Microbial Compositions Comprising Ellagitannins and Methods of Use

Abstract

Combinations of ellagitannin compositions and enzyme compositions comprising one or more ellagitannin enzymes are provided, where the one or more ellagitannin enzymes include a tannin acyl hydrolase enzyme, a gallic acid decarboxylase enzyme, or a combination thereof. Methods of making and using the combinations disclosed herein are also provided.

Description

[Technical field]

[0001] CROSS-REFERENCE TO RELATED APPLICATIONS This application claims priority to U.S. Provisional Application No. 62 / 909,736, filed October 2, 2019, and U.S. Provisional Application No. 62 / 755,880, filed November 5, 2018, the entire contents of both of which are incorporated herein by reference in their entireties. [Background technology]

[0002] Plant polyphenolic compounds are dietary sources of antioxidants that have been linked to many health benefits, including antioxidant and anticancer activities. Summary of the Invention

[0003] The present disclosure recognizes that metabolites of ellagitannins, including urolithins (e.g., urolithin A, urolithin B, urolithin C, urolithin D, and / or isourolitin A), may be beneficial to, for example, mammalian, e.g., human health. However, it is generally understood in the art that metabolites of ellagitannins have low bioavailability. The present disclosure provides insight that certain microorganisms, e.g., microorganisms expressing one or more ellagitannin enzymes, may be provided in combination with an ellagitannin composition. In particular, the present disclosure provides that the combination of a microorganism expressing one or more ellagitannin enzymes with an ellagitannin composition can enhance the bioavailability of metabolites of ellagitannins, including urolithins (e.g., urolithin A, urolithin B, urolithin C, urolithin D, and / or isourolitin A).

[0004] In some embodiments, the combinations provided herein may include an ellagitannin composition and an enzyme composition, hi some embodiments, the enzyme composition may include one or more ellagitannin enzymes.

[0005] In some embodiments, the one or more ellagitannin enzymes may comprise a tannin acyl hydrolase enzyme, a gallic acid decarboxylase enzyme, or a combination thereof. In some embodiments, the one or more ellagitannin enzymes may comprise a tannin acyl hydrolase enzyme. In some embodiments, the tannin acyl hydrolase enzyme is or comprises a tanB tannase enzyme. In some embodiments, the one or more ellagitannin enzymes may comprise a gallic acid decarboxylase enzyme. In some embodiments, the gallic acid decarboxylase enzyme is or comprises an lpdB gallic acid decarboxylase enzyme. In some embodiments, the gallic acid decarboxylase enzyme is or comprises an lpdC gallic acid decarboxylase enzyme. In some embodiments, the one or more ellagitannin enzymes comprise an lpdB gallic acid decarboxylase enzyme and an lpdC gallic acid decarboxylase enzyme. In some embodiments, the one or more ellagitannin enzymes comprise a tanB tannase enzyme, an lpdB gallate decarboxylase enzyme, and an lpdC gallate decarboxylase enzyme.

[0006] In some embodiments, the enzyme composition comprises an ellagitannin enzyme-synthesizing (EES) microorganism or an extract thereof. In some embodiments, the EES microorganism is found in nature. In some embodiments, the EES microorganism is an engineered EES microorganism. In some embodiments, the engineered EES microorganism comprises a genetic modification compared to an otherwise equivalent reference microorganism such that the engineered EES microorganism produces one or more ellagitannin enzymes at absolute or relative levels that differ from those of the reference microorganism.

[0007] In some embodiments, the EES microorganism is a member of the Lactobacillaceae family. In some embodiments, the member of the Lactobacillaceae family is the species L. plantarum.

[0008] In some embodiments, the EES microorganisms are viable or living, hi some embodiments, the EES microorganisms are freeze-dried.

[0009] In some embodiments, the combination includes a sufficient amount of EES microbes to colonize the microbiota of a subject.

[0010] In some embodiments, the ellagitannin composition comprises a plant extract of pomegranate, strawberry, raspberry, cranberry, blackberry, cloudberry, artic blackberry, muscadine grape, guava, fruits of the Myrtaceae family, walnut, pecan, chestnut, cashew, almond, pistachio, hazelnut, Brazil nut, macadamia red wine aged in oak barrels, muscadine grape juice, pomegranate juice, tea, Cognac, Indian gooseberry, licorice mushroom, or combinations thereof. In some embodiments, the combination comprises an amount of the ellagitannin composition sufficient to induce expression, activity, or both of one or more ellagitannin enzymes in an EES microorganism.

[0011] In some embodiments, the ellagitannin composition and one or more ellagitannin enzymes are present in amounts effective to promote urolithin production in a subject.

[0012] In some embodiments, the combination includes a prebiotic. In some embodiments, the combination includes fructooligosaccharides, inulin, isomaltooligosaccharides, lactilol, lactosucrose, lactulose, soybean oligosaccharides, transgalactooligosaccharides, xylooligosaccharides, or combinations thereof.

[0013] In some embodiments, the ellagitannin composition, the enzyme composition, or both may be formulated for oral administration. In some embodiments, the ellagitannin composition, the enzyme composition, or both may be a food, beverage, feed composition, or dietary supplement. In some embodiments, the ellagitannin composition, the enzyme composition, or both may be a liquid, syrup, tablet, lozenge, gummy, capsule, powder, gel, or film.

[0014] In some embodiments, the combination is formulated for oral administration. In some embodiments, the combination is a food, beverage, feed composition, or dietary supplement. In some embodiments, the combination is a liquid, syrup, tablet, lozenge, gummy, capsule, powder, gel, or film.

[0015] In some embodiments, the combination includes a pharma- ceutically acceptable carrier, hi some embodiments, the combination is an enteric coated formulation.

[0016] The present disclosure provides methods comprising administering to a subject a combination disclosed herein.

[0017] The disclosure provides methods comprising administering to a subject an ellagitannin composition, an enzyme composition comprising one or more ellagitannin enzymes, or a combination disclosed herein, such that the subject receives a combination disclosed herein.

[0018] In some embodiments, the method is a method of reducing the formation of polypeptide aggregates in a cell or tissue. In some embodiments, the method is a method of reducing the amount of polypeptide aggregates in a cell or tissue. In some embodiments, the polypeptide aggregates are aggregates of polypeptides that include a polyQ region (i.e., polyQ aggregates). In some embodiments, the polyQ region includes at least 10, at least 20, at least 30, at least 40, or at least 50 glutamines. In some embodiments, the cell is or comprises a neuron. In some embodiments, the cell is or comprises a central nervous system tissue.

[0019] In some embodiments, the method comprises determining a level of polypeptide aggregate formation in a cell or tissue. In some embodiments, the method comprises comparing the level of polypeptide aggregate formation in a cell or tissue to a reference level of polypeptide aggregate formation in a cell or tissue. In some embodiments, the reference level is determined in a cell or tissue of a subject to which an ellagitannin composition, an enzyme composition comprising one or more ellagitannin enzymes, or a combination disclosed herein has not been administered. In some embodiments, the method comprises determining a level of polypeptide aggregate formation in a cell or tissue prior to administration. In some embodiments, the method comprises determining a level of polypeptide aggregate formation in a cell or tissue after administration. In some embodiments, the method comprises comparing a level of polypeptide aggregate formation in a cell or tissue determined prior to administration to a level of polypeptide aggregate formation in a cell or tissue determined after administration.

[0020] In some embodiments, the method comprises determining the level of polypeptide aggregates in a cell or tissue. In some embodiments, the method comprises comparing the level of polypeptide aggregates in a cell or tissue to a reference level of polypeptide aggregates in a cell or tissue. In some embodiments, the reference level is determined in a cell or tissue of a subject to which an ellagitannin composition, an enzyme composition comprising one or more ellagitannin enzymes, or a combination disclosed herein has not been administered. In some embodiments, the method comprises determining the level of polypeptide aggregates in a cell or tissue prior to administration. In some embodiments, the method comprises determining the level of polypeptide aggregates in a cell or tissue after administration. In some embodiments, the method comprises comparing the level of polypeptide aggregates in a cell or tissue determined prior to administration to the level of polypeptide aggregates in a cell or tissue determined after administration.

[0021] In some embodiments, the method is a method of altering the level of one or more urolithins produced in the gastrointestinal tract of a subject.

[0022] In some embodiments, the methods involve determining the level of one or more urolithins produced in the subject's digestive tract. In some embodiments, the methods involve comparing the level of each of the one or more urolithins produced in the subject's digestive tract to a corresponding reference level.

[0023] In some embodiments, the methods involve determining the level of one or more urolithins produced in the plasma of the subject. In some embodiments, the methods involve comparing the level of one or more urolithins in the plasma of the subject to a reference level. In some embodiments, the reference level is the concentration of urolithins in plasma, e.g., 0.2-20 μM (Espin JC, Larrosa M, Garcia-Conesa MT, Tomas-Barberan F. Biological significance of urolithins, the gut microbial ellagic Acid-derived metabolites: the evidence so far. Evid Based Complement Alternative Medicine, vol. 1, pp. 111-115, 2012, incorporated herein by reference). Med. 2013;2013:270418.doi:10.1155 / 2013 / 270418). In some embodiments, the reference level is a plasma urolithin concentration of at least 0.1 μM, at least 0.2 μM, at least 0.5 μM, at least 1 μM, at least 5 μM, at least 10 μM, or at least 15 μM. In some embodiments, the reference level is a plasma urolithin concentration of at least 0.5 μM, up to 1 μM, up to 5 μM, up to 10 μM, up to 15 μM, up to 20 μM, or up to 25 μM.

[0024] In some embodiments, the reference level is a historical reference level of urolithin, whether in the gut or in plasma, the level of urolithin in the gut of the subject prior to receiving the combination, or the level of urolithin in the gut of a comparable subject not receiving the combination.

[0025] In some embodiments, the method is a method of increasing the amount of urolithin produced in the digestive tract of a subject. In some embodiments, the urolithin is urolithin A (3,8-dihydroxyurolithin), urolithin C (3,8,9 trihydroxyurolithin), isourolitin A (3,9 dihydroxyurolithin) urolithin B (3-hydroxyurolithin), urolithin D (3,4,8,9-tetrahydroxyurolithin), or a combination thereof.

[0026] In some embodiments, the methods comprise determining an indicator of mitochondrial function in the subject. In some embodiments, the methods comprise determining a level of mitophagy in the subject.

[0027] In some embodiments, the method is a method for changing the expression level or activity level of Nrf2 in a cell or tissue of a subject. In some embodiments, the method is a method for increasing the expression level or activity level of Nrf2 in a cell or tissue of a subject.

[0028] In some embodiments, the method comprises determining the expression level or activity level of nuclear respiratory factor-2 (Nrf2) in a cell or tissue of a subject. In some embodiments, the method comprises comparing the expression level or activity level of Nrf2 in a cell or tissue with a reference level. In some embodiments, the reference level is the past expression or activity level of Nrf2, the expression level or activity level of nuclear respiratory factor-2 (Nrf2) in a comparable cell or tissue of the subject before receiving the combination, or the expression level or activity level of nuclear respiratory factor-2 (Nrf2) in a comparable cell or tissue of a comparable subject that has not received the combination. In some embodiments, the method comprises determining the expression level or activity level of a gene regulated by Nrf2 expression in a cell or tissue of a subject.

[0029] In some embodiments, the method comprises determining the level of one or more antioxidants in cells or tissues of a subject.In some embodiments, the cells or tissues of a subject comprise hepatocytes or liver tissues.In some embodiments, the method comprises measuring the indicators of liver health or function in a subject.

[0030] In some embodiments, the method is a method of increasing the bioavailability of an ellagitannin composition to a subject. In some embodiments, the method comprises determining the bioavailability level of an ellagitannin of the ellagitannin composition in the digestive tract of the subject. In some embodiments, the method comprises comparing the bioavailability level of an ellagitannin of the ellagitannin composition in the digestive tract of the subject to a reference level. In some embodiments, the reference level is a historical bioavailability reference level of an ellagitannin, a bioavailability level of an ellagitannin in the digestive tract of the subject prior to receiving the combination, or a bioavailability level of an ellagitannin in the digestive tract of a comparable subject not receiving the combination.

[0031] In some embodiments, the method is a method of treating a condition or disorder associated with mitochondrial dysfunction in a subject.

[0032] In some embodiments, the method is a method of treating a liver condition, disease, or disorder in a subject.

[0033] In some embodiments, a method is for extending the viable shelf life of a probiotic product comprising an EES microorganism, comprising adding an ellagitannin composition to the probiotic product, where the EES microorganism expresses one or more ellagitannin enzymes.

[0034] In some embodiments, the one or more ellagitannin enzymes may comprise a tannin acyl hydrolase enzyme, a gallic acid decarboxylase enzyme, or a combination thereof. In some embodiments, the one or more ellagitannin enzymes may comprise a tannin acyl hydrolase enzyme. In some embodiments, the tannin acyl hydrolase enzyme is or comprises a tanB tannase enzyme. In some embodiments, the one or more ellagitannin enzymes may comprise a gallic acid decarboxylase enzyme. In some embodiments, the gallic acid decarboxylase enzyme is or comprises an lpdB gallic acid decarboxylase enzyme. In some embodiments, the gallic acid decarboxylase enzyme is or comprises an lpdC gallic acid decarboxylase enzyme. In some embodiments, the one or more ellagitannin enzymes comprise an lpdB gallic acid decarboxylase enzyme and an lpdC gallic acid decarboxylase enzyme. In some embodiments, the one or more ellagitannin enzymes comprise a tanB tannase enzyme, an lpdB gallate decarboxylase enzyme, and an lpdC gallate decarboxylase enzyme.

[0035] In some embodiments, the enzyme composition comprises an ellagitannin enzyme-synthesizing (EES) microorganism or an extract thereof. In some embodiments, the EES microorganism is found in nature. In some embodiments, the EES microorganism is an engineered EES microorganism. In some embodiments, the engineered EES microorganism comprises a genetic modification relative to an otherwise equivalent reference microorganism such that the engineered EES microorganism produces one or more ellagitannin enzymes at absolute or relative levels that differ from those of the reference microorganism.

[0036] In some embodiments, the EES microorganism is a member of the Lactobacillaceae family. In some embodiments, the member of the Lactobacillaceae family is the species L. plantarum.

[0037] In some embodiments, the EES microorganisms are viable or living, hi some embodiments, the EES microorganisms are freeze-dried.

[0038] In some embodiments, an engineered EES microorganism contains a genetic modification relative to an otherwise equivalent reference microorganism such that it produces one or more ellagitannin enzymes at absolute or relative levels that differ from those of the reference microorganism.

[0039] In some embodiments, the ellagitannin composition comprises a plant extract of pomegranate, strawberry, raspberry, cranberry, blackberry, cloudberry, artic blackberry, muscadine grape, guava, Myrtaceae fruit, walnut, pecan, chestnut, cashew, almond, pistachio, hazelnut, Brazil nut, macadamia red wine aged in oak barrels, muscadine grape juice, pomegranate juice, tea, cognac, Indian gooseberry, licorice mushroom, or combinations thereof. In some embodiments, the ellagitannin composition comprises a supplement comprising one or more ellagitannins or ellagic acid. In some embodiments, the combination comprises an amount of the ellagitannin composition sufficient to induce expression, activity, or both of one or more ellagitannin enzymes in an EES microorganism.

[0040] In some embodiments, the ellagitannin composition and one or more ellagitannin enzymes are present in amounts effective to promote urolithin production in a subject.

[0041] In some embodiments, the method includes adding a prebiotic. In some embodiments, the prebiotic includes fructooligosaccharides, inulin, isomaltooligosaccharides, lactilol, lactosucrose, lactulose, soybean oligosaccharides, transgalactooligosaccharides, xylooligosaccharides, or combinations thereof.

[0042] In some embodiments, the probiotic composition may be formulated for oral administration. In some embodiments, the probiotic composition may be a food, beverage, feed composition, or dietary supplement. In some embodiments, the ellagitannin composition, the enzyme composition, or both, may be a liquid, syrup, tablet, lozenge, gummy, capsule, powder, gel, or film. In some embodiments, the probiotic composition is an enteric coated formulation.

[0043] The present disclosure provides a probiotic product comprising an EES microorganism expressing one or more ellagitannin enzymes. In some embodiments, the one or more ellagitannin enzymes may comprise a tannin acyl hydrolase enzyme. In some embodiments, the tannin acyl hydrolase enzyme is or comprises a tanB tannase enzyme. In some embodiments, the one or more ellagitannin enzymes may comprise a gallic acid decarboxylase enzyme. In some embodiments, the gallic acid decarboxylase enzyme is or comprises an lpdB gallic acid decarboxylase enzyme. In some embodiments, the gallic acid decarboxylase enzyme is or comprises an lpdC gallic acid decarboxylase enzyme. In some embodiments, the one or more ellagitannin enzymes comprise an lpdB gallic acid decarboxylase enzyme and an lpdC gallic acid decarboxylase enzyme. In some embodiments, the one or more ellagitannin enzymes comprise a tanB tannase enzyme, an lpdB gallate decarboxylase enzyme, and an lpdC gallate decarboxylase enzyme.

[0044] In some embodiments, the EES microorganism is found in nature. In some embodiments, the EES microorganism is an engineered EES microorganism. In some embodiments, the engineered EES microorganism comprises a genetic modification to an otherwise equivalent reference microorganism such that the engineered EES microorganism produces one or more ellagitannin enzymes at absolute or relative levels that differ from those of the reference microorganism.

[0045] In some embodiments, the EES microorganism is a member of the Lactobacillaceae family. In some embodiments, the member of the Lactobacillaceae family is the species L. plantarum.

[0046] In some embodiments, the EES microorganisms are viable or living, hi some embodiments, the EES microorganisms are freeze-dried.

[0047] In some embodiments, an engineered EES microorganism contains genetic modifications relative to an otherwise equivalent reference microorganism such that it produces one or more ellagitannin enzymes at absolute or relative levels that differ from those of the reference microorganism.

[0048] In some embodiments, the probiotic comprises a prebiotic, hi some embodiments, the prebiotic comprises a fructooligosaccharide, an inulin, an isomaltooligosaccharide, a lactilol, a lactosucrose, a lactulose, a soybean oligosaccharide, a transgalactooligosaccharide, a xylooligosaccharide, or a combination thereof.

[0049] In some embodiments, the probiotic product is formulated for oral administration. In some embodiments, the probiotic product is a food, beverage, feed composition, or dietary supplement. In some embodiments, the probiotic product is a liquid, syrup, tablet, lozenge, gummy, capsule, powder, gel, or film.

[0050] In some embodiments, the probiotic product is an enteric coated formulation.

[0051] The disclosure provides a method of producing a probiotic product comprising an EES microorganism, where the EES microorganism expresses one or more ellagitannin enzymes, comprising adding an ellagitannin composition to the probiotic product.

[0052] In some embodiments, the method includes adding a prebiotic. In some embodiments, the prebiotic includes fructooligosaccharides, inulin, isomaltooligosaccharides, lactilol, lactosucrose, lactulose, soybean oligosaccharides, transgalactooligosaccharides, xylooligosaccharides, or combinations thereof.

[0053] The present disclosure provides for the use of the combinations disclosed herein to modulate the levels of urolithins produced in the digestive tract of a subject.

[0054] The present disclosure provides for the use of the combination disclosed herein for regulating mitochondrial function in a subject.

[0055] The present disclosure provides for the use of the combinations disclosed herein to modulate the level of mitophagy in a subject.

[0056] The present disclosure provides the use of the combinations disclosed herein for regulating the expression or activity levels of Nrf2 in a cell or tissue of a subject.

[0057] The present disclosure provides for the use of the combinations disclosed herein to regulate the expression or activity levels of genes regulated by Nrf2 expression in a cell or tissue of a subject.

[0058] The present disclosure provides the use of the combination disclosed herein for adjusting the level of one or more antioxidants in cell or tissue of a subject.In some embodiments, the cell or tissue of a subject comprises hepatocyte or liver tissue.The present disclosure provides the use of the combination disclosed herein for improving liver health or function in a subject.

[0059] The present disclosure provides for the use of the combinations disclosed herein to increase the bioavailability level of ellagitannins in the gastrointestinal tract of a subject.

[0060] These and other aspects included in this disclosure are described in more detail below and in the claims.

[0061] definition The scope of the present invention is defined by the claims appended hereto, and is not limited by the specific embodiments described herein. Those skilled in the art who read this specification will recognize various modifications that are equivalent to such described embodiments or that may otherwise be within the scope of the claims. In general, terms used in this specification follow the meanings understood in the art, unless expressly indicated otherwise. Explicit definitions of certain terms are provided below, and the meanings of these terms and other terms in specific instances throughout this specification will be clear to those skilled in the art from the context.

[0062] The use of ordinal terms such as "first," "second," "third," etc. in the claims to modify claim elements does not, in and of itself, imply any priority, precedence, or order of one claim element relative to another claim element or the chronological order of the order in which method actions are performed, but is used solely as a label to distinguish one claim element with a particular name from another element with the same name (but in which an ordinal term is used) to distinguish between claim elements.

[0063] As used herein, the articles "a" and "an" should be understood to include plural referents unless clearly indicated to the contrary. A claim or specification including "or" between one or more members of a group is deemed to be satisfied if one, more than one, or all of the group members are present, used, or otherwise relevant to a particular product or process, unless otherwise specified to the contrary or if clear from the context. In some embodiments, exactly one member of a group is present, used, or otherwise relevant to a given product or process. In some embodiments, more than one, or all of the group members are present, used, or otherwise relevant to a given product or process. It is to be understood that the present invention encompasses all variations, combinations, and permutations of one or more limitations, elements, clauses, descriptive terms, etc., from one or more of the enumerated claims that are introduced into another claim that relies on the same base claim (or any other claim, if relevant), unless otherwise indicated in the paragraph or where it is clear to one of ordinary skill in the art that a contradiction or inconsistency would result. When elements are presented as a list (e.g., in a Markush group or similar format), it is understood that each subgroup of elements is also disclosed, and any element(s) can be removed from the group. In general, when an embodiment or aspect is referred to as "comprising" certain elements, features, it should be understood that the particular embodiment or aspect "consists of" or "consists essentially of" such particular elements, features, etc. For the sake of brevity, these embodiments will not be specifically described in so many words in all cases herein. It is also understood that any embodiment or aspect can be explicitly excluded from the claims, regardless of whether a specific exclusion is described in the specification.

[0064] Administration: As used herein, the term "administration" typically refers to administration of a composition to a subject or system to achieve delivery of the agent to the subject or system. In some embodiments, the agent is a composition or is included in a composition, and in some embodiments, the agent is produced through metabolism of the composition or one or more components thereof. Those skilled in the art will be aware of the various routes that may be utilized for administration to a subject, e.g., a human, in the appropriate circumstances. For example, in some embodiments, administration may be ocular, oral, parenteral, topical, etc. In some particular embodiments, administration may be bronchial (e.g., by bronchial instillation), buccal, transdermal (e.g., may be or include one or more of topical to the dermis, intradermal, interdermal, transdermal, etc.), intestinal, intra-arterial, intradermal, intragastric, intramedullary, intramuscular, intranasal, intraperitoneal, intrathecal, intravenous, intraventricular, in a particular organ (e.g., in the liver), mucosal, intranasal, oral, rectal, subcutaneous, sublingual, topical, tracheal (e.g., by intratracheal instillation), intravaginal, intravitreal, etc. In many embodiments provided by the present disclosure, administration is oral administration. In some embodiments, administration may include only a single administration. In some embodiments, administration may include the application of a certain number of doses. In some embodiments, administration may include administration that is intermittent (e.g., multiple doses separated in time) and / or periodic (e.g., individual doses separated by a common period of time) administration. In some embodiments, administration may include continuous dosing (e.g., perfusion) for at least a selected period of time. Administration of cells may be by any suitable route that results in delivery to a desired location in a subject where at least a portion of the delivered cells or components of the cells remain viable. The survival period of the cells after administration to a subject may be short-term, such as a few hours, e.g., 24 hours to days, to as long as years, i.e., long-term engraftment. In some embodiments, administration includes delivery of a bacterial extract or preparation that contains one or more bacterial metabolic products and / or by-products, but is completely devoid of viable bacterial cells.

[0065] Analog: As used herein, the term "analog" refers to a substance that shares one or more specific structural features, elements, components, or moieties with a reference substance. Typically, an "analog" exhibits significant structural similarity with a reference substance, e.g., sharing a core or consensus structure, but also differs in certain individual ways. In some embodiments, an analog is a substance that can be generated from a reference substance, e.g., by chemical manipulation of the reference substance. In some embodiments, an analog is a substance that can be generated through the execution of a synthetic process that is substantially similar (e.g., shares multiple steps) to that which generates the reference substance. In some embodiments, an analog is generated or can be generated through the execution of a synthetic process that is different from that used to generate the reference substance.

[0066] Approximately: When applied to one or more values ​​of interest, includes values ​​similar to a stated reference value. In certain embodiments, the term "approximately" or "about" refers to a range of values ​​that is within ±10% (greater or less) of a stated reference value, unless otherwise stated or clear from the context (except where such number exceeds 100% of possible values).

[0067] Bioavailability of ellagitannins: As used herein, the term "bioavailability of ellagitannins" refers to the amount of ellagitannin or its hydrolysis products absorbed from an ellagitannin composition into the systemic circulation. The amount of ellagitannin can be determined by measuring the amount of ellagitannin hydrolysis products present in a blood, plasma, or urine sample. In addition, bioavailable ellagitannins can be metabolized to urolithins, for example, in a subject. In this manner, the bioavailability of an ellagitannin can be indirectly determined by assessing the amount of urolithins in the systemic circulation (e.g., blood, plasma, etc.) or excreted by the kidneys (e.g., urine). Thus, a change (e.g., increase) in the bioavailability of a given ellagitannin composition can be determined by assessing the level of urolithins in the presence of an ellagitannin composition or combination described herein. In some embodiments, the level of urolithins can be compared, for example, to the level of the subject before the start of treatment with the composition.

[0068] Equivalent: As used herein, the term "equivalent" refers to two or more agents, entities, situations, sets of conditions, subjects, etc. that may not be identical to each other, but are similar enough to allow a comparison between them where a person skilled in the art would understand that a conclusion can be reasonably drawn based on the observed differences or similarities. In some embodiments, a comparable set of conditions, situations, individuals, or populations is characterized by a number of substantially identical characteristics and one or a few different characteristics. A person skilled in the art will understand what degree of identity is required in any given situation for two or more such agents, entities, situations, sets of conditions, etc. to be considered equivalent in context. For example, a person skilled in the art will understand that a set of situations, individuals, or populations are comparable to each other when they are characterized by a sufficient number and type of substantially identical characteristics to warrant a reasonable conclusion that differences in results obtained or phenomena observed under or with different sets of situations, individuals, or populations are caused by or indicate variations in those characteristics.

[0069] Conservative: As used herein, refers to examples of describing conservative amino acid substitutions, including the replacement of an amino acid residue with another amino acid residue having a side chain R group with similar chemical properties (e.g., charge or hydrophobicity). In general, a conservative amino acid substitution will not substantially change the functional property of interest for a protein, e.g., the ability of a receptor to bind a ligand. Examples of groups of amino acids having side chains with similar chemical properties include aliphatic side chains, such as glycine (Gly, G), alanine (Ala, A), valine (Val, V), leucine (Leu, L), and isoleucine (Ile, I); aliphatic hydroxyl side chains, such as serine (Ser, S) and threonine (Thr, T); amide-containing side chains, such as asparagine (Asn, N) and glutamine (Gln, Q); aromatic side chains, such as phenylalanine (Phe, F), tyrosine (Tyr, Y), and tryptophan (Trp, W); basic side chains, such as lysine (Lys, K), arginine (Arg, R), and histidine (His, H); acidic side chains, such as aspartic acid (Asp, D) and glutamic acid (Glu, E); and sulfur-containing side chains, such as cysteine ​​(Cys, C) and methionine (Met, M). Conservative amino acid substitutions include, for example, valine / leucine / isoleucine (Val / Leu / Ile, V / L / I), phenylalanine / tyrosine (Phe / Tyr, F / Y), lysine / arginine (Lys / Arg, K / R), alanine / valine (Ala / Val, A / V), glutamic acid / aspartic acid (Glu / Asp, E / D), and asparagine / glutamine (Asn / Gln, N / Q). In some embodiments, a conservative amino acid substitution can be the substitution of any naturally occurring residue in a protein with alanine, for example, as used in alanine scanning mutagenesis. In some embodiments, conservative substitutions are made that have a positive value in the PAM250 log-likelihood matrix disclosed in Gonnet, GH et al., 1992, Science 256:1443-1445, which is incorporated herein by reference in its entirety. In some embodiments, the substitutions are moderately conservative substitutions, where the substitutions have non-negative values ​​in the PAM250 log-likelihood matrix.

[0070] [Table 1] [Table 2]

[0071] Control: As used herein, refers to the art-understood meaning of "control," a standard against which results are compared. Typically, controls are used to strengthen the consistency of an experiment by isolating a variable in order to draw conclusions about such a variable. In some embodiments, a control is a reaction or assay that is performed simultaneously with a test reaction or assay to provide a comparison. "Control" also includes "control animals." A "control animal" may have a modification as described herein, a different modification than described herein, or no modification (i.e., a wild-type animal). In one experiment, the "test" (i.e., the variable being tested) is applied. In a second experiment, the "control" does not have the variable being tested applied. In some embodiments, a control is a historical control (i.e., a test or assay previously performed, or a previously known amount or result). In some embodiments, a control is or includes a printed or otherwise stored record. A control can be a positive or negative control.

[0072] Determining, measuring, evaluating, assessing, assaying, analyzing and analysis: Determining, measuring, evaluating, assessing, assaying and analyzing are used interchangeably herein to refer to any form of measurement, including determining whether an element is present. These terms include both quantitative and / or qualitative determinations. Assays can be relative or absolute. "Assaying for the presence of" can be determining the amount of something present and / or determining whether it is present or absent.

[0073] Dosage form: Those skilled in the art will understand that the term "dosage form" may be used to refer to a physically discrete unit of an agent (e.g., a therapeutic agent) for administration to a subject. Typically, each such unit contains a predetermined amount of the agent. In some embodiments, such amount is a unit dosage (or a whole fraction thereof) appropriate for administration according to a dosing regimen determined to correlate with a desired or beneficial outcome when administered to a relevant population (i.e., a therapeutic dosing regimen). Those skilled in the art will understand that the total amount of a therapeutic composition or agent to be administered to a particular subject is determined by one or more attending physicians and may include administration of multiple dosage forms.

[0074] Dosing regimen: Those skilled in the art will understand that the term "dosing regimen" can be used to refer to a series of unit doses (usually multiple) administered individually to a subject, usually separated by a period of time. In some embodiments, a given drug has a recommended dosing regimen, which may include one or more doses. In some embodiments, the dosing regimen includes multiple doses, each separated in time from the other doses. In some embodiments, the individual doses are separated from each other by periods of equal length, and in some embodiments, the dosing regimen includes multiple doses and at least two different periods separating the individual doses. In some embodiments, all doses within the dosing regimen are the same unit dose amount. In some embodiments, the different doses within the dosing regimen are different amounts. In some embodiments, the dosing regimen includes a first dose at a first dose amount, followed by one or more additional doses at a second dose amount different from the first dose amount. In some embodiments, the dosing regimen correlates with a desired or beneficial outcome when administered across a relevant population.

[0075] Ellagitannins-enriched: As used herein, the term "ellagitannin-enriched" refers to a material resulting from processing one or more plant materials in which the proportion of one or more ellagitannins is increased relative to the proportion of one or more ellagitannins in the plant material(s) prior to processing. Enrichment can be, for example, at least 2-fold, at least 5-fold, at least 10-fold, at least 20-fold, or more.

[0076] Ellagitannin composition: As used herein, "ellagitannin composition" refers to a composition comprising one or more ellagitannin compounds. In some embodiments, the ellagitannin composition refers to an ellagitannin-rich material. In some embodiments, the ellagitannin composition comprises a pome extract. In some embodiments, the ellagitannin composition is produced by processing one or more plant materials comprising one or more ellagitannin compounds produced by one or more plants. In some embodiments, the ellagitannin composition comprises a juice of a fruit that produces ellagitannin compounds, a homogenate of a fruit or other material (e.g., skin, peel, husk, etc.) of a plant that produces ellagitannin compounds, an extract of material from a plant that produces ellagitannin compounds, or an ellagitannin-enriched fraction of a juice, a homogenate or extract of a plant that produces ellagitannin compounds. In some embodiments, the ellagitannin composition comprises a supplement comprising one or more ellagitannins or ellagic acid.

[0077] Ellagitannins Compounds: As used herein, "ellagitannin compounds" refers to compounds that are members of a diverse class of polyphenols, and their structural analogs. In nature, ellagitannins are hydrolyzed to ellagic acid, which is metabolized to produce a diverse range of urolithins. Ellagitannins include a diverse class of complex hydrolyzable plant tannin polyphenols composed of a hexahydroxydiphenoyl moiety esterified to a sugar, i.e., hexahydroxydiphenoyl-glucose ester, which are found in, for example, strawberries (Fragaria vesca), raspberries, blackberries, cloudberries (Rubus chamaemorus), jabuticaba, kambuchi, Suriname cherry, camu camu, red guava, white guava, pomegranate, walnut, pecan, licorice mushroom (Fistulina hepatica), and cranberries. Other ellagitannins include, for example, pedunculagin, rosacyanin, philanembrinin, and sanguinin H6.

[0078] Ellagitannin Enzymes: As used herein, "ellagitannin enzymes" refers to enzymes involved in the metabolism of ellagitannins to urolithins. Ellagitannin enzymes include, but are not limited to, tannin acyl hydrolase enzymes (e.g., tanB tannase enzymes), and gallate decarboxylase enzymes (e.g., lpdB gallate decarboxylase enzymes, lpdC gallate decarboxylase enzymes).

[0079] Ellagitannin enzyme-synthesizing microorganism: As used herein, the phrase "ellagitannin enzyme-synthesizing microorganism" or "EES microorganism" refers to a microorganism (e.g., algae, fungi, bacteria) that expresses one or more ellagitannin enzymes. In some embodiments, an EES microorganism may naturally express one or more ellagitannin enzymes. In some embodiments, an EES microorganism includes an ellagitannin enzyme modification. In some embodiments, an EES microorganism may be genetically modified (e.g., has one or more genetic modifications) such that it expresses one or more ellagitannin enzymes at a different absolute or relative level than an otherwise comparable reference microorganism that has not been so genetically modified (i.e., does not include the genetic modification(s)). For example, in some embodiments, an EES microorganism has been genetically engineered to express one or more ellagitannin enzymes that are not expressed by the microorganism if not genetically engineered. Alternatively, in some embodiments, an EES microorganism may be genetically engineered such that expression of one or more ellagitannin enzymes can be at a higher level compared to the microorganism without the genetic modification. In some embodiments, the higher level may be assessed with reference to a threshold level, and in some embodiments, the higher level may be assessed with reference to another compound (e.g., another ellagitannin enzyme) that is also produced by the microorganism (prior to the genetic engineering). In some particular embodiments, the EES microorganism may have been genetically modified to add or increase expression of one or more genes encoding one or more ellagitannin enzymes.

[0080] Ellagitannin enzyme modification: As used herein, the term "ellagitannin enzyme modification" refers to a modification of a microorganism that modulates the production of one or more ellagitannin enzymes, as described herein. For example, an ellagitannin enzyme modification may increase the production level of one or more ellagitannin enzymes and / or change the relative production levels of different ellagitannin enzymes. In principle, an ellagitannin enzyme modification can be any chemical, physiological, genetic, or other modification that appropriately alters the production of one or more ellagitannin enzymes produced by a microorganism compared to the levels produced in an otherwise identical microorganism that has not received the same modification. However, in most embodiments, an ellagitannin enzyme modification includes a genetic modification, typically resulting in increased production of one or more selected ellagitannin enzymes. In some embodiments, the ellagitannin enzyme includes a tannin acyl hydrolase enzyme (e.g., a tanB tannase enzyme), a gallic acid decarboxylase enzyme (e.g., an lpdB gallic acid decarboxylase enzyme, an lpdC gallic acid decarboxylase enzyme), or a combination thereof.

[0081] Engineered: In general, the term "engineered" refers to the aspect of being manipulated by the hand of man. For example, a cell or organism is considered "engineered" if it has been manipulated such that its genetic information has been altered (e.g., by transformation, mating, somatic cell hybridization, transfection, transduction, or other mechanisms, or previously existing genetic material has been altered or removed, e.g., by substitution or deletion mutations, or by mating protocols, where new genetic material not previously present has been introduced, or previously existing genetic material has been altered or removed, etc.). As is common practice and understood by those of skill in the art, the progeny of an engineered polynucleotide or cell is typically still referred to as "engineered," even though actual manipulation was performed on the previous entity.

[0082] Excipient: as used herein, refers to an inert (e.g., non-therapeutic) agent that can be included in a pharmaceutical composition, for example, to provide or contribute a desired consistency or stabilizing effect. In some embodiments, suitable pharmaceutical excipients can include, for example, starch, glucose, lactose, sucrose, gelatin, malt, rice, flour, chalk, silica gel, sodium stearate, glycerol monostearate, talc, sodium chloride, dried skim milk, glycerol, propylene, glycol, water, ethanol, etc.

[0083] Functional: As used herein, a "functional" biomolecule is a biomolecule in a form in which it exhibits a property and / or activity by which it is characterized. A biomolecule can have two functions (i.e., bifunctional) or many functions (i.e., multifunctional).

[0084] Gene: as used herein refers to a DNA sequence in a chromosome that codes for a product (e.g., an RNA product and / or a polypeptide product). In some embodiments, a gene includes coding sequences (i.e., sequences that code for a particular product). In some embodiments, a gene includes non-coding sequences. In some specific embodiments, a gene may include both coding (e.g., exonic) and non-coding (e.g., intronic) sequences. In some embodiments, a gene may include one or more regulatory sequences (e.g., promoters, enhancers, etc.) and / or intronic sequences that may, for example, control or affect one or more aspects of gene expression (e.g., cell type specific expression, inducible expression, etc.). For clarity, as used in this disclosure, the term "gene" generally refers to a portion of a nucleic acid that codes for a polypeptide or a fragment thereof, and it should be noted that the term may optionally encompass regulatory sequences, as will be apparent to one of skill in the art from the context. This definition is not intended to exclude the application of the term "gene" to non-protein-coding expression units, but rather to clarify that in many cases, the term as used in this document refers to a nucleic acid that codes for a polypeptide.

[0085] Improve, increase, enhance, inhibit, or reduce: As used herein, the terms "improve," "increase," "enhance," "inhibit," "reduce," or their grammatical equivalents refer to a value relative to a baseline or other reference measurement. In some embodiments, the value is statistically significantly different from the baseline or other reference measurement. In some embodiments, a suitable reference measurement may be or include a measurement in a particular system (e.g., a single individual) under otherwise comparable conditions in the absence (e.g., before and / or after) of a particular agent or treatment, or in the presence of a suitable comparable reference agent. In some embodiments, a suitable reference measurement may be or include a measurement in a comparable system known or expected to respond in a particular way in the presence of the relevant agent or treatment. In some embodiments, a suitable reference is a negative reference, and in some embodiments, a suitable reference is a positive reference.

[0086] Isolated: As used herein, refers to a substance and / or entity that is (1) separated from at least some of the components with which it was originally produced (whether in natural and / or experimental environments) and / or (2) designed, created, prepared, and / or manufactured by the hand of man. In some embodiments, an isolated substance or entity may be enriched, and in some embodiments, an isolated substance or entity may be pure. In some embodiments, an isolated substance and / or entity is separated from about 10%, about 20%, about 30%, about 40%, about 50%, about 60%, about 70%, about 80%, about 90%, about 91%, about 92%, about 93%, about 94%, about 95%, about 96%, about 97%, about 98%, about 99%, or more than about 99% of the other components with which it was originally produced. In some embodiments, an isolated agent is about 80%, about 85%, about 90%, about 91%, about 92%, about 93%, about 94%, about 95%, about 96%, about 97%, about 98%, about 99%, or about 99% or more pure. As used herein, a substance is "pure" if it is substantially free of other components. In some embodiments, as will be understood by those skilled in the art, a substance may still be considered "enriched," "isolated" or even "pure" after being combined with certain other components, such as, for example, one or more carriers or excipients (e.g., buffers, solvents, water, etc.), and in such embodiments, the percent isolation or purity of the substance is calculated without including such carriers or excipients. Those skilled in the art are aware of various techniques for isolating (e.g., enriching or purifying) a substance or agent (e.g., using one or more of fractionation, extraction, precipitation, or other separation).

[0087] Pharmaceutical composition: As used herein, the term "pharmaceutical composition" refers to a composition in which an active agent is formulated together with one or more pharma- ceutical acceptable carriers. In some embodiments, the active agent is present in a unit dose amount suitable for administration in a treatment regimen that exhibits a statistically significant probability of achieving a predetermined therapeutic effect when administered to a relevant population. In some embodiments, the pharmaceutical composition may be specially formulated for administration in solid or liquid form, including those adapted for oral administration, such as drenches (aqueous or non-aqueous solutions or suspensions), tablets, e.g., buccal, sublingual, and those targeted for systemic absorption, boluses, powders, granules, pastes for application to the tongue, capsules, powders, and the like. In some embodiments, the active agent may be or include a cell or a population of cells (e.g., a culture, e.g., an EES microorganism), and in some embodiments, the active agent may be or include an extract or component of a cell or a population of cells (e.g., a culture). In some embodiments, the active agent may be or include an isolated, purified, or pure compound. In some embodiments, the active agent may be synthesized in vitro (e.g., via chemical and / or enzymatic synthesis). In some embodiments, the active agent may be or include a natural product (isolated from a natural source or synthesized in vitro).

[0088] Pharmaceutically acceptable: As used herein, the term "pharmaceutical acceptable," which may be used in reference to a carrier, diluent, or excipient used, for example, to formulate a pharmaceutical composition disclosed herein, means the carrier, diluent, or excipient is compatible with the other ingredients of the composition and not deleterious to the recipient thereof.

[0089] Pharmaceutically acceptable carrier: As used herein, the term "pharmacologically acceptable carrier" means a pharma- ceutically acceptable material, composition, or vehicle, such as a liquid or solid filler, diluent, excipient, or solvent encapsulating material, that is involved in the carrying or transport of a compound of interest from one organ or part of the body to another. Each carrier must be "acceptable" in the sense of being compatible with the other ingredients of the formulation and not deleterious to the subject. Some examples of materials which can serve as pharma- ceutically acceptable carriers include: sugars such as lactose, glucose, and sucrose; starches such as corn starch and potato starch; celluloses and their derivatives, such as sodium carboxymethylcellulose, ethylcellulose, cellulose acetate; powdered tragacanth; malt; gelatin; talc; excipients such as cocoa butter and suppository wax; oils such as peanut oil, cottonseed oil, safflower oil, sesame oil, olive oil, corn oil, and soybean oil; glycols such as propylene glycol; polyols such as glycerin, sorbitol, mannitol, polyethylene glycol; esters such as ethyl oleate and ethyl laurate; agar; buffers such as magnesium hydroxide and aluminum hydroxide; alginic acid; pyrogen-free water; isotonic saline; Ringer's solution; ethyl alcohol; pH buffer solutions; polyesters, polycarbonates, and / or polyanhydrides; and other non-toxic compatible substances used in pharmaceutical formulations.

[0090] Prebiotic: As used herein, "prebiotic" refers to components that enable or promote certain changes in both the composition and / or activity of the gastrointestinal flora that benefit (or not) the host. In some embodiments, the prebiotic may include one or more of the following: Prebiotics include pome fruit extract, berry extract, and walnut extract.

[0091] Prevention: As used herein, the term "prevention" refers to a delay in the onset and / or a reduction in the frequency and / or severity of one or more symptoms of a particular disease, disorder or condition. In some embodiments, prevention is assessed on a population basis such that an agent is considered to "prevent" a particular disease, disorder or condition if a statistically significant reduction in the onset, frequency, and / or intensity of one or more of the disease, disorder, or symptoms is observed in a population susceptible to the disease, disorder, or condition. In some embodiments, prevention may be considered complete, for example, if the onset of the disease, disorder, or condition is delayed for a predetermined period of time.

[0092] Reference: as used herein describes a standard or control against which a comparison is made. For example, in some embodiments, a subject agent, animal, individual, population, sample, sequence or value is compared to a reference or control agent, animal, individual, population, sample, sequence or value. In some embodiments, the reference or control is tested and / or determined substantially simultaneously with the subject testing or determination. In some embodiments, the reference or control is a historical reference or control, optionally embodied in a tangible medium. Typically, as understood by those of skill in the art, a reference or control is determined or characterized under conditions or circumstances equivalent to those being evaluated. Those of skill in the art will understand when there is sufficient similarity to justify reliance on and / or comparison to a particular possible reference or control. In some embodiments, the reference is a negative control reference, and in some embodiments, the reference is a positive control reference.

[0093] Risk: As understood from the context, "risk" of a disease, disorder, and / or condition refers to the likelihood that a particular individual will develop the disease, disorder, and / or condition. In some embodiments, the risk is expressed as a percentage. In some embodiments, the risk is 0, 1, 2, 3, 4, 5, 6, 7, 8, 9, 10, 20, 30, 40, 50, 60, 70, 80, 90 to 100%. In some embodiments, the risk is expressed as a risk compared to a risk associated with a reference sample or a group of reference samples. In some embodiments, the reference sample or the group of reference samples has a known risk of the disease, disorder, condition, and / or event. In some embodiments, the reference sample or the group of reference samples is from an individual comparable to the particular individual. In some embodiments, the relative risk is 0, 1, 2, 3, 4, 5, 6, 7, 8, 9, 10, or more.

[0094] Sample: As used herein, the term "sample" generally refers to an aliquot of material obtained or derived from a source of interest. In some embodiments, the source of interest is a biological or environmental source. In some embodiments, the source of interest can be or include a cell or organism, such as a microorganism, a plant, or an animal (e.g., human). In some embodiments, the source of interest is or includes a biological tissue or fluid. In some embodiments, the biological tissue or fluid can be or include amniotic fluid, aqueous fluid, ascites, bile, bone marrow, blood, milk, cerebrospinal fluid, earwax, chyle, chime, semen, endolymph, exudate, feces, gastric acid, gastric juice, lymph, mucus, pericardial fluid, lymph, ascites, pleural fluid, pus, rheum, saliva, serum, semen, serum, smegma, saliva, synovial fluid, sweat, tears, urine, vaginal secretions, vitreous humor, vomit, and / or a combination or component(s) thereof. In some embodiments, the biological fluid may be or include intracellular fluid, extracellular fluid, intravascular fluid (plasma), interstitial fluid, lymphatic fluid, and / or permeabilization fluid. In some embodiments, the biological fluid may be or include phytoexudates. In some embodiments, the biological tissue or sample may be obtained, for example, by aspiration, biopsy (e.g., fine needle or tissue biopsy), swab (e.g., oral, nasal, skin, or vaginal swab), scraping, surgery, lavage, or irrigation (e.g., bronchoalveolar, ductal, nasal, ocular, oral, uterine, vaginal, or other lavage or irrigation). In some embodiments, the biological sample is or includes cells obtained from an individual. In some embodiments, the sample is a "primary sample" obtained directly from the source of interest by any suitable means. In some embodiments, as is clear from the context, the term "sample" refers to a preparation obtained by processing the primary sample (e.g., by removing one or more components and / or adding one or more agents), for example, by filtering using a semipermeable membrane.Such a "processed sample" may include, for example, nucleic acids or proteins extracted from a sample or obtained by subjecting a primary sample to one or more techniques, such as amplification or reverse transcription of nucleic acids, isolation and / or purification of specific components, etc.

[0095] Shelf life: As used herein, the term "shelf life" or "viable shelf life" refers to the amount of time (expressed in days, months, or years) that a given composition contains an amount of viable microorganisms (e.g., bacteria) that exceeds the minimum threshold required to produce a biological effect in a subject or group of subjects. Viability can be assessed, for example, by determining the ratio of live:dead cells in the composition at a given time using a suitable culture assay. In other embodiments, viability can be assessed functionally using a cell-based assay to measure the rate and / or maximum amount of hydrolysis of ellagitannins by cells in the composition, formulation, or preparation. As will be understood by one of skill in the art, the viability of a given composition is compared to an appropriate reference, such as the viability of the composition on the day it was packaged or the threshold rate / maximum amount of hydrolysis of ellagitannins desired in the composition. As used herein, the term "increased Savings "Shelf life" or "Increased viable shelf life" teeth, It refers to an increase in shelf life of an ellagitannin composition (or composition or combination comprising an ellagitannin composition) of at least one day compared to a comparable composition. In other embodiments, increased shelf life refers to an increase of at least 2 days, at least 5 days, at least 7 days, at least 10 days, at least 2 weeks, at least 3 weeks, at least 4 weeks, at least 1 month, at least 2 months, at least 3 months, at least 4 months, at least 5 months, at least 6 months, at least 7 months, at least 8 months, at least 9 months, at least 10 months, at least 11 months, at least 12 months or more in an ellagitannin composition (or composition or combination comprising an ellagitannin composition) compared to a comparable composition. In some embodiments, the comparable composition lacks ellagitannins.

[0096] Small molecule: As used herein, the term "small molecule" refers to a small organic or inorganic molecule with a molecular weight of less than about 3000 Daltons. In general, the molecular weight of a small molecule may be less than about 3000 Daltons (Da). A small molecule may be, for example, at least about 100 Da to about 3000 Da (e.g., about 100 to about 3000 Da, about 100 to about 2500 Da, about 100 to about 2000 Da, about 100 to about 1,750 Da, about 100 to about 1,500 Da, about 100 to about 1,250 Da, about 100 to about 1,000 Da, about 100 to about 750 Da, about 100 to about 500 Da, about 200 to about 1500, about 500 to about 1000, about 300 to about 1000 Da, or about 100 to about 250 Da).

[0097] Subject: As used herein, the term "subject" refers to an individual to whom the provided treatment is administered. In some embodiments, the subject is an animal. In some embodiments, the subject is a mammal, for example, a mammal experiencing or susceptible to a disease, disorder, or condition described herein. In some embodiments, the animal is a vertebrate, for example, a mammal such as a non-human primate (especially a higher primate), sheep, dog, rodent (e.g., mouse or rat), guinea pig, goat, pig, cat, rabbit, or cow. In some embodiments, the animal is a non-mammal, such as a chicken, an amphibian, a reptile, or an invertebrate model C. elegans. In some embodiments, the subject is a human. In some embodiments, the patient is suffering from or susceptible to one or more diseases, disorders, or conditions as described herein. In some embodiments, the patient exhibits one or more symptoms of one or more diseases, disorders, or conditions as described herein. In some embodiments, the patient has been diagnosed with one or more diseases, disorders, or conditions as described herein. In some embodiments, the subject has undergone or is undergoing a particular therapy to diagnose and / or treat a disease, disorder, or condition, hi another embodiment, the subject is an experimental animal or animal surrogate as a disease model.

[0098] Substantially: As used herein, refers to a qualitative condition indicating the entire or nearly entire extent or degree of a characteristic or property of interest. Those skilled in the art of biology will understand that biological and chemical phenomena rarely, if ever, proceed perfectly and / or reach perfection or achieve or avoid absolute results. Thus, the term "substantially" is used herein to capture the potential lack of completeness inherent in many biological and chemical phenomena.

[0099] Symptoms are reduced: According to the present invention, a "symptom is reduced" when the magnitude (e.g., intensity, severity, etc.) and / or frequency of one or more symptoms of a particular disease, disorder, or condition is reduced. For clarity, delaying the onset of a particular symptom is considered a form of reducing the frequency of that symptom.

[0100] Therapeutic regimen: "Therapeutic regimen," as that term is used herein, refers to a dosing regimen, the administration of which across a relevant population can be correlated with a desired or beneficial therapeutic outcome.

[0101] Therapeutically effective amount: as used herein, refers to an amount that produces a desired effect in a subject to which it is administered. In some embodiments, the term refers to an amount sufficient to treat a disease, disorder, and / or condition when administered to a population suffering from or susceptible to the disease, disorder, and / or condition according to a therapeutic dosing regimen. In some embodiments, a therapeutically effective amount is an amount that reduces the incidence and / or severity and / or delays the onset of one or more symptoms of a disease, disorder, and / or condition. It has been reported that the term "therapeutically effective amount" does not in fact require that successful treatment be achieved in a particular subject. Rather, a therapeutically effective amount may be an amount that provides a particular desired pharmacological response in a significant number of subjects when administered to a subject in need of such treatment. In some embodiments, reference to a therapeutically effective amount is a reference to an amount measured in one or more particular tissues (e.g., tissues affected by a disease, disorder, or condition) or bodily fluids (e.g., blood, saliva, serum, sweat, tears, urine, etc.). In some embodiments, it has been reported that a therapeutically effective amount of a particular agent or therapy may be formulated and / or administered in a single dose. In some embodiments, therapeutically effective agents may be formulated and / or administered in multiple doses, for example, as part of a dosing regimen.

[0102] Treatment: As used herein, the term "treatment" (or "treat" or "treating") refers to the application of any treatment that partially or completely palliates, improves, reverses, inhibits, delays the onset of, reduces the severity of, and / or reduces the incidence of one or more symptoms, characteristics, and / or causes of a particular disease, disorder, and / or condition. In some embodiments, such treatment may be of subjects who do not show signs of the associated disease, disorder, and / or condition, and / or who show only early signs of the disease, disorder, and / or condition. Alternatively, or in addition, such treatment may be of subjects who show one or more established signs of the associated disease, disorder, and / or condition. In some embodiments, treatment may be of subjects who have been diagnosed as suffering from the associated disease, disorder, and / or condition. In some embodiments, treatment may be of subjects who are known to have one or more susceptibility factors that are statistically correlated with an increased risk of developing the associated disease, disorder, and / or condition. [Brief description of the drawings]

[0103] [Figure 1]Figure 1 shows the induction level of gst-4 expression using reporter CL2166 dvIs19[pAF15(gst-4::gfp-nls)]III in Caenorhabditis elegans using qualitative visual screening. Panel (a) shows the induction level of gst-4 expression from reporter CL2166 dvIs19[pAF15(gst-4::gfp-nls)]III in C. elegans fed negative control bacteria and not pome fruit extract. Panel (b) shows the induction level of gst-4 expression from reporter CL2166 dvIs19[pAF15(gst-4::gfp-nls)]III in C. elegans fed negative control bacteria and pome fruit extract. Panel (c) shows the induction level of gst-4 expression from the reporter CL2166 dvIs19[pAF15(gst-4::gfp-nls)]III in C. elegans fed with Lactobacillus plantarum (MBT501) and not fed with pome fruit extract, and panel (d) shows the induction level of gst-4 expression from the reporter CL2166 dvIs19[pAF15(gst-4::gfp-nls)]III in C. elegans fed with Lactobacillus plantarum (MBT501) and pome fruit extract. [Diagram 2] Panel (A) of Figure 2 includes a schematic diagram of the cluster of genes involved in ellagitannin metabolism, and panel (B) of Figure 2 includes bar graphs showing normalized expression levels from the C. elegans tannase (tanB), gallate decarboxylase (lpdB), and gallate decarboxylase (lpdC) genes in the negative control bacteria with (gray bars) and without (black bars) pome fruit extract. [Diagram 3] Panel (A) of Figure 3 includes a bar graph showing colony forming units of L. plantarum (MBT501) alone (black bars) or with pome fruit extract (gray bars) at 0, 2, and 4 weeks. Panel (B) of Figure 3 shows colony forming units of L. plantarum (MBT501) alone (black bars) or with pome fruit extract (gray bars) at 0, 2, and 4 weeks. [Figure 4]Panel (A) of Figure 4 includes a bar graph showing the induction level of Nrf2 expression using the reporter Nrf2:luciferase in a human hepatic cell line (HepG) treated with L. plantarum (MBT501) alone, pome fruit extract alone, or L. plantarum (MBT501) and pome fruit extract. Panel (B) of Figure 4 includes a Western blot showing Nrf2 protein levels in a human hepatic cell line (HepG) treated with L. plantarum (MBT501) alone, pome fruit extract alone, or L. plantarum (MBT501) and pome fruit extract. [Diagram 5] Included are line graphs showing the number of polyQ aggregates formed using the reporter rmls133(unc_54p::Q40::YFP) in negative control bacteria, L. plantarum (MBT501) fed with pome fruit extract, L. plantarum (MBT501) fed with pome fruit extract, and C. elegans fed with pome fruit extract. Aggregates were determined using a qualitative visual screen. DETAILED DESCRIPTION OF THE PREFERRED EMBODIMENTS

[0104] The present disclosure recognizes that ellagitannin metabolites have biological properties, including potentially beneficial biological activities. For example, urolithins resulting from ellagitannin metabolism (e.g., urolithin A, urolithin B, urolithin C, urolithin D, and / or isourolithin A) may improve mitochondrial function, for example, by increasing mitophagy (e.g., mitochondrial recycling by autophagy) (among other things). Although ellagitannin metabolites (e.g., urolithins) can affect biological activity, such metabolites have been reported to have low bioavailability. Thus, there is a need in the art for approaches that can increase the bioavailability of ellagitannin metabolites.

[0105] The present disclosure provides insight that enzyme compositions comprising one or more ellagitannin enzymes (e.g., tannin acyl hydrolase enzymes, gallic acid decarboxylase enzymes, or combinations thereof) can be utilized to enhance the bioavailability of urolithins resulting from ellagitannin processing. Thus, among other things, the present disclosure provides technology in which one or more ellagitannin enzymes are included in an ellagitannin composition. Such technology results in increased production of urolithins (e.g., urolithin A, urolithin B, urolithin C, urolithin D, and / or isourolithin A) and / or increased bioavailability of urolithins (e.g., urolithin A, urolithin B, urolithin C, urolithin D, and / or isourolithin A), thus providing a solution to a need in the art. In some embodiments, the technology herein may be useful for altering (e.g., improving) mitochondrial function (e.g., by reducing mitochondrial dysfunction) and / or altering antioxidant levels.

[0106] The present disclosure provides further insight that microbes, such as naturally occurring or genetically engineered variants of microbial strains found in the microbiota (e.g., of a mammal, e.g., a human), may contain and / or express one or more ellagitannin enzymes (e.g., ellagitannin enzyme-synthesizing microbes). Thus, the present disclosure provides, among other things, techniques to utilize such microbes alone or in combination with ellagitannin compositions to increase the production and / or bioavailability of urolithins. One advantage of using microbial strains that contain and / or express one or more ellagitannin enzymes includes that microbial strains, such as those found in the microbiota, are generally safe for administration or consumption by a subject (e.g., a mammal, e.g., a human). Another advantage of using such microbial strains may be that the microbial strains can colonize the digestive tract of a subject to which the strain is administered, which can reduce the number of required administrations and increase the time that the ellagitannin enzymes are present in the digestive tract of the subject. Additionally, the microbial strains may be easy to administer to a subject via some probiotic forms, as discussed herein.

[0107] Ellagitannin Composition Ellagitannins are a diverse class of complex hydrolyzable plant tannin polyphenols composed of a hexahydroxydiphenoyl moiety esterified to sugar, i.e., hexahydroxydiphenoyl-glucose esters. Ellagitannins are found in a variety of foods, such as strawberries (Fragaria vesca), raspberries, blackberries, cloudberries (Rubus chamaemorus), jabuticaba, kambuchi, Suriname cherry, camu camu, red guava, white guava, fruits of the Myrtaceae family, pomegranates, walnuts, pecans, liquorice mushrooms (Fistulina hepatica), and cranberries. Ellagitannins hexahydroxydiphenoyl-glucose esters may contain a variable number of hexahydroxydiphenoyl (HHDP) units and galloyl and / or sanguisorboyl units attached to sugars, and are primarily produced in dicotyledonous angiosperm species, including, but not limited to, species of the Myrtaceales.

[0108] Following consumption by a subject (e.g., a mammal, e.g., a human), ellagitannins (ETs) may be metabolized in the subject to ellagitannin metabolites, such as ellagic acid (EA) metabolites, which may be, but are not limited to, urolithin A, urolithin B, urolithin C, urolithin D, isourolitin A, methylurolithin A, hydroxylurolithin A, and / or derivatives thereof. These metabolites may be derived from ellagitannins present in certain foods (such as pomegranate), but ingestion of these foods often results in insufficient bioavailability of these beneficial bioactive metabolites. Specifically, certain subjects may not be able to produce detectable amounts of these metabolites after ingesting an ET-containing food (e.g., pomegranate juice). In some cases, subjects may benefit from the compositions and methods described herein, which may increase the bioavailability of ellagitannins in foods and / or may be co-administered as part of compositions described herein. Subjects who produce very low or undetectable levels of ellagitannin metabolites after ingestion may benefit from the technology disclosed herein. However, subjects that may produce detectable levels of ellagitannin metabolites may also benefit from the technology disclosed herein, as increased levels of such metabolites may be desirable.

[0109] In certain embodiments, ellagitannin compositions are used as components of compositions or administered in the methods described herein. Non-limiting examples of ellagitannins useful in the methods and compositions described herein include numerous pomegranate ellagitannins, particularly punicalagins, including punicalin and gallaginic acid, each of which can be hydrolyzed to ellagic acid (EA), which is further hydrolyzed by gut microbes to urolithins A and B. Other ellagitannins include, for example, pedunculagin, rosacyanin (Fukiu et al., Tetrahedron 62:9661-9670 (2006), which is incorporated herein by reference in its entirety), phyllanemblinin (Zhang et al., J. Nat. Prod. 64:1527-1532 (2001), which is incorporated herein by reference in its entirety), and sanguiin H6.

[0110] Ellagitannin compositions that may be useful in the methods and compositions described herein may include, for example, juices or homogenates of plant material including, but not limited to, the fruit of ellagitannin-producing plants, or the skins and / or shells thereof. For example, it may be preferable to use juices or homogenates that have been enriched in ellagitannins by extraction. Various plant materials can be extracted in a variety of ways. For example, in certain embodiments, materials may be extracted by solvent extraction of freeze-dried, ground plant material. Several examples are described below.

[0111] Extraction of pomegranate shell or rind, which can enrich ellagitannins while removing anthocyanins, is described in Adams et al., J Agric. Food Chem. 54:980-985 (2006), Seeram et al., Sep. Purif. Technol. 41:49-55, and Sharma et al., J. Agric. Food Chem. 58:3965-3969 (2010), each of which is incorporated herein by reference in its entirety. The purity and concentration of ellagitannins in such extracts can be determined by HPLC and liquid chromatography electrospray ionization mass spectrometry (LC-ESI / MS). Pomegranate extracts are commercially available, for example, extracts containing 37.5% punicalagin and punicalagin and 2.7% ellagic acid, the major pomegranate ellagitannin gallic acid, are available from Verdure Sciences, Noblesville IN. The extract is prepared by the method described by Pacheco-Palencia et al. Food Chem. 56:8434-8441 (2008), which is also incorporated herein by reference.

[0112] Extracts of strawberry ellagitannins can be prepared as described in Zhang et al., J. Agric. Food Chem. 56:670-675 (2008), which is also incorporated herein by reference. Briefly, freeze-dried whole fruit strawberry powder can be extracted by cold permeation with methanol to produce an extract, which can be partitioned into chloroform followed by ethyl acetate. The remaining aqueous portion can be further purified by adsorption chromatography on an XAD-16 (Amberlite Resin, Sigma, Louis, MO) column and eluted with water followed by acidic methanol. The ellagitannin content can be further increased by drying the methanol eluate under vacuum, followed by suspension in distilled water and filtration to produce a water-insoluble fraction enriched in ellagitannins and ellagic acid. Extracts can be standardized to 5.0% ellagic acid by HPLC. Typically, the resulting extract can contain approximately 20.5% phenolics measured as gallic acid equivalents (GAE).

[0113] Jamun seed extraction process is described in Sharma et al., J. Agric. Food Chem. 58:3965-3969 (2010), which is also incorporated herein by reference. Indian jamun (Eugenia jambolana) berries contain ellagitannins in their fleshy pulp, but their seeds may be a richer source of lesser anthocyanins. In some cases, anthocyanins can be removed. In some embodiments, the compositions described herein are essentially free or free of anthocyanins. Jamun seed extraction may include, for example, extraction of seed powder in acetone followed by vacuum drying. The resulting extract can be standardized to about 4.2% ellagic acid by HPLC and 20.5% phenolics as GAE. Similar approaches or other previously known approaches can be applied to prepare ellagitannin-containing preparations from other sources for use in the methods and compositions described herein.

[0114] The ellagitannin compositions disclosed herein can be formulated for oral administration. In some embodiments, the ellagitannin compositions can be a food, beverage, feed composition, or dietary supplement. In some embodiments, the ellagitannin compositions can be a liquid, syrup, tablet, lozenge, gummy, capsule, powder, gel, or film.

[0115] In some embodiments, the ellagitannin composition may be mixed with a pharma- ceutically acceptable carrier, hi some embodiments, the ellagitannin composition may be included in an enteric coated formulation.

[0116] When consumed, ellagitannins can be hydrolyzed to release ellagic acid. Ellagic acid can be detected in human plasma and has been proposed to act directly on methyltransferases involved in histone methylation, among other activities. However, the expression of ellagitannin metabolites, including but not limited to urolithin A (3,8-dihydroxyurolithin), urolithin C (3,8,9 trihydroxyurolithin), isourolitin A (3,9 dihydroxyurolithin), urolithin B (3-hydroxyurolithin), urolithin D (3,4,8,9-tetrahydroxyurolithin) or combinations thereof, requires the action of gut microbiota on ellagitannins.

[0117] Concentrations of urolithin A can reach up to micromolar (μM) levels in plasma in vivo without apparent toxic effects. For example, upon ingestion of pomegranate juice by humans, peak plasma levels of urolithin A can reach 14-40 μM. However, wide variations in urolithin levels can exist as a result of inter-individual ellagitannin processing (see, e.g., Cerda et al., Eur. J. Nut. 43:205-220, incorporated herein by reference). Selma et al. identified monocultured bacteria (Gordonibacter urolithinfaciens and Gordonibacter pamelaeae DSM19378T) that metabolize ellagic acid to produce luteic acid, urolithin M-5, urolithin M-6, and urolithin C. However, these cultured bacteria were unable to produce the downstream products, urolithin A and urolithin B. (See Selma et al., Food & Nut. 5:1779-1784 (2014), incorporated herein by reference.) The present disclosure provides recognition that wide inter-individual variability may be due to differences in the microbiota.

[0118] Tissue characterization studies reveal that urolithin may be enriched in mouse prostate, intestine, and colon tissues. Urolithin A can inhibit colon cancer cell proliferation, induce cell cycle arrest, and regulate key cellular processes related to colon cancer development, such as MAPK signaling in vitro (Larossa et al., J. Agric. Fool Chem., 54:1611-1620 (2006); Gonzalez-Sarrias et al., Mol. Nut. Food Res. 53:686-698 (2009), each of which is incorporated herein by reference). In a rat colitis model, urolithin A can reduce inflammatory markers, such as inducible nitric oxide synthase, cycloxygenase-2 (COX-2), prostaglandin E synthase, and prostaglandin E2, in colonic mucosa. Urolithin B has been found in some embodiments to be a regulator of skeletal muscle mass (e.g., Rodriguez et al., J. Cachexia Sarcopenia Muscle 8:583-597 (2017), incorporated herein by reference). Where urolithins are directly bioavailable, treatments that promote urolithin production as described herein can increase the bioavailability of ellagitannin metabolites.

[0119] Urolithins have distinct UV spectra that can enable their detection and measurement, for example, by HPLC coupled with a UV photodiode array detector. Correlations between structural features, including linkages, and UV spectra and retention times have been reported (see, e.g., Gonzalez-Barrio et al., J. Agric. Food Chem. 59:1152-1162 (2011), incorporated herein by reference). Thus, HPLC and UHPLC can be used to assay and identify levels of urolithins in urine obtained from a subject (see, Piwowarski, JP et al. Drug Metabolism and Disposition 45(6):657-665 (2017), incorporated herein by reference in its entirety).

[0120] Ellagitannin Enzyme Tannin acylhydrolase enzyme Embodiments of the compositions and methods described herein include the use of microorganisms expressing ellagitannins or enzymes that act in the ellagitannin metabolic pathway. Exemplary enzymes include tannin acyl hydrolase enzymes that can catalyze the hydrolysis of the galloyl ester bond of hydrolyzable tannins, including ellagitannins, to release gallic acid. The tannin acyl hydrolases described herein can catalyze the reaction characteristic of EC 3.1.1.20. Fungi, such as Aspergillus species, and bacteria, such as members of the Lactobacillaceae family, can naturally produce tannase enzymes suitable for use in the compositions and methods described herein. Although tannase enzymes encoded by fungi may share little structural similarity with those encoded by bacteria, they can share a similar range of substrate specificity. Thus, for embodiments in which the tannase enzyme can be administered or used as a preparation derived from, but not including, a living microorganism, tannase can be isolated or prepared from fungal as well as bacterial sources. Tannases produced by yeast and methods for producing them are described, for example, in Boer et al., Yeast 26:323-337 (2009), and the secretion, purification and characterization of Aspergillus tannase in Pichjia pastoris yeast in Zhong et al., Protein Expression and Purif. 36:165-169 (2004), both of which are incorporated herein by reference.

[0121] Tannases acting on ellagitannins can selectively hydrolyze the galloyl moieties to produce gallic acid and degalloylated ellagitannins. See, for example, Rodriguez-Duran et al., Enzyme Res. 2011:823619 (2011), which includes a description of the hydrolysis products of tannase digestion of various ellagitannins and is incorporated herein by reference. In one embodiment, the tannin acyl hydrolase is a tannase B or tanB tannase enzyme. Examples include, but are not limited to, the tanB enzyme encoded and expressed by members of the Lactobacillaceae family, including but not limited to the species L. plantarum. Tannase B encoded and expressed by other species capable of catalyzing the same reactions as in various embodiments of the compositions and methods described herein may be useful, as well as naturally occurring or artificially generated variants that retain the ability to catalyze the reactions.

[0122] Methods for producing and isolating recombinant tannase, e.g., L. plantarum tannase, are described, for example, in Curiel et al., J. Agric. Food Chem. 57:6224-6230 (2009), which is incorporated herein by reference. The crystal structure of the tannase B polypeptide encoded and expressed by L. plantarum has been determined (see Ren et al., J. Mol. Biol. 425:2737-2751 (2013), which is incorporated herein by reference). As reported, tannase B exhibits an α / β structure characterized by a large cap domain inserted into the serine hydrolase fold. Structural studies of the enzyme complexed with multiple substrates have shown that interactions at the galloyl binding site are determinative of substrate binding. The galloyl binding site is responsible for the esterase and depsidase activities of the enzyme. A catalytic triad consisting of Ser163, His451, and Asp419 has been identified. Mutagenesis studies have shown that during the binding of gallic acid, the carboxyl group of the molecule forms hydrogen-bonding interactions with the catalytic triad of the enzyme, and the three hydroxyl groups contact Asp421, Lys343, and Glu357 to form another hydrogen-bonding network, and that these residues are necessary for enzyme activity. Thus, modifications to tannin acyl hydrolase or tannase B polypeptides that change the identity of one or more of these residues or their equivalents in homologous proteins would likely not be tolerated. Similarly, changes that disrupt the positions of these residues or their equivalents in other homologs relative to each other would also be expected to disrupt the hydrogen-bonding network and interfere with enzyme function. On the other hand, changes that do not affect the identity or relative positions of the described residues would be more likely to be tolerated. In one embodiment, the tannase B polypeptide described herein is at least 85% identical to the L. plantarum tannase B enzyme encoded by strain WCFS1 and retains the above-mentioned amino acids Ser163, His451 and Asp419, as well as the tannin hydroxyl contact amino acids Asp421, Lys343 and Glu357, or their equivalents located in homologous polypeptides.In another embodiment, the tannase B polypeptides described herein have at least 90% or at least 95% or more identity to the L. plantarum tannase B enzyme encoded by strain WCFS1 and retain the catalytic triad amino acids Ser163, His451 and Asp419 and the tannin hydroxyl contacting amino acids Asp421, Lys343 and Glu357 described above, or their equivalents located in homologous polypeptides.

[0123] Many L. plantarum strains encode and express similar tannase B polypeptides. Non-limiting examples include L. plantarum WCFS1 (see nucleic acid and amino acid sequences below), as well as, for example, L. plantarum 5-2, L. plantarum LP3, L. plantarum BLS41, L. plantarum LQ80, L. plantarum A3, L. plantarum FBR6, and L. plantarum RI-51.

[0124] L. plantarum WCFS1 tannase B nucleic acid sequence (NCBI accession number NC_004567.2): atgagtaacc gattgatttt tgatgctgac tggctggtgc cggaacaggt ccaagttgcc gggcaggcta ttcaatatta tgctgcccgt aatattcagt acgttcagca tccagtcgca gcgattcagg tcctaaacgt ttttgtacca gccgcatact tgcatggcag ttcagtcaat ggttatcagc gggcaacggc gccaattctg atgccgaata cggtcggcgg ttatttgcca ggaccggcgg atgatccgca acgtgtcact tggccgacga atgcagggac gattcaacag gcacttaaac gcggttacgt tgtggtggcc gctggaattc gcggtcgtac gacggttgat aagtctgggc aacgggtcgg gcaagcgccg gcttttatcg tagatatgaa ggcggcaatc cgttacgtta agtataatca gggccggctg ccaggtgaca cgaaccggat catcacgaat ggaacgagtg ctgggggtgc cacttcggct ttagcgggtg cgagtggcaa ttcggcttat tttgaaccag ccttaactgc gctcggggca gcaccggcga ctgacgatat ctttgcggtg tcagcttact gcccgattca taatctggaa cacgcagaca tggcctacga gtggcagttt aatggtatta atgactggca ccgttatcag cctgttgcgg ggacgaccaa gaatgggcga ccaaaatttg aaccggttag tggtcagctc acagttgaag aacaggccct ttcgttggcg ttaaaagccc agttcagtac ctacttgaac cagttgaaac tcacggccag tgacgggacg cacttgacgc ttaatgaggc gggaatgggt tcatttcgtg atgttgttcg ccaattattg atatcatctgctcagacggc attcgatcaa gggacggata ttcataagta cgcaggcttt gtcgttactg gaaatcaggt gacggacttg gatttatcag cttattgaa gtcgttaact cgcatgaaag ccgtcccggc gtttgaccaa ttagatttga cgagtccaga gaataatttg tttggcgatg caacggcgaa agccaagcac tttacggcct tggcacagac gcgaagtacg gtgacggcac aactagcgga cgctgagctg attcaggcga ttaatccgct cagttactta acgacaactt cgtcacgagt tgctaagcac tggcggattc gccacggtgc ggccgaccga gatacgagtt ttgcaatccc gattattcta gcaataatgt tagaaaatca tggttatggc attgattttg cgctaccgtg ggatattccc cacagtggtg actatgattt aggcgattta ttttcctgga ttgatggctt gtgccaatga

[0125] L. plantarum WCFS1 tannase B amino acid sequence, NCBI accession number WP_011101979.1: [Table 3] Amino acids Ser163, His451, Asp419, Asp421, Lys343, and Glu357 are shown in bold.

[0126] Methods for detecting or measuring tannin acyl hydrolase activity are described in Beverini & Metche, Sci. Aliments. 10:807-816 (1990), which describes an HPLC assay; Haslam et al. J. Chem. Soc. 1829-1835 (1961), which describes an unbuffered titration assay; Yamada et al. Agr. Biol. Chem. 45:233-240 (1967), which describes a buffered titration assay; Skene & Booker, Anareobe 1:321-327 (1995), which describes a single-wavelength spectrophotometric assay; Bajpai & Patil, World J. Microbiol. Biotechnol. 12:217-220 (1996), which describes a dual-wavelength spectrophotometric assay; and Aguilar et al. Exemplary methods include those described in, for example, ... Based on this comparison, either of these methods can be used, but the HPLC assay described by Beverini and Metche has the lowest coefficient of variation and is more reliable than the other methods. When precision in the measurement of tannin acyl hydrolase enzyme activity is important, the HPLC method may be preferred.To determine whether a given bacterium expresses tannin acyl hydrolase activity, any of the assays provided above can be used, among others, but HPLC approaches are preferred when it is necessary or desired to measure the amount of such activity. The presence of tannin acyl hydrolase enzyme genes can be detected in bacteria via PCR using primers based on available tannin acyl hydrolase enzyme nucleic acid sequences, or if the bacterial genome has been sequenced, the presence of sequences encoding tannin acyl hydrolase enzymes can be determined based on homology or identity with known tannin acyl hydrolase enzymes.

[0127] Gallic acid decarboxylase enzyme Embodiments of the compositions and methods described herein include the use of microorganisms that encode and express a gallate decarboxylase enzyme. This enzyme can catalyze the conversion of 3,4,5-trihydroxybenzoic acid (gallic acid) to pyrogallol and carbon dioxide, which is a characteristic of EC 4.1.1.59. Although microbial gallate decarboxylase genes can be encoded in an operon arrangement of three separate protein-coding sequences, referred to as "subunits" C, B, and D, the active enzyme is not a complex of the three subunits. Rather, for species with this arrangement, the C subunit appears to be the catalytic subunit. In Lactobacillus plantarum WCFS1, based on gene knockout experiments, it has been proposed that the B subunit, but not the D subunit, is required together with the C subunit for gallate decarboxylase activity, and that the B subunit plays a role, for example, in establishing the correct folding of the C subunit. See, e.g., Jimenez et al., Appl. Environ. Microbiol. 79:4253-4263 (2013), which is incorporated by reference herein. For the gallate decarboxylase expressed by L. plantarum WCFS1 (also known as ATCC deposited strain BAA-793), the C subunit lpdC is identified in GenBank Accession No. F9US27-1: atggcagaac aaccatggga tttgcgtcgc gtgcttgatg agatcaagga tgatccaaag aactatcatg aaactgacgt cgaagttgat ccaaatgcgg aactttctgg tgtttatcgg tatatcggtg ctggtgggac cgttcaacgg ccaacgcaag aggcgtcc agattcgtc agattcgtc agattcgt tgatacgcgg gtcttgactg gattgatggc gagtcgccgg cgcgttggta agatgttcca ccacgattat cagacgttag ggcaatactt gaacgaagca gtctctaatc cagtggcgcc agaaacggtt gctgaagcgg atgcgccagc tcacgatgtc gtttataatat cgactttaggat aggcttagatt tagtggcagc accaacgaat acgccccaag atgctggacc atatattacg gtcggtgtgg tgtttggctc aagcatggac aagtctaaga gtgatgtgac gattcaccga atggtccttg aagataagga taagttaggg atttatatca tgcctggcgg tcggcacatt ggtgcgagt cggacagta cggacagta agacagcact tgccaattac aattaatatt ggtttggatc cagccattac gattggtgca actttcgaac caccgaccac gccattcggt tataacgaat taggtgttgc tggtgcgatt cggaaccaag ctgttcaatt agttgacggg gtgaccgtcg atgaaaggc gattgcggtc gctgactatgtatgtagtag cctaacgaac gtattcagga agatatcaat acgcatacgg gcaaggcgat gcctgaattc ccgggttatg atggtgacgc caacccagct ttacaagtgattaaggtgac ggcggtgact catcggaaga atgccatcat gcaaagcgtg attggaccat ccgaagaaca tgtcagcatg gcgggaattc caactgaagc tagtatctta caattggtta accgtgccat tcctggtaaa gtgacgaatg tttataatcc gccgggct ggtcaggt tgcagatccat cacaaggata atgaagcgga tgaaggaatt caacggcaag ctgccttgct tgcgttctca gcctttaagg aattgaagac tgttatcctg gttgatgaag atgttgatat ttttgatatg aatgatgtga tttggacgat gaatacccgt ttccaagccg atcaggactt gatggtcgtta gcagcatt tcggaacgcc cacaatatga tccaaagtcg attcgtttcc gtgggatgag ttctaaacta gtgattgatg gcaccgtacc attcgatatg aaggaccaat ttgaacgggc ccaattcatg aaagtggctg actgggagaa gtatttgaag taa lpdC: F9US27-1(UniprotKB;L.plantarum ATCCBAA-793) MAEQPWDLRR VLDEIKDDPK NYHETDVEVD PNAELSGVYR YIGAGGTVQR PTQEGPAMMF NNVKGFPDTR VLTGLMASRR RVGKMFHHDY QTLGQYLNEA VSNPVAPETV AEADAPAHDV VYKATDEGFD IRKLVAAPTN TPQDAGPYIT VGVVFGSSMD KSKSDVTIHR MVLEDKDKLG IYFAEEGRKAYEPGYEKA NKPMPITINI GLDPAITIGA TFEPPTTPFG YNELGVAGAI RNQAVQLVDG VTVDEKAIAR SEYTLEGYIM PNERIQEDIN THTGKAMPEF PGYDGDANPA LQVIKVTAVT HRKNAIMQSV IGPSEEHVSM AGIPTEASIL QLVNRAIPGK VTNVYNPPAG GGKLMTIMQI HKDNEADEGI QRQAALLAFS AFKELKTVIL VDEDVDIFDM NDVIWTMNTR FQADQDLMVL SGMRNHPLDP SERPQYDPKS IRFRGMSSKL VIDGTVPFDM KDQFERAQFM KVADWEKYLK

[0128] The B subunit of L. plantarum WCFS1 gallate decarboxylase (lpdB) is identified under GenBank accession number F9UT67: atgaaacgaa ttgttgtggg aatcacggga gcgtccggta cgatttacgc ggtcgactta ttagaaaagt tacatcagcg gccagatgtt gaagttcatc tggtaatgag tgcgtgggct aaaaaaaact tggagttaga gactgattac tcgctcgcgc agctgacggc gctcgcggat gctacttatc gggctaatga ccaaggcgca gcgattgcca gcggttcgtt tttgaatgac ggaatggtca ttgtcccagc tagtatgaag acggtagcag ggattgcgta cggcttcggt gataatttaa tatcgcgggc tgctgatgtc actataag aacaacgtaa acttgtgatt gttccacgtg aaacaccgtt aagcgtgatt catttagaaa atctaacgaa gttggcaaaa ctcggtgccc aaattattcc accgattccc gcgttttata atcatccgca atccattcag gatctggtca atcatcaaac catgaaaatt ttagatgcgt ttcatattca taatgaaact gatcgccgtt gggaggggga ttaa MKRIVVGITG ASGTIYAVDL LEKLHQRPDV EVHLVMSAWA KKNLELETDY SLAQLTALAD ATYRANDQGA AIASGSFLND GMVIVPASMK TVAGIAYGFG DNLISRAADV TIKEQRKLVI VPRETPLSVI HLENLTKLAK LGAQIIPPIP AFYNHPQSIQ DLVNHQTMKI LDAFHIHNET DRRWEGD

[0129] The D fragment of L. plantarum potent pneumococcal dyes (lpdD) is GenBank accession number F9UT68: atggcaactt ttacgactga gcaggccggg tatcaaatgc aagcaatact ccaagtgatt ggatatgact tgttgatcgt cgttaccggt gggaccaatc cccatattgg tgacgtgacc acactaactg ccagcacggt tcccgaaacg gttaagtttc ccagccatga tggtcgcttc cacaaagata actttatttc ggaacgaatg gccaagcgga ttcagcgtta tctagctgga agctgtacaa ttactgcggg aattcatgtc aaccaaatta ctaaagcaca aatagcagct gcggcaccaa tgacggatga cctcagccgc cagattatta gctggttaca ggcccatccc gtccaggctg aaaagccgga atattatgga caagacgagc aaccgcggta g MATFTTEQAG YQMQAILQVI GYDLLIVVTG GTNPHIGDVT TLTASTVPET VKFPSHDGRF HKDNFISERM AKRIQRYLAG SCTITAGIHV NQITKAQIAA AAPMTDDLSR QIISWLQAHP VQAEKPEYYG QDEQPR

[0130] Gallic acid decarboxylase-expressing L. plantarum species, and other species expressing gallic acid decarboxylase, such as Streptococcus galloylyticus, can decarboxylate gallic acid released from tannins, for example by the action of tannin acyl hydrolase enzymes, to pyrogallol, but these species lack the ability to further degrade this product. Gallic acid decarboxylase enzymes from many microbial sources are known, including, but not limited to, Lactobacillus plantarum, e.g., L. plantarum WCFS1. Gallic acid decarboxylase activity is present in a wide range of lactic acid bacteria, such as L. brevis, L. casei, and L. fermentum.

[0131] In one embodiment, the gallic acid decarboxylase comprises a gallic acid decarboxylase C polypeptide, such as, but not limited to, the L. plantarum lpdC polypeptide. In another embodiment, the microorganisms useful in the methods and compositions described herein encode and express gallic acid decarboxylase C and B polypeptides. In such microorganisms or compositions made therefrom or including them, the B polypeptide is not necessarily linked to the C polypeptide, but appears to be important for producing a highly active gallic acid decarboxylase enzyme. Examples include, but are not limited to, the lpdC and lpdB polypeptides of L. plantarum species, particularly, but not limited to, L. plantarum WCFS1. Gallic acid decarboxylases encoded and expressed by other species that catalyze the same reaction may also be useful in various embodiments of the compositions and methods described herein, as well as naturally occurring or artificially created variants that retain the ability to catalyze the same reaction.

[0132] Methods for expressing or producing recombinant gallic acid decarboxylase are similar to those for producing recombinant tannin acyl hydrolase enzymes or other recombinant enzyme preparations. See, for example, Jimenez et al., Appl. Environ. Microbiol. 79:4253-4263 (2013), incorporated herein by reference. Gallic acid decarboxylase activity can also be assayed as described therein, and the authors further describe PCR primers and PCR amplification to identify species encoding the enzyme activity and to prepare nucleic acids encoding the enzyme polypeptide for cloning into an expression vector, e.g., for overexpression.

[0133] In one embodiment, the gallate decarboxylase enzyme has at least 80% sequence identity to the catalytic gallate decarboxylase C polypeptide of L. plantarum lpdC of strain WCFS1 described herein and retains at least 50% of the gallate decarboxylase activity of the lpdC polypeptide when expressed in the presence of the lpdB polypeptide. Contemplated variations in the gallate decarboxylase enzyme molecule include, for example, conservative amino acid substitutions, as that term is defined herein.

[0134] Thus, in one embodiment, the gallate decarboxylase enzyme has no more than 50, e.g., no more than 40, no more than 30, no more than 20, no more than 15, no more than 10, no more than 5, no more than 4, no more than 3, no more than 2 or no more than 1 conservative amino acid substitutions compared to a wild-type gallate decarboxylase enzyme or compared to the gallate decarboxylase enzyme encoded and expressed by L. plantarum WCFS1 and retains at least 50%, at least 60%, at least 70%, at least 80%, at least 90%, at least 95%, at least 96%, at least 97%, at least 98%, at least 99% or more activity compared to the wild-type enzyme or the enzyme encoded by L. plantarum WCFS1. In another embodiment, the gallate decarboxylase enzyme has at least 80%, at least 85%, at least 90%, at least 95%, at least 96%, at least 97%, at least 98%, at least 99% or more sequence identity with the catalytic gallate decarboxylase C polypeptide of L. plantarum lpdC of strain WCFS1 described herein and retains at least 50%, at least 60%, at least 70%, at least 80%, at least 90%, at least 95%, at least 96%, at least 97%, at least 98%, at least 99% or more of the gallate decarboxylase activity of the lpdC polypeptide when expressed in the presence of an lpdB polypeptide. It is believed that some mutations may have the potential to improve the associated activity such that the gallate decarboxylase variant has more than 100% activity of the wild-type or naturally occurring polypeptide, for example 110%, 125%, 150%, 175%, 200%, 500%, 1000% or more.

[0135] Ellagitannin Enzyme-Synthesizing (EES) Microorganisms Many microbial species are known that can encode and produce the tannase enzymes described herein, as well as species that can encode and produce the gallic acid decarboxylases described herein. In one embodiment, a single microbial species or strain can express both tannase and gallic acid decarboxylase enzymes. In another embodiment, each enzyme can be encoded and expressed by a different species or strain, in which case it is generally beneficial to administer both species or strains to provide the best benefits with respect to ellagitannin metabolism and urolithin production. In addition to microorganisms that can naturally express tannase and / or gallic acid decarboxylase enzymes, the microorganisms can be engineered to recombinantly express the enzymes of interest. In one embodiment, a microbial species or strain can be modified such that both tannase and gallic acid decarboxylase enzymes can be engineered to include polynucleotides encoding the enzymes and thus recombinantly expressed. In another embodiment, a microbial species or strain can be modified such that either tannase or gallic acid decarboxylase enzymes can be encoded and recombinantly expressed.

[0136] For example, genome sequencing can be used to identify microbial species or strains that encode a given enzyme or enzyme gene cluster. Once a species or strain has been identified as encoding a given enzyme or enzyme gene cluster, it can be determined whether the bacteria actually produces the enzyme(s) using transcriptomics, RT-PCR, or Western blot or other antibody-based analysis of expressed proteins, or via assays of previously known enzyme activity.

[0137] Lactobacillus plantarum is an exemplary species capable of encoding and expressing tannase and gallic acid decarboxylase enzymes. In some embodiments, Streptococcus gallolyticus is used (Genetic and biochemical approaches towards unravelling the degradation of gallotannins by Streptococcus gallolyticus, Microb Cell Fact. 2014 Oct 31;13:154. doi:10.1186 / s12934-014-0154-8, incorporated herein by reference).

[0138] combination Given that certain factors may affect the effective amount of an ellagitannin composition and the effective amount of a microorganism capable of encoding and expressing tannin acyl hydrolase and gallic acid decarboxylase enzymes, it should also be understood that various combinations of ellagitannin amounts and microorganism amounts can provide an effective amount to promote urolithin production in the gastrointestinal tract, as described herein. Thus, for example, a combination can include an ellagitannin composition and an enzyme composition comprising one or more ellagitannin enzymes. In some embodiments, the one or more ellagitannin enzymes include a tannin acyl hydrolase enzyme, a gallic acid decarboxylase enzyme, or a combination thereof. In some embodiments, the enzyme composition can be an EES microorganism.

[0139] In some embodiments, the combination may include about 10 mg to about 10 g, about 10 mg to about 5 g, 10 mg to about 2500 mg, about 100 mg to about 10 g, about 100 mg to about 5 g, or 100 mg to about 2500 mg of the ellagitannin composition. In some embodiments, the combination may comprise at least 10 mg, at least 50 mg, at least 100 mg, at least 150 mg, at least 200 mg, at least 250 mg, at least 300 mg, at least 350 mg, at least 400 mg, at least 450 mg, at least 500 mg, at least 550 mg, at least 600 mg, at least 650 mg, at least 700 mg, at least 800 mg, at least 850 mg, at least 900 mg, at least 950 mg, at least 1000 mg (1 g), at least 1250 mg, at least 1500 mg, at least 2000 mg, at least 2500 mg, at least 3000 mg, at least 3500 mg, at least 4000 mg, at least 4500 mg, at least 5000 mg, or more of an ellagitannin composition. In some embodiments, the combination may be up to 50 mg, up to 100 mg, up to 150 mg, up to 200 mg, up to 250 mg, up to 300 mg, up to 350 mg, up to 400 mg, up to 450 mg, up to 500 mg, up to 550 mg, up to 600 mg, up to 650 mg, up to 700 mg, up to 800 mg, up to 850 mg, up to 900 mg, up to 950 mg, up to 1000 mg (1 g), up to 12 The ellagitannin composition may comprise 50 mg, up to 1500 mg, up to 2000 mg, up to 2500 mg, up to 3000 mg, up to 3500 mg, up to 4000 mg, up to 4500 mg, up to 5000 mg, up to 5500 mg, up to 6000 mg, up to 6500 mg, up to 7000 mg, up to 7500 mg, up to 8000 mg, up to 8500 mg, up to 9000 mg, up to 9500 mg, or up to 10 g.

[0140] In some embodiments, the composition comprises at least about 10 5 CFU~10 12 CFU, approximately 10 5 CFU~10 10 CFU, or about 108 CFU~10 12 In some embodiments, the composition may contain at least 10 CFU of one or more EES microorganisms. 5 , 5×10 5 , 10 6 , 5×10 6 , 10 7 , 5×10 7 , 10 8 , 5×10 8 , 10 9 , 5×10 9 , 10 10 , 5×10 10 , 10 11 , 5×10 11 , 10 12 , or more than one EES microorganism.

[0141] The amount of an ellagitannin composition effective to promote urolithin production will vary, for example, depending on the amount and / or activity of microorganisms in the digestive tract that can metabolize ellagitannins. Thus, when an ellagitannin composition is consumed or administered with a preparation or formulation that includes a microorganism that encodes and expresses tannin acyl hydrolase and / or gallic acid decarboxylase enzymes, the amount of the ellagitannin composition effective to promote urolithin production will generally be less than when the ellagitannin is consumed or administered without such microorganisms. It is understood that, as enzyme expression levels from microorganisms that encode and express tannin acyl hydrolase and / or gallic acid decarboxylase enzymes can vary, the amount of microorganism required to promote urolithin production will vary with such expression levels, i.e., the amount of a given microbial strain can be adjusted for effectiveness depending on the relative levels of tannin acyl hydrolase and / or gallic acid decarboxylase enzymes produced. It is noted that the presence of ellagitannins can induce the expression of enzymes required to metabolize them in microorganisms that can encode such enzymes, see, for example, Example 2. Thus, although a microorganism has been exposed or recently exposed to ellagitannins, the amount of the microorganism required to promote urolithin production may be less than the amount required if the microorganism has not been so exposed prior to administration or consumption.

[0142] In one embodiment, effective treatment may be determined by an increase in the concentration of urolithins in excreted urine of at least 10%, at least 20%, at least 30%, at least 40%, or at least 50% compared to the level of urolithins in urine prior to treatment with a composition comprising an ellagitannin composition or an ellagitannin composition in combination with a microorganism encoding and expressing a tannin acyl hydrolase and / or gallic acid decarboxylase as described herein. In some embodiments, efficacy may be assessed by measuring the degree of cellular oxidative stress in a biological sample before and after administration of a composition described herein. The degree of cellular oxidative stress may be assessed, for example, by measuring the expression of an oxidative stress biomarker, such as high sensitivity C-reactive protein (hs-CRP), or by determining the ratio of oxidized to reduced glutathione. Because high levels of oxidative stress can be cytotoxic, the degree of oxidative stress may be measured by assessing the concentration of intracellular proteins present in the systemic circulation from inflamed or lysed cells, for example, oxidative stress in cardiomyocytes may be determined by assessing troponin-I levels in the blood. Hepatic oxidative stress can be determined by elevated levels of liver enzymes in the bloodstream, including but not limited to alanine transaminase (ALT), aspartate transaminase (AST), alkaline phosphatase (ALP), and gamma-glutamyl transpeptidase (GGT).

[0143] In some embodiments, effective treatment can be determined by an increase in the level of urolithin in the digestive tract of the subject by at least 10%, at least 20%, at least 30%, at least 40%, or at least 50%, compared to the plasma level of urolithin in the digestive tract of the subject prior to treatment with an ellagitannin composition described herein or a composition comprising an ellagitannin composition in combination with a microorganism that encodes and expresses tannin acyl hydrolase and / or gallic acid decarboxylase. In some embodiments, effective treatment can be determined by an increase in the level of urolithin in the digestive tract of the subject by at least 10%, at least 20%, at least 30%, at least 40%, or at least 50%, compared to the plasma level of urolithin prior to treatment with an ellagitannin composition described herein or a composition comprising an ellagitannin composition in combination with a microorganism that encodes and expresses tannin acyl hydrolase and / or gallic acid decarboxylase.

[0144] In some embodiments, the subject is evaluated using one or more additional diagnostic procedures, for example, by medical imaging, physical examination, laboratory test(s), medical history, family history, and genetic testing.Medical imaging techniques are well-documented methods.Therefore, medical imaging can be selected from any known imaging method, including but not limited to ultrasound, computed tomography scan, positron emission tomography, photon emission computed tomography, and magnetic resonance imaging.

[0145] Bioavailability of Ellagitannin Compositions Phenolic compounds constitute a substantial and important group of phenylpropanoids produced by plants as secondary metabolites for the purpose of chemical defense against predators and to participate in reproduction and plant-plant interference. Structurally, phenolic compounds have an aromatic ring to which several hydroxyl groups are attached. Phenolic compounds are classified into various groups based on their functional groups, the number of phenolic rings they contain, and the radicals that link these rings to another ring. Important factors in determining the antioxidant activity of a given phenolic compound are both the number and the position of the hydroxyl groups. For example, flavonoids have more hydroxyl groups than other phenolic compounds, and this structure is associated with higher antioxidant activity. In addition to providing antioxidant activity, the structure of phenolic compounds may affect the solubility of the phenol and / or provide steric effects with respect to interactions with other molecules.

[0146] It has been reported that the structure of such compounds can play a role in their bioavailability. Whether a compound is bioavailable depends on its formulation, absorption characteristics, gastric emptying rate, route of administration, degradation and excretion kinetics in a given subject. Therefore, the bioavailability of a compound may vary from individual to individual. Bioavailability can be evaluated using an assay to measure the level of a given compound in the systemic circulation, particularly in blood, plasma, and / or urine.

[0147] Another important determinant of bioavailability is "bioaccessibility", which is related to the amount of food components, nutrients (e.g., polyphenols), etc., that are released from the food matrix into the gastrointestinal tract and absorbed through the gastrointestinal barrier. Bioaccessibility is related to the extent to which the food is masticated, whether the food is cooked or raw, gastric emptying time, gastrointestinal transit time, the amount of fiber or fat in the food, what is consumed with the food, cofactors required for absorption, the presence of certain microorganisms, and the complexity of the food matrix structure.

[0148] A bioavailable compound may not be bioactive simply because it is absorbed. For example, some nutrients are not directly active but require metabolism into bioactive metabolites. Furthermore, some polyphenols are high molecular weight compounds that are primarily bound to dietary fiber or proteins, remaining insoluble in common solvents, and require an additional step of hydrolysis during extraction to make them soluble and bioavailable.

[0149] Phenolic compounds can have different degrees of bioavailability based on their structure, food processing, matrix properties, and the host, among others. For example, the bioavailability of phenols varies over a wide range, from an estimated 0.3% for anthocyanins to 43% for isoflavones.

[0150] Hydrolyzable tannins and proanthocyanidins are polyphenols that are highly extractable from foods and therefore bioavailable to the host. The bioactivity of tannins is believed to depend on the degree of polymerization and solubility in the digestive tract, for example, highly polymerized tannins have low bioaccessibility in the small intestine and are not easily fermented by colonic microflora. A slow fermentation rate reduces the bioavailability of downstream metabolites, such as urolithins. In some embodiments, the present disclosure describes compositions administered to alter or increase the bioavailability of urolithins in the digestive tract.

[0151] In some embodiments, the method is a method of increasing the bioavailability of an ellagitannin composition to a subject. In some embodiments, the method comprises determining the bioavailability level of an ellagitannin of the ellagitannin composition in the digestive tract of the subject. In some embodiments, the method comprises comparing the bioavailability level of an ellagitannin of the ellagitannin composition in the digestive tract of the subject to a reference level. In some embodiments, the reference level is a historical bioavailability reference level of an ellagitannin, which is the bioavailability level of the ellagitannin in the digestive tract of the subject before receiving the combination, or the bioavailability level of the ellagitannin in the digestive tract of a comparable subject who has not received the combination.

[0152] In some embodiments, the method includes determining the level of urolithins produced in the subject's plasma. In some embodiments, the method includes comparing the level of urolithins in the subject's plasma to a reference level. In some embodiments, the reference level is a concentration of urolithins in plasma, e.g., 0.2 to 20 μM (Espin JC, Larrosa M, Garcia-Conesa MT, Tomas-Barberan F. Biological significance of urolithins, the gut microbial ellagic Acid-derived metabolites: the evidence so far. Evid Based Complement Alternat Med. 2013;2013:270418.doi:10.1155 / 2013 / 270418, incorporated herein by reference). In some embodiments, the reference level is a concentration of urolithins in plasma of at least 0.1 μM, at least 0.2 μM, at least 0.5 μM, at least 1 μM, at least 5 μM, at least 10 μM, or at least 15 μM. In some embodiments, the reference level is a plasma urolithin concentration of at least 0.5 μM, at most 1 μM, at most 5 μM, at most 10 μM, at most 15 μM, at most 20 μM, or at most 25 μM.

[0153] In some embodiments, the reference level is a historical reference level of urolithin, whether in the gut or in plasma, the level of urolithin in the gut of the subject prior to receiving the combination, or the level of urolithin in the gut of a comparable subject not receiving the combination.

[0154] Concentrations of urolithin A can reach micromolar (μM) levels in plasma without apparent toxic effects in vivo. For example, upon consumption of pomegranate juice by humans, peak plasma levels of UA can reach 40-14 μM, although wide variation between individuals may exist (see, e.g., Cerda et al., Eur. J. Nut. 43:205-220, incorporated herein by reference). The high interindividual variability may be due to differences in the microbiota. Selma et al. identified monocultures (Gordonibacter urolithinfaciens and Gordonibacter pamelaeae DSM 19378T) that metabolize ellagic acid to produce luteic acid, urolithin M-5, urolithin M-6, and urolithin C. However, these cultured bacteria were unable to produce the downstream products, Urolithin A and Urolithin B (see Selma et al., Food & Nut. 5:1779-1784 (2014), incorporated herein by reference).

[0155] treatment method The present disclosure recognizes that the compositions described herein can be useful for treating subjects.The methods provided by the present disclosure include methods for treating certain diseases, disorders and conditions.In some embodiments, the relevant diseases, disorders and conditions can be or include liver diseases and conditions or disorders related to mitochondrial dysfunction.

[0156] In general, the methods of treatment provided by the present disclosure involve administering a therapeutically effective amount of a probiotic, alone or in combination with an ellagitannin composition described herein, to a subject in need of, or determined to be in need of, such treatment.

[0157] In some embodiments, the methods of treatment provided herein are therapeutic, e.g., can be administered to a subject after the onset of significant symptoms of a disease or disorder associated with mitochondrial dysfunction.

[0158] In some embodiments, the provided methods of treatment are administered to a subject that is a mammal, e.g., a mammal experiencing a disease, disorder, or condition described herein, and in some embodiments the subject is a human or non-human veterinary subject, e.g., an ape, a cat, a dog, a monkey, or a pig.

[0159] In many embodiments, "treatment" includes ameliorating at least one symptom of a disease, disorder, or condition associated with a disease or disorder associated with mitochondrial dysfunction. In some embodiments, the method of treatment may be prophylactic.

[0160] In some embodiments, the methods may involve administration of a therapeutically effective amount of a probiotic and / or ellagitannin composition before, during (e.g., simultaneously with), or after administration of a therapeutic agent suspected to be associated with liver disease or a related disorder or with mitochondrial dysfunction.

[0161] In some embodiments, the compositions described herein can be administered in a form that includes one or more pharma- ceutically acceptable carriers. Suitable carriers have been described previously and will vary depending on the desired form of the composition and the mode of administration. For example, pharma- ceutically acceptable carriers can include diluents or excipients, such as fillers, binders, wetting agents, disintegrants, surfactants, glidants, and lubricants. Typically, carriers can be solids (including powders), liquids, or any combination thereof. Each carrier is preferably "acceptable" in the sense of being compatible with the other ingredients in the composition and not harmful to the subject. Carriers can be biologically acceptable and inert (e.g., allowing the composition to maintain the viability of biological materials until delivery to the appropriate site).

[0162] Oral compositions may include an inert diluent or an edible carrier. For the purpose of oral therapeutic administration, the active compound may be combined with an excipient and used in the form of tablets, lozenges, pastilles, troches, or capsules, such as gelatin capsules. Oral compositions may also be prepared by combining the composition of the present disclosure with food. In some embodiments, the microorganisms may be incorporated into food. Some non-limiting examples of food used in the methods and compositions described herein include popsicles, cheese, cream, chocolate, milk, meat, drinks, pickles, kefir, miso, sauerkraut, and the like. In other embodiments, the food product may be fruit juice, soft drinks, tea drinks, beverage preparations, jelly drinks, functional drinks; alcoholic drinks such as beer; carbohydrate-containing foods such as rice foods, noodles, bread, pasta; paste products such as fish, ham, sausage, seafood paste products; retort pouch products such as curry, foods with thick starchy sauces, Chinese soups; soups; dairy products such as milk, milk drinks, ice cream, yogurt; fermented products such as fermented soybean paste, fermented beverages, pickles; soybean products; various confectionery products including candies, chewing gums, gummies, jellies such as biscuits, cookies, frozen desserts such as jellies, cream caramel, frozen desserts; instant foods such as instant soups and instant soybean soups, etc. In order not to kill the microorganisms, it is preferred that the food preparation does not require cooking after mixing with the microbial strain.

[0163] In one embodiment, the food used for administration is chilled, e.g., frozen flavored water. In certain embodiments, the food is not a potentially allergenic food (e.g., not soy, wheat, peanut, tree nut, dairy, egg, shellfish, or fish). Pharmaceutically compatible binders and / or adjuvant materials can be included as part of the composition. Tablets, pills, capsules, lozenges, etc. can contain any of the following ingredients, or compounds of a similar nature: binders such as microcrystalline cellulose, tragacanth gum, or gelatin; excipients such as starch or lactose, disintegrants such as alginic acid, primogel, or cornstarch; lubricants such as magnesium stearate or steroids; glidants such as colloidal silicon dioxide; sweeteners such as sucrose or saccharin; or flavorings such as peppermint, methyl salicylate, orange flavor, or other suitable flavors. These are merely illustrative and are not intended to be limiting.

[0164] In related embodiments, the compositions described herein may comprise one or more microorganisms described herein in combination with viable lactic acid bacteria in combination with any material to be absorbed, including, but not limited to, nutrient supplements, foods, vitamins, minerals, pharmaceuticals, therapeutic compositions, antibiotics, hormones, steroids, etc., and similar compounds, for which it is desirable to ensure efficient and healthy absorption of the material from the gastrointestinal tract into the blood. The amount of material included in the composition may vary widely depending on the material and the intended purpose of its absorption, so the composition should not be considered limiting.

[0165] Pharmaceutical Compositions Provided herein are compositions comprising a probiotic microorganism or a combination of a probiotic microorganism and an ellagitannin composition. In some embodiments, such compositions are used to treat a liver disease or disorder associated with mitochondrial dysfunction in a subject. In some embodiments, a composition for use according to the present disclosure is a pharmaceutical composition for administration (e.g., oral administration) to, for example, a mammal (e.g., a human). A pharmaceutical composition may typically include an active agent (e.g., an individual microbial strain or a combination of a microbial strain and an ellagitannin composition) and a pharmaceutically acceptable carrier. Certain exemplary pharmaceutically acceptable carriers include, for example, saline, solvents, dispersion media, coatings, antibacterial and antifungal agents, isotonic and absorption delaying agents, and the like, which are compatible with pharmaceutical administration.

[0166] In some embodiments, pharmaceutical compositions for use according to the present disclosure may include and / or be administered in conjunction with one or more supplemental active compounds, and in certain embodiments, such supplemental active compounds may be ginger, curcumin, probiotics (e.g., one or more probiotic strains of the following genera: Lactobacillus, Bifidobacterium, Saccharomyces, Enterococcus, Streptococcus, Pediococcus, Leuconostoc, Bacillus, and / or Escherichia coli (Fijan, Int J Environ Res Public Health. 2014, incorporated herein by reference). May;11(5):4745-4767), prebiotics (non-digestible food ingredients that support the growth of probiotic microorganisms, e.g., fructans such as fructooligosaccharides (FOS) and inulin, galactans such as galactooligosaccharides (GOS), dietary fibers such as resistant starch, pectin, beta-glucan, and xylooligosaccharides (Hutkins et al., Curr Opin Biotechnol. 2016 Feb;37:1-7, incorporated herein by reference), and combinations thereof.

[0167] Pharmaceutical compositions are usually formulated to be compatible with their intended route of administration. Examples of routes of administration include oral administration. Methods for formulating suitable pharmaceutical compositions have been reported, see, for example, Remington: The Science and Practice of Pharmacy, 21st ed., 2005, and Drugs and the Pharmaceutical Sciences: a Series of Textbooks and Monographs (Dekker, NY). Oral compositions generally include an inert diluent or an edible carrier. To name just a few, in some embodiments, oral formulations can be or include syrups, liquids, tablets, lozenges, gummies, capsules, such as gelatin capsules, powders, gels, films, and the like.

[0168] In some embodiments, pharma- ceutically compatible binders and / or adjuvant materials may be included as part of the pharmaceutical composition. In some particular embodiments, the pharmaceutical composition may include, for example, any one or more of the following inactive ingredients, or compounds of a similar nature: binders such as microcrystalline cellulose, tragacanth gum, or gelatin; excipients such as starch or lactose, disintegrants such as alginic acid, Primogel, or cornstarch; lubricants such as magnesium stearate or Sterotes; glidants such as colloidal silicon dioxide; sweeteners such as sucrose or saccharin; or flavorings such as peppermint, methyl salicylate, or orange flavoring. In some embodiments, the composition may be consumed as is, sprinkled, or mixed into food or liquids (such as water). In some embodiments, a composition that can be administered to a mammal as described herein can be or can include an ingestible article (e.g., a food or beverage) that contains (e.g., is supplemented with) individual or combinations of microbial strains from the mammal's microbiota, extracts thereof, and / or components thereof.

[0169] In some embodiments, the food products can be or include one or more of bars, candies, baked goods, cereals, savory snacks, pasta, chocolate, and other solid foods, as well as liquid or semi-solid foods including yogurt, soups and stews, and beverages such as smoothies, shakes, fruit juices, and other carbonated or non-carbonated beverages. In some embodiments, the food products are prepared by the subject by mixing individual or combinations of microbial strains from the mammalian microbiota, extracts thereof, and / or components thereof.

[0170] The compositions can be included in a kit, container, pack, or dispenser together with instructions for administration or use in the methods described herein.

[0171] Those of skill in the art reading this disclosure will understand that in some embodiments, the compositions (e.g., pharmaceutical compositions) described herein may be or may include one or more cells, tissues, or organisms (e.g., plant or microbial cells, tissues, or organisms) that produce (e.g., have produced and / or are producing) the relevant compound.

[0172] In some embodiments, individual or combination of microbial strains from a mammalian microbiota that has been killed (e.g., heat-killed). Alternatively, in some embodiments, individual or combination of microbial strains from a mammalian microbiota may include viable or living cells.

[0173] In some embodiments, the therapeutic methods described herein comprise administering a viable or live individual microbial strain or combination of microbial strains from a mammalian microbiota, in some such embodiments, the viable or live individual microbial strain or combination of microbial strains from the mammalian microbiota is administered according to a regimen that achieves a population of the subject's microbiota in the administered cells.

[0174] In some embodiments, viable or live individual microbial strains or combinations of microbial strains from a mammalian microbiota described herein are formulated with and / or through the use of one or more cell cultures and / or supernatants or pellets thereof, and / or powders formed therefrom.

[0175] In some embodiments, the pharmaceutical compositions provided herein may promote colonization of individual microbial strains or combinations of microbial strains from a mammalian microbiota, particularly microbial strain(s) that have been identified, characterized, or evaluated as reducing the severity or incidence of a mammalian disease or condition in a mammal suffering from or at risk for a mammalian disease or condition. In some embodiments, the pharmaceutical compositions provided herein may attenuate colonization of individual microbial strains or combinations of microbial strains from a mammalian microbiota, particularly microbial strain(s) that have been identified, characterized, or evaluated as increasing the severity or incidence of a mammalian disease or condition in a mammal suffering from or at risk for a mammalian disease or condition. In some embodiments, the pharmaceutical compositions provided herein are capable of promoting colonization of individual microbial strains or combinations of microbial strains from a mammalian microbiota, particularly microbial strain(s) that have been identified, characterized, or assessed as not affecting the severity or incidence of a mammalian disease or condition, but that have been identified, characterized, or assessed as being capable of outcompeting one or more microbial strains that have been identified, characterized, or assessed as increasing the severity or incidence of a disease or condition in a mammal afflicted with or at risk for the mammalian disease or condition.

[0176] In some embodiments, the pharmaceutical composition is tailored to a particular mammal (e.g., a particular human subject) based on the mammal's (e.g., human) microbiota. In some embodiments, the pharmaceutical composition is specific to the microbiota of a mammalian subject (e.g., human). In some embodiments, the pharmaceutical composition is specific to the microbiota of a population of mammals (e.g., humans). A population of mammals can include, but is not limited to, a family, mammals in the same geographic location (e.g., neighborhood, city, state, or country), mammals with the same disease or condition, mammals of a particular age or age range, mammals consuming a particular diet (e.g., food, food source, or caloric intake).

[0177] Treatment of disorders associated with mitochondrial dysfunction Mitochondrial dysfunction is the inability of mitochondria to carry out processes related to normal function, which may result in, for example, problems with electron transport and ATP synthesis, lack of essential substrates, or a decrease in the number of mitochondria in cells.Several mitochondrial diseases are associated with mitochondrial dysfunction, such as mitochondrial myopathy, diabetes and deafness (DAD), Leber's hereditary optic neuropathy, Leigh syndrome, myoneurogenic gastrointestinal encephalopathy, myoclonus epilepsy with ragged red fibers, mitochondrial DNA deficiency syndrome, Alzheimer's dementia, Parkinson's disease, Huntington's disease, amyotrophic lateral sclerosis (ALS), mental retardation, deafness and blindness, diabetes, obesity, cardiovascular disease, stroke, autoimmune disease, multiple sclerosis, Sjogren's syndrome, lupus, or rheumatoid arthritis.

[0178] Mitophagy is an autophagy process that specifically targets dysfunctional or dysfunctional mitochondria and is important for maintaining mitochondrial homeostasis. Nutrient levels and nutritional stressors can lead to changes in mitophagy-related mitochondrial metabolic turnover, affecting overall mitochondrial function. Urolithin A induces mitophagy in muscle and intestinal tissues while promoting mitochondrial biogenesis, leading to improved mitochondrial function. In some embodiments, the present disclosure describes methods for treating mitochondrial disorders and compositions designed for the treatment of mitochondrial disorders.

[0179] Many human diseases are known to be associated with dysfunctional mitochondria, including but not limited to various cancers, neurodegenerative diseases, and metabolic disorders. In some embodiments, the present disclosure can effect changes in mitochondrial function to improve overall health. For example, in certain embodiments, the present disclosure describes the improvement of mitochondrial function by increasing the bioavailability of various nutrients, including but not limited to ellagitannins and their associated metabolites.

[0180] Treatment of polyglutamine (polyQ) disorders Expanded polyglutamine (polyQ) proteins can aggregate in cells, for example in age-related neurodegenerative diseases such as Huntington's disease (among others). In general, polyQ diseases are characterized by genetic mutations of cytosine-adenine-guanine triplet repeat expansions. The mutations lead to expanded repeat elements in proteins causing polyQ expansions. These diseases are characterized by cognitive impairment due to progressive loss of neuronal function. The exact mechanistic details regarding the cause of expanded polyQ toxicity are not fully understood. A prominent phenotype is the aggregation of expanded polyQ proteins. Various cellular pathways, such as lysosomal degradation pathways, autophagy, and proteasomal degradation, are known to promote the clearance of polyQ proteins. In some embodiments, the present disclosure describes the discovery of our product formulations (pome fruit extract and L. plantarum MBT501) that reduce polyQ aggregates in transgenic worms expressing polyQ repeats.

[0181] The methods provided herein may include administering to a subject an ellagitannin composition, an enzyme composition comprising one or more ellagitannin enzymes, or a combination disclosed herein, such that the subject receives a combination disclosed herein. In some embodiments, the method is a method of reducing the formation of polypeptide aggregates in a cell or tissue. In some embodiments, the method is a method of reducing the amount of polypeptide aggregates in a cell or tissue. In some embodiments, the polypeptide aggregates are aggregates of polypeptides that include a polyQ region (i.e., polyQ aggregates). In some embodiments, the polyQ region comprises at least 10, at least 20, at least 30, at least 40, or at least 50 glutamines. In some embodiments, the cell is or comprises a neuron. In some embodiments, the cell is or comprises a central nervous system tissue.

[0182] In some embodiments, the method comprises determining a level of polypeptide aggregate formation in a cell or tissue. In some embodiments, the method comprises determining a level of polypeptide aggregate formation in a cell or tissue. In some embodiments, the method comprises comparing the level of polypeptide aggregate formation in a cell or tissue to a reference level of polypeptide aggregate formation in a cell or tissue. In some embodiments, the reference level is determined in a cell or tissue of a subject to which an ellagitannin composition, an enzyme composition comprising one or more ellagitannin enzymes, or a combination disclosed herein has not been administered. In some embodiments, the method comprises determining a level of polypeptide aggregate formation in a cell or tissue prior to administration. In some embodiments, the method comprises determining a level of polypeptide aggregate formation in a cell or tissue after administration. In some embodiments, the method comprises comparing a level of polypeptide aggregate formation in a cell or tissue determined prior to administration to a level of polypeptide aggregate formation in a cell or tissue determined after administration.

[0183] In some embodiments, the method comprises determining the level of polypeptide aggregates in a cell or tissue. In some embodiments, the method comprises determining the level of polypeptide aggregates in a cell or tissue. In some embodiments, the method comprises comparing the level of polypeptide aggregates in a cell or tissue to a reference level of polypeptide aggregates in a cell or tissue. In some embodiments, the reference level is determined in a cell or tissue of a subject to which an ellagitannin composition, an enzyme composition comprising one or more ellagitannin enzymes, or a combination disclosed herein has not been administered. In some embodiments, the method comprises determining the level of polypeptide aggregates in a cell or tissue prior to administration. In some embodiments, the method comprises determining the level of polypeptide aggregates in a cell or tissue after administration. In some embodiments, the method comprises comparing the level of polypeptide aggregates in a cell or tissue determined prior to administration to the level of polypeptide aggregates in a cell or tissue determined after administration.

[0184] Treatment of liver disease Antioxidant therapy may be beneficial for use in treating various diseases, including liver diseases. The levels of antioxidant compounds in the body may be influenced by the Nrf2 protein, which has been shown to play a role in liver diseases, such as nonalcoholic steatohepatitis, acute hepatotoxicity, nonalcoholic fatty liver disease, alcoholic liver disease, viral hepatitis, liver fibrosis, hepatic IRI, and some liver cancers. Low levels of Nrf2 expression are reported to be associated with reduced antioxidant activity in cells. Administration of ellagitannins can have a positive effect on liver health, for example, by protecting liver cells from ethanol-induced cell damage through increased Nrf2 expression to reduce oxidative stress, thereby reducing oxidative damage. In some embodiments, the disclosure describes methods of treating various liver diseases by administration of ellagitannins and / or probiotic compositions, alone or in combination. In some embodiments, the treatment increases the expression of Nrf2 in liver cells, promoting antioxidant activity in the cells, thereby promoting liver health or function.

[0185] Nuclear factor (erythroid-derived 2)-like 2 (NRF2) is a transcription factor that regulates the expression of antioxidant proteins that protect against oxidative damage caused by injury or inflammation. When cells are not under stress, NRF2 is retained in the cytoplasm by the cytoplasmic inhibitor KEAP (Kelch-like ECH-associated protein 1) and is rapidly degraded. However, when cells are under oxidative stress, NRF2 is not degraded and localizes to the nucleus to induce the expression of antioxidant gene products. Nuclear localization of NRF2 can be used as an indirect measure of NRF2 activity. However, as reported, a simpler way to determine NRF2 activity is to assess the expression levels of genes that are positively regulated by NRF2. Such genes include, but are not limited to, NAD(P)H quinone oxidoreductase 1 (Nqo1), glutamate cysteine ​​ligase, sulfiredoxin 1 (SRXN1), thioredoxin reductase 1 (TXNRD1), heme oxygenase-1 (HMOX1, HO01), glutathione S-transferase (GST), UDP-glucuronosyltransferase (UGT), and multidrug resistance-associated protein (Mrps).

[0186] The present disclosure provides a method comprising administering to a subject an ellagitannin composition, an enzyme composition comprising one or more ellagitannin enzymes, or a combination disclosed herein, such that the subject receives the combination disclosed herein.In some embodiments, the method is a method for modifying the expression level or activity level of Nrf2 in a cell or tissue of a subject.In some embodiments, the method is a method for increasing the expression level or activity level of Nrf2 in a cell or tissue of a subject.

[0187] In some embodiments, the method comprises determining the expression level or activity level of nuclear respiratory factor-2 (Nrf2) in a cell or tissue of a subject. In some embodiments, the method comprises comparing the expression level or activity level of Nrf2 in a cell or tissue with a reference level. In some embodiments, the reference level is the past expression or activity level of Nrf2, the expression level or activity level of nuclear respiratory factor-2 (Nrf2) in a comparable cell or tissue of the subject before receiving the combination, or the expression level or activity level of nuclear respiratory factor-2 (Nrf2) in a comparable cell or tissue of a comparable subject that has not received the combination. In some embodiments, the method comprises determining the expression level or activity level of a gene regulated by Nrf2 expression in a cell or tissue of a subject.

[0188] Antioxidant compounds in the body can protect organisms from reactive processes involving reactive oxygen and nitrogen species (ROS, RNS). These compounds can protect the human body from oxidative stress associated with human diseases, including but not limited to atherosclerosis, diabetes, chronic inflammation, neurodegenerative disorders, and certain cancers. In some embodiments, the disclosure describes compositions and administration methods for altering antioxidant levels in the body. In some embodiments, the method includes determining the level of one or more antioxidants in a cell or tissue of a subject. In some embodiments, the cell or tissue of a subject includes a hepatocyte or liver tissue. In some embodiments, the method includes measuring an indicator of liver health or function in a subject.

[0189] How to Extend Shelf Life Storage methods for improving the shelf life of prebiotics and / or probiotics vary depending on the organism involved. Often, probiotic formulations containing dairy products can be difficult to store while remaining stable and palatable. In some embodiments, the present disclosure describes a method for extending the shelf life of a probiotic composition through the use of one or more fruit extracts. In some embodiments, a method for extending the viable shelf life of a probiotic product comprising an EES microorganism as described herein comprises adding an ellagitannin composition as described herein to the probiotic product, wherein the EES microorganism expresses one or more ellagitannin enzymes as described herein. EXAMPLES

[0190] The following examples are provided to illustrate to one of ordinary skill in the art how to make and use the methods and compositions described herein and are not intended to limit the scope of the disclosure.

[0191] Example 1 In this example, we used qualitative visual screening to characterize the C. elegans transcriptional fusion reporter CL2166 dvIs19[pAF15(gst-4::gfp-nls)]III 1,2 Lactobacillus plastidis, a bacterium that induces gst-4 expression in Escherichia coli nt a ru We demonstrate the identification of m. gst-4, which encodes an antioxidant gene, glutathione-S-transferase (GST), that is regulated by skn-1, a homolog of the transcription factor Nrf2, and plays a key role in the human antioxidant pathway. The transcription factor skn-1 has been reported in the regulation of various antioxidant genes, including the antioxidant gene gst-4. 3 .

[0192] The transgenic strain CL2166 was used, which expresses GFP only in the hypodermal cells when fed only E. coli OP50 and pome fruit extract. E. coli OP50 was used as a control because Caenorhabditis elegans is a standard microbial strain usually grown in the laboratory. Only the bacterium L. plantarum induced some expression in the worm gut. Treatment of the GFP-expressing transgenic strain CL2166 with L. plantarum and pome fruit extract induced GFP expression in the worm gut and throughout the body (Figure 1).

[0193] Example 2 Genes encoding tannase (tanB), gallate decarboxylase (lpdB), and gallate decarboxylase (lpdC) enzymes were examined to determine whether they are involved in ellagitannin metabolism. 4,5 L. plantarum possesses decarboxylase enzymes involved in the breakdown of polyphenolic compounds found in pome fruit extracts, berry extracts, and walnut extracts. 6,7 (Fig. 2a). The effect of pome extract or polyphenolic compounds on the expression of genes encoding the enzymes tannase (tanB), gallic acid decarboxylase (lpdB) and gallic acid decarboxylase (lpdC) was observed by qPCR. Prebiotic pome extract treatment significantly induced (more than three-fold) the expression of tannase (tanB), gallic acid decarboxylase (lpdB) and gallic acid decarboxylase (lpdC) (Fig. 2b).

[0194] Example 3 In this method, a prebiotic pome fruit extract was tested to determine if it could help maintain L. plantarum, for example by extending the shelf life of the bacteria. It was found that pome fruit extract extended the shelf life of L. plantarum, in order to maintain the bacterial L. plantarum population in a beneficial way. L. plantarum treated with pome fruit extract showed the same count (10 billion CFU) for 4 weeks. In contrast, the bacteria alone showed just over half the initial count (Figures 3a and b).

[0195] Example 4 We used a human hepatocyte cell line (HepG) stably expressing an Nrf2-luciferase reporter gene to observe the induction of Nrf2. This cell line showed increased luciferase activity in response to treatment of L. plantarum with pome extract. Luciferase activity increased threefold within 24 hours after treatment compared to bacteria and pome extract alone (Figure 4a).

[0196] Nrf2 induction was also confirmed by Western blot analysis of cell lysates. In whole cell extracts, an increase in Nrf2 protein expression by treatment of L. plantarum with pome fruit was demonstrated. This increase was specific to Nrf2, as there was no change in actin expression. In contrast, there was no change in Nrf2 expression in cell lysates prepared from treatment with L. plantarum and pome fruit extracts alone (Figure 4b).

[0197] Example 5 An example of this is the bacterium L. planta ruWe demonstrate that a combination of MBT501 and pome fruit extract mitigated polyQ aggregates in C. elegans rmls133(unc_54p::Q40::YFP) using qualitative visual screening. Young adult worms showed that the formation of up to 140 aggregated PolyQ40 repeats directly correlated with human disease observations. Such aggregates may contribute to cytotoxicity and degenerative disease (Morley JF, Brignull HR, Weyers JJ, Morimoto RI. Thresholds for Polyglutamine Expansion Protein Aggregation and Cytotoxicity are Dynamic and Affected by Aging in Caenorhabditis elegans. Proc Natl Acad Sci USA. 2002 Aug 6;99(16):10417-22. doi:10.1073 / pnas.152161099. Epub 2002 Jul 16. PMID:12122205, PMCID:PMC124929; Kailiang Jia, Anne C. Hart & Beth Levine (2007) Autophagy Genes Protect Against Disease Caused by Polyglutamine Expansion Proteins in Caenorhabditis elegans,Autophagy,3:1,21-25,DOI:10.4161 / auto.3528,Kokona B,May CA,Cunningham NR,et al.Studying polyglutamine aggregation in Caenorhabditis elegans using an analytical ultracentrifuge equipped with fluorescence detection.Protein Sci.2016;25(3):605-617,doi:10.1002 / pro.2854.

[0198] PolyQ40 repeats fused to YFP were expressed in the cytoplasm of the body wall muscles of worms (transgenic strain unc_54p::Q40::YFP). The worms were fed (1) E. coli OP50, pome fruit extract, (2) L. plantaru m(MBT501), or (3) L. planta ru m(MBT501) and pome fruit extract. E. coli OP50 was used as a control since C. elegans is a standard microbial strain usually grown in the laboratory. As shown, only the bacterium L. plantarum alleviated the formation of PolyQ40 aggregates to some extent. Treatment of L. plantarum and pome fruit extract was shown to alleviate the expression of PolyQ40 aggregates (Figure 5).

[0199] Other embodiments It should be understood by those skilled in the art that various changes, modifications, and improvements to the present disclosure may be easily made by those skilled in the art. Such changes, modifications, and improvements are intended to be part of this disclosure and are intended to be within the spirit and scope of the present invention. Therefore, the foregoing description and drawings are merely examples, and any inventions described in this disclosure, as further described in the following claims, are within the scope of the present invention.

[0200] One of ordinary skill in the art will understand the typical standards of deviation or error attributable to values ​​obtained in the assays or other processes described herein. Publications, websites, and other reference materials referred to herein to describe the background of the invention and to provide additional details regarding its practice are hereby incorporated by reference in their entireties.

[0201] Although embodiments of the invention have been described in conjunction with the detailed description thereof, it should be understood that the foregoing description is intended to illustrate, but not to limit, the scope of the invention, which is defined by the appended claims. Other aspects, advantages, and modifications are within the scope of the following claims.

Claims

1. (a) a composition comprising a plant extract of pomegranate, and (b) Enzyme composition comprising an ellagitannin enzyme synthesizing (EES) microorganism or an extract thereof wherein the EES microorganism is Lactobacillus plantarum and the enzyme composition comprises one or more ellagitannin enzymes.

2. 2. The combination of claim 1, wherein the one or more ellagitannin enzymes comprise one or more enzymes selected from the group consisting of tannin acyl hydrolase enzymes, gallic acid decarboxylase enzymes, and combinations thereof.

3. 3. The combination of claim 2, wherein the one or more ellagitannin enzymes comprises a tannin acyl hydrolase enzyme.

4. 4. The combination of claim 3, wherein the tannin acyl hydrolase enzyme is a tanB tannase enzyme.

5. 5. The combination of any one of claims 2 to 4, wherein the one or more ellagitannin enzymes comprises a gallic acid decarboxylase enzyme.

6. 6. The combination of claim 5, wherein the gallate decarboxylase enzyme is an lpdB gallate decarboxylase enzyme.

7. 6. The combination of claim 5, wherein the gallate decarboxylase enzyme is an lpdC gallate decarboxylase enzyme.

8. 6. The combination of claim 5, wherein the one or more ellagitannin enzymes comprise an lpdB gallate decarboxylase enzyme and an lpdC gallate decarboxylase enzyme.

9. 3. The combination of claim 2, wherein the one or more ellagitannin enzymes comprise a tanB tannase enzyme, an lpdB gallate decarboxylase enzyme, and an lpdC gallate decarboxylase enzyme.

10. 10. The method of claim 1, wherein the EES microorganism is found in nature. The combination according to claim 1.

11. 11. The combination according to any one of claims 1 to 10, wherein the EES microorganism is viable or living.

12. 12. The combination according to any one of claims 1 to 11, wherein the EES microorganism is lyophilized.

13. 13. The combination according to any one of claims 1 to 12, further comprising a prebiotic.

14. 14. The combination of claim 13, wherein the prebiotic is a fructooligosaccharide, inulin, isomaltooligosaccharide, lactilol, lactosucrose, lactulose, soybean oligosaccharide, transgalactooligosaccharide, xylooligosaccharide, or a combination thereof.

15. 15. The combination of claim 1, wherein the composition comprising a plant extract of pomegranate, the enzyme composition, or both, are formulated for oral administration.

16. 16. The combination according to any one of claims 1 to 15, which is a food, beverage, feed composition, or dietary supplement.

17. 17. The combination of any one of claims 1 to 16, which is a liquid, syrup, tablet, troche, gummy, capsule, powder, gel, or film.

18. 18. The combination according to any one of claims 1 to 17, further comprising a pharma- ceutically acceptable carrier.

19. 20. The combination of claim 18 which is an enteric coated formulation.

20. At least 10 ５ 20. The combination of any one of claims 1 to 19, comprising CFU of an EES microorganism.

21. 21. A combination according to any one of claims 1 to 20, formulated for oral administration and which is a dairy product.

Images