A gene therapy expression system to reduce the cardiotoxicity of FKRP

Abstract

The present invention relates to an expression system for systemic administration comprising a sequence encoding the FKRP protein, and either a promoter sequence that enables the expression of FKRP at a therapeutically acceptable level in skeletal muscle and a target sequence of an miRNA expressed in the heart, or a promoter sequence that enables the expression of FKRP at a therapeutically acceptable level in skeletal muscle and exhibits a level of promoter activity that is acceptable in terms of toxicity in the heart, and to the use of this system for the treatment of various diseases associated with FKRP deficiency.

Description

[Technical field]

[0001] The present invention is based on the identification of the cardiotoxicity of FKRP (Fukutin-related protein) transgenic expression.This provides an expression system for alleviating FKRP toxicity in the heart, in particular by regulating, i.e. partially detargeting, the cardiac expression of FKRP.This then provides a useful and safe therapeutic tool for the treatment of various diseases associated with FKRP deficiency, such as limb-girdle muscular dystrophy R9 type (LGMD2 R9) and newly named limb-girdle muscular dystrophy type 2I (LGMD2I). [Background technology]

[0002] "Dystroglycanopathies" regroup various genetic pathologies that cause secondary glycosylation abnormalities of α-dystroglycan (αDG). Predominantly present in skeletal muscle, heart, eye, and brain tissue, this protein is a highly glycosylated membrane protein, and the glycosylation process increases its molecular weight to 70-156 kDa in muscle. It is part of the dystrophin-glycoprotein complex that connects the cytoskeleton to the extracellular matrix (ECM). High levels of glycosylation allow αDG to bind directly to some ECM proteins, such as laminin in heart and skeletal muscle, agrin and perlecan in neuromuscular junctions, neurexins in the brain, and the laminin globular domain of pikachurin in the retina. Glycosylation of αDG is a complex process that is still not fully understood. Indeed, a number of genes have been identified as involved in αDG glycosylation. Such discoveries have been recently accelerated by the use of high-throughput sequencing methods for mutation detection in patients exhibiting defects in αDG glycosylation. One such protein is the fukutin-related protein (FKRP). It was originally classified as a putative αDG glycosyltransferase due to the presence of a DxD motif common to many glycosyltransferases in its sequence and the demonstration of hypoglycosylation of αDG in patients with mutated FKRP genes (Breton et al., 1999; Brockington et al., 2001). Recently, FKRP and its homolog fukutin have been identified as ribitol-5-phosphate (Rbo5P) transferases that form the di-Rbo5P linker required for the addition of the ligand-binding moiety (Kanagawa et al., 2016).

[0003] Mutations in the FKRP gene can result in the full spectrum of pathologies induced by defects in αDG glycosylation, from limb-girdle muscular dystrophy type 2I (LGMD2I; Muller et al., 2005; new name: limb-girdle muscular dystrophy type R9 or LGMD2 R9), congenital muscular dystrophy type 1C (MDC1C; Brockington et al., 2001), to Walker-Warburg syndrome (WWS) and muscle-eye-brain disease (MEB; Beltran-Valero de Bernabe et al., 2004). An inverse correlation exists between the severity of the disease and the number of patients: the more severe the disease, the rarer the patients (prevalence rates shown at www.orphanet.fr: WWS (all genes): 1-9 / 1,000,000 and LGMD2I: 1-9 / 100,000). The type of pathology seems to be at least partially correlated with the nature of the FKRP mutation. In particular, the homozygous L276I mutation, which results in a substitution of isoleucine for leucine in the 276th protein, is always associated with LGMD2I (Mercuri et al., 2003). LGMD2I is an autosomal recessive muscular dystrophy that selectively, but heterogeneously, affects the muscles of the shoulder and pelvic girdle. It is one of the most frequent forms of LGMD2 in Europe, especially due to the high prevalence of the L276I mutation in Northern Europe (Sveen et al., 2006). The severity of the condition is highly heterogeneous. Muscle manifestations appear from birth to the third decade of life and can vary from Duchenne-like disease to a relatively benign course. Also, the heart can be affected, leading to severe cardiac failure and death (Muller et al., 2005). Studies using cardiac magnetic resonance imaging suggest that a very high percentage of LGMD2I patients (60-80%) may present with myocardial dysfunction, e.g., reduced ejection fraction (Wahbi et al., 2008). Interestingly, the severity of cardiac abnormalities does not correlate with skeletal muscle involvement. Based on a cohort of seven patients, Rosales et al. (2011) concluded that although severe dilated cardiomyopathy can occur (one patient), LGMD2I generally results in mild structural and functional cardiac abnormalities.Also, Petri et al. (2015) observed that within patients with LGMD2, LVEF (left ventricular ejection fraction) significantly (p=0.03) declined from 59% (15–72) to 55% (20–61) in patients (n=28) with LGMD2 type I (i.e., a drop of 0.4 percentage points per year) and that an LVEF of ≤50% was associated with increased mortality in this subgroup.

[0004] Gicquel et al. (Hum Mol Genet, March 3, 2017, doi: 10.1093 / hmg / ddx066) L276I We report the creation of a mouse model and evaluate the introduction of the mouse Fkrp gene under the control of the desmin promoter and the polyadenylation (polyA) signal of the beta-hemoglobin (HBB2) gene by recombinant adeno-associated virus (rAAV2 / 9). After intramuscular or intravenous delivery, we observed an improvement in the muscle pathology. These mice obtained strong expression of FKRP at the mRNA as well as protein level, showed restoration of proper glycosylation of αDG and increased laminin binding, resulting in histological and functional recovery of the dystrophy. As reported in WO 2019 / 008157, the efficiency of this construct in muscle can be further improved by using an FKRP coding sequence with a mutation that avoids the complementary transcripts generated from the frameshift start codon. [Prior art documents] [Patent documents]

[0005] [Patent Document 1] International Publication No. 2019 / 008157 [Patent Document 2] International Publication No. 2014 / 167253 [Patent Document 3] International Publication No. 2016 / 138387 [Patent Document 4] International Publication No. 2007 / 000668 [Patent Document 5] (U.S. Patent No. 7,282,199) [Patent Document 6] International Publication No. 2005 / 033321 [Patent Document 7] U.S. Patent No. 6,156,303 [Patent Document 8] International Publication No. 2003 / 042397 [Patent Document 9] International Publication No. 2003 / 123503 [Patent Document 10] International Publication No. 2019 / 193119 [Patent Document 11] PCT / EP2020 / 061380 [Non-patent literature]

[0006] [Non-Patent Document 1] Breton et al., 1999 [Non-Patent Document 2] Brockington et al., 2001 [Non-Patent Document 3] Kanagawa et al., 2016 [Non-Patent Document 4] Muller et al., 2005 [Non-Patent Document 5] Beltran-Valero de Bernabe et al., 2004 [Non-Patent Document 6] www.orphanet.fr [Non-Patent Document 7] Mercuri et al., 2003 [Non-Patent Document 8] Sveen et al., 2006 [Non-Patent Document 9] Wahbi et al., 2008 [Non-Patent Document 10] Rosales et al. (2011) [Non-Patent Document 11] Petri et al. (2015) [Non-Patent Document 12] Gicquel et al. (Hum Mol Genet, March 3, 2017, doi: 10.1093 / hmg / ddx066)

Non-Patent Document 13

Non-Patent Document 14

Non-Patent Document 15

Non-Patent Document 16

Non-Patent Document 17

Non-Patent Document 18

Non-Patent Document 19

Non-Patent Document 20

Non-Patent Document 21

Non-Patent Document 22

Non-Patent Document 23

Non-Patent Document 24

[0007] Thus, FKRP-based gene replacement therapy appears to be a promising treatment for pathologies resulting from FKRP deficiency, however, there remains a need for safe and effective therapies.

[0008] In the context of gene therapy, a safe expression system is defined as one that ensures the production of a therapeutically effective amount of a protein in the target tissue, i.e. the tissue that requires said protein to cure the disorder associated with the deficiency of the native protein, without exhibiting any toxicity, especially in essential and vital organs or tissues.

[0009] For example, with regard to neuromuscular diseases, WO 2014 / 167253 reported that expression systems encoding myotubularin and calpain 3 are cardiotoxic when administered systemically, but that this toxicity can be reduced by introducing into the construct a target sequence for an miRNA expressed in the heart, or by using a promoter sequence that exhibits a level of promoter activity in the heart that is tolerable for toxicity or that has no activity at all. [Means for solving the problem]

[0010] The present invention aims to reduce or cure devastating pathologies associated with fukutin-related protein (FKRP) deficiency, such as limb-girdle muscular dystrophy type 2I (LGMD2I), by providing an expression system that ensures production of therapeutically effective amounts of the protein in target tissues, primarily skeletal tissues, and acceptable amounts of the protein in the heart with acceptable toxicity.

[0011] In fact, the inventors have detected a potential cardiotoxicity of the expression system encoding FKRP, which was not expected until patients with pathologies associated with Fukutin-related protein (FKRP) deficiency, such as Limb-girdle muscular dystrophy type 2I (LGMD2I), frequently also exhibit cardiac abnormalities. Therefore, according to general knowledge, sustained levels of FKRP expression in the heart were considered to be beneficial, particularly in alleviating cardiac symptoms of FKRP-related diseases.

[0012] It should be noted that the document WO2014 / 167253, which provides a list of candidate genes and related pathologies, does not mention FKRP at all.On the other hand, the document WO2016 / 138387 only mentions the putative hepatotoxicity of FKRP and the possibility of using mir122 targeting sequences in expression systems to reduce expression in the liver.Finally, the document WO2019 / 008157 discloses the possibility of adding miRNA targeting sequences to inhibit expression in tissues where expression is undesirable or even toxic, but does not motivate detargeting of the heart.

[0013] definition Unless otherwise defined, all technical and scientific terms used herein have the same meaning as commonly understood by one of ordinary skill in the art. The terminology used herein is for the purpose of describing particular embodiments only and is not intended to be limiting.

[0014] The articles "a" and "an" are used herein to refer to one or to more than one (i.e., to at least one) of the grammatical object of the article. By way of example, "an element" means one element or more than one element.

[0015] As used herein, "about" or "approximately" when referring to a measurable value, e.g., amount, time period, etc., is meant to encompass variations of ±20% or plus or minus 10% from the particular value, more preferably ±5%, even more preferably ±1%, and even more preferably ±0.1%, as such variations are appropriate for performing the disclosed methods.

[0016] Ranges: Throughout this disclosure, various aspects of the invention can be presented in range format. It should be understood that the description in range format is merely for convenience and brevity and should not be construed as an inflexible limitation on the scope of the invention. Thus, the description of a range should be considered to have all subranges specifically disclosed as well as individual numerical values ​​within that range. For example, the description of a range of 1 to 6 should be considered to have specifically disclosed subranges such as 1 to 3, 1 to 4, 1 to 5, 2 to 4, 2 to 6, 3 to 6, etc., as well as individual numerical values ​​within that range, such as 1, 2, 2.7, 3, 4, 5, 5.3, and 6. This applies regardless of the breadth of the range.

[0017] "Isolated" means something that has been changed or removed from the natural state. For example, a nucleic acid or peptide that is naturally present in a living animal is not an "isolate," but the same nucleic acid or peptide that has been partially or completely separated from the coexisting materials of the natural state is an "isolate." An isolated nucleic acid or protein can exist in a substantially purified form, or can exist in a non-native environment, such as, for example, a host cell.

[0018] In the context of the present invention, the following abbreviations for commonly occurring nucleobases are used: "A" refers to adenosine, "C" refers to cytosine, "G" refers to guanosine, "T" refers to thymidine and "U" refers to uridine.

[0019] A "nucleotide sequence encoding an amino acid sequence" includes all nucleotide sequences that are degenerate versions of each other and that encode the same amino acid sequence. Also, the phrase a nucleotide sequence encoding a protein or RNA or cDNA may contain introns to the extent that a nucleotide sequence that encodes a protein may contain introns in some forms.

[0020] "Code" refers to the inherent property of a particular nucleotide sequence in a polynucleotide, e.g., a gene, cDNA, or mRNA, to act as a template for the synthesis of other polymers and macromolecules in biological processes, either with a defined nucleotide sequence (i.e., rRNA, tRNA, and mRNA) or a defined amino acid sequence, and the biological properties resulting therefrom. Thus, a gene codes for a protein when the protein is produced in a cell or other biological system by transcription and translation of the mRNA corresponding to this gene. Both the coding strand, which is the nucleotide sequence identical to the mRNA sequence and usually presented in a sequence listing, and the non-coding strand, which is used as a template for transcription of the gene or cDNA, can code for a protein or other product of this gene or cDNA.

[0021] The term "polynucleotide" as used herein is defined as a chain of nucleotides. Moreover, a nucleic acid is a polymer of nucleotides. Thus, as used herein, nucleic acid and polynucleotide are interchangeable. Those skilled in the art have the general knowledge that a nucleic acid is a polynucleotide and can be hydrolyzed into monomeric "nucleotides". Monomeric nucleotides can be hydrolyzed into nucleosides. As used herein, polynucleotide includes, but is not limited to, any nucleic acid sequence obtained by any means available in the art, including, but not limited to, recombinant means, i.e., cloning of nucleic acid sequences from recombinant libraries or cell genomes using conventional cloning techniques and PCR, etc., and synthetic means.

[0022] As used herein, the terms "peptide", "polypeptide" and "protein" are used interchangeably and refer to a compound consisting of amino acid residues covalently linked by peptide bonds. A protein or peptide must contain at least two amino acids, and there is no limit on the maximum number of amino acids that may make up the sequence of a protein or peptide. A polypeptide includes any peptide or protein that contains two or more amino acids linked together by peptide bonds. As used herein, the term refers to both short chains, also commonly referred to in the art as peptides, oligopeptides and oligomers, for example, and longer chains, commonly referred to in the art as proteins, of which there are many varieties. "Polypeptides" include, for example, biologically active fragments, substantially homologous polypeptides, oligopeptides, homodimers, heterodimers, variants of polypeptides, modified polypeptides, derivatives, analogs, fusion proteins, among others. A polypeptide includes natural peptides, recombinant peptides, synthetic peptides, or combinations thereof.

[0023] Proteins may be "altered", including deletion, insertion, or substitution of amino acid residues resulting in silent mutations and functional equivalents. Deliberate amino acid substitutions may be made on the basis of similarity in polarity, charge, solubility, hydrophobicity, hydrophilicity, and / or amphipathic nature of the residues, so long as biological activity is retained. For example, negatively charged amino acids may include aspartic acid and glutamic acid, positively charged amino acids may include lysine and arginine, and amino acids with uncharged polar head groups with similar hydrophobicity values ​​may include leucine, isoleucine, and valine, glycine and alanine, asparagine and glutamine, serine and threonine, and phenylalanine and tyrosine.

[0024] As used herein, a "variant" refers to an amino acid sequence that is altered by one or more amino acids. A variant may have "conservative" mutations, such as the substitution of a leucine with an isoleucine, where the substituted amino acid has similar structural or chemical properties. A variant may also have "non-conservative" mutations, such as the substitution of a glycine with a tryptophan. Similar minor mutations may also include amino acid deletions or insertions, or both. Guidance in determining amino acid residues that can be substituted, inserted, or deleted without losing biological or immunological activity may be found using computer programs well known in the art.

[0025] "Identical" or "homologous" refers to sequence identity or sequence similarity between two polypeptides or two nucleic acid molecules. If a position in both compared sequences is occupied by the same base or amino acid monomer subunit, for example, if a position in each of the two DNA molecules is occupied by adenine, then the molecules are homologous or identical at this position. The percentage of homology / identity between two sequences is a function of the number of matching positions shared by the two sequences divided by the number of positions compared, multiplied by 100. For example, if 6 out of 10 positions in the two sequences are identical, then the two sequences are 60% identical. Generally, the comparison is performed when the two sequences are aligned to obtain maximum homology / identity.

[0026] A "vector" is a composition of matter that contains an isolated nucleic acid and can be used to deliver the isolated nucleic acid inside a cell. Numerous vectors are known in the art, including, but not limited to, linear polynucleotides, polynucleotides associated with ionic or amphiphilic compounds, plasmids, and viruses. Thus, the term "vector" includes self-replicating plasmids or viruses. The term should also be construed to include non-plasmid and non-viral compounds that facilitate the introduction of nucleic acids into cells, such as polylysine compounds, liposomes, and the like. Examples of viral vectors include, but are not limited to, adenoviral vectors, adeno-associated viral vectors, retroviral vectors, and the like.

[0027] "Expression vector" refers to a vector that contains a recombinant polynucleotide that includes an expression control sequence operably linked to a nucleotide sequence to be expressed. An expression vector contains sufficient cis-acting elements for expression; other elements for expression can be supplied by the host cell or an in vitro expression system. Expression vectors include all such known in the art that incorporate a recombinant polynucleotide, such as cosmids, plasmids (e.g., naked or contained in liposomes) and viruses (e.g., lentiviruses, retroviruses, adenoviruses and adeno-associated viruses).

[0028] The term "promoter" as used herein is defined as a DNA sequence recognized by the transcription machinery of a cell, or introduced transcription machinery, required to initiate specific transcription of a polynucleotide sequence.

[0029] As used herein, the term "promoter / regulatory sequence" refers to a nucleic acid sequence required for expression of a gene product operably linked to the promoter / regulatory sequence. In some cases, this sequence may be a core promoter sequence, and in other cases, this sequence may also include enhancer sequences and other control elements required for expression of the gene product. The promoter / regulatory sequence may be, for example, a sequence that expresses the gene product in a tissue-specific manner.

[0030] A "constitutive" promoter is a nucleotide sequence that, when operably linked to a polynucleotide encoding or specifying a gene product, causes the gene product to be produced in a cell under most or all physiological conditions of the cell.

[0031] An "inducible" promoter is a nucleotide sequence that, when operably linked to a polynucleotide encoding or specifying a gene product, causes the gene product to be substantially produced in a cell only when an inducer corresponding to the promoter is present in the cell.

[0032] A "tissue-specific" promoter is a nucleotide sequence that, when operably linked to a polynucleotide encoded or specified by a gene, causes a gene product to be produced preferentially in a cell when the cell is a cell of the tissue type corresponding to the promoter.

[0033] The term "abnormal," when used in the context of an organism, tissue, cell, or component thereof, refers to an organism, tissue, cell, or component thereof that differs in at least one observable or detectable characteristic (e.g., age, treatment, time of day, etc.) from an organism, tissue, cell, or component thereof that exhibits the "normal" (expected) respective characteristic. A characteristic that is normal or expected for one cell or tissue type may be abnormal for a different cell or tissue type.

[0034] The terms "patient," "subject," "individual," and the like are used interchangeably herein and refer to any animal, or cells thereof, suitable for the methods described herein, whether in vitro or in situ. The subject may be a mammal, such as a human, dog, but also a mouse, rat, or non-human primate. In certain non-limiting embodiments, the patient, subject, or individual is a human.

[0035] A "disease" or "pathological condition" is a state of health in a subject in which the subject is unable to maintain homeostasis and in which the subject's health continues to deteriorate if the disease is not cured. In contrast, a "disorder" in a subject is a state of health in which the subject is able to maintain homeostasis, but in which the subject's health is less favorable than in the absence of the disorder. If left untreated, the disorder does not necessarily result in further deterioration of the subject's health.

[0036] A disease or disorder is "alleviated" or "ameliorated" if the severity of the symptoms of the disease or disorder, the frequency with which the patient experiences such symptoms, or both, is reduced. This also includes halting the progression of the disease or disorder. A disease or disorder is "cured" if the severity of the symptoms of the disease or disorder, the frequency with which the patient experiences such symptoms, or both, are eliminated.

[0037] A "therapeutic" treatment is a treatment administered to a subject who exhibits symptoms of a pathology for the purpose of reducing or eliminating such symptoms. A "prophylactic" treatment is a treatment administered to a subject who does not exhibit symptoms of a pathology or has not yet been diagnosed with a pathology for the purpose of preventing or postponing the onset of such symptoms.

[0038] As used herein, "treating a disease or disorder" means reducing the frequency or severity of at least one sign or symptom of the disease or disorder experienced by a subject. Disease or disorder are used interchangeably herein in the context of treatment.

[0039] An "effective amount" of a compound is an amount of the compound sufficient to produce a beneficial effect in a subject to which the compound is administered. The phrase "therapeutically effective amount" as used herein refers to an amount sufficient or effective to prevent or treat (delay or prevent the onset of, or prevent, inhibit, reduce, or reverse the progression of) a disease or condition, including alleviating the symptoms of such disease. An "effective amount" of a delivery vehicle is an amount sufficient to effectively bind or deliver the compound. DETAILED DESCRIPTION OF THE PREFERRED EMBODIMENTS

[0040] The present invention is based on the inventors' identification that an expression system intended to produce high levels of FKRP protein in skeletal muscle following systemic administration may result in concomitant expression in the heart, which is potentially toxic, making the system unsuitable for therapeutic use.

[0041] In particular, a technical solution to this newly identified problem regarding excessive cardiac leakage as well as skeletal muscle expression of the FKRP transgene is provided in the present invention.

[0042] Thus, in general, the invention provides an expression system comprising a sequence encoding an FKRP protein, - expression of a therapeutically acceptable level of the protein in the target tissue, preferably in the skeletal muscle, and - Expression of the protein at levels that are acceptable for toxicity in all tissues, especially the heart The present invention relates to an expression system that enables the above.

[0043] In the framework of the present invention, an expression system is generally defined as a polynucleotide that allows the production of FKRP in vivo. According to one embodiment, said system comprises a nucleic acid encoding the FKRP protein as well as the control elements required for its expression, at least a promoter. Said expression system may then correspond to an expression cassette. Alternatively, said expression cassette may be harbored by a vector or a plasmid. The expression "expression system" as used herein encompasses all embodiments.

[0044] According to the present invention, the target tissue is defined as a tissue or organ in which a protein should play a therapeutic role, especially when the native gene encoding that protein is defective. According to a particular embodiment of the present invention, the target tissue is named striated skeletal muscle, hereafter referred to as skeletal muscle, i.e. all muscles involved in motor function and the diaphragm. Other potential target tissues are the retina and the brain.

[0045] As mentioned above, the heart may also be affected by various diseases related to FKRP deficiency, and therefore the heart is also a potential target tissue. However, in the framework of this application, we show that FKRP may be cardiac toxic when highly expressed. Therefore, for gene transfer, since cardiac abnormalities may be treated using various strategies, such as beta-blockers, diuretics, or ACE (angiotensin-converting enzyme) inhibitors, the expression system should support FKRP expression in the heart at a toxic level, not at a therapeutically acceptable level.

[0046] As demonstrated in this application, even though FKRP may have a therapeutic role to play in the heart, its expression levels should be tightly controlled, since excessive amounts of this protein in this tissue, particularly amounts that exceed the endogenous amounts, may prove harmful or even fatal and thus toxic.

[0047] Therefore, in the context of the present invention, the heart must be protected from this potential toxicity. According to certain embodiments, the expression system of the present invention ensures FKRP expression at a toxicity-tolerable protein level in the heart.

[0048] Thus, according to a particular aspect, the present invention provides an expression system comprising a sequence encoding an FKRP protein, - expression of a therapeutically acceptable level of the protein in target tissues, including skeletal muscle, and optionally the retina and brain; and - Expression of the protein at levels that are acceptable for toxicity in all tissues, especially the heart The present invention relates to an expression system that enables the above.

[0049] Advantageously, the present invention relates to an expression system for systemic administration comprising a sequence encoding an FKRP protein, - FKRP is expressed in skeletal muscle at a therapeutically acceptable level; - FKRP is expressed in the heart at levels that are acceptable for toxicity; Concerning expression systems.

[0050] According to a first characteristic, the expression system of the invention comprises a sequence encoding an FKRP protein, which corresponds to a transgene. In the context of the present invention, the term "transgene" refers to a sequence, preferably an open reading frame, that is placed in trans using the expression system of the invention.

[0051] According to a particular embodiment, this sequence is an identical or equivalent copy of an endogenous sequence present in the genome of the body into which the expression system is introduced.

[0052] According to another particular embodiment, the endogenous sequence has one or more mutations that make the protein partially or completely non-functional, or even non-existent (lack of expression or activity of endogenous protein), or not properly located in the desired intracellular compartment.In other words, preferably, the expression system of the present invention is intended to be administered to a subject that has a defective copy of the sequence that codes for the protein and has a related pathology.Therefore, in this context, the protein encoded by the sequence carried by the expression system of the present invention can be defined as a protein whose mutation causes a pathology related to FKRP deficiency.

[0053] Thus, more generally, the sequence carried by the expression system of the present invention can be defined as a sequence encoding a protein having therapeutic activity in the context of a pathology associated with FKRP deficiency. The concept of therapeutic activity is defined as follows with respect to the term "therapeutically acceptable level".

[0054] The sequence encoding the FKRP protein, also named ORF for "open reading frame," is a nucleic acid sequence or polynucleotide, which may in particular be single- or double-stranded DNA (deoxyribonucleic acid), RNA (ribonucleic acid) or cDNA (complementary deoxyribonucleic acid).

[0055] Advantageously, said sequence encodes a functional protein, i.e. a protein capable of ensuring its native or essential function, in particular in skeletal muscle, which means that the protein produced using the expression system of the invention is properly expressed, located and active.

[0056] According to a preferred embodiment, said sequence codes for a natural protein, said protein preferably being of human origin. It may also be a derivative or fragment of this protein, provided that the derivative or fragment retains the desired activity. Preferably, the term "derivative" or "fragment" refers to a protein sequence having at least 60%, preferably 70%, even more preferably 80% or even 90%, 95% or 99% identity with the human FKRP sequence. It encompasses, for example, active proteins, which are from another source (such as a non-human mammal) or truncated or even mutated proteins. Thus, in the context of the present invention, the term "protein" is understood as the full-length protein, regardless of its origin, as well as functional derivatives and fragments thereof.

[0057] In a particular embodiment, the disease treated by the expression system according to the invention is caused by a mutation in at least one gene that results in the non-production of FKRP protein or the production of a completely or partially non-functional protein. According to the invention, the expression system serves to produce this protein in an active form and in an amount that at least partially compensates for the absence of the native protein, or another protein that can compensate for the absence of the native protein. Thus, the administration of the expression system allows the improvement or restoration of the normal phenotype in the target tissue, in particular the skeletal muscle, in terms of mobility and respiration.

[0058] The protein of interest, in the context of the present invention, is advantageously FKRP (SEQ ID NO: 5) of human origin, even though it is possible to use, for example, the mouse, rat or dog types (the sequences of which are available in the databases).

[0059] According to a particular embodiment, the FKRP protein is a protein consisting of or comprising the sequence shown in SEQ ID NO: 5 (corresponding to a protein of 495 aa). According to a particular embodiment, FKRP is a protein having the same function as the native human FKRP encoded by SEQ ID NO: 5, in particular the ability to glycosylate alpha-dystroglycan (αDG) and / or at least partially alleviate one or more of the symptoms associated with a defect in FKRP, in particular the LGMD2I phenotype disclosed above. It may be a fragment and / or a derivative thereof. According to one embodiment, said FKRP sequence has 60%, 70%, 80%, 90%, 95% or even 99% or more identity with the sequence of SEQ ID NO: 5.

[0060] Any sequence encoding such a protein, its functional therapeutic derivative or fragment can be incorporated as part of the expression system of the present invention. By way of example, the corresponding nucleotide sequence (cDNA) is the sequence identified as SEQ ID NO:2, SEQ ID NO:3, SEQ ID NO:4, SEQ ID NO:5, SEQ ID NO:6, SEQ ID NO:7 or SEQ ID NO:8 in WO 2019 / 008157.

[0061] According to a particular embodiment, the sequence encoding FKRP comprises or consists of nucleotides 1659 to 3146 of the sequence SEQ ID NO:1, SEQ ID NO:3 or SEQ ID NO:4.

[0062] Mutations in the FKRP gene can give rise to a whole range of pathologies induced by defects in αDG glycosylation, as is known, from limb-girdle muscular dystrophy type 2I (LGMD2I; Muller et al., 2005), congenital muscular dystrophy type 1C (MDC1C; Brockington et al., 2001) to Walker-Warburg syndrome (WWS) and muscle-eye-brain disease (MEB; Beltran-Valero de Bernabe et al., 2004). Thus, gene replacement or transfer strategies, for example trans placement of sequences encoding natural therapeutic FKRPs, can serve to treat said pathologies.

[0063] The present invention refers to FKRPs whose mutations result in disease in one or more target tissues, particularly skeletal muscle, and whose production by expression systems exhibits toxicity in at least one tissue, particularly the heart.

[0064] Advantageously, in accordance with the present invention, the expression system should allow for the expression of therapeutically acceptable levels of FKRP protein in skeletal muscle.

[0065] Moreover, according to another preferred embodiment, this should allow expression of FKRP protein at levels in the heart that are tolerable for toxicity.

[0066] In the context of the present invention, the term "protein expression" may be understood as "protein production". The expression system should therefore allow both transcription and translation of the protein at the levels defined above. Also, correct folding and localization of said protein is important.

[0067] The levels defined in the context of the present invention, ie "therapeutically acceptable" and "toxicly acceptable" levels, relate to the amount of a protein as well as to its activity.

[0068] The amount of protein produced in a given tissue can be evaluated by immunodetection using antibodies against said protein, for example, Western blot or ELISA, or by mass spectrometry. Alternatively, the corresponding messenger RNA can be quantified, for example, by PCR or RT-PCR. This quantification can be carried out for one sample of tissue, or for several samples. Thus, in the case where the target tissue is skeletal muscle, this can be carried out for one muscle type, or for several muscle types (for example, quadriceps, diaphragm, tibialis anterior, triceps, etc.).

[0069] In the context of the present invention, the term "therapeutically acceptable levels" refers to the protein produced by the expression system of the present invention being useful for improving the patient's condition, particularly in terms of quality of life or longevity. Thus, with respect to diseases affecting skeletal muscles, this includes improving the muscle condition of a subject suffering from the disease, or restoring a muscle phenotype similar to that of a healthy subject. As mentioned above, muscle status, which is primarily defined by muscle strength, size, histology, and function, can be assessed by one of the following methods: biopsy, measurement of strength, muscle tone, muscle mass, or muscle mobility, clinical testing, medical imaging, biomarkers, etc.

[0070] Therefore, criteria that can be used to assess therapeutic efficacy with respect to skeletal muscle and that can be evaluated at various time points after treatment include, inter alia: - Increased life expectancy, - Increased muscle strength, - Improved histology, and / or - Improved diaphragm functionality At least one of the following:

[0071] In the context of the present invention, the term "acceptable levels of toxicity" refers to the fact that the protein produced by the expression system of the present invention does not cause significant changes in the tissue, in particular histologically, physiologically and / or functionally. In particular, the expression of the protein may not be lethal. In a particular embodiment, the amount of protein produced in said tissue should not exceed the endogenous level of said protein in this tissue, in particular compared to a healthy subject. Toxicity in a tissue can be assessed histologically, physiologically and functionally.

[0072] In the particular case of the heart, any toxicity of the protein can be assessed by morphology and cardiac function tests, by clinical examination, electrophysiology, imaging, biomarkers, monitoring of life expectancy, or by histological analysis, including detection of fibrosis, and / or cellular infiltrates, and / or inflammation, for example by staining with Sirius Red or hematoxylin (e.g., hematoxylin-eosin-saffron (HES) or hematoxylin-phloxine-saffron (HFS)).

[0073] Advantageously, the level of efficacy and / or toxicity of the expression system according to the invention is evaluated in vivo in an animal, optionally in an animal carrying a defective copy of the gene encoding the protein and thus suffering from the relevant pathology. Preferably, the expression system is administered systemically, for example by intravenous (iv) injection.

[0074] According to the invention, preferably the expression system comprises: - preventing expression or reducing the level of expression of the protein in tissues where expression of the protein is toxic, in particular in the heart; and / or - maintaining expression or increasing expression levels of the protein in target tissues, in particular in skeletal muscle, and optionally in the retina and / or brain; The present invention includes at least one sequence that enables

[0075] According to a particular embodiment, the present invention provides a method for producing a method for treating a pulmonary circulation comprising the steps of: - preventing expression or reducing the expression level of FKRP in the heart, and / or - maintaining or increasing the expression level of FKRP in skeletal muscle; The present invention relates to an expression system comprising at least one sequence.

[0076] In the context of the present invention, the term "prevention of expression" preferably refers to the case where there is no expression even in the absence of the sequence, whereas the term "reduced expression levels" refers to the case where expression is reduced (or decreased) due to the presence of the sequence.

[0077] Similarly, the term "maintained expression" preferably refers to cases where there is a comparable level of expression in the absence of the sequence, while the term "increased expression level" refers to cases where there is an increased level of expression due to the presence of the sequence.

[0078] In the context of the present invention, the desired objectives: - the use of sequences capable of preventing the expression or reducing the expression level of a protein in tissues to which it is toxic, without reducing its expression level in the target tissue; - the use of promoter sequences that are able to ensure high levels of expression in target tissues and low or no expression in tissues where expression of the protein is deemed toxic; - the use of vectors, preferably viral vectors, with suitable tropism, i.e. a higher tropism for the target tissue than for tissues where expression of the protein would be toxic; There are at least three ways to achieve this, which can be combined:

[0079] According to one aspect, the invention provides a sequence encoding an FKRP protein, and - a promoter sequence allowing for therapeutically acceptable levels of expression of FKRP in skeletal muscle and a target sequence of an miRNA expressed in the heart, or - a promoter sequence that allows for therapeutically acceptable levels of expression of FKRP in skeletal muscle and exhibits a toxicologically acceptable level of promoter activity in the heart; The present invention relates to an expression system for systemic administration comprising:

[0080] Advantageously, the expression system of the present invention comprises a promoter sequence, preferably located 5' of the transgene, directing the transcription of the protein-encoding sequence operably linked thereto, preferably ensuring therapeutically acceptable levels of expression of the protein in skeletal muscle.

[0081] This may include promoters that are inducible or constitutive, natural or synthetic (artificial), as well as promoters of any origin, including human, of the same origin as the transgene, or of another origin.

[0082] According to a first embodiment, the promoter sequence corresponds to a non-selective promoter, i.e. a promoter with low tissue specificity, ensuring approximately the same level of expression in different tissues, possibly in skeletal muscle and heart. The cytomegalovirus (CMV), phosphoglycerate kinase 1 (PGK), EF1 or CMV early enhancer / chicken β-actin (CAG) promoters can be cited as examples.

[0083] According to certain embodiments, this refers to a promoter sequence that is suitable for skeletal muscle expression, but can cause expression in other tissues, particularly other muscles, such as the heart. Such promoters are considered to be muscle-specific, but they are not muscle-exclusive. Promoter sequences derived from the desmin promoter, preferably the desmin promoter of sequence SEQ ID NO: 6, the skeletal alpha-actin promoter (ACTA1), the muscle creatine kinase (MCK) promoter or the myosin heavy chain promoter, and their derivatives, such as the CK4 and MHCK7 promoters, or the C5-12 synthetic promoter, can be cited as examples.

[0084] According to a preferred embodiment of the invention, the promoter sequence of the expression system is selected for different promoter activity in different tissues, in this case this sequence serves to increase the expression of the protein in skeletal muscle while preventing expression in tissues where the expression of the protein is toxic, mainly the heart.

[0085] By way of example, when the target tissue is skeletal muscle, the promoter is preferably a muscle-specific promoter. According to another advantageous property, said promoter allows a level of protein expression with acceptable toxicity in the tissue, with low or no promoter activity in the heart. More advantageously, low promoter activity in the heart is preferred.

[0086] According to a particular embodiment, said promoter sequence may correspond to a sequence derived from the promoter of the calpain 3 gene, preferably a sequence of human origin, even more preferably the sequence of SEQ ID NO: 7. Another suitable promoter sequence is the sequence of miRNA206 (miR206), preferably a sequence of human origin, more preferably the sequence of SEQ ID NO: 8. Two such promoters are reported in document WO 2014 / 167253 as being capable of ensuring a therapeutically acceptable level of expression of calpain 3 in skeletal muscle and a toxicologically acceptable level of expression of this protein in the heart.

[0087] Thus, according to a particular embodiment, the present invention relates to an expression system comprising a sequence encoding the FKRP protein placed under the control of a promoter having the sequence of SEQ ID NO: 7 or SEQ ID NO: 8. Also encompassed under the present invention are promoter sequences which are derived from the sequences of SEQ ID NO: 7 and SEQ ID NO: 8 or correspond to fragments thereof, but which have a similar promoter activity, in particular with regard to tissue specificity and, optionally, efficacy.

[0088] Advantageously, any promoter may be used that presents an expression profile as defined above that is very low in the heart but sufficient or very strong in skeletal muscle.

[0089] Candidate promoter sequences may be derived from genes that have been reported to be highly active in skeletal muscle and, optionally, have the desired expression profile, e.g., - the promoter of the gamma-sarcoglycan gene, - the skeletal alpha-actin (ACTA1) promoter or versions derived therefrom, - the muscle hybrid (MH) promoter, as disclosed by Piekarowicz et al. (2017, European Society Of Gene & Cell Therapy conference, Poster P096; HUMAN GENE THERAPY 28:A44 (2017), DOI: 10.1089 / hum.2017.29055. Abstract); - derivatives of muscle creatine kinase promoters, in particular truncated MCK promoters with double (dMCK) or triple (tMCK) tandem MCK enhancers, or the CK6 and CK8 promoters, as disclosed in Hauser et al. (2000, Molecular Therapy, Vol. 2, No 1, pp. 16-24) and Wang et al. (2008, Gene Therapy, Vol. 15, pp. 1489-99); - a promoter containing at least one USE (upstream enhancer) sequence, such as that identified in the troponin I promoter sequence (Corin et al., 1995, Proc. Natl. Acad. Sci., Vol. 92, pp. 6185-89) or a deletion of this 100 bp (ΔUSE; Blain et al., 2010, Human Gene Therapy, Vol. 21, pp. 127-34), optionally in three (x3) or four (x4) copies. Of particular interest are the delta USEx3 (DUSEx3) promoter and the delta USEx4 (DUSEx4) promoter.

[0090] Further mention may be made of the promoters of other genes: Troponin, Myogenic factor 5 (Myf5), Myosin light chain 1 / 3 fast (MLC1 / 3f), Muscle differentiation 1 (MyoD1), Myogenin (Myog), Paired box gene 7 (Pax7), MEF2.

[0091] Also encompassed under the present invention are promoter sequences derived from said sequences or corresponding to fragments thereof, but having similar promoter activity, in particular with regard to tissue specificity and, optionally, efficacy. Preferably, the term "derivative" or "fragment" refers to sequences having at least 60%, preferably 70%, even more preferably 80%, or even 90%, 95% or 99% identity with said sequences. Of particular interest are promoter sequences which allow proper FKRP expression in skeletal muscle and heart, as defined above.

[0092] According to one embodiment, the expression system of the present invention comprises: - a sequence encoding the FKRP protein, and - a promoter sequence that allows for therapeutically acceptable levels of expression of FKRP in skeletal muscle and exhibits toxically acceptable levels of promoter activity or no activity at all in the heart, optionally one of those listed above; Includes.

[0093] If this promoter sequence does not permit expression of FKRP protein at levels that result in acceptable toxicity in all tissues, particularly the heart, it is advantageously combined with a sequence that functions to reduce the expression levels of FKRP protein in those tissues in which expression of the protein is toxic.

[0094] Therefore, the present application reports that the use of the desmin promoter for expressing FKRP leads to cardiotoxicity.In contrast, according to the present invention, the use of a desmin promoter, preferably the desmin promoter of the sequence of SEQ ID NO: 6, which binds to at least one target sequence of miRNA-208a, preferably the target sequence of the sequence of SEQ ID NO: 2, leads to cardiotoxicity. - expression of a therapeutically acceptable level of a protein in skeletal muscle, - Protein expression at levels that tolerate toxicity in the heart Both are possible.

[0095] As already mentioned, said sequences are capable of preventing the expression or reducing the expression levels of the FKRP protein in tissues where the expression of the protein is toxic, in particular in the heart. This effect is particularly evident in - the transcription level of protein-coding sequences, - transcripts resulting from the transcription of sequences encoding proteins (e.g. via their degradation), - Translation of transcripts into proteins This can occur according to a variety of mechanisms.

[0096] Such sequences are preferably, for example, from the following group: - MicroRNAs, - endogenous small interfering RNA or siRNA, - small fragments of transfer RNA (tRNA), - RNA in intergenic regions, - ribosomal RNA (rRNA), - Small nuclear RNA (snRNA), - Nucleolar small RNA (snoRNA), - piwi protein-interacting RNA (piRNA) The target is a small RNA molecule selected from the group consisting of:

[0097] Advantageously, this sequence serves to maintain or even increase the expression level of the FKRP protein in the target tissue, preferably skeletal muscle.

[0098] Preferably, such sequences are selected for their effectiveness in tissues where expression of the protein is toxic. Because the effectiveness of the sequence may vary depending on the tissue, it may be necessary to combine several such sequences selected for their effectiveness in all target tissues where toxicity is found.

[0099] According to a preferred embodiment, this sequence is a target sequence for a microRNA (miRNA). As is known, such judiciously selected sequences are useful for the specific suppression of gene expression in selected tissues.

[0100] Thus, according to a particular embodiment, the expression system of the present invention comprises a target sequence for a microRNA (miRNA) that is expressed or present in tissues in which protein expression is toxic, particularly in the heart. Advantageously, the amount of this miRNA present in the target tissue, preferably in skeletal muscle, is less than the amount present in tissues in which FKRP is toxic, or this miRNA may not even be expressed in the target tissue. According to a particular embodiment, the target miRNA is not expressed in skeletal muscle. According to another particular embodiment, it is specifically or even exclusively expressed in the heart.

[0101] As known to those of skill in the art, in particular, the presence or level of miRNA expression in a given tissue can be assessed by PCR, preferably RT-PCR, or Northern blot.

[0102] Various miRNAs and their target sequences and their tissue specificity are known to those skilled in the art and are described, for example, in the document WO 2007 / 000668.The miRNAs expressed in the heart are, for example, miR-1, miR133a, miR-206, miR-499 and miR-208a.Of particular interest is the miRNA that is exclusively expressed in the heart, for example, miR208a, sequence SEQ ID NO: 21.

[0103] According to a particular embodiment, the expression system of the invention comprises a target sequence of miRNA-208a (miR208a; also referred to as SEQ ID NO: 21). It is therefore shown in the frame of the invention that the use of such a target sequence for FKRP allows the solution of this cardiotoxicity problem. Preferably, this target sequence, which is identical in humans, dogs and mice, has the sequence of SEQ ID NO: 2 of 22 pb. Needless to say, any derived or truncated sequence recognized by miRNA-208a can be incorporated as part of the invention. In particular, sequences that diverge from SEQ ID NO: 2 by one or more nucleotides, for example sequences that have at least 60%, 70%, 80%, 90% or even 95% identity with SEQ ID NO: 2, can be used as long as they are capable of binding to miR208a, i.e. preferably, as long as they are target sequences of miR208a in terms of homology with this seed sequence.

[0104] As already mentioned, the target sequence for microRNA can be used alone or in combination with other sequences, advantageously with target sequences for microRNA, which can be the same or different. Such sequences can be used in tandem or in opposite directions. For FKRP, the use of the target sequence of mir122, which is expressed in the liver, has already been proposed.

[0105] According to a preferred embodiment, in particular the target sequence of miRNA208a, one or more, in particular two or four sequences can be incorporated.Preferably, they are used in tandem, i.e. all in the same direction.If several target sequences are incorporated, they can be separated by DNA spacers of random sequence, in a manner known to those skilled in the art.

[0106] Preferably, in the case of the target sequence of a miRNA, in particular miR208a, it is placed 3' of the protein-coding sequence, more advantageously inserted within the 3'UTR ("untranslated region") region of the expression system. Even more preferably, if the expression system comprises a polyadenylation signal 3' of the cDNA encoding the protein, this sequence is inserted between the stop codon of the open reading frame and the polyadenylation signal.

[0107] In the context of the present invention, it was demonstrated that at least one target sequence of miRNA-208a was configured to obtain levels of FKRP protein with acceptable toxicity, at least in the heart.

[0108] According to one embodiment, the expression system of the present invention comprises: - a sequence encoding the FKRP protein, and - Target sequences of miRNAs expressed in the heart Includes.

[0109] Moreover, it preferably further comprises a promoter sequence directing expression of FKRP, said promoter preferably being a promoter sequence allowing for therapeutically acceptable levels of expression of FKRP in skeletal muscle, such as the desmin promoter, preferably the human desmin promoter (SEQ ID NO: 6).

[0110] According to a particular embodiment, the expression system comprises: - a sequence encoding FKRP placed under the control of a promoter allowing muscle expression, such as the desmin promoter, preferably the human desmin promoter, such as the human desmin promoter of sequence SEQ ID NO: 6, at least one target sequence of a miRNA expressed in the heart, preferably the target sequence of miRNA-208a, preferably the target sequence of SEQ ID NO: 2; Includes.

[0111] According to a particular embodiment, the expression system according to the invention comprises: - nucleotides 146 to 3946 of SEQ ID NO: 3, or - nucleotides 146 to 3974 of SEQ ID NO: 4 It comprises or consists of:

[0112] In another particular form of embodiment, the expression system comprises: a sequence encoding FKRP placed under the control of a promoter, such as a desmin promoter, preferably a human desmin promoter, such as the human desmin promoter of sequence SEQ ID NO: 6, or a calpain 3 promoter, preferably a human calpain 3 promoter, such as the human calpain 3 promoter of sequence SEQ ID NO: 7, or a miRNA206 promoter, preferably a human miRNA206 promoter, such as the human miRNA206 promoter of sequence SEQ ID NO: 8, at least one target sequence of a miRNA expressed in the heart, preferably a target sequence of miRNA-208a, for example the miRNA-208a target sequence of sequence SEQ ID NO: 2, optionally two target sequences, advantageously in tandem; It may include.

[0113] Thus, the various types of sequences detailed above may be combined in the same expression system.

[0114] According to the invention, an expression system or expression cassette comprises the elements necessary for the expression of a transgene present. In addition to sequences, such as those defined above, that ensure and regulate the expression of the transgene, such a system may also comprise: a polyadenylation signal, such as the polyA of SV40 or human hemoglobin, preferably inserted 3' of the coding sequence or 3' of the target sequence of the miRNA; - sequences that stabilize the transcript, for example intron 1 of human hemoglobin, - Enhancer sequence It may contain other sequences such as:

[0115] The expression system according to the invention can be introduced into a cell, tissue or body, in particular in a human. The introduction can be carried out ex vivo or in vivo, for example by transfection or transduction, by methods known to the person skilled in the art. Thus, in another aspect, the invention encompasses a cell or tissue, preferably of human origin, which comprises the expression system of the invention.

[0116] The expression system according to the present invention, in this case the isolated nucleic acid, i.e. in the form of naked DNA, can be administered to a subject.To facilitate the introduction of this nucleic acid into cells, it can be combined with various scientific means, such as colloidal dispersion systems (polymer complexes, nanocapsules, microspheres, beads) or lipid-based systems (oil-in-water emulsions, micelles, liposomes).

[0117] Alternatively, according to another preferred embodiment, the expression system of the present invention comprises a plasmid or vector. Advantageously, such a vector is a viral vector. The viral vectors commonly used in gene therapy of mammals, including humans, are known to those skilled in the art. Such viral vectors are preferably selected from the following list: vectors derived from herpes viruses, baculovirus vectors, lentivirus vectors, retrovirus vectors, adenovirus vectors and adeno-associated virus (AAV) vectors.

[0118] According to a particular embodiment of the invention, the viral vector comprising the expression system is an adeno-associated viral (AAV) vector.

[0119] Adeno-associated virus (AAV) vectors have become powerful gene delivery tools for the treatment of various disorders. AAV vectors have a number of characteristics that make them ideally suited for gene therapy, including lack of pathogenicity, moderate immunogenicity, and the ability to stably and efficiently transduce postmitotic cells and tissues. Expression of a particular gene contained within an AAV vector can be specifically targeted to one or more types of cells by selecting the appropriate combination of AAV serotype, promoter, and delivery method.

[0120] In one embodiment, the coding sequence is contained within an AAV vector. Over 100 naturally occurring AAV serotypes are known. There are many natural variants in the AAV capsid, allowing the identification and use of AAV with properties specifically suited to dystrophic pathologies. AAV viruses may be modified using conventional molecular biology techniques, allowing such particles to be optimized for cell-specific delivery of nucleic acid sequences, minimizing immunogenicity, tuning stability and particle lifetime, efficient degradation, and targeted delivery to the nucleus.

[0121] As mentioned above, the use of AAV vectors is a common method of exogenous delivery of DNA because it is relatively non-toxic, provides efficient gene transfer, and can be easily optimized for specific purposes.Among the serotypes of AAV isolated from humans or non-human primates (NHPs) and well characterized, human serotype 2 is the first AAV developed as a gene transfer vector.Other AAV serotypes currently in use include AAV1, AAV3, AAV4, AAV5, AAV6, AAV7, AAV8, AAV9, AAVrhlO, AAVrhl74, AAV11 and AAV12.In addition, non-naturally modified variants and chimeric AAVs can also be useful.

[0122] Desirable AAV fragments for vector construction include the cap proteins, including vp1, vp2, vp3 and hypervariable regions, the rep proteins, including rep78, rep68, rep52 and rep40, and sequences encoding such proteins. Such fragments can be readily utilized in a variety of vector systems and host cells.

[0123] Such fragments may be used alone, in combination with other AAV serotype sequences or fragments, or in combination with elements derived from other AAV or non-AAV viral sequences. As used herein, artificial AAV serotypes include, but are not limited to, AAVs with capsid proteins that do not occur in nature. Such artificial capsids may be generated by any suitable technique using selected AAV sequences (e.g., fragments of vp1 capsid protein) in combination with heterologous sequences that may be obtained from a selected different AAV serotype, non-contiguous parts of the same AAV serotype, heterologous sequences that may be obtained from a non-AAV viral source, or heterologous sequences that may be obtained from a non-viral source. Artificial AAV serotypes may be, but are not limited to, chimeric AAV capsids, recombinant AAV capsids, or "humanized" AAV capsids. Thus, exemplary AAVs or engineered AAVs include AAV2 / 8 (U.S. Pat. No. 7,282,199), AAV2 / 5 (available from the National Institutes of Health), AAV2 / 9 (WO 2005 / 033321), AAV2 / 6 (U.S. Pat. No. 6,156,303), AAVrh10 (WO 2003 / 042397), AAVrh74 (WO 2003 / 123503), AAV9-rh74 hybrid or AAV9-rh74-P1 hybrid (WO 2019 / 193119), AAV variants disclosed in PCT / EP 2020 / 061380, among others. In one embodiment, the vectors useful in the compositions and methods described herein contain, at a minimum, a sequence encoding the capsid of a selected AAV serotype, e.g., the AAV8 capsid, or a fragment thereof. In another embodiment, a useful vector contains, at a minimum, a sequence encoding the rep protein of a selected AAV serotype, e.g., the AAV8 rep protein, or a fragment thereof. Optionally, such a vector may contain both the AAVcap and rep proteins. In vectors that place both the AAVrep and cap, the AAVrep and AAVcap sequences may both be sequences of one serotype origin, e.g., all of AAV8 origin. Alternatively, a vector may be used in which the rep sequence is derived from a different AAV serotype than the serotype that places the cap sequence.In one embodiment, the rep and cap sequences are expressed from separate sources (e.g., separate vectors, or a host cell and a vector). In another embodiment, such rep sequences are fused in frame to a cap sequence of a different AAV serotype to form a chimeric AAV vector, e.g., AAV2 / 8 (U.S. Patent No. 7,282,199).

[0124] According to one embodiment, the composition comprises AAV of serotype 2, 5, 8 or 9 or AAVrh74. Advantageously, the claimed vector is an AAV8 or AAV9 vector, in particular an AAV2 / 8 or AAV2 / 9 vector. More advantageously, the claimed vector is an AAV9 or AAV2 / 9 vector.

[0125] In the AAV vectors used in the present invention, the AAV genome can be either a single-stranded (ss) nucleic acid or a double-stranded (ds) / self-complementary (sc) nucleic acid molecule.

[0126] Advantageously, the polynucleotide encoding the FKRP protein is inserted between the ITR ("inverted terminal repeat") sequences of the AAV vector. Exemplary ITR sequences correspond to nucleotides 1 to 145 of SEQ ID NO: 1 (5'ITR sequence) and nucleotides 3913 to 4057 of SEQ ID NO: 1 (3'ITR sequence).

[0127] Recombinant viral particles can be obtained by any method known to those skilled in the art, such as co-transfection of 293HEK cells, herpes simplex virus systems, and baculovirus systems. Vector titers are usually expressed as viral genomes per mL (vg / mL).

[0128] In one embodiment, the vector comprises regulatory sequences, in particular promoter sequences, advantageously as described above.

[0129] A non-exhaustive list of other possible regulatory sequences follows. - a sequence for transcript stabilization, such as intron 1 of hemoglobin (HBB2), for example a sequence corresponding to nucleotides 1207 to 1652 of SEQ ID NO: 1. Advantageously, said HBB2 intron is followed by a Kozak consensus sequence (GCCACC) before the AUG start codon in the mRNA, as shown in the sequence of SEQ ID NO: 1, to improve translation initiation. Advantageously, a polyadenylation signal 3' of the sequence coding for human FKRP, such as poly A of the gene of interest, SV40 or poly A of beta-hemoglobin (HBB2). As a preferred example, poly A of HBB2 corresponds to nucleotides 3147 to 3912 of SEQ ID NO: 1. - Enhancer sequences. - a miRNA target sequence capable of inhibiting the expression of the sequence encoding human FKRP in non-target tissues, where said expression is undesirable and may be, for example, toxic. An example may be the miR122 target sequence to avoid liver toxicity. Preferably, the corresponding miRNA is not present in skeletal muscle.

[0130] With respect to a polynucleotide encoding the sequence of SEQ ID NO:5, which corresponds, for example, to nucleotides 1659 to 3146 of SEQ ID NO:1, a vector of the present invention may comprise the sequences shown in SEQ ID NO:1, SEQ ID NO:3 and SEQ ID NO:4, respectively.

[0131] According to a preferred embodiment, the expression system of the present invention comprises a vector with suitable tropism, in this case a tropism for the target tissue, advantageously skeletal muscle, higher than for tissues where the expression of the protein is deemed toxic. Advantageously, the expression system of the present invention comprises a vector with a tropism for skeletal muscle higher than for the heart. This may be an AAV vector with a capsid selected for minimal or non-cardiac targeting / transduction, or selective or even exclusive skeletal muscle targeting / transduction.

[0132] A further aspect of the present invention is - a cell comprising an expression system of the invention as disclosed above, or a vector comprising said expression system Regarding.

[0133] The cell can be any cell type, i.e., prokaryotic or eukaryotic. The cell can be used for propagation of the vector or can be further introduced (e.g., transplanted) into a host or subject. The expression system or vector can be introduced into the cell by any means known in the art, such as transformation, electroporation or transfection. Vesicles derived from the cell can also be used.

[0134] - a transgenic animal, advantageously non-human, comprising an expression system of the invention, a vector comprising said expression system, or a cell comprising said expression system or said vector, as disclosed above.

[0135] Another aspect of the invention relates to a composition for use as a medicament, comprising an expression system, a vector or a cell as disclosed above.

[0136] According to embodiments, the composition comprises at least said gene therapy agent (expression system, vector or cell) and, optionally, other active molecules (other gene therapy agents, chemical molecules, peptides, proteins, etc.) intended for the treatment of the same or a different disease.

[0137] According to a particular embodiment, the use of the expression system according to the invention is combined with the use of an anti-inflammatory drug or ribitol.

[0138] The present invention then provides a pharmaceutical composition comprising the expression system, vector or cell of the present invention. Such a composition comprises a therapeutically effective amount of a therapeutic agent (the expression system or vector or cell of the present invention) and a pharmaceutically acceptable carrier. In certain embodiments, the term "pharmaceutically acceptable" means approved by a federal or state regulatory agency for use in animals and humans, or listed in the United States or European Pharmacopoeia or other generally recognized pharmacopoeias. The term "carrier" refers to a diluent, adjuvant, excipient, or vehicle with which a therapeutic agent is administered. Such pharmaceutical carriers may be sterile liquids, such as water and oils, including those of petroleum, animal, vegetable, or synthetic origin, such as peanut oil, soybean oil, mineral oil, sesame oil, and the like. When the pharmaceutical composition is administered intravenously, water is a preferred carrier. Saline solutions and aqueous dextrose and glycerin solutions can also be utilized as liquid carriers, particularly for injectable solutions. Suitable pharmaceutical excipients include starch, glucose, lactose, sucrose, sodium stearate, glyceryl monostearate, talc, sodium chloride, dried skim milk, glycerin, propylene glycol, water, ethanol, and the like.

[0139] The composition may also contain minor amounts of wetting or emulsifying agents, or pH buffering agents, if necessary. Such compositions may take the form of solutions, suspensions, emulsions, sustained release formulations, and the like. Examples of suitable pharmaceutical carriers are described in "Remington's Pharmaceutical Sciences" by EW Martin. Such compositions contain a therapeutically effective amount of the therapeutic agent, preferably in purified form, together with a suitable amount of carrier, providing the form for proper administration to the subject.

[0140] In a preferred embodiment, the composition is formulated according to routine procedures when the pharmaceutical composition is configured for intravenous administration to humans.Typically, the composition for intravenous administration is a solution in sterile isotonic aqueous buffer.Also, if necessary, the composition contains a solubilizing agent and a local anesthetic, such as lidocaine, to ease the pain at the injection site.

[0141] In one embodiment, the composition according to the invention is suitable for administration in humans. The composition is preferably in liquid form, advantageously a saline composition, more advantageously a phosphate buffered saline (PBS) composition or Ringer's lactate solution.

[0142] The amount of the therapeutic agent (e.g., expression system or vector or cell) of the present invention that is effective in treating a target disease can be determined by standard clinical techniques. In addition, in vivo and / or in vitro assays can be optionally used to help predict optimal dosage ranges. The exact dose to be used in the formulation also depends on the route of administration, body weight, and severity of the disease, and should be determined according to the physician's judgment and each patient's circumstances.

[0143] Suitable administration should allow delivery of a therapeutically effective amount of the gene therapy formulation to the target tissue, particularly skeletal muscle, and optionally the heart. In the context of the present invention, when the gene therapy formulation is a viral vector containing a polynucleotide encoding human FKRP, the dose of the therapeutic agent is defined as the amount of viral particles (vg representing the viral genome) containing the FKRP sequence administered per kilogram (kg) of subject.

[0144] Available routes of administration are topical, enteral (acting throughout the system but delivered via the gastrointestinal (GI) tract) or parenteral (acting systemically but delivered by a route other than the GI tract). A preferred route of administration for the compositions disclosed herein is the parenteral route, including intramuscular (i.e., into the muscle) and systemic (i.e., into the circulatory system). In this context, the term "injection" (or "perfusion" or "infusion") includes intravascular, particularly intravenous (IV), intramuscular (IM), intraocular, intrathecal, or intracerebral administration. Injections are typically performed using a syringe or catheter.

[0145] In one embodiment, systemic delivery of the composition involves administration of the composition to a vein or artery near the local treatment site, i.e., near the weakened muscle. In a particular embodiment, the invention involves local delivery of the composition, resulting in a systemic effect. This route of administration, commonly referred to as "regional (locoregional) infusion," "administration by isolated limb perfusion," or "high pressure intravenous limb perfusion," has been successfully used as a method of gene therapy in muscular dystrophies.

[0146] In one embodiment, the composition is administered to an isolated limb (locally) by injection or perfusion. In other words, the present invention includes regional delivery of the composition in the leg and / or arm by intravascular administration routes, i.e., vein (intravenous) or artery, under pressure. This is usually achieved by temporarily arresting blood circulation, using a tourniquet, while allowing regional diffusion of the injected formulation, as disclosed, for example, in Toromanoff et al. (2008).

[0147] In one embodiment, the composition is injected into the limb of the subject. If the subject is a human, the limb can be an arm or a leg. According to one embodiment, the composition is administered to the lower part of the subject's body, for example below the knee, or to the upper part of the subject's body, for example the forearm.

[0148] A preferred method of administration according to the present invention is systemic administration, which opens the way to systemic injection to reach all of the muscles of the subject's body, including the heart and diaphragm, and then to the substantial treatment of such systemic and still incurable diseases. In certain embodiments, systemic delivery includes delivery of the composition to the subject such that the composition can reach the entire body of the subject.

[0149] According to a preferred embodiment, systemic administration occurs by injection of the composition in a blood vessel, i.e., intravascular (intravenous or intraarterial) administration. According to one embodiment, the composition is administered by intravenous injection through a peripheral vein.

[0150] Systemic administration is typically performed under the following conditions. - a flow rate between 1 and 10 mL / min, advantageously between 1 and 5 mL / min, for example 3 mL / min. - The total injection volume may vary between 1 and 20 mL, preferably 5 mL of vector formulation per kg of subject. The injection volume should not be more than 10% of the total blood volume, preferably around 6%.

[0151] When delivered systemically, the composition is preferably administered in a dose of 10 15 vg / kg or even 10 14 vg / kg or less, advantageously 10 10 , 10 11 or even 10 12 The dose is 5.10 vg / kg or more. 12 vg / kg~10 14 Between vg / kg, e.g., 1, 2, 3, 4, 5, 6, 7, 8 or 9.10 13 vg / kg. Also, for example, 1, 2, 3, 4, 5, 6, 7, 8 or 9.10 12 A low dose of vg / kg can be considered to avoid potential toxicity and / or immune reactions. As known to those skilled in the art, it is preferable to use the lowest possible dose to provide satisfactory results in terms of efficacy.

[0152] In certain embodiments, the treatment comprises a single administration of the composition.

[0153] "Dystroglycanopathy" refers to a disease or condition associated with abnormal glycosylation of alpha-dystroglycan (alphaDG). The defect may be due to a defect in FKRP. According to a particular embodiment, the condition is selected in the group consisting of limb-girdle muscular dystrophy type 2I or R9 (LGMD2I or LGMD2 R9), congenital muscular dystrophy type 1C (MDC1C), Walker-Warburg syndrome (WWS) and muscle-eye-brain disease (MEB), preferably LGMD2I.

[0154] The subjects who can benefit from the compositions of the present invention include all patients who have been diagnosed with such diseases or who have the risk of developing such diseases.Subsequently, the subjects to be treated can be selected based on the identification of mutations or deletions in FKRP gene by any method known to those skilled in the art, including, for example, sequencing of FKRP gene, and / or by evaluating FKRP level of expression or activity by any method known to those skilled in the art.Therefore, said subjects include both subjects who have already shown symptoms of such diseases and subjects who have the risk of developing said diseases.In one embodiment, said subjects include subjects who have already shown symptoms of such diseases.In another embodiment, said subjects are outpatients and early non-ambulatory patients.

[0155] Such compositions are intended inter alia for gene therapy, in particular for the treatment of limb-girdle muscular dystrophy type 2I (LGMD2I), congenital muscular dystrophy type 1C (MDC1C), Walker-Warburg syndrome (WWS) and muscle-eye-brain disease (MEB), advantageously for LGMD2I.

[0156] According to one embodiment, the present invention relates to a method for treating dystroglycanopathy comprising the administration to a subject of a gene therapy formulation (expression system, vector or cells) as disclosed above.

[0157] Advantageously, the dystroglycanopathy is a condition associated with defective glycosylation of α-dystroglycan (αDG) and / or FKRP deficiency, more advantageously, the condition is limb-girdle muscular dystrophy type 2I (LGMD2I), congenital muscular dystrophy type 1C (MDC1C), Walker-Warburg syndrome (WWS) or muscle-eye-brain disease (MEB).

[0158] In a further aspect, the present invention provides a method for increasing glycosylation of alpha-dystroglycan (alpha-DG) in a cell, comprising the step of delivering an expression system or vector of the present invention to the cell, wherein an FKRP polynucleotide is expressed in the cell, thereby producing FKRP and increasing glycosylation of alpha-DG.

[0159] Advantageously, the expression system is administered systemically to the body, in particular to an animal, advantageously a mammal, more preferably a human.

[0160] The practice of the present invention utilizes, unless otherwise indicated, conventional techniques of molecular biology (including recombinant technology), microbiology, cell biology, biochemistry, and immunology, which are well within the scope of the art. Such techniques are fully described in such publications as "Molecular Cloning: A Laboratory Manual", 4th Edition (Sambrook, 2012); "Oligonucleotide Synthesis" (Gait, 1984); "Culture of Animal Cells" (Freshney, 2010); "Methods in Enzymology" and "Handbook of Experimental Immunology" (Weir, 1997); "Gene Transfer Vectors for Mammalian Cells" (Miller and Calos, 1987); "Short Protocols in Molecular Biology" (Ausubel, 2002); "Polymerase Chain Reaction: Principles, Applications and Troubleshooting" (Babar, 2011); "Current Protocols in Immunology" (Coligan, 2002). Such techniques are applicable to the production of the polynucleotides and polypeptides of the invention and therefore may be considered in making and practicing the invention. Techniques that are particularly useful for particular embodiments are discussed in the following sections.

[0161] The disclosures of any and all patents, patent applications, and publications cited herein are hereby incorporated by reference in their entirety.

[0162] Without further description, it is believed that one of ordinary skill in the art can, using the preceding description and the following illustrative examples, make and utilize the compounds of the present invention and practice the claimed methods.

[0163] The present invention will now be further described in detail by reference to the following experimental examples and the accompanying drawings, in which such examples are provided for purposes of illustration only and are not intended to be limiting.

[0164] In this application, the invention is exemplified with respect to an AAV9 vector comprising a sequence encoding FKRP placed under the control of the desmin promoter and one or two miR208a targeting sequences. [Brief description of the drawings]

[0165] [Figure 1] Diagram of the vector constructs: A / FKRP expression cassette lacking the target sequence of miRNA-208a (AAV-FKRP); B / FKRP expression cassette containing one (AAV-FKRP single) or two (AAV-FKRP tandem) miRNA-208a target sequences (arrows) at the 3' end of the FKRP gene. [Diagram 2] Transverse sections of hearts from rats administered AAV-FKRP vectors intravenously: histological analysis of the myocardium and HES staining (top, scale=50 μm) or Sirius Red staining (bottom) 15 days after AAV-FKRP injection at the three indicated doses (1e12vg / kg; 5e12vg / kg; 7.5e13vg / kg). [Diagram 3] Transverse sections of hearts from mice administered AAV-FKRP vectors intravenously: histological analysis of the myocardium and HPS staining (top, scale=200 μm) or Sirius Red staining (bottom) 6 weeks after AAV-FKRP injection at a dose of 1e14 vg / kg. [Figure 4] 1 is a graph showing the weight curves of rats injected with either PBS (buffer), AAV-FKRP, AAV-FKRP single or AAV-FKRP tandem. [Diagram 5]1 is a graph showing vector copy number per nucleus (VCN) of AAV-FKRP, AAV-FKRP single, and AAV-FKRP tandem in the TA (tibialis anterior) muscle of rats two weeks after injection. [Figure 6] 1 shows the assessment of FKRP mRNA (A) or protein (B) in rat hearts 2 weeks after injection of PBS (buffer), AAV-FKRP, AAV-FKRP single or AAV-FKRP tandem. Asterisks (*) indicate statistical differences. [Figure 7] FIG. 14 shows histological analysis of rat myocardium and HES staining (top, scale=50 μm) or Sirius Red staining (bottom) 15 days after injection of AAV-FKRP, AAV-FKRP single or AAV-FKRP tandem (as indicated) at a dose of 7.5e13 vg / kg. [Figure 8] FIG. 1 shows the assessment of FKRP mRNA (A) or protein (B) in TA muscle of rats 2 weeks after injection of PBS (buffer), AAV-FKRP, AAV-FKRP single or AAV-FKRP tandem. [Figure 9] 1 is a graph showing the weight curves of rats injected with either AAV-FKRP single or AAV-FKRP tandem. [Figure 10] FIG. 1 shows histological analysis of rat myocardium and HES staining (top, scale=50 μm) or Sirius Red staining (bottom) 11 weeks after injection of AAV-FKRP single and AAV-FKRP tandem at a dose of 7.5e13 vg / kg. EXAMPLES

[0166] Materials and Methods 1) Generation of recombinant AAV vectors: The cassette contained in the vector AAV-FKRP (SEQ ID NO: 1; see FIG. 1A) corresponds to nucleotides 496 to 4550 of the sequence of SEQ ID NO: 11, as disclosed in WO 2019 / 008157. 22 pb of target sequences of miRNA-208a (SEQ ID NO: 2) (one or two of each sequence), each separated by a DNA spacer, are added to the 3'UTR region of FKRP cDNA. The corresponding cassettes (FIG. 1B) have the sequences of SEQ ID NO: 3 and SEQ ID NO: 4, respectively, resulting in the AAV-FKRP single and AAV-FKRP tandem vectors, respectively.

[0167] In particular, the expression cassette of SEQ ID NO:1 comprises - a 5'ITR sequence corresponding to nucleotides 1 to 145 of SEQ ID NO: 1, followed by the human desmin promoter (SEQ ID NO: 6), corresponding to nucleotides 146 to 1206 of SEQ ID NO: 1, followed by - a Kozak consensus sequence (GCCACC) inserted after the HBB2 intron corresponding to nucleotides 1207 to 1652 of SEQ ID NO: 1, immediately preceding the following sequence: a polynucleotide encoding human FKRP corresponding to nucleotides 1659 to 3146 of SEQ ID NO:1 (SEQ ID NO:5), followed by - the HBB2 polyA sequence corresponding to nucleotides 3147 to 3912 of SEQ ID NO: 1, followed by - the 3'ITR sequence corresponding to nucleotides 3913 to 4057 of SEQ ID NO:1 Includes.

[0168] In particular, the expression cassette of SEQ ID NO:3 comprises - a 5'ITR sequence corresponding to nucleotides 1 to 145 of SEQ ID NO:3, followed by the human desmin promoter (SEQ ID NO: 6), corresponding to nucleotides 146 to 1206 of SEQ ID NO: 3, followed by - a Kozak consensus sequence (GCCACC) inserted after the HBB2 intron corresponding to nucleotides 1207 to 1652 of SEQ ID NO:3, immediately preceding the following sequence: a polynucleotide encoding human FKRP (SEQ ID NO:5) corresponding to nucleotides 1659 to 3146 of SEQ ID NO:3, followed by - the miR208a target sequence (SEQ ID NO: 2), corresponding to nucleotides 3153 to 3174 of SEQ ID NO: 3, followed by - the HBB2 polyA sequence corresponding to nucleotides 3181 to 3946 of SEQ ID NO:3, followed by - the 3'ITR sequence corresponding to nucleotides 3947 to 4091 of SEQ ID NO:3 Includes.

[0169] In particular, the expression cassette of SEQ ID NO: 4 comprises - a 5'ITR sequence corresponding to nucleotides 1 to 145 of SEQ ID NO: 4, followed by the human desmin promoter (SEQ ID NO: 6), corresponding to nucleotides 146 to 1206 of SEQ ID NO: 4, followed by - a Kozak consensus sequence (GCCACC) inserted after the HBB2 intron corresponding to nucleotides 1207 to 1652 of SEQ ID NO: 4, immediately preceding the following sequence: a polynucleotide encoding human FKRP (SEQ ID NO:5) corresponding to nucleotides 1659 to 3146 of SEQ ID NO:4, followed by - two miR208a target sequences (SEQ ID NO: 2) in tandem, corresponding to nucleotides 3153 to 3174 and nucleotides 3181 to 3202 of SEQ ID NO: 4, followed by - the HBB2 polyA sequence corresponding to nucleotides 3209 to 3974 of SEQ ID NO: 4, followed by - the 3'ITR sequence corresponding to nucleotides 3975 to 4119 of SEQ ID NO: 4 Includes.

[0170] Adenovirus-free rAAV2 / 9 viral preparations were generated by packaging the AAV2-ITR recombinant genome into AAV9 capsids using a three-plasmid transfection protocol as previously described (Bartoli et al., 2006). Briefly, HEK293 cells were co-transfected with pAAV-hDesmin-hFKRP, RepCap plasmid (pAAV2.9, Dr J. Wilson, UPenn) and adenovirus helper plasmid (pXX6; Apparailly et al., 2005) in a 1:1:2 ratio. Crude viral lysates were harvested 60 hours after transfection and lysed by freeze and thaw cycles. Viral lysates were purified by two rounds of CsCl ultracentrifugation and then dialyzed. Viral genomes were quantified by TaqMan real-time PCR assay using primers and probes specific for the FKRP coding sequence contained in the AAV vector genome. The primer pairs and TaqMan probes used for amplification were: FKRPopt forward: GCCCTTCTACCCCAGGAATG (SEQ ID NO: 9) FKRPopt reverse: AAACTTCAGCTCCAGGAACCTC (SEQ ID NO: 10); and FKRPt probe: TGCCCTTTGCTGGCTTTGTGGCCCAGGC (SEQ ID NO: 11) Vector titers are expressed in units of viral genomes per ml (vg / ml).

[0171] 2) In vivo experiments: Rats and mice were treated in accordance with French and European legislation on animal testing. Male Sprague-Dawley rats aged 10–12 weeks and male FKRP-deficient mice aged 4 weeks (Gicquel et al., P094, Conference European Society Of Gene & Cell Therapy 2017, doi: 10.1089 / hum.2017.29055. Abstract) were used in this study.

[0172] Recombinant vectors at the indicated doses were injected into the tail vein of rats and mice as indicated. An equal volume of buffered saline (PBS) was administered as a control. The clinical condition and weight of the animals were monitored regularly. The animals were sacrificed at the indicated times (rats at 2 or 11 weeks; mice at 6 weeks).

[0173] 3) Western Blot: Heart and muscle tissues were mechanically homogenized in RIPA lysis buffer (Thermo Fisher Scientific, Waltham, MA, USA) supplemented with EDTA-free Complete protease inhibitor cocktail (Roche, Bale, Switzerland). Nucleic acids contained in the samples were degraded by incubation with Benzonase (Sigma, St. Louis, MO, USA) for 15 min at 37°C.

[0174] Proteins were separated using precast polyacrylamide gels (4–15%, BioRad, Hercules, CA, USA) and then transferred to nitrocellulose membranes.

[0175] A rabbit polyclonal antibody against FKRP was previously described (Gicquel et al., 2017). Nitrocellulose membranes were probed for 2 h at room temperature with antibodies against FKRP (1:100) and GAPDH (Santa Cruz Biotechnologies, Dallas, TX, USA, 1:5000) for normalization.

[0176] Finally, the membranes were incubated with IRDye® and detected by an Odyssey infrared scanner (LI-COR Biosciences, Lincoln, NE, USA).

[0177] 4) PCR: Vector copy number (VCN) was quantified in TA muscle by quantitative RT-PCR against the HBB2 polyA sequence contained in the vector genome and normalized using the titin gene (TTN). HBB2pA forward: CTTGACTCCACTCAGTTCTCTTGCT (SEQ ID NO: 12); HBB2pA reverse: CCAGGCGAGGAGAAACCA (SEQ ID NO: 13); and HBB2pA probe: CTCGCCGTAAAACATGGAAGGAACACTTC (SEQ ID NO: 14). TTN forward: GTCCCCTGCGTATCTGCTATG (SEQ ID NO: 15); TTN reverse: CGCTCGTTTTCAATACTACCTCTCT (SEQ ID NO: 16); and TTN probe: TCCGCAGCTCTAGTGGAAGAACCACC (SEQ ID NO: 17).

[0178] FKRP mRNA was extracted from TA muscle and heart using the TriZOL method and then quantified by quantitative RT-PCR using oligonucleotides and probes designed against the codon-optimized FKRP sequence and normalized to expression of the P0 gene. P0 forward: CTCCAAGCAGATGCAGCAGA (SEQ ID NO: 18); P0 reverse: ATAGCCTTGCGCATCATGGT (SEQ ID NO: 19); and P0 probe: CCGTGGTGCTGATGGGCAAGAA (sequence number 20).

[0179] FKRPopt forward (SEQ ID NO: 9), FKRPopt reverse (SEQ ID NO: 10) and FKRPopt probe (SEQ ID NO: 11) are as disclosed above.

[0180] 5) Histological examination: Frozen transverse sections of myocardium (8 μm thick) were stained with hematoxylin-eosin-saffron (HES), Sirius red, or hematoxylin-phloxine-saffron (HFS) using standard protocols.

[0181] Sections were mounted with PERTEX medium (Leica). Digital images were acquired using an Axio Scan Z1 slide scanner (Zeiss).

[0182] result: 1 / FKRP gene transfer induces cardiotoxicity 1-1 / in rats Systemic administration of AAV-FKRP (Figure 1A; encapsulating SEQ ID NO: 1) was performed in five 10- to 12-week-old male Sprague-Dawley rats. e 12, 5 e 12 and 7.5 e Three different doses of 13 vg / kg were administered. Two weeks after injection, rats were euthanized and sampled. Heart slices were stained with both hematoxylin-eosin-saffron (HES) and Sirius red.

[0183] Histological examination of the rat hearts after AAV-FKRP administration showed cardiac injury, with inflammation and fibrosis increasing by 7.5% as shown in FIG. e This was clearly observed in rats 15 days after injection of a dose of 13 vg / kg. Moreover, one rat died under these conditions.

[0184] 1-2 / in mice Because mice are the only mammalian species in which an FKRP-deficient animal model has been developed and therefore the only species in which the therapeutic effects of the expression system can be studied, the potential cardiotoxicity of AAV-FKRP vectors was also investigated in this model.

[0185] Systemic administration of AAV-FKRP was performed in six 4-week-old male FKRP-deficient mice at four doses: e 12, 1.5 e 13, 4.5 e 13 and 1 e Six weeks after injection, mice were euthanized and sampled, and cardiac slices were stained with both hematoxylin-phloxine-saffron (HES) and Sirius red.

[0186] All mice were treated with the highest dose (1 e 14 vg / kg). In contrast (see below), 7.5 e One rat died two weeks after administration of the 13 vg / kg dose, demonstrating that mice are less ill than rats following systemic administration of AAV-FKRP.

[0187] However, histological examination of the mouse hearts after AAV-FKRP administration revealed cardiac damage, with inflammation and fibrosis occurring at 1–3 days after administration, as shown in Figure 3. e Observed in mice 6 weeks after injection of a dose of 14 vg / kg.

[0188] Overall, the data presented reveal a cardiotoxic effect of AAV-FKRP, which was confirmed in two species (rat and mouse) and was entirely unexpected.

[0189] 2 / Reducing FKRP transgene expression in the heart reduces cardiotoxicity without affecting muscle expression As a proof of concept to prevent FKRP cardiotoxicity, one or two copies of the target sequence of a cardiac-specific microRNA, i.e., miR-208a, were introduced into the AAV-FKRP vector. The resulting vectors (Figure 1B) are named AAV-FKRP single (containing one target sequence of miR-208a, harboring SEQ ID NO: 3) and AAV-FKRP tandem (containing two target sequences of miR-208a in the same orientation, harboring SEQ ID NO: 4).

[0190] 2-1 / Short-term (2-week) study in rats This animal model allows us to specifically e Based on previous data, the rat model was chosen for further studies since at the 13 vg / kg dose, cardiotoxicity was rapidly and clearly evident.

[0191] Systemic administration of AAV-FKRP containing 0, 1 or 2 copies of the miR-208a target (SEQ ID NO: 2) was performed at 7.5 eA dose of 13 vg / kg was administered to five 10-12 week old male Sprague-Dawley rats. Two weeks after injection, the rats were euthanized and samples were collected.

[0192] a) Survival and weight monitoring: Survival data are shown in the table below.

[0193] [Table 1]

[0194] The data reveal that only deaths occurred in the cohort that received AAV-FKRP, presumably due to cardiotoxicity of this construct.

[0195] Moreover, FIG. 4 shows that rats injected with AAV-FKRP do not gain weight over time, whereas rats injected with AAV-FKRP single or AAV-FKRP tandem do gain weight.

[0196] As a result, after 2 weeks, rats receiving AAV-FKRP single or AAV-FKRP tandem appear to be more fit than rats receiving AAV-FKRP.

[0197] b) Quantification of vector copy number in TA muscle The data shown in Figure 5, based on quantification of the HBB2 polyA sequence contained in each vector genome and further normalized using the titin gene (TTN), reveals similar levels of infection of skeletal muscle tissue, i.e., TA muscle, with the three vectors.

[0198] Importantly, this confirms that introduction of the miR-208a targeting sequence does not have any negative impact on the efficiency of vector delivery in muscle, where the protein should be produced at therapeutic levels to correct muscle abnormalities associated with FKRP deficiency.

[0199] c) FKRP expression in the heart after gene transfer As shown in Figure 6, a significant reduction in FKRP transgene expression is observed at the mRNA level (A) and protein level (B) with the AAV-FKRP single and AAV-FKRP tandem constructs compared to AAV-FKRP.

[0200] It is noteworthy that there are sufficient miR-208a target sequences to observe such a decrease.

[0201] d) Cardiac damage after gene transfer The data shown in Figure 7 demonstrates a large reduction in cardiac damage with AAV-FKRP single and AAV-FKRP tandem constructs compared to AAV-FKRP, i.e., when FKRP transgene expression is reduced in the heart, i.e., under appropriate microRNA control, the toxic effects are abolished.

[0202] e) FKRP expression in skeletal muscle after gene transfer As shown in Figure 8 for TA muscle, no reduction in FKRP transgene expression was observed at the mRNA level (A) or protein level (B) with the AAV-FKRP single and AAV-FKRP tandem constructs compared to AAV-FKRP.

[0203] This confirms that the use of miR208a allows for specific detargeting of the heart. It is very important that the introduction of miR208a targeting sequence does not have any negative effect on the efficiency of FKRP expression in skeletal muscle, where the protein should be produced at therapeutic levels to cure muscle abnormalities associated with FKRP deficiency.

[0204] 2-2 / Long-term (11-week) study in rats This experiment was performed on rats identical to that reported above, but 11 weeks after injection.

[0205] a) Survival and weight monitoring: Of note, at the time of sacrifice 2 weeks after AAV-FKRP administration, one rat had died, but all had severe cardiac damage. In contrast, all rats injected with AAV-FKRP single or AAV-FKRP tandem survived 11 weeks after administration.

[0206] Moreover, FIG. 9 shows that rats injected with AAV-FKRP single or AAV-FKRP tandem steadily gained weight over time.

[0207] As a result, after 11 weeks, all rats administered AAV-FKRP single or AAV-FKRP tandem appear to be in good condition.

[0208] b) Cardiac defects after gene transfer: Moreover, FIG. 10 confirms that even after 11 weeks, no cardiac damage is observed.

[0209] As a result, AAV-FKRP single and AAV-FKRP tandem vectors do not exhibit any cardiotoxicity.

[0210] [References] TIFF0007651562000002.tif233170TIFF0007651562000003.tif129170

Claims

1. - a promoter sequence enabling expression of FKRP in skeletal muscle; and - at least one target sequence of miR208a expressed in the heart An expression system for systemic administration comprising a sequence encoding an FKRP protein placed under the control of

2. 2. The expression system of claim 1, wherein the FKRP protein has the sequence of SEQ ID NO:

5.

3. 2. The expression system of claim 1, wherein the sequence encoding the FKRP protein comprises or consists of nucleotides 1659 to 3146 of SEQ ID NO:1 or SEQ ID NO:3 or SEQ ID NO:

4.

4. 4. The expression system according to claim 1, wherein the target sequence of miR208a has the sequence of SEQ ID NO:

2.

5. 5. An expression system according to any one of claims 1 to 4, comprising a desmin promoter.

6. An expression system described in claim 5, wherein the desmin promoter has the sequence of SEQ ID NO:

6.

7. 7. The expression system according to claim 6, comprising or consisting of nucleotides 146 to 3946 of SEQ ID NO:3 or nucleotides 146 to 3974 of SEQ ID NO:

4.

8. The expression system of claim 1, comprising a promoter selected from the group consisting of a cytomegalovirus (CMV) promoter, a phosphoglycerate kinase 1 (PGK) promoter, an EF1 promoter, a CMV early enhancer / chicken beta-actin (CAG) promoter, a skeletal alpha-actin (ACTA1) promoter, a muscle creatine kinase (MCK) promoter, a myosin heavy chain promoter, a CK4 promoter, a MHCK7 promoter, a C5-12 synthetic promoter, a gamma-sarcoglycan promoter, a muscle hybrid (MH) promoter, a dMCK promoter, a tMCK promoter, a CK6 promoter, a CK8 promoter, a DUSEx3 promoter, a DUSEx4 promoter, a troponin promoter, a myogenic factor 5 (Myf5) promoter, a myosin light chain 1 / 3 fast (MLC1 / 3f) promoter, a muscle differentiation 1 (MyoD1) promoter, a myogenin (Myog) promoter, a paired box gene 7 (Pax7) promoter, and a MEF2 promoter.

9. The expression system of claim 8, wherein the promoter is selected from the group consisting of dMCK promoter, tMCK promoter, DUSEx3 promoter and DUSEx4 promoter.

10. 10. An expression system according to any one of claims 1 to 9, comprising a viral vector.

11. The expression system described in claim 10, wherein the viral vector is an adeno-associated viral (AAV) vector.

12. An expression system described in claim 11, comprising an AAV vector of serotype 8, an AAV vector of serotype 9, an AAV2 / 8 vector or an AAV2 / 9 vector.

13. A pharmaceutical composition comprising an expression system according to any one of claims 1 to 12.

14. 14. An expression system according to any one of claims 1 to 12, or a pharmaceutical composition according to claim 13, for use in gene therapy.

15. 14. An expression system according to any one of claims 1 to 12 or a pharmaceutical composition according to claim 13 for use in the treatment of a pathology associated with FKRP deficiency or induced by a defect in alpha-dystroglycan (alpha-DG) glycosylation or a dystroglycanopathy.

16. An expression system or pharmaceutical composition for use according to claim 15, wherein the pathology or dystroglycanopathy is selected from the group consisting of limb-girdle muscular dystrophy type 2I (LGMD2I), congenital muscular dystrophy type 1C (MDC1C), Walker-Warburg syndrome (WWS) and muscle-eye-brain disease (MEB).

17. 17. An expression system or pharmaceutical composition for use according to any one of claims 14 to 16, which is administered systemically.

18. An expression system or pharmaceutical composition for use according to claim 17, administered by intravenous injection.

Images