Kits for screening colon cancer and advanced adenomas and their applications

Abstract

The present invention provides a combination of primers and probes for performing quantitative PCR that can be used to determine the methylation status and levels of the BMP3 and NDRG4 genes in patients in need, resulting in remarkably high diagnostic specificity and sensitivity for diagnosing the presence or absence of colorectal cancer (CRC) and / or advanced adenoma (AA) in patients in need. Compositions and methods for performing the diagnosis are provided.

Description

[Technical field]

[0001] CROSS-REFERENCE TO RELATED APPLICATIONS This application claims priority to Chinese Patent Application No. 201810502359.7, filed May 23, 2018, and No. 201810502387.9, filed May 23, 2018, each of which is incorporated by reference in its entirety for all purposes.

[0002] FIELD OF THE PRESENT APPLICATION The present invention relates to compositions and methods for screening for colorectal cancer and advanced adenomas, as well as other applications.

[0003] Description of electronically submitted text files The contents of the text file submitted electronically herewith are incorporated by reference in their entirety herein: Copy of a Computer Readable Format of the Sequence Listing (Filename: NEWH-017_01WO_SeqList_ST25.txt, Recorded: May 22, 2019, File Size: 22 KB). [Background technology]

[0004] Colorectal cancer (CRC) is the fourth most common cancer in the world, with a lower mortality rate than lung, liver, and gastric cancer. Approximately 700,000 people die annually from CRC. CRC is a "modernized" disease with a higher incidence in developed countries compared to developing countries. In the United States, CRC is still the second leading cause of death (Clinical Interventions in Aging 2016; 11:967-976). With the improvement of people's living standards, the incidence and mortality rates of CRC have increased in China since 2000 (CA CANCER J CLIN 2016; 66:115-132). The 5-year survival rate of patients with early-stage localized disease (stages I and II) approaches 90%, while the survival rate of patients with late-stage CRC is only 13.1%. The costs of treatment for patients with late-stage CRC are often prohibitive and only reduce the symptoms of the disease (Clinical Interventions in Aging 2016; 11:967-976).

[0005] The development of CRC is generally an asymptomatic, slow process that is difficult to detect early on until the tumor grows to a size of several centimeters that may obstruct the passage of stool and result in cramping, pain, or visible bleeding. The development of CRC is a multi-step process (i.e., from healthy to hyperplasia, small polyp, large polyp, adenocarcinoma, and cancer) with a series of histological, morphological, and genetic changes that accumulate over time. Polyps are abnormal cells that grow or accumulate locally within the intestinal mucosa. Dividing cells within a polyp may accumulate enough genetic changes to penetrate the intestinal wall and eventually evolve into CRC. However, only a small number of polyps evolve into CRC after more than 10 years of development. The two main types of potentially malignant polyps are adenomas and sessile serrated polyps (SSPs), each of which has a different risk of developing into CRC. The risk of an adenoma developing into CRC is related to its size. In general, the larger the size of the adenoma, the more likely it is to develop into CRC. Advanced adenoma (AA) refers to a size of 1 cm or more or a villous component of 25% or more or high-grade dysplasia of any size. Although only about 10% of most AAs become cancerous, 60%-70% of CRCs develop from adenomas, and the remaining 25%-35% of CRCs develop from SSPs (Clinical Interventions in Aging 2016; 11:967-976). Therefore, early detection and removal of CRC and AA lesions can effectively stop the progression of CRC and save patients' lives, significantly improve the 5-year survival rate of patients, and reduce the high treatment costs of late-stage CRC, which greatly reduces the economic burden on families and society.

[0006] Currently, several tests exist for the detection of CRC, mainly including colonoscopy, sigmoidoscopy, CT colonography, fecal occult blood test (FOBT) and immunochemical fecal occult blood test (FIT).

[0007] The sensitivity of colonoscopy to detect CRC is >95%. The screening interval is every 10 years. The advantages of colonoscopy are high sensitivity, the ability to examine the entire colon, and the ability to remove lesions simultaneously. However, the disadvantages are that it is an invasive test, bowel preparation can cause discomfort and the patient needs to be calmed down, and there is a risk of bowel perforation and bleeding during colonoscopy. These limitations contribute to low compliance with colonoscopy screening.

[0008] The sensitivity of sigmoidoscopy to detect the distal colon is over 95%. The interval for screening for CRC by sigmoidoscopy is every 5 years in combination with FOBT. The advantages of screening for CRC by sigmoidoscopy are its high sensitivity, no need for systemic sedation, and the ability to simultaneously remove lesions during the examination. The disadvantages are that it is a semi-invasive examination, which is prone to discomfort during the examination, and the examination cost is high.

[0009] CT colonography uses radiation to visualize the colon, has a sensitivity of >90%, and is performed every 5 years. The advantages are high sensitivity, allowing the entire colon to be viewed, and no need for sedation. The disadvantages are that the assay is a semi-invasive test, so patients are prone to discomfort during the screening process. In addition, lesions cannot be removed at the same time, and radiation safety must be considered.

[0010] In summary, the above tests based on imaging to detect CRC have high sensitivity, but are expensive, and bowel preparation is prone to discomfort and other side effects. As a result, patient compliance is low. In addition, these assays require specialized equipment and physicians with specialized skills and extensive experience, which may not be available. As a result, the overall screening / detection rate is low. In addition, some patients are not compatible with these assays. For example, diabetic patients have a lower success rate of bowel preparation and a higher risk of side effects (J Gastrointestin Liver Dis 2010; 19: 369-372, World J Gastrointest Endosc 2013; 5: 39-46).

[0011] FOBT and FIT detect hemoglobin in the stool of patients by enzymatic reactions and immunochemical methods, respectively, and have a detection sensitivity of 33-75% and 60-85%, respectively, and are performed annually. FOBT and FIT are widely available, non-invasive, and inexpensive, but have a low detection rate of precancerous lesions (Clinical Interventions in Aging 2016; 11 967-976).

[0012] During the development of polyps into CRC, mutations and methylation changes in several genes (e.g., APC, KRAS, p53, BRAF, NDRG4, BMP3) accumulate (Clinical Interventions in Aging 2016; 11:967-976). Therefore, detection of these mutations or methylation changes is useful for detecting CRC and precancerous lesions.

[0013] Zou et al. (Clinical Chemistry 2012; 58: 2375-383) used methylation qPCR to detect the methylation levels of BMP3, NDRG4, VIM and TFPI2 genes in tissue samples. In a total of 37 CRC tissue samples, 25 adenoma tissue samples and 29 healthy human tissue samples were examined. When the specificity was 95%, the sensitivity of BMP3, NDRG4, VIM and TFPI2 genes for CRC detection was 84%, 92%, 86% and 92%, respectively, and the sensitivity for adenoma detection was 68%, 76%, 76% and 88%, respectively. It was shown that the detection of gene methylation in colon cancer tissues has high sensitivity and specificity. However, the tissue sampling method is difficult to be widely used because it causes certain damage to the patient's body during the sampling process. Therefore, it is not suitable for screening CRC and precancerous lesions in the general public.

[0014] Multi-target stool DNA (mt-sDNA) testing includes the detection of methylation and mutations in tumor exfoliated cells and the detection of hemoglobin in stool samples, which is screened every three years and has the advantages of high sensitivity, non-invasiveness and easy dissemination (Clinical Interventions In Aging 2016;11:967-976). As a screening method, mt-sDNA can detect CRC and AA early, significantly improving the survival rate of patients. Imperiale et al. (N Engl J Med 2014;370:1287-97) established a system based on mt-sDNA for methylation detection of BMP3 and NDRG4 genes, point mutation detection of KRAS gene, and hemoglobin detection in stool, and evaluated the risk of CRC and AA according to the logistic regression equation. The detection sensitivity of CRC and AA was 92.3% and 42.4%, respectively, and the specificity was 86.6%.

[0015] Mt-sDNA has been applied to screen sporadic CRC and AA, with the advantages of being non-invasive compared with colonoscopy and having higher sensitivity compared with FOBT and FIT, but the detection sensitivity of AA remains much lower than that of CRC (Clinical Interventions in Aging 2016; 11:967-976).

[0016] Currently, mt-sDNA-based products for detecting CRC or AA (such as Cologuard®) have been developed mainly for Western populations. There are no products available for the detection of CRC and AA in Asian populations. In particular, according to the "Summary of safety and effectiveness data (SSED)" of Cologuard® published by the US Food and Drug Administration (www.accessdata.fda.gov / cdrh_docs / pdf13 / P130017b.pdf), the sensitivity of detecting AA with Cologuard® in Caucasian and African-American populations is 42.3% and 42.4%, respectively, while the sensitivity of detecting AA with the same product in Asian populations is only 30.8%. Therefore, to address the current increase in the incidence and mortality of colorectal cancer in Asian countries, it is necessary to develop an effective system for the detection of CRC and / or AA in Asian populations.

[0017] Although many studies have been done on methods to detect methylation of BMP3 and NDRG4 genes in stool samples from patients with CRC and AA, there is no detailed and comprehensive study on hypermethylated CpG sites in BMP3 and NDRG4 genes in Asian populations (ONCOLOGY LETTERS 2014;8:1751-1756; ONCOLOGY LETTERS 2015;9:1383-1387). In addition, due to the limitation of sample size, previous studies on methylation of BMP3 and NDRG4 genes in Asian patients were not useful to identify the methylation sites most related to CRC and AA. Therefore, it is necessary to determine the exact location of hypermethylated CpG sites of BMP3 and NDRG4 genes in Asian populations and design and optimize kits that will make the detection of AA more sensitive based on these methylated CpG sites. Summary of the Invention

[0018] The present disclosure provides DNA sequences containing hypermethylated CpG sites in the promoter regions of the BMP3 and NDRG4 genes.

[0019] The present disclosure also provides preferred primers and probes for detecting methylation of the BMP3 or NDRG4 gene, as well as combinations thereof for detecting methylation of both the BMP3 and NDRG4 genes.

[0020] The present disclosure further provides a kit for detecting CRC and AA in Asian populations.The DNA sequence comprising hypermethylated CpG sites in the promoter region of BMP3 and NDRG4 genes can be used as a marker for detecting CRC and / or AA in Asian populations.

[0021] Compared with other primers and probes, the preferred primer pair and probe for detecting the methylation level of BMP3 and / or NDRG4 gene has surprisingly high sensitivity and specificity for detecting tumor tissue (such as CRC and AA, especially AA).In addition, these preferred primer and probe combinations of the present disclosure also achieve surprisingly high sensitivity and specificity for detecting tumor tissue (such as CRC and AA, especially AA).

[0022] Also provided are kits for detecting CRC and AA in Asian populations based on the above preferred primer and probe combinations.

[0023] In some embodiments, the kit includes: (1) preferred combinations of primer pairs and probes and corresponding qPCR reagents; (2) primers and probes and corresponding qPCR reagents for detecting seven mutations () in the coding region of the KRAS gene; and (3) reagents for detecting hemoglobin in stool.

[0024] In some embodiments, the results obtained from the assay using the kit are corrected and analyzed according to a logistic regression formula. In some embodiments, the formula is used to calculate the value for determining the presence or absence of CRC and / or AA. In some embodiments, the formula is: P=e K / (1+e K ), where P is a comprehensive index, K=a*ΔCt1+b*ΔCt2+c*ΔCt3+d*FIT+X, e is a natural constant, and a, b, c, d, and X are clinical constants. In some embodiments, if the P value is equal to or greater than a predetermined threshold, the result indicates a positive detection of CRC and / or AA in the patient. In some embodiments, if the P value is less than the threshold, the result indicates a negative detection of CRC and / or AA in the patient, and the patient is determined to be healthy.

[0025] The present disclosure provides kits for detecting the presence or absence of colorectal cancer (CRC) or advanced adenoma (AA) in a patient in need thereof, such as a patient suspected of having CRC and / or AA (such as a patient having at least one symptom of developing CRC and / or AA, or a patient at risk of developing CRC and / or AA, or a subject undergoing regular medical checkups but otherwise not having symptoms or risk).

[0026] In some embodiments, the kit comprises: a) a first primer pair and a first probe for detecting the methylation status or level of at least one CpG dinucleotide of BMP3 gene in a biological sample obtained from a patient.In some embodiments, the first primer pair and the first probe each comprise a continuous sequence of at least 16 nucleotides that is identical to SEQ ID NO:1, is complementary, or hybridizes under stringent hybridization conditions.

[0027] In some embodiments, the kit comprises a second primer pair and a second probe for detecting the methylation status or level of at least one CpG dinucleotide of NDRG4 gene in a biological sample obtained from a patient.In some embodiments, the second primer pair and the second probe each comprise the continuous sequence of at least 16 nucleotides that are identical to SEQ ID NO:2, are complementary, or hybridize under stringent hybridization conditions.

[0028] In some embodiments, the first primer pair and the first probe are selected from the group consisting of:

[0029] i) a forward primer comprising SEQ ID NO:3, a reverse primer comprising SEQ ID NO:4, and a probe comprising SEQ ID NO:5;

[0030] ii) a forward primer comprising SEQ ID NO:9, a reverse primer comprising SEQ ID NO:10, and a probe comprising SEQ ID NO:11; and

[0031] iii) a forward primer comprising SEQ ID NO:15, a reverse primer comprising SEQ ID NO:16, and a probe comprising SEQ ID NO:17;

[0032] wherein in some embodiments, the second primer pair and the second probe are selected from the group consisting of:

[0033] iv) a forward primer comprising SEQ ID NO:6, a reverse primer comprising SEQ ID NO:7, and a probe comprising SEQ ID NO:8;

[0034] v) a forward primer comprising SEQ ID NO:12, a reverse primer comprising SEQ ID NO:13, and a probe comprising SEQ ID NO:14; and

[0035] vi) a forward primer comprising SEQ ID NO:18, a reverse primer comprising SEQ ID NO:19, and a probe comprising SEQ ID NO:20;

[0036] In some embodiments, the kit comprises: i) a forward primer comprising SEQ ID NO: 3, a reverse primer comprising SEQ ID NO: 4, and a probe comprising SEQ ID NO: 5 for detecting the methylation status or level of at least one CpG dinucleotide of the BMP3 gene in a biological sample obtained from a patient; and ii) A forward primer comprising sequence number 6, a reverse primer comprising sequence number 7, and a probe comprising sequence number 8 for detecting the methylation status or level of at least one CpG dinucleotide of the NDRG4 gene in a biological sample obtained from a patient.

[0037] In some embodiments, the kit comprises: i) a forward primer comprising SEQ ID NO: 9, a reverse primer comprising SEQ ID NO: 10, and a probe comprising SEQ ID NO: 11 for detecting the methylation status or level of at least one CpG dinucleotide of the BMP3 gene in a biological sample obtained from a patient; and ii) A forward primer comprising sequence number 12, a reverse primer comprising sequence number 13, and a probe comprising sequence number 14 for detecting the methylation status or level of at least one CpG dinucleotide of the NDRG4 gene in a biological sample obtained from a patient.

[0038] In some embodiments, the kit comprises: i) a forward primer comprising SEQ ID NO: 15, a reverse primer comprising SEQ ID NO: 16, and a probe comprising SEQ ID NO: 17 for detecting the methylation status or level of at least one CpG dinucleotide of the BMP3 gene in a biological sample obtained from a patient; and ii) A forward primer comprising sequence number 18, a reverse primer comprising sequence number 19, and a probe comprising sequence number 20 for detecting the methylation status or level of at least one CpG dinucleotide of the NDRG4 gene in a biological sample obtained from a patient.

[0039] In some embodiments, both the first probe and the second probe comprise fluorescent donor and acceptor fluorophores.

[0040] In some embodiments, the first probe and the second probe are TAQMAN® probes.

[0041] In some embodiments, the kit further comprises: (1) a means for detecting the presence or absence of at least one mutation in the KRAS gene in a patient; and (2) A means for detecting the presence or absence of hemoglobin in a biological sample obtained from a patient.

[0042] In some embodiments, the means for detecting the presence or absence of at least one mutation in the KRAS gene in a patient comprises at least one primer pair capable of amplifying the exon 12 and / or exon 13 region of the KRAS gene in a polymerase chain reaction (PCR).

[0043] In some embodiments, the means for detecting the presence or absence of hemoglobin in a biological sample comprises an anti-hemoglobin antibody.

[0044] In some embodiments, the primers are capable of amplifying a region of the KRAS gene that includes at least one KRAS mutation selected from the group consisting of G12D, G12V, G12C, G13D, G12A, G12R, G12S and G13C.

[0045] In some embodiments, the antibody is a colloidal gold-labeled antibody. In some embodiments, the kit further comprises a means for amplifying an internal quality control gene. The internal standard can detect (1) inhibitory contamination from the sample or extraction method, (2) equipment malfunction, (3) chemical failure (e.g., expired or deteriorated kit or components, or incorrect combination of reagents), and (4) human error. In some embodiments, the internal standard gene is a positive control (such as a gene in the positive control sample that is determined to have methylation). In some embodiments, the internal standard gene is a negative control (such as a gene in the negative control sample that is determined to have no methylation).

[0046] In some embodiments, the kit further comprises instructions for use and / or interpretation of test results obtained using the kit.

[0047] In some embodiments, the kit further comprises a means for detecting a complex formed by the antibody and hemoglobin in a biological sample.

[0048] In some embodiments, the biological sample obtained from the patient is a stool sample.

[0049] In some embodiments, the kit further comprises a bisulfite reagent and a container suitable for mixing the bisulfite reagent and the patient's biological sample or polynucleotides obtained from the biological sample.

[0050] In some embodiments, instead of using bisulfite, the kit further comprises a methylation-sensitive restriction enzyme reagent.

[0051] In some embodiments, the kit further comprises: (1) a positive standard and a negative standard for detecting BMP3 methylation in a biological sample, and (2) a positive standard and a negative standard for detecting NDRG4 methylation in a biological sample.

[0052] In some embodiments, the positive standard for detecting BMP3 methylation comprises the following polynucleotide sequence: GTTAGTTTGGTCGGGTGTTTTAAAAATAAAGCGAGGAGGGAAGGTATAGATAGATTTTGAAAATATTCGGGTTATATACGTCGCGATTTATAGTTTTTTTTTAGCGTTGGAGTGGAGACGGCGTTCGTAGCGTTTTGCG CGGGTGAGGTTCGCGTAGTTGTTGGGGAAGAGTTTATTTGTTAGGTTGCGTTGGGTTAGCGTAGTAAGTGGGGTTGGTCGTTATTTCGTTGTATTCGGTCGCGTTTCGGGTTTCGTGCGTTTTCGTTTTAG (SEQ ID NO: 67);

[0053] In some embodiments, the negative standard for detecting BMP3 methylation comprises the following polynucleotide sequence: GTTAGTTTGGTTGGGTGTTTTAAAAATAAAGTGAGGAGGGAAGGTATAGATAGATTTTGAAAATATTTGGGTTATATATGTTGTGATTTATAGTTTTTTTAGTGTTGGAGTGGAGATGGTGTTTGTAGTGTTTTGTG TGGGTGAGGTTTGTGTAGTTGTTGGGGAAGAGTTTATTTGTTAGGTTGTGTTGGGTTAGTGTAGTAAGTGGGGTTGGTTGTTATTTTGTTGTATTTGGTTGTGTTTTGGGTTTTGTGTGTTTTTGTTTTAG (SEQ ID NO: 68);

[0054] In some embodiments, the positive standard for detecting NDRG4 methylation comprises the following polynucleotide sequence: TGAGAAGTCGGCGGGGGCGCGGATCGATCGGGGTGTTTTTTAGGTTTCGCGTCGCGGTTTTCGTTCGTTTTTTCGTTCGTTTATCGGGTATTTTAGTCGCGTAGAAGGCGGAAGTTACGCGC GAGGGATCGCGGTTCGTTCGGGATTAGTTTTAGGTTCGGTATCGTTTCGCGGGTCGAGCGTTTATATTCGTTAAATTTACGCGGTACGTTTTCGCGGCGTATCGTTTTTAGTT (SEQ ID NO: 69).

[0055] In some embodiments, the negative standard for detecting NDRG4 methylation comprises the following polynucleotide sequence: TGAGAAGTTGGGTGGGGGTGTGGATTGATTGGGGTGTTTTTTAGGTTTTGTGTTGTGGTTTTTGTTTGTTTTTTTGTTTGTTTATTGGGTATTTTAGTTGTGTAGAAGTGGAAGTTATGTGT GAGGGATTGTGGTTTGTTTGGGATTAGTTTTAGGTTTGGTATTGTTTTGTGGGTTGAGTGTTTATATTTGTTAAATTTATGTGGGTATGTTTTTGTGGTGTATTGTTTTTAGTT (SEQ ID NO: 70).

[0056] Also provided are methods for detecting the presence or absence of colorectal cancer (CRC) or advanced adenoma (AA) in a patient in need thereof.

[0057] In some embodiments, the method comprises: a) obtaining genomic DNA from a biological sample from a patient.

[0058] In some embodiments, the method further comprises: b) treating the genomic DNA of a) or a fragment thereof with one or more reagents to convert unmethylated cytosine bases to uracil or another base that is detectably different from cytosine in terms of hybridization properties.

[0059] In some embodiments, the method further comprises: c) contacting the treated genomic DNA or the treated fragment thereof with a first primer pair for detecting the presence or absence of methylation site of gene encoding bone morphogenetic protein 3 (BMP3) in the patient.In some embodiments, the method further comprises contacting the treated genomic DNA or the treated fragment thereof with a second primer pair for detecting the presence or absence of methylation site of gene encoding NDRG family member 4 protein (NDRG4) in the patient.

[0060] In some embodiments, the first primer pair comprises a contiguous sequence of at least 9 nucleotides that is identical to, complementary to, or hybridizes under stringent hybridization conditions to SEQ ID NO: 1. In some embodiments, the second primer pair comprises a contiguous sequence of at least 9 nucleotides that is complementary to, or hybridizes under stringent hybridization conditions to SEQ ID NO: 2.

[0061] In some embodiments, the treated genomic DNA or a fragment thereof is amplified or not amplified to generate at least one amplicon by the first primer pair or the second primer pair.

[0062] In some embodiments, the method further comprises d) determining the presence or absence of CRC or AA in the patient based on the presence or absence of the amplification product, the methylation status or level of at least one CpG dinucleotide in the BMP3 gene and the NDRG4 gene in the patient.

[0063] In some embodiments, quantitative PCR is used to amplify the methylated BMP3 gene in the sample. In some embodiments, quantitative PCR is used to amplify the methylated NDRG4 gene in the sample.

[0064] In some embodiments, the method also includes using primers to amplify a reference gene (also known as a normalizer, housekeeping gene or endogenous control). In some embodiments, quantitative PCR is used to amplify the reference gene in the sample.

[0065] In some embodiments, the first primer pair and the first probe are selected from the group consisting of: i) a forward primer comprising SEQ ID NO:3, a reverse primer comprising SEQ ID NO:4, and a probe comprising SEQ ID NO:5; ii) a forward primer comprising SEQ ID NO:9, a reverse primer comprising SEQ ID NO:10, and a probe comprising SEQ ID NO:11; and iii) a forward primer comprising SEQ ID NO:15, a reverse primer comprising SEQ ID NO:16, and a probe comprising SEQ ID NO:17.

[0066] In some embodiments, the second primer pair and the second probe are selected from the group consisting of: iv) a forward primer comprising SEQ ID NO:6, a reverse primer comprising SEQ ID NO:7, and a probe comprising SEQ ID NO:8; v) a forward primer comprising SEQ ID NO:12, a reverse primer comprising SEQ ID NO:13, and a probe comprising SEQ ID NO:14; and vi) a forward primer comprising SEQ ID NO:18, a reverse primer comprising SEQ ID NO:19, and a probe comprising SEQ ID NO:20.

[0067] In some embodiments, the method comprises using: i) a forward primer comprising SEQ ID NO: 3, a reverse primer comprising SEQ ID NO: 4, and a probe comprising SEQ ID NO: 5 for detecting the methylation status or level of at least one CpG dinucleotide of the BMP3 gene in a biological sample obtained from a patient; and ii) A forward primer comprising sequence number 6, a reverse primer comprising sequence number 7, and a probe comprising sequence number 8 for detecting the methylation status or level of at least one CpG dinucleotide of the NDRG4 gene in a biological sample obtained from a patient.

[0068] In some embodiments, the method includes using: i) a forward primer comprising SEQ ID NO: 9, a reverse primer comprising SEQ ID NO: 10, and a probe comprising SEQ ID NO: 11 for detecting the methylation status or level of at least one CpG dinucleotide of the BMP3 gene in a biological sample obtained from a patient; and ii) A forward primer comprising sequence number 12, a reverse primer comprising sequence number 13, and a probe comprising sequence number 14 for detecting the methylation status or level of at least one CpG dinucleotide of the NDRG4 gene in a biological sample obtained from a patient.

[0069] In some embodiments, the method includes using: i) a forward primer comprising SEQ ID NO: 15, a reverse primer comprising SEQ ID NO: 16, and a probe comprising SEQ ID NO: 17 for detecting the methylation status or level of at least one CpG dinucleotide of the BMP3 gene in a biological sample obtained from a patient; and ii) A forward primer comprising sequence number 18, a reverse primer comprising sequence number 19, and a probe comprising sequence number 20 for detecting the methylation status or level of at least one CpG dinucleotide of the NDRG4 gene in a biological sample obtained from a patient.

[0070] In some embodiments, the first probe and the second probe both comprise a fluorescent donor and an acceptor fluorophore. In some embodiments, the first probe and the second probe are TAQMAN® probes.

[0071] In some embodiments, the method further comprises detecting the presence or absence of at least one mutation in the KRAS gene in a biological sample obtained from the patient.

[0072] In some embodiments, the method further comprises detecting the presence or absence of hemoglobin in a biological sample obtained from a patient. In some embodiments, detecting the presence or absence of hemoglobin in a biological sample comprises using an anti-hemoglobin antibody. In some embodiments, the antibody is a gold colloid-labeled antibody.

[0073] In some embodiments, detecting the presence or absence of at least one mutation in the KRAS gene in a patient comprises using at least one primer pair that can amplify the exon 12 and / or exon 13 region of the KRAS gene in polymerase chain reaction (PCR).In some embodiments, the primer can amplify the KRAS gene region that comprises at least one KRAS mutation selected from the group consisting of G12D, G12V, G12C, G13D, G12A, G12R, G12S and G13C.

[0074] In some embodiments, the mutated KRAS gene is amplified by one or more primer pairs selected from the group consisting of: (1) forward primer G12D-F comprising SEQ ID NO:35, and reverse primer Kras-R comprising SEQ ID NO:42; (2) forward primer G13D-F comprising SEQ ID NO:36, and reverse primer Kras-R comprising SEQ ID NO:42; (3) forward primer G12V-F comprising SEQ ID NO:37, and reverse primer Kras-R comprising SEQ ID NO:42; (4) forward primer G12C-F comprising SEQ ID NO:38, and reverse primer Kras-R comprising SEQ ID NO:42; (5) forward primer G12S-F comprising SEQ ID NO:39, and reverse primer Kras-R comprising SEQ ID NO:42; (6) forward primer G12A-F comprising SEQ ID NO: 40, and reverse primer Kras-R comprising SEQ ID NO: 42; and (7) Forward primer G12R-F comprising sequence number 41, and reverse primer Kras-R comprising sequence number 42.

[0075] In some embodiments, the KRAS probe for qPCR comprises SEQ ID NO:46.

[0076] In some embodiments, the amplification of the BMP3 gene is performed by quantitative PCR (qPCR), and the method further includes amplifying a first reference gene (i.e., the first reference gene) and determining the Ct value of the BMP3 amplification as ΔCt1.

[0077] In some embodiments, the amplification of the NDRG4 gene is performed by quantitative PCR (qPCR), and the method further comprises amplifying a second reference gene (i.e., a second reference gene) and determining the Ct value of the NDRG4 amplification as ΔCt2.

[0078] In some embodiments, the amplification of the mutant KRAS gene is performed by quantitative PCR (qPCR), and the method further comprises amplifying a third reference gene (i.e., a third reference gene) and determining the Ct value of the mutant KRAS amplification as ΔCt3.

[0079] In some embodiments, the first reference gene and the second reference gene are the same. In some embodiments, the same reference gene is the B2M gene.

[0080] In some embodiments, the third reference gene is the ACTB gene. In some embodiments, the qPCR primers for amplifying the ACTB gene comprise SEQ ID NO: 43 and 44, and the probe comprises SEQ ID NO: 46.

[0081] In some embodiments, the method includes using (1) a positive standard and a negative standard for detecting BMP3 methylation in a sample, and (2) a positive standard and a negative standard for detecting NDRG4 methylation in a sample.

[0082] In some embodiments, the positive standard for detecting BMP3 methylation comprises the following polynucleotide sequence: GTTAGTTTGGTCGGGTGTTTTAAAAATAAAGCGAGGAGGGAAGGTATAGATAGATTTTGAAAATATTCGGGTTATATACGTCGCGATTTATAGTTTTTTTTTAGCGTTGGAGTGGAGACGGCGTTCGTAGCGTTTTGCG CGGGTGAGGTTCGCGTAGTTGTTGGGGAAGAGTTTATTTGTTAGGTTGCGTTGGGTTAGCGTAGTAAGTGGGGTTGGTCGTTATTTCGTTGTATTCGGTCGCGTTTCGGGTTTCGTGCGTTTTCGTTTTAG (SEQ ID NO: 67);

[0083] In some embodiments, the negative standard for detecting BMP3 methylation comprises the following polynucleotide sequence: GTTAGTTTGGTTGGGTGTTTTAAAAATAAAGTGAGGAGGGAAGGTATAGATAGATTTTGAAAATATTTGGGTTATATATGTTGTGATTTATAGTTTTTTTAGTGTTGGAGTGGAGATGGTGTTTGTAGTGTTTTGTG TGGGTGAGGTTTGTGTAGTTGTTGGGGAAGAGTTTATTTGTTAGGTTGTGTTGGGTTAGTGTAGTAAGTGGGGTTGGTTGTTATTTTGTTGTATTTGGTTGTGTTTTGGGTTTTGTGTGTTTTTGTTTTAG (SEQ ID NO: 68);

[0084] In some embodiments, the positive standard for detecting NDRG4 methylation comprises the following polynucleotide sequence: TGAGAAGTCGGCGGGGGCGCGGATCGATCGGGGTGTTTTTTAGGTTTCGCGTCGCGGTTTTCGTTCGTTTTTTCGTTCGTTTATCGGGTATTTTAGTCGCGTAGAAGGCGGAAGTTACGCGC GAGGGATCGCGGTTCGTTCGGGATTAGTTTTAGGTTCGGTATCGTTTCGCGGGTCGAGCGTTTATATTCGTTAAATTTACGCGGTACGTTTTCGCGGCGTATCGTTTTTAGTT (SEQ ID NO: 69).

[0085] In some embodiments, the negative standard for detecting NDRG4 methylation comprises the following polynucleotide sequence: TGAGAAGTTGGGTGGGGGTGTGGATTGATTGGGGTGTTTTTTAGGTTTTGTGTTGTGGTTTTTGTTTGTTTTTTTGTTTGTTTATTGGGTATTTTAGTTGTGTAGAAGTGGAAGTTATGTGT GAGGGATTGTGGTTTGTTTGGGATTAGTTTTAGGTTTGGTATTGTTTTGTGGGTTGAGTGTTTATATTTGTTAAATTTATGTGGGTATGTTTTTGTGGTGTATTGTTTTTAGTT (SEQ ID NO: 70).

[0086] In some embodiments, the method includes amplifying the quality control standard.

[0087] In some embodiments, a method for detecting the presence or absence of colorectal cancer (CRC) or advanced adenoma (AA) in a patient in need thereof comprises using a kit of the present disclosure.

[0088] The present disclosure further provides a method of detecting the presence or absence of colorectal cancer (CRC) or advanced adenoma (AA) in a patient in need thereof, comprising: a) Obtaining unprocessed genomic DNA from a patient's stool sample: b) treating the genomic DNA of a) or a fragment thereof with one or more reagents to convert unmethylated cytosine bases to uracil or another base that is detectably different from cytosine in terms of hybridization properties; c) Perform quantitative PCR (qPCR) using the treated genomic DNA of b) as a template to determine the Ct value of the BMP3 gene in the patient as ΔCt1; d) Perform qPCR using the treated genomic DNA of b) as a template to determine the Ct value of the NDRG4 gene in the patient as ΔCt2; e) Perform qPCR using untreated genomic DNA as template to determine the Ct value of mutant KRAS gene in patients as ΔCt3; f) performing an immunochemical fecal occult blood test for hemoglobin protein in the stool sample and determining the score as FIT; g) determining the value of K, where K=a*ΔCt1+b*ΔCt2+c*ΔCt3+d*FIT+X, where a, b, c, d, and X are clinical constants; and h) Determine the value of the overall index P, where P = e K / (1+e K ) where e is a natural constant.

[0089] The clinical constants a, b, c, d and X may be determined by analyzing the distribution of clinical data among a patient population.

[0090] In some embodiments, if P is equal to or greater than a predetermined threshold, the patient is determined to have CRC and / or AA, and if P is less than a predetermined threshold, the patient is determined to be healthy.

[0091] In some embodiments, the predetermined threshold is calculated from a distribution of clinical data (such as clinical data obtained from patients determined to have CRC and / or AA and patients determined to not have CRC and / or AA).

[0092] In some embodiments, the qPCR for amplifying the BMP3 gene comprises a first primer pair and a first probe, wherein the first primer pair and the first probe are selected from the group consisting of: i) a forward primer comprising SEQ ID NO:3, a reverse primer comprising SEQ ID NO:4, and a probe comprising SEQ ID NO:5; ii) a forward primer comprising SEQ ID NO:9, a reverse primer comprising SEQ ID NO:10, and a probe comprising SEQ ID NO:11; and iii) a forward primer comprising SEQ ID NO:15, a reverse primer comprising SEQ ID NO:16, and a probe comprising SEQ ID NO:17.

[0093] In some embodiments, the qPCR for amplifying the NDRG4 gene comprises a second primer pair and a second probe, wherein the second primer pair and the second probe are selected from the group consisting of: iv) a forward primer comprising SEQ ID NO:6, a reverse primer comprising SEQ ID NO:7, and a probe comprising SEQ ID NO:8; v) a forward primer comprising SEQ ID NO:12, a reverse primer comprising SEQ ID NO:13, and a probe comprising SEQ ID NO:14; and vi) a forward primer comprising SEQ ID NO:18, a reverse primer comprising SEQ ID NO:19, and a probe comprising SEQ ID NO:20.

[0094] In some embodiments, the method includes using: i) a forward primer comprising SEQ ID NO: 3, a reverse primer comprising SEQ ID NO: 4, and a probe comprising SEQ ID NO: 5 for detecting the methylation status or level of at least one CpG dinucleotide of the BMP3 gene in a sample; and ii) A forward primer comprising sequence number 6, a reverse primer comprising sequence number 7, and a probe comprising sequence number 8 for detecting the methylation status or level of at least one CpG dinucleotide of the NDRG4 gene in a sample.

[0095] In some embodiments, the method includes using: i) a forward primer comprising SEQ ID NO: 9, a reverse primer comprising SEQ ID NO: 10, and a probe comprising SEQ ID NO: 11 for detecting the methylation status or level of at least one CpG dinucleotide of the BMP3 gene in a sample; and ii) A forward primer comprising sequence number 12, a reverse primer comprising sequence number 13, and a probe comprising sequence number 14 for detecting the methylation status or level of at least one CpG dinucleotide of the NDRG4 gene in a sample.

[0096] In some embodiments, the method includes using: i) a forward primer comprising SEQ ID NO: 15, a reverse primer comprising SEQ ID NO: 16, and a probe comprising SEQ ID NO: 17 for detecting the methylation status or level of at least one CpG dinucleotide of the BMP3 gene in a sample; and ii) A forward primer comprising sequence number 18, a reverse primer comprising sequence number 19, and a probe comprising sequence number 20 for detecting the methylation status or level of at least one CpG dinucleotide of the NDRG4 gene in a sample.

[0097] In some embodiments, the first probe and the second probe both comprise a fluorescent donor and an acceptor fluorophore. In some embodiments, the first probe and the second probe are TAQMAN® probes.

[0098] In some embodiments, the mutated KRAS gene comprises at least one KRAS mutation selected from the group consisting of G12D, G12V, G12C, G13D, G12A, G12R, G12S and G13C.

[0099] In some embodiments, the immunochemical fecal occult blood test comprises a colloidal gold-labeled antibody.

[0100] In some embodiments, steps c) and d) of the method comprise using the B2M gene as a reference gene.

[0101] In some embodiments, the method includes using: (1) a positive standard and a negative standard for detecting BMP3 methylation in a sample; and (2) Positive and negative standards for detecting NDRG4 methylation in samples.

[0102] In some embodiments, the positive standard for detecting BMP3 methylation comprises the following polynucleotide sequence: GTTAGTTTGGTCGGGTGTTTTAAAAATAAAGCGAGGAGGGAAGGTATAGATAGATTTTGAAAATATTCGGGTTATATACGTCGCGATTTATAGTTTTTTTTTAGCGTTGGAGTGGAGACGGCGTTCGTAGCGTTTTGCG CGGGTGAGGTTCGCGTAGTTGTTGGGGAAGAGTTTATTTGTTAGGTTGCGTTGGGTTAGCGTAGTAAGTGGGGTTGGTCGTTATTTCGTTGTATTCGGTCGCGTTTCGGGTTTCGTGCGTTTTCGTTTTAG (SEQ ID NO: 67).

[0103] In some embodiments, the negative standard for detecting BMP3 methylation comprises the following polynucleotide sequence: GTTAGTTTGGTTGGGTGTTTTAAAAATAAAGTGAGGAGGGAAGGTATAGATAGATTTTGAAAATATTTGGGTTATATATGTTGTGATTTATAGTTTTTTTAGTGTTGGAGTGGAGATGGTGTTTGTAGTGTTTTGTG TGGGTGAGGTTTGTGTAGTTGTTGGGGAAGAGTTTATTTGTTAGGTTGTGTTGGGTTAGTGTAGTAAGTGGGGTTGGTTGTTATTTTGTTGTATTTGGTTGTGTTTTGGGTTTTGTGTGTTTTTGTTTTAG (SEQ ID NO: 68).

[0104] In some embodiments, the positive standard for detecting NDRG4 methylation comprises the following polynucleotide sequence: TGAGAAGTCGGCGGGGGCGCGGATCGATCGGGGTGTTTTTTAGGTTTCGCGTCGCGGTTTTCGTTCGTTTTTTCGTTCGTTTATCGGGTATTTTAGTCGCGTAGAAGGCGGAAGTTACGCGC GAGGGATCGCGGTTCGTTCGGGATTAGTTTTAGGTTCGGTATCGTTTCGCGGGTCGAGCGTTTATATTCGTTAAATTTACGCGGTACGTTTTCGCGGCGTATCGTTTTTAGTT (SEQ ID NO: 69).

[0105] In some embodiments, the negative standard for detecting NDRG4 methylation comprises the following polynucleotide sequence: TGAGAAGTTGGGTGGGGGTGTGGATTGATTGGGGTGTTTTTTAGGTTTTGTGTTGTGGTTTTTGTTTGTTTTTTTGTTTGTTTATTGGGTATTTTAGTTGTGTAGAAGTGGAAGTTATGTGT GAGGGATTGTGGTTTGTTTGGGATTAGTTTTAGGTTTGGTATTGTTTTGTGGGTTGAGTGTTTATATTTGTTAAATTTATGTGGGTATGTTTTTGTGGTGTATTGTTTTTAGTT (SEQ ID NO: 70). In some embodiments, the method comprises amplifying a quality control standard in step c) and in step d).

[0106] Also provided are methods for diagnosing and treating colorectal cancer (CRC) and / or advanced adenoma (AA) in a patient in need thereof, comprising: determining the presence or absence of CRC and / or AA in the patient using the kit of the present disclosure, and treating the patient according to the presence or absence of CRC and / or AA in the patient.

[0107] Also provided are methods of diagnosing and treating colorectal cancer (CRC) and / or advanced adenoma (AA) in a patient in need thereof, including determining the presence or absence of CRC and / or AA in the patient using the methods described herein, and treating the patient depending on the presence or absence of CRC and / or AA in the patient. [Brief description of the drawings]

[0108] [Figure 1A] 1A to 1D show the results of CpG island prediction of the two BMP3 and NDRG4 genes and the relative positions of the amplification products. "Y" and "R" are degenerate bases. Results of CpG island prediction of the promoter region of the BMP3 gene. [Figure 1B] 1A to 1D show the results of CpG island prediction and the relative positions of the amplification products of the two BMP3 and NDRG4 genes. "Y" and "R" are degenerate bases. Relative positions of the amplification products of the BMP3 gene. [Figure 1C]1A to 1D show the results of CpG island prediction of two BMP3 and NDRG4 genes and the relative positions of the amplification products. "Y" and "R" are degenerate bases. Results of CpG island prediction of the promoter region of the NDRG4 gene. [Figure 1D] 1A to 1D show the results of CpG island prediction of two BMP3 and NDRG4 genes and the relative positions of the amplification products. "Y" and "R" are degenerate bases. Relative positions of the amplification products of the NDRG4 gene.

[0109] [Figure 2A] FIG. 2A shows the differences in methylated CpG sites of BMPs in Caucasian and Asian populations. [Figure 2B] FIG. 2B shows the differences in methylated CpG sites of the NDRG4 gene in Caucasian and Asian populations.

[0110] [Figure 3A] FIG. 3A shows the analytical sensitivity amplification curves of BMP3 using primers and probes in preferred group 1. [Figure 3B] FIG. 3B shows the analytical sensitivity amplification curve of NDRG4 using primers and probes in preferred group 1. [Figure 3C] FIG. 3C shows the analytical sensitivity amplification curves of BMP3 using primers and probes in preferred group 2. [Figure 3D] FIG. 3D shows the analytical sensitivity amplification curve of NDRG4 using primers and probes in preferred group 2. [Figure 3E] FIG. 3E shows the analytical sensitivity amplification curve of BMP3 using primers and probes in preferred group 3. [Figure 3F] FIG. 3F shows the analytical sensitivity amplification curve of NDRG4 using primers and probes in preferred group 3. [Figure 3G] FIG. 3G shows the analytical sensitivity amplification curves of BMP3 using primers and probes in comparison group 1. [Figure 3H]FIG. 3H shows the analytical sensitivity amplification curve of NDRG4 using primers and probes in comparison group 1. [Figure 3I] FIG. 3I shows the analytical sensitivity amplification curves of BMP3 using primers and probes in comparison group 2. [Figure 3J] FIG. 3J shows the analytical sensitivity amplification curve of NDRG4 using primers and probes in comparison group 2. [Figure 3K] FIG. 3K shows the analytical sensitivity amplification curve of BMP3 using primers and probes in comparison group 3. [Figure 3L] FIG. 3L shows the analytical sensitivity amplification curve of NDRG4 using primers and probes in comparison group 3.

[0111] [Figure 4A] FIG. 4A shows the analytical specificity amplification curves of BMP3 using primers and probes in preferred group 1. [Figure 4B] FIG. 4B shows the analytical specificity amplification curves of NDRG4 using primers and probes in preferred group 1. [Figure 4C] FIG. 4C shows the analytical specificity amplification curves of BMP3 using primers and probes in preferred group 2. [Figure 4D] FIG. 4D shows the analytical specificity amplification curve of NDRG4 using primers and probes in preferred group 2. [Figure 4E] FIG. 4E shows the analytical specificity amplification curves of BMP3 using primers and probes in preferred group 3. [Figure 4F] FIG. 4F shows the analytical specificity amplification curve of NDRG4 using primers and probes in preferred group 3. [Figure 4G] FIG. 4G shows the analytical specificity amplification curves of BMP3 using primers and probes in comparison group 1. [Figure 4H] FIG. 4H shows the analytical specificity amplification curve of NDRG4 using primers and probes in comparison group 1. [Figure 4I] FIG. 4I shows the analytical specificity amplification curves of BMP3 using primers and probes in comparison group 2. [Figure 4J] FIG. 4J shows the analytical specificity amplification curve of NDRG4 using primers and probes in comparison group 2. [Figure 4K] FIG. 4K shows the analytical specificity amplification curves of BMP3 using primers and probes in comparison group 3. [Figure 4L] FIG. 4L shows the analytical specificity amplification curve of NDRG4 using primers and probes in comparison group 3.

[0112] [Figure 5A] FIG. 5A shows amplification curves using primers and probes in preferred group 1 for detecting BMP3 methylation in clinical samples. [Figure 5B] FIG. 5B shows amplification curves using primers and probes in preferred group 2 for detecting BMP3 methylation in clinical samples. [Figure 5C] FIG. 5C shows amplification curves using primers and probes in preferred group 3 for detecting BMP3 methylation in clinical samples. [Figure 5D] FIG. 5D shows the amplification curves using primers and probes in comparative group 1 to detect BMP3 methylation in the same assay. [Figure 5E] FIG. 5E shows the amplification curves using primers and probes in comparative group 2 to detect BMP3 methylation in the same assay. [Figure 5F] FIG. 5F shows the amplification curves using primers and probes in comparative group 3 to detect BMP3 methylation in the same assay.

[0113] [Figure 6A] FIG. 6A shows the amplification curves using primers and probes in preferred group 1 for detecting NDRG4 methylation in clinical samples. [Figure 6B] FIG. 6B shows the amplification curves using primers and probes in preferred group 2 for detecting NDRG4 methylation in clinical samples. [Figure 6C] FIG. 6C shows the amplification curves using primers and probes in preferred group 3 for detecting NDRG4 methylation in clinical samples. [Figure 6D] FIG. 6D shows the amplification curves using primers and probes in comparative group 1 to detect NDRG4 methylation in the same assay. [Figure 6E] FIG. 6E shows the amplification curves using primers and probes in comparative group 2 to detect NDRG4 methylation in the same assay. [Figure 6F] FIG. 6F shows the amplification curves using primers and probes in comparative group 3 to detect NDRG4 methylation in the same assay. DETAILED DESCRIPTION OF THE PREFERRED EMBODIMENTS

[0114] definition References to "one embodiment," "an embodiment," "one example," and "an example" indicate that the embodiment or example so described may include a particular feature, structure, characteristic, property, element, or limitation, but not all embodiments or examples necessarily include that particular feature, structure, characteristic, property, element, or limitation. Further, repeated use of the phrase "in one embodiment" does not necessarily refer to the same embodiment, although it may.

[0115] "Nucleic acid" or "oligonucleotide" or "polynucleotide" in this specification means at least two nucleotides covalently linked to each other. The depiction of a single strand also defines the sequence of the complementary strand. Thus, a nucleic acid also encompasses the complementary strand of the depicted single strand. Many variants of a nucleic acid can be used for the same purpose as a given nucleic acid. Thus, a nucleic acid also encompasses substantially identical nucleic acids and their complements. A single strand provides a probe that can hybridize to a target sequence under stringent hybridization conditions. Thus, a nucleic acid also encompasses a probe that hybridizes under stringent hybridization conditions. A nucleic acid can be single-stranded or double-stranded, or can include parts of both double-stranded and single-stranded sequences. The nucleic acid may be DNA, both genomic and cDNA, RNA, or a hybrid, where the nucleic acid may contain combinations of deoxyribonucleotides and ribonucleotides, and combinations of bases including uracil, adenine, thymine, cytosine, guanine, inosine, xanthine, hypoxanthine, isocytosine, and isoguanine. The nucleic acid may be obtained by chemical synthesis or recombinant methods.

[0116] The phrase "subject in need" herein refers to an animal or human subject known to have cancer, an animal or human subject at risk of having cancer (e.g., a subject with a genetic predisposition, a subject with a medical and / or family history of cancer, a subject exposed to carcinogens, occupational hazards, environmental hazards), and / or a subject exhibiting clinical signs suspicious of cancer (e.g., bloody stool or melena, unexplained pain, sweating, unexplained fever, unexplained weight loss (up to anorexia), changes in bowel habits (constipation and / or diarrhea), tenesmus (a feeling of incomplete defecation, especially in the case of rectal cancer), anemia and / or general weakness). Additionally or alternatively, a subject in need may be a healthy human subject undergoing regular medical checkups.

[0117] As used herein, the term "about" refers to ±10%.

[0118] The phrase "consisting essentially of" means that a composition or method may include additional ingredients and / or steps only if the additional ingredients and / or steps do not materially alter the basic and novel characteristics of the claimed composition or method.

[0119] As used herein, the singular forms "a," "an," and "the" include plural referents unless the context clearly dictates otherwise. For example, the term "a compound" or "at least one compound" can include a plurality of compounds, including mixtures thereof.

[0120] As used herein, "stringent hybridization conditions" refers to conditions under which a first nucleic acid sequence (e.g., a probe) hybridizes to a second nucleic acid sequence (e.g., a target) (such as in a mixture of nucleic acids). Stringent conditions are sequence-dependent and will be different in different circumstances. Stringent conditions are those that meet the thermal melting point (T) of a particular sequence at a defined ionic strength pH. m ) can be selected to be about 5 to 10°C lower than T m can be the temperature (under defined ionic strength, pH and nucleic acid concentration) at which 50% of the probes complementary to the target hybridize to the target sequence at equilibrium (because the target sequences are present in excess, T m(At pH 7.0-8.3, 50% of the probes are occupied at equilibrium). Stringent conditions can be conditions in which the salt concentration is less than about 1.0 M sodium ion (such as about 0.01-1.0 M sodium ion concentration (or other salt) at pH 7.0-8.3) and the temperature is at least about 30° C. for short probes (e.g., about 10-50 nucleotides) and at least about 60° C. for long probes (e.g., longer than about 50 nucleotides). Stringent conditions can also be achieved by the addition of destabilizing agents such as formamide. For selective or specific hybridization, a positive signal can be at least 2-10 times background hybridization. Exemplary stringent hybridization conditions include: 50% formamide, 5×SSC, and 1% SDS, incubating at 42° C., or 5×SSC, 1% SDS, incubating at 65° C., and washing at 65° C. with 0.2×SSC and 0.1% SDS.

[0121] As used herein, "substantially complementary" means that a first sequence is at least 60%, 65%, 70%, 75%, 80%, 85%, 90%, 95%, 97%, 98% or 99% identical to the complement of a second sequence over a region of 8, 9, 10, 11, 12, 13, 14, 15, 16, 17, 18, 19, 20, 21, 22, 23, 24, 25, 30, 35, 40, 45, 50, 55, 60, 65, 70, 75, 80, 85, 90, 95, 100 or more nucleotides, or that the two sequences hybridize under stringent hybridization conditions.

[0122] As used herein, "substantially identical" means that a first sequence and a second sequence are at least 60%, 65%, 70%, 75%, 80%, 85%, 90%, 95%, 97%, 98% or 99% identical over a region or nucleic acid of 8, 9, 10, 11, 12, 13, 14, 15, 16, 17, 18, 19, 20, 21, 22, 23, 24, 25, 30, 35, 40, 45, 50, 55, 60, 65, 70, 75, 80, 85, 90, 95, 100 or more nucleotides or amino acids, where the first sequence is substantially complementary to the complement of the second sequence.

[0123] As used herein, the term "diagnosis" refers to classifying a pathology or condition, determining the severity (e.g., grade or stage) of a pathology, monitoring the progression of a pathology, and predicting the outcome and / or chances of recovery from a pathology.

[0124] The phrase "consisting essentially of" means that a composition or method may include additional ingredients and / or steps only if the additional ingredients and / or steps do not materially alter the basic and novel characteristics of the claimed composition or method.

[0125] 1. DNA sequences containing hypermethylated CpG sites in the promoter regions of BMP3 and NDRG4 genes in Chinese populations with CRC and AA The present invention provides DNA sequences containing detailed hypermethylated CpG sites in the promoter regions of BMP3 and NDRG4 genes in Asian populations (eg, Chinese populations), which can be used as markers for the detection of CRC and AA.

[0126] In some embodiments, the following native sequence (5' to 3') of the BMP3 gene is provided, which shows potentially methylated sites marked by a superscript "m": GCCAGTTTGGC m CGGGTGTTCCCAAAAATAAAG mCGAGGAGGGAAGGTACAGACAGATCTTGAAAACACC m CGGGCCACACA m C.G.C. m CG m CGACCTACAGCTCTTTCTCAG m CGTTGGAGTGGAGA m CGG m CGCCCGCAG m CGCCCTG m CG m CGGGTGAGGTC m CG m CGCAGCTGCTGGGGAAGAGCCCACCTGTCAGGCTG m CGCTGGGTCAG m CGCAGCAAGTGGGGCTGGC m CGCTATCT m CGCTGCACCCGGC m CG m CGTCC m CGGGCTC m CGTG m CGCCCT m CGCCCCAG (sequence number 65).

[0127] In some embodiments, the following native sequence (5' to 3') of the NDRG4 gene is provided, which shows potentially methylated sites marked by a superscript "m": TGAGAAAGT m CGG m CGGGGG m CG m CGGAT m CGAC m CGGGGTGTCCCCCAGGCTC m CG m CGT m CG m CGGTCCC m CGCT m CGCCCTCC m CGCC m CGCCCAC m CGGGCACCCCAGC m CG m CGCAGAGGm CGGAAGCA m CG m CG m CGAGGGAC m CG m CGGTC m CGTC m CGGGACTAGCCCCAGGCC m CGGCAC m CGCCC m CG m CGGGC m CGAG m CGCCCACACC m CGCCAAACCCA m CG m CGGGCA m CGCCCC m CG m CGG m CGCAC m CGCCCCCAGCC (sequence number 66).

[0128] After treating native genomic DNA or a fragment thereof with one or more reagents to convert unmethylated cytosine bases (e.g., by bisulfite) to uracil or another base that is detectably different from cytosine in terms of hybridization properties, the sequence of the converted BMP3 gene is the following (5' to 3'), which shows the potentially methylated sites labeled by the superscript "m": GTTAGTTTGGT m CGGGTGTTTTTAAAAATAAAG m CGAGGAGGGAAGGTATAGATAGATTTTGAAAATATT m CGGGTTATATA m CGT m CG m CGATTTATAGTTTTTTTTTAG m CGTTGGAGTGGAGA m CGG m CGTT m CGTAG m CGTTTTG m CG m CGGGTGAGGTT m CG mCGTAGTTGTTGGGGAAGAGTTTATTTGTTAGGTTG m CGTGGGTTAG m CGTAGTAAGTGGGGTTGGT m CGTTATTT m CGTTGTATT m CGGT m CG m CGTTT m CGGGTTT m CGTG m CGTTTT m CGTTTTAG (sequence number 1).

[0129] After treating native genomic DNA or a fragment thereof with one or more reagents to convert unmethylated cytosine bases (e.g., by bisulfite) to uracil or another base that is detectably different from cytosine in terms of hybridization properties, the sequence of the converted NDRG4 gene is the following (5' to 3'), which shows the potentially methylated sites labeled by the superscript "m": TGAGAAAGT m CGG m CGGGGG m CG m CGGAT m CGAT m CGGGGTGTTTTTTAGGTTT m CG m CGT m CG m CGGTTTT m CGTT m CGTTTTTT m CGTT m CGTTTAT m CGGGTATTTTAGT m CG m CGTAGAGG m CGGAAGTT m CG m CG m CGAGGGAT m CG m CGGTT m CGTT m CGGGATTAGTTTTAGGTT mCGGTAT m CGTTT m CG m CGGGT m CGAG m CGTTTATATT m CGTTAAATTTA m CG m CGGGTA m CGTTTT m CG m CGG m CGTAT m CGTTTTTAGTT (sequence number 2).

[0130] The DNA sequence of the present disclosure that comprises the detailed hypermethylated CpG sites of the promoter region of BMP3 and NDRG4 genes in Asian populations is particularly useful for detecting CRC and / or AA in Asian populations.For example, primers and probes can be designed to target one or more specific methylation sites in BMP3 and / or NDRG4 genes as a tool for determining the methylation status and level of BMP3 and / or NDRG4, and thus determining tumor status in patients who need it.

[0131] 2. Three sets of preferred primers and probes and corresponding reagents for detecting methylation of BMP3 and NDRG4 genes, respectively. The present invention provides three sets of preferred primers and probes for detecting the methylation level of BMP3 and NDRG4 genes, respectively.These primers and probes are designed to target the CpG sites that are frequently methylated in Asian populations (e.g. Chinese populations).

[0132] These particular combinations of preferred primers and probes have surprisingly high sensitivity and specificity in detecting CRC and AA, particularly in detecting AA in Asian populations, compared to existing commercial products (such as Cologuard®). The sequences of the primers and probe are as follows: [Table 1]

[0133] The oligonucleotides of the present disclosure advantageously allow highly specific amplification of hypermethylated CpG sites in the promoter regions of BMP3 or NDRG4 in biological samples obtained from Asian patients.

[0134] In some embodiments, oligonucleotides partially or completely complementary to the sequences of SEQ ID NOs: 3-20 are provided.

[0135] In some embodiments, oligonucleotides are provided that have one or more modifications compared to a probe sequence (such as SEQ ID NOs: 5, 11, 17, 8, 14, and 20). In some embodiments, the modifications may occur at the 5' and / or 3' end of one of the nucleotide sequences set forth in SEQ ID NOs: 5, 11, 17, 8, 14, and 20.

[0136] Examples of modified base moieties that can be used to modify a nucleotide at any position on its structure include, but are not limited to, 5-fluorouracil, 5-bromouracil, 5-chlorouracil, 5-iodouracil, hypoxanthine, xanthine, acetylcytosine, 5-(carboxyhydroxymethyl)uracil, 5-carboxymethylaminomethyl-2-thiouridine, 5-carboxymethylaminomethyluracil, dihydrouracil, beta-D-galactosylketosine, inosine, N-6-sopentenyladenine, 1-methylguanine, 1-methylinosine, 2,2-dimethylguanine, 2-methyladenine, 2-methylguanine, 3-methylcytosine, 5-methylcytosine, among others. , N-6-adenine, 7-methylguanine, 5-methylaminomethyluracil, methoxyaminomethyl-2-thiouracil, beta-D-mannosylketosine, 5'-methoxycarboxymethyluracil, 5-methoxyuracil, 2-methylthio-N6-isopentenyladenine, uracil-5-oxyacetic acid, pseudouracil, ketosine, 2-thiocytosine, 5-methyl-2-thiouracil, 2-thiouracil, 4-thiouracil, 5-methyluracil, uracil-5-oxyacetic acid methyl ester, uracil-S-oxyacetic acid, 5-methyl-2-thiouracil, 3-(3-amino-3-N-2-carboxypropyl)uracil, and 2,6-diaminopurine.

[0137] Examples of modified sugar moieties that can be used to modify a nucleotide at any position on its structure include, but are not limited to, arabinose, 2-fluoroarabinose, xylose, and hexose, or modified phosphate backbone components such as phosphorothioates, phosphorodithioates, phosphoroamidothioates, phosphoroamidates, phosphorodiamidates, methylphosphonates, alkyl phosphotriesters, or formacetals or analogs thereof.

[0138] In some embodiments, the oligonucleotides in the sequences of SEQ ID NO:5, 11, 17, 8, 14 and 20 are substituted with non-natural nucleotides (such as artificial nucleic acids).Artificial nucleic acids include, but are not limited to, peptide nucleic acid (PNA), morpholino, locked nucleic acid (LNA), glycol nucleic acid (GNA), and threose nucleic acid (TNA).Each of these are distinguished from naturally occurring DNA or RNA by changes in the molecular backbone.

[0139] In some embodiments, the probes of the present disclosure comprise a label and a probe at 5'.

[0140] In some embodiments, the label at 5' of the probe includes a fluorescent dye (such as a fluorophore). As used herein, a fluorophore is a fluorescent compound that can re-emit light upon light excitation. Fluorophores usually include planar or cyclic molecules with several interdigitated aromatic groups or several pi-bonds. Non-protein organic fluorophores include, but are not limited to, xanthene derivatives (e.g., fluorescein, rhodamine, Oregon Green, Eosin, and Texas Red); cyanine derivatives (e.g., cyanine, indocarbocyanine, oxacarbocyanine, thiacarbocyanine, and merocyanine), squaraine derivatives and ring-substituted squaraines (e.g., SeTa, SeTau, and Square dyes), naphthalene derivatives (e.g., dansyl derivatives and prodan derivatives), coumarin derivatives; oxadiazole derivatives (e.g., pyridyloxazole, nitrobenzoxadiazole, and benzoxadiazole); anthracene derivatives (e.g., DRAQ5, DRAQ7, and CyTRAK). anthraquinones including orange; pyrene derivatives (e.g., cascade blue, etc.); oxazine derivatives (e.g., nile red, nile blue, nile blue, cresyl violet, oxazine 170, etc.); acridine derivatives (e.g., proflavine, acridine orange, acridine yellow, etc.); arylmethine derivatives (e.g., auramine, crystal violet, malachite green);Tetrapyrrole derivatives (e.g., porphine, phthalocyanine, bilirubin) are included. Particular examples include, but are not limited to, VIC, PET, Texas Red, Cy3, Cy5, FAM (6-carboxyfluorescein), HEX (6-carboxy-2',4,4',5',7,7'-hexachlorofluorescein), ROX (5(6)-carboxy-X-rhodamine), JOE (6-carboxy-4',5'-dichloro-21,71-dimethoxyfluorescein), TET (5'-tetrachloro-fluorescein phosphoramidite), NED (fluorescein benzoxanthene), TAMRA (6-carboxy-N,N,N,N-tetramethylrhodamine), FITC (fluorescein isothiocyanate). Examples of specific fluorophores that can be used in the probes disclosed herein are known to those of skill in the art and are described in Nazarenko et al. Fluorophores such as those provided in U.S. Pat. No. 5,866,366 to et al. (particularly 4-acetamido-4'-isothiocyanatostilbene-2,2' disulfonic acid; acridine and derivatives such as acridine and acridine isothiocyanate; 5-(2'-aminoethyl)aminonaphthalene-1-sulfonic acid (EDANS); 4-amino-N-[3-vinylsulfonyl]phenyl]naphthalimide-3,5-disulfonic acid salt (Lucifer Yellow VS); N-(4-anilino-1-naphthyl)maleimide, anthranilamide; brilliant yellow; coumarin and derivatives such as coumarin, 7-amino-4-methylcoumarin (A MC, coumarin 120), 7-amino-4-trifluoromethylcoumarin (couluarin) (Coumaran 151), etc.; cyanosine; 4',6-diaminidino-2-phenylindole (DAPI); 5',5''-dibromopyrogallol-sulfonphthalein (Bromopyrogallol Red); 7-diethylamino-3-(4'-isothiocyanatophenyl)-4-methylcoumarin; diethylenetriamine pentaacetate; 4,4'-diisothiocyanatodihydro-stilbene-2,2'-disulfonic acid; 4,4'-diisothiocyanatostilbene-2,2'-disulfonic acid;5-[Dimethylamino]naphthalene-1-sulfonyl chloride (DNS, dansyl chloride); 4-Dimethylaminophenylazophenyl-4'-isothiocyanate (DABITC); Eosin and derivatives (such as eosin and eosin isothiocyanate); Erythrosine and derivatives (such as erythrosine B and erythrosine isothiocyanate); Ethidium; Fluorescein and derivatives (5-carboxyfluorescein (FAM), 5-(4,6-dichlorotriazin-2-yl)aminofluorescein (DTAF), 2'7'-dimethoxy-4'5'-dichloro-6-carboxyfluorescein (JOE), fluorescein, fluorescein isothiocyanate (FITC), QFITC ​​(XRITC), -6-carboxy-fluorescein (HEX) and TET (tetramethylfluorescein); fluorescamine; IR144; IR1446; Malachite Green isothiocyanate; 4-Methylumbelliferone; orthocresolphthalein; Nitrotyrosine; Pararosaniline; Phenol Red; B-Phycoerythrin; o-F thaldialdehyde; pyrene and derivatives (such as pyrene, pyrene butyrate and succinimidyl 1-pyrene butyrate); Reactive Red 4 (CIBACRON™ Brilliant Red 3B-A); rhodamine and derivatives (6-carboxy-X-rhodamine (ROX), 6-carboxyrhodamine (R6G), Lissamine rhodamine B sulfonyl chloride, rhodamine (Rhod), rhodamine B, rhodamine 123, rhodamine X isothiocyanate, N,N,N',N'-tetramethyl-6-carboxyrhodamine (T AMRA), tetramethylrhodamine, and tetramethylrhodamine isothiocyanate (TRITC); sulforhodamine B; sulforhodamine 101 and sulfonyl chloride derivatives of sulforhodamine 101 (Texas Red); riboflavin; rosolic acid and terbium chelate derivatives; LightCycler Red 640; Cy5.5; and Cy56-carboxyfluorescein; boron dipyrromethene difluoride (BODIPY); acridine; stilbene; 6-carboxy-X-rhodamine (ROX); Cy3;Cy3.5, Cy5, Cy5.5, VIC® (Applied Biosystems); LC Red 640; LC Red 705; Oregon Green™; CAL Red™; Red640; and Yakima yellow; LightCycler® Cyan500; LightCycler®; Red610; Alexa647; Alexa555; 5-(2-aminoethyl)amino-1-naphthalenesulfonic acid (EDANS); tetramethylrhodamine (TMR); tetramethylrhodamine isocyanate (TMRITC), fluorescein isocyanate (FITC), χ-rhodamine, derivatives thereof, or any combination thereof, etc.). Further fluorescent dyes are disclosed in U.S. Patent Nos. 5,866,366, 6,818,431, 6,056,859, 9,140,688, 9,581,587, 6,165,765, 6,485,909, 8,158,358, 7,625,723, 7,560,236, 7,867,701, 9,150,912, 7,960,543, 6,555, 383, 6881570, 8198026, 5625081, 8445291, 9194801, 8835110, 7893227, 9243289, 7427674, 9512493, U.S. Patent Application Publication Nos. 20170152552, 20030170672, and 20160281 No. 151, No. 20130084558, No. 20060281100, No. 20140234833, No. 20150072340, No. 20050089910, No. 20090081677, No. 2014002402220180171393, No. 20060188886, No. 20010018185, No. 2011015 1446, and WO / 2000 / 017330A1, WO / 2008 / 030071A1, WO / 2013 / 049631A1, WO / 2016 / 179090A1, WO / 2016 / 123895A1, WO / 2003 / 079022A1, each of which is incorporated herein by reference in its entirety.

[0141] In some embodiments, the probes of the present disclosure include a fluorescent donor and an acceptor fluorophore. As used herein, an acceptor fluorophore (e.g., a "fluorescence quencher") is a fluorophore that absorbs energy from a donor fluorophore (e.g., in the range of about 400-900 nm). The acceptor fluorophore generally absorbs light at a wavelength that is usually at least 10 nm higher (e.g., at least 20 nm higher) than the maximum absorption wavelength of the donor fluorophore. The acceptor fluorophore has an excitation spectrum that overlaps with the emission of the donor fluorophore such that the energy emitted by the donor can excite the quencher. Any acceptor fluorophore known in the art can be utilized. In particular examples, the acceptor fluorophore is a dark quencher (such as Dabcyl, QSY7 (Molecular Probes), QSY9 (Molecular Probes), QSY21 (Molecular Probes), QSY33 (Molecular Probes), BLACK HOLE QUENCHERS™ (Glen Research, e.g., BHQ-1, BHQ-2, BHQ-3), ECLIPSE™ Dark Quencher (Epoch Biosciences), DDQ-I, DDQ-II, Dabcyl, Eclipse, or IOWA BLACK™ (Integrated DNA Technologies, e.g., Iowa Black FQ, Iowa Black RQ)). Further fluorescence quenchers are described in U.S. Patent No. 9957546, US9274008, U.S. Patent Application Publication Nos. 20140295422, 20090042205, 20160281182, 20180142284, 20140147929, and WO / 2009 / 009615A1, WO / 2016 / 160572A1, WO / 2016 / 178953A1, WO / 2018 / 229663A1, WO / 2010 / 051544A2, WO / 2013 / 152220A2, each of which is incorporated herein by reference in its entirety. The quencher may reduce or quench the emission of the donor fluorophore.In such an example, instead of detecting an increase in the emission signal from the acceptor fluorophore when it is sufficiently close to the donor fluorophore (or detecting a decrease in the emission signal from the acceptor fluorophore when it is significantly farther away from the donor fluorophore), an increase in the emission signal from the donor fluorophore can be detected when the quencher is significantly farther away from the donor fluorophore (or a decrease in the emission signal from the donor fluorophore can be detected when the quencher is sufficiently close to the acceptor fluorophore).

[0142] In some embodiments, the primer and probe of the present disclosure are based on fluorescence resonance energy transfer (FRET).The examples of oligonucleotides using FRET that can be used to detect amplification products include linear oligo probes (such as HybProbes), 5' nuclease oligo probes (such as TAQMAN® probes), hairpin oligo probes (such as molecular beacons, scorpion primers and UniPrimers), minor groove binding probes, and autofluorescent amplification products (such as sunrise primers).

[0143] In some embodiments, the primers and / or probes of the present disclosure are labeled with other functional entities (such as biotin, haptens, antigens, chemical groups, radioactive substances, enzymatic markers, etc.). Detection of the labeled amplification products can be achieved, for example, using fluorescence, chemiluminescence, densitometry, photometry, precipitation reactions, enzymatic reactions (including enzymatic reinforcement reactions), SPR ("surface plasmon resonance"), ellipsometry, refractive index measurements, reflectance measurements, and similar methods.

[0144] In some embodiments, the primers and probes described herein can be used in quantitative PCR to determine the methylation status and level of BMP3 and / or NDRG4 genes in patients.In some embodiments, additional reactions can be included to amplify one or more reference genes.In some embodiments, the reference gene is a gene in a patient whose activity is not affected by the presence or absence of CRC and AA, and is not affected by the methylation status and level of BMP3 and NDRG4.In some embodiments, the reference gene includes, but is not limited to, β-globin (HBB), telomerase (TERT), glyceraldehyde-3-phosphate dehydrogenase (GAPDH), albumin (ALB), β-actin (ACTB), beta 2 microglobulin (B2M), and T cell receptor gamma (TRG).

[0145] In some embodiments, the B2M gene is used as a reference gene in quantitative PCR to detect the methylation status and levels of BMP3 / NDRG4.

[0146] In some embodiments, one or more other controls may be introduced, including, but not limited to, a no-template control (to detect contamination of reagents or equipment and to confirm a positive result), a no-amplified control (to detect background fluorescence generated by degraded labeled probes), and a positive control (to detect inhibitors or malfunctions and to confirm that reagents and equipment are functioning).

[0147] In some embodiments, qPCR is used to determine whether there is amplification of methylated BMP3 gene or methylated NDRG4 gene in sample. The signal detected from BMP3 or NDRG4 probe is quantified by referring to a standard curve or by comparing Ct value with a reference gene. Analysis of housekeeping genes is often used to normalize results. Cycle threshold (Ct) is defined as the number of cycles required for the fluorescence signal to exceed a certain threshold (e.g., exceed background level, such as the level of amplification in negative control sample). In some embodiments, the threshold is automatically determined by the software of qPCR device or other suitable method. In some embodiments, the threshold is set to a value slightly higher than the terminal fluorescence value in negative control sample (e.g., about 0.01%, 0.1%, 1%, 5% or 10% higher).

[0148] In some embodiments, if the Ct value associated with the amplification of BMP3 or NDRG4 in the test sample is (≦) about 35, 34, 33, 32, 31, 30 or less, the sample is determined to contain methylated BMP3 or NDRG4, and the patient has CRC and / or AA (positive result); otherwise, the sample is determined to not contain methylated BMP3 or NDRG4, and the patient does not have CRC or AA (negative result).For the amplification of reference gene, if the Ct value associated with the amplification of control gene in the sample is (≦) about 34, 33, 32, 31, 30, 29 or less, the amplification of reference gene is determined to be positive; otherwise, the amplification of reference gene is determined to be negative.If the amplification of reference gene is determined to be negative, the test result is invalid.

[0149] In some embodiments, the difference in Ct values ​​associated with BMP3 is compared to the Ct value associated with the amplification of a reference gene (ΔCt=Ct 対象の遺伝子 -Ct 参照遺伝子), referred to as ΔCt1. In some embodiments, when ΔCt1 is equal to or less than a predetermined critical value (≦critical value), the sample is determined to have BMP3 methylation (positive result), and the patient is determined to have CRC or AA. In some embodiments, when ΔCt1 is higher than a predetermined critical value (>critical value), the sample is determined to not have BMP3 methylation (negative result), and the patient is determined to be healthy. In some embodiments, the critical value is the corresponding ΔCt value of the sample containing 5 ng / μL of nucleotide sequence with a methylation rate of 1% (such as about 8, 9 or 10).

[0150] In some embodiments, the difference in Ct value associated with NDRG4 is compared to the Ct value associated with the amplification of a reference gene (ΔCt=Ct 対象の遺伝子 -Ct 参照遺伝子 ), referred to as ΔCt2. In some embodiments, when ΔCt2 is equal to or less than a predetermined critical value (≦critical value), the sample is determined to have NDRG4 methylation (positive result), and the patient is determined to have CRC or AA. In some embodiments, when ΔCt2 is higher than a predetermined critical value (>critical value), the sample is determined to not have NDRG4 methylation (negative result), and the patient is determined to be healthy. In some embodiments, the critical value is the corresponding ΔCt value of the sample containing 5ng / μL of nucleotide sequence with 1% (such as about 8, 9 or 10) methylation rate.

[0151] The preferred primers and probes of the present disclosure have surprisingly high sensitivity and specificity in detecting CRC and AA (especially AA) in Asian populations compared to existing commercial products (such as Cologuard®).

[0152] As used herein, the term "sensitivity" refers to the proportion of patients who are actually diagnosed with CRC and / or AA in a given population.In some embodiments, the sensitivity is at least about 65%, at least about 70%, at least about 75%, at least about 80%, at least about 85%, at least about 86%, at least about 87%, at least about 88%, at least about 89%, at least about 90%, at least about 91%, at least about 92%, at least about 93%, at least about 94%, at least about 95%, at least about 96%, at least about 97%, at least about 98%, at least about 99% or more, or 100%. In some embodiments, the population size is at least about 50, 100, 200, 300, 400, 500, 600, 700, 800, 900, 1000, 2000, 3000, 4000, 5000, 6000, 7000, 8000, 9000, 10,000 or more.

[0153] As used herein, the term "specificity" refers to the proportion of patients in a given population who do not actually have CRC or AA that are correctly diagnosed as not having the condition.In some embodiments, the specificity is at least about 85%, at least about 86%, at least about 87%, at least about 88%, at least about 89%, at least about 90%, at least about 91%, at least about 92%, at least about 93%, at least about 94%, at least about 95%, at least about 96%, at least about 97%, at least about 98%, at least about 99% or more, or 100%.In some embodiments, the size of the population is at least about 50, 100, 200, 300, 400, 500, 600, 700, 800, 900, 1000, 2000, 3000, 4000, 5000, 6000, 7000, 8000, 9000, 10,000 or more.

[0154] As shown in the examples, the preferred primers and probes provide surprisingly high sensitivity and specificity in detecting the methylation of BMP3 and NDRG4, and thus provide surprisingly high sensitivity and specificity in detecting CRC and / or AA.For example, the sensitivity of CRC detection by three sets of preferred primers and probes of BMP3 gene is at least 85%; the sensitivity of CRC detection by three sets of preferred primers and probes of NDRG4 gene is at least 90%; the sensitivity of AA detection by three sets of preferred primers and probes of BMP3 gene is at least 66%; the sensitivity of AA detection by three sets of preferred primers and probes of NDRG4 gene is at least 73%.In addition, the specificity of CRC and AA detection by three sets of preferred primers and probes of BMP3 gene is about 97%-100% (for example, at least about 97.8%); the specificity of CRC and AA detection by three sets of preferred primers and probes of NDRG4 gene is about 97%-100% (for example, at least about 97.8%).

[0155] 3. Three preferred primer-probe combinations for detecting CRC and / or AA in patients The present disclosure also provides three sets of preferred primer and probe combinations for detecting the methylation level of BMP3 and NDRG4 genes to determine the presence or absence of CRC or AA in patients.These specific combinations have surprisingly high sensitivity and specificity in detecting CRC and AA (especially detecting AA) in Asian populations compared with existing commercial products (such as Cologuard®). The sequences of the three preferred primer and probe sets are as follows: [Table 2]

[0156] As shown in the examples, the preferred combination of BMP3 and NDRG4 primer-probe set provides surprisingly high sensitivity and specificity in detecting the methylation of BMP3 and NDRG4, and thus brings about surprisingly high sensitivity and specificity in detecting CRC and / or AA.In some embodiments, this sensitivity and specificity is obtained when the same assay comprises KRAS gene analysis and hemoglobin test, as described in the example 5. For example, the overall sensitivity of CRC detection by the three preferred combinations of primers and probes for the BMP3 and NDRG4 genes in a combination of KRAS gene analysis and hemoglobin testing is at least 95%; the sensitivity of AA detection by the three preferred combinations of primers and probes for the BMP3 and NDRG4 genes in a combination of KRAS gene analysis and hemoglobin testing is at least 93%; the sensitivity of CRC+AA detection by the three preferred combinations of primers and probes for the BMP3 and NDRG4 genes in a combination of KRAS gene analysis and hemoglobin testing is at least 97%; the specificity of CRC+AA detection by the three preferred combinations of primers and probes for the BMP3 and NDRG4 genes in a combination of KRAS gene analysis and hemoglobin testing is at least 97%.

[0157] 4. Kits for detecting CRC and AA The present disclosure provides a kit for detecting BMP3 / NDRG4 methylation and / or for detecting CRC / AA in patients who need it.In some embodiments, the kit is particularly suitable for Asian patients (such as Chinese patients).

[0158] In some embodiments, the kit includes: (1) at least one of three preferred primer and probe combinations (combination numbers 4, 5 and 7 in Table 20) for detecting CRC and AA, and corresponding qPCR reagents; (2) means (such as suitable primers and probes) for detecting seven mutations (i.e., G12D, G13D, G12V, G12C, G12S, G12A and G13R) in the coding region of the KRAS gene, and corresponding qPCR reagents; (3) means for detecting hemoglobin in a stool sample (such as reagents based on FIT technology, e.g., anti-hemoglobin antibodies, and reagents for detecting the complex formed by the antibodies and hemoglobin in a stool sample).

[0159] In some embodiments, the kit comprises at least one of the following preferred primer-probe combinations: (1) Three preferred combinations of primers and probes are as follows: [Table 3]

[0160] (2) Triple quantitative PCR reagents for detecting the methylation levels of BMP3 and NDRG4 genes. In some embodiments, the kit comprises reagents for performing multiplex PCR to simultaneously detect the methylation of BMP3 and NDRG4. In some embodiments, the multiplex PCR is quantitative PCR.

[0161] In some embodiments, the reagent comprises Taq DNA polymerase. In some embodiments, the final concentration of Taq DNA polymerase is about 2U / reaction. In some embodiments, the reagent comprises MgCl2. In some embodiments, the final concentration of MgCl2 in the reaction is 2mM. In some embodiments, the reagent comprises dNTPs. In some embodiments, the dNTPs have a final concentration of 0.2mM. In some embodiments, the reagent comprises about 0.5mM-0.75mM primers that amplify BMP3, NDRG4 and a reference gene. In some embodiments, the reagent comprises about 0.1mM-0.25mM probes that hybridize with the DNA sequences of BMP3, NDRG4 and a reference gene. In some embodiments, the reagent further comprises a PCR buffer, such as a concentrated (e.g., 5x or 10x) PCR buffer, which can be diluted to a final concentration of 1x. In some embodiments, B2M is a reference gene and is amplified for quality control in quantitative PCR.

[0162] (3) Primers and probes for detecting seven mutations in the coding region of the KRAS gene. In some embodiments, the kit comprises a means for detecting mutations in KRAS gene.In some embodiments, the kit comprises primers and probes designed to amplify and detect the seven mutation hotspots G12D, G13D, G12V, G12C, G12S, G12A and G13R in exon 12 and exon 13 of the open reading region of KRAS gene.In some embodiments, the sequences of the primers and probes are as follows: [Table 4]

[0163] (4) A multiplex quantitative PCR reagent for detecting codon mutations in the KRAS gene. A multiplex quantitative PCR system for detecting all seven mutations of the KRAS gene is provided. In some embodiments, the multiplex quantitative PCR reaction comprises Taq DNA polymerase at a final concentration of 2.5 U / reaction, MgCl2 at a final concentration of 1 mM, dNTPs at a final concentration of 0.1 mM, primers amplifying the KRAS and ACTB genes at 0.3-0.9 μM, probes hybridizing to the DNA sequences of the KRAS and ACTB genes at 0.05-0.1 μM, and 1×PCR buffer. ACTB is a reference gene and is amplified for quality control in quantitative PCR.

[0164] (5) A kit to detect hemoglobin in stool In some embodiments, the kit comprises reagents for detecting hemoglobin, hi some embodiments, the hemoglobin is qualitatively tested by enzyme-linked immunosorbent assay (ELISA).

[0165] 5. Logistic Regression Model In some embodiments, after obtaining the results of the BMP3 / NDRG4 methylation test, the KRAS mutation test and the hemoglobin test, all the results are collected and subjected to a logistic regression model to determine the presence or absence of CRC and / or AA in the patient.

[0166] In some embodiments, the method includes calculating a value of a comprehensive index value P of the cancer, where P=e K / (1+e K ) where e is a natural constant.

[0167] In some embodiments, K is defined as K=a*ΔCt1+b*ΔCt2+c*ΔCt3+d*FIT+X, where a, b, c, d, and X are clinical constants. ΔCt1, ΔCt2, and ΔCt3 are the Ct values ​​of BMP3, NDRG4, and KRAS minus the Ct values ​​of reference genes.

[0168] In some embodiments, if the P value is equal to or greater than a predetermined threshold, the test result is positive, otherwise it is negative. A positive result indicates that the person may have CRC or AA, otherwise is healthy.

[0169] 6. Treatment Method In some embodiments, the methods of the present disclosure include treating a patient in need thereof after the patient has been classified as having colorectal cancer and / or adenoma. In some embodiments, the treatment includes, but is not limited to, surgery, chemotherapy, radiation therapy, immunotherapy, palliative care, and exercise.

[0170] As used herein, the phrase "treatment regimen" refers to a treatment plan that defines the type, dosage, schedule and / or duration of treatment provided to a subject in need (e.g., a subject diagnosed by pathology). The treatment regimen selected may be an aggressive regimen that is expected to provide the best clinical outcome (e.g., complete cure of the pathology), or a more moderate regimen that may alleviate symptoms of the pathology but result in an incomplete cure of the pathology. It is understood that in some cases, the treatment regimen may involve unpleasant or harmful side effects to the subject (e.g., damage to healthy cells or tissues). Types of treatment may include surgical intervention (e.g., removal of lesions, diseased cells, tissues or organs), cell replacement therapy, administration of therapeutic agents (e.g., receptor agonists, antagonists, hormones, chemotherapeutic agents) in a local or systemic manner, exposure to radiation therapy using external sources (e.g., external beam) and / or internal sources (e.g., brachytherapy), and / or any combination thereof. The dosage, schedule and duration of treatment may vary depending on the severity of the pathology and the type of treatment selected, and one skilled in the art can adjust the dosage, schedule and duration of treatment to suit the type of treatment.

[0171] In some embodiments, treatments include, but are not limited to, fluorouracil, capecitabine, oxaliplatin, irinotecan, UFT, FOLFOX, FOLFOXIRI and FOLFIRI, antiangiogenic agents (such as bevacizumab), and epidermal growth factor receptor inhibitors (e.g., cetuximab and panitumumab).

[0172] 7. Advantages of the Invention Without wishing to be bound by any particular theory, the present invention has at least the following advantages: (1) Detailed methylated CpG sites in the promoter regions of BMP3 and NDRG4 genes in Chinese population are provided, which may be biomarkers for detecting CRC and / or AA. (2) Conventional products are targeted at Caucasian populations, whereas the present invention targets methylated CpG sites specific to the Chinese population, making the kit more suitable for detecting CRC and AA in the Chinese population than other similar products based on mt-sDNA (such as Cologuard®). (3) The sensitivity and specificity of CRC detection are high compared with other similar products based on mt-sDNA. (4) The sensitivity and specificity of AA detection are significantly improved compared with other similar products based on mt-sDNA. (5) The method is noninvasive and easy to collect samples at home, leading to good patient compliance and allowing it to be widely used as a screening method for CRC and AA, thereby reducing the morbidity and mortality of CRC in Asian populations. EXAMPLES

[0173] Example 1 Discovery of methylated CpG sites in the promoter regions of BMP3 and NDRG4 genes in Chinese CRC and AA populations, respectively. (1) Sample collection A total of 191 colon FFPE tissue samples were collected from patients with colonoscopy-confirmed CRC and AA, including 50 colon cancer tissues and 49 paired adjacent normal tissues, 46 adenoma cancer tissues and 46 paired ancillary normal tissues.

[0174] (2)DNA extraction Genomic DNA was extracted from FFPE samples using TaKaRa MiniBEST FFPE DNA Extraction Kit (Cat. No.: 9782). The detailed procedure steps are described below: i. Scrap 30 mg of paraffin section tissue with a sterile scalpel and remove excess paraffin. ii. Place the paraffin sectioned tissue in a 1.5 mL centrifuge tube, add 500 μL of Buffer DP, mix and incubate in 80° C. water for 1 minute, then vortex for 10 seconds. Add 180 μL of Buffer GL and vortex. iii. After the mixture was centrifuged at 12,000 rpm for 1 minute at room temperature, the solution formed two layers (upper oil phase, lower aqueous phase). Add 20 μL of proteinase K (20 mg / mL) and 10 μL of RNase (10 mg / mL) to the lower aqueous phase and mix thoroughly by gently pipetting up and down. Be careful not to disturb the layers. Then place in a water bath at 56°C for 1 hour. iv. The solution from the previous step was incubated at 90°C for 30 minutes and cooled to room temperature. Then, 200μL of Buffer GB and 200μL of 100% ethanol were added to the solution, and vortexed for 10 seconds. The solution was centrifuged at 12,000rpm for 1 minute at room temperature, and the solution formed two layers (upper oil phase, lower aqueous phase). v. Place the spin column into a collection tube and add the lower aqueous phase from the previous step to the spin column, taking care not to disturb the layers, and centrifuge at 12,000 rpm for 2 minutes at room temperature, then discard the waste. vi. Add 500 μL of Buffer WA to the spin column and centrifuge at 12,000 rpm for 1 minute at room temperature, then discard the waste. vii. Add 500 μL of Buffer WB to the spin column, centrifuge at 12,000 rpm for 1 minute at room temperature, and discard the waste. Repeat once. viii. Place the spin column into a collection tube and centrifuge at 12,000 rpm for 2 minutes at room temperature. ix. Place the spin column in a new 1.5 mL centrifuge tube and add 50-100 µL of sterile water or elution buffer to the center of the spin column membrane and leave at room temperature for 5 min. x. Centrifuge at 12,000 rpm for 2 minutes at room temperature to elute the DNA. xi. Quantify the eluted DNA with a Nanodrop2000 fluorometer and store at -20°C for use.

[0175] (3) Primer design for prediction of CpG islands in the promoter regions of BMP3 and NDRG4 genes and sequencing of the amplified products. i. Prediction of CpG islands in the promoter regions of BMP3 and NDRG4 genes. The promoter sequences of the BMP3 and NDRG4 genes were downloaded, which included DNA sequences approximately 1000-1500 bp upstream from the transcription start site (TSS) and 5'UTR region. The CpG islands of these sequences were predicted using MethPrimer software (www.urogene.org / methprimer / ). As shown in Figure 1A-D, two large CpG islands out of three CpG islands in the BMP3 gene were located approximately 400 bp upstream from the TSS and the entire 5'UTR region (chr4:81951752-81952760), and the only CpG island in the NDRG4 gene was located approximately 500 bp upstream from the TSS and partial 5'UTR region (chr16:58497061-58497938). The human reference genome assembly is GRCh37 / hg19.

[0176] ii. Primer design to amplify the predicted CpG island sequences of BMP3 and NDRG4 genes. Based on the length of the sequence to be amplified and the length of the sequencing read, four and five pairs of primers were designed for the BMP3 and NDRG4 genes, respectively. There was as much overlap as possible between adjacent amplification products so that the CpG islands of the two genes could be completely sequenced. The primers for the two genes are shown in Table 1, and the relative positions of the amplification products of the two genes are shown in Figure 1A-D. Table 1 Primers for sequencing of the amplification products of BMP3 and NDRG4 genes [Table 5]

[0177] DNA samples were bisulfite treated as described below. (4) Bisulfite treatment i. Leave the extracted DNA at room temperature to thaw and dilute the DNA concentration to 20 ng / μL. Add 40 μL of the diluted DNA to a 1.5 mL centrifuge tube, add 4 μL of 3 M NaOH solution, and incubate at 42°C for 20 minutes. ii. Add 400 μL of transformation solution, mix and incubate in the dark at 50° C. for 16 hours. iii. Add 550 μL of Binding Solution, mix, and transfer the solution to the DNA purification column. Centrifuge at 13,000 rpm for 90 seconds and discard the waste. Centrifuge again for 3 minutes and discard the waste. iv. Add 600 µL of 90% ethanol to the DNA purification column, centrifuge at 13,000 rpm for 90 s, discard the waste, and centrifuge again at 13,000 rpm for 15 s. v. Add 300 µL of desulfurization solution (0.3 M NaOH in 90% ethanol) to the DNA purified material and leave it at room temperature for 30 min. Centrifuge at 13,000 rpm for 90 s and discard the waste. vi. Add 600 µL of 90% ethanol, centrifuge at 13,000 rpm for 90 s, and discard the waste. Repeat this procedure once and centrifuge again at 13,000 rpm for 3 min. vii. Place the DNA purification column into a new 1.5 mL centrifuge tube and add 40 µL of elution solution. Incubate the tube at 50 °C for 30 min and centrifuge at 13,000 rpm for 90 s. Store the converted DNA solution at -20 °C for use.

[0178] (5) Library preparation and sequencing of amplification products (a) Multiplex PCR amplification i. Prepare PCR master mix as follows: Table 2 [Table 6] ii. Gently vortex the mixture and pipette 40 μL of it into each PCR tube followed by the addition of 10 μL of bisulfite-treated DNA. iii. Vortex gently and perform PCR amplification as follows: 1 cycle of denaturation at 95°C for 15 minutes, 35 cycles of denaturation at 94°C for 30 seconds, annealing at 55°C for 90 seconds and extension at 72°C for 90 seconds, 1 cycle of extension at 72°C for 10 minutes, and a final rest at 4°C for an unlimited time. iv. 5 μL of PCR product was mixed with 6X loading buffer (TakaRa, Catalog No.: 9156) and loaded onto a 1% (w / v) agarose gel along with a control of DL2000 DNA marker (TakaRa, Catalog No.: 3427Q) and electrophoresed at 120 V for 40 min. v. If there was non-specific amplification, the remaining 45 μL of PCR product had to be collected after electrophoresis according to the kit's instructions (QIAGEN, Cat. No.: 28704).

[0179] (b) Purification and quantification of PCR products The PCR products were purified using the MinElute PCR Purification Kit according to the kit's instructions (QIAGEN, Catalog No.: 28004). The purified PCR products were quantified using the Qubit™ dsDNA BR Assay Kit (Cat. No.: Q32850).

[0180] (c) Adapter connection Adaptors were ligated to the purified PCR products using the NEBNext Quick Ligation Module (NEB, Cat. No.: E6056L) and the reaction mixture was prepared as follows: Table 3. Reaction mixture for adapter ligation. [Table 7] Add 30 μL of the mixture to each PCR tube and 20 μL of purified PCR product to each. Mix the solution gently and incubate at 20 °C for 15 min and keep at 4 °C for 10 min.

[0181] (d) Purification of ligation products i. Agencourt AMpure XP beads (Beckman, Catalog Number: A63882) are placed at room temperature for use. ii. Centrifuge the PCR tubes at 280g for 1 minute at 20°C and transfer 50 μL of the ligation product to a new 96-well PCR plate. iii. Vortex the AMpure XP beads for 30 seconds to disperse them evenly, then add 56 µL of beads to each well of the PCR plate. Gently pipette the mixture 10 times to mix and keep at room temperature for 5 minutes. iv. Place the 96-well PCR plate on the 96-well magnetic plate and keep it on for 2 minutes until the supernatant is clear. Keep the 96-well PCR plate on the 96-well magnetic plate, remove the supernatant, add 200 μL of freshly prepared 80% ethanol to each well, incubate at room temperature for 30 seconds, and remove the supernatant. v. Keep the 96-well PCR plate on the 96-well magnetic plate and add 200 μL of freshly prepared 80% ethanol to each well. Then incubate at room temperature for 30 seconds. Discard the supernatant and remove the residual ethanol with a 10 μL pipette. vi. Keep the 96-well PCR plate on the magnetic plate and allow the beads to air dry for 10 min. vii. Remove the 96-well PCR plate from the magnetic plate and add 27.5 μL of 10 mM Tris (pH 8.5) to each well of the 96-well plate. Mix the beads and Tris by gently pipetting up and down 10 times until the beads are completely dispersed. Keep the plate at room temperature for 2 minutes. viii. Place the 96-well PCR plate on a magnetic plate and leave for 2 minutes until the supernatant is clear. Pipette 25 μL of the supernatant into a new PCR tube and store at -20 °C for use.

[0182] (e) PCR amplification and product purification Prepare a PCR master mix as follows and mix gently: Add 40 μL of the mix to each PCR tube and add 5 μL of the purified ligation product. Table 4. PCR reaction mixture [Table 8] The PCR tubes were gently vortexed, briefly centrifuged, and the PCR reaction carried out under the following conditions: 1 cycle of denaturation at 98°C for 30 s, 8 to 15 cycles of denaturation at 98°C for 10 s and extension at 65°C for 75 s, 1 cycle of denaturation at 65°C for 5 min, and a final hold at 4°C. The PCR products were purified according to (d) Purification of ligated products.

[0183] (f) Library detection and sequencing The concentration and size distribution of the purified PCR products were analyzed using Qubit™ dsDNA BR Assay Kit (Cat. No.: Q32850) and Agilent 2100 Bioanalyzer instrument, respectively. Libraries were pooled in equimolar concentrations and sequenced on an Illumina HiSeq2500 with a read length of PE125.

[0184] (g) Sequence data analysis The raw data were demultiplexed according to the sample index, and the sequencing reads were mapped to the reference gene sequences of BMP3 and NDRG4 using SHRiMP V2.04 software. Methylated CpG sites were identified based on the mapping results. Finally, 26 and 39 CpG sites in BMP3 and NDRG4 genes were found to be hypermethylated (p<0.05) in CRC and AA tissues compared with adjacent normal tissues, indicating that these methylated CpG sites could be DNA biomarkers for the early diagnosis of CRC and AA. Table 5. Frequency of methylation of CpG sites in the BMP3 gene in CRC tissues and adjacent normal tissues. [Table 9] Table 6. Frequency of methylation of CpG sites in the BMP3 gene in AA tissues and adjacent normal tissues. [Table 10] Table 7. Frequency of methylation of CpG sites of NDRG4 gene in CRC tissues and adjacent normal tissues. [Table 11-1] [Table 11-2] Table 8. Frequency of methylation of CpG sites of NDRG4 gene in AA tissues and adjacent normal tissues. [Table 12]

[0185] Example 2 Comparison of differentially methylated CpG sites of BMP3 and NDRG4 genes associated with CRC among different ethnic groups We analyzed the methylation microarray data (Illumina human methylation 450 data) of BMP3 and NDRG4 genes in the TCGA database and found that there are five significantly different methylated CpG sites in the promoter region of NDRG4 gene between Caucasian and Asian populations (Figure 2 and Table 9). To further verify the differentially methylated CpG sites, tissue and blood samples were collected from 106 CRC and AA patients in China. DNA was extracted and bisulfite treated. The promoter regions of BMP3 and NDRG4 genes were amplified and sequenced. We analyzed the sequence data and found that indeed the hypermethylated CpG sites in Asian populations were different from those in Caucasian populations in the TCGA database, and the hypermethylated CpG sites were different between CRC and AA tissue samples. According to these various methylated CpG sites, we developed a detection kit specific for screening CRC and AA in Asian populations (e.g., Chinese population). Table 9. Differences in methylated CpG sites of BMP3 and NDRG4 genes between Caucasian and Asian populations. [Table 13]

[0186] Example 3 Screening of primers and probes for BMP3 and NDRG4 genes (1) Design and selection of primers and probes for BMP3 and NDRG4 genes qPCR primers and probes are designed based on the methylated CpG sites of BMP3 and NDRG4 genes.Three sets of preferred primers and probes are identified.Preferred primers and probes are compared with several other candidate primers and probes of BMP3 and NDRG4 genes with positive and negative controls.The primer and probe information is shown in Table 10. Table 10. Preferred and remaining primer and probe information [Table 14]

[0187] (2) Comparison of the preferred primers and probes to controls, including positive and negative controls for the BMP3 and NDRG4 genes. Standard samples with various methylation ratios were formed by adding various ratios of positive control DNA to the negative control DNA of each of the BMP3 and NDRG4 genes (Table 11). The analytical sensitivity was compared by amplifying the standard sample DNA with the preferred primers and probes of each of the BMP3 and NDRG4 genes and the control primers and probes. The analytical specificity was compared by amplifying the negative control DNA of the BMP3 and NDRG4 genes with the preferred primers and probes of each of the BMP3 and NDRG4 genes and the control primers and probes, and the amount of negative control DNA per reaction was 10 4 Copy, 10 5 Copy, 10 6 Copy, 10 7 Copy and 10 8 It was a copy. Table 11. Standard samples of BMP3 and NDRG4 genes [Table 15]

[0188] A master mix was prepared as per Table 5, and the quantitative PCR reaction conditions were initial denaturation at 95°C for 1 min, followed by 50 cycles of denaturation at 95°C for 20 s and extension at 60°C for 1 min. Table 12 Final concentrations of reagents for methylation qPCR [Table 16]

[0189] As shown in Table 13 and Figures 3A to 3L, 4 Methylated DNA can be detected using the triplicate preferred primers and probes, but not the triplicate controls.

[0190] As shown in Table 13 and Figures 3A to 3L, three preferred pairs of BMP3 and NDRG4 primers and probes of the present invention can stably detect methylation levels as low as 1 in 10,000, while three pairs of comparative primers and probes cannot detect methylation levels as low as 1 in 10,000. Table 13. Comparison of analytical sensitivity of preferred and control primers and probes for BMP3 and NDRG4 genes. [Table 17] Y: Detected, N: Not detected

[0191] Amplification curves of analytical sensitivity of BMP3 and NDRG4 are shown in Figures 3A to 3L for each of the preferred combinations compared to the control group. [Table 18]

[0192] As shown in Table 14 and Figures 4A to 4L, three sets of preferred primers and probes for the BMP3 and NDRG4 genes have no amplification signals for various concentrations of unmethylated DNA, while the comparative primers and probes show various degrees of non-specific amplification. Table 14. Comparison of analytical specificity between preferred and control primers and probes. [Table 19] Y: no amplification, N: non-specific amplification Amplification curves of BMP3 and NDRG4 analytical specificity [Table 20]

[0193] Example 4 Validation of the preferred and comparative methylation primers and probes is performed using stool samples for the BMP3 and NDRG4 genes. The methylation levels of the BMP3 and NDRG4 genes in 81 stool samples were detected using three sets of preferred primers and probes and a comparative primer and probe. The three comparative primers and probes are: Comparison 1: BMP3 forward primer SEQ ID NO:21, BMP3 reverse primer SEQ ID NO:22, and BMP3 probe SEQ ID NO:23; NDRG4 forward primer SEQ ID NO:24, NDRG4 reverse primer SEQ ID NO:25, and NDRG4 probe SEQ ID NO:26; Comparison 2: BMP3 forward primer SEQ ID NO:27, BMP3 reverse primer SEQ ID NO:28, and BMP3 probe SEQ ID NO:29; NDRG4 forward primer SEQ ID NO:24, NDRG4 reverse primer SEQ ID NO:30, and NDRG4 probe SEQ ID NO:26; Comparison 3: BMP3 forward primer SEQ ID NO:31, BMP3 reverse primer SEQ ID NO:32, and BMP3 probe SEQ ID NO:33; NDRG4 forward primer SEQ ID NO:24, NDRG4 reverse primer SEQ ID NO:34, and NDRG4 probe SEQ ID NO:26.

[0194] Stool sample information is shown in Table 15. Table 15. Statistics for 81 stool samples [Table 21]

[0195] Stool DNA was extracted from the samples according to the method described below. (1) Extraction of fecal DNA i. Add 40 mL of solubilization solution to 4-6 g of stool sample, vortex thoroughly, and then incubate at 50 °C for 16 h. ii. Then centrifuge at 5000 rpm for 10 minutes. Be careful to weigh before centrifugation. After centrifugation is complete, carefully remove the centrifuge tube and avoid shaking it vigorously. iii.Pipette 9 mL of the supernatant into a new 50 mL centrifuge tube and add 1 mL of extraction adjuvant, 60 µL of magnetic beads, and 10 mL of isopropanol. Vortex for 10 s and incubate at 65 °C for 20 min. Mix up and down once every 5 min during incubation. iv. After incubation, place the 50 mL centrifuge tube on a magnetic stand and keep it stable for 3 minutes until the supernatant becomes clear, then discard the supernatant. v. Remove the 50 mL centrifuge tube from the magnetic stand and add 12 mL of wash solution. Vortex until the magnetic beads detach from the wells of the centrifuge tube and keep stable for 3 min. Place the 50 mL centrifuge tube back on the magnetic stand and let it sit for 3 min until the supernatant is clear and discard the supernatant. vi.Add 15 mL of 80% ethanol solution, vortex until the beads are detached from the wells of the centrifuge tube, and keep stable for 3 min. Place the centrifuge tube back on the magnetic stand and keep stable for 3 min until the supernatant is clear, then discard the supernatant. vii. Repeat the previous step once. viii. Pipette off the remaining liquid at the bottom and incubate the tube open at 65 °C for 5 min. Remove the tube from the magnetic stand until the beads are dry and add 1.5 mL of pre-heated eluent I. Pipette the beads from the well into eluent I with a 1000 µL pipette and transfer the mixture to a 2 mL centrifuge tube, close the lid, and incubate at 65 °C for 5 min. ix. Centrifuge at 13,000 rpm for 3 min, pipette 600 μL of the supernatant into a new 1.5 mL tube, add 600 μL of binding solution and vortex thoroughly. Transfer x. 600 µL of the above mixture onto a DNA purification column, centrifuge at 13,000 rpm for 1 min, and discard the waste. xi. Treat the remaining mixture as in the previous step and centrifuge at 13,000 for 2 minutes. xii. Add 600 µL of 90% ethanol solution to the DNA purification column, centrifuge at 13,000 rpm for 1 min, and discard the waste. xiii. Repeat the previous step twice. xiv. Centrifuge at 13,000 rpm for 3 min and place the DNA purification column into a new 1.5 mL centrifuge tube. Open the DNA purification column and incubate at 65 °C for 5 min to dry it. xv. Drop 100 µL of pre-warmed elution solution II onto the center of the DNA purification column, cover and incubate at 65 °C for 5 min. Centrifuge at 13,000 rpm for 2 min. Obtain the eluted DNA solution and store at 2-8 °C for use. Long-term storage should be maintained at -25 °C to -15 °C.

[0196] (2) Bisulfite treatment The detailed procedure follows that of Example 3.

[0197] (3)qPCR The QPCR master mix was prepared as follows. Table 16 [Table 22] The qPCR reaction conditions were 1 cycle of denaturation at 95° C. for 2 min, and 50 cycles of denaturation at 95° C. for 20 s and extension at 95° C. for 1 min. The B2M gene was the reference gene for the quality control of the qPCR reaction.

[0198] (4) Results As shown in Table 17, the sensitivity of CRC and AA detection in 81 stool samples using three sets of preferred primers and probes for BMP3 and NDRG4 genes is up to 85.0%-95.0% (CRC by BMP3 methylation), 66.7%-73.3% (AA by BMP3 methylation), 90.0%-95.0% (CRC by NDRG4 methylation), and 73.3%-86.7% (AA by NDRG4 methylation), respectively. Furthermore, the specificity of CRC and AA detection using either BMP3 methylation data or NDRG4 methylation data is both about 97.8%-100.0%.

[0199] However, the sensitivity of CRC and AA detection in 81 stool samples using three sets of comparative primers and probes for BMP3 and NDRG4 genes is 85.0%-90.0% (CRC by BMP3 methylation), 46.7%-60.0% (AA by BMP3 methylation), 90.0%-95.0% (CRC by NDRG4 methylation), and 66.7%-73.3% (AA by NDRG4 methylation), respectively. Also, the overall specificity of CRC and AA detection using either BMP3 methylation or NDRG4 methylation data is up to about 91.3%-93.5% and 93.5%-95.7%, respectively.

[0200] It can be seen that the preferred primers and probes are superior to the comparative primers and probes in detection of clinical samples, particularly AA detection. Table 17. Statistics of detection results in clinical samples [Table 23-1] [Table 23-2] Table 18. Detection results for 81 stool samples [Table 24-1] [Table 24-2] [Table 24-3] Annotation U:Undetected

[0201] Example 5 Screening of methylation primer and probe combinations of BMP3 and NDRG4 genes (1) Extraction of fecal DNA Stool DNA is extracted according to the protocol in Example 3.

[0202] (2) Detection of methylation of BMP3 and NDRG4 genes The primer and probe combinations for the BMP3 and NDRG4 genes are shown below. Following the procedure of Example 3, qPCR was performed using each of the nine combinations. Table 19. Primer and probe combinations [Table 25] The sequences of the nine combinations of primers and probes for the BMP3 and NDRG4 genes are as follows: Table 20. Primer and probe sequences in combination [Table 26]

[0203] The QPCR master mix used in the reactions was: Table 21. QPCR master mix for BMP3 / NDRG4 [Table 27]

[0204] The qPCR reaction conditions were 1 cycle of denaturation at 95°C for 2 minutes, and 50 cycles of denaturation at 95°C for 20 seconds and extension at 60°C for 1 minute.

[0205] (3) Detection of KRAS gene variants Seven mutation hotspots were detected in codons 12 and 13 of the KRAS gene. The seven mutations are G12D, G13D, G12V, G12C, G12S, G12A and G13R, and the sequences of their primers and probes are in Table 22. Table 22 Primers and probes for detecting seven mutations in the KRAS gene [Table 28] The QPCR master mix used in the reactions was: Table 23. QPCR Master Mix for KRAS [Table 29]

[0206] QPCR reaction conditions were 1 cycle of denaturation at 95° C. for 5 minutes and 45 cycles of denaturation at 95° C. for 15 seconds, annealing at 71° C. for 60 seconds, and extension at 55° C. for 50 seconds.

[0207] Quality control of the qPCR reactions was performed using ACTB as a reference gene.

[0208] (4) Fecal hemoglobin test Hemoglobin in the stool is detected by an immunological fecal occult blood test (FIT), and the results are either positive or negative.

[0209] Score generation using formula (5) The Ct values ​​of qPCR detection of BMP3, NDRG4 and KRAS genes, as well as the positive and negative results of the fecal hemoglobin test, were entered into the following logistic regression equation: P=e K / (1+e K )

[0210] where P is a composite index, K==a*ΔCt1+b*ΔCt2+c*ΔCt3+d*FIT+X, e is a natural constant, and a, b, c, d, and X are clinical constants. ΔCt1, ΔCt2, and ΔCt3 are the Ct values ​​of the target gene minus the Ct values ​​of the reference gene.

[0211] If the P value is equal to or greater than a predetermined threshold, the test result is positive, otherwise it is negative. A positive result indicates that the subject is likely to have CRC or AA.

[0212] (6) Test results The 81 stool samples of Example 3 were detected, and the results of various combinations of primers and probes for BMP3 and NDRG4 genes are shown in Table 24. Table 24. Detection results for 81 stool samples [Table 30]

[0213] The following was found: (1) combination numbers 4, 5 and 7 are superior to the other six combinations. Considering that all primers and probes tested are preferred and superior to other primers and probes (see Example 3), these three specific combinations are superior to all known combinations of BMP3 and NDRG4 primers / probes. (2) The sensitivity and specificity of the present kit for CRC and AA detection, including BMP3, NDRG4, KRAS gene and stool hemoglobin detection, are significantly superior to the sensitivity and specificity of the kit for single gene methylation detection of BMP3 or NDRG4. (3) The sensitivity and specificity of the present kit for CRC detection in Asian populations (e.g. Chinese populations) are obviously superior to existing similar products (such as Cologuard®). (4) The sensitivity and specificity of the present kit for AA detection in Asian populations (e.g. Chinese populations) are significantly superior to existing similar products (such as Cologuard®).

[0214] The disclosures of all patents, patent applications, and publications cited herein, including any claims, figures, and / or drawings, are hereby incorporated by reference in their entirety.

[0215] Unless otherwise specified, all technical and scientific terms in this specification have the same meaning as those commonly understood by those skilled in the art to which this invention belongs.Although any method and material similar or equivalent to the method and material described herein can be used to carry out or test this invention, the preferred method and material are described herein.All publications, patents and patent applications cited herein are incorporated herein by reference in their entirety for all purposes.

[0216] The publications discussed herein are provided solely for their disclosure prior to the filing date of the present application, and nothing herein is to be construed as an admission that the present invention is not entitled to antedate such publication by virtue of prior invention.

[0217] While the invention has been described in relation to specific embodiments thereof, it will be understood that further modifications are possible, and this application is intended to cover any variation, use, or adaptation of the invention generally in accordance with the principles of the invention and within known or customary practice in the art to which the invention pertains, which may be applied to the essential features set forth above, including departures from the present disclosure as set forth in the appended claims.

Claims

1. A kit for detecting the presence or absence of colorectal cancer (CRC) or advanced adenoma (AA) in a patient in need thereof, comprising: a) a first primer pair and a first probe for detecting the methylation status or level of at least one CpG dinucleotide of the BMP3 gene in a biological sample obtained from a patient, wherein the first primer pair and the first probe each comprise a contiguous sequence of at least 16 nucleotides that is identical to, complementary to, or hybridizes under stringent hybridization conditions to a fragment of SEQ ID NO:1; and b) a second primer pair and a second probe for detecting the methylation status or level of at least one CpG dinucleotide of the NDRG4 gene in a biological sample obtained from a patient, wherein the second primer pair and the second probe each comprise a contiguous sequence of at least 16 nucleotides that is identical to, complementary to, or hybridizes under stringent hybridization conditions to a fragment of SEQ ID NO:2; wherein the first primer pair and the first probe are selected from the group consisting of: i) a forward primer comprising SEQ ID NO:3, a reverse primer comprising SEQ ID NO:4, and a probe comprising SEQ ID NO:5; ii) a forward primer comprising SEQ ID NO:9, a reverse primer comprising SEQ ID NO:10, and a probe comprising SEQ ID NO:11; and iii) a forward primer comprising SEQ ID NO:15, a reverse primer comprising SEQ ID NO:16, and a probe comprising SEQ ID NO:17; and, the second primer pair and the second probe are selected from the group consisting of: iv) a forward primer comprising SEQ ID NO:6, a reverse primer comprising SEQ ID NO:7, and a probe comprising SEQ ID NO:8; v) a forward primer comprising SEQ ID NO:12, a reverse primer comprising SEQ ID NO:13, and a probe comprising SEQ ID NO:14; and vi) a forward primer comprising SEQ ID NO:18, a reverse primer comprising SEQ ID NO:19, and a probe comprising SEQ ID NO:

20.

2. 2. The kit of claim 1, comprising: (a) a first primer pair and a first probe; and (b) a second primer pair and a second probe, the kit being intended for use in Asian patients.

3. The kit of claim 1, comprising: i) a forward primer comprising SEQ ID NO: 3, a reverse primer comprising SEQ ID NO: 4, and a probe comprising SEQ ID NO: 5 for detecting the methylation status or level of at least one CpG dinucleotide of the BMP3 gene in a biological sample obtained from a patient; and ii) a forward primer comprising SEQ ID NO:6, a reverse primer comprising SEQ ID NO:7, and a probe comprising SEQ ID NO:8 for detecting the methylation status or level of at least one CpG dinucleotide of the NDRG4 gene in a biological sample obtained from a patient.

4. The kit of claim 1, comprising: i) a forward primer comprising SEQ ID NO: 9, a reverse primer comprising SEQ ID NO: 10, and a probe comprising SEQ ID NO: 11 for detecting the methylation status or level of at least one CpG dinucleotide of the BMP3 gene in a biological sample obtained from a patient; and ii) a forward primer comprising SEQ ID NO:12, a reverse primer comprising SEQ ID NO:13, and a probe comprising SEQ ID NO:14 for detecting the methylation status or level of at least one CpG dinucleotide of the NDRG4 gene in a biological sample obtained from a patient.

5. The kit of claim 1, comprising: i) a forward primer comprising SEQ ID NO: 15, a reverse primer comprising SEQ ID NO: 16, and a probe comprising SEQ ID NO: 17 for detecting the methylation status or level of at least one CpG dinucleotide of the BMP3 gene in a biological sample obtained from a patient; and ii) a forward primer comprising SEQ ID NO:18, a reverse primer comprising SEQ ID NO:19, and a probe comprising SEQ ID NO:20 for detecting the methylation status or level of at least one CpG dinucleotide of the NDRG4 gene in a biological sample obtained from a patient.

6. The kit of any one of claims 1 to 5, wherein the first probe and the second probe both comprise fluorescent donor and acceptor fluorophores.

7. 7. The kit of claim 6, wherein the first probe and the second probe are TAQMAN® probes.

8. The kit of any one of claims 1 to 7, further comprising: (1) a means for detecting the presence or absence of at least one mutation in the KRAS gene in a patient; and (2) a means for detecting the presence or absence of hemoglobin in a biological sample obtained from a patient; Here, the means for detecting the presence or absence of at least one mutation in the KRAS gene includes one or more primer pairs selected from the following group, which are capable of amplifying a region containing at least one mutation selected from the group consisting of G12D, G12V, G12C, G13D, G12A, G12R, G12S, and G13C in the exon 12 and / or exon 13 region of the KRAS gene by polymerase chain reaction (PCR): (1) forward primer G12D-F comprising SEQ ID NO:35, and reverse primer Kras-R comprising SEQ ID NO:42; (2) forward primer G13D-F comprising SEQ ID NO:36, and reverse primer Kras-R comprising SEQ ID NO:42; (3) forward primer G12V-F comprising SEQ ID NO:37, and reverse primer Kras-R comprising SEQ ID NO:42; (4) forward primer G12C-F comprising SEQ ID NO:38, and reverse primer Kras-R comprising SEQ ID NO:42; (5) forward primer G12S-F comprising SEQ ID NO:39, and reverse primer Kras-R comprising SEQ ID NO:42; (6) forward primer G12A-F comprising SEQ ID NO:40, and reverse primer Kras-R comprising SEQ ID NO:42; and (7) A forward primer G12R-F comprising SEQ ID NO: 41, and a reverse primer Kras-R comprising SEQ ID NO: 42 and a KRAS probe comprising SEQ ID NO:

45. Includes.

9. The kit according to any one of claims 1 to 8, wherein the biological sample obtained from a patient is a stool sample.

10. The kit of any one of claims 1 to 9, further comprising a bisulfite reagent and a container suitable for mixing the bisulfite reagent and a patient's biological sample or a polynucleotide obtained from the biological sample.

11. The kit according to any one of claims 1 to 10, further comprising a methylation-sensitive restriction enzyme reagent.

12. 1. A method of aiding in the diagnosis of colorectal cancer (CRC) or advanced adenoma (AA) in a patient in need thereof, comprising: a) obtaining genomic DNA from a patient biological sample; b) treating the genomic DNA of a) or a fragment thereof with one or more reagents to convert unmethylated cytosine bases to uracil or another base that is detectably different from cytosine in terms of hybridization properties; c) contacting the treated genomic DNA or a treated fragment thereof with a first primer pair for detecting the presence or absence of a methylation site in a gene encoding bone morphogenetic protein 3 (BMP3) in the patient and a second primer pair for detecting the presence or absence of a methylation site in a gene encoding NDRG family member 4 protein (NDRG4) in the patient, wherein the first primer pair comprises a contiguous sequence of at least 9 nucleotides that is identical to, complementary to, or hybridizes under stringent hybridization conditions with a fragment of SEQ ID NO:1, and the second primer pair comprises a contiguous sequence of at least 9 nucleotides that is complementary to, or hybridizes under stringent hybridization conditions with a fragment of SEQ ID NO:2, and the treated genomic DNA or a fragment thereof is amplified or not amplified by the first primer pair or the second primer pair to generate at least one amplicon; and d) determining the presence or absence of CRC or AA in the patient based on the presence or absence of the amplification product, the methylation status or level of at least one CpG dinucleotide in the BMP3 gene and the NDRG4 gene in the patient, using a first probe for detecting the presence or absence of a methylation site in the BMP3 gene and a second probe for detecting the presence or absence of a methylation site in the NDRG4 gene; wherein the first primer pair and the first probe are selected from the group consisting of: i) a forward primer comprising SEQ ID NO:3, a reverse primer comprising SEQ ID NO:4, and a probe comprising SEQ ID NO:5; ii) a forward primer comprising SEQ ID NO:9, a reverse primer comprising SEQ ID NO:10, and a probe comprising SEQ ID NO:11; and iii) a forward primer comprising SEQ ID NO:15, a reverse primer comprising SEQ ID NO:16, and a probe comprising SEQ ID NO:17; and, the second primer pair and the second probe are selected from the group consisting of: iv) a forward primer comprising SEQ ID NO:6, a reverse primer comprising SEQ ID NO:7, and a probe comprising SEQ ID NO:8; v) a forward primer comprising SEQ ID NO:12, a reverse primer comprising SEQ ID NO:13, and a probe comprising SEQ ID NO:14; and vi) a forward primer comprising SEQ ID NO:18, a reverse primer comprising SEQ ID NO:19, and a probe comprising SEQ ID NO:

20.

13. 13. The method of claim 12, comprising the use of (a) a first primer pair and a first probe and (b) a second primer pair and a second probe, wherein the patient is Asian.

14. 13. The method of claim 12, comprising using: i) a forward primer comprising SEQ ID NO: 3, a reverse primer comprising SEQ ID NO: 4, and a probe comprising SEQ ID NO: 5 for detecting the methylation status or level of at least one CpG dinucleotide of the BMP3 gene in a biological sample obtained from a patient; and ii) a forward primer comprising SEQ ID NO:6, a reverse primer comprising SEQ ID NO:7, and a probe comprising SEQ ID NO:8 for detecting the methylation status or level of at least one CpG dinucleotide of the NDRG4 gene in a biological sample obtained from a patient.

15. 13. The method of claim 12, comprising using: i) a forward primer comprising SEQ ID NO: 9, a reverse primer comprising SEQ ID NO: 10, and a probe comprising SEQ ID NO: 11 for detecting the methylation status or level of at least one CpG dinucleotide of the BMP3 gene in a biological sample obtained from a patient; and ii) a forward primer comprising SEQ ID NO:12, a reverse primer comprising SEQ ID NO:13, and a probe comprising SEQ ID NO:14 for detecting the methylation status or level of at least one CpG dinucleotide of the NDRG4 gene in a biological sample obtained from a patient.

16. 13. The method of claim 12, comprising using: i) a forward primer comprising SEQ ID NO: 15, a reverse primer comprising SEQ ID NO: 16, and a probe comprising SEQ ID NO: 17 for detecting the methylation status or level of at least one CpG dinucleotide of the BMP3 gene in a biological sample obtained from a patient; and ii) a forward primer comprising SEQ ID NO:18, a reverse primer comprising SEQ ID NO:19, and a probe comprising SEQ ID NO:20 for detecting the methylation status or level of at least one CpG dinucleotide of the NDRG4 gene in a biological sample obtained from a patient.

17. The method of any of claims 12 to 16, wherein the first probe and the second probe both comprise fluorescent donor and acceptor fluorophores.

18. The method of any one of claims 12 to 16, wherein the first probe and the second probe are TAQMAN® probes.

19. The method according to any one of claims 12 to 18, further comprising the steps of detecting the presence or absence of at least one mutation in the KRAS gene in a biological sample obtained from the patient, and detecting the presence or absence of hemoglobin in a biological sample obtained from the patient. Here, the step of detecting the presence or absence of at least one mutation in the KRAS gene in a biological sample obtained from a patient includes amplifying a region containing at least one mutation selected from the group consisting of G12D, G12V, G12C, G13D, G12A, G12R, G12S, and G13C in exon 12 and / or exon 13 region of the KRAS gene, using one or more primer pairs selected from the following group: (1) forward primer G12D-F comprising SEQ ID NO:35, and reverse primer Kras-R comprising SEQ ID NO:42; (2) forward primer G13D-F comprising SEQ ID NO:36, and reverse primer Kras-R comprising SEQ ID NO:42; (3) forward primer G12V-F comprising SEQ ID NO:37, and reverse primer Kras-R comprising SEQ ID NO:42; (4) forward primer G12C-F comprising SEQ ID NO:38, and reverse primer Kras-R comprising SEQ ID NO:42; (5) forward primer G12S-F comprising SEQ ID NO:39, and reverse primer Kras-R comprising SEQ ID NO:42; (6) forward primer G12A-F comprising SEQ ID NO:40, and reverse primer Kras-R comprising SEQ ID NO:42; and (7) A forward primer G12R-F comprising SEQ ID NO: 41, and a reverse primer Kras-R comprising SEQ ID NO: 42 and a KRAS probe comprising SEQ ID NO:

45. The method includes carrying out PCR using the above-mentioned method.

20. A method for aiding in the diagnosis of colorectal cancer (CRC) or advanced adenoma (AA) in a patient in need thereof, comprising using a kit according to any one of claims 1 to 11.

21. 1. A method of aiding in the diagnosis of colorectal cancer (CRC) or advanced adenoma (AA) in a patient in need thereof, comprising: a) Obtaining unprocessed genomic DNA from a patient's stool sample: b) treating the genomic DNA of a) or a fragment thereof with one or more reagents to convert unmethylated cytosine bases to uracil or another base that is detectably different from cytosine in terms of hybridization properties; c) performing quantitative PCR (qPCR) using the treated genomic DNA of b) as a template, and determining ΔCt1 as the Ct value of the BMP3 gene in the patient minus the Ct value of the first reference gene; d) performing qPCR using the treated genomic DNA of b) as a template, and determining ΔCt2 as the Ct value of the NDRG4 gene in the patient minus the Ct value of the first reference gene; e) performing qPCR using untreated genomic DNA as a template, and determining the Ct value of the mutant KRAS gene in the patient minus the Ct value of the second reference as ΔCt3; f) performing an immunochemical fecal occult blood test for hemoglobin protein in the stool sample and determining the score as FIT; g) determining the value of K, where K=a*ΔCt1+b*ΔCt2+c*ΔCt3+d*FIT+X, where a, b, c, d, and X are clinical constants; and h) Determine the value of the overall index P, where P=e Ｋ / (1+e Ｋ ), where e is a natural constant, where if P is equal to or greater than a predetermined threshold, the patient is determined to have CRC and / or AA, and if P is less than the predetermined threshold, the patient is determined to not have CRC and AA. wherein the qPCR for amplifying the BMP3 gene is performed using a first primer pair and a first probe selected from the group consisting of: i) a forward primer comprising SEQ ID NO:3, a reverse primer comprising SEQ ID NO:4, and a probe comprising SEQ ID NO:5; ii) a forward primer comprising SEQ ID NO:9, a reverse primer comprising SEQ ID NO:10, and a probe comprising SEQ ID NO:11; and iii) a forward primer comprising SEQ ID NO:15, a reverse primer comprising SEQ ID NO:16, and a probe comprising SEQ ID NO:17; and qPCR to amplify the NDRG4 gene is performed using a second primer pair and a second probe selected from the group consisting of: iv) a forward primer comprising SEQ ID NO:6, a reverse primer comprising SEQ ID NO:7, and a probe comprising SEQ ID NO:8; v) a forward primer comprising SEQ ID NO:12, a reverse primer comprising SEQ ID NO:13, and a probe comprising SEQ ID NO:14; and vi) a forward primer comprising SEQ ID NO:18, a reverse primer comprising SEQ ID NO:19, and a probe comprising SEQ ID NO:

20.

22. 22. The method of claim 21, wherein qPCR to amplify the BMP3 gene is performed using a first primer pair and a first probe, and qPCR to amplify the NDRG4 gene is performed using a second primer pair and a second probe, wherein the patient is Asian.

23. 22. The method of claim 21, comprising using: i) a forward primer comprising SEQ ID NO:3, a reverse primer comprising SEQ ID NO:4, and a probe comprising SEQ ID NO:5 for detecting the methylation status or level of at least one CpG dinucleotide of the BMP3 gene in a sample; and ii) a forward primer comprising SEQ ID NO:6, a reverse primer comprising SEQ ID NO:7, and a probe comprising SEQ ID NO:8 for detecting the methylation status or level of at least one CpG dinucleotide of the NDRG4 gene in a sample.

24. 22. The method of claim 21, comprising using: i) a forward primer comprising SEQ ID NO: 9, a reverse primer comprising SEQ ID NO: 10, and a probe comprising SEQ ID NO: 11 for detecting the methylation status or level of at least one CpG dinucleotide of the BMP3 gene in a sample; and ii) a forward primer comprising SEQ ID NO:12, a reverse primer comprising SEQ ID NO:13, and a probe comprising SEQ ID NO:14 for detecting the methylation status or level of at least one CpG dinucleotide of the NDRG4 gene in a sample.

25. 22. The method of claim 21, comprising using: i) a forward primer comprising SEQ ID NO: 15, a reverse primer comprising SEQ ID NO: 16, and a probe comprising SEQ ID NO: 17 for detecting the methylation status or level of at least one CpG dinucleotide of the BMP3 gene in a sample; and ii) a forward primer comprising SEQ ID NO:18, a reverse primer comprising SEQ ID NO:19, and a probe comprising SEQ ID NO:20 for detecting the methylation status or level of at least one CpG dinucleotide of the NDRG4 gene in a sample.

26. The method of any of claims 21 to 25, wherein the first probe and the second probe both comprise fluorescent donor and acceptor fluorophores.

27. The method of any one of claims 21 to 26, wherein the first probe and the second probe are TAQMAN® probes.

28. The method according to any one of claims 21 to 27, further comprising detecting the presence or absence of at least one mutation in the KRAS gene selected from the group consisting of G12D, G12V, G12C, G13D, G12A, G12R, G12S and G13C; wherein the detection of the mutant KRAS gene comprises one or more primer pairs selected from the group consisting of: (1) forward primer G12D-F comprising SEQ ID NO:35, and reverse primer Kras-R comprising SEQ ID NO:42; (2) forward primer G13D-F comprising SEQ ID NO:36, and reverse primer Kras-R comprising SEQ ID NO:42; (3) forward primer G12V-F comprising SEQ ID NO:37, and reverse primer Kras-R comprising SEQ ID NO:42; (4) forward primer G12C-F comprising SEQ ID NO:38, and reverse primer Kras-R comprising SEQ ID NO:42; (5) forward primer G12S-F comprising SEQ ID NO:39, and reverse primer Kras-R comprising SEQ ID NO:42; (6) forward primer G12A-F comprising SEQ ID NO:40, and reverse primer Kras-R comprising SEQ ID NO:42; and (7) A forward primer G12R-F comprising SEQ ID NO: 41, and a reverse primer Kras-R comprising SEQ ID NO: 42 and a KRAS probe comprising SEQ ID NO:

45. This is done using.

29. The kit according to any of claims 1 to 11 for use in the diagnosis and treatment of colorectal cancer (CRC) and / or advanced adenoma (AA) in a patient in need thereof, wherein the patient is Asian.

Images