TMPRSS6 IRNA COMPOSITIONS AND METHODS OF USE THEREOF

Abstract

To provide methods of treating subjects having a TMPRSS6 associated disorder, e.g., an iron overload associated disorder, such as β-thalassemia or hemochromatosis.SOLUTION: The invention relates to RNAi agents, e.g., double- stranded RNAi agents, targeting the TMPRSS6 gene, and methods of using such RNAi agents to inhibit expression of TMPRSS6.SELECTED DRAWING: None

Description

[Technical Field]

[0001] Related Applications This application claims the benefit of priority to U.S. Provisional Patent Application No. 61 / 826,178, filed May 22, 2013, and U.S. Provisional Patent Application No. 61 / 912,988, filed December 6, 2013. This application is related to U.S. Provisional Patent Application No. 61 / 561,710, filed November 18, 2011, and PCT / US2012 / 065601, filed November 16, 2012. The entire contents of each of the above provisional patent applications are incorporated herein by reference.

[0002] Sequence Listing This application contains a Sequence Listing which has been submitted electronically in ASCII format, and is hereby incorporated by reference in its entirety. The ASCII copy, created on May 21, 2014, is titled 121301-00720_SL.txt and is 449,620 bytes in size. [Background technology]

[0003] The TMPRSS6 (transmembrane protease, serine 6) gene encodes TMPRSS6, also known as matriptase-2, a type II serine protease. The TMPRSS6 gene is primarily expressed in the liver, but high levels of TMPRSS6 mRNA are also found in the kidney, lower levels are found in the uterus, and much smaller amounts are detected in many other tissues (Non-Patent Document 1). TMPRSS6 plays a role in iron homeostasis by binding to hepcidin activator and BMP co-receptor HJV (hemojuvelin) and degrading the protein, thereby causing downregulation of hepcidin levels.

[0004] TMPRSS6 consists of a short N-terminal cytoplasmic tail, a type II transmembrane domain, a stem region composed of two extracellular CUB (complement factors Cls / Clr, sea urchin embryonic growth factor, and BMP (bone morphogenetic protein)) domains, three LDLR (low-density lipoprotein receptor class A) domains, and a C-terminal trypsin-like serine protease domain. There are also consensus sites for N-glycosylation in the extracellular domain and potential phosphorylation sites in the cytoplasmic tail region. [Prior art documents] [Non-patent literature]

[0005] [Non-Patent Document 1] Ramsay et al.,Haematologica(2009),94(6),840-849 Summary of the Invention [Problem to be solved by the invention]

[0006] Many diseases can be associated with iron overload, a condition characterized by increased levels of iron. Iron overload can cause excessive iron deposition in various tissues, leading to tissue and organ damage. Therefore, there is currently a need for methods for the effective treatment of diseases associated with iron overload. [Means for solving the problem]

[0007] The invention provides compositions comprising an RNAi agent, e.g., a double-stranded iRNA agent, that targets TMPRSS6. The invention also provides methods of using the compositions of the invention to inhibit TMPRSS6 expression and treat a TMPRSS6-associated disease, e.g., a disease associated with iron overload, such as thalassemia, e.g., β-thalassemia, or hemochromatosis.

[0008] Thus, in one aspect, the invention provides an RNAi agent, e.g., a double-stranded RNAi agent, capable of inhibiting expression of TMPRSS6 (matriptase-2) in a cell, wherein the double-stranded RNAi agent comprises a sense strand and an antisense strand that form a double-stranded region, wherein the sense strand comprises at least 15 contiguous nucleotides that differ by no more than 3 nucleotides from any one of the nucleotide sequences of SEQ ID NO:1, SEQ ID NO:2, or SEQ ID NO:3, SEQ ID NO:4, or SEQ ID NO:5, and the antisense strand comprises at least 15 contiguous nucleotides that differ by no more than 3 nucleotides from any one of the nucleotide sequences of SEQ ID NO:6, SEQ ID NO:7, or SEQ ID NO:8, SEQ ID NO:9, or SEQ ID NO:10, substantially all of the nucleotides of the sense strand and substantially all of the nucleotides of the antisense strand are modified nucleotides; A double-stranded RNAi agent is provided in which the sense strand is conjugated to a ligand attached at the 3' end.

[0009] In one embodiment, all of the nucleotides in the sense strand and all of the nucleotides in the antisense strand are modified nucleotides.

[0010] In one embodiment, the sense and antisense strands comprise a region of complementarity comprising at least 15 contiguous nucleotides that differ by no more than 3 nucleotides from any one of the antisense sequences listed in any one of Tables 1, 2, 4, 5, 8, 10, and 12.

[0011] In one embodiment, at least one of the modified nucleotides is selected from the group consisting of a 3'-terminal deoxy-thymine (dT) nucleotide, a 2'-O-methyl modified nucleotide, a 2'-fluoro modified nucleotide, a 2'-deoxy-modified nucleotide, a locked nucleotide, an abasic nucleotide, a 2'-amino-modified nucleotide, a 2'-alkyl-modified nucleotide, a morpholino nucleotide, a phosphoramidate, a nucleotide containing an unnatural base, a nucleotide containing a 5'-phosphorothioate group, a nucleotide containing a 5' phosphate or a 5' phosphate mimic (see, e.g., PCT Publication No. WO 2011 / 005860), and a terminal nucleotide linked to a cholesteryl derivative or a dodecanoic acid bisdecylamide group.

[0012] In one embodiment, at least one strand comprises a 3' overhang of at least one nucleotide. In another embodiment, at least one strand comprises a 3' overhang of at least two nucleotides. In another aspect, the invention provides an RNAi agent, e.g., a double-stranded RNAi agent, capable of inhibiting expression of TMPRSS6 (matriptase-2) in a cell, wherein the double-stranded RNAi agent comprises a sense strand that is complementary to an antisense strand, the antisense strand comprising a region complementary to a portion of an mRNA encoding TMPRSS6, each strand being about 14 to about 30 nucleotides in length, and the double-stranded RNAi agent has a structure represented by Formula (III): Sense:5'n p -N a -(XXX) i -N b -YYY-N b -(ZZZ) j -N a -n q 3' Antisense: 3'n p '-N a '-(X'X'X') k -N b '-Y'Y'Y'-N b '-(Z'Z'Z') l -N a '-n q '5'(III) (In the formula: i, j, k, and l are each independently 0 or 1; p, p', q, and q' are each independently 0 to 6; each N a and N a ' independently represent oligonucleotide sequences containing 0-25 nucleotides, either modified or unmodified, or a combination thereof, each sequence containing nucleotides of at least two different modifications; each N b and N b ' independently represents an oligonucleotide sequence containing 0-10 nucleotides, either modified or unmodified, or a combination thereof; Each n may or may not be present p , n p ',n q , and n q ' independently represents an overhanging nucleotide; XXX, YYY, ZZZ, X'X'X', Y'Y'Y', and Z'Z'Z' each independently represent one motif of three identical modifications on three consecutive nucleotides; N b The modification on Y is different from the modification on N b The modification on ' is different from the modification on Y'; the sense strand is conjugated to at least one ligand The present invention provides a double-stranded RNAi agent represented by:

[0013] In one embodiment, i is 0; j is 0; i is 1; j is 1; both i and j are 0; or both i and j are 1. In another embodiment, k is 0; l is 0; k is 1; l is 1; both k and l are 0; or both k and l are 1.

[0014] In one embodiment, XXX is complementary to X'X'X', YYY is complementary to Y'Y'Y', and ZZZ is complementary to Z'Z'Z'.

[0015] In one embodiment, the YYY motif is present at or near the cleavage site on the sense strand.

[0016] In one embodiment, the Y'Y'Y' motif is present at positions 11, 12 and 13 of the 5'-end antisense strand.

[0017] In one embodiment, Y' is 2'-O-methyl.

[0018] In one embodiment, formula (III) is formula (IIIa): Sense:5'n p -N a -YYY-N a -n q 3' Antisense: 3'n p’ -N a’ -Y'Y'Y'-N a’ -n q’ 5'(IIIa) is expressed by

[0019] In another embodiment, formula (III) is formula (IIIb): Sense:5'n p -N a -YYY-N b -ZZZ-N a -n q 3' Antisense: 3'n p’ -N a’ -Y'Y'Y'-N b’ -Z'Z'Z'-N a’ -n q’ 5'(IIIb) (In the formula, each N b and N b ' independently represents an oligonucleotide sequence containing 1 to 5 modified nucleotides) is expressed by

[0020] In yet another embodiment, formula (III) is formula (IIIc): Sense:5'n p -N a -XXX-N b -YYY-Na -n q 3' Antisense: 3'n p’ -N a’ -X'X'X'-N b’ -Y'Y'Y'-N a’ -n q’ 5'(IIIc) (In the formula, each N b and N b ' independently represents an oligonucleotide sequence containing 1 to 5 modified nucleotides) is expressed by

[0021] In one embodiment, formula (III) is formula (IIId): Sense:5'n p -N a -XXX-N b -YYY-N b -ZZZ-N a -n q 3' Antisense: 3'n p’ -N a’ -X'X'X'-N b’ -Y'Y'Y'-N b’ -Z'Z'Z'-N a’ -n q’ 5'(IIId) (In the formula, each N b and N b ' independently represents an oligonucleotide sequence containing 1 to 5 modified nucleotides, and each N a and N a ' independently represent an oligonucleotide sequence containing 2 to 10 modified nucleotides) is expressed by

[0022] In one embodiment, the double-stranded region is 15 to 30 nucleotide pairs in length. In another embodiment, the double-stranded region is 17 to 23 nucleotide pairs in length. In yet another embodiment, the double-stranded region is 17 to 25 nucleotide pairs in length. In one embodiment, the double-stranded region is 23 to 27 nucleotide pairs in length. In another embodiment, the double-stranded region is 19 to 21 nucleotide pairs in length. In another embodiment, the double-stranded region is 21 to 23 nucleotide pairs in length. In one embodiment, each strand has 15 to 30 nucleotides. In another embodiment, each strand has 19 to 30 nucleotides.

[0023] In one embodiment, the modification on the nucleotide is selected from the group consisting of LNA, HNA, CeNA, 2'-methoxyethyl, 2'-O-alkyl, 2'-O-allyl, 2'-C-allyl, 2'-fluoro, 2'-deoxy, 2'-hydroxyl, and combinations thereof. In another embodiment, the modification on the nucleotide is a 2'-O-methyl or 2'-fluoro modification.

[0024] In one embodiment, the ligand is one or more GalNAc derivatives attached via a bivalent or trivalent branched linker. [ka] is.

[0025] In one embodiment, the ligand is attached to the 3' end of the sense strand.

[0026] In one embodiment, the RNAi agent is shown in the following schematic diagram: [ka] wherein X is O or S. In certain embodiments, X is O.

[0027] In one embodiment, the agent further comprises at least one phosphorothioate or methylphosphonate internucleotide linkage.

[0028] In one embodiment, the phosphorothioate or methylphosphonate internucleotide linkage is at the 3'-end of one strand. In one embodiment, the strand is the antisense strand. In another embodiment, the strand is the sense strand.

[0029] In one embodiment, the phosphorothioate or methylphosphonate internucleotide linkage is at the 5'-end of one strand. In one embodiment, the strand is the antisense strand. In another embodiment, the strand is the sense strand.

[0030] In one embodiment, the phosphorothioate or methylphosphonate internucleotide linkages are at both the 5' and 3' ends of one strand. In one embodiment, the strand is the antisense strand.

[0031] In one embodiment, the RNAi agent comprises 6 to 8 phosphorothioate internucleotide linkages.

[0032] In one embodiment, the antisense strand comprises two phosphorothioate internucleotide linkages at the 5' end and two phosphorothioate internucleotide linkages at the 3' end, and the sense strand comprises at least two phosphorothioate internucleotide linkages at either the 5' end or the 3' end.

[0033] In one embodiment, the base pair at position 1 of the 5' end of the antisense strand of the duplex is an AU base pair.

[0034] In one embodiment, the Y nucleotide comprises a 2'-fluoro modification.

[0035] In one embodiment, the Y' nucleotide comprises a 2'-O-methyl modification.

[0036] In one embodiment, p'>0. In another embodiment, p'=2.

[0037] In one embodiment, q'=0, p=0, q=0, and the p' overhanging nucleotides are complementary to the target mRNA. In another embodiment, q'=0, p=0, q=0, and the p' overhanging nucleotides are non-complementary to the target mRNA.

[0038] In one embodiment, the sense strand has a total of 21 nucleotides and the antisense strand has a total of 23 nucleotides.

[0039] In one embodiment, at least one n p ' is attached to the adjacent nucleotide via a phosphorothioate bond.

[0040] In one embodiment, all n p ' is attached to the adjacent nucleotide via a phosphorothioate bond.

[0041] In one embodiment, the RNAi agent is selected from the group of RNAi agents listed in any one of Tables 1, 2, 4, 5, 8, 10, and 12.

[0042] In one embodiment, the RNAi agent is AD-59743. In another embodiment, the RNAi agent is AD-60940.

[0043] In one aspect, the present invention provides a double-stranded RNAi agent for inhibiting expression of TMPRSS6 in a cell, comprising: the double-stranded RNAi agent comprises a sense strand and an antisense strand that form a double-stranded region; the sense strand comprises at least 15 consecutive nucleotides that differ by no more than three nucleotides from any one of the nucleotide sequences of SEQ ID NO:1, SEQ ID NO:2, or SEQ ID NO:3, SEQ ID NO:4, or SEQ ID NO:5, and the antisense strand comprises at least 15 consecutive nucleotides that differ by no more than three nucleotides from any one of the nucleotide sequences of SEQ ID NO:6, SEQ ID NO:7, SEQ ID NO:8, SEQ ID NO:9, or SEQ ID NO:10; substantially all of the nucleotides of the sense strand comprise a modification selected from the group consisting of a 2'-O-methyl modification and a 2'-fluoro modification; the sense strand comprises two phosphorothioate internucleotide linkages at the 5' end; substantially all of the nucleotides of the antisense strand comprise a modification selected from the group consisting of a 2'-O-methyl modification and a 2'-fluoro modification; the antisense strand comprises two phosphorothioate internucleotide linkages at the 5' end and two phosphorothioate internucleotide linkages at the 3' end; Double-stranded RNAi agents are provided in which the sense strand is conjugated at the 3' end to one or more GalNAc derivatives attached via a branched bivalent or trivalent linker.

[0044] In one embodiment, all of the nucleotides in the sense strand and all of the nucleotides in the antisense strand comprise a modification.

[0045] In another aspect, the present invention provides an RNAi agent, e.g., a double-stranded RNAi agent, capable of inhibiting expression of TMPRSS6 (matriptase-2) in a cell, wherein the double-stranded RNAi agent comprises a sense strand that is complementary to an antisense strand, and the antisense strand comprises a region that is complementary to a portion of an mRNA encoding TMPRSS6, each strand being about 14 to about 30 nucleotides in length, and the double-stranded RNAi agent has a structure represented by formula (III): Sense:5'n p -N a -(XXX) i -N b -YYY-N b -(ZZZ) j -Na -n q 3' Antisense: 3'n p '-N a '-(X'X'X') k -N b '-Y'Y'Y'-N b '-(Z'Z'Z') l -N a '-n q '5'(III) (In the formula: i, j, k, and l are each independently 0 or 1; p, p', q, and q' are each independently 0 to 6; each N a and N a ' independently represent oligonucleotide sequences containing 0-25 nucleotides, either modified or unmodified, or a combination thereof, each sequence containing nucleotides of at least two different modifications; each N b and N b ' independently represents an oligonucleotide sequence containing 0-10 nucleotides, either modified or unmodified, or a combination thereof; Each n may or may not be present p , n p ',n q , and n q ' independently represents an overhanging nucleotide; XXX, YYY, ZZZ, X'X'X', Y'Y'Y', and Z'Z'Z' each independently represent one motif of three identical modifications on three consecutive nucleotides, wherein the modifications are 2'-O-methyl or 2'-fluoro modifications; N b The modification on Y is different from the modification on N b The modification on ' is different from the modification on Y'; the sense strand is conjugated to at least one ligand The present invention provides a double-stranded RNAi agent represented by:

[0046] In yet another aspect, the present invention provides an RNAi agent, e.g., a double-stranded RNAi agent, capable of inhibiting expression of TMPRSS6 (matriptase-2) in a cell, wherein the double-stranded RNAi agent comprises a sense strand complementary to an antisense strand, the antisense strand comprising a region complementary to a portion of an mRNA encoding TMPRSS6, each strand being about 14 to about 30 nucleotides in length, and the double-stranded RNAi agent has a structure represented by formula (III): Sense:5'n p -N a -(XXX) i -N b -YYY-N b -(ZZZ) j -N a -n q 3' Antisense: 3'n p '-N a '-(X'X'X') k -N b '-Y'Y'Y'-N b '-(Z'Z'Z') l -N a '-n q '5'(III) (In the formula: i, j, k, and l are each independently 0 or 1; Each n may or may not be present p , n q , and n q ' independently represents an overhanging nucleotide; p, q, and q' are each independently 0 to 6; n p '>0 and at least one n p ' is attached to the adjacent nucleotide via a phosphorothioate bond; each N a and N a ' independently represent oligonucleotide sequences containing 0-25 nucleotides, either modified or unmodified, or a combination thereof, each sequence containing nucleotides of at least two different modifications; each N b and N b' independently represents an oligonucleotide sequence containing 0-10 nucleotides, either modified or unmodified, or a combination thereof; XXX, YYY, ZZZ, X'X'X', Y'Y'Y', and Z'Z'Z' each independently represent one motif of three identical modifications on three consecutive nucleotides, wherein the modifications are 2'-O-methyl or 2'-fluoro modifications; N b The modification on Y is different from the modification on N b The modification on ' is different from the modification on Y'; the sense strand is conjugated to at least one ligand The present invention provides a double-stranded RNAi agent represented by:

[0047] In a further aspect, the present invention provides an RNAi agent, e.g., a double-stranded RNAi agent, capable of inhibiting expression of TMPRSS6 (matriptase-2) in a cell, wherein the double-stranded RNAi agent comprises a sense strand that is complementary to an antisense strand, and the antisense strand comprises a region that is complementary to a portion of an mRNA encoding TMPRSS6, each strand being about 14 to about 30 nucleotides in length, and wherein the double-stranded RNAi agent has a structure represented by formula (III): Sense:5'n p -N a -(XXX) i -N b -YYY-N b -(ZZZ) j -N a -n q 3' Antisense: 3'n p '-N a '-(X'X'X') k -N b '-Y'Y'Y'-N b '-(Z'Z'Z') l -N a '-n q '5'(III) (In the formula: i, j, k, and l are each independently 0 or 1; Each n may or may not be present p , nq , and n q ' independently represents an overhanging nucleotide; p, q, and q' are each independently 0 to 6; n p '>0 and at least one n p ' is attached to the adjacent nucleotide via a phosphorothioate bond; each N a and N a ' independently represent oligonucleotide sequences containing 0-25 nucleotides, either modified or unmodified, or a combination thereof, each sequence containing nucleotides of at least two different modifications; each N b and N b ' independently represents an oligonucleotide sequence containing 0-10 nucleotides, either modified or unmodified, or a combination thereof; XXX, YYY, ZZZ, X'X'X', Y'Y'Y', and Z'Z'Z' each independently represent one motif of three identical modifications on three consecutive nucleotides, wherein the modifications are 2'-O-methyl or 2'-fluoro modifications; N b The modification on Y is different from the modification on N b The modification on ' is different from the modification on Y'; the sense strand is conjugated to at least one ligand, the ligand being one or more GalNAc derivatives attached via a bivalent or trivalent branched linker; The present invention provides a double-stranded RNAi agent represented by:

[0048] In another aspect, the present invention provides an RNAi agent, e.g., a double-stranded RNAi agent, capable of inhibiting expression of TMPRSS6 (matriptase-2) in a cell, wherein the double-stranded RNAi agent comprises a sense strand that is complementary to an antisense strand, and the antisense strand comprises a region that is complementary to a portion of an mRNA encoding TMPRSS6, each strand being about 14 to about 30 nucleotides in length, and the double-stranded RNAi agent has a structure represented by formula (III): Sense:5'n p -Na -(XXX) i -N b -YYY-N b -(ZZZ) j -N a -n q 3' Antisense: 3'n p '-N a '-(X'X'X') k -N b '-Y'Y'Y'-N b '-(Z'Z'Z') l -N a '-n q '5'(III) (In the formula: i, j, k, and l are each independently 0 or 1; Each n may or may not be present p , n q , and n q ' independently represents an overhanging nucleotide; p, q, and q' are each independently 0 to 6; n p '>0 and at least one n p ' is attached to the adjacent nucleotide via a phosphorothioate bond; each N a and N a ' independently represent oligonucleotide sequences containing 0-25 nucleotides, either modified or unmodified, or a combination thereof, each sequence containing nucleotides of at least two different modifications; each N b and N b ' independently represents an oligonucleotide sequence containing 0-10 nucleotides, either modified or unmodified, or a combination thereof; XXX, YYY, ZZZ, X'X'X', Y'Y'Y', and Z'Z'Z' each independently represent one motif of three identical modifications on three consecutive nucleotides, wherein the modifications are 2'-O-methyl or 2'-fluoro modifications; N b The modification on Y is different from the modification on N bThe modification on ' is different from the modification on Y'; the sense strand comprises at least one phosphorothioate linkage; the sense strand is conjugated to at least one ligand, the ligand being one or more GalNAc derivatives attached via a bivalent or trivalent branched linker; The present invention provides a double-stranded RNAi agent represented by:

[0049] In yet another aspect, the present invention provides an RNAi agent, e.g., a double-stranded RNAi agent, capable of inhibiting expression of TMPRSS6 (matriptase-2) in a cell, wherein the double-stranded RNAi agent comprises a sense strand that is complementary to an antisense strand, and the antisense strand comprises a region that is complementary to a portion of an mRNA encoding TMPRSS6, each strand being about 14 to about 30 nucleotides in length, and the double-stranded RNAi agent has a structure represented by formula (III): Sense:5'n p -N a -YYY-N a -n q 3' Antisense: 3'n p '-N a '-Y'Y'Y'-N a '-n q '5'(IIIa) (In the formula: Each n may or may not be present p , n q , and n q ' independently represents an overhanging nucleotide; p, q, and q' are each independently 0 to 6; n p '>0 and at least one n p ' is attached to the adjacent nucleotide via a phosphorothioate bond; each N a and N a ' independently represent oligonucleotide sequences containing 0-25 nucleotides, either modified or unmodified, or a combination thereof, each sequence containing nucleotides of at least two different modifications; YYY and Y'Y'Y' each independently represent one motif of three identical modifications on three consecutive nucleotides, wherein the modifications are 2'-O-methyl or 2'-fluoro modifications; the sense strand comprises at least one phosphorothioate linkage; the sense strand is conjugated to at least one ligand, the ligand being one or more GalNAc derivatives attached via a bivalent or trivalent branched linker; The present invention provides a double-stranded RNAi agent represented by:

[0050] In one embodiment, the invention provides an RNAi agent selected from the group of RNAi agents listed in any one of Tables 1, 2, 4, 5, 8, 19, and 12.

[0051] In one aspect, the invention provides a composition comprising a modified antisense polynucleotide agent, wherein the agent is capable of inhibiting expression of TMPRSS6 in a cell and comprises a sequence complementary to a sense sequence selected from the group of sequences listed in any one of Tables 1, 2, 4, 5, 8, 10, and 12, and wherein the polynucleotide is about 14 to about 30 nucleotides in length.

[0052] The invention also provides, for example, cells, vectors, host cells, and pharmaceutical compositions comprising the double-stranded RNAi agents of the invention.

[0053] In certain embodiments, the RNAi agent is administered using a pharmaceutical composition.

[0054] In a preferred embodiment, the RNAi agent is administered in a solution. In some such embodiments, the siRNA is administered in a non-buffered solution. In one embodiment, the siRNA is administered in water. In other embodiments, the siRNA is administered with a buffer such as acetate buffer, citrate buffer, prolamin buffer, carbonate buffer, or phosphate buffer, or any combination thereof. In some embodiments, the buffer is phosphate buffered saline (PBS).

[0055] In one embodiment, the pharmaceutical composition further comprises a lipid formulation. In one embodiment, the lipid formulation comprises LNP or XTC. In another embodiment, the lipid formulation comprises MC3.

[0056] In one aspect, the present invention provides a method for inhibiting TMPRSS6 expression in a cell, the method comprising the steps of contacting the cell with an RNAi agent, such as a double-stranded RNAi agent, or a modified antisense polynucleotide agent of the present invention, or a vector of the present invention, or a pharmaceutical composition of the present invention, and maintaining the cell produced in step (a) for a time sufficient to allow degradation of mRNA transcripts of the TMPRSS6 gene, thereby inhibiting expression of the TMPRSS6 gene in the cell.

[0057] In one embodiment, the cell is in a subject.

[0058] In one embodiment, the subject is a human.

[0059] In one embodiment, TMPRSS6 expression is inhibited by at least about 30%, 35%, 40%, 45%, 50%, 55%, 60%, 65%, 70%, 75%, 80%, 85%, 90%, 95%, 98%, or 100%.

[0060] In another embodiment, hepcidin gene expression is increased by at least about 1.5-fold, about 2-fold, about 3-fold, about 4-fold, or about 5-fold.

[0061] In yet other embodiments, serum hepcidin concentrations are increased by at least about 10%, about 25%, about 50%, about 100%, about 150%, about 200%, about 250%, or about 300%.

[0062] In one embodiment, serum iron concentrations are reduced by at least about 20%, about 30%, about 40%, about 50%, about 60%, about 70%, about 80%, about 90%, about 95%, about 98%, or about 100%.

[0063] In another embodiment, the percent transferrin saturation is reduced by at least about 20%, about 30%, about 40%, about 50%, about 60%, about 70%, about 80%, about 90%, about 95%, about 98%, or about 100%.

[0064] In another aspect, the present invention provides a method for treating a subject suffering from a disease mediated by or associated with TMPRSS6 expression, comprising administering to the subject a therapeutically effective amount of an RNAi agent of the present invention, such as a double-stranded RNAi agent, or a modified antisense polynucleotide agent of the present invention, or a vector of the present invention, or a pharmaceutical composition of the present invention, thereby treating the subject.

[0065] In one embodiment, the present invention provides a method for treating a subject suffering from a disease associated with TMPRSS6, the method comprising subcutaneously administering a therapeutically effective amount of a double-stranded RNAi agent to the subject, thereby treating the subject; the double-stranded RNAi agent comprises a sense strand and an antisense strand that form a double-stranded region; the sense strand comprises at least 15 consecutive nucleotides that differ by no more than three nucleotides from any one of the nucleotide sequences of SEQ ID NO:1, SEQ ID NO:2, or SEQ ID NO:3, SEQ ID NO:4, or SEQ ID NO:5, and the antisense strand comprises at least 15 consecutive nucleotides that differ by no more than three nucleotides from any one of the nucleotide sequences of SEQ ID NO:6, SEQ ID NO:7, SEQ ID NO:8, SEQ ID NO:9, or SEQ ID NO:10; substantially all of the nucleotides of the antisense strand comprise a modification selected from the group consisting of a 2'-O-methyl modification and a 2'-fluoro modification; the antisense strand comprises two phosphorothioate internucleotide linkages at the 5' end and two phosphorothioate internucleotide linkages at the 3' end, substantially all of the nucleotides of the sense strand comprise a modification selected from the group consisting of a 2'-O-methyl modification and a 2'-fluoro modification; the sense strand comprises two phosphorothioate internucleotide linkages at the 5' end; The sense strand is conjugated at the 3' end to one or more GalNAc derivatives attached via a branched bivalent or trivalent linker.

[0066] In one embodiment, all of the nucleotides in the sense strand and all of the nucleotides in the antisense strand comprise a modification.

[0067] In one embodiment, the subject is a human.

[0068] In one embodiment, the subject has a disease associated with iron overload, such as hereditary hemochromatosis, β-thalassemia (e.g., β-thalassemia major and β-thalassemia intermedia), erythroporphyria, Parkinson's disease, Alzheimer's disease, or Friedreich's ataxia.

[0069] In one embodiment, the RNAi agent, e.g., a double-stranded RNAi agent, is administered at a concentration of about 0.01 mg / kg to about 10 mg / kg, about 1 mg / kg to about 10 mg / kg, about 2 mg / kg to about 10 mg / kg, about 3 mg / kg to about 10 mg / kg, about 4 mg / kg to about 10 mg / kg, about 5 mg / kg to about 15 mg / kg, about 6 mg / kg to about 15 mg / kg, about 7 mg / kg to about 15 mg / kg, In certain embodiments, the double-stranded RNAi agent is administered at a dose of about 0.1 mg / kg, about 1.0 mg / kg, or about 3.0 mg / kg.

[0070] In one embodiment, the RNAi agent, eg, a double-stranded RNAi agent, is administered subcutaneously or intravenously.

[0071] In one embodiment, the RNAi agent is administered in two or more doses. In certain embodiments, the RNAi agent is administered at intervals selected from the group consisting of about once every 12 hours, about once every 24 hours, about once every 48 hours, about once every 72 hours, about once every 96 hours, about once every 7 days, or about once every 14 days. In certain embodiments, the RNAi agent is administered once a week for two weeks or less, three weeks or less, four weeks or less, five weeks or less, or more.

[0072] In yet another aspect, the invention provides a method for treating a disease associated with iron overload in a subject, the method comprising administering to the subject a therapeutically effective amount of an RNAi agent, e.g., a double-stranded RNAi agent, or a vector of the invention, thereby treating the subject.

[0073] In one embodiment, the disease associated with iron overload is hemochromatosis. In another embodiment, the disease associated with iron overload is thalassemia, e.g., β-thalassemia (e.g., β-thalassemia major and β-thalassemia intermedia), or erythropoietic porphyria. In yet another embodiment, the disease associated with iron overload is a neurological disease, e.g., Parkinson's disease, Alzheimer's disease, or Friedreich's ataxia.

[0074] In one embodiment, the subject is a primate or rodent, hi another embodiment, the subject is a human.

[0075] In one embodiment, the RNAi agent, e.g., a double-stranded RNAi agent, is administered at a dose of about 0.01 mg / kg to about 10 mg / kg, about 0.5 mg / kg to about 50 mg / kg, about 10 mg / kg to about 30 mg / kg, about 10 mg / kg to about 20 mg / kg, about 15 mg / kg to about 20 mg / kg, about 15 mg / kg to about 25 mg / kg, about 15 mg / kg to about 30 mg / kg, or about 20 mg / kg to about 30 mg / kg.

[0076] In one embodiment, the RNAi agent, eg, a double-stranded RNAi agent, is administered subcutaneously or intravenously.

[0077] In one embodiment, the RNAi agent is administered in two or more doses. In certain embodiments, the RNAi agent is administered at intervals selected from the group consisting of about once every 12 hours, about once every 24 hours, about once every 48 hours, about once every 72 hours, about once every 96 hours, about once every 7 days, or about once every 14 days.

[0078] In one embodiment, the administration reduces iron levels, ferritin levels and / or transferrin saturation levels in the subject.

[0079] In one embodiment, the method further comprises determining iron levels in the subject.

[0080] In one embodiment, a method of the invention comprising administering to a subject an iRNA agent of the invention (or a pharmaceutical composition of the invention) is practiced in combination with the administration of an additional agent and / or other therapeutic method, hi one embodiment, a method of the invention further comprises administering to a subject an iron chelator, e.g., deferiprone, deferoxamine, and deferasirox.

[0081] The present invention is further illustrated by the following detailed description and drawings. [Brief explanation of the drawings]

[0082] [Figure 1] 1 is a graph showing the relative levels of TMPRSS6 mRNA in the liver of wild-type mice following administration of a single dose of 1 mg / kg, 3 mg / kg, or 10 mg / kg of the iRNA agent AD-59743. [Figure 2] 1 is a graph showing relative levels of hepcidin mRNA in the liver of wild-type mice following administration of a single dose of 1 mg / kg, 3 mg / kg, or 10 mg / kg of the iRNA agent AD-59743. [Figure 3-1]Figure 3A shows the levels of liver TMPRSS6 mRNA (Figure 3A) and liver hepcidin mRNA (Figure 3B) in C57BL / 6 mice at various time points after a single subcutaneous injection of AD-60940 at doses of 0.3 mg / kg, 1.0 mg / kg, or 3.0 mg / kg, or PBS alone (control). Each data point represents the average value from three mice. The standard deviation of the mean is represented by the error bars. [Figure 3-2] Serum hepcidin (FIG. 3C) and total serum iron (FIG. 3D) levels in C57BL / 6 mice at various time points after a single subcutaneous injection of AD-60940 at doses of 0.3 mg / kg, 1.0 mg / kg, or 3.0 mg / kg, or PBS alone (control). Each data point represents the mean value of three mice. The standard deviation of the mean is represented by the error bars. [Figure 3-3] Figure 3E shows the level of percent transferrin saturation in C57BL / 6 mice at various time points after a single subcutaneous injection of AD-60940 at doses of 0.3 mg / kg, 1.0 mg / kg, or 3.0 mg / kg, or PBS alone (control). Each data point represents the mean value of three mice. The standard deviation of the mean is represented by the error bars. Figure 3F shows the relative liver TMPRSS6 mRNA concentration as a function of AD-60940 dose 11 days after administration. Each data point represents the maximum suppression of TMPRSS6 mRNA concentration observed at each dose level. Data were fitted to the Hill equation. [Figure 4] Figure 4A: Schematic diagram showing the dosing regimen of once-weekly administration for 3 weeks followed by sacrifice of mice on day 21. Figure 4B: Graph showing liver TMPRSS6 mRNA, liver hepcidin mRNA, and percent transferrin saturation levels in C57BL / 6 mice administered subcutaneous injections of AD-60940 at doses of 0.3 mg / kg, 1.0 mg / kg, or PBS (control) according to the regimen shown in Figure 4A. Each bar represents the mean value for three mice. The standard deviation of the mean is represented by the error bars. Figure 4C: Relative liver TMPRSS6 mRNA concentrations as a function of AD-60940 dose. Data were fitted to the Hill equation. [Figure 5] 5A and 5B are graphs showing the relationship between serum hepcidin concentration and relative TMPRSS6 mRNA levels (FIG. 5A), the relationship between percent transferrin saturation and relative TMPRSS6 mRNA levels (FIG. 5B), the relationship between serum hepcidin concentration and relative hepcidin mRNA levels (FIG. 5C), and the relationship between percent transferrin saturation and serum hepcidin concentration (FIG. 5D). [Figure 6] 1 is a graph showing relative levels of TMPRSS6 mRNA in the liver of C57BL / 6 mice after a single subcutaneous administration of 3 mg / kg of the indicated iRNA agent or PBS (control). Bars represent the mean of three mice, and error bars represent the standard deviation of the mean. [Figure 7] 1 is a graph showing relative levels of TMPRSS6 mRNA in the liver of C57BL / 6 mice after subcutaneous administration of the indicated iRNA agent at 0.3 mg / kg or 1.0 mg / kg, or PBS (control), once weekly for 3 weeks. Bars represent the mean of three mice, and error bars represent the standard deviation of the mean. [Figure 8] The nucleotide sequence of human (Homo sapiens) TMPRSS6 (SEQ ID NO: 1) is shown. [Figure 9] The nucleotide sequence of Mus musculus TMPRSS6 (SEQ ID NO: 2) is shown. [Figure 10] The nucleotide sequence of Rattus norvegicus TMPRSS6 (SEQ ID NO: 3) is shown. [Figure 11] The nucleotide sequence of rhesus monkey (Macaca mulatta) TMPRSS6 (SEQ ID NO: 4) is shown. [Figure 12] The nucleotide sequence of rhesus monkey (Macaca mulatta) TMPRSS6 (SEQ ID NO: 5) is shown. [Figure 13] The reverse complementary sequence of SEQ ID NO: 1 (SEQ ID NO: 6) is shown. [Figure 14] The reverse complementary sequence of SEQ ID NO: 2 (SEQ ID NO: 7) is shown. [Figure 15]The reverse complementary sequence of SEQ ID NO:3 (SEQ ID NO:8) is shown. [Figure 16] The reverse complement sequence of SEQ ID NO: 4 (SEQ ID NO: 9) is shown. [Figure 17] The reverse complementary sequence of SEQ ID NO: 5 (SEQ ID NO: 10) is shown. DETAILED DESCRIPTION OF THE INVENTION

[0083] The invention provides compositions comprising RNAi agents, e.g., double-stranded iRNA agents, that target TMPRSS6. The invention also provides methods of using the compositions of the invention to inhibit TMPRSS6 expression and treat TMPRSS6-associated diseases, e.g., β-thalassemia or hemochromatosis.

[0084] TMPRSS6 plays an important role in iron homeostasis as an inhibitor of HAMP gene expression. The HAMP gene encodes the hepatic hormone hepcidin, a central regulator of iron homeostasis. Hepcidin binds to the iron efflux protein ferroportin (FPN1), which is primarily localized in absorptive enterocytes, hepatocytes, and macrophages. Hepcidin binding to the extracellular domain of ferroportin leads to its internalization and degradation, thus reducing dietary iron absorption from the intestine and iron release from macrophages and hepatocytes. HAMP gene expression can be stimulated in response to iron through a bone morphogenetic protein (BMP) / Sons of Mothers Against Decapentaplegic (SMAD)-dependent signaling cascade mediated by the BMP coreceptor hemojuvelin (HJV). TMPRSS6's key role in HAMP regulation is to inhibit BMP-mediated HAMP upregulation. TMPRSS6 cleaves the BMP coreceptor HJV, which is essential for BMP-mediated HAMP upregulation; thus, it inhibits BMP-mediated HAMP upregulation by preventing BMP signaling, SMAD translocation to the nucleus, and HAMP transcriptional activation.

[0085] Several human and mouse studies have confirmed the role of TMPRSS6 in HAMP regulation and iron homeostasis (Du et al., Science 2008, Vol. 320, pp. 1088-1092; Folgueras et al., Blood 2008, Vol. 112, pp. 2539-45). Studies have shown that loss-of-function mutations in TMPRSS6 lead to upregulation of hepcidin expression and can cause a hereditary iron deficiency anemia called iron-refractory iron deficiency anemia (IRIDA), which is characterized by elevated hepcidin levels, hypochromic microcytic anemia, low mean corpuscular volume (MCV), low transferrin saturation, inadequate oral iron absorption, and an incomplete response to parenteral iron (Finberg, Seminars in Hematology 2009, Vol. 46, pp. 378-86). However, loss-of-function mutations in positive regulators of HAMP (e.g., BMP1, BMP4, and HFE) have been shown to downregulate hepcidin expression and cause iron overload (Milet et al. Am J Hum Gen 2007, Vol. 81, pp. 799-807; Finberg et al. Blood 2011, Vol. 117, pp. 4590-9). In primary iron overload disorders collectively known as hereditary hemochromatosis (HH), anemia characterized by massive ineffective hematopoiesis, and iron overload (secondary hemochromatosis) such as β-thalassemia intermedia (TI), hepcidin levels are low despite elevated serum iron concentrations and iron stores. A mouse model of beta-thalassemia intermedia demonstrated that reduced TMPRSS6 expression leads to increased hepcidin levels (Finberg 2010 Oral Presentation: "TMPRSS6, an inhibitor of hepatic BMP / Smad signaling, is required for hepcidin suppression and iron loading in a mouse model of beta-thalassemia." American Society of Hematology Annual Meeting 2010, Abstract No.: 164).

[0086] The present invention describes iRNA agents, compositions, and methods for regulating the expression of the TMPRSS6 gene. In certain embodiments, TMPRSS6 expression is reduced or inhibited using a TMPRSS6-specific iRNA agent, thereby resulting in increased HAMP expression and reduced serum iron levels. Thus, inhibiting the expression or activity of the TMPRSS6 gene using the iRNA compositions featured in the present invention may be a useful therapeutic approach aimed at reducing iron levels in a subject. Such inhibition may be useful for treating diseases associated with iron overload, such as hemochromatosis or thalassemia, e.g., β-thalassemia (e.g., β-thalassemia major and β-thalassemia intermedia).

[0087] I. Definition So that the present invention may be more readily understood, several terms are first defined. Furthermore, it should be noted that whenever a value or range of values ​​for a variable is recited, all values ​​and ranges intermediate to the recited values ​​are also intended to be part of the invention.

[0088] The articles "a" and "an" are used herein to refer to one or to more than one (i.e., to at least one) of the grammatical object of the article. By way of example, "an element" means one element or more than one element, e.g., a plurality of elements.

[0089] The term "including" is used herein to mean, and is used synonymously with, the phrase "including but not limited to."

[0090] The term "or" is used herein to mean, and is used interchangeably with, the term "and / or," unless context clearly indicates otherwise.

[0091] As used herein, "TMPRSS6" refers to a type II plasma membrane serine protease (TTSP) gene or protein. TMPRSS6 is also known as matriptase-2, IRIDA (iron-refractory iron deficiency anemia), transmembrane protease serine 6, type II transmembrane serine protease 6, and membrane-bound mosaic serine proteinase matriptase-2. TMPRSS6 is a serine protease type II transmembrane protein approximately 899 amino acids in length. TMPRSS6 contains multiple domains, including a short internal region, a transmembrane domain, a sea urchin sperm protein / enteropeptidase domain / agrin (SEA) domain, two complement factor / sea urchin embryonic growth factor / BMP domains (CUBs), three LDL-R class a domains (LDLas), and a trypsin-like serine protease domain with a conserved His-Asp-Ser triad (HDS). The term "TMPRSS6" includes human TMPRSS6 (the amino acid and nucleotide sequences of which can be found, for example, in GenBank Accession No. GI:56682967); mouse TMPRSS6 (the amino acid and nucleotide sequences of which can be found, for example, in GenBank Accession No. GI:125656151); rat TMPRSS6 (the amino acid and nucleotide sequences of which can be found, for example, in GenBank Accession No. GI:194474097); and rhesus TMPRSS6 (the amino acid and nucleotide sequences of which can be found, for example, in GenBank Accession Nos. XM_001085203.2 (GI:297260989) and XM_001085319.1 (GI:109094061)). Further examples of AGT mRNA sequences are readily available using public databases, such as GenBank, UniProt, OMIM, and the Macaca Genome Project website.

[0092] As used herein, the term "TMPRSS6" also refers to variations in the natural DNA sequence of the TMPRSS6 gene, such as single nucleotide polymorphisms (SNPs) in the TMPRSS6 gene. Exemplary SNPs can be found in the dbSNP database available at www.ncbi.nlm.nih.gov / projects / SNP.

[0093] As used herein, "target sequence" refers to a contiguous portion of the nucleotide sequence of an mRNA molecule formed upon transcription of the TMPRSS6 gene, including mRNA that is the product of RNA processing of a primary transcript.

[0094] As used herein, the term "strand comprising a sequence" refers to an oligonucleotide comprising a strand of nucleotides represented by a sequence given using standard nucleotide nomenclature.

[0095] "G," "C," "A," and "U" generally represent nucleotides containing guanine, cytosine, adenine, and uracil as bases, respectively. "T" and "dT" are used interchangeably herein to refer to deoxyribonucleotides in which the nucleobase is thymine, e.g., deoxyribothymine, 2'-deoxythymidine, or thymidine. However, it will be understood that the terms "ribonucleotide" or "nucleotide" or "deoxyribonucleotide" can also refer to modified nucleotides or surrogate replacement moieties, as described in more detail below. Those skilled in the art will appreciate that guanine, cytosine, adenine, and uracil can be substituted by other moieties without significantly altering the base-pairing properties of oligonucleotides containing nucleotides with such replacement moieties. For example, but not limited to, a nucleotide containing inosine as its base can base pair with a nucleotide containing adenine, cytosine, or uracil. Thus, nucleotides containing uracil, guanine, or adenine may be substituted in the nucleotide sequences of the invention by nucleotides containing, for example, inosine, and sequences containing such substituted moieties are embodiments of the invention.

[0096] The terms "iRNA," "RNAi agent," "iRNA agent," and "RNA interfering agent," as used interchangeably herein, refer to an agent that contains RNA and mediates targeted cleavage of RNA transcripts via the RNA-induced silencing complex (RISC) pathway, as those terms are defined herein. iRNA directs sequence-specific degradation of mRNA through a process known as RNA interference (RNAi). iRNA regulates (e.g., inhibits) the expression of TMPRSS6 in cells, e.g., cells in a subject, such as a mammalian subject.

[0097] In one embodiment, the RNAi agent of the present invention comprises a single-stranded RNA that interacts with a target RNA sequence, such as a TMPRSS6 target mRNA sequence, and induces cleavage of the target RNA. Without wishing to be bound by theory, it is believed that long double-stranded RNA introduced into cells is degraded into siRNAs by a type III endonuclease known as Dicer (Sharp et al. (2001) Genes Dev. 15:485). Dicer, a RNase III-like enzyme, processes dsRNA into 19-23 base pair short interfering RNAs with characteristic two-base 3' overhangs (Bernstein, et al., (2001) Nature 409:363). Then, siRNA is incorporated into RNA-induced silencing complex (RISC), where one or more helicases unwind the siRNA duplex, allowing complementary antisense strands to guide target recognition (Nykanen, et al., (2001) Cell 107:309). When bound to the appropriate target mRNA, one or more endonucleases in RISC cleave the target, inducing silencing (Elbashir, et al., (2001) Genes Dev. 15:188). Here, in one aspect, the present invention relates to a single-stranded RNA (siRNA) that is produced in cells and promotes the formation of a RISC complex that leads to the silencing of target gene, i.e., TMPRSS6 gene. Therefore, the term "siRNA" is also used herein to refer to the above-mentioned RNAi.

[0098] In another embodiment, the RNAi agent can be a single-stranded siRNA introduced into a cell or organism to inhibit target mRNA. The single-stranded RNAi agent binds to the RISC endonuclease Argonaute 2, which then cleaves the target mRNA. Single-stranded siRNAs are generally 15-30 nucleotides and are chemically modified. The design and testing of single-stranded siRNAs are described in U.S. Patent No. 8,101,348 and Lima et al., (2012) Cell 150:883-894, the entire contents of each of which are incorporated herein by reference. Any of the antisense nucleotide sequences described herein can be used as single-stranded siRNAs chemically modified as described herein or by the method described in Lima et al., (2012) Cell 150;:883-894.

[0099] In yet another embodiment, the present invention provides a single-stranded antisense oligonucleotide molecule targeting TMPRSS6. A "single-stranded antisense oligonucleotide molecule" is complementary to a sequence in the target mRNA (i.e., TMPRSS6). The single-stranded antisense oligonucleotide molecule can stoichiometrically inhibit translation by base pairing to the mRNA and physically interfering with the translation machinery (see Dias, N. et al., (2002) Mol Cancer Ther 1:347-355). Alternatively, the single-stranded antisense oligonucleotide molecule inhibits the target mRNA by hybridizing to the target and cleaving the target via an RNase H cleavage event. The single-stranded antisense oligonucleotide molecule can be about 10 to about 30 nucleotides in length and have a sequence complementary to the target sequence. For example, a single-stranded antisense oligonucleotide molecule can comprise an antisense nucleotide sequence described herein, e.g., a sequence that is at least about 10, 11, 12, 13, 14, 15, 16, 17, 18, 19, 20, or more consecutive nucleotides from any one of the sequences set forth in any one of Tables 1, 2, 4, 5, 8, 10, and 12, or can bind to any of the target sites described herein. A single-stranded antisense oligonucleotide molecule can comprise modified RNA, DNA, or a combination thereof.

[0100] In another embodiment, the "iRNA" for use in the compositions, uses, and methods of the present invention is double-stranded RNA, and is referred to herein as a "double-stranded RNAi agent," "double-stranded RNA (dsRNA) molecule," "dsRNA agent," or "dsRNA." The term "dsRNA" refers to a complex of ribonucleic acid molecules having a double-stranded structure comprising two antiparallel and substantially complementary nucleic acid strands, which are shown to have "sense" and "antisense" orientations relative to the target RNA, i.e., the TMPRSS6 gene. In certain embodiments of the present invention, the double-stranded RNA (dsRNA) causes degradation of the target RNA, e.g., mRNA, by a post-transcriptional gene silencing mechanism, referred to herein as RNA interference or RNAi.

[0101] Generally, the majority of the nucleotides in each strand of dsRNA molecule are ribonucleotides; however, as described in detail herein, each or both strands can also contain one or more non-ribonucleotides, such as deoxyribonucleotides and / or modified nucleotides.Furthermore, as used herein, " RNAi agent " can also contain ribonucleotides with chemical modifications; RNAi agent can contain substantial modifications in multiple nucleotides.Such modifications can include any type of modification disclosed herein or known in the art.Any such modification when used in siRNA type molecules is encompassed by " RNAi agent " for the purpose of this specification and claims.

[0102] The two strands forming the double-stranded structure may be different parts of one larger RNA molecule, or they may be separate RNA molecules. When the two strands are part of one larger molecule and are therefore connected by a continuous chain of nucleotides between the 3' end of one strand forming the double-stranded structure and the 5' end of the other strand, the connected RNA strands are called a "hairpin loop." When the two strands are covalently linked by means other than a continuous chain of nucleotides between the 3' end of one strand forming the double-stranded structure and the 5' end of the other strand, the connected structure is called a "linker." The RNA strands may have the same or different numbers of nucleotides. The maximum number of base pairs is the number of nucleotides in the shortest strand of the dsRNA minus the overhang present in the double strand. In addition to the double-stranded structure, the RNAi agent may contain one or more nucleotide overhangs.

[0103] In one embodiment, the RNAi agent of the present invention is a 24-30 nucleotide dsRNA that interacts with a target RNA sequence, such as a TMPRSS6 target mRNA sequence, and induces cleavage of the target RNA. Without wishing to be bound by theory, long double-stranded RNA introduced into cells is degraded into siRNAs by a type III endonuclease known as Dicer (Sharp et al. (2001) Genes Dev. 15:485). Dicer, a RNase III-like enzyme, processes dsRNA into 19-23 base pair short interfering RNAs with characteristic two-base 3' overhangs (Bernstein, et al., (2001) Nature 409:363). The siRNA is then incorporated into the RNA-induced silencing complex (RISC), where one or more helicases unwind the siRNA duplex, allowing the complementary antisense strand to guide target recognition (Nykanen, et al., (2001) Cell 107:309). Upon binding to the appropriate target mRNA, one or more endonucleases in the RISC cleave the target, inducing silencing (Elbashir, et al., (2001) Genes Dev. 15:188). As used herein, "nucleotide overhang" refers to one or more unpaired nucleotides that protrude from the double-stranded structure of an RNAi agent, when the 3'-end of one strand of the RNAi agent extends beyond the 5'-end of the other strand, or vice versa. "Blunt" or "blunt end" means that there are no unpaired nucleotides at the corresponding end of the double-stranded RNAi agent, i.e., there are no nucleotide overhangs. A "blunt-ended" RNAi agent is a dsRNA that is double-stranded throughout its entire length, i.e., has no nucleotide overhangs at either end of the molecule. The RNAi agents of the present invention include RNAi agents with nucleotide overhangs at one end (i.e., agents with one overhang and one blunt end) or RNAi agents with nucleotide overhangs at both ends.

[0104] The term "antisense strand" refers to the strand of a double-stranded RNAi agent (e.g., human TMPRSS6 mRNA) that includes a region that is substantially complementary to a target sequence. As used herein, the term "region complementary to a portion of the mRNA encoding transthyretin" refers to a region of the antisense strand that is substantially complementary to a portion of the TMPRSS6 mRNA sequence. When the region of complementarity is not perfectly complementary to the target sequence, mismatches are most tolerated in the terminal regions, and, if present, are generally present in one or more terminal regions, e.g., within 6, 5, 4, 3, or 2 nucleotides of the 5' and / or 3' termini.

[0105] The term "sense strand," as used herein, refers to the strand of a dsRNA that includes a region that is substantially complementary to a region of the antisense strand.

[0106] As used herein, the term "cleavage region" refers to a region located immediately adjacent to the cleavage site. The cleavage site is the site in the target where cleavage occurs. In some embodiments, the cleavage region comprises three bases immediately adjacent to the cleavage site on either side of the cleavage site. In some embodiments, the cleavage region comprises two bases immediately adjacent to the cleavage site on either side of the cleavage site. In some embodiments, the cleavage site specifically occurs at the site bound by nucleotides 10 and 11 of the antisense strand, and the cleavage region comprises nucleotides 11, 12, and 13.

[0107] As used herein, unless otherwise indicated, the term "complementary," when used to describe a first nucleotide sequence in relation to a second nucleotide sequence, refers to the ability of an oligonucleotide or polynucleotide comprising the first nucleotide sequence to hybridize and form a double-stranded structure with an oligonucleotide or polynucleotide comprising the second nucleotide sequence under defined conditions, as understood by those of skill in the art. Such conditions may be, for example, stringent conditions, where stringent conditions may include 400 mM NaCl, 40 mM PIPES (pH 6.4), 1 mM EDTA, at 50°C or 70°C for 12-16 hours, followed by washing. Other conditions, such as physiologically relevant conditions that may occur inside an organism, may also be applied. For example, complementary sequences are sufficient to allow the relevant function of the nucleic acid, such as RNAi, to proceed. Those skilled in the art will be able to determine the most appropriate set of conditions for testing the complementarity of two sequences depending on the ultimate use of the hybridized nucleotides.

[0108] Sequences can be "fully complementary" to each other if there is base pairing between the nucleotides comprising the first nucleotide sequence and the nucleotides comprising the second nucleotide sequence throughout the entire length of the first and second nucleotide sequences.However, when a first sequence is referred to herein as "substantially complementary" to a second sequence, the two sequences can be completely complementary, or they can form one or more, but generally no more than 4, 3, or 2 mismatched base pairs when hybridized while retaining the ability to hybridize under the conditions most relevant to their final application.However, if two oligonucleotides are designed to form one or more single-stranded overhangs upon hybridization, such overhangs shall not be considered mismatches when determining complementarity.For example, for the purposes described herein, a dsRNA comprising one oligonucleotide 21 nucleotides long and another oligonucleotide 23 nucleotides long may be referred to as "fully complementary" if the longer oligonucleotide comprises a 21-nucleotide sequence that is completely complementary to the shorter oligonucleotide.

[0109] As used herein, "complementary" sequences can also include, or be formed entirely of, non-Watson-Crick base pairs and / or base pairs formed from unnatural and modified nucleotides, so long as the above requirements related to their ability to hybridize are met. Such non-Watson-Crick base pairs include, but are not limited to, G:U wobble or Hoogsteen base pairs.

[0110] The terms "complementary," "fully complementary," and "substantially complementary" herein may be used in reference to matching bases between the sense and antisense strands of a dsRNA, or between the antisense strand of a dsRNA and a target sequence, as understood in the context of their use.

[0111] As used herein, a polynucleotide "substantially complementary to at least a portion of" a messenger RNA (mRNA) refers to a polynucleotide that is substantially complementary to a contiguous portion of an mRNA of interest (e.g., an mRNA encoding TMPRSS6), including the 5' UTR, open reading frame (ORF), or 3' UTR. For example, a polynucleotide is complementary to at least a portion of a TMPRSS6 mRNA if its sequence is substantially complementary to a contiguous portion of an mRNA encoding TMPRSS6.

[0112] As used herein, the term "inhibit" is used interchangeably with "reduce," "silencing," "downregulate," "suppress," and other similar terms, and includes any level of inhibition.

[0113] As used herein, the phrase "inhibiting the expression of TMPRSS6" includes inhibiting the expression of any TMPRSS6 gene (e.g., mouse TMPRSS6 gene, rat TMPRSS6 gene, monkey TMPRSS6 gene, human TMPRSS6 gene, etc.), as well as variants (e.g., naturally occurring variants) or mutants of the TMPRSS6 gene. Thus, the TMPRSS6 gene can be a wild-type TMPRSS6 gene, a mutant TMPRSS6 gene, or a transgenic TMPRSS6 gene in the context of a genetically modified cell, cell population, or organism.

[0114] "Inhibiting expression of the TMPRSS6 gene" includes any level of inhibition of the TMPRSS6 gene, for example, at least partial suppression of expression of the TMPRSS6 gene, such as at least about 5%, at least about 10%, at least about 15%, at least about 20%, at least about 25%, at least about 30%, at least about 35%, at least about 40%, at least about 45%, at least about 50%, at least about 55%, at least about 60%, at least about 65%, at least about 70%, at least about 75%, at least about 80%, at least about 85%, at least about 90%, at least about 91%, at least about 92%, at least about 93%, at least about 94%, at least about 95%, at least about 96%, at least about 97%, at least about 98%, or at least about 99%.

[0115] The expression of the TMPRSS6 gene can be evaluated based on the level of any variable associated with the expression of the TMPRSS6 gene, such as the TMPRSS6 mRNA level, TMPRSS6 protein level, hepcidin mRNA level, hepcidin protein level, or serum lipid level in tissues or serum. Inhibition can be evaluated by a decrease in the absolute or relative level of one or more of these variables compared to the control level. The control level can be any type of control level used in the art, such as a pre-dose baseline level, or a level measured from a similar subject, cell, or sample that is untreated or treated with a control (e.g., a buffer-only control or an inactive agent control).

[0116] As used herein, the phrase "contacting a cell with a double-stranded RNAi agent" includes contacting a cell by any possible means.Contacting a cell with a double-stranded RNAi agent includes contacting a cell with an RNAi agent in vitro or contacting a cell with an RNAi agent in vivo.Contacting can be performed directly or indirectly.Therefore, for example, an RNAi agent can be physically contacted with a cell by carrying out a method individually, or an RNAi agent can be placed in a situation that allows it to contact a cell later or that allows it to contact a cell later.

[0117] The step of contacting cells in vitro can be carried out, for example, by incubating cells with an RNAi agent.The step of contacting cells in vivo can be carried out, for example, by injecting the RNAi agent into or near the tissue where the cells are located, or by injecting the RNAi agent into another region, bloodstream, or subcutaneous cavity, so that the RNAi agent can subsequently reach the tissue where the contacted cells are located.For example, the RNAi agent can contain and / or be bound to a ligand, such as a GalNAc3 ligand, that directs the RNAi agent to a target site, for example, the liver.A combination of in vitro and in vivo contact methods is also possible.In connection with the method of the present invention, cells can also be contacted with an RNAi agent in vitro and then transplanted into a subject.

[0118] A "patient" or "subject" as used herein is intended to include either a human or non-human animal, preferably a mammal, e.g., a human or a monkey. Most preferably, the subject or patient is a human.

[0119] As used herein, "TMPRSS6-associated disease" is intended to include any disease that can be treated or prevented, or symptoms that can be alleviated, by inhibiting the expression of TMPRSS6. In certain embodiments, the TMPRSS6-associated disease is also associated with iron overload, a condition characterized by elevated iron levels, or iron dysregulation. Iron overload can be caused, for example, by genetic disorders, increased dietary iron intake, or parenterally administered excess iron, including intravenous injection of excess iron, and transfusional iron overload.

[0120] Diseases associated with TMPRSS6 include, but are not limited to, hereditary hemochromatosis, idiopathic hemochromatosis, primary hemochromatosis, secondary hemochromatosis, severe juvenile hemochromatosis, neonatal hemochromatosis, sideroblastic anemia, hemolytic anemia, dyserythroid anemia, sickle cell anemia, hemoglobinopathies, thalassemia (e.g., β-thalassemia and α-thalassemia), chronic liver disease, porphyria cutanea tarda, erythroblastic porphyria, atransferrinemia, hereditary tyrosinemia, cerebrohepatorenal syndrome, idiopathic pulmonary hemosiderosis, and renal hemosiderosis.

[0121] TMPRSS6-related disorders include disorders associated with excessive oral iron administration, transfusional iron overload, and excessive intravenous iron administration.

[0122] TMPRSS6-associated diseases also include diseases with symptoms related to or that can be caused by iron overload. These symptoms include liver disease (cirrhosis, cancer), heart attack or heart failure, diabetes, osteoarthritis, osteoporosis, metabolic syndrome, hypothyroidism, hypogonadism, and, in some cases, an increased risk of premature death. In one embodiment, TMPRSS6-associated diseases include neurodegenerative diseases associated with iron overload and / or iron dysregulation, such as Alzheimer's disease, Parkinson's disease, Huntington's disease, Friedreich's ataxia, epilepsy, and multiple sclerosis. Administration of iRNAs targeting TMPRSS6, such as those listed in any one of Tables 1, 2, 4, 5, 8, 10, and 12, can treat one or more of these symptoms or prevent the onset or progression of diseases or disorders exacerbated by increased iron levels.

[0123] In one embodiment, the TMPRSS6-associated disease is β-thalassemia. β-thalassemia is any one of a group of genetic disorders characterized by a genetic defect in the synthesis of β-globulin chains. In the homozygous state, β-thalassemia ("thalassemia major") causes severe, transfusion-dependent anemia. In the heterozygous state, the β-thalassemia trait ("thalassemia minor") causes mild to moderate microcytic anemia.

[0124] "Thalassemia intermedia" is a β-thalassemia in which the clinical severity of the disease lies somewhere between the mild symptoms of β-thalassemia minor and β-thalassemia major. The diagnosis is clinical, based on the patient maintaining adequate hemoglobin (Hb) levels of at least 6-7 g / dL at the time of diagnosis without the need for regular blood transfusions.

[0125] In one embodiment, the β-thalassemia is thalassemia major. In another embodiment, the β-thalassemia is thalassemia intermedia.

[0126] As used herein, a "therapeutically effective amount" is intended to include the amount of an RNAi agent that, when administered to a patient to treat a TMPRSS6-related disease, is sufficient to treat the disease (e.g., by reducing, ameliorating, or maintaining an existing disease or one or more symptoms of the disease). A "therapeutically effective amount" may vary depending on the RNAi agent, the manner in which the RNAi agent is administered, the disease and its severity, and the medical history, age, weight, family history, genetic makeup, stage of the pathological process mediated by TMPRSS6 expression, type of previous or concurrent treatment, if any, and other individual characteristics of the patient being treated.

[0127] As used herein, a "prophylactically effective amount" is intended to include an amount of an RNAi agent sufficient to prevent or ameliorate the disease or one or more symptoms of the disease when administered to a subject who has not yet developed or exhibited symptoms of a TMPRSS6-associated disease but may be susceptible to the disease. Amelioration of the disease includes slowing the progression of the disease or reducing the severity of later-onset disease. A "prophylactically effective amount" may vary depending on the RNAi agent, the manner in which the agent is administered, the risk of developing the disease, and the patient's medical history, age, weight, family history, genetic makeup, type of previous or concurrent treatment, if any, and other individual characteristics.

[0128] A "therapeutically effective amount" or "prophylactically effective amount" also includes the amount of an RNAi agent that produces a desired local or systemic effect at a reasonable benefit / risk ratio applicable to any treatment. The iRNA agents used in the methods of the invention can be administered in amounts sufficient to obtain a reasonable benefit / risk ratio applicable to such treatment.

[0129] As used herein, the term "sample" includes similar body fluids, cells, or tissues isolated from a subject, as well as collections of body fluids, cells, or tissues present in a subject. Examples of biological fluids include blood, serum and serous fluid, plasma, cerebrospinal fluid, ocular fluid, lymph, urine, saliva, etc. Tissue samples can include samples derived from tissues, organs, or localized regions. For example, samples can be derived from specific organs, parts of organs, or body fluids or cells within those organs. In certain embodiments, samples can be derived from the liver (e.g., the whole liver or specific parts of the liver, or specific types of cells in the liver, e.g., hepatocytes). In preferred embodiments, a "sample derived from a subject" refers to blood or plasma obtained from a subject. In further embodiments, a "sample derived from a subject" refers to liver tissue (or a subcomponent thereof) obtained from a subject.

[0130] II. iRNAs of the Invention Described herein are improved double-stranded RNAi agents that inhibit expression of the TMPRSS6 gene in cells, such as cells in a subject, e.g., a mammal, such as a human, suffering from a TMPRSS6-associated disease, e.g., β-thalassemia (e.g., β-thalassemia major and β-thalassemia intermedia) or hemochromatosis, and uses of such double-stranded RNAi agents.

[0131] Thus, the present invention provides double-stranded RNAi agents having chemical modifications capable of inhibiting expression of a target gene (i.e., the TMPRSS6 gene) in vivo. In certain aspects of the present invention, substantially all of the nucleotides of an iRNA of the present invention are modified. In other embodiments of the present invention, all of the nucleotides of an iRNA of the present invention are modified. An iRNA of the present invention in which "substantially all of the nucleotides are modified" is mostly, but not completely, modified and may contain no more than five, no more than four, no more than three, no more than two, or no more than one unmodified nucleotide.

[0132] RNAi agents include a sense strand and an antisense strand. Each strand of an RNAi agent can be in the range of 12 to 30 nucleotides in length. For example, each strand can be 14 to 30 nucleotides in length, 17 to 30 nucleotides in length, 19 to 30 nucleotides in length, 25 to 30 nucleotides in length, 27 to 30 nucleotides in length, 17 to 23 nucleotides in length, 17 to 21 nucleotides in length, 17 to 19 nucleotides in length, 19 to 25 nucleotides in length, 19 to 23 nucleotides in length, 19 to 21 nucleotides in length, 21 to 25 nucleotides in length, or 21 to 23 nucleotides in length.

[0133] The sense strand and antisense strand typically form double-stranded RNA ("dsRNA"), also referred to herein as an "RNAi agent." The double-stranded region of an RNAi agent can be 12 to 30 nucleotide pairs in length. For example, the double-stranded region can be 14 to 30 nucleotide pairs in length, 17 to 30 nucleotide pairs in length, 27 to 30 nucleotide pairs in length, 17 to 23 nucleotide pairs in length, 17 to 21 nucleotide pairs in length, 17 to 19 nucleotide pairs in length, 19 to 25 nucleotide pairs in length, 19 to 23 nucleotide pairs in length, 19 to 21 nucleotide pairs in length, 21 to 25 nucleotide pairs in length, or 21 to 23 nucleotide pairs in length. In another example, the double-stranded region is selected from 15, 16, 17, 18, 19, 20, 21, 22, 23, 24, 25, 26, and 27 nucleotides in length.

[0134] In one embodiment, an RNAi agent can include one or more overhang regions and / or capping groups at the 3'-end, 5'-end, or both ends of one or both strands. The overhangs can be 1 to 6 nucleotides in length, e.g., 2 to 6 nucleotides, 1 to 5 nucleotides, 2 to 5 nucleotides, 1 to 4 nucleotides, 2 to 4 nucleotides, 1 to 3 nucleotides, 2 to 3 nucleotides, or 1 to 2 nucleotides in length. The overhangs can be the result of one strand being longer than the other, or the result of two strands of the same length being staggered. The overhangs can form mismatches with the target mRNA, or the overhangs can be complementary to the targeted gene sequence or can be another sequence. The first and second strands can also be joined by additional bases or other non-basic linkers, e.g., to form a hairpin.

[0135] In one embodiment, each nucleotide in the overhang region of an RNAi agent can independently be a modified or unmodified nucleotide, including a 2'-sugar modification, such as, but not limited to, 2-F, 2'-O-methyl, thymidine (T), 2'-O-methoxyethyl-5-methyluridine (Teo), 2'-O-methoxyethyl adenosine (Aeo), 2'-O-methoxyethyl-5-methylcytidine (m5Ceo), and any combination thereof. For example, TT can be an overhang sequence for either end on either strand. The overhang can form a mismatch with the target mRNA, or the overhang can be complementary to the targeted gene sequence, or it can be another sequence.

[0136] The 5'- or 3'-overhang on the sense strand, antisense strand, or both strands of an RNAi agent can be phosphorylated. In some embodiments, the overhang region comprises two nucleotides with a phosphorothioate between them, wherein the two nucleotides can be the same or different. In one embodiment, the overhang is present at the 3'-end of the sense strand, the antisense strand, or both strands. In one embodiment, the 3'-overhang is present in the antisense strand. In one embodiment, the 3'-overhang is present in the sense strand.

[0137] RNAi agent can have only one overhang, which can enhance the interference activity of RNAi without affecting its overall stability.For example, the single-stranded overhang can be located at the 3'-end of the sense strand or the 3'-end of the antisense strand.RNAi can also have a blunt end located at the 5'-end of the antisense strand (or the 3'-end of the sense strand) or vice versa.Generally, the antisense strand of RNAi has a nucleotide overhang at the 3'-end, and the 5'-end is blunt.Without wishing to be bound by theory, the asymmetric blunt end at the 5'-end of the antisense strand and the 3'-end overhang of the antisense strand favors the introduction of the guide strand into the RISC process.

[0138] Any of the nucleic acids featured in the present invention can be synthesized and / or modified by methods well established in the art, such as those described in "Current protocols in nucleic acid chemistry," Beaucage, S. Lett. et al. (Eds.), John Wiley & Sons, Inc., New York, NY, USA, which is incorporated herein by reference. Modifications include, for example, terminal modifications, such as 5'-end modifications (phosphorylation, conjugation, inverted linkage) or 3'-end modifications (conjugation, DNA nucleotide, inverted linkage, etc.); base modifications, such as substitution with a stable base, an unstable base, or a base that base-pairs with a wide range of partners, base removal (abasic nucleotide), or conjugated base; sugar modifications (e.g., at the 2' or 4' position) or sugar substitution; and / or backbone modifications, including modification or substitution of phosphodiester linkages. Specific examples of iRNA compounds useful in the embodiments described herein include, but are not limited to, RNAs containing modified backbones or that do not contain natural internucleoside linkages. The RNA with modified backbone particularly includes those that do not have a phosphorus atom in the backbone.For the purpose of this specification and as sometimes referred to in the art, the modified RNA that does not have a phosphorus atom in the internucleoside backbone can also be considered as oligonucleoside.In some embodiments, the modified iRNA has a phosphorus atom in its internucleoside backbone.

[0139] Modified RNA backbones include, for example, phosphorothioates, chiral phosphorothioates, phosphorodithioates, phosphotriesters, aminoalkylphosphotriesters, methylphosphonates, and other alkyl phosphonates, including 3'-alkylene phosphonates and chiral phosphonates; phosphinates; phosphoramidates, including 3'-aminophosphoramidates and aminoalkylphosphoramidates; thionophosphoramidates, thionoalkylphosphonates, thionoalkylphosphotriesters; and boranophosphates with normal 3'-5' linkages, their 2'-5' linked analogs, and those with reversed polarity, in which adjacent pairs of nucleoside units are linked 3'-5' to 5'-3' or 2'-5' to 5'-2'. Various salts, mixed salts, and free acid forms are also included.

[0140] Representative United States patents that teach the preparation of the above phosphorus-containing linkages include, but are not limited to, U.S. Patent Nos. 3,687,808; 4,469,863; 4,476,301; 5,023,243; 5,177,195; 5,188,897; 5,264,423; 5,276,019; 5,278,302; 5,286,717; 5,32 Specification No. 1,131; Specification No. 5,399,676; Specification No. 5,405,939; Specification No. 5,453,496; Specification No. 5,455,233; Specification No. 5,466,677; Specification No. 5,476,925 Specification No. 5,519,126; Specification No. 5,536,821; Specification No. 5,541,316; Specification No. 5,550,111; Specification No. 5,563,253; Specification No. 5,571,799; Specification No. 5,587 ,361 Specification; 5,625,050; 6,028,188; 6,124,445; 6,160,109; 6,169,170; 6,172,209 ; Specification No. 6,239,265; Specification No. 6,277,603; Specification No. 6,326,199; Specification No. 6,346,614; Specification No. 6,444,423; Specification No. 6,531,590; Specification No. 6,534, Nos. 6,608,035; 6,683,167; 6,858,715; 6,867,294; 6,878,805; 7,015,315; 7,041,816; 7,273,933; 7,321,029; and U.S. Reissue Patent No. RE39464, the entire contents of each of which are incorporated herein by reference.

[0141] Modified RNA backbones that do not contain internal phosphorus atoms have backbones formed by short alkyl or cycloalkyl internucleoside linkages, mixed heteroatom and alkyl or cycloalkyl internucleoside linkages, or one or more short heteroatom or heterocyclic internucleoside linkages. These include those with morpholino linkages (formed in part from the sugar portion of the nucleoside), siloxane backbones, sulfide, sulfoxide, and sulfone backbones, formacetyl and thioformacetyl backbones, methyleneformacetyl and thioformacetyl backbones, alkene-containing backbones, sulfamate backbones, methyleneimino and methylenehydrazino backbones, sulfonate and sulfonamide backbones, amide backbones, and others with mixed N, O, S, and CH2 constituent moieties.

[0142] Representative United States patents which teach the preparation of the above oligonucleosides include, but are not limited to, U.S. Patent Nos. 5,034,506; 5,166,315; 5,185,444; 5,214,134; 5,216,141; 5,235,033; 5,64,562; 5,264,564; 5,405,938; 5,434,257; 5,466,677; 5,470,967; Nos. 489,677; 5,541,307; 5,561,225; 5,596,086; 5,602,240; 5,608,046; 5,610,289; 5,618,704; 5,623,070; 5,663,312; 5,633,360; 5,677,437; and 5,677,439, the entire contents of each of which are incorporated herein by reference.

[0143] In other embodiments, suitable RNA mimics are contemplated for use in iRNA, in which both the sugar and internucleoside linkages, i.e., the backbone of the nucleotide units, are replaced with novel groups. The base units are maintained for hybridization with appropriate nucleic acid target compounds. One such oligomeric compound, an RNA mimic, that has been shown to have excellent hybridization properties is called peptide nucleic acid (PNA). In PNA compounds, the sugar backbone of RNA is replaced with an amide-containing backbone, particularly an aminoethylglycine backbone. The nucleobases are retained and are directly or indirectly linked to the aza nitrogen atoms of the amide portion of the backbone. Representative U.S. patents that teach the preparation of PNA compounds include, but are not limited to, U.S. Pat. Nos. 5,539,082; 5,714,331; and 5,719,262, the entire contents of each of which are incorporated herein by reference. Additional PNA compounds suitable for use in the iRNA of the present invention are described, for example, in Nielsen et al., Science, 1991, 254, 1497-1500.

[0144] Certain embodiments featured in the present invention include RNAs with phosphorothioate backbones and oligonucleosides with heteroatom backbones, particularly those described in U.S. Pat. No. 5,489,677, such as --CH2--NH--CH2-, --CH2--N(CH3)--O--CH2-- (also known as the methylene (methylimino) or MMI backbone), --CH2--O--N(CH3)--CH2--, --CH2--N(CH3)--N(CH3)--CH2--, and --N(CH3)--CH2--CH2-- (where the natural phosphodiester backbone is represented as --O--P--O--CH2--) and those described in U.S. Pat. No. 5,602,240, such as the amide backbones described in U.S. Pat. In certain embodiments, RNAs featured herein have the morpholino backbone structures described in U.S. Pat. No. 5,034,506, such as the morpholino backbone structures described in U.S. Pat.

[0145] Modified RNAs may also contain one or more substituted sugar moieties. The iRNAs, e.g., dsRNAs, featured herein, can include one of the following at the 2' position: OH; F; O-, S-, or N-alkyl; O-, S-, or N-alkenyl; O-, S-, or N-alkynyl; or O-alkyl-O-alkyl, where alkyl, alkenyl, and alkynyl are substituted or unsubstituted C1-C6. 10 Alkyl or C2-C 10 It can be alkenyl and alkynyl. Exemplary suitable modifications include O[(CH) n O] m CH3, O(CH2). n OCH3, O(CH2) n NH2, O(CH2) n CH3, O(CH2) n ONH2 and O(CH2) n ON[(CH2) n CH3)]2, where n and m are from 1 to about 10. In other embodiments, the dsRNA comprises at the 2' position a C1 to C 10The modification may include one of the following: lower alkyl, substituted lower alkyl, alkaryl, aralkyl, O-alkaryl or O-aralkyl, SH, SCH, OCN, Cl, Br, CN, CF, OCF, SOCH, SOCH, ONO, NO, N, NH, heterocycloalkyl, heterocycloalkaryl, aminoalkylamino, polyalkylamino, substituted silyl, RNA cleaving group, reporter group, intercalator, group that improves the pharmacodynamic properties of iRNA, or group that improves the pharmacokinetic properties of iRNA, and other substituents with similar properties. In certain embodiments, the modification includes 2'-methoxyethoxy (2'-O--CHCHOCH, also known as 2'-O-(2-methoxyethyl) or 2'-MOE) (Martin et al., Helv. Chim. Acta, 1995, 78:486-504), i.e., an alkoxy-alkoxy group. Another exemplary modification is 2'-dimethylaminooxyethoxy, also known as 2'-DMAOE, i.e., O(CH2)2ON(CH3)2 group, and 2'-dimethylaminoethoxyethoxy (also known in the art as 2'-O-dimethylaminoethoxyethyl or 2'-DMAEOE), i.e., 2'-O--CH2--O--CH2--N(CH2)2, as described in the Examples herein below.

[0146] Other modifications include 2'-methoxy (2'-OCH), 2'-aminopropoxy (2'-OCHCHCHNH), and 2'-fluoro (2'-F). Similar modifications can also be made at other positions in the RNA of an iRNA, particularly the 3' position of the sugar on the 3'-terminal nucleotide or in a 2'-5'-linked dsRNA and the 5' position of the 5'-terminal nucleotide. iRNAs can also have sugar mimetics such as cyclobutyl moieties in place of the pentofuranosyl sugar. Representative United States patents that teach the preparation of such modified sugar structures include, but are not limited to, U.S. Patent Nos. 4,981,957; 5,118,800; 5,319,080; 5,359,044; 5,393,878; 5,446,137; 5,466,786; 5,514,785; 5,519,134; 5,567,81 Nos. 5,576,427; 5,591,722; 5,597,909; 5,610,300; 5,627,053; 5,639,873; 5,646,265; 5,658,873; 5,670,633; and 5,700,920, several of which are co-owned with the present application, the entire contents of each of which are incorporated herein by reference.

[0147] iRNAs can also include nucleobase (often simply referred to in the art as "base") modifications or substitutions. As used herein, "unmodified" or "natural" nucleobases include the purine bases adenine (A) and guanine (G), and the pyrimidine bases thymine (T), cytosine (C), and uracil (U). Modified nucleobases include deoxythymine (dT), 5-methylcytosine (5-me-C), 5-hydroxymethylcytosine, xanthine, hypoxanthine, 2-aminoadenine, 6-methyl and other alkyl derivatives of adenine and guanine, 2-propyl and other alkyl derivatives of adenine and guanine, 2-thiouracil, 2-thiothymine and 2-thiocytosine, 5-halouracil and cytosine, 5-propynyluracil and cytosine, 6-azouracil, cytosine and thymine, 5-uracil (pseudouracil), and 5-uracil (pseudouracil). Other synthetic and natural nucleobases include uracil, 4-thiouracil, 8-halo, 8-amino, 8-thiol, 8-thioalkyl, 8-hydroxyl and other 8-substituted adenines and guanines, 5-halo, particularly 5-bromo, 5-trifluoromethyl and other 5-substituted uracils and cytosines, 7-methyladenine and 7-methyladenine, 8-azaguanine and 8-azaadenine, 7-deazaguanine and 7-daazaadenine and 3-deazaguanine and 3-deazaadenine.Further nucleobases include those disclosed in U.S. Patent No. 3,687,808, those disclosed in Modified Nucleosides in Biochemistry, Biotechnology and Medicine, Herdewijn, P. ed. Wiley-VCH, 2008, those disclosed in The Concise Encyclopedia of Polymer Science and Engineering, pages 858-859, Kroschwitz, JL, ed. John Wiley & Sons, 1990, those disclosed by Englisch et al., Angewandte Chemie, International Edition, 1991, 30, 613, and those disclosed by Sanghvi, Y S., Chapter 15, dsRNA Research and Applications, pages 289-302, Crooke, ST and Lebleu, B., Ed., CRC Press, 1993. Some of these nucleobases are particularly useful for increasing the binding affinity of the oligomeric compounds featured in the present invention. These include 5-substituted pyrimidines, 6-azapyrimidines, and N-2, N-6, and O-6 substituted purines, including 2-aminopropyladenine, 5-propynyluracil, and 5-propynylcytosine. 5-Methylcytosine substitutions have been shown to increase nucleic acid duplex stability by 0.6-1.2°C (Sanghvi, Y.S., Crooke, S.T., and Lebleu, B., Eds., dsRNA Research and Applications, CRC Press, Boca Raton, 1993, pp. 276-278), making them exemplary base substitutions, especially when combined with 2'-O-methoxyethyl sugar modifications.

[0148] Representative United States patents that teach the preparation of some of the above-mentioned modified nucleobases, as well as other modified nucleobases, include, but are not limited to, the above-mentioned U.S. Patent Nos. 3,687,808; 4,845,205; 5,130,30; 5,134,066; 5,175,273; 5,367,066; 5,432,272; 5,457,187; 5,459,255; 5,484,908; 5,502,177; 5,525,711; 5,552,540; 5,587,469; and 5,594,121. Nos. 5,596,091; 5,614,617; 5,681,941; 5,750,692; 6,015,886; 6,147,200; 6,166,197; 6,222,025; 6,235,887; 6,380,368; 6,528,640; 6,639,062; 6,617,438; 7,045,610; 7,427,672; and 7,495,088, the entire contents of each of which are incorporated herein by reference.

[0149] The RNA of an iRNA can also be modified to contain one or more locked nucleic acids (LNAs). Locked nucleic acids are nucleotides with a modified ribose moiety, which contains an additional bridge connecting the 2' and 4' carbons. This structure effectively "locks" the ribose in a 3'-endo structural configuration. The addition of locked nucleic acids to siRNA has been shown to increase siRNA stability in serum and reduce off-target effects (Elmen, J. et al., (2005) Nucleic Acids Research 33(1):439-447; Mook, OR. et al., (2007) Mol Canc Ther 6(3):833-843; Grunweller, A. et al., (2003) Nucleic Acids Research 31(12):3185-3193).

[0150] Representative United States patents that teach the preparation of locked nucleic acid nucleotides include, but are not limited to, U.S. Pat. Nos. 6,268,490; 6,670,461; 6,794,499; 6,998,484; 7,053,207; 7,084,125; and 7,399,845, the entire contents of each of which are incorporated herein by reference.

[0151] Potentially stable modifications to the ends of RNA molecules can include N-(acetylaminocaproyl)-4-hydroxyprolinol (Hyp-C6-NHAc), N-(caproyl-4-hydroxyprolinol (Hyp-C6), N-(acetyl-4-hydroxyprolinol (Hyp-NHAc), thymidine-2'-0-deoxythymidine (ether), N-(aminocaproyl)-4-hydroxyprolinol (Hyp-C6-amino), 2-docosanoyl-uridine-3"-phosphate, inverted base dT (idT), and the like. Disclosure of this modification can be found in PCT Publication No. WO 2011 / 005861.

[0152] A. Modified iRNAs Containing Motifs of the Invention In certain embodiments of the invention, double-stranded RNAi agents of the invention include agents having chemical modifications disclosed, for example, in U.S. Provisional Patent Application No. 61 / 561,710, filed November 18, 2011, or PCT / US2012 / 065691, filed November 16, 2012, the entire contents of each of which are incorporated herein by reference.

[0153] As shown herein and in U.S. Provisional Patent Application No. 61 / 561,710, better results can be obtained by introducing one or more motifs of three identical modifications on three consecutive nucleotides into the sense strand and / or antisense strand of an RNAi agent, particularly at or near the cleavage site.In some embodiments, the sense strand and antisense strand of an RNAi agent can be completely modified.The introduction of these motifs, if present, disrupts the modification pattern of the sense strand and / or antisense strand.The RNAi agent can optionally be conjugated with a GalNAc derivative ligand, for example, on the sense strand.The resulting RNAi agent exhibits better gene silencing activity.

[0154] More specifically, it has been surprisingly discovered that when the sense and antisense strands of a double-stranded RNAi agent are modified to have one or more motifs of three identical modifications on three consecutive nucleotides at or near the cleavage site of at least one strand of the RNAi agent, the gene silencing activity of the RNAi agent is significantly improved.

[0155] In one embodiment, the RNAi agent is a 19-nucleotide double-ended bluntmer, wherein the sense strand contains at least one motif of three 2'-F modifications at three consecutive nucleotides, positions 7, 8, and 9, from the 5' end, and the antisense strand contains at least one motif of three 2'-O-methyl modifications at three consecutive nucleotides, positions 11, 12, and 13, from the 5' end.

[0156] In another embodiment, the RNAi agent is a 20-nucleotide long blunt-ended duplex, wherein the sense strand comprises at least one motif of three 2'-F modifications at three consecutive nucleotides at positions 8, 9, and 10 from the 5' end, and the antisense strand comprises at least one motif of three 2'-O-methyl modifications at three consecutive nucleotides at positions 11, 12, and 13 from the 5' end.

[0157] In yet another embodiment, the RNAi agent is a blunt-ended duplex 21 nucleotides in length, wherein the sense strand comprises at least one motif of three 2'-F modifications at three consecutive nucleotides, positions 9, 10, and 11, from the 5' end, and the antisense strand comprises at least one motif of three 2'-O-methyl modifications at three consecutive nucleotides, positions 11, 12, and 13, from the 5' end.

[0158] In one embodiment, the RNAi agent comprises a 21-nucleotide sense strand and a 23-nucleotide antisense strand, wherein the sense strand comprises at least one motif of three 2'-F modifications in three consecutive nucleotides at positions 9, 10, and 11 from the 5' end; and the antisense strand comprises at least one motif of three 2'-O-methyl modifications in three consecutive nucleotides at positions 11, 12, and 13 from the 5' end, and one end of the RNAi agent is blunt, while the other end comprises two nucleotide overhangs. Preferably, the two nucleotide overhangs are at the 3' end of the antisense strand. When the two nucleotide overhangs are at the 3' end of the antisense strand, there may be two phosphorothioate internucleotide bonds between the three terminal nucleotides, two of the three nucleotides being overhanging nucleotides, and the third nucleotide being a paired nucleotide adjacent to the overhanging nucleotide. In one embodiment, the RNAi agent further comprises two phosphorothioate internucleotide linkages between the terminal three nucleotides at both the 5'-end of the sense strand and the 5'-end of the antisense strand. In one embodiment, all nucleotides in the sense and antisense strands of the RNAi agent, including nucleotides that are part of a motif, are modified nucleotides. In one embodiment, each residue is independently modified with 2'-O-methyl or 3'-fluoro, for example, in alternating motifs. Optionally, the RNAi agent further comprises a ligand (preferably GalNAc3).

[0159] In one embodiment, the RNAi agent comprises a sense strand and an antisense strand, the RNAi agent comprising a first strand having a length of at least 25 and no more than 29 nucleotides, and a second strand having a length of no more than 30 nucleotides, the second strand comprising at least one motif of three 2'-O-methyl modifications at three consecutive nucleotides, positions 11, 12, and 13, from the 5' end; the 3' end of the first strand and the 5' end of the second strand form a blunt end, the second strand is 1 to 4 nucleotides longer than the first strand at its 3' end, the double-stranded region is at least 25 nucleotides long, the second strand is sufficiently complementary to a target mRNA along at least 19 nucleotides of the second strand length such that the RNAi agent reduces expression of the target gene when introduced into a mammalian cell, and dicer cleavage of the RNAi agent preferentially yields siRNA comprising the 3' end of the second strand, thereby reducing expression of the target gene in a mammal. Optionally, the RNAi agent further comprises a ligand.

[0160] In one embodiment, the sense strand of the RNAi agent contains at least one motif of three identical modifications in three consecutive nucleotides, one of the motifs being at the cleavage site of the sense strand.

[0161] In one embodiment, the antisense strand of the RNAi agent can also contain at least one motif of three identical modifications in three consecutive nucleotides, one of the motifs being at or near the cleavage site on the antisense strand.

[0162] In RNAi agents having a double-stranded region 17-23 nucleotides in length, the cleavage sites in the antisense strand are typically near positions 10, 11, and 12 from the 5' end. Thus, the three identical modification motifs can be located at positions 9, 10, 11; 10, 11, 12; 11, 12, 13; 12, 13, 14; or 13, 14, 15 of the antisense strand, counting from the first nucleotide from the 5' end of the antisense strand, or from the first paired nucleotide in the double-stranded region from the 5' end of the antisense strand. The cleavage site in the antisense strand can also vary depending on the length of the double-stranded region of the RNAi from the 5' end.

[0163] The sense strand of RNAi agent can comprise at least one motif of three identical modifications in three consecutive nucleotides at the break site of strand; antisense strand can have at least one motif of three identical modifications in three consecutive nucleotides at or near the break site of strand.When sense strand and antisense strand form dsRNA duplex, sense strand and antisense strand can be aligned so that one motif of three nucleotides in sense strand and one motif of three nucleotides in antisense strand have at least one nucleotide overlap, that is, at least one of the three nucleotides of the motif in sense strand and at least one of the three nucleotides of the motif in antisense strand form base pairs.Alternatively, at least two nucleotides can overlap, or all three nucleotides can overlap.

[0164] In one embodiment, the sense strand of an RNAi agent may contain two or more motifs of three identical modifications in three consecutive nucleotides. The first motif may be located at or near the cleavage site of the strand, and the other motif may be a wing modification. The term "wing modification" herein refers to a motif located in another part of the strand, away from a motif located at or near the cleavage site of the same strand. The wing modification may be adjacent to the first motif or separated by at least one or more nucleotides. When the motifs are directly adjacent to each other, the chemical structures of the motifs are different from each other; when the motifs are separated by one or more nucleotides, the chemical structures may be the same or different. Two or more wing modifications may be present. For example, when two wing modifications are present, each wing modification may be located at one end or on either side of the lead motif relative to the first motif at or near the cleavage site.

[0165] Like the sense strand, the antisense strand of an RNAi agent may contain two or more motifs of three identical modifications in three consecutive nucleotides, with at least one of the motifs occurring at or near the site of strand cleavage. The antisense strand may also contain one or more wing modifications in the same sequence as the wing modifications that may be present in the sense strand.

[0166] In one embodiment, wing modifications on the sense or antisense strand of an RNAi agent typically do not include the first one or two terminal nucleotides at the 3' end, 5' end, or both ends of the strand.

[0167] In another embodiment, wing modifications on the sense or antisense strand of an RNAi agent typically do not include the first one or two paired nucleotides within the double-stranded region at the 3' end, 5' end, or both ends of the strand.

[0168] When the sense and antisense strands of an RNAi agent each include at least one wing modification, the wing modifications may be located at the same end of the double-stranded region and may have an overlap of 1, 2, or 3 nucleotides.

[0169] When the sense and antisense strands of an RNAi agent each contain at least two wing modifications, the sense and antisense strands can be arranged such that two modifications from one strand are each located at one end of the double-stranded region and have an overlap of one, two, or three nucleotides; two modifications from one strand are each located at the other end of the double-stranded region and have an overlap of one, two, or three nucleotides; or two modifications from one strand are located on either side of the lead motif and have an overlap of one, two, or three nucleotides in the double-stranded region.

[0170] In one embodiment, all nucleotides in the sense and antisense strands of an RNAi agent, including nucleotides that are part of a motif, can be modified. Each nucleotide can be modified with the same or different modifications, and these modifications can include one or more changes to one or both of the non-linked phosphate oxygen and / or one or more linking phosphate oxygens; changes to components of the ribose sugar, such as the 2' hydroxyl of the ribose sugar; large-scale replacement of the phosphate moiety with a "dephosphorylation" linker; modifications or replacement of natural bases; and replacement or modification of the ribose-phosphate backbone.

[0171] Because nucleic acids are polymers of subunits, many modifications, such as modifications of bases, phosphate moieties, or non-linked Os in phosphate moieties, occur at repeated positions within the nucleic acid. In some cases, modifications can occur at all of the intended positions in the nucleic acid, but often this is not the case. For example, modifications can occur only at the 3' or 5' terminal positions, or only in terminal regions, such as at the terminal nucleotide position or the last 2, 3, 4, 5, or 10 nucleotides of the chain. Modifications can occur in double-stranded regions, single-stranded regions, or both. Modifications can occur only in double-stranded regions of RNA, or only in single-stranded regions of RNA. For example, phosphorothioate modifications at non-linked O positions can occur only at one or both ends, or only in terminal regions, such as at the terminal nucleotide position or the last 2, 3, 4, 5, or 10 nucleotides of the chain, or in double-stranded and single-stranded regions, especially at the ends. The 5' or both ends can be phosphorylated.

[0172] For example, it may be possible to enhance stability, include specific bases in the overhang, or include modified nucleotides or nucleotide surrogates in the single-stranded overhang, e.g., the 5' or 3' overhang, or both. For example, it may be desirable to include purine nucleotides in the overhang. In certain embodiments, all or some of the bases in the 3' or 5' overhang may be modified, e.g., with the modifications described herein. Modifications may include, for example, the use of modifications at the 2' position of the ribose sugar, e.g., deoxyribonucleotides, 2'-deoxy-2'-fluoro (2'-F) or 2'-O-methyl modifications in place of the ribosugar of the nucleobase, according to modifications known in the art, and modifications of the phosphate group, e.g., phosphorothioate modifications. The overhang need not be homologous to the target sequence.

[0173] In one embodiment, each residue in the sense strand and the antisense strand is independently modified with LNA, HNA, CeNA, 2'-methoxyethyl, 2'-O-methyl, 2'-O-allyl, 2'-C-allyl, 2'-deoxy, 2'-hydroxyl, or 2'-fluoro. A strand may contain two or more modifications. In one embodiment, each residue in the sense strand and the antisense strand is independently modified with 2'-O-methyl or 2'-fluoro.

[0174] At least two different modifications are typically present in the sense and antisense strands, and the two modifications may be 2'-O-methyl or 2'-fluoro modifications, or others.

[0175] In one embodiment, N a and / or N b includes an alternating pattern of modifications. As used herein, the term "alternating motif" refers to a motif having one or more modifications, each modification occurring at alternating nucleotides in a strand. The alternating nucleotides can refer to one at every other nucleotide or one at every third nucleotide, or a similar pattern. For example, if A, B, and C each represent one type of modification to a nucleotide, the alternating motif could be "ABABABABABAB...", "AABBAABBAABB...", "AABAABAABAAB...", "AAABAAABAAAB...", "AAABBBAAABBB...", or "ABCABCABCABC...", etc.

[0176] The types of modifications included in the alternating motif can be the same or different. For example, if A, B, C, and D each represent one type of modification on a nucleotide, the alternation pattern, i.e., the modifications at every other nucleotide, can be the same, but each of the sense or antisense strands can be selected from several possibilities for modifications within the alternating motif, such as "ABABAB...", "ACACAC...", "BDBDBD...", or "CDCDCD...".

[0177] In one embodiment, the RNAi agent of the present invention comprises an alternating motif modification pattern in the sense strand that is shifted relative to the alternating motif modification pattern in the antisense strand. This shift can be such that the modification group of the nucleotide of the sense strand corresponds to a different modification group of the nucleotide of the antisense strand, or vice versa. For example, when the sense strand is paired with the antisense strand in a dsRNA duplex, the alternating motif in the sense strand can start with "ABABAB" from 5' to 3' of the strand, and the alternating motif in the antisense strand can start with "BABABA" from 5' to 3' of the strand in the double-stranded region. As another example, the alternating motif in the sense strand can start with "AABBAABB" from 5' to 3' of the strand, and the alternating motif in the antisense strand can start with "BBAABBAA" from 5' to 3' of the strand in the double-stranded region, thereby resulting in a complete or partial shift in the modification pattern between the sense strand and the antisense strand.

[0178] In one embodiment, the RNAi agent comprises a pattern of alternating motifs of 2'-O-methyl and 2'-F modifications in the sense strand, and this pattern has a first shift with respect to the pattern of alternating motifs of 2'-O-methyl and 2'-F modifications in the antisense strand, i.e., the 2'-O-methyl modified nucleotides in the sense strand form base pairs with the 2'-F modified nucleotides in the antisense strand, and vice versa. Position 1 of the sense strand may start with a 2'-F modification, and position 1 of the antisense strand may start with a 2'-O-methyl modification.

[0179] The introduction of one or more motifs of three identical modifications on three consecutive nucleotides into the sense strand and / or antisense strand interrupts the original modification pattern present in the sense strand and / or antisense strand. This interruption of the modification pattern of the sense strand and / or antisense strand by introducing one or more motifs of three identical modifications on three consecutive nucleotides into the sense strand and / or antisense strand unexpectedly enhances the gene silencing activity against the target gene.

[0180] In one embodiment, when a motif of three identical modifications on three consecutive nucleotides is introduced into either strand, the modifications of the nucleotides adjacent to the motif are different from the modification of the motif. For example, a portion of a sequence containing a motif may be represented by "...N a YYYN b ...", where "Y" represents a modification of a motif of three identical modifications in three consecutive nucleotides, and "N a " and "N b " represents a modification of the nucleotide adjacent to the motif "YYY" that is different from the modification of Y, and N a and N b may be the same or different modifications. a and / or N b may or may not be present if wing modifications are present.

[0181] The RNAi agent may further comprise at least one phosphorothioate or methylphosphonate internucleotide bond. The phosphorothioate or methylphosphonate internucleotide bond modification may be present at any nucleotide in the sense strand, antisense strand, or both strands, at any position in the strand. For example, the internucleotide bond modification may be present at every nucleotide in the sense strand and / or antisense strand; each internucleotide bond modification may be present in an alternating pattern in the sense strand and / or antisense strand; or the sense strand or antisense strand may contain both internucleotide bond modifications in an alternating pattern. The alternating pattern of the internucleotide bond modification in the sense strand may be the same or different from that of the antisense strand, and the alternating pattern of the internucleotide bond modification in the sense strand may have a shift relative to the alternating pattern of the internucleotide bond modification in the antisense strand.

[0182] In one embodiment, the RNAi comprises a phosphorothioate or methylphosphonate internucleotide bond modification in the overhang region. For example, the overhang region can comprise two nucleotides with a phosphorothioate or methylphosphonate internucleotide bond between the two nucleotides. The internucleotide bond modification can also be formed to link the overhang nucleotide with the terminal paired nucleotide in the double-stranded region. For example, at least 2, 3, 4, or all of the overhang nucleotides can be linked by phosphorothioate or methylphosphonate internucleotide bonds, and optionally, there can be additional phosphorothioate or methylphosphonate internucleotide bonds that link the overhang nucleotide with the paired nucleotide adjacent to the overhang nucleotide. For example, there can be at least two phosphorothioate internucleotide bonds between the terminal three nucleotides, two of the three nucleotides being overhang nucleotides, and the third nucleotide being the paired nucleotide adjacent to the overhang nucleotide. These terminal three nucleotides can be at the 3' end of the antisense strand, the 3' end of the sense strand, the 5' end of the antisense strand, and / or the 5' end of the antisense strand.

[0183] In one embodiment, the two nucleotide overhangs are at the 3'-end of the antisense strand, and there are two phosphorothioate internucleotide bonds between the terminal three nucleotides, two of which are overhanging nucleotides, and the third nucleotide is a paired nucleotide adjacent to the overhanging nucleotide. Optionally, the RNAi agent can further have two phosphorothioate internucleotide bonds between the terminal three nucleotides at both the 5'-end of the sense strand and the 5'-end of the antisense strand.

[0184] In one embodiment, the RNAi agent contains mismatches with the target, mismatches within the duplex, or a combination thereof. Mismatches can occur in overhang regions or duplex regions. Base pairs can be evaluated based on their tendency to promote dissociation or melting (e.g., for the free energy of binding or dissociation of a particular pairing; the simplest approach is to examine each pair individually, but similar or equivalent analyses can also be used). With regard to promoting dissociation: A:U is preferred over G:C; G:U is preferred over G:C; and I:C is preferred over G:C (I = inosine). Mismatches, such as non-canonical or non-canonical pairings (described elsewhere herein), are preferred over canonical (A:T, A:U, G:C) pairings; and pairings involving universal bases are preferred over canonical pairings.

[0185] In one embodiment, the RNAi agent includes at least one of the first one, two, three, four, or five base pairs within the double-stranded region from the 5' end of the antisense strand independently selected from the group of A:U, G:U, I:C, and a mismatch pair, e.g., a non-canonical or non-canonical pairing or a pairing containing a universal base, to promote dissociation of the antisense strand at the 5' end of the duplex.

[0186] In one embodiment, the nucleotide at position 1 in the double-stranded region from the 5' end of the antisense strand is selected from the group consisting of A, dA, dU, U, and dT. Alternatively, at least one of the first 1, 2, or 3 base pairs in the double-stranded region from the 5' end of the antisense strand is an AU base pair. For example, the first base pair in the double-stranded region from the 5' end of the antisense strand is an AU base pair.

[0187] In one embodiment, the sense strand sequence has formula (I): 5'n p -N a -(XXX) i -N b -YYY-N b -(ZZZ) j -N a -n q 3'(I) (In the formula: i and j are each independently 0 or 1; p and q are each independently 0 to 6; each N a independently represent oligonucleotide sequences containing 0 to 25 modified nucleotides, each sequence containing at least two differently modified nucleotides; each N b independently represent an oligonucleotide sequence comprising 0 to 10 modified nucleotides; each n p and n q independently represent overhanging nucleotides; wherein Nb and Y do not have the same modification; XXX, YYY and ZZZ each independently represent one motif of three identical modifications in three consecutive nucleotides. Preferably, all of YYY are 2'-F modified nucleotides.

[0188] In one embodiment, N a and / or N b contains alternating patterns of modifications.

[0189] In one embodiment, the YYY motif is located at or near the cleavage site of the sense strand. For example, if the RNAi agent has a double-stranded region 17 to 23 nucleotides in length, the YYY motif can be located at or near the cleavage site of the sense strand, counting from the first nucleotide from the 5' end; or optionally, counting from the first paired nucleotide in the double-stranded region from the 5' end (e.g., at positions 6, 7, 8, 7, 8, 9, 8, 9, 10, 9, 10, 11, 10, 11, 12, or 11, 12, 13).

[0190] In one embodiment, i is 1 and j is 0, or i is 0 and j is 1, or both i and j are 1. Thus, the sense strand may be represented by the following formula: 5'n p -Na -YYY-N b -ZZZ-N a -n q 3'(Ib); 5'n p -N a -XXX-N b -YYY-N a -n q 3'(Ic); or 5'n p -N a -XXX-N b -YYY-N b -ZZZ-N a -n q 3'(Id).

[0191] When the sense strand is represented by formula (Ib), N b represents an oligonucleotide sequence containing 0 to 10, 0 to 7, 0 to 5, 0 to 4, 0 to 2, or 0 modified nucleotides. a can independently represent an oligonucleotide sequence that includes 2 to 20, 2 to 15, or 2 to 10 modified nucleotides.

[0192] When the sense strand is represented by formula (Ic), N b represents an oligonucleotide sequence containing 0 to 10, 0 to 7, 0 to 10, 0 to 7, 0 to 5, 0 to 4, 0 to 2, or 0 modified nucleotides. a can independently represent an oligonucleotide sequence that includes 2 to 20, 2 to 15, or 2 to 10 modified nucleotides.

[0193] When the sense strand is represented as formula (Id), each N b independently represent an oligonucleotide sequence containing 0 to 10, 0 to 7, 0 to 5, 0 to 4, 0 to 2, or 0 modified nucleotides. b is 0, 1, 2, 3, 4, 5 or 6. Each N a can independently represent an oligonucleotide sequence that includes 2 to 20, 2 to 15, or 2 to 10 modified nucleotides.

[0194] Each of X, Y and Z can be the same or different from each other.

[0195] In other embodiments, i is 0, j is 0, and the sense strand may be represented by the formula: 5'n p -N a -YYY-N a -n q 3'(Ia).

[0196] When the sense strand is represented by formula (Ia), each N a can independently represent an oligonucleotide sequence that includes 2 to 20, 2 to 15, or 2 to 10 modified nucleotides.

[0197] In one embodiment, the antisense strand sequence of the RNAi has formula (II): 5'n q’ -N a '-(Z'Z'Z') k -N b '-Y'Y'Y'-N b '-(X'X'X') l -N' a -n p '3'(II) (In the formula: k and l are each independently 0 or 1; p' and q' are each independently 0 to 6; each N a ' independently represent oligonucleotide sequences containing 0 to 25 modified nucleotides, each sequence containing at least two differently modified nucleotides; each N b ' independently represents an oligonucleotide sequence containing 0 to 10 modified nucleotides; each n p ' and n q ' independently represents an overhanging nucleotide; where N b ' and Y' do not have the same modification; X'X'X', Y'Y'Y' and Z'Z'Z' each independently represent one motif of three identical modifications in three consecutive nucleotides. It can be represented by:

[0198] In one embodiment, N a ' and / or N b ' includes alternating pattern modifications.

[0199] The Y'Y'Y' motif is present at or near the cleavage site of the antisense strand. For example, if the RNAi agent has a double-stranded region 17 to 23 nucleotides in length, the Y'Y'Y' motif can be present at positions 9, 10, 11; 10, 11, 12; 11, 12, 13; 12, 13, 14; or 13, 14, 15 of the antisense strand, counting from the first nucleotide from the 5' end; or optionally, counting from the first paired nucleotide in the double-stranded region from the 5' end. Preferably, the Y'Y'Y' motif is present at positions 11, 12, or 13.

[0200] In one embodiment, the Y'Y'Y' motif is all 2'-OMe modified nucleotides.

[0201] In one embodiment, k is 1 and l is 0, or k is 0 and l is 1, or both k and l are 1.

[0202] Thus, the antisense strand can be represented by the following formula: 5'n q’ -N a '-Z'Z'Z'-N b '-Y'Y'Y'-N a '-n p’ 3'(IIb); 5'n q’ -N a '-Y'Y'Y'-N b '-X'X'X'-n p’ 3'(IIc); or 5'n q’ -N a '-Z'Z'Z'-N b '-Y'Y'Y'-N b '-X'X'X'-N a '-n p’3'(IId).

[0203] When the antisense strand is represented by formula (IIb), N b ’ represents an oligonucleotide sequence containing 0 to 10, 0 to 7, 0 to 10, 0 to 7, 0 to 5, 0 to 4, 0 to 2, or 0 modified nucleotides. a ' independently represents an oligonucleotide sequence containing 2 to 20, 2 to 15, or 2 to 10 modified nucleotides.

[0204] When the antisense strand is represented by formula (IIc), N b ' represents an oligonucleotide sequence containing 0 to 10, 0 to 7, 0 to 10, 0 to 7, 0 to 5, 0 to 4, 0 to 2, or 0 modified nucleotides. a ' independently represents an oligonucleotide sequence containing 2 to 20, 2 to 15, or 2 to 10 modified nucleotides.

[0205] When the antisense strand is represented by formula (IId), each N b Each N' independently represents an oligonucleotide sequence containing 0 to 10, 0 to 7, 0 to 10, 0 to 7, 0 to 5, 0 to 4, 0 to 2, or 0 modified nucleotides. a ' independently represents an oligonucleotide sequence containing 2 to 20, 2 to 15, or 2 to 10 modified nucleotides. b is 0, 1, 2, 3, 4, 5 or 6.

[0206] In other embodiments, k is 0, l is 0, and the antisense strand may be represented by the formula: 5'n p’ -N a’ -Y'Y'Y'-N a’ -n q’ 3'(Ia).

[0207] When the antisense strand is represented by formula (IIa), each N a ' independently represents an oligonucleotide sequence containing 2 to 20, 2 to 15, or 2 to 10 modified nucleotides.

[0208] Each of X', Y' and Z' can be the same or different from each other.

[0209] Each nucleotide in the sense strand and the antisense strand can be independently modified with LNA, HNA, CeNA, 2'-methoxyethyl, 2'-O-methyl, 2'-O-allyl, 2'-C-allyl, 2'-hydroxyl, or 2'-fluoro. For example, each nucleotide in the sense strand and the antisense strand can be independently modified with 2'-O-methyl or 2'-fluoro. Each X, Y, Z, X', Y', and Z' can specifically represent a 2'-O-methyl modification or a 2'-fluoro modification.

[0210] In one embodiment, the sense strand of the RNAi agent may include a YYY motif at positions 9, 10, and 11 of the strand, counting from the first nucleotide from the 5' end if the double-stranded region is 21 nucleotides; or optionally, counting from the first paired nucleotide in the double-stranded region from the 5' end; Y represents a 2'-F modification. The sense strand may further include a XXX motif or a ZZZ motif as a wing modification at the opposite end of the double-stranded region; XXX and ZZZ each independently represent a 2'-OMe modification or a 2'-F modification.

[0211] In one embodiment, the antisense strand may include a Y'Y'Y' motif at positions 11, 12, and 13 of the strand, counting from the first nucleotide from the 5'-end; or optionally, counting from the first paired nucleotide in the double-stranded region from the 5'-end; Y' represents a 2'-O-methyl modification. The antisense strand may further include an X'X'X' motif or a Z'Z'Z' motif as a wing modification at the opposite end of the double-stranded region; X'X'X' and Z'Z'Z' each independently represent a 2'-OMe modification or a 2'-F modification.

[0212] The sense strand represented by any one of the above formulas (Ia), (Ib), (Ic), and (Id) forms a duplex with the antisense strand represented by any one of the above formulas (IIa), (IIb), (IIc), and (IId).

[0213] Thus, an RNAi agent for use in the methods of the invention may comprise a sense strand and an antisense strand, each strand having 14 to 30 nucleotides, and the RNAi duplex has the formula (III): Sense:5'n p -N a -(XXX) i -N b -YYY-N b -(ZZZ) j -N a -n q 3' Antisense: 3'n p ’ -N a ’ -(X'X'X') k -N b ’ -Y'Y'Y'-N b ’ -(Z'Z'Z') l -N a ’ -n q ’ 5' (III) (In the formula: i, j, k, and l are each independently 0 or 1; p, p', q, and q' are each independently 0 to 6; each N a and N a ’ independently represent oligonucleotide sequences containing 0 to 25 modified nucleotides, each sequence containing at least two differently modified nucleotides; each N b and N b ’ independently represent an oligonucleotide sequence comprising 0 to 10 modified nucleotides; where: Each n may or may not be present p ',n p , n q ', and n q independently represent overhanging nucleotides; XXX, YYY, ZZZ, X'X'X', Y'Y'Y', and Z'Z'Z' each independently represent one motif of three identical modifications on three consecutive nucleotides. is expressed by

[0214] In one embodiment, i is 0 and j is 0; or i is 1 and j is 0; or i is 0 and j is 1; or both i and j are 0; or both i and j are 1. In another embodiment, k is 0 and l is 0; or k is 1 and l is 0; or k is 0 and l is 1; or both k and l are 0; or both k and l are 1.

[0215] Exemplary combinations of sense and antisense strands that form RNAi duplexes include the following formulas: 5'n p -N a -YYY-N a -n q 3' 3'n p ’ -N a ’ -Y'Y'Y'-N a ’ n q ’ 5' (IIIa) 5'n p -N a -YYY-N b -ZZZ-N a -n q 3' 3'n p ’ -N a ’ -Y'Y'Y'-N b ’ -Z'Z'Z'-N a ’ n q’ 5' (IIIb) 5'n p -N a -XXX-N b -YYY-N a -n q 3' 3'n p ’ -N a ’ -X'X'X'-N b ’ -Y'Y'Y'-N a ’ -n q ’ 5' (IIIc) 5'n p -N a -XXX-N b -YYY-N b -ZZZ-N a -n q 3' 3'n p ’ -N a ’ -X'X'X'-N b ’ -Y'Y'Y'-N b ’ -Z'Z'Z'-N a -n q ’ 5' (IIId)

[0216] When the RNAi agent is represented by formula (IIIa), each N a represents an oligonucleotide sequence that independently contains 2 to 20, 2 to 15, or 2 to 10 modified nucleotides.

[0217] When the RNAi agent is represented by formula (IIIb), each N b represents an oligonucleotide sequence containing, independently, 1 to 10, 1 to 7, 1 to 5, or 1 to 4 modified nucleotides. a represents an oligonucleotide sequence that independently contains 2 to 20, 2 to 15, or 2 to 10 modified nucleotides.

[0218] When the RNAi agent is represented as formula (IIIc), each N b , N b Each N' independently represents an oligonucleotide sequence containing 0 to 10, 0 to 7, 0 to 10, 0 to 7, 0 to 5, 0 to 4, 0 to 2, or 0 modified nucleotides. a represents an oligonucleotide sequence that independently contains 2 to 20, 2 to 15, or 2 to 10 modified nucleotides.

[0219] When the RNAi agent is represented as formula (IIId), each N b , N b Each N' independently represents an oligonucleotide sequence containing 0 to 10, 0 to 7, 0 to 10, 0 to 7, 0 to 5, 0 to 4, 0 to 2, or 0 modified nucleotides. a , N a ’ represents an oligonucleotide sequence containing, independently, 2 to 20, 2 to 15, or 2 to 10 modified nucleotides. a , N a ', N b and N b ’ Each of independently comprises an alternating pattern of modifications.

[0220] Each of X, Y and Z in formulas (III), (IIIa), (IIIb), (IIIc), and (IIId) can be the same as or different from each other.

[0221] When an RNAi agent is represented by formula (III), (IIIa), (IIIb), (IIIc), and (IIId), at least one of the Y nucleotides can be base-paired with one of the Y' nucleotides, alternatively, at least two of the Y nucleotides are base-paired with a corresponding Y' nucleotide; or all three of the Y nucleotides are base-paired with a corresponding Y' nucleotide.

[0222] When the RNAi agent is represented by formula (IIIb) or (IIId), at least one of the Z nucleotides can be base-paired with one of the Z' nucleotides, or at least two of the Z nucleotides can be base-paired with a corresponding Z' nucleotide; or all three of the Z nucleotides can be base-paired with a corresponding Z' nucleotide.

[0223] When an RNAi agent is represented as formula (IIIc) or (IIId), at least one of the X nucleotides can be base-paired with one of the X' nucleotides, alternatively, at least two of the X nucleotides are base-paired with the corresponding X' nucleotide; or all three of the X nucleotides are base-paired with the corresponding X' nucleotide.

[0224] In one embodiment, the modification on a Y nucleotide is different from the modification on a Y' nucleotide, the modification on a Z nucleotide is different from the modification on a Z' nucleotide, and / or the modification on an X nucleotide is different from the modification on an X' nucleotide.

[0225] In one embodiment, when the RNAi agent is represented by formula (IIId), N a The modification is a 2'-O-methyl or a 2'-fluoro modification. In another embodiment, when the RNAi agent is represented by formula (IIId), N a The modification is a 2'-O-methyl or 2'-fluoro modification, p '>0 and at least one n p In yet another embodiment, when the RNAi agent is represented by formula (IIId), N' is linked to the adjacent nucleotide via a phosphorothioate bond. a The modification is a 2'-O-methyl or 2'-fluoro modification, p '>0 and at least one n pIn another embodiment, when the RNAi agent is represented by formula (IIId), N' is attached to the adjacent nucleotide via a phosphorothioate linkage, and the sense strand is conjugated to one or more GalNAc derivatives attached via a bivalent or trivalent branched linker. a The modification is a 2'-O-methyl or 2'-fluoro modification, p '>0 and at least one n p ' is linked to adjacent nucleotides via phosphorothioate linkages, and the sense strand comprises at least one phosphorothioate linkage, and the sense strand is conjugated to one or more GalNAc derivatives linked via a bivalent or trivalent branched linker.

[0226] In one embodiment, when the RNAi agent is represented by formula (IIIa), N a The modification is a 2'-O-methyl or 2'-fluoro modification, p '>0 and at least one n p ' is linked to adjacent nucleotides via phosphorothioate linkages, and the sense strand comprises at least one phosphorothioate linkage, and the sense strand is conjugated to one or more GalNAc derivatives linked via a bivalent or trivalent branched linker.

[0227] In one embodiment, the RNAi agent is a multimer comprising at least two duplexes represented by formula (III), (IIIa), (IIIb), (IIIc), and (IIId), wherein the duplexes are linked by a linker. The linker may be cleavable or non-cleavable. Optionally, the multimer further comprises a ligand. Each of the duplexes can target the same gene or two different genes; or each of the duplexes can target the same gene at two different target sites.

[0228] In one embodiment, the RNAi agent is a multimer comprising three, four, five, six or more duplexes represented by formulas (III), (IIIa), (IIIb), (IIIc), and (IIId), the duplexes being linked by a linker. The linker may be cleavable or non-cleavable. Optionally, the multimer further comprises a ligand. Each of the duplexes can target the same gene or two different genes; or each of the duplexes can target the same gene at two different target sites.

[0229] In one embodiment, two RNAi agents represented by formula (III), (IIIa), (IIIb), (IIIc), and (IIId) are linked to each other at one or both of the 5' and 3' ends, and are optionally conjugated to a ligand. Each of the RNAi agents can target the same gene or two different genes; or each of the RNAi agents can target the same gene at two different target sites.

[0230] Various publications describe the multimeric RNAi agent that can be used in the method of the present invention.Such publications include WO2007 / 091269, US Patent No. 7858769, WO2010 / 141511, WO2007 / 117686, WO2009 / 014887 and WO2011 / 031520, each of which is incorporated herein by reference in its entirety.

[0231] RNAi agents comprising one or more carbohydrate moieties conjugated to the RNAi agent can optimize one or more properties of the RNAi agent. Often, the carbohydrate moiety is attached to a modified subunit of the RNAi agent. For example, the ribose sugar of one or more ribonucleotide subunits of a dsRNA agent can be replaced with another moiety, such as a non-carbohydrate (preferably cyclic) carrier to which a carbohydrate ligand is attached. Ribonucleotide subunits in which the ribose sugar of the subunit has been replaced in this manner are referred to herein as ribose-replacement modified subunits (RRMS). The cyclic carrier can be a carbocyclic ring system, i.e., all ring atoms are carbon atoms, or a heterocyclic ring system, i.e., one or more ring atoms can be a heteroatom, such as nitrogen, oxygen, or sulfur. The cyclic carrier can be a monocyclic ring system or can contain two or more rings, such as fused rings. The cyclic carrier can be a fully saturated ring system or can contain one or more double bonds.

[0232] The ligand can be attached to the polynucleotide via a carrier. The carrier comprises (i) at least one "backbone attachment point," preferably two "backbone attachment points," and (ii) at least one "tether attachment point." As used herein, "backbone attachment point" refers to a bond available and suitable for incorporation of the carrier into the backbone of a ribonucleic acid, containing a functional group, e.g., a hydroxyl group, or generally a backbone, e.g., a phosphate, or a modified phosphate, e.g., sulfur. In certain embodiments, a "tether attachment point" (TAP) refers to a ring atom, e.g., a carbon atom or heteroatom (different from the atom providing the backbone attachment point), of the cyclic carrier to which the selected moiety is attached. This moiety can be, for example, a carbohydrate, e.g., a monosaccharide, disaccharide, trisaccharide, tetrasaccharide, oligosaccharide, or polysaccharide. Optionally, the selected moiety is attached to the cyclic carrier by an intervening tether. Thus, cyclic carriers often contain functional groups, such as amino groups, or generally provide bonds suitable for the incorporation or tethering of another chemical moiety, such as a ligand, to the constituent ring.

[0233] The RNAi agent may be conjugated to the ligand via a carrier, which may be a cyclic group or a cyclic group; preferably, the cyclic group is selected from pyrrolidinyl, pyrazolinyl, pyrazolidinyl, imidazolinyl, imidazolidinyl, piperidinyl, piperazinyl, [1,3]dioxolane, oxazolidinyl, isoxazolidinyl, morpholinyl, thiazolidinyl, isothiazolidinyl, quinoxalinyl, pyridazinonyl, tetrahydrofuryl, and decalin; preferably, the cyclic group is selected from a serinol backbone or a diethanolamine backbone.

[0234] In certain embodiments, an RNAi agent for use in the methods of the invention is an agent selected from the group of agents listed in any one of Tables 1, 2, 4, 5, 8, 10, and 12. In one embodiment, when the agent is an agent listed in Table 12, the agent may lack a terminal dT.

[0235] The present invention further includes double-stranded RNAi agents comprising any one of the sequences listed in any one of Tables 1, 2, 4, 5, 8, 10, and 12, which comprise a 5' phosphate or 5' phosphate mimic on the antisense strand (see, e.g., PCT Publication No. WO 2011005860). Additionally, the present invention includes double-stranded RNAi agents comprising any one of the sequences listed in any one of Tables 1, 2, 4, 5, 8, 10, and 12, which comprise a 2' fluoro group instead of a 2'-OMe group at the 5' end of the sense strand.

[0236] These agents may further comprise a ligand.

[0237] In one embodiment, the agent is AD-60940 (sense strand: CfsusGfgUfaUfuUfCfCfuAfgGfgUfaCfaAfL96; antisense strand: usUfsgUfaCfcCfuAfggaAfaUfaCfcAfgsasg).

[0238] A. Ligand The double-stranded RNA (dsRNA) agent of the present invention can optionally be conjugated to one or more ligands. The ligand can be attached to the sense strand, the antisense strand, or both strands at the 3' end, the 5' end, or both ends. For example, the ligand can be conjugated to the sense strand. In a preferred embodiment, the ligand is conjugated to the 3' end of the sense strand. In a preferred embodiment, the ligand is a GalNAc ligand. In a particularly preferred embodiment, the ligand is GalNAc3: [ka]

[0239] In certain embodiments, a ligand, e.g., a GalNAc ligand, is attached to the 3' end of the RNAi agent. [ka] wherein X is O or S. In one embodiment, X is O.

[0240] A variety of components can be attached to the RNAi agents of the invention. Preferred moieties are ligands, which are attached directly or indirectly, preferably covalently, via an intervening tether.

[0241] In preferred embodiments, the ligand alters the distribution, targeting, or lifetime of the molecule into which it is incorporated. In preferred embodiments, the ligand provides improved affinity for a selected target, e.g., a molecule, a cell or cell type, a compartment, a receptor, e.g., a cellular or organ compartment, a tissue, an organ, or a region of the body, compared to, e.g., a species in the absence of such ligand. Ligands that provide improved affinity for a selected target are also referred to as targeting ligands.

[0242] Some ligands may have endosomolytic properties. Endosomolytic ligands promote lysis of endosomes and / or transport of the compositions of the present invention, or components thereof, from endosomes to the cytoplasm of cells. Endosomolytic ligands may be polyanionic peptides or peptidomimetics that exhibit pH-dependent membrane activity and fusogenicity. In one embodiment, the endosomolytic ligand adopts its active conformation at endosomal pH. An "active" conformation is one in which the endosomolytic ligand promotes lysis of endosomes and / or transport of the compositions of the present invention, or components thereof, from endosomes to the cytoplasm of cells. Exemplary endosomolytic ligands include GALA peptide (Subbarao et al., Biochemistry, 1987, 26:2964-2972), EALA peptide (Vogel et al., J. Am. Chem. Soc., 1996, 118:1581-1586), and their derivatives (Turk et al., Biochem. Biophys. Acta, 2002, 1559:56-68). In one embodiment, the endosomolytic component may contain a chemical group (e.g., an amino acid) that undergoes a change in charge or protonation in response to a change in pH. The endosomolytic component may be linear or branched.

[0243] The ligands can improve the transport, hybridization, and specificity properties, and can also improve the nuclease resistance of the resulting natural or modified oligoribonucleotides, or polymer molecules comprising any combination of the monomers described herein and / or natural or modified ribonucleotides.

[0244] Ligands may generally include therapeutic modifiers, e.g., to enhance uptake; diagnostic compounds or reporter groups, e.g., to monitor distribution; cross-linking agents; and moieties that confer nuclease resistance. Common examples include lipids, steroids, vitamins, sugars, proteins, peptides, polyamines, and peptidomimetics.

[0245] Ligands can include naturally occurring substances such as proteins (e.g., human serum albumin (HSA), low density lipoprotein (LDL), high density lipoprotein (HDL), or globulins); carbohydrates (e.g., dextran, pullulan, chitin, chitosan, inulin, cyclodextrin, or hyaluronic acid); or lipids. Ligands can also be recombinant or synthetic molecules, such as synthetic polymers, e.g., synthetic polyamino acids, oligonucleotides (e.g., aptamers), and the like. Examples of polyamino acids include polylysine (PLL), poly-L-aspartic acid, poly-L-glutamic acid, styrene-maleic anhydride copolymer, poly(L-lactide-co-glycolide) copolymer, divinyl ether-maleic anhydride copolymer, N-(2-hydroxypropyl)methacrylamide copolymer (HMPA), polyethylene glycol (PEG), polyvinyl alcohol (PVA), polyurethane, poly(2-ethylacrylic acid), N-isopropylacrylamide polymer, and polyphosphazine. Examples of polyamines include polyethyleneimine, polylysine (PLL), spermine, spermidine, polyamines, pseudopeptide-polyamines, peptidomimetic polyamines, dendrimeric polyamines, arginine, amidine, protamine, cationic lipids, cationic porphyrins, quaternary salts of polyamines, and α-helical peptides.

[0246] The ligand can also include a targeting group, e.g., a cell or tissue targeting agent, e.g., a lectin, glycoprotein, lipid, or protein, e.g., an antibody that binds to a specific cell type such as a kidney cell. The targeting group can be thyrotropin, melanotropin, lectin, glycoprotein, surfactant protein A, mucin carbohydrate, multivalent lactose, multivalent galactose, N-acetyl-galactosamine, N-acetyl-glucosamine, multivalent mannose, multivalent fucose, glycosylated polyamino acid, multivalent galactose, transferrin, bisphosphonate, polyglutamate, polyaspartate, lipid, cholesterol, steroid, bile acid, folate, vitamin B12, biotin, RGD peptide, RGD peptidomimetic, or aptamer.

[0247] Other examples of ligands include dyes, intercalating agents (e.g., acridine), crosslinkers (e.g., psoralens, mitomycin C), porphyrins (TPPC4, texaphyrin, sapphyrin), polycyclic aromatic hydrocarbons (e.g., phenazine, dihydrophenazine), artificial endonucleases or chelating agents (e.g., EDTA), lipophilic molecules such as cholesterol, cholic acid, adamantaneacetic acid, 1-pyrenebutyric acid, dihydrotestosterone, 1,3-bis-O(hexadecyl)glycerol, geranyloxyhexyl group, hexadecylglycerol, borneol, menthol, 1,3-propanediol, heptadecyl group, palmitic acid, myristic acid, O3-(oleoyl)lithocholic acid, O3-(oleoyl)cholenic acid (cholenic acid), and the like. acid, dimethoxytrityl, or phenoxazine) and peptide conjugates (e.g., antennapedia peptide, Tat peptide), alkylating agents, phosphate, amino, mercapto, PEG (e.g., PEG-40K), MPEG, [MPEG]2, polyamino, alkyl, substituted alkyl, radiolabeled markers, enzymes, haptens (e.g., biotin), transport / absorption enhancers (e.g., aspirin, vitamin E, folic acid), synthetic ribonucleases (e.g., imidazole, bis-imidazole, histamine, imidazole cluster, acridine-imidazole conjugate, Eu3+ tetraazamacrocycle conjugate), dinitrophenyl, HRP, or AP.

[0248] Ligands can be proteins, e.g., glycoproteins, or peptides, e.g., co-ligands, or antibodies, e.g., molecules with specific affinity for antibodies that bind to specific cell types, such as cancer cells, endothelial cells, or bone cells. Ligands can also include hormones and hormone receptors. Ligands can also include non-peptide species, such as lipids, lectins, carbohydrates, vitamins, cofactors, multivalent lactose, multivalent galactose, N-acetyl-galactosamine, N-acetyl-glucosamine, multivalent mannose, multivalent fucose, or aptamers. Ligands can be, for example, lipopolysaccharides, activators of MAP kinase, or activators of NF-κB.

[0249] The ligand can be a substance, e.g., a drug, that can enhance uptake of the iRNA agent into the cell, e.g., by disrupting the cellular microtubules, microfilaments, and / or intermediate filaments, e.g., by disrupting the cytoskeleton. The drug can be, e.g., taxon, vincristine, vinblastine, cytochalasin, nocodazole, jasplakinolide, latrunculin A, phalloidin, swinholide A, indanocine, or myoservin.

[0250] Ligands can increase oligonucleotide uptake into cells, for example, by activating an inflammatory response. Exemplary ligands that can have such an effect include tumor necrosis factor alpha (TNFα), interleukin-1β, or gamma interferon.

[0251] In one embodiment, the ligand is a lipid or lipid-based molecule. Such lipid or lipid-based molecule preferably binds to serum proteins, such as human serum albumin (HSA). HSA-binding ligands allow the conjugate to be distributed to target tissues in the body, such as non-renal target tissues. For example, the target tissue can be the liver, including liver parenchymal cells. Other molecules that can bind to HSA can also be used as ligands. For example, naproxen or aspirin can be used. Lipid or lipid-based ligands can be used to (a) increase the resistance of the conjugate to degradation, (b) increase targeting or transport to target cells or cell membranes, and / or (c) adjust binding to serum proteins, such as HSA.

[0252] Lipid-based ligands can be used to regulate, for example, control, the binding of conjugates to target tissues.For example, lipids or lipid-based ligands that bind more strongly to HSA are less likely to be targeted to the kidney and therefore less likely to be removed from the body.Lipids or lipid-based ligands that bind less strongly to HSA can be used to target conjugates to the kidney.

[0253] In a preferred embodiment, the lipid-based ligand binds to HSA. Preferably, the lipid-based ligand binds to HSA with sufficient affinity such that the conjugate preferably distributes to non-renal tissues. However, the affinity is preferably not so strong that the HSA-ligand binding cannot be reversed.

[0254] In another preferred embodiment, the lipid-based ligand binds weakly or not at all to HSA, such that the conjugate preferably distributes to the kidney. Other moieties that target kidney cells can also be used in place of or in addition to the lipid-based ligand.

[0255] In another embodiment, the ligand is a moiety, e.g., a vitamin, that is taken up by target cells, e.g., proliferating cells. These are particularly useful, for example, for treating disorders characterized by unwanted malignant or non-malignant cell proliferation, e.g., cancer cells. Exemplary vitamins include vitamins A, E, and K. Other exemplary vitamins include vitamin B, e.g., folic acid, B12, riboflavin, biotin, pyridoxal, or other vitamins or nutrients taken up by cancer cells. Also included are HAS, low-density lipoproteins (LDL), and high-density lipoproteins (HDL).

[0256] In another embodiment, the ligand is a cell-permeation agent, preferably a helical cell-permeation agent. Preferably, the agent is amphipathic. Exemplary agents are peptides such as tat or antennopedia. If the agent is a peptide, it can be modified, including peptidyl mimetics, invertomers, non-peptide or pseudo-peptide bonds, and the use of D-amino acids. The helical agent is preferably an α-helical agent, which preferably has a lipophilic and lipophobic phase.

[0257] The ligand can be a peptide or peptidomimetic. Peptidomimetics (also referred to herein as oligopeptidomimetics) are molecules capable of folding into defined three-dimensional structures similar to natural peptides. The peptide or peptidomimetic moiety can be about 5 to 50 amino acids in length, e.g., about 5, 10, 15, 20, 25, 30, 35, 40, 45, or 50 amino acids in length. The peptide or peptidomimetic can be, for example, a cell-penetrating peptide, a cationic peptide, an amphipathic peptide, or a hydrophobic peptide (e.g., composed primarily of Tyr, Trp, or Phe). The peptide moiety can be a dendrimeric peptide, a constrained peptide, or a cross-linked peptide. In another alternative, the peptide moiety can include a hydrophobic membrane transport sequence (MTS). An exemplary hydrophobic MTS-containing peptide is RFGF, having the amino acid sequence AAVALLPAVLLALLAP (SEQ ID NO: 11). An RFGF analog containing a hydrophobic MTS (e.g., the amino acid sequence AALLPVLLAAP (SEQ ID NO: 12)) A peptide moiety can also be a targeting moiety. The peptide moiety can be a "delivery" peptide capable of transporting large polar molecules, including peptides, oligonucleotides, and proteins, across cell membranes. For example, the sequence (GRKKRRQRRRPPQ) (SEQ ID NO: 13) from the HIV Tat protein and the Drosophila Antennapedia protein (RQIKIWFQNRRMKWKK) (SEQ ID NO: 14) have been shown to be capable of functioning as delivery peptides. A peptide or peptidomimetic can be encoded by a random sequence of DNA, such as peptides identified from a phage display library or a one-bead-one-compound (OBOC) combinatorial library (Lam et al., Nature, 354:82-84, 1991). Preferably, the peptide or peptidomimetic attached to the iRNA agent via an incorporated monomer unit is a peptide such as an arginine-glycine-aspartic acid (RGD)-peptide or RGD mimic. The peptide moiety can range in length from about 5 amino acids to about 40 amino acids. The peptide moiety can have structural modifications, such as to enhance stability or direct conformational properties. Any of the structural modifications described below can be used. An RGD peptide moiety can be used to target tumor cells, such as endothelial tumor cells or breast cancer tumor cells (Zitzmann et al., Cancer Res., 62:5139-43, 2002). RGD peptides can facilitate targeting of iRNA agents to tumors of various other tissues, including the lung, kidney, spleen, or liver (Aoki et al., Cancer Gene Therapy 8:783-787, 2001). Preferably, RGD peptides facilitate targeting of iRNA agents to the kidney. RGD peptides can be linear or cyclic and can be modified, e.g., glycosylated or methylated, to facilitate targeting to specific tissues. For example, a glycosylated RGD peptide can target an iRNA agent to a α VIt can be delivered to tumor cells expressing β3 (Haubner et al., Jour. Nucl. Med., 42:326-336, 2001). Peptides that target markers abundant in proliferating cells can be used. For example, RGD-containing peptides and peptidomimetics can target cancer cells, particularly cells that display integrins. Thus, RGD peptides, cyclic peptides containing RGD, RGD peptides containing D-amino acids, and synthetic RGD mimetics can be used. In addition to RGD, other moieties that target integrin ligands can be used. Generally, such ligands can be used to control proliferating cells and angiogenesis. Preferred conjugates of this type of ligand target PECAM-1, VEGF, or other oncogenes, such as those described herein.

[0258] A "cell-penetrating peptide" is capable of penetrating cells, e.g., microbial cells such as bacterial or fungal cells, or mammalian cells such as human cells. Peptides that penetrate microbial cells can be, for example, α-helical linear peptides (e.g., LL-37 or Ceropin P1), disulfide bond-containing peptides (e.g., α-defensins, β-defensins, or bactenecins), or peptides containing only one or two dominant amino acids (e.g., PR-39 or indolicidin). Cell-penetrating peptides can also contain a nuclear localization signal (NLS). For example, a cell-penetrating peptide can be a bisected amphipathic peptide such as MPG, derived from the fusion peptide domain of HIV-1 gp41 and the NLS of SV40 large T antigen (Simeoni et al., Nucl. Acids Res. 31:2717-2724, 2003).

[0259] In one embodiment, the targeting peptide may be an amphipathic α-helical peptide. Exemplary amphipathic α-helical peptides include, but are not limited to, cecropin, lycotoxin, paradaxin, buforin, CPF, bombinin-like peptide (BLP), cathelicidin, ceratotoxin, S. clava peptide, hagfish intestinal antimicrobial peptide (HFIAP), magainin, brevinin-2, dermaseptin, melittin, pleurocidin, H2A peptide, Xenopus peptide, esculentinis-1, and caerin. Several factors are believed to preferably maintain the integrity of helical stability. For example, a maximum number of helix-stabilizing residues (e.g., leu, ala, or lys) are used, and a minimum number of helix-destabilizing residues (e.g., proline, or cyclic monomer units) are used. Capping residues are contemplated (e.g., Gly is an exemplary N-capping residue), and / or C-terminal amidation can be used to provide additional H-bonds to stabilize the helix. Stability can be provided by the formation of salt bridges between oppositely charged residues separated by positions i±3, or i±4. For example, cationic residues such as lysine, arginine, homo-arginine, ornithine, or histidine can form salt bridges with the anionic residues glutamic acid or aspartic acid.

[0260] Peptide and peptidomimetic ligands include ligands having natural or modified peptides, e.g., D or L peptides; α, β, or γ peptides; N-methyl peptides; azapeptides; peptides having one or more amide bonds, i.e., peptide bonds, replaced by one or more urea, thiourea, carbamate, or sulfonylurea bonds; or cyclic peptides.

[0261] The targeting ligand can be any ligand that can target a specific receptor. Examples include folate, GalNAc, galactose, mannose, mannose-6P, sugar clusters such as GalNAc clusters, mannose clusters, galactose clusters, or aptamers. A cluster is a combination of two or more sugar units. Targeting ligands also include integrin receptor ligands, chemokine receptor ligands, transferrin, biotin, serotonin receptor ligands, PSMA, endothelin, GCPII, somatostatin, LDL, and HDL ligands. The ligand can also be based on nucleic acids, for example, aptamers. The aptamer can be unmodified or can have any combination of modifications disclosed herein.

[0262] Endosomal release agents include imidazoles, poly- or oligoimidazoles, PEI, peptides, fusogenic peptides, polycarboxylates, polycations, masked oligo- or polycations or anions, acetals, polyacetals, ketals / polyketals, orthoesters, polymers with masked or unmasked cationic or anionic charge, dendrimers with masked or unmasked cationic or anionic charge.

[0263] PK modulators refer to pharmacokinetic modulators. PK modulators include lipophiles, bile acids, steroids, phospholipid analogs, peptides, protein binders, PEG, vitamins, and the like. Exemplary PK modulators include, but are not limited to, cholesterol, fatty acids, cholic acid, lithocholic acid, dialkylglycerides, diacylglycerides, phospholipids, sphingolipids, naproxen, ibuprofen, vitamin E, biotin, and the like. Oligonucleotides containing several phosphorothioate linkages are also known to bind to serum proteins. Therefore, short oligonucleotides containing multiple phosphorothioate linkages in the backbone, e.g., oligonucleotides of about 5, 10, 15, or 20 bases, are also suitable as ligands (e.g., as PK-modulating ligands) for the present invention.

[0264] Furthermore, aptamers that bind to serum components (eg, serum proteins) are also suitable as PK-modulating ligands in the present invention.

[0265] Other ligand conjugates suitable for the present invention are described in U.S. patent application Ser. Nos. 10 / 916,185, filed Aug. 10, 2004; 10 / 946,873, filed Sep. 21, 2004; 10 / 833,934, filed Aug. 3, 2007; 11 / 115,989, filed Apr. 27, 2005; and 11 / 944,227, filed Nov. 21, 2007, which are incorporated by reference in their entireties for all purposes.

[0266] When two or more ligands are present, the ligands may all have the same properties, or all have different properties, or some ligands have the same properties while other ligands have different properties.For example, the ligands may have targeting properties, endosomolytic activity, or PK modulating properties.In a preferred embodiment, all ligands have different properties.

[0267] The ligand can be attached to the oligonucleotide at various positions, e.g., the 3' end, the 5' end, and / or an internal position. In a preferred embodiment, the ligand is attached to the oligonucleotide via an intervening tether, e.g., a carrier described herein. The ligand or linking ligand can be present on the monomer as it is incorporated into the growing chain. In some embodiments, the ligand can be incorporated by attachment to a "precursor" monomer after it has been incorporated into the growing chain. For example, a monomer having an amino-terminal tether (i.e., no ligand attached), e.g., TAP-(CH2) nNH can be incorporated into the growing oligonucleotide chain. In a subsequent operation, i.e., after the precursor monomer has been incorporated into the chain, a ligand bearing an electrophilic group, e.g., a pentafluorophenyl ester group or an aldehyde group, can then be attached to the precursor monomer by bonding the electrophilic group of the ligand with the terminal electrophilic group of the tether of the precursor monomer.

[0268] In another example, a monomer bearing a chemical group suitable for participating in a click chemistry reaction can be incorporated into a tether / linker, for example, an azide or alkyne terminated tether / linker. In a subsequent operation, i.e., after the precursor monomer is incorporated into the chain, a ligand bearing a complementary chemical group, e.g., an alkyne or azide, can be attached to the precursor monomer by linking the alkyne and azide together.

[0269] In the case of a double-stranded oligonucleotide, a ligand can be attached to one or both strands. In some embodiments, a double-stranded iRNA agent includes a ligand conjugated to the sense strand. In other embodiments, a double-stranded iRNA agent includes a ligand conjugated to the antisense strand.

[0270] In some embodiments, the ligand can be conjugated to the nucleobase, sugar moiety, or internucleoside linkage of a nucleic acid molecule. Conjugation to a purine nucleobase or a derivative thereof can occur at any position, including endocyclic and exocyclic atoms. In some embodiments, the 2-, 6-, 7-, or 8-position of a purine nucleobase is bound to a conjugate moiety. Conjugation to a pyrimidine nucleobase or a derivative thereof can also occur at any position. In some embodiments, the 2-, 5-, and 6-positions of a pyrimidine nucleobase can be substituted with a conjugate moiety. Conjugation to a sugar moiety of a nucleoside can occur at any carbon atom. Examples of carbon atoms of the sugar moiety that can be bound to a conjugate moiety include the 2', 3', and 5' carbon atoms. The 1' position can also be bound to a conjugate moiety, such as in an abasic residue. The internucleoside linkage can also have a conjugate moiety. In the case of phosphorus-containing linkages (e.g., phosphodiester, phosphorothioate, phosphorodithioate, phosphoramidate, etc.), the conjugate moiety can be attached directly to the phosphorus atom or to an O, N, or S atom attached to the phosphorus atom. In the case of amine- or amide-containing internucleoside linkages (e.g., PNA), the conjugate moiety can be attached to the nitrogen atom or adjacent carbon atom of the amine or amide.

[0271] While any suitable ligand in the field of RNA interference can be used, the ligand is typically a carbohydrate, such as a monosaccharide (such as GalNAc), disaccharide, trisaccharide, tetrasaccharide, or polysaccharide.

[0272] Linkers that conjugate the ligand to the nucleic acid include those described above. For example, the ligand can be one or more GalNAc (N-acetylglucosamine) derivatives attached via a bivalent or trivalent branched linker.

[0273] In one embodiment, the dsRNA of the invention is conjugated to bivalent and trivalent branched linkers comprising the structure shown in any of formulas (IV) to (VII): [ka] During the ceremony: q 2A , q 2B , q 3A , q 3B , q4 A , q 4B , q 5A , q 5B and q 5C represents independently for each occurrence 0 to 20, and the repeating units may be the same or different; P 2A , P 2B , P 3A , P 3B , P 4A , P 4B , P 5A , P 5B , P 5C , T 2A , T 2B , T 3A , T 3B , T 4A , T 4B , T 4A , T 5B , T 5C are each, independently for each occurrence, absent, CO, NH, O, S, OC(O), NHC(O), CH, CHNH, or CHO; Q 2A , Q 2B , Q 3A , Q 3B , Q 4A , Q 4B , Q 5A , Q 5B , Q 5C is independently for each occurrence absent, alkylene, or substituted alkylene, wherein one or more methylenes are selected from O, S, S(O), SO, N(R N ), C(R')=C(R''), C≡C or C(O); R 2A , R 2B , R 3A , R 3B , R 4A , R 4B , R 5A , R 5B , R 5Care each independently absent for each occurrence, NH, O, S, CH2, C(O)O, C(O)NH, NHCH(R a )C(O), -C(O)-CH(R a )-NH-, CO, CH=NO, [ka] or heterocyclyl; L 2A , L 2B , L 3A , L 3B , L 4A , L 4B , L 5A , L 5B and L 5C represents a ligand; i.e., each, independently for each occurrence, is a monosaccharide (such as GalNAc), disaccharide, trisaccharide, tetrasaccharide, oligosaccharide, or polysaccharide; R a is H or an amino acid side chain.

[0274] Trivalent conjugated GalNAc derivatives, such as those of formula (VII), are particularly useful in conjunction with RNAi agents to inhibit expression of target genes: [ka] In the formula, L 5A , L 5B and L 5C represents a monosaccharide such as a GalNAc derivative.

[0275] Examples of suitable divalent and trivalent branched linking groups for conjugation to GalNAc derivatives include, but are not limited to, the following compounds: [ka] [ka] [ka]

[0276] In another embodiment, the RNAi agent for use in the methods of the invention is AD-59743.

[0277] III. Delivery of iRNA of the Invention Delivery of an iRNA agent of the invention to a cell, e.g., a cell in a subject, such as a human subject (e.g., a subject in need of an iRNA agent, such as a subject suffering from a TMPRSS6-associated disorder, such as hemochromatosis), can be accomplished in several different ways. For example, delivery can be accomplished by contacting a cell with an iRNA of the invention either in vitro or in vivo. In vivo delivery can also be accomplished directly by administering a composition containing an iRNA, e.g., a dsRNA, to the subject. Alternatively, in vivo delivery can be accomplished indirectly by administering one or more vectors that encode and direct the expression of the iRNA. Examples of these alternatives are described further below.

[0278] Generally, any method for delivering nucleic acid molecules (in vitro or in vivo) can be adapted for use with the iRNAs of the present invention (see, e.g., Akhtar S. and Julian R.L., (1992) Trends Cell. Biol. 2(5):139-144 and WO 94 / 02595, which are incorporated herein by reference in their entireties). For in vivo delivery, factors to consider when delivering iRNA molecules include, for example, the biological stability of the delivered molecule, prevention of nonspecific effects, and accumulation of the delivered molecule in the target tissue. Nonspecific effects of iRNA can be minimized by local administration, e.g., by direct injection or implantation into the tissue, or by administering the formulation locally. Local administration at the treatment site maximizes the local concentration of the agent, limits exposure of the agent to systemic tissues that may be adversely affected by or degrade the agent, and can reduce the total dose of the iRNA molecule administered. Several studies have demonstrated successful knockdown of gene products when iRNAs are administered locally. For example, intraocular delivery of VEGF dsRNA via intravitreal injection in cynomolgus monkeys (Tolentino, MJ. et al., (2004) Retina 24:132-138) and subretinal injection in mice (Reich, SJ. et al., (2003) Mol. Vis. 9:210-216) have both been shown to prevent neovascularization in experimental models of age-related macular degeneration. Furthermore, direct intratumoral administration of dsRNA in mice can reduce tumor volume (Pille, J. et al., (2005) Mol. Ther. 11:267-274) and prolong the survival of tumor-bearing mice (Kim, WJ. et al., (2006) Mol. Ther. 14:343-350; Li, S. et al., (2007) Mol. Ther. 15:515-523).RNA interference can be delivered locally to the central nervous system by direct injection (Dorn, G. et al., (2004) Nucleic Acids 32:e49; Tan, P.H. et al. (2005) Gene Ther. 12:59-66; Makimura, H. et al. (2002) BMC Neurosci. 3:18; Shishkina, G.T. et al. (2004) Neuroscience 129:521-528; Thakker, E.R. et al. (2004) Proc. Natl. Acad. Sci. USA 101:17270-17275; Akaneya, Y. et al. (2005) J. Neurophysiol. 93:594-602) and locally to the lung by intranasal administration (Howard, K.A. et al. (2006) Mol. Ther. 14:476-484; Zhang, X. et al., (2004) J. Biol. Chem. 279:10677-10684; Bitko, V. et al., (2005) Nat. Med. 11:50-55) have also demonstrated success. To administer iRNA systemically for disease treatment, the RNA can be modified or delivered using a drug delivery system; both methods serve to prevent rapid degradation of dsRNA by endonucleases and exonucleases in vivo. Modification of the RNA or pharmaceutical carrier can also enable targeting of iRNA compositions to target tissues and avoid undesirable off-target effects. iRNA molecules can be modified by chemical conjugation to lipophilic groups, such as cholesterol, to improve cellular uptake and prevent degradation. For example, iRNAs against ApoB conjugated to lipophilic cholesterol moieties were administered systemically to mice, resulting in knockdown of apoB mRNA in both the liver and jejunum (Soutschek, J. et al., (2004) Nature 432:173-178). Conjugation of iRNAs to aptamers has been shown to inhibit tumor growth and mediate tumor regression in mouse models of prostate cancer (McNamara, J. et al., (2006) Nat. Biotechnol. 24:1005-1015).In alternative embodiments, iRNAs can be delivered using drug delivery systems such as nanoparticles, dendrimers, polymers, liposomes, or cationic delivery systems. Positively charged cationic delivery systems facilitate binding of iRNA molecules (which are negatively charged) and also improve interaction with the negatively charged cell membrane, allowing for efficient uptake of iRNA by cells. Cationic lipids, dendrimers, or polymers can be bound to iRNAs or induced to form vesicles or micelles that encapsulate iRNAs (see, e.g., Kim SH. et al., (2008) Journal of Controlled Release 129(2):107-116). The formation of vesicles or micelles further prevents degradation of iRNAs when administered systemically. Methods for making and administering cationic iRNA complexes are well within the capabilities of those skilled in the art (see, e.g., Sorensen, D.R., et al. (2003) J. Mol. Biol 327:761-766; Verma, U.N. et al., (2003) Clin. Cancer Res. 9:1291-1300; Arnold, A.S. et al., (2007) J. Hypertens. 25:197-205, which are incorporated herein by reference in their entireties).Some non-limiting examples of drug delivery systems useful for systemic delivery of iRNA include DOTAP (Sorensen, D.R., et al. (2003), supra; Verma, U.N. et al. (2003), supra), Oligofectamine, "solid nucleic acid lipid particles" (Zimmermann, T.S. et al. (2006) Nature 441:111-114), cardiolipin (Chien, P.Y. et al. (2005) Cancer Gene Ther. 12:321-328; Pal, A. et al. (2005) Int J. Oncol. 26:1087-1091), polyethyleneimine (Bonnet M.E. et al. (2008) Pharm. Res. Aug 16 Epub ahead of print; Aigner, A. (2006) J. Biomed. Biotechnol. 71659), Arg-Gly-Asp (RGD) peptide (Liu, S. (2006) Mol. Pharm. 3:472-487), and polyamidoamine (Tomalia, D. A. et al., (2007) Biochem. Soc. Trans. 35:61-67; Yoo, H. et al., (1999) Pharm. Res. 16:1799-1804). In some embodiments, iRNAs are complexed with cyclodextrins for systemic administration. Methods for administration and pharmaceutical compositions of iRNAs and cyclodextrins can be found in U.S. Pat. No. 7,427,605, which is incorporated herein by reference in its entirety.

[0279] A. Vector-encoded iRNA of the invention iRNAs targeting the TMPRSS6 gene can be expressed from transcription units inserted into DNA or RNA vectors (see, e.g., Couture, A., et al., TIG. (1996), 12:5-10; Skillern, A., et al., International PCT Publication No. WO 00 / 22113; Conrad, International PCT Publication No. WO 00 / 22114; and Conrad, U.S. Patent No. 6,054,299). Expression can be transient (from a few hours to a few weeks) or sustained (from weeks to months or longer), depending on the specific construct used and the target tissue or cell type. These transgenes can be introduced as linear constructs, circular plasmids, or viral vectors, which can be integrating or non-integrating vectors. Transgenes can also be constructed to allow them to be inherited as extrachromosomal plasmids (Gassmann, et al., Proc. Natl. Acad. Sci. USA (1995) 92:1292).

[0280] The individual strands of the iRNA can be transcribed from a promoter in an expression vector. Two separate expression vectors can be co-introduced into a target cell (e.g., by transfection or infection) where two separate strands are expressed to produce, for example, dsRNA. Alternatively, each individual strand of the dsRNA can be transcribed by a promoter located on the same expression plasmid. In one embodiment, the dsRNA is expressed as an inverted repeat polynucleotide joined by a linker polynucleotide sequence to form a stem-loop structure.

[0281] iRNA expression vectors are generally DNA plasmids or viral vectors. Recombinant constructs for expressing the iRNAs described herein can be produced using expression vectors compatible with eukaryotic cells, preferably vertebrate cells. Eukaryotic expression vectors are well known in the art and are available from numerous commercial sources. Such vectors are typically provided containing convenient restriction sites for inserting the desired nucleic acid segment. Delivery of the iRNA expression vector can be systemic, for example, by intravenous or intramuscular administration, by administration to target cells transplanted from the patient and then reintroduced into the patient, or by any other means that allows for introduction into the desired target cells.

[0282] iRNA expression plasmids can be transfected into target cells as a complex with cationic lipid carriers (e.g., Oligofectamine) or non-cationic lipid-based carriers (e.g., Transit-TKO™). Multiple lipid transfections for iRNA-mediated knockdown targeting different regions of the target RNA over a period of one week or more are also contemplated by the present invention. Successful introduction of vectors into host cells can be monitored using various known methods. For example, transient transfection can be indicated using a reporter, such as a fluorescent marker like green fluorescent protein (GFP). Stable transfection of cells ex vivo can be ensured using a marker that confers resistance to certain environmental factors (e.g., antibiotics and drugs) on the transfected cells, such as hygromycin B resistance.

[0283] Viral vector systems that can be used with the methods and compositions described herein include, but are not limited to, (a) adenoviral vectors; (b) retroviral vectors, including but not limited to lentiviral vectors, Moloney murine leukemia virus, and the like; (c) adeno-associated virus vectors; (d) herpes simplex virus vectors; (e) SV40 vectors; (f) polyomavirus vectors; (g) papillomavirus vectors; (h) picornavirus vectors; (i) orthopox, e.g., vaccinia virus vectors, or avian pox, e.g., canarypox or fowlpox, poxvirus vectors; and (j) helper-dependent or attenuated adenoviruses. Replication-deficient viruses may also be advantageous. Different vectors may or may not integrate into the cellular genome. The constructs may optionally include viral sequences for transfection. Alternatively, the constructs may be incorporated into vectors capable of episomal replication, such as EPV and EBV vectors. Constructs for recombinant expression of iRNA generally require regulatory elements, e.g., promoters, enhancers, etc., to ensure expression of the iRNA in target cells. Other aspects to consider for vectors and constructs are discussed further below.

[0284] Vectors useful for delivery of iRNA will contain sufficient regulatory elements (promoters, enhancers, etc.) for expression of the iRNA in the desired target cells or tissues. Regulatory elements can be selected to provide for either constitutive or regulatable / inducible expression.

[0285] Expression of iRNA can be precisely regulated, for example, by using inducible regulatory sequences that are sensitive to specific physiological regulators, such as blood glucose levels or hormones (Docherty et al., 1994, FASEB J. 8:20-24). Suitable inducible expression systems for controlling dsRNA expression in cells or mammals include, for example, regulation by ecdysone, estrogen, progesterone, tetracycline, chemical inducers of dimerization, and isopropyl-β-D1-thiogalactopyranoside (IPTG). Those skilled in the art will be able to select appropriate regulatory / promoter sequences based on the intended use of the iRNA transgene.

[0286] Viral vectors containing nucleic acid sequences encoding iRNAs can be used. For example, retroviral vectors can be used (see Miller et al., Meth. Enzymol. 217:581-599 (1993)). These retroviral vectors contain the components necessary for proper packaging of the viral genome and integration into host cell DNA. The nucleic acid sequences encoding the iRNAs are cloned into one or more vectors, which facilitate delivery of the nucleic acid to a patient. Further details about retroviral vectors can be found, for example, in Boesen et al., Biotherapy 6:291-302 (1994), which describes the use of retroviral vectors to deliver the mdr1 gene to hematopoietic stem cells to make them more resistant to chemotherapy. Other references demonstrating the use of retroviral vectors in gene therapy are Clowes et al., J. Clin. Invest. 93:644-651 (1994); Kiem et al., Blood 83:1467-1473 (1994); Salmons and Gunzberg, Human Gene Therapy 4:129-141 (1993); and Grossman and Wilson, Curr. Opin. in Genetics and Devel. 3:110-114 (1993). Lentiviral vectors contemplated for use include, for example, the HIV-based vectors described in U.S. Patent Nos. 6,143,520; 5,665,557; and 5,981,276, which are incorporated herein by reference.

[0287] Adenoviruses are also contemplated for use in delivering iRNAs of the present invention. Adenoviruses are particularly attractive vehicles for delivering genes to, for example, respiratory epithelia. Adenoviruses naturally infect respiratory epithelia, causing a mild disease. Other targets for adenovirus-based delivery systems are the liver, central nervous system, endothelial cells, and muscle. Adenoviruses have the advantage of being able to infect non-dividing cells. Kozarsky and Wilson, Current Opinion in Genetics and Development 3:499-503 (1993), provide a review of adenovirus-based gene therapy. Bout et al., Human Gene Therapy 5:3-10 (1994), demonstrated the use of adenovirus vectors to transfer genes to the respiratory epithelia of rhesus monkeys. Other examples of the use of adenovirus in gene therapy can be found in Rosenfeld et al., Science 252:431-434 (1991); Rosenfeld et al., Cell 68:143-155; Mastrangeli et al. (1992), J. Clin. Invest. 91:225-234 (1993); PCT Publication WO 94 / 12649; and Wang et al., Gene Therapy 2:775-783 (1995). AV vectors suitable for expressing iRNAs featured in the present invention, methods for constructing recombinant AV vectors, and methods for delivering the vectors into target cells are described in Xia H et al. (2002), Nat. Biotech. 20:1006-1010.

[0288] Adeno-associated virus (AAV) vectors can also be used to deliver the iRNAs of the invention (Walsh et al., Proc. Soc. Exp. Biol. Med. 204:289-300 (1993); U.S. Pat. No. 5,436,146). In one embodiment, the iRNAs can be expressed as two separate, complementary single-stranded RNA molecules from a recombinant AAV vector having, for example, either a U6 or H1 RNA promoter, or a cytomegalovirus (CMV) promoter. AAV vectors suitable for expressing the dsRNA featured in the present invention, methods for constructing recombinant AV vectors, and methods for delivering the vectors into target cells are described in Samulski R et al. (1987), J.Virol. 61:3096-3101; Fisher KJ et al. (1996), J.Virol, 70:520-532; Samulski R et al. (1989), J.Virol. 63:3822-3826; U.S. Patent No. 5,252,479; U.S. Patent No. 5,139,941; International Patent Application No. WO 94 / 13788; and International Patent Application No. WO 93 / 24641, the entire disclosures of which are incorporated herein by reference.

[0289] Another viral vector suitable for delivery of the iRNA of the invention is a poxvirus, such as a vaccinia virus, e.g., an attenuated vaccinia such as Modified Virus Ankara (MVA) or NYVAC, or an avian pox, such as fowlpox or canarypox.

[0290] The tropism of viral vectors can be modified by pseudotyping the vector with envelope proteins or other surface antigens from other viruses, or by substituting different viral capsid proteins as needed. For example, lentiviral vectors can be pseudotyped with surface proteins from vesicular stomatitis virus (VSV), rabies, Ebola, Mokola, etc. AAV vectors can be engineered to target different cells by engineering the vector to express different capsid protein serotypes. See, for example, Rabinowitz JE et al. (2002), J Virol 76:791-801, the entire disclosure of which is incorporated herein by reference.

[0291] The pharmaceutical preparation of the vector can include the vector in an acceptable diluent, or can comprise a slow release matrix in which the gene delivery vehicle is imbedded. Alternatively, where the complete gene delivery vector can be produced intact from recombinant cells, e.g., retroviral vectors, the pharmaceutical preparation can include one or more cells which produce the gene delivery system.

[0292] IV. Pharmaceutical Compositions of the Present Invention The present invention also includes pharmaceutical compositions and formulations comprising the iRNA of the present invention. In one embodiment, a pharmaceutical composition containing the iRNA described herein and a pharmaceutically acceptable carrier is also provided herein. Pharmaceutical compositions containing iRNA are useful for treating diseases or disorders associated with TMPRSS6, such as hemochromatosis. Such pharmaceutical compositions are formulated based on the mode of delivery. One example is a composition formulated for systemic administration via parenteral administration, e.g., intravenous (IV) delivery. Another example is a composition formulated for direct delivery to the brain parenchyma, e.g., by injection into the brain, such as by continuous pump infusion.

[0293] Pharmaceutical compositions containing the RNAi agents of the present invention can be, for example, solutions with or without buffers, or compositions containing pharmaceutically acceptable carriers, including, for example, aqueous or crystalline compositions, liposomal formulations, micelle formulations, emulsions, and gene therapy vectors.

[0294] In the method of the present invention, the RNAi agent can be administered in a solution. The free RNAi agent can be administered in a non-buffered solution, such as saline or water. Alternatively, the free siRNA can also be administered in a suitable buffer. The buffer can contain acetate, citrate, prolamin, carbonate, or phosphate, or any combination thereof. In a preferred embodiment, the buffer is phosphate-buffered saline (PBS). The pH and osmolality of the buffer containing the RNAi agent can be adjusted to be suitable for administration to a subject.

[0295] In some embodiments, the buffer solution further comprises an agent for controlling the osmolality of the solution so that the osmolality is maintained at a desired value, e.g., the physiological value of human plasma. Solutes that can be added to the buffer solution to control the osmolality include, but are not limited to, proteins, peptides, amino acids, non-metabolized polymers, vitamins, ions, sugars, metabolites, organic acids, lipids, or salts. In some embodiments, the agent for controlling the osmolality of the solution is a salt. In certain embodiments, the agent for controlling the osmolality of the solution is sodium chloride or potassium chloride.

[0296] The pharmaceutical compositions of the present invention may be administered in a dosage sufficient to inhibit the expression of the TMPRSS6 gene.

[0297] Generally, suitable doses of iRNAs of the present invention range from about 0.001 to about 200.0 milligrams per kilogram of recipient body weight per day, generally from about 1 to 50 mg per kilogram of body weight per day. For example, dsRNAs can be administered at about 0.01 mg / kg, about 0.05 mg / kg, about 0.5 mg / kg, about 1 mg / kg, about 1.5 mg / kg, about 2 mg / kg, about 3 mg / kg, about 4 mg / kg, about 5 mg / kg, about 6 mg / kg, about 7 mg / kg, about 8 mg / kg, about 9 mg / kg, about 10 mg / kg, about 20 mg / kg, about 30 mg / kg, about 40 mg / kg, or about 50 mg / kg per single administration.

[0298] For example, the RNAi agent, e.g., dsRNA, may have a specific activity of about 0.1, 0.2, 0.3, 0.4, 0.5, 0.6, 0.7, 0.8, 0.9, 1, 1.1, 1.2, 1.3, 1.4, 1.5, 1.6, 1.7, 1.8, 1.9, 2, 2.1, 2.2, 2.3, 2.4, 2.5, 2.6, 2.7, 2.8, 2.9, 3, 3.1, 3.2, 3.3, 3.4, 3.5, 3.6, 3.7, 3.8, 3.9, 4, 4.1, 4.2, 4.3, 4.4, 4.5, 4.6, 4.7, 4.8, 4.9, 5 , 5.1, 5.2, 5.3, 5.4, 5.5, 5.6, 5.7, 5.8, 5.9, 6, 6.1, 6.2, 6.3, 6.4, 6.5, 6.6, 6.7, 6.8, 6.9, 7, 7.1, 7.2, 7.3, 7.4, 7.5, 7.6, 7.7, 7.8, 7.9, 8, 8.1, 8.2, 8.3, 8.4, 8.5, 8.6, 8.7, 8.8.8, 9, 9, 9.1, 9.2, 9.3, 9.4, 9.5, 9.6, 9.7, 9.8, 9.9, or about 10 mg / kg. Values ​​and ranges intermediate to the recited values ​​are also contemplated as part of the invention.

[0299] In another embodiment, the RNAi agent, for example, dsRNA, is administered at a concentration of about 0.1 to about 50 mg / kg, about 0.25 to about 50 mg / kg, about 0.5 to about 50 mg / kg, about 0.75 to about 50 mg / kg, about 1 to about 50 mg / mg, about 1.5 to about 50 mg / kb, about 2 to about 50 mg / kg, about 2.5 to about 50 mg / kg, about 3 to about 50 mg / kg, about 3.5 to about 50 mg / kg, about 4 to about 50 mg / kg, about 4.5 to about 50 mg / kg, about 5 to about 50 mg / kg, about 7.5 to about 50 mg / kg, about 10 to about 50 mg / kg, about 15 to about 50 mg / kg, about 20 to about 50 mg / kg, about 35 to about 50 mg / kg, about 36 to about 50 mg / kg, about 37 to about 50 mg / kg, about 38 to about 50 mg / kg, about 39 to about 50 mg / kg, about 40 to about 50 mg / kg, about 41 to about 50 mg / kg, about 42 to about 50 mg / kg, about 43 to about 50 mg / kg, about 44 to about 50 mg / kg, about 45 to about 50 mg / kg, about 46 to about 50 mg / kg, about 47 to about 50 mg / kg, about 48 to about 50 mg / kg, about 49 to about 50 mg / kg, about 50 to about 50 mg / kg, about 51 to about 51 mg / kg, about 52 to about 52 mg / kg, about 53 to about 53 mg / kg, about 54 to about 54 mg / kg, 0mg / kg, about 20 to about 50mg / kg, about 25 to about 50mg / kg, about 25 to about 50mg / kg, about 30 to about 50mg / kg, about 35 to about 50mg / kg, about 40 to about 50mg / kg, about 45 to about 50mg / kg, about 0.1 to about 45mg / kg, about 0.25 to about 45mg / kg, about 0.5 to about 45 mg / kg, about 0.75 to about 45 mg / kg, about 1 to about 45 mg / mg, about 1.5 to about 45 mg / kb, about 2 to about 45 mg / kg, about 2.5 to about 45 mg / kg, about 3 to about 45 mg / kg, about 3.5 to about 45 mg / kg, about 4 to about 45 mg / kg, about 4.5 to about 45 mg / kg, about 5 to about 45 mg / kg, about 7.5 to about 45 mg / kg, about 10 to about 45 mg / kg, about 15 to about 45 mg / kg, about 20 to about 45 mg / kg, about 20 to about 45 mg / kg, about 25 to about 45 mg / kg, about 25 to about 45 mg / kg, about 30 to about 4 5mg / kg, about 35 to about 45mg / kg, about 40 to about 45mg / kg, about 0.1 to about 40mg / kg, about 0.25 to about 40mg / kg, about 0.5 to about 40mg / kg, about 0.75 to about 40mg / kg, about 1 to about 40mg / mg, about 1.5 to about 40mg / kb, about 2 to about 40m g / kg, about 2.5 to about 40 mg / kg, about 3 to about 40 mg / kg, about 3.5 to about 40 mg / kg, about 4 to about 40 mg / kg, about 4.5 to about 40 mg / kg, about 5 to about 40 mg / kg, about 7.5 to about 40 mg / kg, about 10 to about 40 mg / kg, about 15 to about 40 mg / kg, About 20 to about 40 mg / kg, about 20 to about 40 mg / kg, about 25 to about 40 mg / kg, about 25 to about 40 mg / kg, about 30 to about 40 mg / kg, about 35 to about 40 mg / kg, about 0.1 to about 30 mg / kg, about 0.25 to about 30 mg / kg, about 0.5 to about 30 mg / kg, about 0.75 to about 30 mg / kg, about 1 to about 30 mg / mg, about 1.5 to about 30 mg / kb, about 2 to about 30 mg / kg, about 2.5 to about 30 mg / kg, about 3 to about 30 mg / kg, about 3.5 to about 30 mg / kg, about 4 to about 30 mg / kg, about 4.5 to about 30mg / kg, about 5 to about 30mg / kg, about 7.5 to about 30mg / kg, about 10 to about 30mg / kg, about 15 to about 30mg / kg, about 20 to about 30mg / kg, about 20 to about 30mg / kg, about 25 to about 30mg / kg, about 0.1 to about 20m g / kg, about 0.25 to about 20 mg / kg, about 0.5 to about 20 mg / kg, about 0.75 to about 20 mg / kg, about 1 to about 20 mg / kg, about 1.5 to about 20 mg / kg, about 2 to about 20 mg / kg, about 2.5 to about 20 mg / kg, about 3 to about 20 mg / kg, about 3.5 to about 20 mg / kg, about 4 to about 20 mg / kg, about 4.5 to about 20 mg / kg, about 5 to about 20 mg / kg, about 7.5 to about 20 mg / kg, about 10 to about 20 mg / kg, or about 15 to about 20 mg / kg. Values ​​and ranges intermediate to the recited values ​​are also intended to be part of the present invention.

[0300] For example, an RNAi agent, e.g., dsRNA, may have a specific activity of about 0..01, 0.02, 0.03, 0.04, 0.05, 0.06, 0.07, 0.08, 0.09, 0.1, 0.2, 0.3, 0.4, 0.5, 0.6, 0.7, 0.8, 0.9, 1, 1.1, 1.2, 1.3, 1.4, 1.5, 1.6, 1.7, 1.8, 1.9, 2, 2.1, 2.2, 2.3, 2.4, 2.5, 2.6, 2.7, 2.8, 2.9, 3, 3.1, 3.2, 3.3, 3.4, 3.5, 3.6, 3.7, 3.8, 3.9, 4, 4.1, 4.2, 4.3, 4.4, 4.5, 4.6, 4.7, 4.8, 4.9, 5.0, 5.10, 5.11, 5.12, 5.13, 5.14, 5.15, 5.16, 5.17, 5.18, 5.19, 5.20, 5.21, 5.22, 5.23, 5.24, 5.25, 5.26, 5.27, 5.28, 5.29, 5.30, 5.31, 5.32, 5.33, 5.34, 5.35, 5.36, 5.37, 5.38, 5.39, 5.40, 5. The compound may be administered at a dose of 4, 4.5, 4.6, 4.7, 4.8, 4.9, 5, 5.1, 5.2, 5.3, 5.4, 5.5, 5.6, 5.7, 5.8, 5.9, 6, 6.1, 6.2, 6.3, 6.4, 6.5, 6.6, 6.7, 6.8, 6.9, 7, 7.1, 7.2, 7.3, 7.4, 7.5, 7.6, 7.7, 7.8, 7.9, 8, 8.1, 8.2, 8.3, 8.4, 8.5, 8.6, 8.7, 8.8, 8.9, 9, 9.1, 9.2, 9.3, 9.4, 9.5, 9.6, 9.7, 9.8, 9.9, or about 10 mg / kg. Values ​​and ranges intermediate to the recited values ​​are also contemplated as part of the invention.

[0301] In another embodiment, the RNAi agent, e.g., dsRNA, is administered at a concentration of about 0.5 to about 50 mg / kg, about 0.75 to about 50 mg / kg, about 1 to about 50 mg / kg, about 1.5 to about 50 mg / kg, about 2 to about 50 mg / kg, about 2.5 to about 50 mg / kg, about 3 to about 50 mg / kg, about 3.5 to about 50 mg / kg, about 4 to about 50 mg / kg, about 4.5 to about 50 mg / kg, about 5 to about 50 mg / kg, about 7.5 to about 50 mg / kg, about 10 to about 50 mg / kg, about 15 to about 50 mg / kg, about 20 to about 50 mg / kg, about 25 to about 50 mg / kg, or about 30 to about 50 mg / kg. 0mg / kg, about 25 to about 50mg / kg, about 30 to about 50mg / kg, about 35 to about 50mg / kg, about 40 to about 50mg / kg, about 45 to about 50mg / kg, about 0.5 to about 45mg / kg, about 0.75 to about 45mg / kg, about 1 to about 45mg / mg, about 1.5 to about 45m g / kb, about 2 to about 45 mg / kg, about 2.5 to about 45 mg / kg, about 3 to about 45 mg / kg, about 3.5 to about 45 mg / kg, about 4 to about 45 mg / kg, about 4.5 to about 45 mg / kg, about 5 to about 45 mg / kg, about 7.5 to about 45 mg / kg, about 10 to about 45 mg / kg, About 15 to about 45 mg / kg, about 20 to about 45 mg / kg, about 20 to about 45 mg / kg, about 25 to about 45 mg / kg, about 25 to about 45 mg / kg, about 30 to about 45 mg / kg, about 35 to about 45 mg / kg, about 40 to about 45 mg / kg, about 0.5 to about 40 mg / kg, about 0.7 5 to about 40 mg / kg, about 1 to about 40 mg / mg, about 1.5 to about 40 mg / kb, about 2 to about 40 mg / kg, about 2.5 to about 40 mg / kg, about 3 to about 40 mg / kg, about 3.5 to about 40 mg / kg, about 4 to about 40 mg / kg, about 4.5 to about 40 mg / kg, about 5 to about 40 m g / kg, about 7.5 to about 40 mg / kg, about 10 to about 40 mg / kg, about 15 to about 40 mg / kg, about 20 to about 40 mg / kg, about 20 to about 40 mg / kg, about 25 to about 40 mg / kg, about 25 to about 40 mg / kg, about 30 to about 40 mg / kg, about 35 to about 40 mg / kg , about 0.5 to about 30 mg / kg, about 0.75 to about 30 mg / kg, about 1 to about 30 mg / mg, about 1.5 to about 30 mg / kb, about 2 to about 30 mg / kg, about 2.5 to about 30 mg / kg, about 3 to about 30 mg / kg, about 3.5 to about 30 mg / kg, about 4 to about 30 mg / kg, about 4.5 to about 30 mg / kg, about 5 to about 30 mg / kg, about 7.5 to about 30 mg / kg, about 10 to about 30 mg / kg, about 15 to about 30 mg / kg, about 20 to about 30 mg / k g, about 20 to about 30 mg / kg, about 25 to about 30 mg / kg, about 0.5 to about 20 mg / kg, about 0.75 to about 20 mg / kg, about 1 to about 20 mg / mg, about 1.5 to about The dsRNA is administered at a dose of about 20 mg / kb, about 2 to about 20 mg / kg, about 2.5 to about 20 mg / kg, about 3 to about 20 mg / kg, about 3.5 to about 20 mg / kg, about 4 to about 20 mg / kg, about 4.5 to about 20 mg / kg, about 5 to about 20 mg / kg, about 7.5 to about 20 mg / kg, about 10 to about 20 mg / kg, or about 15 to about 20 mg / kg. In one embodiment, the dsRNA is administered at a dose of about 10 mg / kg to about 30 mg / kg. Values ​​and ranges intermediate to the recited values ​​are also contemplated as part of the present invention.

[0302] For example, the subject may be administered approximately 0.5, 0.6, 0.7, 0.8, 0.9, 1, 1.1, 1.2, 1.3, 1.4, 1.5, 1.6, 1.7, 1.8, 1.9, 2, 2.1, 2.2, 2.3, 2.4, 2.5, 2.6, 2.7, 2.8, 2.9, 3, 3.1, 3.2, 3.3, 3.4, 3.5, 3.6, 3.7, 3.8, 3.9, 4, 4.1, 4.2, 4.3, 4.4, 4.5, 4.6, 4.7, 4.8, 4.9, 5.0, 5.10, 5.11, 5.12, 5.13, 5.14, 5.15, 5.16, 5.17, 5.18, 5.19, 5.20, 5.21, 5.22, 5.23, 5.24, 5.25, 5.26, 5.27, 5.28, 5.29, 5.30, 5.31, 5.32, 5.33, 5.34, 5.35, 5.36, 5.37, 5.38, 5.39, 5.40, 5.41, 5.42, 5.43, 5.44, 5.45, 5.46, 5.47, 5.48, 5.49, 5.50, 5.51, 5.52, 5.53, 5.54, 5.55, 5.5 ,4.4,4.5,4.6,4.7,4.8,4.9,5,5.1,5.2,5.3,5.4,5.5,5.6,5.7,5.8,5.9,6,6.1,6.2,6.3,6.4,6.5,6.6,6.7,6.8,6.9,7,7.1,7.2,7.3,7.4,7.5,7.6,7.7,7.8,7.9,8,8.1,8.2,8.3,8.4 ,8.5,8.6,8.7,8.8,8.9,9,9.1,9.2,9.3,9.4,9.5,9.6,9.7,9.8,9.9,10,10.5,11,11.5,12,12.5,13,13.5,14,14.5,15,15.5,16,16.5,17,17.5,18,18.5,19,19.5,20,20.5,21,21.5,2 Therapeutic amounts of iRNA such as 2, 22.5, 23, 23.5, 24, 24.5, 25, 25.5, 26, 26.5, 27, 27.5, 28, 28.5, 29, 29.5, 30, 31, 32, 33, 34, 34, 35, 36, 37, 38, 39, 40, 41, 42, 43, 44, 45, 46, 47, 48, 49, or about 50 mg / kg may be administered. Values ​​and ranges intermediate to the recited values ​​are also contemplated as part of the invention.

[0303] In certain embodiments, for example, when the compositions of the present invention comprise a dsRNA and a lipid described herein, the subject is administered a dose of about 0.01 mg / kg to about 5 mg / kg, about 0.01 mg / kg to about 10 mg / kg, about 0.05 mg / kg to about 5 mg / kg, about 0.05 mg / kg to about 10 mg / kg, about 0.1 mg / kg to about 5 mg / kg, about 0.1 mg / kg to about 10 mg / kg, or about 0.2 mg / kg to about 5 mg / kg. g, about 0.2 mg / kg to about 10 mg / kg, about 0.3 mg / kg to about 5 mg / kg, about 0.3 mg / kg to about 10 mg / kg, about 0.4 mg / kg to about 5 mg / kg, about 0.4 mg / kg to about 10 mg / k g, about 0.5 mg / kg to about 5 mg / kg, about 0.5 mg / kg to about 10 mg / kg, about 1 mg / kg to about 5 mg / kg, about 1 mg / kg to about 10 mg / kg, about 1.5 mg / kg to about 5 mg / kg, about 1.5 mg / kg~about 10mg / kg, about 2mg / kg~about 2.5mg / kg, about 2mg / kg~about 10mg / kg, about 3mg / kg~about 5mg / kg, about 3mg / kg~about 10mg / kg, about 3.5mg / kg ~5mg / kg, approximately 4mg / kg~5mg / kg, approximately 4.5mg / kg~5mg / kg, approximately 4mg / kg~10mg / kg, approximately 4.5mg / kg~10mg / kg, approximately 5mg / kg~10mg / kg A therapeutic amount of iRNA may be administered, such as about 5.5 mg / kg to about 10 mg / kg, about 6 mg / kg to about 10 mg / kg, about 6.5 mg / kg to about 10 mg / kg, about 7 mg / kg to about 10 mg / kg, about 7.5 mg / kg to about 10 mg / kg, about 8 mg / kg to about 10 mg / kg, about 8.5 mg / kg to about 10 mg / kg, about 9 mg / kg to about 10 mg / kg, or about 9.5 mg / kg to about 10 mg / kg. Values ​​and ranges intermediate to the recited values ​​are also contemplated as part of the invention.

[0304] For example, the dsRNA may be about 0.1, 0.2, 0.3, 0.4, 0.5, 0.6, 0.7, 0.8, 0.9, 1, 1.1, 1.2, 1.3, 1.4, 1.5, 1.6, 1.7, 1.8, 1.9, 2, 2.1, 2.2, 2.3, 2.4, 2.5, 2.6, 2.7, 2.8, 2.9, 3, 3.1, 3.2, 3.3, 3.4, 3.5, 3.6, 3.7, 3.8, 3.9, 4, 4.1, 4.2, 4.3, 4.4, 4.5, 4.6, 4.7, 4.8, 4.9, 5, 5.1 , 5.2, 5.3, 5.4, 5.5, 5.6, 5.7, 5.8, 5.9, 6, 6.1, 6.2, 6.3, 6.4, 6.5, 6.6, 6.7, 6.8, 6.9, 7, 7.1, 7.2, 7.3, 7.4, 7.5, 7.6, 7.7, 7.8, 7.9, 8, 8.1, 8.2, 8.3, 8.4, 8.5, 8.6, 8.7, 8.8, 8.9, 9, 9.1, 9.2, 9.3, 9.4, 9.5, 9.6, 9.7, 9.8, 9.9, or about 10 mg / kg. Values ​​and ranges intermediate to the recited values ​​are also contemplated as part of the invention.

[0305] In certain embodiments of the invention, for example, when a double-stranded RNAi agent comprises a modification (e.g., one or more motifs of three identical modifications on three consecutive nucleotides (including one such motif at or near the cleavage site of the agent)), six phosphorothioate linkages, and a ligand, such an agent may be administered at a concentration of about 0.01 to about 0.5 mg / kg, about 0.01 to about 0.4 mg / kg, about 0.01 to about 0.3 mg / kg, about 0.01 to about 0.2 mg / kg, about 0.01 to about 0.1 mg / kg, about 0.01 mg / kg to about 0.09 mg / kg, about 0.01 mg / kg to about 0.09 mg / kg, or about 0.01 mg / kg. to about 0.08mg / kg, about 0.01mg / kg to about 0.07mg / kg, about 0.01mg / kg to about 0.06mg / kg, about 0.01mg / kg to about 0.05mg / kg, about 0.02 to about 0.5mg / kg, about 0.02 to about 0.4mg / kg, about 0.02 to about 0.3mg / kg, about 0.02 to about 0.2mg / kg, about 0.02 to about 0.1mg / kg, about 0.02mg / kg to about 0.09mg / kg, about 0.02mg / kg to about 0.08mg / kg, about 0.02mg / kg to about 0.07mg / kg, about 0.02mg / kg to about 0.06mg / kg, about 0.02mg / kg to about 0.05mg / kg, about 0.03 to about 0.5mg / kg, about 0.03 to about 0.4mg / kg, about 0.03 to about 0.3mg / kg, about 0.03 to about 0.2mg / kg, about 0.03 to about 0.1mg / kg, about 0.03mg / kg to about 0.09mg / kg, about 0.03mg / kg to about 0.08mg / kg, about 0.03mg / kg to about 0.07mg / kg, about 0.03mg / kg to about 0.06mg / kg, about 0.03mg / kg to about 0.05mg / kg, about 0.04 to about 0.5mg / kg, about 0.04 to about 0.4mg / kg, about 0.0 4 to about 0.3 mg / kg, about 0.04 to about 0.2 mg / kg, about 0.04 to about 0.1 mg / kg, about 0.04 mg / kg to about 0.09 mg / kg, about 0.04 mg / kg to about 0.08 mg / kg, about 0.04 mg / kg to about 0.07 mg / kg, about 0.04 mg / kg to about 0. 0.06 mg / kg, about 0.05 to about 0.5 mg / kg, about 0.05 to about 0.4 mg / kg, about 0.05 to about 0.3 mg / kg, about 0.05 to about 0.2 mg / kg, about 0.05 to about 0.1 mg / kg, about 0.05 mg / kg to about 0.09 mg / kg, about 0.05 mg / kg to about 0.The RNAi agent may be administered at a dose of about 0.08 mg / kg, or about 0.05 mg / kg to about 0.07 mg / kg. Values ​​and ranges intermediate to the above-recited values ​​are also contemplated as being part of the invention; for example, the RNAi agent may be administered to a subject at a dose of about 0.015 mg / kg to about 0.45 mg / kg.

[0306] For example, the RNAi agent, e.g., the RNAi agent in the pharmaceutical composition, may be about 0.01 mg / kg, 0.0125 mg / kg, 0.015 mg / kg, 0.0175 mg / kg, 0.02 mg / kg, 0.0225 mg / kg, 0.025 mg / kg, 0.0275 mg / kg, 0.03 mg / kg, 0.0325 mg / kg, 0.035 mg / kg, 0.0 375mg / kg, 0.04mg / kg, 0.0425mg / kg, 0.045mg / kg, 0.0475mg / kg, 0.05mg / kg, 0.0525mg / kg, 0 .055mg / kg, 0.0575mg / kg, 0.06mg / kg, 0.0625mg / kg, 0.065mg / kg, 0.0675mg / kg, 0.07mg / kg, 0 .0725mg / kg, 0.075mg / kg, 0.0775mg / kg, 0.08mg / kg, 0.0825mg / kg, 0.085mg / kg, 0.0875mg / k g, 0.09mg / kg, 0.0925mg / kg, 0.095mg / kg, 0.0975mg / kg, 0.1mg / kg, 0.125mg / kg, 0.15mg / kg, 0 The compound may be administered at a dose of 0.175 mg / kg, 0.2 mg / kg, 0.225 mg / kg, 0.25 mg / kg, 0.275 mg / kg, 0.3 mg / kg, 0.325 mg / kg, 0.35 mg / kg, 0.375 mg / kg, 0.4 mg / kg, 0.425 mg / kg, 0.45 mg / kg, 0.475 mg / kg, or about 0.5 mg / kg. Values ​​intermediate to the above-recited values ​​are also contemplated as part of this invention.

[0307] The pharmaceutical composition can be administered once daily, or the iRNA can be administered as two, three, or more subdoses at appropriate intervals throughout the day, or even via continuous infusion or delivery via sustained-release formulations. In such cases, each subdose must contain a correspondingly smaller amount of iRNA to achieve the total daily dosage. The dosage unit can also be formulated for delivery over several days, for example, using a conventional sustained-release formulation that provides sustained release of the iRNA over a period of several days. Sustained-release formulations are well known in the art and can be used with the agents of the present invention, as they are particularly useful for delivering agents to specific sites. In this embodiment, the dosage unit contains a corresponding multiple of the daily dose.

[0308] In other embodiments, a single dose of the pharmaceutical composition can be administered prolonged, with subsequent doses administered at intervals of no more than 3, 4, or 5 days, or no more than 1, 2, 3, or 4 weeks. In some embodiments of the invention, a single dose of the pharmaceutical composition of the invention is administered weekly. In other embodiments of the invention, a single dose of the pharmaceutical composition of the invention is administered bi-monthly.

[0309] Those skilled in the art will recognize that certain factors, including but not limited to the severity of the disease or disorder, previous treatments, the overall health and / or age of the subject, and other diseases present, can influence the dosage and duration required to effectively treat a subject. Moreover, treatment of a subject with a therapeutically effective amount of a composition can include a single treatment or a series of treatments. Effective dosages and in vivo half-lives for individual iRNAs encompassed by the invention can be estimated using conventional methodology or based on in vivo testing using appropriate animal models, as described elsewhere herein.

[0310] Advances in mouse genetics have led to the generation of many mouse models for the study of various human diseases, such as iron overload-related diseases that may benefit from reduced expression of TMPRSS6. Such models can be used for in vivo testing of iRNAs and to determine therapeutically effective doses. Suitable mouse models are known in the art, including, for example, thalassemia Th3 / + mice as a model of β-thalassemia (Douet et al., Am. J. Pathol. (2011), 178(2):774-83), HFE knockout mice as a model of hereditary hemochromatosis (Zhou et al. (1998) Proc. Natl. Acad. Sci USA, 85:2492-2497), and Uros (mut248) mice as a model of congenital erythroporphyria (Ged et al. (2006) Genomics, 87(1):84-92).

[0311] The pharmaceutical compositions of the present invention can be administered in several ways, depending on whether local or systemic treatment is required and the area to be treated. Administration can be topical (e.g., via a transdermal patch), pulmonary administration, e.g., by inhalation or insufflation of powders or aerosols, such as with a nebulizer; intratracheal, intranasal, epidermal and transdermal, oral, or parenteral. Parenteral administration includes intravenous, intraarterial, subcutaneous, intraperitoneal, or intramuscular injection or infusion; subcutaneous administration, e.g., via an implanted device; or intracranial administration, e.g., via intraparenchymal, intrathecal, or intraventricular administration.

[0312] The iRNA can be delivered to target a specific tissue, such as the liver (e.g., hepatocytes of the liver).

[0313] Pharmaceutical compositions and formulations for topical administration include transdermal patches, ointments, lotions, creams, gels, drops, suppositories, sprays, liquids, and powders. Conventional pharmaceutical carriers, aqueous, powder, or oily bases, thickeners, and the like may be necessary or desirable. Coated condoms, gloves, and the like may also be useful. Suitable topical formulations include those in which the iRNA featured in the present invention is mixed with a topical delivery agent, such as lipids, liposomes, fatty acids, fatty acid esters, steroids, chelating agents, and surfactants. Suitable lipids and liposomes include neutral (e.g., dioleylphosphatidyl DOPE ethanolamine, dimyristoylphosphatidylcholine DMPC, distearoylphosphatidylcholine), anionic (e.g., dimyristoylphosphatidylglycerol DMPG), and cationic (e.g., dioleyltetramethylaminopropyl DOTAP and dioleylphosphatidylethanolamine DOTMA). The iRNAs featured in the present invention can be encapsulated in liposomes or complexed to liposomes, particularly cationic liposomes. Alternatively, the iRNAs can be complexed to lipids, particularly cationic lipids. Suitable fatty acids and esters include, but are not limited to, arachidonic acid, oleic acid, eicosanoic acid, lauric acid, caprylic acid, capric acid, myristic acid, palmitic acid, stearic acid, linoleic acid, linolenic acid, dicaprate, tricaprate, monoolein, dilaurin, glyceryl 1-monocaprate, 1-dodecylazacycloheptan-2-one, acylcarnitine, acylcholine, or C 1~20 alkyl esters (e.g., isopropyl myristate IPM), monoglycerides, diglycerides, or pharmaceutically acceptable salts thereof. Topical formulations are described in detail in U.S. Pat. No. 6,747,014, which is incorporated herein by reference.

[0314] A. iRNA formulations containing membrane molecular assemblies iRNAs for use in the compositions and methods of the present invention can be formulated for delivery in membrane molecular assemblies, such as liposomes or micelles. As used herein, the term "liposome" refers to a vesicle composed of amphiphilic lipids arranged in at least one bilayer, e.g., one or more bilayers. Liposomes include unilamellar and multilamellar vesicles, whose membrane is formed from a lipophilic material and an aqueous interior. The aqueous portion contains the iRNA composition. The lipophilic material separates the aqueous interior from the aqueous exterior and typically does not contain the iRNA composition, although in some cases it may. Liposomes are useful for transporting and delivering active ingredients to sites of action. Because the liposome membrane is structurally similar to biological membranes, when the liposome is attached to a tissue, the liposome bilayer fuses with the cell membrane bilayer. As the liposome and cell fuse, the aqueous contents, including the iRNA, are delivered to the cell, where the iRNA can specifically bind to the target RNA and mediate RNAi. In some cases, the liposomes are also specifically targeted, for example, to direct the iRNA to a particular cell type.

[0315] Liposomes containing RNAi agents can be prepared by various methods. In one example, the lipid components of the liposome are dissolved in a detergent so that micelles are formed with the lipid components. For example, the lipid components can be amphipathic cationic lipids or lipid conjugates. The detergent can have a high critical micelle concentration and can be non-ionic. Exemplary detergents include cholate, CHAPS, octylglucoside, deoxycholate, and lauroyl sarcosine. Next, a preparation of the RNAi agent is added to the micelles containing the lipid components. The cationic groups in the lipids interact with the RNAi agent and condense around the RNAi agent to form liposomes. After condensation, the detergent is removed, for example, by dialysis, to obtain a liposome preparation of the RNAi agent.

[0316] If necessary, a carrier compound that aids in condensation can be added during the condensation reaction, for example, by controlled addition. For example, the carrier compound can be a polymer other than a nucleic acid (e.g., spermine or spermidine). The pH can also be adjusted to aid in condensation.

[0317] Methods for producing stable polynucleotide delivery vehicles that incorporate polynucleotide / cationic lipid complexes as components of the delivery vehicle are further described, for example, in WO 96 / 37194, the entire contents of which are incorporated herein by reference. Liposome formation is described by Felgner, PLet al., Proc. Natl. Acad. Sci. USA 8:7413-7417, 1987; U.S. Patent No. 4,897,355; U.S. Patent No. 5,171,678; Bangham et al., M. Mol. al.,Biochim.Biophys.Acta 557:9,1979;Szoka et al.,Proc.Natl.Acad.Sci.75:4194,1978;Mayhew et al.,Biochim.Biophys.Acta 775:169,1984;Kim et al.,Biochim.Biophys.Acta 728:339,1983; and Fukunaga et al. The present invention may also include one or more embodiments of the exemplary method described in

[0010] et al., Endocrinol. 115:757, 1984. Commonly used techniques for preparing lipid aggregates of an appropriate size for use as a delivery vehicle include sonication and freeze-thaw and extrusion (see, e.g., Mayer et al., Biochim. Biophys. Acta 858:161, 1986). When consistently small (50-200 nm) and relatively uniform aggregates are desired, microfluidization can be used (Mayhew et al., Biochim. Biophys. Acta 775:169, 1984). These methods are easily adapted to packaging preparations of RNAi agents into liposomes.

[0318] Liposomes are divided into two major classes. Cationic liposomes are positively charged liposomes that interact with negatively charged nucleic acid molecules to form stable complexes. The positively charged nucleic acid / liposome complexes bind to the negatively charged cell surface and are transported into endosomes. The acidic pH within the endosomes causes the liposomes to rupture, releasing their contents into the cytoplasm (Wang et al., Biochem. Biophys. Res. Commun., 1987, 147, 980-985).

[0319] pH-sensitive, negatively charged liposomes entrap nucleic acids rather than complexing them. Because both the nucleic acid and the lipid are similarly charged, repulsion occurs rather than complexation. Nevertheless, some nucleic acids are entrapped within the aqueous interior of these liposomes. pH-sensitive liposomes have been used to deliver nucleic acids encoding the thymidine kinase gene to cell monolayers in culture. Expression of the foreign gene was detected in the target cells (Zhou et al., Journal of Controlled Release, 1992, 19, 269-274).

[0320] One major type of liposome composition contains phospholipids other than naturally occurring phosphatidylcholine. For example, neutral liposome compositions can be formed from dimyristoylphosphatidylcholine (DMPC) or dipalmitoylphosphatidylcholine (DPPC). Anionic liposome compositions are generally formed from dimyristoylphosphatidylglycerol, while anionic membrane-fusogenic liposomes are primarily formed from dioleylphosphatidylethanolamine (DOPE). Other types of liposome compositions are formed from phosphatidylcholine (PC), such as soybean PC and egg PC. Other types are formed from mixtures of phospholipids and / or phosphatidylcholine and / or cholesterol.

[0321] Other exemplary methods for introducing liposomes into cells in vitro and in vivo include U.S. Pat. No. 5,283,185; U.S. Pat. No. 5,171,678; WO 94 / 00569; WO 93 / 24640; WO 91 / 16024; Felgner, J. Biol. Chem. 269:2550, 1994; Nabel, Proc. Natl. Acad. Sci. 90:11307, 1993; Nabel, Human Gene Ther. 3:649, 1992; Gershon, Biochem. 32:7143, 1993; and Strauss, EMBO J. 11:417, 1992.

[0322] Nonionic liposomal systems, particularly those containing nonionic surfactants and cholesterol, have also been tested to determine their usefulness in delivering drugs to the skin. Nonionic liposomal formulations containing Novasome™ I (glyceryl dilaurate / cholesterol / polyoxyethylene-10-stearyl ether) and Novasome™ II (glyceryl distearate / cholesterol / polyoxyethylene-10-stearyl ether) were used to deliver cyclosporine A to the dermis of mouse skin. The results showed that such nonionic liposomal systems were effective in promoting the deposition of cyclosporine A in different layers of the skin (Hu et al. STP Pharma. Sci., 1994, 4(6)466).

[0323] Liposomes also include "sterically stabilized" liposomes, a term used herein to refer to liposomes containing one or more specialized lipids that, when incorporated into the liposome, result in enhanced circulation life compared to liposomes lacking such specialized lipids. An example of a sterically stabilized liposome is one in which a portion of the vesicle-forming lipid portion of the liposome is (A) monosialoganglioside G M1or (B) those that are derivatized with one or more hydrophilic polymers, such as polyethylene glycol (PEG) moieties. Without being bound by any particular theory, it is believed in the art that the enhanced circulation half-life of these sterically stabilized liposomes, at least for those containing gangliosides, sphingomyelin, or PEG-derivatized lipids, is due to reduced uptake into cells of the reticuloendothelial system (RES) (Allen et al., FEBS Letters, 1987, 223, 42; Wu et al., Cancer Research, 1993, 53, 3765).

[0324] Various liposomes containing one or more glycolipids are known in the art. Papahadjopoulos et al. (Ann. NY Acad. Sci., 1987, 507, 64) reported the use of monosialoganglioside G, which improves the blood half-life of liposomes. M1 reported the ability of (1) sphingomyelin and (2) ganglioside G to bind to sphingomyelin. These findings are detailed by Gabizon et al. (Proc. Natl. Acad. Sci. USA, 1988, 85, 6949). U.S. Patent No. 4,837,028 and WO 88 / 04924, both to Allen et al., report the ability of (1) sphingomyelin and (2) ganglioside G to bind to sphingomyelin. M1 or galactocerebroside sulfate esters. U.S. Patent No. 5,543,152 (Webb et al.) discloses liposomes containing sphingomyelin. WO 97 / 13499 (Lim et al.) discloses liposomes containing 1,2-sn-dimyristoylphosphatidylcholine.

[0325] In one embodiment, cationic liposome is used.Cationic liposome has the advantage that it can fuse with cell membrane.Non-cationic liposome cannot fuse with cell membrane as efficiently, but it can be taken up by macrophage in vivo and can be used to deliver RNAi agent to macrophage.

[0326] Additional advantages of liposomes include: liposomes derived from natural phospholipids are biocompatible and biodegradable; liposomes can incorporate a wide range of water-soluble and lipid-soluble drugs; and liposomes can protect the RNAi agent encapsulated in their internal compartment from metabolism and degradation (Rosoff, in "Pharmaceutical Dosage Forms," ​​Lieberman, Rieger and Banker (Eds.), 1988, volume 1, p. 245). Important considerations in preparing liposome formulations are the lipid surface charge, vesicle size and aqueous volume of the liposome.

[0327] A positively charged synthetic cationic lipid, N-[1-(2,3-dioleyloxy)propyl]-N,N,N-trimethylammonium chloride (DOTMA), can be used to form small liposomes that spontaneously interact with nucleic acids, forming lipid-nucleic acid complexes that can fuse with the negatively charged lipids of tissue culture cell membranes, resulting in delivery of RNAi agents (see, e.g., Felgner, PL et al., Proc. Natl. Acad. Sci. USA 8:7413-7417, 1987, and U.S. Pat. No. 4,897,355 for a description of DOTMA and its use with DNA).

[0328] DOTMA analogue, 1,2-bis(oleyloxy)-3-(trimethylammonia)propane (DOTAP), can be used in combination with phospholipids to form DNA complex vesicles. Lipofectin™ (Bethesda Research Laboratories, Gaithersburg, Md.) is an effective agent for delivering highly anionic nucleic acids into living tissue culture cells, containing positively charged DOTMA liposomes that spontaneously interact with negatively charged polynucleotides to form complexes. When sufficiently positively charged liposomes are used, the net charge of the resulting complex is also positive. The positively charged complexes thus prepared spontaneously adhere to negatively charged cell surfaces, fuse with the cell membrane, and efficiently deliver functional nucleic acids into, for example, tissue culture cells. Another commercially available cationic lipid, 1,2-bis(oleyloxy)-3,3-(trimethylammonia)propane ("DOTAP") (Boehringer Mannheim, Indianapolis, Indiana), differs from DOTMA in that the oleoyl moiety is attached by an ester rather than an ether bond.

[0329] Other reported cationic lipid compounds include those conjugated to one of two types of lipids and conjugated to various moieties, including, for example, carboxyspermine, including compounds such as 5-carboxyspermylglycine dioctaoleoylamide (“DOGS”) (Transfectam™, Promega, Madison, Wisconsin) and dipalmitoylphosphatidylethanolamine 5-carboxyspermyl-amide (“DPPES”) (see, e.g., U.S. Pat. No. 5,171,678).

[0330] Another cationic lipid conjugate involves derivatizing lipids with cholesterol ("DC-Chol") formulated into liposomes in combination with DOPE (see Gao, X. and Huang, L., Biochim. Biophys. Res. Commun. 179:280, 1991). Lipopolylysine, prepared by conjugating polylysine to DOPE, has been reported to be effective for transfection in the presence of serum (Zhou, X. et al., Biochim. Biophys. Acta 1065:8, 1991). In certain cell lines, these liposomes containing conjugated cationic lipids are said to exhibit lower toxicity and provide more efficient transfection than DOTMA-containing compositions. Other commercially available cationic lipid products include DMRIE and DMRIE-HP (Vical, La Jolla, California) and Lipofectamine (DOSPA) (Life Technology, Inc., Gaithersburg, Maryland). Other cationic lipids suitable for delivery of oligonucleotides are described in WO 98 / 39359 and WO 96 / 37194.

[0331] Liposome preparations are particularly suitable for topical administration, and liposomes have several advantages over other preparations.These advantages include the reduction of side effects associated with the high systemic absorption rate of administered drug, the increase in the accumulation of administered drug in desired target, and the ability to administer RNAi agent to skin.In some implementations, liposomes are used to deliver RNAi agent to epidermal cells and promote the penetration of RNAi agent into dermal tissue, for example, skin.For example, liposomes can be applied topically. Topical delivery of drugs formulated as liposomes to the skin has been reported (e.g., Weiner et al., Journal of Drug Targeting, 1992, vol. 2, 405-410 and du Plessis et al., Antiviral Research, 18, 1992:259-265; Mannino, RJ and Fould-Fogerite, S., Biotechniques 6:682-690, 1988; Itani, T. et al., Gene 56:267-276, 1987; Nicolau, C. et al. (1987) Meth. Enz. 149:157-176, 1987; Straubinger, R M and Papahadjopoulos, D. Meth. Enz. 101:512-527, 1983; Wang, C Y and See Huang, L., Proc. Natl. Acad. Sci. USA 84:7851-7855, 1987).

[0332] Nonionic liposome systems, particularly those containing nonionic surfactants and cholesterol, have also been investigated to determine their usefulness in delivering drugs to the skin. Nonionic liposome formulations containing Novasome I (glyceryl dilaurate / cholesterol / polyoxyethylene-10-stearyl ether) and Novasome II (glyceryl distearate / cholesterol / polyoxyethylene-10-stearyl ether) were used to deliver drugs to the dermis of mouse skin. Such formulations containing RNAi agents are useful for treating skin diseases.

[0333] Liposomes containing iRNA can be made highly deformable. Such deformability can allow the liposomes to pass through pores smaller than the average radius of the liposome. For example, transfersomes are a type of deformable liposome. Transfersomes can be made by adding a surface edge activator, usually a surfactant, to a standard liposome composition. Transfersomes containing RNAi agents can be delivered, for example, by subcutaneous injection to deliver the RNAi agent to keratinocytes in the skin. To cross intact mammalian skin, lipid vesicles must pass through a series of micropores, each with a diameter of less than 50 nm, under the influence of a suitable transdermal gradient. Furthermore, due to their lipid properties, these transferosomes can be self-optimizing (e.g., adaptable to the shape of pores), self-repairing, often reaching their target without fracture, and often self-loading.

[0334] Other formulations suitable for the present invention are described in U.S. Provisional Patent Applications Nos. 61 / 018,616, filed January 2, 2008; 61 / 018,611, filed January 2, 2008; 61 / 039,748, filed March 26, 2008; 61 / 047,087, filed April 22, 2008; and 61 / 051,528, filed May 8, 2008. PCT Application No. PCT / US2007 / 080331, filed October 3, 2007, also describes formulations suitable for the present invention.

[0335] Transfersomes are yet another type of liposome, highly deformable lipid aggregates that are attractive candidates for drug delivery vehicles. Transfersomes can also be described as lipid droplets, which, because of their high deformability, can easily penetrate pores smaller than the droplets. Transfersomes can adapt to the environment in which they are used, for example, they are self-optimizing (adapting to the shape of pores in the skin), self-repairing, often reach their targets without fragmentation, and are often self-loading. To create transfersomes, surface edge activators, usually surfactants, can be added to standard liposome compositions. Transfersomes have been used to deliver serum albumin to the skin. Transfersome-mediated delivery of serum albumin has been shown to be as effective as subcutaneous injection of a solution containing serum albumin.

[0336] Surfactants find wide application in formulations such as emulsions (including microemulsions) and liposomes. The most common way to classify and rank the many different types of surfactants, both natural and synthetic, is by using the hydrophilic / lipophilic balance (HLB). The nature of the hydrophilic group (also known as the "head") provides the most useful means of categorizing the different surfactants used in formulations (Rieger, in Pharmaceutical Dosage Forms, Marcel Dekker, Inc., New York, NY, 1988, p. 285).

[0337] If the surfactant molecule is not ionized, the surfactant is classified as a nonionic surfactant. Nonionic surfactants find wide application in pharmaceutical and cosmetic products and are usable over a wide range of pH values. Their HLB values ​​generally range from 2 to approximately 18, depending on their structure. Nonionic surfactants include nonionic esters such as ethylene glycol esters, propylene glycol esters, glyceryl esters, polyglyceryl esters, sorbitan esters, sucrose esters, and ethoxylated esters. Nonionic alkanolamides and ethers such as fatty alcohol ethoxylates, propoxylated alcohols, and ethoxylated / propoxylated block polymers are also included in this class. Polyoxyethylene surfactants are the most popular members of the nonionic surfactant class.

[0338] When surfactant molecule dissolves or disperses in water, if it carries negative charge, this surfactant is classified as anionic.Anionic surfactants include carboxylates such as soap, acyl lactylates, acyl amides of amino acids, sulfates such as alkyl sulfates and ethoxylated alkyl sulfates, sulfonates such as alkylbenzene sulfonates, acyl isethionates, acyl taurates and sulfosuccinates, and phosphates.The most important members of anionic surfactant class are alkyl sulfates and soaps.

[0339] If the surfactant molecule carries a positive charge when dissolved or dispersed in water, the surfactant is classified as cationic.Cationic surfactants include quaternary ammonium salts and ethoxylated amines.Quaternary ammonium salts are the most commonly used members of this class.

[0340] If the surfactant molecule has the ability to carry either a positive or negative charge, the surfactant is classified as amphoteric. Amphoteric surfactants include acrylic acid derivatives, substituted alkylamides, N-alkylbetaines, and phosphatides.

[0341] The use of surfactants in drug products, formulations and emulsions has been reviewed (Rieger, in Pharmaceutical Dosage Forms, Marcel Dekker, Inc., New York, NY, 1988, p. 285).

[0342] The iRNA for use in the method of the present invention can also be provided as a micelle formulation. " Micelle " is defined herein as a specific type of molecular assembly in which amphiphilic molecules are arranged in a spherical structure, with all hydrophobic parts of the molecule facing inward, and the hydrophilic parts remaining in contact with the surrounding aqueous phase. When the environment is hydrophobic, the opposite arrangement exists.

[0343] Mixed micelle formulations suitable for transdermal delivery contain an aqueous solution of the siRNA composition, alkali metal C8-C 22 They can be prepared by mixing alkyl sulfates and micelle-forming compounds. Exemplary micelle-forming compounds include lecithin, hyaluronic acid, pharmaceutically acceptable salts of hyaluronic acid, glycolic acid, lactic acid, chamomile extract, cucumber extract, oleic acid, linoleic acid, linolenic acid, monoolein, monooleate, monolaurate, borage oil, evening primrose oil, menthol, trihydroxyoxocholanylglycine and its pharmaceutically acceptable salts, glycerin, polyglycerin, lysine, polylysine, triolein, polyoxyethylene ethers and their analogs, polidocanol alkyl ethers and their analogs, chenodeoxycholate, deoxycholate, and mixtures thereof. The micelle-forming compounds may be added simultaneously with or after the addition of alkali metal alkyl sulfates. Mixed micelles can be formed by virtually any type of mixing of components, but more vigorous mixing is preferred to provide smaller micelles.

[0344] In one method, a first micelle composition containing an siRNA composition and at least an alkali metal alkyl sulfate is prepared. The first micelle composition is then mixed with at least three micelle-forming compounds to form a mixed micelle composition. In another method, the micelle composition is prepared by mixing the siRNA composition, the alkali metal alkyl sulfate, and at least one of the micelle-forming compounds, followed by adding the remaining micelle-forming compounds while vigorously mixing.

[0345] Phenol and / or m-cresol may be added to the mixed micelle composition to stabilize the formulation and protect against bacterial growth. Alternatively, phenol and / or m-cresol may be added together with the micelle-forming components. An isotonicity agent, such as glycerin, may also be added after the mixed micelle composition is formed.

[0346] To deliver a micelle formulation as a spray, the formulation can be placed in an aerosol dispenser, which is then filled with a propellant. The propellant, under pressure, is in liquid form in the dispenser. The ratio of the components is adjusted so that there is one aqueous phase and one propellant phase, i.e., one phase. If two phases are present, the dispenser must be shaken before dispensing a portion of its contents, for example, via a metered valve. The medicinal dose is then expelled from the metered valve in the form of a fine spray.

[0347] Propellants may include hydrogen-containing chlorofluorocarbons, hydrogen-containing fluorocarbons, dimethyl ether, and diethyl ether. In certain embodiments, HFA 134a (1,1,1,2 tetrafluoroethane) may be used.

[0348] The specific concentrations of the essential components can be determined by relatively simple experimentation. For absorption via the oral cavity, it is often desirable to increase the dosage, for example, by at least two or three times, that for injection or administration via the gastrointestinal tract.

[0349] B. Lipid particles The iRNA or dsRNA of the present invention may be fully encapsulated in a lipid formulation, such as an LNP, or may form other nucleic acid-lipid particles.

[0350] As used herein, the term "LNP" refers to stable nucleic acid-lipid particles. LNPs typically contain cationic lipids, non-cationic lipids, and lipids that prevent particle aggregation (e.g., PEG-lipid conjugates). LNPs have an extended circulatory life after intravenous (iv) injection and accumulate at distal sites (e.g., sites physically separated from the administration site), making them extremely useful for systemic applications. LNPs include "pSPLPs," which contain encapsulated condensing agent-nucleic acid complexes, as described in PCT Publication No. WO 00 / 03683. The particles of the present invention typically have an average particle size of about 50 nm to about 150 nm, more typically about 60 nm to about 130 nm, more typically about 70 nm to about 110 nm, and most typically about 70 nm to about 90 nm, and are substantially nontoxic. Additionally, when present in the nucleic acid-lipid particles of the present invention, the nucleic acid is resistant to degradation by nucleases in aqueous solution. Nucleic acid-lipid particles and methods for their preparation are disclosed, for example, in U.S. Pat. Nos. 5,976,567; 5,981,501; 6,534,484; 6,586,410; 6,815,432; U.S. Patent Application Publication No. 2010 / 0324120; and PCT Publication No. WO 96 / 40964.

[0351] In one embodiment, the lipid to drug ratio (mass / mass ratio) (e.g., lipid to dsRNA ratio) will be in the range of about 1:1 to about 50:1, about 1:1 to about 25:1, about 3:1 to about 15:1, about 4:1 to about 10:1, about 5:1 to about 9:1, or about 6:1 to about 9:1. Ranges intermediate to the above ranges are also considered part of the invention.

[0352] Examples of cationic lipids include N,N-dioleyl-N,N-dimethylammonium chloride (DODAC), N,N-distearyl-N,N-dimethylammonium bromide (DDAB), N-(I-(2,3-dioleyloxy)propyl)-N,N,N-trimethylammonium chloride (DOTAP), N-(I-(2,3-dioleyloxy)propyl)-N,N,N-trimethylammonium chloride (DOTMA), N,N-dimethyl-2,3-dioleyloxy)propylamine (DODMA), 1,2-dilinoleyloxy-N,N-dimethylaminopropane (DLinDMA), 1,2-dilinoleyloxy-N,N-dimethylaminopropane (DLenDMA), 1,2-dilinoleylcarbamoyloxy-3-di Methylaminopropane (DLin-C-DAP), 1,2-Dilinoleyloxy-3-(dimethylamino)acetoxypropane (DLin-DAC), 1,2-Dilinoleyloxy-3-morpholinopropane (DLin-MA), 1,2-Dilinoleoyl-3-dimethylaminopropane (DLin-DAP), 1,2-Dilinoleylthio-3-dimethylaminopropane (DLin-S-DMA), 1-Linoleoyl-2-linoleyloxy-3-dimethylaminopropane (DLin-2-DMAP), 1,2-Dilinoleyloxy-3-trimethylaminopropane chloride salt (DLin-TMA.Cl), 1,2-Dilinoleoyl-3-trimethylaminopropane chloride salt (DLin-TAP.Cl), 1,2-dilinoleyloxy-3-(N-methylpiperazino)propane (DLin-MPZ), or 3-(N,N-dilinoleylamino)-1,2-propanediol (DLinAP), 3-(N,N-dioleylamino)-1,2-propanedio (DOAP), 1,2-dilinoleyloxo-3-(2-N,N-dimethylamino)ethoxypropane (DLin-EG-DMA), 1,2-dilinoleyloxy-N,N-dimethylaminopropane (DLinDMA), 2,2-dilinoleyl-4-dimethylaminomethyl-[1,3]-dioxolane (DLin-K-DMA) or analogs thereof , (3aR,5s,6aS)-N,N-dimethyl-2,2-di((9Z,12Z)-octadeca-9,12-dienyl)tetrahydro-3aH-cyclopenta[d][1,3]dioxol-5-amine (ALN100), (6Z,9Z,28Z,31Z)-heptatriaconta-6,9,28,31-tetraen-19-yl 4-(dimethylamino)butanoate (MC3), 1,1'-(2-(4-(2-((2-(bis(2-hydroxydodecyl)amino)ethyl)(2-hydroxydodecyl)amino)ethyl)piperazin-1-yl)ethylazanediyl)didodecan-2-ol (Tech G1), or a mixture thereof. The cationic lipid can comprise from about 20 mol% to about 50 mol%, or about 40 mol% of the total lipid present in the particle.

[0353] In another embodiment, the compound 2,2-dilinoleyl-4-dimethylaminoethyl-[1,3]-dioxolane can be used to prepare lipid-siRNA nanoparticles. The synthesis of 2,2-dilinoleyl-4-dimethylaminoethyl-[1,3]-dioxolane is described in U.S. Provisional Patent Application No. 61 / 107,998, filed October 23, 2008, which is incorporated herein by reference.

[0354] In one embodiment, the lipid-siRNA particles comprise 40% 2,2-dilinoleyl-4-dimethylaminoethyl-[1,3]-dioxolane:10% DSPC:40% cholesterol:10% PEG-C-DOMG (mol percent), and have a particle size of 63.0±20 nm and a 0.027 siRNA / lipid ratio.

[0355] Ionic / non-cationic lipids include, but are not limited to, distearoylphosphatidylcholine (DSPC), dioleoylphosphatidylcholine (DOPC), dipalmitoylphosphatidylcholine (DPPC), dioleoylphosphatidylglycerol (DOPG), dipalmitoylphosphatidylglycerol (DPPG), dioleoyl-phosphatidylethanolamine (DOPE), palmitoyloleoylphosphatidylcholine (POPC), palmitoyloleoylphosphatidylethanolamine (POPE), dioleoyl-phosphatidylethanolamine 4-(N The lipid may be an anionic or neutral lipid, including 1-(2-maleimidomethyl)-cyclohexane-1-carboxylate (DOPE-mal), dipalmitoylphosphatidylethanolamine (DPPE), dimyristoylphosphoethanolamine (DMPE), distearoylphosphatidylethanolamine (DSPE), 16-O-monomethyl PE, 16-O-dimethyl PE, 18-1-trans PE, 1-stearoyl-2-oleoyl-phosphatidyethanolamine (SOPE), cholesterol, or a mixture thereof. The non-cationic lipid, when cholesterol is included, may comprise about 5 mol% to about 90 mol%, about 10 mol%, or about 58 mol% of the total lipid present in the particle.

[0356] The conjugated lipid that inhibits particle aggregation can be, for example, a polyethylene glycol (PEG)-lipid, including, but not limited to, PEG-diacylglycerol (DAG), PEG-dialkyloxypropyl (DAA), PEG-phospholipid, PEG-ceramide (Cer), or a mixture thereof. The PEG-DAA conjugate can be, for example, PEG-dilauryloxypropyl (Ci2), PEG-dimyristyloxypropyl (Ci4), PEG-dipalmityloxypropyl (Ci6), or PEG-distearyloxypropyl (C]8). The conjugated lipid that inhibits particle aggregation can be 0 mol% to about 20 mol%, or 2 mol% of the total lipid present in the particle.

[0357] In some embodiments, the nucleic acid-lipid particles further comprise cholesterol, for example, from about 10 mol % to about 60 mol % or about 48 mol % of the total lipid present in the particle.

[0358] In one embodiment, lipidoid ND98·4HCl (MW 1487) (see U.S. Patent Application No. 12 / 056,230, filed March 26, 2008, incorporated herein by reference), cholesterol (Sigma-Aldrich), and PEG-Ceramide C16 (Avanti Polar Lipids) can be used to prepare lipid-dsRNA nanoparticles (i.e., LNP01 particles). Stock solutions of each can be prepared in ethanol as follows: ND98, 133 mg / ml; cholesterol, 25 mg / ml; PEG-Ceramide C16, 100 mg / ml. The ND98, cholesterol, and PEG-Ceramide C16 stock solutions can then be combined in a molar ratio of, for example, 42:48:10. The combined lipid solution can be mixed with an aqueous dsRNA solution (e.g., in sodium acetate (pH 5)) so that the final ethanol concentration is about 35-45% and the final sodium acetate concentration is about 100-300 mM. Lipid-dsRNA nanoparticles usually form spontaneously upon mixing. Depending on the desired particle size distribution, the resulting nanoparticle mixture can be extruded through a polycarbonate membrane (e.g., 100 nm cutoff) using a thermobarrel extruder such as the Lipex Extruder (Northern Lipids, Inc.). In some cases, the extrusion step can be omitted. Ethanol removal and simultaneous buffer exchange can be achieved, for example, by dialysis or tangential flow filtration. The buffer can be exchanged with phosphate-buffered saline (PBS), for example, at about pH 7, e.g., about pH 6.9, about pH 7.0, about pH 7.1, about pH 7.2, about pH 7.3, or about pH 7.4. [ka]

[0359] LNP01 formulations are described, for example, in International Application Publication No. WO 2008 / 042973, which is incorporated herein by reference.

[0360] Further exemplary lipid-dsRNA formulations are described in Table A.

[0361] [Table 1]

[0362] [Table 2]

[0363] [Table 3]

[0364] DSPC: Distearoylphosphatidylcholine DPPC: dipalmitoylphosphatidylcholine PEG-DMG: PEG-didimyristoyl glycerol (C14-PEG, or PEG-C14) (PEG with an average molecular weight of 2000) PEG-DSG: PEG-distyrylglycerol (C18-PEG, or PEG-C18) (PEG with an average molecular weight of 2000) PEG-cDMA: PEG-carbamoyl-1,2-dimyristyloxypropylamine (PEG with an average molecular weight of 2000)

[0365] Formulations containing LNP (l,2-dilinolenyloxy-N,N-dimethylaminepropane (DLinDMA)) are described in WO 2009 / 127060, filed April 15, 2009, which is incorporated herein by reference.

[0366] Formulations containing XTC are described, for example, in U.S. Provisional Patent Application Nos. 61 / 148,366, filed January 29, 2009; 61 / 156,851, filed March 2, 2009; 61 / 156,851, filed June 10, 2009; 61 / 228,373, filed July 24, 2009; 61 / 239,686, filed September 3, 2009; and International Application No. PCT / US2010 / 022614, filed January 29, 2010, which are incorporated herein by reference.

[0367] Formulations containing MC3 are described, for example, in US Patent Application Publication No. 2010 / 0324120, filed June 10, 2010, the entire contents of which are incorporated herein by reference.

[0368] Formulations containing ALNY-100 are described, for example, in International Patent Application No. PCT / US09 / 63933, filed November 10, 2009, which is incorporated herein by reference.

[0369] Formulations containing C12-200 are described in U.S. Provisional Patent Application No. 61 / 175,770, filed May 5, 2009, and International Application No. PCT / US10 / 33777, filed May 5, 2010, which are incorporated herein by reference.

[0370] Synthesis of ionic / cationic lipids Any of the compounds, e.g., cationic lipids, used in the nucleic acid-lipid particles of the present invention can be prepared by known organic synthesis techniques, including those methods described in more detail in the Examples. All substituents are as defined below unless otherwise indicated.

[0371] "Alkyl" means a straight-chain or branched-chain, acyclic or cyclic, saturated aliphatic hydrocarbon containing 1 to 24 carbon atoms. Representative saturated straight-chain alkyls include methyl, ethyl, n-propyl, n-butyl, n-pentyl, n-hexyl, and the like; while saturated branched-chain alkyls include isopropyl, sec-butyl, isobutyl, tert-butyl, isopentyl, and the like. Representative saturated cyclic alkyls include cyclopropyl, cyclobutyl, cyclopentyl, cyclohexyl, and the like; while unsaturated cyclic alkyls include cyclopentenyl and cyclohexenyl, and the like.

[0372] "Alkenyl" refers to an alkyl as defined above containing at least one double bond between adjacent carbon atoms. Alkenyl includes both cis and trans isomers. Representative straight and branched chain alkenyls include ethylenyl, propylenyl, 1-butenyl, 2-butenyl, isobutylenyl, 1-pentenyl, 2-pentenyl, 3-methyl-1-butenyl, 2-methyl-2-butenyl, 2,3-dimethyl-2-butenyl, and the like.

[0373] "Alkynyl" means any alkyl or alkenyl as defined above further containing at least one triple bond between adjacent carbons. Representative straight and branched chain alkynyls include acetylenyl, propynyl, 1-butynyl, 2-butynyl, 1-pentynyl, 2-pentynyl, 3-methyl-1 butynyl, and the like.

[0374] "Acyl" means any alkyl, alkenyl, or alkynyl group in which the carbon at the point of attachment is substituted with an oxo group, as defined below. For example, -C(=O)alkyl, -C(=O)alkenyl, and -C(=O)alkynyl are acyl groups.

[0375] "Heterocycle" means a 5- to 7-membered monocyclic or 7- to 10-membered bicyclic heterocycle that is either saturated, unsaturated, or aromatic and contains one or two heteroatoms independently selected from nitrogen, oxygen, and sulfur, where the nitrogen and sulfur heteroatoms are optionally oxidized and the nitrogen heteroatom is optionally quaternized, including bicyclic rings in which any of the above heterocycles are fused to a benzene ring. The heterocycle can be bonded via any heteroatom or carbon atom. Heterocycle includes heteroaryl, as defined below. Heterocycles include morpholinyl, pyrrolidinonyl, pyrrolidinyl, piperidinyl, piperidinyl, hydantoinyl, valerolactamyl, oxiranyl, oxetanyl, tetrahydrofuranyl, tetrahydropyranyl, tetrahydropyridinyl, tetrahydropyrimidinyl, tetrahydrothiophenyl, tetrahydrothiopyranyl, tetrahydropyrimidinyl, tetrahydrothiophenyl, tetrahydrothiopyranyl, and the like.

[0376] The terms "optionally substituted alkyl," "optionally substituted alkenyl," "optionally substituted alkynyl," "optionally substituted acyl," and "optionally substituted heterocycle," when substituted, mean that at least one hydrogen atom is replaced with a substituent. In the case of an oxo substituent (=O), two hydrogen atoms are replaced. In this regard, substituents include oxo, halogen, heterocycle, -CN, -ORx, -NRxRy, -NRxC(=O)Ry, -NRxS02Ry, -C(=O)Rx, -C(=O)ORx, -C(=O)NRxRy, -SONRx and -SONNRxRy, where n is 0, 1 or 2 and Rx and Ry are the same or different and independently hydrogen, alkyl or heterocycle, and each of said alkyl and heterocycle substituents can be further substituted with one or more of oxo, halogen, -OH, -CN, alkyl, -ORx, heterocycle, -NRxRy, -NRxC(=O)Ry, -NRxS02Ry, -C(=O)Rx, -C(=O)ORx, -C(=O)NRxRy, -SONRx and -SONNRxRy.

[0377] "Halogen" means fluoro, chloro, bromo and iodo.

[0378] In some embodiments, the methods of the present invention may require the use of protecting groups. Protecting group methods are well known to those skilled in the art (see, for example, Protective Groups in Organic Synthesis, Green, TW et al., Wiley-Interscience, New York City, 1999). Briefly, a protecting group in the context of the present invention is any group that reduces or eliminates the undesired reactivity of a functional group. A protecting group can be added to a functional group to mask its reactivity during a specific reaction and then removed to reveal the original functional group. In some embodiments, an "alcohol protecting group" is used. An "alcohol protecting group" is any group that reduces or eliminates the undesired reactivity of an alcohol functional group. Protecting groups can be added and removed using techniques well known in the art.

[0379] Synthesis of Formula A In one embodiment, the nucleic acid-lipid particles of the present invention have Formula A: [ka] In some embodiments, the cationic lipid is XTC (2,2-dilinoleyl-4-dimethylaminoethyl-[1,3]-dioxolane). Generally, the lipid of formula A above can be prepared by the following reaction scheme 1 or 2, where R1 and R2 are independently alkyl, alkenyl or alkynyl, each of which may be optionally substituted, and R3 and R4 are independently lower alkyl, or R3 and R4 can be taken together to form an optionally substituted heterocycle.

[0380] [ka] Lipids A (wherein R1 and R2 are independently alkyl, alkenyl, or alkynyl, each of which may be optionally substituted; R3 and R4 are independently lower alkyl; or R3 and R4 can be joined to form an optionally substituted heterocycle) can be prepared according to Scheme 1. Ketone 1 and bromide 2 can be purchased or prepared according to methods known to those skilled in the art. Reaction of 1 and 2 provides ketal 3. Treatment of ketal 3 with amine 4 provides lipids of formula A. Lipids of formula A can be converted to the corresponding ammonium salt using an organic salt of formula 5 (wherein X is an anionic counterion selected from halogen, hydroxide, phosphate, sulfate, etc.).

[0381] [ka] Alternatively, the starting material ketone 1 can be prepared according to Scheme 2. Grignard reagent 6 and cyanide 7 can be purchased or prepared according to methods known to those skilled in the art. Reaction of 6 and 7 gives ketone 1. Conversion of ketone 1 to the corresponding lipid of formula A is depicted in Scheme 1.

[0382] Synthesis of MC3 DLin-M-C3-DMA (i.e., (6Z,9Z,28Z,31Z)-heptatriaconta-6,9,28,31-tetraen-19-yl 4-(dimethylamino)butanoate) was prepared as follows. A solution of (6Z,9Z,28Z,31Z)-heptatriaconta-6,9,28,31-tetraen-19-ol (0.53 g), 4-N,N-dimethylaminobutyric acid hydrochloride (0.51 g), 4-N,N-dimethylaminopyridine (0.61 g), and 1-ethyl-3-(3-dimethylaminopropyl)carbodiimide hydrochloride (0.53 g) in dichloromethane (5 mL) was stirred overnight at room temperature. The solution was washed with dilute hydrochloric acid and then with dilute aqueous sodium bicarbonate. The organic fraction was dried over anhydrous magnesium sulfate, filtered, and the solvent was removed on a rotary evaporator. The residue was passed through a silica gel column (20 g) using a 1-5% methanol / dichloromethane elution gradient. Fractions containing the purified product were combined. The solvent was removed to give a colorless oil (0.54 g). Synthesis of ALNY-100

[0383] The synthesis of ketal 519 [ALNY-100] was carried out according to Scheme 3: [ka]

[0384] Synthesis of 515 To a stirred suspension of LiAlH4 (3.74 g, 0.09852 mol) in 200 mL of anhydrous THF in a two-necked round-bottom flask (1 L) was slowly added a solution of 514 (10 g, 0.04926 mol) in 70 mL of THF at 0°C under a nitrogen atmosphere. After complete addition, the reaction mixture was warmed to room temperature and then heated to reflux for 4 h. The progress of the reaction was monitored by TLC. After completion of the reaction (by TLC), the mixture was cooled to 0°C and quenched by careful addition of saturated Na2SO4 solution. The reaction mixture was stirred at room temperature for 4 h and filtered off. The residue was washed thoroughly with THF. The filtrate and washings were combined, diluted with 400 mL of dioxane and 26 mL of concentrated HCl, and stirred at room temperature for 20 min. The volatiles were removed under reduced pressure to give the hydrochloride salt of 515 as a white solid. Yield: 7.12 g 1 H-NMR (DMSO, 400MHz): δ = 9.34 (broad, 2H), 5.68 (s, 2H), 3.74 (m, 1H), 2.66~2.60 (m, 2H), 2.50~2.45 (m, 5H).

[0385] Synthesis of 516 To a stirred solution of compound 515 in 100 mL of dry DCM in a 250 mL two-neck round-bottom flask, NEt3 (37.2 mL, 0.2669 mol) was added and cooled to 0 °C under a nitrogen atmosphere. N-(benzyloxy-carbonyloxy)-succinimide (20 g, 0.08007 mol) in 50 mL of dry DCM was slowly added, and the reaction mixture was allowed to warm to room temperature. After completion of the reaction (2-3 h by TLC), the mixture was washed successively with 1 N HCl solution (1 × 100 mL) and saturated NaHCO3 solution (1 × 50 mL). The organic layer was then dried over anhydrous Na2SO4, and the solvent was evaporated to give crude material, which was purified by silica gel column chromatography to give 516 as a sticky mass. Yield: 11 g (89%). 1H-NMR (CDCl3, 400MHz): δ=7.36~7.27(m,5H), 5.69(s,2H), 5.12(s,2H), 4.96(br.,1H)2.74(s,3H), 2.60(m,2H), 2.30~2.25(m,2H). LC-MS[M+H]-232.3(96.94%).

[0386] Synthesis of 517A and 517B Cyclopentene 516 (5 g, 0.02164 mol) was dissolved in 220 mL of a 10:1 solution of acetone and water in a 500 mL single-neck round-bottom flask, and N-methylmorpholine-N-oxide (7.6 g, 0.06492 mol) was added thereto, followed by 4.2 mL of a 7.6% solution of OsO (0.275 g, 0.00108 mol) in tert-butanol at room temperature. After completion of the reaction (approximately 3 h), the mixture was quenched by the addition of solid NaSO, and the resulting mixture was stirred at room temperature for 1.5 h. The reaction mixture was diluted with DCM (300 mL) and washed with water (2 × 100 mL), followed by saturated NaHCO (1 × 50 mL) solution, water (1 × 30 mL), and finally brine (1 × 50 mL). The organic phase was dried over anhydrous NaSO, and the solvent was removed under reduced pressure. Silica gel column chromatography purification of the crude material afforded a mixture of diastereomers, which were separated by preparative HPLC. Yield: 6 g of crude 517A-Peak-1 (white solid), 5.13 g (96%). H-NMR (DMSO, 400 MHz): δ = 7.39–7.31 (m, 5H), 5.04 (s, 2H), 4.78–4.73 (m, 1H), 4.48–4.47 (d, 2H), 3.94–3.93 (m, 2H), 2.71 (s, 3H), 1.72–1.67 (m, 4H). LC-MS: [M+H] = 266.3, [M+NH] = 283.5 present, HPLC = 97.86%. Stereochemistry confirmed by X-ray.

[0387] Synthesis of 518 Using a procedure similar to that described for the synthesis of compound 505, compound 518 (1.2 g, 41%) was obtained as a colorless oil. H-NMR (CDCl, 400 MHz): δ = 7.35–7.33 (m, 4H), 7.30–7.27 (m, 1H), 5.37–5.27 (m, 8H), 5.12 (s, 2H), 4.75 (m, 1H), 4.58–4.57 (m, 2H), 2.78–2.74 (m, 7H), 2.06–2.00 (m, 8H), 1.96–1.91 (m, 2H), 1.62 (m, 4H), 1.48 (m, 2H), 1.37–1.25 (br m, 36H), 0.87 (m, 6H). HPLC-98.65%.

[0388] General procedure for the synthesis of compound 519 A solution of compound 518 (1 equiv.) in hexane (15 mL) was added dropwise to an ice-cooled solution of LAH in THF (1 M, 2 equiv.). After complete addition, the mixture was heated at 40° C. for 0.5 h and then cooled again on an ice bath. The mixture was carefully hydrolyzed with saturated aqueous NaSO, then filtered through Celite and reduced to an oil. Column chromatography afforded pure 519 (1.3 g, 68%), which was obtained as a colorless oil. 13 C NMR δ = 130.2, 130.1 (x2), 127.9 (x3), 112.3, 79.3, 64.4, 44.7, 38.3, 35.4, 31.5, 29.9 (x2), 29.7, 29.6 (x2), 29.5 (x3), 29.3 (x2), 27.2 (x3), 25.6, 24.5, 23.3, 226, 14.1; electrospray MS (+ve): C 44 H 80 Molecular weight (M+H) for NO2 calculated 654.6, found 654.6.

[0389] Formulations prepared by either standard or extrusion-free methods can be characterized in a similar manner. For example, formulations are typically characterized by visual inspection. The formulation should be a whitish, translucent solution without aggregates or precipitates. The particle size and particle size distribution of the lipid-nanoparticles can be measured by light scattering, for example, using a Malvern Zetasizer Nano ZS (Malvern, USA). Particles should be approximately 20-300 nm in size, e.g., 40-100 nm. The particle size distribution should be unimodal. The total dsRNA concentration in the formulation and the entrapped fraction can be estimated using a dye exclusion assay. A sample of the formulated dsRNA may be incubated with an RNA-binding dye, such as Ribogreen (Molecular Probes), in the presence or absence of a formulation-disrupting surfactant, e.g., 0.5% Triton-X100. The total dsRNA in the formulation can be determined by comparing the signal from the sample containing the surfactant against a standard curve. The entrapped fraction is determined by subtracting the "free" dsRNA content (measured by the signal in the absence of surfactant) from the total dsRNA content. The percent of entrapped dsRNA is typically >85%. For LNP formulations, particle sizes are at least 30 nm, at least 40 nm, at least 50 nm, at least 60 nm, at least 70 nm, at least 80 nm, at least 90 nm, at least 100 nm, at least 110 nm, and at least 120 nm. Suitable ranges are typically at least about 50 nm to at least about 110 nm, at least about 60 nm to at least about 100 nm, or at least about 80 nm to at least about 90 nm.

[0390] Oral compositions and formulations include powders or granules, microparticles, nanoparticles, suspensions, or solutions in water or non-aqueous media, capsules, gel capsules, sachets, tablets, or mini-tablets. Thickeners, flavoring agents, diluents, emulsifiers, dispersing aids, or binders may be desirable. In some embodiments, oral formulations are those in which the dsRNA characterizing the present invention is administered with one or more permeation enhancers, surfactants, and chelating agents. Suitable surfactants include fatty acids and / or esters or their salts, bile acids and / or their salts. Suitable bile acids / salts include chenodeoxycholic acid (CDCA) and ursodeoxychenodeoxycholic acid (UDCA), cholic acid, dehydrocholic acid, deoxycholic acid, glycolic acid, glycodeoxycholic acid, taurocholic acid, taurodeoxycholic acid, sodium tauro-24,25-dihydrofusidate, and sodium glycodihydrofusidate. Suitable fatty acids include arachidonic acid, undecanoic acid, oleic acid, lauric acid, caprylic acid, capric acid, myristic acid, palmitic acid, stearic acid, linoleic acid, linolenic acid, dicaprate, tricaprate, monoolein, dilaurin, glyceryl 1-monocaprate, 1-dodecylazacycloheptan-2-one, acylcarnitine, acylcholine, or monoglycerides, diglycerides, or pharmaceutically acceptable salts thereof (e.g., sodium). In some embodiments, a combination of penetration enhancers is used, such as a fatty acid / salt in combination with a bile acid / salt. An exemplary combination is the sodium salt of lauric acid, capric acid, and UDCA. Additional penetration enhancers include polyoxyethylene-9-lauryl ether and polyoxyethylene-20-cetyl ether. The DsRNA characterizing the present invention can be orally delivered in the form of granules, including spray-dried particles, or complexed to form micro- or nanoparticles.dsRNA complexing agents include polyamino acids, polyimines, polyacrylates, polyalkylacrylates, polyoxetanes, polyalkylcyanoacrylates, cationized gelatin, albumin, starch, acrylates, polyethylene glycol (PEG) and starch, polyalkylcyanoacrylates, DEAE-derivatized polyimines, pullulan, cellulose, and starch. Suitable complexing agents include chitosan, N-trimethylchitosan, poly-L-lysine, polyhistidine, polyornithine, polyspermine, protamine, polyvinylpyridine, polythiodiethylaminomethylethylene P(TDAE), polyaminostyrene (e.g., p-amino), poly(methylcyanoacrylate), poly(ethylcyanoacrylate), poly(butylcyanoacrylate), poly(isobutylcyanoacrylate), poly(isohexylcyanoacrylate), DEAE-methacrylate, DEAE-hexylacrylate. Oral formulations for dsRNA and their formulations are described in U.S. Pat. No. 6,887,906, U.S. Patent Application Publication No. 20030027780, and U.S. Pat. No. 6,747,014, each of which is incorporated herein by reference.

[0391] Compositions and formulations for parenteral, intraparenchymal (into the brain), intrathecal, intraventricular, or intrahepatic administration may include sterile aqueous solutions, which may also contain buffers, diluents, and other suitable additives, including, but not limited to, penetration enhancers, carrier compounds, and other pharmaceutically acceptable carriers or excipients.

[0392] The pharmaceutical compositions of the present invention include, but are not limited to, liquids, emulsions, and liposome-containing formulations. These compositions can be made from a variety of components, including, but not limited to, preformed liquids, self-emulsifying solids, and self-emulsifying semi-solids. When treating liver diseases such as hepatocarcinoma, liver-targeting formulations are particularly preferred.

[0393] The pharmaceutical formulations of the present invention, which can be conveniently presented in unit dosage form, can be prepared according to conventional techniques well known in the pharmaceutical industry. Such techniques include the step of bringing the active ingredient into association with pharmaceutical carriers or excipients. In general, the formulations are prepared by uniformly and intimately bringing the active ingredient into association with liquid carriers or finely divided solid carriers, or both, and then, if necessary, shaping the product.

[0394] The compositions of the present invention can be formulated into any of a number of possible dosage forms, including, but not limited to, tablets, capsules, gel capsules, liquid syrups, soft gels, suppositories, and enemas. The compositions of the present invention can also be formulated as suspensions in aqueous, non-aqueous, or mixed media. Aqueous suspensions may further contain substances that increase the viscosity of the suspension, including, for example, sodium carboxymethylcellulose, sorbitol, and / or dextran. The suspension may also contain a stabilizer.

[0395] C. Further Formulations i. Emulsion The compositions of the present invention may be prepared and formulated as emulsions. Emulsions are typically heterogeneous systems in which one liquid is dispersed in another liquid in the form of droplets, usually greater than 0.1 μm in diameter (see, e.g., Ansel's Pharmaceutical Dosage Forms and Drug Delivery Systems, Allen, LV., Popovich NG., and Ansel HC., 2004, Lippincott Williams & Wilkins (8th ed.), New York, NY; Idson, in Pharmaceutical Dosage Forms, Lieberman, Rieger and Banker (Eds.), 1988, Marcel Dekker, Inc., New York, NY, Volume 1, p. 199; Rosoff, in Pharmaceutical Dosage Forms, Lieberman, Rieger and Banker (Eds.), 1988, Marcel Dekker, Inc., New York, NY, Volume 1, p. 245; Block, in Pharmaceutical Dosage Forms, Lieberman, Rieger and (See Banker (Eds.), 1988, Marcel Dekker, Inc., New York, NY, volume 2, p. 335; Higuchi et al., in Remington's Pharmaceutical Sciences, Mack Publishing Co., Easton, Pa., 1985, p. 301). Emulsions are often biphasic systems containing two immiscible liquid phases intimately mixed and dispersed with each other. Generally, emulsions can be either water-in-oil (w / o) or oil-in-water (o / w) types. When an aqueous phase is finely divided and dispersed as minute droplets into a bulk oil phase, the resulting composition is called a water-in-oil (w / o) emulsion. Alternatively, when an oil phase is finely divided and dispersed as minute droplets into a bulk aqueous phase, the resulting composition is called an oil-in-water (o / w) emulsion.In addition to the dispersed phase and active drug, emulsions can contain additional components, which may be present in the aqueous phase, as a solution in the oil phase, or as a separate phase. Pharmaceutical excipients such as emulsifiers, stabilizers, dyes, and antioxidants can also be present in the emulsion as needed. Pharmaceutical emulsions can be multiple emulsions consisting of three or more phases, such as oil-in-water-in-oil (o / w / o) and water-in-oil-in-water (w / o / w) emulsions. Such complex formulations often offer certain advantages that simple binary emulsions do not. Multiple emulsions in which individual oil droplets of an o / w emulsion surround small water droplets constitute w / o / w emulsions. Similarly, a system of oil droplets surrounded by globules of water stabilized in a continuous oil phase provides an o / w / o emulsion.

[0396] Emulsions are characterized by having little or no thermodynamic stability.In many cases, the dispersed or discontinuous phase of an emulsion is well dispersed in the external or continuous phase and is maintained in this form through the use of emulsifiers or the viscosity of the formulation.Either phase of an emulsion can be semi-solid or solid, as in the case of emulsion-type ointment bases and creams.Other means of stabilizing emulsions include the use of emulsifiers, which can be incorporated into either phase of the emulsion. Emulsifiers can be broadly classified into four categories: synthetic surfactants, natural emulsifiers, absorption bases, and finely dispersed solids (see, e.g., Ansel's Pharmaceutical Dosage Forms and Drug Delivery Systems, Allen, LV., Popovich NG., and Ansel HC., 2004, Lippincott Williams & Wilkins (8th ed.), New York, NY; Idson, in Pharmaceutical Dosage Forms, Lieberman, Rieger and Banker (Eds.), 1988, Marcel Dekker, Inc., New York, NY, volume 1, p. 199).

[0397] Synthetic surfactants, also known as surface active agents, have found widespread application in the formulation of emulsions and have been reviewed in the literature (see, for example, Ansel's Pharmaceutical Dosage Forms and Drug Delivery Systems, Allen, LV., Popovich NG., and Ansel HC., 2004, Lippincott Williams & Wilkins (8th ed.), New York, NY; Rieger, in Pharmaceutical Dosage Forms, Lieberman, Rieger and Banker (Eds.), 1988, Marcel Dekker, Inc., New York, NY, volume 1, p. 285; Idson, in Pharmaceutical Dosage Forms, Lieberman, Rieger and Banker (Eds.), Marcel Dekker, Inc., New York, NY, 1988, volume 1, p. 199). Surfactants are usually amphiphilic, comprising a hydrophilic portion and a hydrophobic portion. The ratio of hydrophilicity to hydrophobicity of surfactant is called hydrophilic / lipophilic balance (HLB), which is a valuable tool for classifying and selecting surfactants when preparing formulations.Surfactants can be classified into different types based on the nature of hydrophilic groups, namely, nonionic, anionic, cationic and amphoteric (see, for example, Ansel's Pharmaceutical Dosage Forms and Drug Delivery Systems, Allen, LV., Popovich NG., and Ansel HC., 2004, Lippincott Williams & Wilkins (8th ed.), New York, NY Rieger, in Pharmaceutical Dosage Forms, Lieberman, Rieger and Banker (Eds.), 1988, Marcel Dekker, Inc., New York, NY, volume 1, p.285).

[0398] Naturally occurring emulsifiers used in emulsion formulations include lanolin, beeswax, phosphatides, lecithin, and acacia. Absorption bases, such as anhydrous lanolin and hydrophilic petrolatum, possess hydrophilic properties that allow them to incorporate water to form water-in-oil emulsions while still maintaining their semisolid consistency. Finely divided solids have been used as good emulsifiers, especially in surfactant combinations and in viscous formulations. These include polar inorganic solids such as heavy metal hydroxides, non-swelling clays such as bentonite, attapulgite, hectorite, kaolin, montmorillonite, colloidal aluminum silicate, and colloidal magnesium aluminum silicate, pigments, and non-polar solids such as carbon or glyceryl tristearate.

[0399] A wide variety of non-emulsifying materials are also included in emulsion formulations and contribute to the properties of emulsions, including fats, oils, waxes, fatty acids, fatty alcohols, fatty esters, humectants, hydrophilic colloids, preservatives, and antioxidants (Block, in Pharmaceutical Dosage Forms, Lieberman, Rieger, and Banker (Eds.), 1988, Marcel Dekker, Inc., New York, NY, volume 1, p. 335; Idson, in Pharmaceutical Dosage Forms, Lieberman, Rieger, and Banker (Eds.), 1988, Marcel Dekker, Inc., New York, NY, volume 1, p. 199).

[0400] Hydrophilic colloids, or hydrocolloids, include naturally occurring gums and synthetic polymers such as polysaccharides (e.g., acacia, agar, alginate, carrageenan, guar gum, karaya gum, and tragacanth), cellulose derivatives (e.g., carboxymethyl cellulose and carboxypropyl cellulose), and synthetic polymers (e.g., carbomer, cellulose ethers, and carboxyvinyl polymers), which disperse in or swell in water to form colloidal solutions that stabilize emulsions by forming strong interfacial films around droplets of the dispersed phase and by increasing the viscosity of the external phase.

[0401] Emulsions often contain many ingredients, such as carbohydrates, proteins, sterols, and phosphatides, which can easily support the growth of microorganisms, so these preparations often incorporate preservatives. Commonly used preservatives in preparations include methylparaben, propylparaben, quaternary ammonium salts, benzalkonium chloride, esters of p-hydroxybenzoic acid, and boric acid. Antioxidants are also usually added to emulsion preparations to prevent the preparation from deteriorating. The antioxidants used can be free radical scavengers such as tocopherol, alkyl gallate, butylated hydroxyanisole, and butylated hydroxytoluene, or reducing agents such as ascorbic acid and sodium metabisulfite, and antioxidant synergists such as citric acid, tartaric acid, and lecithin.

[0402] The application of emulsion formulations via the dermal, oral and parenteral routes, as well as their manufacturing methods, have been reviewed in the literature (see, for example, Ansel's Pharmaceutical Dosage Forms and Drug Delivery Systems, Allen, LV., Popovich NG., and Ansel HC., 2004, Lippincott Williams & Wilkins (8th ed.), New York, NY; Idson, in Pharmaceutical Dosage Forms, Lieberman, Rieger and Banker (Eds.), 1988, Marcel Dekker, Inc., New York, NY, volume 1, p. 199). Emulsion formulations for oral delivery are very widely used due to their ease of formulation and effectiveness in terms of absorption and bioavailability (see, e.g., Ansel's Pharmaceutical Dosage Forms and Drug Delivery Systems, Allen, LV., Popovich NG., and Ansel HC., 2004, Lippincott Williams & Wilkins (8th ed.), New York, NY; Rosoff, in Pharmaceutical Dosage Forms, Lieberman, Rieger and Banker (Eds.), 1988, Marcel Dekker, Inc., New York, NY, volume 1, p. 245; Idson, in Pharmaceutical Dosage Forms, Lieberman, Rieger and Banker (Eds.), 1988, Marcel Dekker, Inc., New York, NY, volume 1, p. 199). Mineral oil-based laxatives, oil-soluble vitamins, and high-fat nutritional formulations are among the materials commonly administered orally as oil-in-water emulsions.

[0403] ii. Microemulsions In one embodiment of the present invention, iRNA and nucleic acid compositions are formulated as microemulsions. A microemulsion can be defined as a system of water, oil, and an amphiphile that is a single, optically isotropic, and thermodynamically stable liquid solution (see, e.g., Ansel's Pharmaceutical Dosage Forms and Drug Delivery Systems, Allen, LV., Popovich NG., and Ansel HC., 2004, Lippincott Williams & Wilkins (8th ed.), New York, NY; Rosoff, in Pharmaceutical Dosage Forms, Lieberman, Rieger, and Banker (Eds.), 1988, Marcel Dekker, Inc., New York, NY, volume 1, p. 245). Typically, microemulsions are prepared by first dispersing an oil in an aqueous surfactant solution, followed by the addition of a sufficient amount of a fourth component, typically a medium-chain alcohol, to form a clear system. Thus, microemulsions are described as thermodynamically stable, isotropically transparent dispersions of two immiscible liquids stabilized by an interfacial film of surface-active molecules (Leung and Shah, in: Controlled Release of Drugs: Polymers and Aggregate Systems, Rosoff, M., Ed., 1989, VCH Publishers, New York, pp. 185-215). Microemulsions are usually prepared using a combination of three to five components, including oil, water, surfactant, cosurfactant, and electrolyte. Whether a microemulsion is water-in-oil (w / o) or oil-in-water (o / w) depends on the properties of the oil and surfactant used and the structure and geometric packing of the polar heads and hydrocarbon tails of the surfactant molecules (Schott, in: Remington's Pharmaceutical Sciences, Mack Publishing Co., Easton, Pa., 1985, p. 271).

[0404] The phenomenological approach using phase diagrams has been extensively studied, providing those skilled in the art with extensive knowledge of how to formulate microemulsions (see, for example, Ansel's Pharmaceutical Dosage Forms and Drug Delivery Systems, Allen, LV., Popovich NG., and Ansel HC., 2004, Lippincott Williams & Wilkins (8th ed.), New York, NY; Rosoff, in Pharmaceutical Dosage Forms, Lieberman, Rieger and Banker (Eds.), 1988, Marcel Dekker, Inc., New York, NY, volume 1, p. 245; Block, in Pharmaceutical Dosage Forms, Lieberman, Rieger and Banker (Eds.), 1988, Marcel Dekker, Inc., New York, NY, volume 1, p. 335). Compared to conventional emulsions, microemulsions offer the advantage of solubilizing water-insoluble drugs in a formulation of thermodynamically stable droplets that form spontaneously.

[0405] Surfactants used in preparing microemulsions, alone or in combination with cosurfactants, include, but are not limited to, ionic surfactants, nonionic surfactants, Brij 96, polyoxyethylene oleyl ether, polyglycerol fatty acid esters, tetraglycerol monolaurate (ML310), tetraglycerol monooleate (MO310), hexaglycerol monooleate (PO310), hexaglycerol pentaoleate (PO500), decaglycerol monocaprate (MCA750), decaglycerol monooleate (MO750), decaglycerol sequioleate (SO750), and decaglycerol decaoleate (DAO750). The cosurfactant, typically a short-chain alcohol such as ethanol, 1-propanol, or 1-butanol, serves to increase interfacial fluidity by penetrating the surfactant film, resulting in the formation of an irregular film due to the void spaces created between the surfactant molecules. However, microemulsions can be prepared without the use of cosurfactants, and alcohol-free self-emulsifying microemulsion systems are known in the art. The aqueous phase can typically be, but is not limited to, water, an aqueous solution of the drug, glycerol, PEG 300, PEG 400, polyglycerol, propylene glycol, and ethylene glycol derivatives. The oil phase can include materials such as, but not limited to, Captex 300, Captex 355, Capmul MCM, fatty acid esters, medium-chain (C8-C12) mono-, di-, and tri-glycerides, polyoxyethylated glyceryl fatty acid esters, fatty alcohols, polyglycolized glycerides, saturated polyglycolized C8-C10 glycerides, vegetable oils, and silicone oils.

[0406] Microemulsions are particularly interesting from the standpoint of drug solubilization and drug absorption enhancement. Lipid-based microemulsions (both o / w and w / o) have been proposed to improve the oral bioavailability of drugs, including peptides (see, e.g., U.S. Pat. Nos. 6,191,105, 7,063,860, 7,070,802, 7,157,099; Constantinides et al., Pharmaceutical Research, 1994, 11, 1385-1390; Ritschel, Meth. Find. Exp. Clin. Pharmacol., 1993, 13, 205). Microemulsions offer the advantages of improved drug solubilization, drug protection from enzymatic hydrolysis, potential enhancement of drug absorption due to surfactant-induced alterations in membrane fluidity and permeability, ease of preparation, ease of oral administration over solid dosage forms, improved clinical efficacy, and reduced toxicity (see, e.g., U.S. Pat. Nos. 6,191,105, 7,063,860, 7,070,802, 7,157,099; Constantinides et al., Pharmaceutical Research, 1994, 11, 1385; Ho et al., J. Pharm. Sci., 1996, 85, 138-143). In many cases, microemulsions can form spontaneously when the components of the microemulsion are combined at ambient temperature. This can be particularly advantageous when formulating heat-labile drugs, peptides, or iRNA. Microemulsions are also effective for the efficient delivery of active ingredients in both cosmetic and pharmaceutical applications. It is expected that the microemulsion compositions and formulations of the present invention will promote increased systemic absorption of iRNA and nucleic acids from the gastrointestinal tract and improved local cellular uptake of iRNA and nucleic acids.

[0407] The microemulsions of the present invention may also contain additional components and additives, such as sorbitan monostearate (Grill 3), Labrasol, and penetration enhancers, to improve formulation properties and enhance absorption of the iRNA and nucleic acids of the present invention. The penetration enhancers used in the microemulsions of the present invention can be classified as belonging to one of five broad categories: surfactants, fatty acids, bile salts, chelating agents, and non-chelating non-surfactants (Lee et al., Critical Reviews in Therapeutic Drug Carrier Systems, 1991, p. 92). Each of these classes is discussed above.

[0408] iii. Particulates The RNAi agents of the present invention may be incorporated into particles, such as microparticles. Microparticles can be produced by spray drying, but can also be produced by other methods, including freeze-drying, evaporation, fluid bed drying, vacuum drying, or a combination of these techniques.

[0409] iv. Penetration enhancers In one embodiment, the present invention utilizes various penetration enhancers to efficiently deliver nucleic acids, particularly iRNA, to the skin of animals. Most drugs exist in solution in both ionized and non-ionized forms. However, typically, only lipid-soluble or lipophilic drugs readily cross cell membranes. It has been discovered that even non-lipophilic drugs can cross cell membranes if the membrane to be crossed is treated with a penetration enhancer. In addition to aiding the diffusion of non-lipophilic drugs across cell membranes, penetration enhancers also improve the permeability of lipophilic drugs.

[0410] Penetration enhancers can be classified as belonging to one of five broad categories: surfactants, fatty acids, bile salts, chelating agents, and non-chelating non-surfactants (see, e.g., Malmsten, M., Surfactants and polymers in drug delivery, Informa Health Care, New York, NY, 2002; Lee et al., Critical Reviews in Therapeutic Drug Carrier Systems, 1991, p. 92). Each of the above types of penetration enhancers is described in more detail below.

[0411] Surfactants (or "surface-active agents") are chemicals that, when dissolved in an aqueous solution, reduce the surface tension of the solution or the interfacial tension between the aqueous solution and another liquid, resulting in improved absorption of iRNA through mucosal membranes. In addition to bile salts and fatty acids, these penetration enhancers include, for example, sodium lauryl sulfate, polyoxyethylene-9-lauryl ether, and polyoxyethylene-20-cetyl ether (see, e.g., Malmsten, M., Surfactants and polymers in drug delivery, Informa Health Care, New York, NY, 2002; Lee et al., Critical Reviews in Therapeutic Drug Carrier Systems, 1991, p. 92); and perfluorochemical emulsions such as FC-43 (Takahashi et al., J. Pharm. Pharmacol., 1988, 40, 252).

[0412] Various fatty acids and their derivatives that act as penetration enhancers include, for example, oleic acid, lauric acid, capric acid (n-decanoic acid), myristic acid, palmitic acid, stearic acid, linoleic acid, linolenic acid, dicaprate, tricaprate, monoolein (1-monooleyl-rac-glycerol), dilaurin, caprylic acid, arachidonic acid, glycerol 1-monocaprate, 1-dodecylazacycloheptan-2-one, acylcarnitines, acylcholines, and their C 1~20 Included are alkyl esters (e.g., methyl, isopropyl, and t-butyl), and their monoglycerides and diglycerides (i.e., oleate, laurate, caprate, myristate, palmitate, stearate, linoleate, etc.) (see, for example, Touitou, E., et al. Enhancement in Drug Delivery, CRC Press, Danvers, MA, 2006; Lee et al., Critical Reviews in Therapeutic Drug Carrier Systems, 1991, p. 92; Muranishi, Critical Reviews in Therapeutic Drug Carrier Systems, 1990, 7, 1-33; El Hariri et al., J. Pharm. Pharmacol., 1992, 44, 651-654).

[0413] The physiological role of bile includes facilitating the dispersion and absorption of lipids and fat-soluble vitamins (see, e.g., Malmsten, M. Surfactants and polymers in drug delivery, Informa Health Care, New York, NY, 2002; Brunton, Chapter 38 in: Goodman & Gilman's The Pharmacological Basis of Therapeutics, 9th Ed., Hardman et al. Eds., McGraw-Hill, New York, 1996, pp. 934-935). Various natural bile salts, and their synthetic derivatives, act as penetration enhancers. Thus, the term "bile salt" includes any of the natural components of bile as well as any of their synthetic derivatives.Suitable bile salts include, for example, cholic acid (or its pharmaceutically acceptable sodium salt, sodium cholate), dehydrocholic acid (sodium dehydrocholate), deoxycholic acid (sodium deoxycholate), glucholic acid (sodium glucholate), glycolic acid (sodium glycocholate), glycodeoxycholic acid (sodium glycodeoxycholate), taurocholic acid (sodium taurocholate), taurodeoxycholic acid (sodium taurodeoxycholate), chenodeoxycholic acid (sodium chenodeoxycholate), ursodeoxycholic acid (UDCA), sodium tauro-24,25-dihydro-fusidate (STDHF), sodium glycodihydrofusidate, and polyoxyethylene-9-lauryl ether (POE) (see, e.g., Malmsten, M. Surfactants and polymers in drug delivery, Informa Health Care, New York, NY, 2002; Lee, et al.,Critical Reviews in Therapeutic Drug Carrier Systems,1991,page 92;Swinyard,Chapter 39 In:Remington's Pharmaceutical Sciences,18th Ed.,Gennaro,ed.,Mack Publishing Co.,Easton,Pa.,1990,pages 782-783;Muranishi,Critical Reviews in Therapeutic Drug Carrier Systems, 1990, 7, 1-33; Yamamoto et al., J. Pharm. Exp. Ther., 1992, 263, 25; Yamashita et al., J. Pharm. Sci., 1990, 79, 579-583).

[0414] Chelators used in connection with the present invention can be defined as compounds that remove metal ions from solution by forming complexes with the metal ions, resulting in enhanced absorption of iRNA through mucosal membranes. With regard to the use of chelators as penetration enhancers in the present invention, chelators have the added advantage of also acting as DNase inhibitors, since most characterized DNA nucleases require divalent metal ions for catalysis and are therefore inhibited by chelators (Jarrett, J. Chromatogr., 1993, 618, 315-339). Suitable chelating agents include, but are not limited to, disodium ethylenediaminetetraacetic acid (EDTA), citric acid, salicylates (e.g., sodium salicylate, 5-methoxysalicylate, and homovanilate), N-acyl derivatives of collagen, laureth-9, and N-aminoacyl derivatives (enamines) of β-diketones (see, for example, Katdare, A. et al., Excipient development for pharmaceutical, biotechnology, and drug delivery, CRC Press, Danvers, MA, 2006; Lee et al., Critical Reviews in Therapeutic Drug Carrier Systems, 1991, page 92; Muranishi, Critical Reviews in Therapeutic Drug Carrier Systems, 1990, 7, 1-33; Buur et al., J. Control Rel., 1990, 14, 43-51).

[0415] As used herein, non-chelating, non-surfactant penetration enhancers can be defined as compounds that exhibit minimal activity as chelators or surfactants but nonetheless enhance the absorption of iRNA through the gastrointestinal mucosa (see, e.g., Muranishi, Critical Reviews in Therapeutic Drug Carrier Systems, 1990, 7, 1-33). Examples of penetration enhancers of this type include unsaturated cyclic ureas, 1-alkyl- and 1-alkenylazacycloalkanone derivatives (Lee et al., Critical Reviews in Therapeutic Drug Carrier Systems, 1991, 92); and nonsteroidal anti-inflammatory drugs such as diclofenac sodium, indomethacin, and phenylbutazone (Yamashita et al., J. Pharm. Pharmacol., 1987, 39, 621-626).

[0416] Agents that enhance cellular uptake of iRNA can also be added to pharmaceutical and other compositions of the present invention. For example, cationic lipids such as lipofectin (Junichi et al., U.S. Pat. No. 5,705,188), cationic glycerol derivatives, and polycationic molecules such as polylysine (Lollo et al., PCT Application WO 97 / 30731) are known to enhance cellular uptake of dsRNA. Examples of commercially available transfection reagents include, for example, Lipofectamine™ (Invitrogen; Carlsbad, CA), Lipofectamine 2000™ (Invitrogen; Carlsbad, CA), 293fectin™ (Invitrogen; Carlsbad, CA), Cellfectin™ (Invitrogen; Carlsbad, CA), DMRIE-C™ (Invitrogen; Carlsbad, CA), FreeStyle™ MAX (Invitrogen; Carlsbad, CA), Lipofectamine™ 2000, among others. CD (Invitrogen; Carlsbad, CA), Lipofectamine(TM) (Invitrogen; Carlsbad, CA), RNAiMAX(Invitrogen; Carlsbad, CA), Oligofectamine(TM) (Invitrogen; Carlsbad, CA), Optifect(TM) (Invitrogen; Carlsbad, CA), X-tremeGENE Q2 Transfection Reagent (Roche; Grenzacherstrasse, Switzerland), DOTAP Liposomal Transfection Reagent (Grenzacherstrasse, Switzerland), DOSPER Liposomal Transfection Reagent (Grenzacherstrasse, Switzerland), or Fugene (Grenzacherstrasse, Switzerland), Transfectam® Reagent (Promega;(Madison, WI), TransFast (trademark) Transfection Reagent (Promega; Madison, WI), Tfx (trademark)-20 Reagent (Promega; Madison, WI), Tfx (trademark)-50 Reagent (Promega; Madison, WI), DreamFect (trademark) (OZ Biosciences; Marseille, France), EcoTransfect (OZ Biosciences; Marseille, France), TransPass; aD1 Transfection Reagent (New England Biolabs; Ipswich, MA, USA), LyoVec(TM) / LipoGen(TM) (Invitrogen; San Diego, CA, USA), PerFectin Transfection Reagent (Genlantis; San Diego, CA, USA), NeuroPORTER Transfection Reagent (Genlantis; San Diego, CA, USA), GenePORTER Transfection reagent (Genlantis; San Diego, CA, USA), GenePORTER 2 Transfection reagent (Genlantis; San Diego, CA, USA), Cytofectin Transfection Reagent (Genlantis; San Diego, CA, USA), BaculoPORTER Transfection Reagent (Genlantis; San Diego, CA, USA), TroganPORTER(TM) transfection Reagent (Genlantis; San Examples of suitable fusion proteins include RiboFect (Bioline; Taunton, MA, USA), RiboFect (Bioline; Taunton, MA, USA), PlasFect (Bioline; Taunton, MA, USA), UniFECTOR (B-Bridge International; Mountain View, CA, USA), SureFECTOR (B-Bridge International; Mountain View, CA, USA), and HiFect™ (B-Bridge International, Mountain View, CA, USA).

[0417] Other agents can be used to enhance penetration of the administered nucleic acid, including glycols such as ethylene glycol and propylene glycol, pyrroles such as 2-pyrrole, azone, and terpenes such as limonene and menthone.

[0418] v. Carrier Certain compositions of the present invention also incorporate a carrier compound in the formulation. As used herein, "carrier compound" or "carrier" can refer to a nucleic acid or analog thereof that may be inert (i.e., not possessing biological activity) but is recognized as a nucleic acid by in vivo processes that reduce the bioavailability of biologically active nucleic acids, for example, by degrading the biologically active nucleic acid or promoting its removal from the circulation. Co-administration of a nucleic acid and a carrier compound, typically with an excess of the latter, can substantially reduce the amount of nucleic acid recovered in the liver, kidney, or other extracirculatory reservoir, possibly due to competition between the carrier compound and the nucleic acid for a common receptor. For example, recovery of partial phosphorothioates in liver tissue can be reduced when they are co-administered with polyinosinic acid, dextran sulfate, polycytidic acid, or 4-acetamido-4'isothiocyano-stilbene-2,2'-disulfonic acid (Miyao et al., DsRNA Res. Dev., 1995, 5, 115-121; Takakura et al., DsRNA & Nucl. Acid Drug Dev., 1996, 6, 177-183).

[0419] vi. excipients In contrast to a carrier compound, a "pharmaceutical carrier" or "excipient" is a pharmaceutically acceptable solvent, suspending agent, or any other pharmacologically inert vehicle for delivering one or more nucleic acids to an animal. The excipient can be liquid or solid and is selected to provide the desired bulk, consistency, etc. when combined with the nucleic acid and other desired components of the pharmaceutical composition, taking into account the planned method of administration. Typical pharmaceutical carriers include, but are not limited to, binders (such as pregelatinized maize starch, polyvinylpyrrolidone, or hydroxypropyl methylcellulose); fillers (such as lactose and other sugars, microcrystalline cellulose, pectin, gelatin, calcium sulfate, ethylcellulose, polyacrylates, or calcium hydrogen phosphate); lubricants (such as magnesium stearate, talc, silica, colloidal silicon dioxide, stearic acid, metallic stearates, hydrogenated vegetable oils, maize starch, polyethylene glycol, sodium benzoate, sodium acetate, and the like); tablet disintegrants (such as starch, sodium starch glycolate, and the like); and wetting agents (such as sodium lauryl sulfate, and the like).

[0420] Suitable organic or inorganic excipients that are pharmaceutically acceptable for parenteral administration and do not adversely react with nucleic acids can also be used to formulate the compositions of the present invention. Suitable pharmaceutically acceptable carriers include, but are not limited to, water, saline, alcohol, polyethylene glycol, gelatin, lactose, amylose, magnesium stearate, talc, silicic acid, viscous paraffin, hydroxymethylcellulose, polyvinylpyrrolidone, etc.

[0421] Formulations for topical administration of nucleic acids can include sterile and non-sterile aqueous solutions, non-aqueous solutions, or solutions of nucleic acids in liquid or solid oil bases in common solvents such as alcohol. Solutions can also contain buffers, diluents, and other suitable additives. Suitable organic or inorganic excipients that are pharmaceutically acceptable for parenteral administration and do not adversely react with nucleic acids can be used.

[0422] Suitable pharmaceutically acceptable excipients include, but are not limited to, water, saline, alcohol, polyethylene glycol, gelatin, lactose, amylose, magnesium stearate, talc, silicic acid, viscous paraffin, hydroxymethylcellulose, polyvinylpyrrolidone, and the like.

[0423] vii. Other components The compositions of the present invention may also contain other auxiliary components conventionally found in pharmaceutical compositions, at their art-established usage levels. Thus, for example, the compositions may contain additional, compatible, pharmaceutically active ingredients, such as antipruritics, astringents, local anesthetics, or anti-inflammatory agents, or may contain additional materials useful for physically formulating various dosage forms of the compositions of the present invention, such as dyes, flavorings, preservatives, antioxidants, opacifiers, thickeners, and stabilizers. However, when added, these materials should not unduly interfere with the biological activity of the components of the compositions of the present invention. The formulations may be sterilized and, if desired, mixed with auxiliary substances that do not adversely interact with the nucleic acid of the formulation, such as lubricants, preservatives, stabilizers, wetting agents, emulsifiers, salts for influencing osmotic pressure, buffers, colorants, flavorings, and / or aromatic substances.

[0424] The aqueous suspension may contain substances that increase the viscosity of the suspension, including, for example, sodium carboxymethylcellulose, sorbitol, and / or dextran. The suspension may also contain a stabilizer.

[0425] In some embodiments, pharmaceutical compositions featured in the present invention comprise (a) one or more iRNA compounds and (b) one or more agents that function via a non-RNAi mechanism and are useful for treating bleeding disorders. Examples of such agents include, but are not limited to, anti-inflammatory agents, anti-steatotic agents, antiviral agents, and / or anti-fibrotic agents. Additionally, other substances commonly used to protect the liver, such as silymarin, can also be used with the iRNAs described herein. Other agents useful for treating liver disease include protease inhibitors such as telbivudine, entecavir, and telaprevir, as well as other agents disclosed, for example, in U.S. Patent Application Publications 2005 / 0148548, 2004 / 0167116, and 2003 / 0144217 to Tung et al.; and U.S. Patent Application Publication 2004 / 0127488 to Hale et al.

[0426] The toxicity and therapeutic efficacy of such compounds are discussed, for example, in the LD 50 (lethal dose for 50% of the population) and ED 50 The LD (the dose therapeutically effective in 50% of the population) can be determined by standard pharmaceutical procedures in cell cultures or experimental animals. The dose ratio between toxic and therapeutic effects is the therapeutic index, and the LD 50 / ED 50 Compounds that exhibit high therapeutic indices are preferred.

[0427] The data obtained from cell culture assays and animal studies can be used to formulate a range of dosages for use in humans. The dosages of the compositions featured herein in the present invention are generally administered with little or no toxicity to the ED 50The dosage may vary within this range depending on the dosage form and route of administration employed. For any compound used in the methods featured in the present invention, a therapeutically effective dose can be initially estimated from cell culture assays. A dose can be formulated to achieve a circulating plasma concentration range of the compound, or, if appropriate, the polypeptide product of the target sequence (e.g., achieve a reduction in polypeptide concentration), in an animal model that includes the IC50 (i.e., the concentration of the test compound that achieves a half-maximal inhibition of symptoms) as measured in cell culture. Such information can be used to more accurately determine useful doses in humans. Plasma levels can be measured, for example, by high performance liquid chromatography.

[0428] In addition to those administrations described above, the iRNAs featured in the present invention may be administered in combination with other known agents effective in treating pathological processes mediated by iron overload and that can be treated by inhibiting TMPRSS6 expression. In either case, the administering physician can adjust the amount and time of administration of the iRNA based on the observed results, using standard efficacy measures known in the art or described herein.

[0429] V. Methods for Inhibiting TMPRSS6 Expression The present invention provides a method for inhibiting expression of TMPRSS6 (matriptase-2) in a cell, comprising contacting the cell with an RNAi agent, e.g., a double-stranded RNAi agent, in an amount effective to inhibit expression of TMPRSS6 in the cell, thereby inhibiting expression of TMPRSS6 in the cell.

[0430] The step of contacting a cell with a double-stranded RNAi agent can be carried out in vitro or in vivo. The step of contacting a cell with an RNAi agent in vivo includes contacting a cell or a group of cells in a subject, for example, a human subject, with the RNAi agent. A combination of in vitro and in vivo contacting methods is also possible. The contacting can be carried out directly or indirectly, as described above. Furthermore, the step of contacting a cell can be carried out by a targeting ligand, including any ligand described herein or known in the art. In a preferred embodiment, the targeting ligand is a carbohydrate moiety, for example, a GalNAc3 ligand, or any other ligand that directs the RNAi agent to a target site, for example, the liver of a subject.

[0431] As used herein, the term "inhibit" is used interchangeably with "reduce," "silencing," "downregulate," and other similar terms, and includes any level of inhibition.

[0432] As used herein, the phrase "inhibiting the expression of TMPRSS6" is intended to refer to the inhibition of expression of any TMPRSS6 gene (e.g., mouse TMPRSS6 gene, rat TMPRSS6 gene, monkey TMPRSS6 gene, human TMPRSS6 gene, etc.), as well as variants or mutants of the TMPRSS6 gene. Thus, the TMPRSS6 gene may be a wild-type TMPRSS6 gene, a mutant TMPRSS6 gene, or a transgenic TMPRSS6 gene in the context of a genetically modified cell, cell group, or organism.

[0433] "Inhibiting expression of the TMPRSS6 gene" includes any level of inhibition of the TMPRSS6 gene, for example, at least partial suppression of expression of the TMPRSS6 gene. TMPRSS6 gene expression can be assessed based on the level or change in level of any variable associated with TMPRSS6 gene expression, for example, TMPRSS6 mRNA level, TMPRSS6 protein level, or lipid level. This level can be assessed, for example, in an individual cell or a group of cells, including a sample derived from a subject.

[0434] Inhibition can be assessed by a decrease in the absolute or relative level of one or more variables related to TMPRSS6 expression compared to a control level, which can be any type of control level used in the art, such as a pre-dose baseline level or a level measured from a similar subject, cell, or sample that is untreated or treated with a control (e.g., a buffer-only control or an inactive agent control).

[0435] In certain embodiments of the methods of the present invention, expression of the TMPRSS6 gene is inhibited by at least about 5%, at least about 10%, at least about 15%, at least about 20%, at least about 25%, at least about 30%, at least about 35%, at least about 40%, at least about 45%, at least about 50%, at least about 55%, at least about 60%, at least about 65%, at least about 70%, at least about 75%, at least about 80%, at least about 85%, at least about 90%, at least about 91%, at least about 92%, at least about 93%, at least about 94%, at least about 95%, at least about 96%, at least about 97%, at least about 98%, or at least about 99%.

[0436] Inhibition of expression of the TMPRSS6 gene is manifested by a reduction in the amount of mRNA expressed by a first cell or group of cells (such cells may be present, for example, in a sample derived from a subject) that have been treated so that the TMPRSS6 gene is transcribed and expression of the TMPRSS6 gene is inhibited (e.g., by contacting one or more cells with an RNAi agent of the invention, or by administering an RNAi agent of the invention to a subject in which the cells are or were present), compared to a second cell or group of cells (control cells) that are substantially identical to the first cell or group of cells but have not been so treated. In a preferred embodiment, inhibition is assessed by expressing the level of mRNA in the treated cells as a percentage of the level of mRNA in the control cells using the following formula:

number

[0437] Alternatively, inhibition of TMPRSS6 gene expression can be assessed by, for example, reducing parameters functionally related to TMPRSS6 gene expression, such as TMPRSS6 protein expression, hepcidin gene or protein expression, or tissue or serum iron levels. TMPRSS6 gene silencing can be measured in any cells that express TMPRSS6, either structurally or by genome engineering, and by any assay known in the art. The liver is the primary site of TMPRSS6 expression. Other substantial sites of expression include the kidney and uterus.

[0438] Inhibition of TMPRSS6 protein expression is manifested by a decrease in the level of TMPRSS6 protein expressed by a cell or group of cells (e.g., the level of the protein expressed in a sample derived from a subject). As described above for assessing mRNA suppression, inhibition of the expression level of a protein in a treated cell or group of cells can similarly be expressed as a percentage of the level of the protein in a control cell or group of cells.

[0439] A control cell or group of cells that can be used to evaluate inhibition of TMPRSS6 gene expression includes a cell or group of cells that has not yet been contacted with an RNAi agent of the present invention. For example, the control cell or group of cells is obtained from an individual subject (e.g., a human or animal subject) prior to treatment of the subject with an RNAi agent.

[0440] The level of TMPRSS6 mRNA expressed by a cell or group of cells can be measured using any method known in the art for assessing mRNA expression. In one embodiment, the level of TMPRSS6 expression in a sample is measured by detecting a transcribed polynucleotide, or a portion thereof, such as the mRNA of the TMPRSS6 gene. RNA can be extracted from cells using RNA extraction techniques, including, for example, acid phenol / guanidine isothiocyanate extraction (RNAzol B; Biogenesis), the RNeasy RNA preparation kit (Qiagen), or the PAX gene (PreAnalytix, Switzerland). Exemplary assay formats using ribonucleic acid hybridization include nuclear run-on assays, RT-PCR, RNase protection assays (Melton et al., Nuc. Acids Res. 12:7035), Northern blotting, in situ hybridization, and microarray analysis.

[0441] In one embodiment, the level of TMPRSS6 expression is measured using a nucleic acid probe. As used herein, the term "probe" refers to any molecule capable of selectively binding to a specific TMPRSS6. Probes can be synthesized by those skilled in the art or obtained from appropriate biological preparations. Probes can also be specifically designed to be labeled. Examples of molecules that can be used as probes include, but are not limited to, RNA, DNA, proteins, antibodies, and organic molecules.

[0442] The isolated mRNA can be used in hybridization or amplification assays, including, but not limited to, Southern or Northern analysis, polymerase chain reaction (PCR) analysis, and probe assays. One method for measuring mRNA levels involves contacting the isolated mRNA with a nucleic acid molecule (probe) that can hybridize to TMPRSS6 mRNA. In one embodiment, the mRNA is immobilized on a solid surface and contacted with the probe, for example, by running the isolated mRNA on an agarose gel and transferring the mRNA from the gel to a membrane such as nitrocellulose. In an alternative embodiment, the probe is immobilized on a solid surface and the mRNA is contacted with the probe, for example, in an Affymetrix gene chip array. One skilled in the art can easily adapt known mRNA detection methods for use in measuring TMPRSS6 mRNA levels.

[0443] Alternative methods for measuring the level of TMPRSS6 expression in a sample include, for example, RT-PCR (Mullis, 1987, experimental embodiment described in U.S. Pat. No. 4,683,202), ligase chain reaction (Barany (1991) Proc. Natl. Acad. Sci. USA 88:189-193), self-sustained sequence replication (Guatelli et al. (1990) Proc. Natl. Acad. Sci. USA 87:1874-1878), transcription amplification systems (Kwoh et al. (1989) Proc. Natl. Acad. Sci. USA 86:1173-1177), Q-Beta Replicase (Lizardi et al. (1988) Bio / Technology 6:1197), rolling circle replication (Lizardi et al., U.S. Pat. No. 5,854,033), or any other nucleic acid amplification method, for example, by nucleic acid amplification and / or reverse transcriptase processes of mRNA in a sample (to prepare cDNA), followed by detection of the amplified molecules using techniques well known to those of skill in the art. These detection schemes are particularly useful for detecting nucleic acid molecules when they are present in very low numbers. In certain embodiments of the present invention, the level of TMPRSS6 expression is measured by quantitative fluorescent RT-PCR (i.e., TaqMan™ System).

[0444] The expression level of TMPRSS6 mRNA can be monitored using membrane blots (such as those used in hybridization analyses such as Northern, Southern, and dot), or microwells, sample tubes, gels, beads, or fibers (or any solid support containing bound nucleic acids). See U.S. Patent Nos. 5,770,722, 5,874,219, 5,744,305, 5,677,195, and 5,445,934, which are incorporated herein by reference. Measuring TMPRSS6 expression levels can also involve the use of nucleic acid probes in solution.

[0445] In preferred embodiments, the level of mRNA expression is assessed using branched DNA (bDNA) assays or real-time PCR (qPCR). The use of these methods is described and illustrated in the Examples provided herein.

[0446] The level of TMPRSS6 protein expression can be measured using any method known in the art for measuring protein levels, including, for example, electrophoresis, capillary electrophoresis, high-performance liquid chromatography (HPLC), thin-layer chromatography (TLC), hyperdiffusion chromatography, fluid or gel precipitin reaction, absorbance spectroscopy, colorimetry, spectrophotometric assay, flow cytometry, (simple or double) immunodiffusion, immunoelectrophoresis, Western blotting, radioimmunoassay (RIA), enzyme-linked immunosorbent assay (ELISA), immunofluorescence assay, electrochemiluminescence assay, etc.

[0447] As used herein, the term "sample" includes similar body fluids, cells, or tissues isolated from a subject, as well as collections of body fluids, cells, or tissues present in a subject. Examples of biological fluids include blood, serum and serous fluid, plasma, lymph, urine, cerebrospinal fluid, saliva, ocular fluid, etc. Tissue samples can include samples derived from tissues, organs, or localized regions. For example, samples can be derived from specific organs, parts of organs, or body fluids or cells within those organs. In certain embodiments, samples can be derived from the liver (e.g., the whole liver or specific parts of the liver, or specific types of cells in the liver, e.g., hepatocytes). In preferred embodiments, a "sample derived from a subject" refers to blood or plasma obtained from a subject. In further embodiments, a "sample derived from a subject" refers to liver tissue obtained from a subject.

[0448] In some embodiments of the methods of the present invention, the RNAi agent is administered to a subject so that the RNAi agent is delivered to a specific site within the subject. Inhibition of TMPRSS6 expression can be assessed by measuring the level or change in the level of TMPRSS6 mRNA or TMPRSS6 protein in a sample derived from a body fluid or tissue from a specific site within the subject. In a preferred embodiment, the site is the liver. The site can also be a subsection or subgroup of cells from any one of the above sites. The site can also include cells expressing a specific type of receptor.

[0449] VI. METHODS OF TREATING OR PREVENTING DISEASES ASSOCIATED WITH TMPRSS6 The present invention also provides methods for treating or preventing diseases and conditions that can be regulated by TMPRSS6 gene expression. For example, the compositions described herein can be used to treat diseases associated with iron overload, such as thalassemia (e.g., β-thalassemia or α-thalassemia), primary hemochromatosis, secondary hemochromatosis, severe juvenile hemochromatosis, erythroporphyria, sideroblastic anemia, hemolytic anemia, dyserythroid anemia, or sickle cell anemia. In one embodiment, TMPRSS6 iRNA can be used to treat hemoglobinopathies. The TMPRSS6 iRNA of the present invention can also be used to treat elevated iron levels resulting from other conditions, such as chronic alcoholism.

[0450] In thalassemia, the bone marrow synthesizes insufficient hemoglobin chains; this in turn reduces red blood cell production and causes anemia. Either the alpha or beta chains can be affected, but beta thalassemia is more common. Newborns are normal because their bodies still produce HbF, which lacks the beta chain; during the first few months of life, the bone marrow switches to producing HbA, and symptoms begin to appear.

[0451] β-thalassemia results from mutations in either the non-expressing (β°) or low-expressing (β+) allele of the HBB gene, and β-thalassemia varies in severity depending on the genotype, including β-thalassemia minor / β-thalassemia trait (β / β° or β / β+), β-thalassemia intermedia (β° / β+), and β-thalassemia major (β° / β° or β″β+).

[0452] While thalassemia intermedia (TI) typically exhibits little hemolysis, β-thalassemia major (TM) is typically associated with, for example, substantial hemolysis resulting in anemia and splenomegaly, and markedly ineffective hematopoiesis resulting in bone marrow drive (skeletal changes, osteopenia), increased erythropoietin synthesis, hepatosplenomegaly, hematopoietic drug intake (megaloblastic anemia), and elevated uric acid in the blood. iRNAs of the present invention, e.g., TMPRSS6 iRNA, are typically more suitable for treating iron overload associated with thalassemias such as TI (e.g., for treating individuals with the β° / β+, β / β°, or β / β+ genotypes).

[0453] Symptoms of β-thalassemia also include, for example, iron overload, which can lead to treatment complications, such as endocrine disorders, liver fibrosis, and myocardial fibrosis. Administration of an iRNA agent that targets TMPRSS6 can be effective in treating one or more of these symptoms.

[0454] Alpha-thalassemia results from mutations in either the non-expressing (a°) or low-expressing (a+) alleles of the HBA1 or HBA2 gene, and thalassemia varies in severity depending on the genotype, including thalassemia trait (-α / αα), Hb Bart type and hydrops fetalis (a° / a°), minor a-thalassemia (-- / αα), (-α / -α), and HbH disease (- / -a). The production of fewer a-globin chains results in excess beta chains in adults and excess gamma chains in newborns. Excess beta chains form an unstable tetramer (called four-beta chain hemoglobin H or HbH), which has an abnormal oxygen dissociation curve. Administration of iRNA agents targeting TMPRSS6 can be effective in treating iron overload in subjects with a-thalassemia.

[0455] Symptoms of hemochromatosis include, for example, abdominal pain, joint pain, fatigue, lack of energy, weakness, darkening of the skin (often referred to as "bronzing"), and loss of body hair. Administration of an iRNA agent that targets TMPRSS6 can be effective in treating one or more of these symptoms.

[0456] Other conditions associated with iron overload include liver disease (cirrhosis, cancer), heart attack or heart failure, diabetes, osteoarthritis, osteoporosis, metabolic syndrome, hypothyroidism, hypogonadism, and, in some cases, increased risk of premature death. Iron overload can also promote neurodegenerative diseases such as Alzheimer's disease, early-onset Parkinson's disease, Huntington's disease, epilepsy, and multiple sclerosis. Administration of an iRNA agent targeting TMPRSS6, such as an iRNA listed in Tables 1 or 2, can treat one or more of these conditions or prevent the onset or progression of diseases or disorders exacerbated by increased iron levels.

[0457] The methods of the present invention further relate to the use of iRNA agents or pharmaceutical compositions thereof to treat, e.g., diseases associated with iron overload, in combination with, e.g., known agents and / or known treatments, such as those currently used to treat these diseases. For example, in certain embodiments, iRNA agents targeting TMPRSS6 are administered in combination with, e.g., iron chelators (e.g., deferoxamine), folic acid, blood transfusions, phlebotomy, drugs for treating ulcers, drugs for increasing fetal hemoglobin levels (e.g., hydroxyurea), drugs for controlling infections (e.g., antibiotics and antivirals), drugs for treating thrombotic conditions, or stem cell or bone marrow transplants. Stem cell transplants can use stem cells derived from the umbilical cord of a related person, e.g., a sibling. Exemplary iron chelators include deferoxamine, deferasirox (Exjade), deferiprone, vitamin E, wheat germ extract, tocophersolan, and indicaxanthin.

[0458] The iRNA agent and additional therapeutic agent can be administered in the same composition, e.g., parenterally, or the additional therapeutic agent can be administered as part of a separate composition or by another method described herein. Administration of the iRNA agent and additional therapeutic agent can be simultaneous, or at different times, in any order.

[0459] Administration of the iRNA agent of the present invention can reduce iron levels, reduce ferritin levels, and / or reduce transferrin saturation levels. For example, administration of dsRNA can reduce serum iron levels and / or reduce serum ferritin levels. Transferrin saturation levels can be reduced by 5%, 10%, 15%, 20%, 25%, 30%, 35%, 40%, 45%, 50%, 55%, 60%, 65%, 70%, 75%, 80%, 85% or more. In another embodiment, transferrin saturation levels remain lower for 7 days, 10 days, 20 days, 30 days or more after administration.

[0460] Transferrin saturation levels can be reduced to less than 50%, less than 45%, less than 40%, less than 35%, less than 35%, less than 30%, less than 25%, less than 20%, less than 15%, or even lower. In another embodiment, the lower transferrin saturation levels are maintained for 7 days, 10 days, 20 days, 30 days, or more after administration. Transferrin saturation is a measure of the amount of iron bound to serum transferrin and corresponds to the ratio of serum iron to total iron binding capacity.

[0461] Serum iron levels may be reduced by 20%, 30%, 40%, 50%, 60%, 70%, 80%, 90%, or more, hi another embodiment, serum iron levels remain lower for 7 days, 10 days, 20 days, 30 days, or more after administration.

[0462] Administration of an iRNA agent of the invention preferably results in a reduction in iron levels in the blood, more particularly serum, or in one or more tissues of a mammal. In certain embodiments, iron levels are reduced by at least 10%, 15%, 20%, 25%, 30%, 40%, 50%, 60%, 70%, 80%, 90% or more compared to pre-treatment levels.

[0463] "Reducing" in this context means a statistically significant decrease in such levels, which can be, for example, at least 10%, at least 20%, at least 30%, at least 40% or more, and is preferably reduced to a level considered to be within the normal range for individuals without such disorder.

[0464] Administration of the iRNA agent of the present invention can increase serum hepcidin levels and / or increase hepcidin gene expression. For example, administration of dsRNA can increase serum hepcidin by at least about 10%, 25%, 50%, 100%, 150%, 200%, 250%, 300%, or more. In a further example, administration of dsRNA can increase hepcidin mRNA levels by at least about 1.5-fold, 2-fold, 3-fold, 4-fold, 5-fold, or more.

[0465] The effectiveness of disease treatment or prevention can be assessed, for example, by measuring disease progression, disease remission, symptom severity, pain reduction, quality of life, the dose of drug required to sustain a therapeutic effect, the level of a disease marker, or any other measurable parameter appropriate for the given disease being treated or prevented. It is well within the ability of one of ordinary skill in the art to monitor the effectiveness of treatment or prevention by measuring any one or any combination of such parameters. For example, transferrin saturation or serum ferritin levels can be monitored for the effectiveness of a given treatment regimen.

[0466] Iron level tests are typically performed on a sample of a patient's blood. Iron level tests measure the amount of iron in serum that is carried by the protein transferrin. The TIBC (total iron binding capacity) test measures the amount of iron that blood can carry if transferrin is fully saturated. Because transferrin is produced by the liver, TIBC can be used to monitor liver function and nutrition. The transferrin test is a direct measure of the level of transferrin (also called siderophilin) ​​in the blood. The saturation level of transferrin can be calculated by dividing the serum iron level by the TIBC. The ferritin test measures the level of a protein in the blood that stores iron for later use by the body.

[0467] The iRNA treatments described herein can be used to treat individuals suffering from a TMPRSS6-related disease (e.g., elevated iron levels, as may be indicated by serum iron levels, e.g., greater than 350 μg / dL, greater than 500 μg / dL, greater than 1000 μg / dL, or great...

Claims

1. A double-stranded RNAi agent for inhibiting expression of TMPRSS6 in a cell, comprising a sense strand and an antisense strand forming a double-stranded region, wherein the antisense strand is AGAAUGAACCAGAAGAAGCAGGGU (SEQ ID NO: 187) comprises at least 15 contiguous nucleotides which differ by no more than 3 nucleotides from the nucleotide sequence of each strand is independently 15-30 nucleotides in length; all of the nucleotides of the sense strand and all of the nucleotides of the antisense strand are modified nucleotides; the double-stranded RNAi agent comprises six to eight phosphorothioate internucleotide linkages, and At least one strand is conjugated to an N-acetylgalactosamine (GalNAc) derivative ligand attached to the 3'-terminus, the 5'-terminus, or both termini; Double-stranded RNAi agents.

2. A double-stranded RNAi agent for inhibiting expression of TMPRSS6 in a cell, comprising a sense strand and an antisense strand forming a double-stranded region, wherein the antisense strand is AGAAUGAACCAGAAGAAGCAGGGU (SEQ ID NO: 187) comprises at least 16 contiguous nucleotides which differ by no more than 3 nucleotides from the nucleotide sequence of each strand is independently 15-30 nucleotides in length; all of the nucleotides of the sense strand and all of the nucleotides of the antisense strand are modified nucleotides; the double-stranded RNAi agent comprises six to eight phosphorothioate internucleotide linkages, and At least one strand is conjugated to an N-acetylgalactosamine (GalNAc) derivative ligand attached to the 3'-terminus, the 5'-terminus, or both termini; Double-stranded RNAi agents.

3. A double-stranded RNAi agent for inhibiting expression of TMPRSS6 in a cell, comprising a sense strand and an antisense strand forming a double-stranded region, wherein the antisense strand is AGAAUGAACCAGAAGAAGCAGGGU (SEQ ID NO: 187) comprising at least 17 contiguous nucleotides which differ by no more than 3 nucleotides from the nucleotide sequence of each strand is independently 15-30 nucleotides in length; all of the nucleotides of the sense strand and all of the nucleotides of the antisense strand are modified nucleotides; the double-stranded RNAi agent comprises six to eight phosphorothioate internucleotide linkages, and At least one strand is conjugated to an N-acetylgalactosamine (GalNAc) derivative ligand attached to the 3'-terminus, the 5'-terminus, or both termini; Double-stranded RNAi agents.

4. The double-stranded RNAi agent of claim 1, wherein each strand is independently 17-25 nucleotides in length.

5. The double-stranded RNAi agent of claim 1, wherein each strand is independently 19-25 nucleotides in length.

6. The double-stranded RNAi agent of claim 1, wherein each strand is independently 19-23 nucleotides in length.

7. 2. The double stranded RNAi agent of claim 1, wherein at least one of the modified nucleotides is selected from the group consisting of a 3' terminal deoxy-thymine (dT) nucleotide, a 2'-O-methyl modified nucleotide, a 2'-fluoro modified nucleotide, a 2'-deoxy-modified nucleotide, a locked nucleotide, a non-basic nucleotide, a 2'-amino-modified nucleotide, a 2'-alkyl-modified nucleotide, a morpholino nucleotide, a phosphoramidate, a nucleotide containing a non-natural base, a nucleotide containing a 5'-phosphorothioate group, a nucleotide containing a 5' phosphate or a 5' phosphate mimic, and a terminal nucleotide attached to a cholesteryl derivative or a dodecanoic acid bisdecylamide group.

8. 2. The double-stranded RNAi agent of claim 1, wherein at least one of the modified nucleotides is selected from the group consisting of 2'-O-methyl modified nucleotides, 2'-fluoro modified nucleotides, nucleotides comprising a 5'-phosphorothioate group, abasic nucleotides, and 2'-amino-modified nucleotides.

9. 2. The double-stranded RNAi agent of claim 1, wherein at least one strand comprises an overhang of at least one nucleotide.

10. The double-stranded RNAi agent of claim 1 , wherein at least one of the phosphorothioate internucleotide linkages is at the 3′ end of one strand.

11. 11. The double-stranded RNAi agent of claim 10, wherein the strand is an antisense strand.

12. The double-stranded RNAi agent of claim 10, wherein the strand is a sense strand.

13. The double-stranded RNAi agent of claim 1 , wherein at least one of the phosphorothioate internucleotide linkages is at the 5′ end of one strand.

14. 14. The double-stranded RNAi agent of claim 13, wherein the strand is an antisense strand.

15. The double-stranded RNAi agent of claim 1 , wherein the phosphorothioate internucleotide linkages are at both the 5′ and 3′ ends of one strand.

16. 16. The double-stranded RNAi agent of claim 15, wherein the strand is an antisense strand.

17. A pharmaceutical composition for inhibiting expression of the TMPRSS6 gene, comprising the double-stranded RNAi agent of claim 1.

18. A pharmaceutical composition for inhibiting expression of the TMPRSS6 gene, comprising the double-stranded RNAi agent of claim 2.

19. A pharmaceutical composition for inhibiting expression of the TMPRSS6 gene, comprising the double-stranded RNAi agent according to claim 3.

20. The double-stranded RNAi agent according to any one of claims 1 to 16, or the pharmaceutical composition according to any one of claims 17 to 19, for use in a method for treating a human subject suffering from a disease associated with TMPRSS6.

21. The double-stranded RNAi agent or pharmaceutical composition of claim 20, wherein the human suffers from hereditary hemochromatosis, β-thalassemia, erythroblastic porphyria, a disease associated with iron overload, Parkinson's disease, Alzheimer's disease, or Friedreich's ataxia.

22. The double-stranded RNAi agent or pharmaceutical composition according to claim 20 or 21, wherein the double-stranded RNAi agent or pharmaceutical composition is administered subcutaneously or intravenously.

23. A cell comprising the double-stranded RNAi agent of any one of claims 1 to 16.

24. The double-stranded RNAi agent of claim 1, wherein the N-acetylgalactosamine (GalNAc) derivative ligand is attached via a trivalent branched linker.

25. The N-acetylgalactosamine (GalNAc) derivative ligand of formula (VII): 【Chemistry 1】 [In the formula: q ５Ａ , q ５Ｂ and q ５Ｃ represents independently for each occurrence 0 to 20, and the repeating units may be the same or different; P ５Ａ , P ５Ｂ , P ５Ｃ , T ５Ａ , T ５Ｂ , T ５Ｃ are each independently for each occurrence absent, CO, NH, O, S, OC(O), NHC(O), CH ２ , C.H. ２ NH or CH ２ O; Q ５Ａ , Q ５Ｂ , Q ５Ｃ is independently for each occurrence absent, alkylene, or substituted alkylene, where one or more methylenes are O, S, S(O), SO ２ , C≡C or C(O); R ５Ａ , R ５Ｂ , R ５Ｃ are each independently absent for each occurrence, NH, O, S, CH ２ , C(O)O, C(O)NH, NHCH(R ａ )C(O), -C(O)-CH(R ａ )-NH-, CO, CH=N-O, 【Chemistry 2】 or heterocyclyl; L ５Ａ , L ５Ｂ and L ５Ｃ represents an N-acetylgalactosamine (GalNAc) derivative ligand, and R ａ is H or an amino acid side chain.

25. The double-stranded RNAi agent of claim 24, wherein the RNAi agent is linked via a trivalent branched linker as shown in

Images