Biological treatment method

Abstract

To provide a biological treatment method capable of stably performing biological treatment of treatment target water.SOLUTION: There is provided a biological treatment method for biological treatment of treatment target water by a biological treatment device. The method calculates a bacteria amount ratio of microbial populations among a plurality of function groups in the biological treatment device or a value correlated thereto, and operates the biological treatment device so that the calculated value is within a prescribed range. The calculated value is calculated by realtime PCR in which primers and probes or intercalators in the respective function groups are set, where the primers and the probes or the intercalators do not overlap mutually among the respective function groups.SELECTED DRAWING: Figure 2

Description

[Technical field]

[0001] The present invention relates to a method for biologically treating wastewater or the like. [Background technology]

[0002] When biologically treating wastewater, stable operation is usually achieved by controlling the raw water quality, treated water quality, and operating conditions to maintain them within a specified range according to the biological treatment method. However, even if the above-mentioned operational control is performed appropriately, the treatment performance may decrease due to fluctuations in raw water load, the organic matter composition in the raw water, and the amount and properties of microorganisms held in the reaction tank. In such cases, the decrease in treatment performance is usually detected by sensors or water quality analysis, or visually confirmed by on-site workers, and countermeasures are generally taken.

[0003] However, in anaerobic treatment such as methane fermentation, once the treatment performance is reduced, it generally takes a long time to recover. In addition, there is a concern that it will take time to identify the cause of the reduction in treatment performance, which may delay the implementation of countermeasures.

[0004] For example, the accumulation of propionic acid inhibits methane fermentation. Once propionic acid begins to accumulate, it takes time to recover, which can lead to loss of profits due to load reductions and shutdowns.

[0005] For these reasons, in biological treatment of wastewater, particularly in anaerobic treatment, there is a demand for preventing performance degradation before it occurs and for quickly identifying the cause of performance degradation.

[0006] Patent document 1 discloses a technology in which the floating tendency of granular sludge is determined based on the distribution of methanogens and eubacteria inside the granular sludge, and if the floating tendency is determined to be high, the technology is addressed by adjusting the retention time and wastewater temperature.

[0007] Patent Document 2 discloses a technique for determining anomalies in wastewater treatment capacity by observing the rRNA / rDNA ratio and changes in the number of rRNA bands in activated sludge using the DGGE method or the TGGE method.

[0008] However, microbial flora analysis that focuses only on higher classification levels as in Patent Document 1, or indicators that do not include microbiological or biochemical information as in Patent Document 2, has been difficult to diagnose various fluctuations and abnormalities in wastewater treatment. [Prior art documents] [Patent documents]

[0009] [Patent Document 1] JP 2001-104988 A [Patent Document 2] JP 2018-121528 A Summary of the Invention [Problem to be solved by the invention]

[0010] An object of the present invention is to provide a biological treatment method capable of stably carrying out biological treatment of water to be treated. [Means for solving the problem]

[0011] As mentioned above, the accumulation of propionic acid inhibits methane fermentation. Therefore, it is possible to detect signs of propionic acid accumulation from metagenomic analysis and changes in the flora of propionic acid-producing and -utilizing bacteria based on a microbial database.

[0012] However, metagenomic analysis requires a long time and is expensive because it uses expensive chemicals, making it unsuitable for frequent monitoring. Therefore, cheaper and simpler methods for monitoring microbial flora are needed.

[0013] The inventors have found that the above-mentioned object can be achieved by estimating the bacterial mass ratios of microbial groups among multiple functional groups in a biological treatment device using real-time PCR, which requires less time and requires less use of expensive chemicals than metagenomic analysis, and operating the biological treatment device based on the results.

[0014] The biological treatment method of the present invention is based on such findings, and involves calculating the bacterial mass ratio of microbial groups among multiple functional groups within the biological treatment device, or a value correlated therewith, and operating the biological treatment device so that this calculated value falls within a predetermined range. The calculated value is calculated by real-time PCR using primers and probes or intercalators for each functional group that do not overlap with each other in each functional group.

[0015] In one embodiment of the present invention, the biological treatment is methane fermentation.

[0016] In one embodiment of the present invention, the functional groups include a propionic acid production function and a propionic acid assimilation function, and the microbial communities among the functional groups include propionic acid producing bacteria and propionic acid assimilation bacteria.

[0017] In one embodiment of the present invention, the bacterial mass ratio between functional groups or a value correlated therewith is calculated by absolute quantification using real-time PCR, or by calculating the difference ΔCp between the rise times of the fluorescence curves of both groups in real-time PCR, raised to the power of 2. ΔCp It is calculated by using Effect of the Invention

[0018] According to the present invention, the bacterial mass ratio of microbial groups among multiple functional groups in a biological treatment device can be estimated, thereby enabling stable operation and management of the biological treatment device. According to the present invention, the time required for each analysis can be significantly shortened. Furthermore, the use of expensive chemicals required for the analysis can be significantly reduced. This makes it possible to quickly and easily predict the accumulation tendency of target substances in the biological treatment device. [Brief description of the drawings]

[0019] [Figure 1] FIG. 2 is a configuration diagram of a test device. [Diagram 2] 1 is a flowchart showing a sludge analysis method. [Diagram 3] 13 is a graph showing experimental results. DETAILED DESCRIPTION OF THE PREFERRED EMBODIMENTS

[0020] Hereinafter, an embodiment of the present invention will be described.

[0021] In the biological treatment method of the present invention, as shown in FIG. 2, first, biological treatment sludge is sampled from a target water system, for example, a biological treatment reactor of a wastewater treatment facility, and DNA is extracted from the sludge and subjected to real-time PCR analysis.

[0022] Sampling of biological treatment sludge and real-time PCR analysis should be performed periodically (e.g., once every 1 to 7 days, especially once every 1 to 3 days).

[0023] Biologically treated sludge is not limited to suspended sludge, but also includes microbial granules and non-biological carriers with attached biofilms. In the case of fixed bed carriers, the biofilms are partially removed from the carrier before operation. Biological treatment is, for example, a methane fermentation system.

[0024] In the analysis by real-time PCR, in order to estimate the bacterial mass ratio of microbial groups among multiple functional groups, the bacterial mass ratio or a value correlated therewith is calculated by real-time PCR using primers and probes or intercalators for each functional group that do not overlap with each other in each functional group.

[0025] For example, in the case of methane fermentation, the multiple functional groups are the production function and assimilation function of the monitored substance (such as an inhibitor), and in this case, the microbial communities between the multiple functional groups are the producers and assimilation bacteria of the monitored substance. An example of an inhibitor in methane fermentation is propionic acid.

[0026] When propionic acid is the monitored substance, the dominant species of the producer bacteria with the propionic acid production function and the dominant species of the assimilation bacteria with the assimilation function are set. For example, the dominant species of the propionic acid producer bacteria and the propionic acid assimilation bacteria are set by amplicon analysis based on the sequence of the V3-V4 region of the 16S rRNA gene. In addition, primers and probes for detecting these bacteria by real-time PCR are set.

[0027] The bacterial mass ratio between functional groups or a value correlated therewith can be calculated by absolute quantification using real-time PCR, or by calculating a value correlated with the bacterial mass ratio, such as the difference ΔCp between the rise times of the fluorescence curves (Crossing Point: Cp value) in real-time PCR, raised to the power of 2. ΔCp It is calculated by using

[0028] The value calculated in this manner is used as the ratio of the bacterial mass of the microbial groups between the functional groups, and the biological treatment device is operated so that the calculated value falls within a predetermined range.

[0029] For example, the calculated value is acquired over time within the biological treatment device, and if the bacterial mass ratio or a value correlated therewith is equal to or less than a predetermined value, it is determined that stable operation is continuing without any significant fluctuations in the biological treatment. This predetermined value is set based on past operating data, water quality data, etc.

[0030] If the bacteria mass ratio or a value correlated therewith is calculated to exceed a predetermined value, it is determined that a biological treatment problem has already occurred or may occur in the future, and the operating conditions are changed, for example by reducing the inflow load to the reactor.

[0031] According to the method of the present invention, the time required for each analysis can be shortened to about one day. In addition, the use of expensive chemicals required for the analysis can be significantly reduced. Therefore, it becomes possible to quickly and easily predict the accumulation tendency of the target substance in the biological treatment apparatus.

[0032] <Regarding application to other biological treatments> In the following examples, it was exemplified that there is a relationship between the inhibition of the methane fermentation reaction and the accumulation of propionic acid, and the present invention is preferably used. However, the present invention is not limited thereto, and the present invention can be particularly used for reactions that take a long time to recover from performance degradation. For example, the present invention can be used for monitoring a decrease in treatment capacity due to a decrease in hydrolytic bacteria in methane fermentation, or an increase in denitrifying bacteria that compete with anammox bacteria in the anammox reaction.

Examples

[0033] Hereinafter, examples will be described. In the following examples, sludge in the anaerobic digestion test of artificial food waste was used as the seed sludge.

[0034] For this sludge, by amplicon analysis based on the sequence of the V3-V4 region of the 16S rRNA gene, the dominant species of propionic acid-producing bacteria and assimilating bacteria were classified as bacteria belonging to the genus Propioniciclava and bacteria belonging to the phylum Cloacimonates, respectively.

[0035] As primers and probes for detecting these bacteria by real-time PCR, the sequences of Pro_F2, Pro_R1, Pro_Probe2 were used for bacteria belonging to the genus Propioniciclava, and the sequences of Clo_F1, Clo_R1, Clo_Probe1 were used for bacteria belonging to the phylum Cloacimonates. The sequences are shown below.

[0036] <Bacteria belonging to the genus Propioniciclava> Forward primer Pro_F2 CTAACTACGTGCCAGCAGC Reverse primer Pro_R1 CCACCGCTCCACCAGGAATT Probe Pro_Probe2 CGTATCGAAAGCAAGCCCACA

[0037] <Bacteria of the phylum Cloacimonetes> Forward primer Clo_F1 TAACTCCGTGCCAGCAGC Reverse primer Clo_R1 CACCGCTACACCAGGAATTCTG Probe Clo_Probe1 TAAAGGGCAGGCAGGCGGAT

[0038] [Example 1] An artificial substrate having the following composition with sugar as the main substrate was anaerobically treated using a treatment apparatus having a methane fermentation tank 1 with a capacity of about 10 L shown in Fig. 1. Glucose 25000 mg-COD / L Ammonium chloride 303 mg / L Disodium hydrogen phosphate 37.4 mg / L Potassium dihydrogen phosphate 13.9 mg / L Trace metal solution 10 ppm Yeast extract 40.5 mg-COD / L

[0039] The supply rate of the artificial substrate from the artificial substrate tank 2 was set to 5 mL / min, and the pH of the fermentation tank 1 was maintained at 6.8 - 7.4 using 2N-NaOH in the NaOH tank 3.

[0040] In order to accumulate propionic acid in the fermentation tank, the fermentation tank was continuously fed water under overload conditions with the HRT shortened to 10 - 20 days, which is shorter than the HRT of general anaerobic digestion, and data on water quality and bacterial flora were obtained.

[0041] [Analysis operation] The analytical procedure was performed according to the flow chart in Figure 2. DNA was extracted from approximately 400 μL of sample sludge using the FastDNA SPIN Kit for Soil (MP BiomediCals, Irvine, CA) according to the manufacturer's instructions. Samples to be subjected to real-time PCR were prepared using the LightCycler 480 Probes Master, and reactions and analysis were performed using the LightCycler 480.

[0042] <How to calculate the bacterial quantity ratio> In this embodiment, the ratio of the amount of bacteria of the dominant species of propionic acid producing bacteria to the amount of bacteria of the dominant species of assimilation bacteria was calculated by raising 2 to the power of the difference ΔCp between the rise times (Crossing Point: Cp value) of the fluorescence curves of both species in real-time PCR. ΔCp The calculation was carried out using

[0043] <Analysis results> Figure 3 shows the influent load, removal load, propionic acid concentration, and ΔCp The time course of the increase in the load on the 33rd day led to the accumulation of propionic acid from the 40th day onwards. ΔCp increased from 3.0 to 4.8 from day 36 to day 37.

[0044] After that, reducing the load or shutting down the operation did not have a significant effect on eliminating the accumulation of propionic acid. However, the accumulation was eliminated by replacing part of the sludge on the 130th day.

[0045] 2 on the 130th day ΔCp 4.9, 2 on the 141st day ΔCp was 2.2.

[0046] In this system, 2 ΔCp It is believed that the accumulation of propionic acid can be prevented by operating the reactor so that the ratio does not exceed 3.

[0047] Although the above describes a method using primers and probes, other analytical methods that do not use probes may also be used. For example, the intercalator method does not use a probe, but instead adds a reagent (intercalator) that emits fluorescence when bound to double-stranded DNA to the PCR reaction system, and measures the amount of amplified product by detecting the intensity of the fluorescence emitted by the PCR reaction. From this measurement, the bacterial mass ratio of the dominant species of producer bacteria with propionic acid production function and assimilating bacteria with assimilation function, or a value correlated therewith, is calculated. [Explanation of symbols]

[0048] 1. Methane fermentation tank 2. Artificial substrate tank

Claims

1. A biological treatment method in which water to be treated is biologically treated by methane fermentation in a biological treatment device, A dominant species of producer bacteria having a propionic acid production function (hereinafter referred to as the dominant species of producer bacteria) and a dominant species of assimilating bacteria having a propionic acid assimilation function (hereinafter referred to as the dominant species of assimilation bacteria) are established in the water to be treated; a bacterial mass ratio between the dominant species of producer bacteria and the dominant species of assimilation bacteria in the biological treatment device, or a value correlated therewith, is calculated, and the biological treatment device is operated so that the calculated value falls within a predetermined range; the calculated value is calculated by real-time PCR using primers and a probe or an intercalator for each of the predominant species of producer bacteria and the predominant species of assimilation bacteria, the primers and the probe or the intercalator being set such that they do not overlap with each other, A biological treatment method in which the predetermined range is set by a predetermined value based on past operation data or water quality data.

2. 2. The biological treatment method according to claim 1, wherein the predominant species of producer bacteria is a propionic acid-producing bacteria, and the predominant species of assimilation bacteria is a propionic acid assimilation bacteria.

3. In the biological treatment method according to claim 1 or 2, the bacterial mass ratio between the dominant species of producer bacteria and the dominant species of assimilation bacteria, or a value correlated therewith, is calculated by absolute quantification using real-time PCR, or by calculating the difference ΔCp between the rise times of the fluorescence curves of both species in real-time PCR raised to the power of 2. ΔＣｐ A biological treatment method using the above method.

Images