genome. Combination treatment with a 5'-aminobutyric acid sequence having at least a partially complementary antisense strand sequence is described in Group H of Example 6. , I, and J, which are the results of two RNAi drugs (one of which targets the S domain of the HBV genome) one targeting the X ORF of the HBV genome, and the other targeting the X ORF of the HBV genome. Similarly, there was a reduction in HBsAg compared to the PBS control across all time points measured.

[0305] In addition, serum hepatitis B e antigen (HBeAg) levels were also evaluated. Samples from mice were first pooled and the resulting serum samples were assayed in the singlet state. The experimental data are shown in the table below:

[0306] [Table 16]

[0307] As shown in Table 16, AD04872 (targeting the S ORF of the HBV genome) AD04981 or AD04963 (both targeting the X ORF of the HBV genome) Combination of AD04872 with either of the following drugs significantly improved HBeAg levels compared with AD04872 alone The results showed a significant decrease.

[0308] Example 7. HBV RNAi agents in pHBV mice: additive dose response and combination studies. The pHBV mouse model described in Example 2 above was used. Mice were: The mice were divided into various groups as shown, and each group received a single A single 200 μL subcutaneous injection was administered.

[0309] [Table 17]

[0310] Each mouse received a single subcutaneous dose of 200 μL, which included the following: , a given amount of HBV RNAi drug formulated in phosphate-buffered saline, or H 200 μL of phosphate-buffered saline without BV RNAi drug was included. The RNAi agents are N-acetylglucosamine conjugated to the 5' end of the sense strand, as shown in Tables 4 and 5. The injection contained a galactosamine targeting ligand. The injections were made on the skin, between the skin and the muscle (i.e., subcutaneously). Four mice were tested (n=4) and one mouse from each group was then euthanized and histologically analyzed. On days 22 and 29, three mice were tested per group (n=3).

[0311] Serum was collected on day -1 before dosing, and then on days 8, 15, 22, and 29. and serum hepatitis B surface antigen (HBsAg) levels were measured according to the procedure set forth in Example 2 above. The experimental data is shown in Table 18 below:

[0312] [Table 18]

[0313] The HBV RNAi agents tested demonstrated a significant improvement over the PBS control across all time points measured. A decrease in HBsAg was observed.

[0314] In addition, serum hepatitis B e antigen (HBeAg) levels were also evaluated. Samples from mice were first pooled and the resulting serum samples were assayed in the singlet state. The experimental data are shown in the table below:

[0315] [Table 19]

[0316] [Table 20]

[0317] Table 19-1 reflects the fold knockdown comparing HBeAg to the control. Normalized HBeAg levels in the control (PBS) group / normalized HBeAg levels in the respective RNAi drug(s) group The HBeAg concentration is calculated as the total HBeAg level (i.e., 1.000 / HBeAg level). The data shown in 19-1 are from AD04872 (as mentioned above, position 261– 279 S ORF) and , AD04982 (for the X ORF at positions 1781 to 1799 of the HBV genome) The combination of the antisense strand with the nucleotide sequence (which contains an antisense strand sequence that is partially complementary to the nucleotide sequence of the individual RNAi drugs) Compared to monotherapy, a further reduction in HBeAg levels was observed (see, e.g., Tables 19 and 19- 1, groups H and I). Furthermore, data from this example show that AD04872 and AD04 The combination of AD04872 and AD04982 significantly reduces the H The fold decrease in HBeAg was greater than the sum of the fold decrease in BeAg. For example, Group I (3.0 mg / kg AD04872 + 2. 0 mg / kg AD04982) showed a 17.0% reduction in HBeAg on day 15. This was a reduction ratio of 4.6 in group G (3.0 mg / kg AD04872) and 4.7 in group D ( 2.0mg / kg AD04982) is greater than the sum of the reduction factor of 3.2.

[0318] In addition, serum HBV DNA levels were measured at −1, 8, 10, 20, 30, 40, 50, 60, 70, 80, 90, 100, 110, 120, 130, 140, 150, 160, 170, 180, 190, 200, 210, 220, 230, 24 For each of the groups in Table 17 for serum samples taken on days 15, 22, 29, and 36 Serum HBV DNA was isolated from each animal at each time point. The data are shown in the table below. show:

[0319] [Table 21]

[0320] The data in Table 20 show that the RNAi agents tested, both individually and in combination, showed a significant improvement over PBS The results showed that AD0487 resulted in a reduction in HBV DNA levels compared with the control group. 2 (targeting the S ORF) in combination with AD04982 (targeting the X ORF) The combination of AD04872 and AD04872 alone reduced serum HBV DNA to the same extent as the same dose of AD04872 alone. It further shows.

[0321] Example 8. HBV RNAi Agents in pHBV Mice: Further Dose Response and Combination Studies . The pHBV mouse model described in Example 2 above was used. Mice were: The mice were divided into various groups as shown, and each group was administered a single A single 200 μL subcutaneous injection was administered.

[0322] [Table 22]

[0323] In addition, mice will be euthanized according to the following schedule: Day 11: 2 mice from groups 2A, 3A, 4A, 5A, 6A, 7A and 8A, and 2 mice from group 9 One mouse was euthanized. Day 14: euthanize 2 mice from groups 2A, 3A, 4A, 5A, 6A, 7A, and 8A. . Day 21: euthanize 2 mice from groups 2B, 3B, 4B, 5B, 6B, 7B, and 8B. . Day 28: 2 mice from groups 1, 2B, 3B, 4B, 5B, 6B, 7B, and 8B, and All mice (4 mice) in groups 10 and 12 were euthanized.

[0324] Each mouse received a single subcutaneous dose of 200 μL, which included the following: , a given amount of HBV RNAi drug formulated in phosphate-buffered saline, or H 200 μL of phosphate-buffered saline without BV RNAi drug was included. The RNAi agents are N-acetylglucosamine conjugated to the 5' end of the sense strand, as shown in Tables 4 and 5. The injection contained a galactosamine targeting ligand. The injections were given either on the skin or between the skin and muscle (i.e. subcutaneous injection). As shown in Table 14 above, Four mice per group were tested (n=4), except for groups 10, 11, 12, and 13. Three mice were tested (n=3).

[0325] Serum was collected on day -1 before dosing, and then on days 8, 14, 21, and 28. and serum hepatitis B surface antigen (HBsAg) levels were measured according to the procedure set forth in Example 2 above. The experimental data are shown in the table below:

[0326] [Table 23]

[0327] The HBV RNAi agents tested, both alone and in combination, demonstrated Across the points, there was a substantial reduction in HBsAg compared to the PBS control.

[0328] Example 9. Delivery of RNAi agents. The pHBV mouse model described in Example 2 above was used. On day 1, each mouse was HBV RNAi drug 10 mg / kg (m A single subcutaneous injection of 200 μL containing either HBV RN (pk) or HBV RN (pk) used as a control A single subcutaneous injection of 200 μL of Ai drug-free phosphate buffered saline was administered. HBV RNAi agents include those with duplex numbers as shown in Table 23 below. These were conjugated to the 5' end of the sense strand as shown in Tables 4 and 5, respectively. The injections contained an N-acetyl-galactosamine targeting ligand. The injection was made between the skin and the muscle (i.e. subcutaneous injection) in the loose skin. Three mice were injected in each group. were tested (n=3).

[0329] Serum was collected before administration and then on days 8, 15, 22, and 29, and analyzed as described above. Serum hepatitis B surface antigen (HBsAg) levels were measured according to the procedure set forth in Example 2 of The experimental data is shown in the table below:

[0330] [Table 24]

[0331] The HBV RNAi agents shown in Table 23 above each target position 1781-1788 of the HBV genome. 799 contained antisense sequences at least partially complementary to the X ORF. The RNAi agents showed significant knockdown compared to the PBS control.

[0332] Example 10. HBV RNAi agents in pHBV mice: further combination studies. The pHBV mouse model described in Example 2 above was used. Mice were: The mice were divided into various groups as shown, and each group received a single dose of A single 200 μL subcutaneous injection was administered.

[0333] [Table 25]

[0334] Each mouse received a single subcutaneous dose of 200 μL, which included the following: , a given amount of HBV RNAi drug formulated in phosphate-buffered saline, or H 200 μL of phosphate-buffered saline without BV RNAi drug was included. The RNAi agents are N-acetylglucosamine conjugated to the 5' end of the sense strand, as shown in Tables 4 and 5. The injection contained a galactosamine targeting ligand. The injections were given either on the exposed skin or between the skin and muscle (i.e., subcutaneous injection). Three mice were tested in each group. (n=3).

[0335] Serum was collected before administration and on days -1, 8, 15, 22, 29, and 36. Serum hepatitis B surface antigen (HBS) was collected on days 43, 50, 57, and 64. BsAg) levels were measured according to the procedure set forth in Example 2 above. As shown below:

[0336] [Table 26]

[0337] HBV RNAi drugs AD04585 and AD04771 were used as At least one S open reading frame from positions 257 to 275 of the HBV genome The HBV RNAi drug A was designed to have a partially complementary antisense strand sequence. D04580 and AD04776 were cloned into the HBV genome at position 17 as shown in Tables 1 and 2. At least partially complementary to the X open reading frame 81-1799 The HBV RNAi agents tested were designed to have antisense strand sequences. Both combinations reduced HBsA activity compared to the PBS control across all time points measured. g. Each subsequent dose further reduced the nadir of HBsAg reduction. .

[0338] In addition, serum HBV DNA levels were measured at −1, 8 Groups in Table 24 for serum samples taken on days 15, 22, 29, 36, 43 and 50 C (3.0mg / kg AD04585), group E (3.0mg / kg AD04580) , and group G (1.5 mg / kg AD04585 + 1.5 mg / kg AD04580) Serum HBV DNA was isolated from each animal at each of these time points. The data are shown in the table below:

[0339] [Table 27]

[0340] The data in Table 26 demonstrate that the HBV RNAi agents tested, both individually and in combination, , indicating that it resulted in a reduction in HBV DNA levels compared to the PBS group.

[0341] Example 11. HBV RNAi agents in pHBV mice: combination studies. The pHBV mouse model described in Example 2 above was used. Mice were: The mice were divided into various groups as shown, and each mouse was administered a single A single 200 μL subcutaneous injection was administered.

[0342] [Table 28]

[0343] Each mouse received a single subcutaneous dose of 200 μL, which included the following: , a given amount of HBV RNAi drug formulated in phosphate-buffered saline, or H 200 μL of phosphate-buffered saline without BV RNAi drug was included. The RNAi agents are N-acetylglucosamine conjugated to the 5' end of the sense strand, as shown in Tables 4 and 5. The injection contained a galactosamine targeting ligand. The injections were given either on the exposed skin or between the skin and muscle (i.e., subcutaneous injection). Three mice were tested in each group. (n=3).

[0344] Day -1 before dosing, and then days 8, 15, 22, 29, and 36 Serum was collected from each group (except for group L (AD04882) and group M (AD04885)). Serum Hepatitis B surface antigen (HBsAg) levels were measured according to the procedure set forth in Example 2 above. The experimental data is shown in the table below:

[0345] [Table 29]

[0346] The RNAi drug AD04962 was administered to HBV genome positions 257–270 of the HBV genome as shown in Tables 1 and 2. Antisense oligonucleotides that are at least partially complementary to the S open reading frame of 275 The RNAi drug AD04872 was designed to have the sequence of the base pair as shown in Tables 1 and 2. As shown in Fig. 1, the S open reading frame at positions 261–279 of the HBV genome is The RNAi drug AD was designed to have an antisense strand sequence that is at least partially complementary to the RNAi drug AD. 04963 was synthesized by combining the X-linked nucleotide sequence of positions 1781 to 1799 of the HBV genome as shown in Tables 1 and 2. The antisense strand sequence is at least partially complementary to the open reading frame. The RNAi drugs AD04882 and AD04885 are listed in Tables 1 and 2. As shown, the X open reading frame at positions 1780 to 1798 of the HBV genome The antisense strand sequence was designed to be at least partially complementary to the above. Each of the HBV RNAi agents listed in Table 9 performed well, both individually and in combination, across all time points measured. Both groups showed a reduction in HBsAg compared to the PBS control. Further reductions in BsAg were obtained.

[0347] In addition, serum hepatitis B e antigen (HBeAg) levels were significantly higher in all groups except for groups L and M. The samples from each group of mice were first pooled, resulting in The serum samples obtained were assayed in the singlet state. The experimental data are shown in the table below:

[0348] [Table 30]

[0349] In addition, serum HBV DNA levels were measured at 8, 15, 20, 30, 40, 50, 60, 70, 80, 90, 100, 110, 120, 130, 140, 150, 160, 170, 180, 190, 200, 210, 220, 230, 240, Serum samples taken on days 22 and 29 were measured for each of the groups in Table 27. Serum HBV DNA was isolated from each animal at each time point. The data are shown in the table below:

[0350] [Table 31]

[0351] The data in Table 30 show that the RNAi agents tested, both individually and in combination, were significantly lower than PBS The results show that re-administration resulted in a reduction in HBV DNA levels compared with the control group. , a further reduction in HBV DNA was obtained.

[0352] Example 12. HBV RNAi drugs in pHBV mice. The pHBV mouse model described in Example 2 above was used. Mice were: The mice were divided into various groups as shown, and each mouse was administered a single A single 200 μL subcutaneous injection was administered.

[0353] [Table 32]

[0354] Each mouse received a single subcutaneous dose of 200 μL, which included the following: , a given amount of HBV RNAi drug formulated in phosphate-buffered saline, or H 200 μL of phosphate-buffered saline without BV RNAi drug was included. The RNAi agents are N-acetylglucosamine conjugated to the 5' end of the sense strand, as shown in Tables 4 and 5. The injection contained a galactosamine targeting ligand. The injections were given either on the exposed skin or between the skin and muscle (i.e., subcutaneous injection). Three mice were tested in each group. (n=3).

[0355] Serum was collected before administration, then on days 8, 15, and 22. Group A (PBS) , Group B (2.0mg / kg AD04871), Group C (2.0mg / kg AD0487 2), Group D (2.0mg / kg AD04874), Group E (2.0mg / kg AD04 875) and group F (2.0 mg / kg AD04876) were further randomized to groups A and B on days 29 and 36. Serum samples were collected on days 41, 42, and 43. Serum hepatitis B surface antigen (HBsAg) levels were The viscosity was measured according to the procedure set forth in Example 2 above. The data from the experiment are shown in the table below:

[0356] [Table 33]

[0357] HBV RNAi drugs AD04871, AD04872, AD04874, AD0487 5, and AD04876, located at positions 261-27 of the HBV genome, as shown in Tables 1 and 2. Antisense at least partially complementary to the S open reading frame of 9 Each of these HBV RNAi drugs was designed to have the same sequence as P showed substantial HBsAg reduction compared to the BS control. AD04872 (group C), AD04874 (group D), and AD04876 (group F), respectively At a single dose of 2 mg / kg, each of the following was significantly increased in the 15th to 43rd day groups compared to the control group: At this time point, HBsAg levels were reduced by more than 90%. 1, AD04883, and AD04884 were used as HBV genome antigens as shown in Tables 1 and 2, respectively. At least a portion of the X open reading frame at positions 1780 to 1798 of the The antisense strand sequence was designed to be complementary to the antisense strand sequence.

[0358] Example 13. Dose response of HBV RNAi drugs in X-region knockout model mice and combinations. An antisense oligonucleotide that is at least partially complementary to a region located in the S ORF of HBV mRNA. The RNAi drug contains a sequence similar to that of the X ORF of HBV mRNA. The effect of combining the first RNAi agent with a second RNAi agent that contains an antisense strand sequence that is also partially complementary to the first RNAi agent. As an alternative means of assessing the efficacy of ribozymes, positions 1780 and 1781 were targeted as shown in Tables 1 and 2. The HBV RNAi drug is a HBV inhibitor that targets the HBV genome and knocks out the binding site. We generated a mouse model of X-region knockout mice (hereafter referred to as X-region knockout mice). Mutating 10 bases in the pHBV1.3 plasmid within the RNAi drug binding site The remainder of the HBV mRNA (including the S region) remains functional. Therefore, in this HBV mouse model, the HBV genome disclosed herein HBV RNAi with an antisense strand targeting positions 1780 and 1781 of the HBV RNAi Inclusion of the drug is expected to be ineffective in silencing expression.

[0359] The mice were divided into various groups, including those shown in Table 33 below, and the mice received the following 200 μL subcutaneous injections were given according to the dosing regimen indicated.

[0360] [Table 34]

[0361] Each mouse received a single subcutaneous dose of 200 μL, which included the following: , a given amount of HBV RNAi drug formulated in phosphate-buffered saline, or H 200 μL of phosphate-buffered saline without BV RNAi drug was included. The RNAi agents are N-acetylglucosamine conjugated to the 5' end of the sense strand, as shown in Tables 4 and 5. The injection contained a galactosamine targeting ligand. The injections were given either on the exposed skin or between the skin and muscle (i.e., subcutaneous injection). Three mice were tested in each group. (n=3).

[0362] Serum was collected on days 5, 8, 15, 22, and 29 and analyzed as described in Example 2 above. Serum hepatitis B surface antigen (HBsAg) levels were measured according to the procedure shown in 36 Serum was collected for groups 1-5 on days 1, 2, 3, 4, and 43. The data from the study are shown in Table 34 below. show:

[0363] [Table 35]

[0364] As expected, Group 6 (a single dose of HBV RNAi drug AD04963 at 3.0 mg / kg) The X open reading frame at positions 1781 to 1799 of the HBV genome is The HBsAg knockout antibody (containing an antisense strand at least partially complementary to the knockout antibody) In addition, each of groups 2 to 5 was significantly lower than the PBS control. Both groups 3 and 5 resulted in substantial knockdown of HBsAg compared to the nadir values ​​( On day 22, the patient showed a >2-log decrease in HBsAg.

[0365] Example 14. Dose response of HBV RNAi drugs in X-region knockout model mice and combinations. The X region knockout mouse model described in Example 13 above was used. The mice were divided into various groups, including those shown in Table 31 below, and each group received the dosing regimen shown in Table 35. A single 200 μL subcutaneous injection was administered according to the protocol.

[0366] [Table 36]

[0367] Each mouse received a single subcutaneous dose of 200 μL, which included the following: , a given amount of HBV RNAi drug formulated in phosphate-buffered saline, or H 200 μL of phosphate-buffered saline without BV RNAi drug was included. The RNAi agents are N-acetylglucosamine conjugated to the 5' end of the sense strand, as shown in Tables 4 and 5. The injection contained a galactosamine targeting ligand. The injections were made on the skin, between the skin and the muscle (i.e., subcutaneous injection). Three mice were injected in each group as shown in Table 35. Mice were tested (n=3).

[0368] Serum was collected on days 1 (before administration), 8, 15, 22, and 29, and analyzed as described above. Serum hepatitis B surface antigen (HBsAg) levels were measured according to the procedure set forth in Example 2 of The experimental data is shown in the table below:

[0369] [Table 37]

[0370] Table 36 shows the results of the HBV RNAi drug AD04872 administered alone and AD048 72 (at least for the S open reading at positions 261-279 of the HBV genome) containing a partially complementary antisense strand) and AD05070 (position 178 of the HBV genome) An antigen that is at least partially complementary to the X open reading frame from 1 to 1799 The combination of 100% IgG1 with antisense strand (containing antisense strand) was significantly higher than the PBS control across all time points measured. These results show that all of the X-region knockdowns resulted in significant knockdown of HBsAg. HBV RNAi drug AD05070 against mutated target site in out model When 0.7mg / kg to 2mg / kg is added, 2mg / kg HBV RNAi drug A It did not reduce the activity of D04872.

[0371] In addition, blood samples were taken on days 8, 15, and 22 according to the procedure set forth in Example 2 above. Serum HBV DNA levels were measured in serum samples. Serum from each group was pooled and singlet-state DNA was isolated from serum at 100°C for 12 min. The data are shown in the table below:

[0372] [Table 38]

[0373] HBV RNA for the mutated target site in this X-region knockout model When i-drug AD05070 is added at 0.7mg / kg to 2mg / kg, 2mg / kg H It did not reduce the activity of the BV RNAi drug AD04872.

[0374] Example 15. HBV RNAi drugs in pHBV mice. The pHBV mouse model described in Example 2 above was used. Mice were: The mice were divided into various groups, including those shown in Table 38, and each group was administered the same dosing regimen as shown in Table 38. , a single 200 μL subcutaneous injection was administered.

[0375] [Table 39]

[0376] Each mouse received a single subcutaneous dose of 200 μL, which included the following: , a given amount of HBV RNAi drug formulated in phosphate-buffered saline, or H 200 μL of phosphate-buffered saline without BV RNAi drug was included. The RNAi agents are N-acetylglucosamine conjugated to the 5' end of the sense strand, as shown in Tables 4 and 5. The injection contained a galactosamine targeting ligand. The injections were given either on the exposed skin or between the skin and muscle (i.e., subcutaneous injection). Three mice were tested in each group. (n=3).

[0377] Serum was collected on day -1 before administration, then on days 8, 15, 22, 29, and 36. Serum hepatitis B surface antigen (HBsAg) levels were collected on days 40, 41, 42, and 43 and 50. The measurements were performed according to the procedure set forth in Example 2 above. The experimental data are shown in Table 39 below. Mean HBsAg reflects the normalized mean value of HBsAg:

[0378] [Table 40]

[0379] RNAi drugs AD04776, AD05069, AD05070, AD05071, AD HBV genome fragments AD05073 and AD05074 were used as clones of the HBV genome fragments AD05073 and AD05074 as shown in Tables 1 and 2, respectively. At least partially to positions 1781-1799 of the X open reading frame The RNAi drug AD05075 was designed to have a complementary antisense strand sequence. 05076, AD05077, and AD05078 as shown in Tables 1 and 2, respectively. HBV genome position 1780-1798 for the X open reading frame. The antisense strand was designed to have an antisense strand sequence that is at least partially complementary to the antisense strand sequence.

[0380] Table 39 shows the results of the HBV RNAi drugs AD04776, AD05069, and A administered alone. D05070, AD05071, AD05073, and AD05074, or their A D04872 (a small number of S open readings at positions 261-279 of the HBV genome) At each time point measured, a combination of the 10-kDa antisense strand and the 10-kDa antisense strand was Results showed that the HBsAg knockdown across the entire study was significantly greater than that of the PBS control. is doing.

[0381] Example 16. HBV RNAi agents in pHBV mice: dose response and combination studies. The pHBV mouse model described in Example 2 above was used. Mice were: The mice were divided into various groups as shown, and each mouse was administered a single A single 200 μL subcutaneous injection was administered.

[0382] [Table 41]

[0383] Each mouse received a single subcutaneous dose of 200 μL, which included the following: , a given amount of HBV RNAi drug formulated in phosphate-buffered saline, or H 200 μL of phosphate-buffered saline without BV RNAi drug was included. The RNAi agents are N-acetylglucosamine conjugated to the 5' end of the sense strand, as shown in Tables 4 and 5. The injection contained a galactosamine targeting ligand. The injections were given either on the exposed skin or between the skin and muscle (i.e. subcutaneous injection). Six mice were tested in each group. (n=6).

[0384] Serum was collected before administration and then on days 8, 15, 22, and 29, and analyzed as described above. Serum hepatitis B surface antigen (HBsAg) levels were measured according to the procedure set forth in Example 2 of The data from the experiment is shown in Table 41 below:

[0385] [Table 42]

[0386] The HBV RNAi agents tested, both individually and in combination, demonstrated Over the course of 22 days, HBsAg expression was reduced compared to the PBS control. There was a further decline in all groups re-administered on day 1.

[0387] In addition, serum hepatitis B e antigen (HBeAg) levels were also assessed. For each group, serum samples from all six mice were pooled and the resulting samples were analyzed in single replicates. The assay was performed under normal conditions. Measurements on days -1, 15, 22, and 29 were performed. For each group, six mice were paired within each group, and the serum samples were pooled. Three subgroups were formed for each group. The serum samples from each of the three subgroups were The experimental data are shown in Table 42 below:

[0388] [Table 43]

[0389] The HBV RNAi agents tested, both individually and in combination, demonstrated The HBeAg expression was decreased compared to saline controls across all time points. There was a further decline in all groups rechallenged on day 22.

[0390] In addition, serum HBV DNA levels were measured at −1, 8, 10, 20, 30, 40, 50, 60, 70, 80, 90, 100, 110, 120, 130, 140, 150, 160, 170, 180, 190, 200, 210, 220, 230, 24 Serum samples taken on days 15 and 22 were measured for each of the groups in Table 40. Sera from paired mice were pooled and DNA was isolated from each serum pool in a single run. As shown in the table below:

[0391] [Table 44]

[0392] The HBV RNAi agents tested, both individually and in combination, demonstrated reduced serum HBV DNA over time compared to saline controls, but , Groups 11 and 12 showed no decline in serum HBV DNA on day 8.

[0393] Example 17. HBV RNAi drugs in pHBV mice. The pHBV mouse model described in Example 2 above was used. Mice were: The mice were divided into various groups as shown, and each mouse was administered a single A single 200 μL subcutaneous injection was administered.

[0394] [Table 45]

[0395] Each mouse received a single subcutaneous dose of 200 μL, which included the following: , a given amount of HBV RNAi drug formulated in phosphate-buffered saline, or H 200 μL of phosphate-buffered saline without BV RNAi drug was included. The RNAi agents are N-acetylglucosamine conjugated to the 5' end of the sense strand, as shown in Tables 4 and 5. The injection contained a galactosamine targeting ligand. The injections were given either on the exposed skin or between the skin and muscle (i.e., subcutaneous injection). Three mice were tested in each group. (n=3).

[0396] Serum was collected before administration and then on days 8, 14, 21, 29, and 36. The serum hepatitis B surface antigen (HBsAg) levels were measured according to the procedure described in Example 2 above. The experimental data are shown in Table 45 below:

[0397] [Table 46]

[0398] The HBV RNAi drug combinations tested were significantly lower in patients with saline than those without saline across all time points measured. The combination containing AD04872 showed a reduction in HBsAg compared to the water control. This shows a greater reduction than the equivalent combination of AD04585 instead of 4872. Ta.

[0399] In addition, samples were collected on days 8, 14, 21, and 29 according to the procedure set forth in Example 2 above. Serum HBV DNA levels were measured in serum samples collected from patients with HBV infection. The data are shown in Table 46 below:

[0400] [Table 47]

[0401] The HBV RNAi drug combinations tested were significantly lower in patients with saline than those without saline across all time points measured. The combination containing AD04872 demonstrated a reduction in serum HBV DNA compared to the water control. , a significant reduction over an equivalent combination using AD04585 instead of AD04872. These large declines were observed on days 22 and 29.

[0402] Example 18. HBV RNAi agents in an HBV-infected humanized mouse model. In this study, male FRG mice (C57BL / 6 background (Yecu ris) genotype Fah- / - / Rag2- / - / Il2rg- / - triple knockout When the mice were 1-2 months old, human hepatocytes were transplanted into them. To suppress proliferation, the liver was repopulated with regular NTBC treatment for approximately 6 months. At 9 months of age, mice were inoculated with 4 × 10 8 Intravenous inoculation of HBV genotype C genomes / kg This infected human hepatocytes. After 2-3 months, serum HBV DNA levels were A plateau was reached, indicating that human hepatocytes were maximally infected (mouse hepatocytes were HBV At the start of treatment with HBV RNAi drugs, the mice were 1 year old, and thus It was near the end of its life.

[0403] Pre-treatment serum samples were collected on days -10 and -3. On day 1, each mouse was given Entecavir was administered orally once daily at a dose of 0.01 mg / kg dissolved in water. Entecavir was administered once daily until the day of euthanasia. Entecavir treatment increased serum HBV DN in chronically infected human patients. It was predicted that HBsAg would decrease but not HBsAg.

[0404] The mice were divided into various groups, including those shown in Table 47 below:

[0405] [Table 48]

[0406] Each mouse was further administered an amount of HBV RNAi drug (multiple Subcutaneous administration of 100 μL per 20 grams of body weight containing HBV RNAi drug Subcutaneous injection of 100 μL per 20 grams of body weight containing an equal volume of phosphate buffered saline without The doses were administered on days 1 and 29 (if still not administered on day 29) according to the schedule shown in Table 47 above. Each HBV RNAi drug was used to detect the sense strand of the HBV RNAi vector, as shown in Tables 4 and 5. Containing an N-acetyl-galactosamine targeting ligand conjugated to the 5' end The injections were administered into the loose skin over the neck and shoulder area, between the skin and muscle (i.e., subcutaneous injections). ) I went to.

[0407] Serum was collected on days 8, 15, 22, 29, 36, and 40. Serum hepatitis B surface antigen (HBsAg) levels were measured according to the procedure shown in Example 2 above. The experimental data is shown in the table below:

[0408] [Table 49]

[0409] In addition, following the procedure set forth in Example 2 above, -10, -3, 8, 15, 22, 29, Serum HBV DNA levels were measured in serum samples taken on days 36 and 40. The data are shown in Table 49 below:

[0410] [Table 50]

[0411] As expected, entecavir administration in the absence or presence of HBV RNAi agents Both reduced viral replication.

[0412] Other embodiments While the invention has been described in conjunction with this detailed description, it is understood that the foregoing description is illustrative of the scope of the invention and is not intended to limit the scope of the invention, which is defined by the appended claims. Other aspects, advantages, and modifications are within the scope of the following claims. The following aspects may be included. [1] An RNAi agent for inhibiting expression of a Hepatitis B virus gene, comprising an antisense strand and a sense strand, wherein the antisense strand comprises a sequence having at least about 85% identity to any of the antisense strand sequences provided in Table 2 or Table 3. [2] The RNAi agent according to [1] above, wherein the antisense strand comprises at least 16 consecutive nucleotides of any of the antisense sequences provided in Table 2 or Table 3. [3] The composition described in [1] above, wherein the antisense strand comprises nucleotides at positions 2 to 18 (5'→3') of any of the antisense strand sequences provided in Table 2 or Table 3. [4] The RNAi agent of [1] or [2] above, wherein at least one nucleotide of the sense strand and / or at least one nucleotide of the antisense strand of the RNAi agent is a modified nucleotide and / or has a modified internucleoside linkage. [5] The RNAi agent according to any one of the above-mentioned [1] to [4], wherein the sense strand and the antisense strand are each 17 to 30 nucleotides in length. [6] The RNAi agent according to any of the above-mentioned [1] to [5], wherein the sense strand comprises at least 16 contiguous nucleotides of any of the sense strand sequences provided in Table 2 or Table 4, and the sense strand has a region of at least about 85% complementarity to the antisense strand over the 16 contiguous nucleotides. [7] The RNAi agent according to any one of [1] to [6] above, wherein all or substantially all of the nucleotides in both the sense strand and the antisense strand of the RNAi agent are modified nucleotides. [8] The RNAi agent of [1] above, wherein the antisense strand comprises a nucleotide sequence of any of the modified sequences provided in Table 3. [9] The RNAi agent of [1] or [8] above, wherein the sense strand comprises a nucleotide sequence of any of the modified sense sequences provided in Table 4.

[10] A composition for inhibiting expression of an HBV gene, comprising the RNAi agent according to any one of [1] to [9] above, wherein the RNAi agent is conjugated to a targeting ligand.

[11] The composition described in

[10] above, wherein the targeting ligand comprises N-acetyl-galactosamine.

[12] The targeting ligand is (NAG13), (NAG13)s, (NAG18), (NAG18)s, (NAG24), (NAG24)s, (NAG25), (NAG25)s, (NAG26), (NAG26)s, (NAG27), (NAG27)s, (NAG28), (NAG28)s, (NAG29), (NAG29)s, (NAG30), (NAG30)s, (NAG 31), (NAG31)s, (NAG32), (NAG32)s, (NAG33), (NAG33)s, (NAG34), (NAG34)s, (NAG35), (NAG35)s, (NAG36), (NAG36)s, (NAG37), (NAG37)s, (NAG38), (NAG38)s, (NAG39), or (NAG39)s.

[13] The composition according to any one of the above

[10] to

[12] , wherein the targeting ligand is conjugated to the sense strand of the RNAi agent.

[14] The composition according to any one of

[10] to

[13] above, further comprising a pharma- ceutically acceptable excipient.

[15] The RNAi drug is AD03498;AD03499;AD03500;AD03501;AD03738;AD03739;AD03967;AD03968;AD03969;AD03970;AD03971;AD03972;AD03973;AD03974;AD03975;AD03976;AD03977;AD03978;AD04001;AD04002;AD04003;AD04004;AD04005;AD04006;AD04007;AD04008;AD04009;AD04010;AD04176;AD04177 ;AD04178;AD04412;AD04413;AD04414;AD04415;AD04416;AD04417;AD04418;AD04419;AD04420;AD04421;AD04422;AD04423;AD04425;AD04426;AD0 4427;AD04428;AD04429;AD04430;AD04431;AD04432;AD04433;AD04434;AD04435;AD04436;AD04437;AD04438;AD04439;AD04440;AD04441;AD04442 ;AD04511;AD04570;AD04571;AD04572;AD04573;AD04574;AD04575;AD04576;AD04577;AD04578;AD04579;AD04580;AD04581;AD04583;AD04584;AD0 4585;AD04586;AD04587;AD04588;AD04590;AD04591;AD04592;AD04593;AD04594;AD04595;AD04596;AD04597;AD04598;AD04599;AD04734;AD04771 ;AD04772;AD04773;AD04774;AD04775;AD04776;AD04777;AD04778;AD04822;AD04823;AD04871;AD04872;AD04873;AD04874;AD04875;AD04876;AD0 4881;AD04882;AD04883;AD04884;AD04885;AD04962;AD04963;AD04981;AD04982;AD04983;AD05069;AD05070;AD05071;AD05072;AD05073;AD05074;The composition according to any one of the above

[10] to

[14] , having a duplex structure of AD05075;AD05076;AD05077;AD05078;AD05147;AD05148;AD05149;AD05164; or AD05165.

[16] The composition described in

[15] above, wherein the RNAi drug has a duplex structure of AD04580; AD04585; AD04776; AD04872; AD04962; AD04963; AD04982; or AD05070.

[17] The composition described in any of

[10] to

[16] above, further comprising a second RNAi agent comprising a sense strand and an antisense strand for inhibiting expression of a Hepatitis B virus gene.

[18] The composition of

[17] , wherein the second RNAi agent comprises an antisense sequence having at least about 85% identity to any of the antisense strand sequences provided in Table 2 or Table 3.

[19] The composition of

[18] , wherein the antisense strand of the second RNAi agent comprises at least 16 contiguous nucleotides of any of the antisense sequences provided in Table 2 or Table 3.

[20] The composition of

[19] above, wherein the antisense strand of the second RNAi agent comprises nucleotides at positions 2 to 18 (5'→3') of any of the antisense strand sequences provided in Table 2 or Table 3.

[21] The composition according to any of the above-mentioned

[17] to

[20] , wherein the first RNAi agent targets the S open reading frame (ORF) of the HBV gene, and the second RNAi agent targets the X open reading frame (ORF) of the HBV gene.

[22] The composition according to any of the above-mentioned

[17] to

[20] , wherein the first RNAi agent targets the X ORF of the HBV gene, and the second RNAi agent targets the S ORF of the HBV gene.

[23] the first RNAi drug is AD04001;AD04002;AD04003;AD04004;AD04005;AD04006;AD04007;AD04008;AD04009;AD04010;AD04422;AD04423;AD04425;AD04426;AD04427;AD04428;AD04429;AD04430;AD04431;AD04432;AD04433;AD04434;AD04435;AD04436;AD04437;AD04438;AD04439;AD04440;AD04441;AD0 4442;AD04511;AD04581;AD04583;AD04584;AD04585;AD04586;AD04587;AD04588;AD04590;AD04591;AD04592;AD04593;AD04594;AD04595;AD04596 ;AD04597;AD04598;AD04599;AD04734;AD04771;AD04772;AD04773;AD04774;AD04775;AD04822;AD04871;AD04872;AD04873;AD04874;AD04875;AD0 4876;AD04962; and AD05164, and the second RNAi agent is selected from the group consisting of AD03498;AD03499;AD03500;AD03501;AD03738;AD03739;AD03967;AD03968;AD03969;AD03970;AD03971;AD03972;AD03973;AD03974;AD03975;AD03976;AD03977;AD03978;AD04176;AD04177;AD04178;AD04412;AD04413;AD04414;AD04415; AD04416;AD04417;AD04418;AD04419;AD04420;AD04421;AD04570;AD04571;AD04572;AD04573;AD04574;AD04575;AD04576;AD04577;AD04578;AD04 579;AD04580;AD04776;AD04777;AD04778;AD04823;AD04881;AD04882;AD04883;AD04884;AD04885;AD04963;AD04981;AD04982;AD04983;AD05069;The composition according to any one of the above

[17] to

[21] , which is selected from the group consisting of AD05070; AD05071; AD05072; AD05073; AD05074; AD05075; AD05076; AD05077; AD05078; AD05147; AD05148; AD05149; and AD05165.

[24] The composition described in any one of

[17] to

[21] or

[23] above, wherein the first RNAi agent is AD04872 and the second RNAi agent is AD05070.

[25] The composition described in any one of

[17] to

[21] or

[23] above, wherein the first RNAi agent is AD04872 and the second RNAi agent is AD04982.

[26] The composition described in any one of

[17] to

[21] or

[23] above, wherein the first RNAi agent is AD04872 and the second RNAi agent is AD04776.

[27] The composition described in any of

[17] to

[21] above, wherein the first RNAi agent is AD04585 and the second RNAi agent is AD04580.

[28] The composition described in any of

[10] to

[27] above, further comprising one or more additional treatments.

[29] The composition described in

[28] above, wherein the additional treatment is lamivudine, tenofovir, tenofovir alafenamide, tenofovir disoproxil, or entecavir.

[30] The composition described in

[28] above, wherein the additional treatment is interferon.

[31] A method for inhibiting expression of a Hepatitis B virus gene in a subject, the method comprising administering to the subject an RNAi agent described in any of [1] to [9] above.

[32] A method for inhibiting expression of a Hepatitis B virus gene in a subject, the method comprising administering to the subject a composition described in any one of

[10] to

[30] above.

[33] The method according to

[31] or

[32] above, wherein the subject has or is at risk of having HBV infection.

[34] A method for treating HBV infection and / or a disease, disorder, or condition associated with HBV infection in a subject, the method comprising administering to the subject an effective amount of an RNAi agent described in any of [1] to [9] above.

[35] A method for treating HBV infection and / or a disease, disorder, or condition associated with HBV infection in a subject, the method comprising administering to the subject an effective amount of a composition described in any of

[10] to

[30] above.

[36] The method according to

[32] ,

[33] , or

[35] above, wherein the composition comprises effective amounts of two RNAi agents for inhibiting the expression of a Hepatitis B virus gene.

[37] The method of any of

[32] ,

[33] ,

[35] , or

[36] above, wherein the effective amount of the composition is sufficient to reduce the level of HBsAg in the subject by at least about 40% compared to the HBsAg expression level in the subject before administration of the composition.

[38] The method of any of

[32] ,

[33] ,

[35] , or

[36] above, wherein the effective amount of the composition is sufficient to reduce the level of HBeAg in the subject by at least about 40% compared to the HBeAg expression level in the subject before administration of the composition.

[39] The method of any of

[32] ,

[33] ,

[35] , or

[36] above, wherein the effective amount of the composition is sufficient to reduce serum HBV DNA levels in the subject by at least about 40% compared to the serum HBV DNA level of the subject before administration of the composition.

[40] The method according to

[34] or

[35] above, wherein the disease, disorder, or condition associated with HBV infection is a chronic liver disease or disorder, liver inflammation, a fibrotic condition, a proliferative disease, hepatocellular carcinoma, hepatitis D virus infection, or acute HBV infection.

[41] The method of any one of

[32] ,

[33] ,

[35] ,

[36] ,

[37] ,

[38] ,

[39] , or 40] above, wherein the first RNAi agent and the second RNAi agent are administered in a ratio of about 1:1.

[42] The method of any one of

[32] ,

[33] ,

[35] ,

[36] ,

[37] ,

[38] ,

[39] , or

[40] above, wherein the first RNAi agent and the second RNAi agent are administered in a ratio of about 2:1.

[43] The method of any one of

[32] ,

[33] ,

[35] ,

[36] ,

[37] ,

[38] ,

[39] , or

[40] above, wherein the first RNAi agent and the second RNAi agent are administered in a ratio of about 3:1.

[44] The method of any one of

[32] ,

[33] ,

[35] ,

[36] ,

[37] ,

[38] ,

[39] , or

[40] above, wherein the first RNAi agent and the second RNAi agent are administered in a ratio of about 4:1.

[45] The method of any one of

[32] ,

[33] ,

[35] ,

[36] ,

[37] ,

[38] ,

[39] , or

[40] above, wherein the first RNAi agent and the second RNAi agent are administered in a ratio of about 5:1.

[46] The method of any one of

[32] ,

[33] ,

[35] ,

[36] ,

[37] ,

[38] ,

[39] , or

[40] above, wherein the effective amount of the first RNAi agent is between about 0.5 mg / kg and about 5 mg / kg, and the effective amount of the second RNAi agent is between about 0.5 mg / kg and about 5 mg / kg.

[47] The method according to

[31] above, wherein the effective amount of the RNAi agent is between about 0.5 mg / kg and about 5 mg / kg.

[48] ​​Use of an RNAi drug described in any of [1] to [9] above for the treatment of HBV infection.

[49] Use of a composition described in any one of

[10] to

[30] above for the treatment of HBV infection.

[50] Use of a composition described in any one of

[10] to

[30] above for the manufacture of a medicine for the treatment of HBV infection.

[51] An RNAi drug for inhibiting expression of a Hepatitis B virus gene, comprising an antisense strand and a sense strand, the RNAi drug comprising: AD03498;AD03499;AD03500;AD03501;AD03738;AD03739;AD03967;AD03968;AD03969;AD03970;AD03971;AD03972;AD03973;AD03974;AD03975;AD03976;AD03977;AD03978;AD04001;AD04002;AD04003;AD04004;AD04005;AD04006 ;AD04007;AD04008;AD04009;AD04010;AD04176;AD04177;AD04178;AD04412;AD04413;AD04414;AD04415;AD04416;AD04417;AD04418;AD04419;AD0 4420;AD04421;AD04422;AD04423;AD04425;AD04426;AD04427;AD04428;AD04429;AD04430;AD04431;AD04432;AD04433;AD04434;AD04435;AD04436 ;AD04437;AD04438;AD04439;AD04440;AD04441;AD04442;AD04511;AD04570;AD04571;AD04572;AD04573;AD04574;AD04575;AD04576;AD04577;AD0 4578;AD04579;AD04580;AD04581;AD04583;AD04584;AD04585;AD04586;AD04587;AD04588;AD04590;AD04591;AD04592;AD04593;AD04594;AD04595 ;AD04596;AD04597;AD04598;AD04599;AD04734;AD04771;AD04772;AD04773;AD04774;AD04775;AD04776;AD04777;AD04778;AD04822;AD04823;AD0 4871;AD04872;AD04873;AD04874;AD04875;AD04876;AD04881;AD04882;AD04883;AD04884;AD04885;AD04962;AD04963;AD04981;AD04982;AD04983;an RNAi agent having a duplex structure comprising a sense or antisense strand identical or substantially identical to the respective sense or antisense strand in the duplex structure from the group consisting of: AD05069;AD05070;AD05071;AD05072;AD05073;AD05074;AD05075;AD05076;AD05077;AD05078;AD05147;AD05148;AD05149;AD05164; or AD05165;

[52] The RNAi drug is AD03498;AD03499;AD03500;AD03501;AD03738;AD03739;AD03967;AD03968;AD03969;AD03970;AD03971;AD03972;AD03973;AD03974;AD03975;AD03976;AD03977;AD03978;AD04001;AD04002;AD04003;AD04004;AD04005;AD04006;AD04007;AD04008;AD04009;AD04010;AD04176;AD04177 ;AD04178;AD04412;AD04413;AD04414;AD04415;AD04416;AD04417;AD04418;AD04419;AD04420;AD04421;AD04422;AD04423;AD04425;AD04426;AD0 4427;AD04428;AD04429;AD04430;AD04431;AD04432;AD04433;AD04434;AD04435;AD04436;AD04437;AD04438;AD04439;AD04440;AD04441;AD04442 ;AD04511;AD04570;AD04571;AD04572;AD04573;AD04574;AD04575;AD04576;AD04577;AD04578;AD04579;AD04580;AD04581;AD04583;AD04584;AD0 4585;AD04586;AD04587;AD04588;AD04590;AD04591;AD04592;AD04593;AD04594;AD04595;AD04596;AD04597;AD04598;AD04599;AD04734;AD04771 ;AD04772;AD04773;AD04774;AD04775;AD04776;AD04777;AD04778;AD04822;AD04823;AD04871;AD04872;AD04873;AD04874;AD04875;AD04876;AD0 4881;AD04882;AD04883;AD04884;AD04885;AD04962;AD04963;AD04981;AD04982;AD04983;AD05069;AD05070;AD05071;AD05072;AD05073;AD05074;The RNAi agent according to

[51] above, having a duplex structure comprising a sense strand identical or substantially identical to each sense in the duplex structure from the group consisting of AD05075; AD05076; AD05077; AD05078; AD05147; AD05148; AD05149; AD05164; or AD05165.

[53] The RNAi drug is AD03498;AD03499;AD03500;AD03501;AD03738;AD03739;AD03967;AD03968;AD03969;AD03970;AD03971;AD03972;AD03973;AD03974;AD03975;AD03976;AD03977;AD03978;AD04001;AD04002;AD04003;AD04004;AD04005;AD04006;AD04007;AD04008;AD04009;AD04010;AD04176;AD04177 ;AD04178;AD04412;AD04413;AD04414;AD04415;AD04416;AD04417;AD04418;AD04419;AD04420;AD04421;AD04422;AD04423;AD04425;AD04426;AD0 4427;AD04428;AD04429;AD04430;AD04431;AD04432;AD04433;AD04434;AD04435;AD04436;AD04437;AD04438;AD04439;AD04440;AD04441;AD04442 ;AD04511;AD04570;AD04571;AD04572;AD04573;AD04574;AD04575;AD04576;AD04577;AD04578;AD04579;AD04580;AD04581;AD04583;AD04584;AD0 4585;AD04586;AD04587;AD04588;AD04590;AD04591;AD04592;AD04593;AD04594;AD04595;AD04596;AD04597;AD04598;AD04599;AD04734;AD04771 ;AD04772;AD04773;AD04774;AD04775;AD04776;AD04777;AD04778;AD04822;AD04823;AD04871;AD04872;AD04873;AD04874;AD04875;AD04876;AD0 4881;AD04882;AD04883;AD04884;AD04885;AD04962;AD04963;AD04981;AD04982;AD04983;AD05069;AD05070;AD05071;AD05072;AD05073;AD05074;The RNAi agent according to

[52] above, having a duplex structure comprising an antisense strand identical or substantially identical to each antisense strand in the duplex structure from the group consisting of AD05075; AD05076; AD05077; AD05078; AD05147; AD05148; AD05149; AD05164; or AD05165.

[54] The RNAi drug is AD03498;AD03499;AD03500;AD03501;AD03738;AD03739;AD03967;AD03968;AD03969;AD03970;AD03971;AD03972;AD03973;AD03974;AD03975;AD03976;AD03977;AD03978;AD04001;AD04002;AD04003;AD04004;AD04005;AD04006;AD04007;AD04008;AD04009;AD04010;AD04176;AD04177 ;AD04178;AD04412;AD04413;AD04414;AD04415;AD04416;AD04417;AD04418;AD04419;AD04420;AD04421;AD04422;AD04423;AD04425;AD04426;AD0 4427;AD04428;AD04429;AD04430;AD04431;AD04432;AD04433;AD04434;AD04435;AD04436;AD04437;AD04438;AD04439;AD04440;AD04441;AD04442 ;AD04511;AD04570;AD04571;AD04572;AD04573;AD04574;AD04575;AD04576;AD04577;AD04578;AD04579;AD04580;AD04581;AD04583;AD04584;AD0 4585;AD04586;AD04587;AD04588;AD04590;AD04591;AD04592;AD04593;AD04594;AD04595;AD04596;AD04597;AD04598;AD04599;AD04734;AD04771 ;AD04772;AD04773;AD04774;AD04775;AD04776;AD04777;AD04778;AD04822;AD04823;AD04871;AD04872;AD04873;AD04874;AD04875;AD04876;AD0 4881;AD04882;AD04883;AD04884;AD04885;AD04962;AD04963;AD04981;AD04982;AD04983;AD05069;AD05070;AD05071;AD05072;AD05073;AD05074;The RNAi agent according to

[53] above, wherein the duplex structure comprises a sense strand and an antisense strand that are both identical or substantially identical to each other, in each sense strand and antisense strand in the duplex structure from the group consisting of AD05075;AD05076;AD05077;AD05078;AD05147;AD05148;AD05149;AD05164; or AD05165.

[55] The RNAi agent according to any one of

[51] to

[54] above, wherein the substantially identical means exactly identical, or at least or about 85%, 86%, 87%, 88%, 89%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, or 99% identical.

[56] The RNAi agent according to any of the above-mentioned

[51] to

[54] , wherein the substantially identical identity is at least or about 85%, 86%, 87%, 88%, 89%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, or 99%.

[57] The RNAi agent according to any of the above-mentioned

[51] to

[54] , wherein the substantially identical identity is about 85%, 86%, 87%, 88%, 89%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, or 99%.

[58] The RNAi agent according to any of the above-mentioned

[51] to

[54] , wherein the substantially identical identity is at least about 85%, 86%, 87%, 88%, 89%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, or 99%.

[59] A composition comprising the RNAi agent according to any one of

[51] to

[58] above.

[60] A composition comprising at least two RNAi agents according to any one of

[51] to

[58] above.

[61] The RNAi agent according to any one of [1] to [9] or

[51] to

[58] above, wherein the RNAi agent comprises at least one overhang.

[62] The RNAi agent of

[61] above, wherein the RNAi agent comprises an overhang at the 3' end of the antisense strand.

[63] The RNAi agent of

[62] above, wherein the RNAi agent comprises an overhang at the 3' end of the antisense strand and the 3' end of the sense strand.

[64] The RNAi agent according to any one of [1] to [9] or

[51] to

[58] above, wherein the RNAi agent comprises one or two blunt ends.

[65] The RNAi agent according to any one of [1] to [9] or

[51] to

[58] above, wherein the RNAi agent comprises one or two frayed ends.

[66] The RNAi agent according to any one of the above [1] to [9],

[51] to

[58] , or

[61] to

[65] , wherein the sense strand comprises at least one inverted abasic nucleoside.

Claims

1. 1. An RNAi agent for inhibiting gene expression of Hepatitis B virus in a subject, comprising:

1. An RNAi agent comprising a sense strand that comprises the nucleobase sequence set forth in SEQ ID NO: 328 and an antisense strand that comprises the nucleobase sequence set forth in SEQ ID NO: 188, wherein at least one nucleotide of the sense strand and / or at least one nucleotide of the antisense strand of the RNAi agent is a modified nucleotide and / or has a modified internucleoside linkage.

2. The RNAi agent of claim 1, wherein 0, 1, 2, 3, or 4 nucleotides of the sense strand and the antisense strand of the RNAi agent are unmodified nucleotides.

3. The RNAi agent of claim 2, wherein both the sense strand and the antisense strand independently comprise 1, 2, 3, 4, 5, or 6 phosphorothioate linkages.

4. The RNAi agent of any one of claims 1 to 3, wherein the RNAi agent comprises a targeting ligand.

5. The RNAi agent of claim 4, wherein the targeting ligand comprises N-acetyl-galactosamine.

6. The targeting ligand is: 【Chemistry 1-1】 【Chemistry 1-2】 【Chemistry 1-3】 【Chemistry 1-4】 【Chemistry 1-5】 【Chemistry 1-6】 【Chemistry 1-7】 【Chemistry 1-8】 【Chemistry 1-9】 【Chemistry 1-10】 【Chemistry 1-11】 and NAG is N-acetyl-galactosamine.

7. The RNAi agent of any one of claims 4 to 6, wherein the targeting ligand is linked to the 3' or 5' end of the sense strand of the RNAi agent.

8. The RNAi agent of any one of claims 4 to 6, wherein the targeting ligand is linked to the 3' or 5' end of the antisense strand of the RNAi agent.

9. The sense strand is (NAG37)s(invAb)scgcuguagGfCfAfuaaauugguas(invAb) (SEQ ID NO:262); (NAG37) csgcuguagGfCfAfuaaauugguas(invAb) (SEQ ID NO: 271); or (NAG25)s(invAb)scgcuguagGfCfAfuaaauugguas(invAb) (SEQ ID NO: 274), a, g, c and u are 2'-O-methyl modified nucleotides; Af, Cf, Gf and Uf are 2'-fluoro modified nucleotides; s is a phosphorothioate internucleoside linkage; The RNAi agent of claim 4, wherein (invAb) is an inverted (3'-3' linked) abasic deoxyribonucleotide.

10. The RNAi agent of claim 9, wherein the antisense strand has the structure: usAfscsCfaAfuUfuAfuGfcCfuAfcAfgcsg (SEQ ID NO: 140).

11. 11. The RNAi agent of claim 10, wherein the RNAi agent is linked at its 5' end to NAG37s and comprises a sense strand having the structure (NAG37)s(invAb)scgcuguagGfCfAfuaaauugguas(invAb) (SEQ ID NO:262) and an antisense strand having the structure usAfscsCfaAfuUfuAfuGfcCfuAfcAfgcsg (SEQ ID NO:140).

12. The RNAi agent of any one of claims 1 to 11, wherein the RNAi agent is in the form of a salt.

13. The RNAi agent is in the form of a sodium salt and has the following structure: 【Chemistry 2-1】 【Chemistry 2-2】 【Chemistry 2-3】 【Chemistry 2-4】 The RNAi agent of any one of claims 1 to 12, comprising:

14. 1. A pharmaceutical composition for inhibiting gene expression of Hepatitis B virus in a subject, comprising: a first RNAi agent linked at its 5' end to NAG37s, the first RNAi agent comprising a sense strand having the structure (NAG37)s-(invAb)sguggacuuCfUfCfucaauuuucus(invAb) (SEQ ID NO:252), and an antisense strand having the structure asGfsasAfaAfuUfgAfgAfgAfaGfuCfcasc (SEQ ID NO:126); the first RNAi agent is used in combination with a second RNAi agent that is an RNAi agent of any one of claims 1 to 13; The ratio of said first RNAi agent to said second RNAi agent is about 2:

1.

15. 1. A pharmaceutical composition for inhibiting gene expression of Hepatitis B virus in a subject, comprising: a second RNAi agent which is an RNAi agent of any one of claims 1 to 13; the second RNAi agent comprising: in combination with a first RNAi agent linked at its 5' end to NAG37s and comprising a sense strand having the structure (NAG37)s-(invAb)sguggacuuCfUfCfucaauuuucus(invAb) (SEQ ID NO:252), and an antisense strand having the structure asGfsasAfaAfuUfgAfgAfgAfaGfuCfcasc (SEQ ID NO:126); The ratio of said first RNAi agent to said second RNAi agent is about 2:

1.

16. 16. The pharmaceutical composition of claim 14 or 15, wherein the pharmaceutical composition comprises the first RNAi agent and the second RNAi agent.

17. The pharmaceutical composition of any one of claims 14-16, wherein the first RNAi agent and the second RNAi agent are each in the form of a salt.

18. the first RNAi agent is in the form of a sodium salt and has the following structure: 【Chemistry 3-1】 【Chemistry 3-2】 【Chemistry 3-3】 【Chemistry 3-4】 having the second RNAi agent is in the form of a sodium salt and has the following structure: 【Chemistry 4-1】 【Chemistry 4-2】 【Chemistry 4-3】 【Chemistry 4-4】 18. The pharmaceutical composition of claim 17, having the formula:

19. A composition comprising an RNAi agent according to any one of claims 1 to 13, or a pharmaceutical composition according to any one of claims 14 to 18, The composition is for inhibiting gene expression of Hepatitis B virus in a subject, and further comprises a pharma- ceutically acceptable excipient.

20. 20. The composition of claim 19, which is formulated for subcutaneous injection.

21. 21. The composition of claim 20, which is a sterile injectable solution.

22. 22. The composition of claim 21 packaged in a pre-filled syringe.

23. 20. The composition of claim 19, which is a sterile powder for the preparation of a sterile injectable solution.

24. 24. The composition of claim 23 packaged in a vial.

25. The RNAi agent of any one of claims 1 to 13, the pharmaceutical composition of any one of claims 14 to 18, or the composition of any one of claims 19 to 24, for use in the therapeutic treatment of chronic HBV infection.

26. An RNAi agent according to any one of claims 1 to 13, a pharmaceutical composition according to any one of claims 14 to 18, or a composition according to any one of claims 19 to 24 for use in the therapeutic treatment of a chronic HBV infection, comprising Used in combination with further treatments, The RNAi agent, pharmaceutical composition or composition and the additional treatment are administered separately.

27. 27. The RNAi agent, pharmaceutical composition or composition for use of claim 26, wherein the further therapy is a nucleoside inhibitor or a nucleotide inhibitor.

Images