Lassa virus vaccine

Abstract

The present invention relates to a polynucleotide comprising a live, infectious, attenuated flavivirus sequence, in which a nucleotide sequence encoding at least a portion of an arenavirus glycoprotein is arranged in an intergenic region between the E gene and NS1 gene of the flavivirus so as to express a chimeric virus, wherein the encoded sequence at the C-terminus of the flavivirus E protein and the N-terminus of the signal peptide of the flavivirus NS1 protein comprises, in the following order: an additional signal peptide of the flavivirus NS1 protein; an arenavirus glycoprotein lacking the N-terminal signal sequence and GP2 transmembrane domain; and the TM1 and TM2 domains of the flavivirus E protein.

Description

[Technical field]

[0001] The present invention relates to a flavivirus-based chimeric vaccine.Furthermore, the present invention relates to a vaccine against viruses such as Lassa virus. [Background technology]

[0002] Currently, there is no licensed human vaccine approved against Lassa virus (LASV). Many different vaccine candidates have been generated, including several platform technologies. The most advanced candidates are a VSV-based LASV (VSV-LASV-GPC), a Mopeia virus (MOPV) / LASV reassortant virus (clone ML29), and a DNA vaccine called INO-4500 (pLASV-GPC). The VSV-based LASV vaccine candidate is constructed in a replication-competent VSV expressing the glycoproteins of LASV. ML29 is a reassortant between Lassa virus and Mopeia virus that harbors the L segment of MOPV and the S segment (nucleoprotein and glycoprotein) from LASV. INO-4500 is a DNA vaccine encoding the LASV-GPC gene from Josiah strain f, manufactured by Inovio (pLASV-GPC).

[0003] Besides using the various approaches mentioned above, 17D of Yellow Fever virus has also been used as a vector for the glycoprotein (GPC) of Lassa virus or its subunits GP1 and GP2 (Non-Patent Document 1 and Non-Patent Document 2). In these constructs, the GP gene (lacking the signal peptide (SSP)) (or either the GP1 or GP2 sequence) was inserted between YF-E / NS1. These constructs have WNV-E or an artificially designed sequence at the C-terminus of the inserted fusion sequence from YF-E. These constructs need to be transfected into cells, and the virus obtained from the cells is used as a vaccine.

[0004] The only vaccine that has just begun Phase I clinical trials is INO-4500 (pLASV-GPC). This vaccine requires multiple high doses delivered via skin electroporation to achieve full protection and enhance the vaccine immune response. This multiple dose administration regimen is very difficult to accomplish in rural areas of West Africa where LASV is endemic and where the main outbreaks are occurring.

[0005] As for the other candidates, ML29 is classified as risk group 2 by the EU and risk group 3 by the US CDC, which is an obstacle to the further development of this vaccine. VSV-LASV-GPC still requires a cold chain to store it, which entails high costs, and there are no studies on its safety yet. An approach requiring YF17D as a vector to express the Lassa glycoprotein precursor did not perform well in NHP studies (0% survival rate, marmosets).

[0006] Furthermore, this vaccine candidate exhibited problems with genetic instability, making it impossible to scale up the technologies required for vaccine production. [Prior art documents] [Non-patent literature]

[0007] [Non-Patent Document 1] Bredenbeek et al. (2006) Virology 345, 299-304 [Non-Patent Document 2] Jiang et al. (2011) Vaccine 29, 1248-1257 Summary of the Invention

[0008] Using our PLLAV (plasmid-launched live-attenuated vaccine) technology and a live attenuated yellow fever vaccine strain (YFV-17D) as a vector, we engineered a transgenic vaccine by inserting LASV-GPC (with the mutation R246A at the cleavage site to maintain the binding of GP1 and GP2, and with additional mutations R207C, G360C, and E329P) into the yellow fever E / NS1 intergenic region as follows: the N-terminal (Nt) signal peptide was deleted, the first 9 amino acids (27 nucleotides) of NS1 were added to the Nt of LASV-GPC to allow proper release of the LASV-GPC protein, the transmembrane domain was deleted, and the ectodomain was fused to transmembrane domain 1 and transmembrane domain 2 of WNV. The resulting PLLAV-YFV17D-LASV-GPC releases live attenuated virus expressing functional LASV-GPC and YFV-17D proteins. The PLLAV-YFV17D-LASV-GPC construct can be used directly as a vaccine, but this requires that the vaccine is thermostable. The vaccine induces an immune response against both LASV and YFV after a single shot. A second similar construct was made in which the cleavage site was restored (the R246A mutation was restored to R246R) (additional information in the attached data).

[0009] PLLAV-YFV17D-LASV-GPC is a dual vaccine that induces YFV and Lassa virus specific immunity. Not only can PLLAV-YFV17D-LASV-GPC also be used as a stable seed for the production of tissue culture derived live attenuated vaccines in the PLLAV modality, but it is also unexpected that the recombinant YFV17D-LASV-GPC virus appears to be genetically superior to those disclosed in the prior art by Friedrichsson et al., J. Immunol. 1999, 144:1311-1323 (ibid.).

[0010] The present invention is further summarized in the following:

[0011] 1. A polynucleotide comprising a sequence of an infectious, attenuated live flavivirus, in which a nucleotide sequence encoding at least a portion of an arenavirus glycoprotein is arranged in an intergenic region between the E gene and the NS1 gene of said flavivirus so as to express a chimeric virus, wherein the encoded sequences at the C-terminus of the E protein of said flavivirus and at the N-terminus of the signal peptide of the NS1 protein of said flavivirus are in the following order: an additional signal peptide of the NS1 protein of a flavivirus; an arenavirus glycoprotein lacking the N-terminal signal sequence and the GP2 transmembrane domain; The TM1 and TM2 domains of the E protein of a flavivirus; A polynucleotide comprising:

[0012] 2. A polynucleotide according to claim 1, wherein the sequence of an infectious live attenuated flavivirus is the sequence of a Yellow Fever virus, typically of the YF17D strain.

[0013] 3. The polynucleotide of claim 1, wherein the infectious, attenuated, live flavivirus backbone is a chimeric backbone of two different flaviviruses.

[0014] 4. A polynucleotide according to any one of claims 1 to 3, wherein the arenavirus is a Mammarenavirus.

[0015] 5. The polynucleotide according to any one of claims 1 to 4, wherein the arenavirus is Lassa virus.

[0016] 6. A polynucleotide according to any one of claims 1 to 3, wherein the Lassa strain is the Josiah strain.

[0017] 7. The polynucleotide of any one of claims 1 to 6, wherein the glycoprotein comprises the stabilizing mutations R207C, G360C, and E329P.

[0018] 8. The polynucleotide of any one of claims 1 to 7, wherein the glycoprotein comprises a proteolytic cleavage site of R246A.

[0019] 9. The polynucleotide of any one of claims 1 to 8, wherein the nucleotide sequence of the G protein is codon-optimized for improved expression in mammalian cells.

[0020] 10. A polynucleotide according to any one of claims 1 to 9, wherein the signal peptide of the NS1 protein comprises or consists of the sequence DQGCAINFG (SEQ ID NO: 10).

[0021] 11. A polynucleotide according to any one of claims 1 to 10, wherein the TM1 and TM2 domains of the flavivirus E protein are derived from West Nile virus.

[0022] 12. A polynucleotide according to any one of claims 1 to 11, wherein the TM1 domain of a flavivirus E protein has the sequence of SEQ ID NO:14.

[0023] 13. A polynucleotide according to any one of claims 1 to 12, wherein the TM2 domain of a flavivirus E protein has the sequence of SEQ ID NO:15.

[0024] 14. A polynucleotide described in any one of claims 1 to 13, wherein the sequence of the junction of the NS1 signal sequence and the GP1 domain of the chimeric virus comprises the sequence of SEQ ID NO:11.

[0025] 15. A polynucleotide described in any one of claims 1 to 14, wherein the sequence of the junction of the GP2 domain and the TM1 domain of the chimeric virus comprises the sequence of SEQ ID NO:12.

[0026] 16. A polynucleotide described in any one of claims 1 to 14, wherein the sequence of the junction of the TM2 domain and the NS1 protein of the chimeric virus comprises the sequence of SEQ ID NO:13.

[0027] In a preferred embodiment, the junction connecting the flavivirus NS1 signal sequence, the Lassa virus G protein, the TM2 protein, and the second NS1 signal sequence provides a fingerprint for the encoded protein. Thus, an embodiment of the encoded sequence may be defined by a sequence having the sequence of SEQ ID NO:2 or SEQ ID NO:4, including sequences having SEQ ID NO:11, SEQ ID NO:12, and SEQ ID NO:13, where outside of SEQ ID NO:11, SEQ ID NO:12, and SEQ ID NO:13, some amino acids may differ from SEQ ID NO:2 or SEQ ID NO:4, e.g., by up to 20, up to 10, or up to 5 amino acids compared to SEQ ID NO:2 or SEQ ID NO:4, or have at least 95%, 96%, 97%, 98%, or 99% sequence identity to SEQ ID NO:2 or SEQ ID NO:4, for example.

[0028] 17. The polynucleotide of any one of claims 1 to 16, which is a bacterial artificial chromosome.

[0029] 18. A polynucleotide according to any one of claims 1 to 17 for use as a medicine.

[0030] 19. A polynucleotide for use as a medicament according to claim 18, wherein the medicament is a vaccine.

[0031] 20. A polynucleotide sequence according to any one of claims 1 to 17 for use in vaccination against arenavirus infections.

[0032] 21. A chimeric, infectious, attenuated, live flavivirus, comprising at least a portion of an arenavirus glycoprotein between the E protein and the NS1 protein of said flavivirus, at the C-terminus of the E protein and at the N-terminus of the signal peptide of the NS1 protein, in the following order: an additional signal peptide of the NS1 protein of a flavivirus; an arenavirus glycoprotein lacking the N-terminal signal sequence and the GP2 transmembrane domain; The TM1 and TM2 domains of the E protein of a flavivirus; a chimeric, live, infectious, attenuated flavivirus,

[0033] 22. The chimeric flavivirus of claim 21, wherein the flavivirus is YFV.

[0034] 23. The chimeric flavivirus of claim 21 or 22, wherein the arenavirus is a Lassa virus.

[0035] 24. The chimeric virus according to any one of claims 21 to 23, for use as a medicine.

[0036] 25. The chimeric virus according to any one of claims 21 to 24, which is used to prevent arenavirus infection.

[0037] 26. A chimeric virus encoded by the nucleotide sequence described in any one of claims 21 to 23, for use in the prevention of arenavirus infections and the prevention of flavivirus infections.

[0038] 27. A method for making a vaccine against arenavirus infection, comprising: an inducible bacterial ori sequence that amplifies the BAC to 11 or more copies per bacterial cell; A viral expression cassette comprising a cDNA of the chimeric virus of arenavirus and flavivirus according to any one of claims 1 to 16, and comprising a cis-regulatory element for transcribing the viral cDNA in a mammalian cell and processing the transcribed RNA into an infectious RNA virus; providing a BAC comprising: transfecting mammalian cells with the BAC of step a) and passaging the infected cells; Testing the replicated viruses of the transfected cells of step b) for their pathogenicity and their ability to generate antibodies and induce protection against infection with said arenavirus; cloning the verified virus from step c) into a vector; formulating the vector into a vaccine formulation; A method comprising:

[0039] 28. The method of claim 27, wherein the flavivirus is a yellow fever virus.

[0040] 29. The method of claim 27 or 28, wherein the arenavirus is Lassa virus.

[0041] 30. The method of any one of claims 27 to 29, wherein the vector is a BAC that contains an inducible bacterial ori sequence that amplifies the BAC to 11 or more copies per bacterial cell. [Brief description of the drawings]

[0042]

Figure 1

Figure 2

Figure 3

Figure 4

Figure 5

Figure 6

[0043] Although the invention is exemplified with Yellow Fever virus, it may also be applied using other viral backbones of the Flavivirus species such as, but not limited to, Japanese Encephalitis virus, Dengue virus, Murray Valley Encephalitis (MVE) virus, St. Louis Encephalitis (SLE) virus, West Nile (WN) virus, Tick-borne Encephalitis (TBE) virus, Russian Spring-Summer Encephalitis (RSSE) virus, Kunjin virus, Powassan virus, Kyasanur Forest disease virus, Zika virus, Ustu virus, Wesselsbron virus, and Omsk hemorrhagic fever virus.

[0044] Furthermore, the present invention is applicable to the family Flaviviridae, which includes not only the genus Flavivirus, but also the genera Pegivirus, Hepacivirus, and Pestivirus.

[0045] The hepacivirus genus includes, for example, hepacivirus C (hepatitis C virus) and hepacivirus B (GB virus B).

[0046] The genus Pegivirus includes, for example, Pegivirus A (GB virus A), Pegivirus C (GB virus C), and Pegivirus B (GB virus D).

[0047] The genus Pestivirus includes, for example, Bovine viral diarrhea virus type 1 and Classical swine fever virus (formerly known as hog cholera virus).

[0048] The flavivirus used as the backbone may itself be a chimeric virus made up of parts of different flaviviruses.

[0049] For example, the C region and the NS1 to NS5 regions are derived from a yellow fever virus, and the prME region is derived from a Japanese encephalitis virus or a Zika virus.

[0050] The invention is exemplified with respect to the G protein of Lassa virus, but is also applicable to the G proteins of other arenaviruses.

[0051] The present invention relates to nucleotide sequences and encoded proteins in which arenavirus glycoproteins are inserted into the RNA or copy DNA (cDNA) of a flavivirus.

[0052] The glycoproteins of arenaviruses are discussed in Burr et al. (2012) Viruses 4, 2162-2181 and Nurnberg & Yorke (2012) Viruses 4, 83-101. Arenaviruses are composed of two RNA genome segments and four proteins: polymerase L, envelope glycoprotein GP (also referred to herein as G protein or GPC), matrix protein Z, and nucleoprotein NP.

[0053] In the arenavirus life cycle, the biosynthesis and maturation of the GP precursor (GPC) is carried out by the cellular signal peptidase and the cellular enzyme subtilisin kexin isozyme-1 (SKI-1) / site-1 protease (S1P), resulting in the tripartite mature GP complex formed by GP1 / GP2 and a stable signal peptide (SSP).

[0054] Based on serological, genetic, and geographic data, the arenaviruses Mammarenaviruses are divided into two major subgroups: the Old World (OW) complex and the New World (NW) complex. The Old World lineage consists of the prototype LCMV and other viruses endemic to the African continent, including Lassa virus (LASV), Mopeia virus (MOPV), Yippee virus, and Mobara virus (MOBV).

[0055] The larger New World complex is further divided into three clades, A, B, and C. Clade B is the most important from the perspective of human disease, as it contains the main viruses causing hemorrhagic fever (HF) in South America, namely Junin virus (JUNV), Machupo virus (MACV), Gunarito virus (GTOV), and Sabia virus (SABV), but also other non-pathogenic viruses such as Tacaribe virus (TCRV) and Amapari virus (AMPV).

[0056] The present invention contemplates the use of chimeric constructs based on the G protein of any of the above groups, subgroups, or species, with a preferred embodiment being a construct based on the G protein of LASV inserted into flavivirus RNA or cDNA.

[0057] The present invention contemplates the use of chimeric constructs based on the G protein of Reptarenavirus or Hartmanniivirus.

[0058] The invention is exemplified using the G protein of the Lassa virus Josiah strain, the sequence of which is accessible, for example, as the UniProtKB P08669 database entry or the NCBI NP_694870.1 database entry.

[0059] In alternative embodiments, a contemplated arenavirus is a virus whose protein sequence of the G protein has at least 70%, at least 80%, at least 90%, at least 95%, or at least 99% sequence identity to the G protein of the Lassa virus Josiah strain disclosed in the above database entry.

[0060] The construct of the present invention allows the proper presentation and proteolytic processing of the encoded insert into the ER lumen. As exemplified by the G protein of Lassa, the protein encoded by the insert lacks an N-terminal signal sequence and a GP2 transmembrane domain. To maintain the required topology, for example, two transmembrane domains of WNV are fused to the C-terminus of the glycoprotein sequence. Based on this principle, any immunogenic protein can be presented via the vector of the present invention, in which the protein lacks an N-terminal membrane targeting domain and contains a cytoplasmic sequence at the C-terminus that connects the targeting membrane followed by the transmembrane domain preceding the NS1 protein.

[0061] The invention is now further described in an embodiment in which a flavivirus is used as the backbone and the G protein of Lassa virus is used as the insert.

[0062] Despite the high degree of sequence identity between the G proteins of different arenaviruses, the skilled artisan has no problem identifying sequence elements in related sequences which correspond to sequence elements present in the Lassa virus G protein.

[0063] Flaviviruses have a single-stranded positive-sense RNA genome approximately 11,000 nucleotides in length. The genome contains a 5' untranslated region (UTR), a long open reading frame (ORF), and a 3'UTR. The ORF encodes three structural proteins (capsid (C), precursor membrane (prM), and envelope (E)) and seven nonstructural proteins (NS1, NS2A, NS2B, NS3, NS4A, NS4B, and NS5). Together with the genomic RNA, the structural proteins form the virus particle. The nonstructural proteins are involved in viral polyprotein processing, replication, virion assembly, and evasion of the host immune response. A signal peptide at the C-terminus of the C protein (also called C-signal peptide or C-anchor domain) regulates flavivirus packaging by the coordinated cleavage of sequences at the N-terminus (by the viral NS2B / NS3 protease in the cytoplasm) and C-terminus (by host signalase in the lumen of the endoplasmic reticulum (ER)) of the signal peptide sequence.

[0064] The single-stranded positive-stranded genome is translated into a single polyprotein, which is co- and post-translationally cleaved by viral and host proteins into three structural proteins (capsid (C), precursor membrane (prM), envelope (E)) and seven nonstructural proteins (NS1, NS2A, NS2B, NS3, NS4A, NS4B, NS5). The structural proteins form the (spherical) structure of the virion and initiate the attachment, internalization, and release of viral RNA into the cell, thereby initiating the viral life cycle. On the other hand, the nonstructural proteins are involved in viral replication, regulation and evasion of immune responses in infected cells, and viral transmission to mosquitoes. Intra- and intermolecular interactions between structural and nonstructural proteins play an important role in viral infection and pathogenesis.

[0065] The E protein contains two transmembrane sequences at its C-terminus, designated TM1 and TM2.

[0066] NS1 is transported into the lumen of the ER via a signal sequence corresponding to the last 24 amino acids of E and is released from E at its amino terminus via cleavage by an ER-retained host signal peptidase (Nowak et al. (1989) Virology 169,365-376). NS1 contains a signal sequence of 8-9 amino acids at its C-terminus that includes a recognition site for a protease (Muller & Young (2013) Antiviral Res. 98, 192-208).

[0067] The constructs of the present invention are chimeric viruses in which the Lassa virus G protein is inserted at the boundary between the E and NS1 proteins, however, additional sequence elements are provided at the N- and C-termini of the G protein insert.

[0068] The present invention relates to a polynucleotide comprising a sequence of an infectious attenuated live flavivirus in which a nucleotide sequence encoding at least a portion of an arenavirus G protein has been inserted into the intergenic region between the E gene and the NS1 gene of said flavivirus so as to express a chimeric virus, said polynucleotide comprising the C-terminus of the E protein of said flavivirus and the N-terminus of the NS1 protein of said flavivirus in the following order: a sequence element that allows proteolytic processing of the G protein from the E protein by a signal peptidase; a G protein lacking a signal peptide and a GP2 transmembrane protein; The two TM domains of the flavivirus E protein and The present invention relates to a polynucleotide comprising:

[0069] Sequence elements that are substrates for signal peptidases are provided to allow proteolytic processing of the arenavirus G protein from the flavivirus E protein at the amino terminus and from the flavivirus NS1 protein at the C terminus. These can vary in length and sequence and can be as short as one amino acid as shown in Jang et al., cited above. A discussion of suitable recognition sites for signaling proteases can be found in Nielsen et al. (1997) Protein Eng. 10, 1-6.

[0070] Typically, at the C-terminus of the G protein, the signal peptide (or a fragment that allows proteolytic processing) at the N-terminus of the NS1 protein is used. Typically, at the N-terminus of the G protein, the same signal peptide (or a fragment) of the NS1 protein of the flavivirus backbone is introduced.

[0071] The present invention also relates to a polynucleotide comprising the sequence of an infectious live attenuated flavivirus, wherein a nucleotide sequence encoding at least a portion of an arenavirus G protein is inserted into the intergenic region between the E and NS1 genes of said flavivirus, such that the encoded sequence from the C-terminus of the E protein to the N-terminus of the signal peptide of the NS1 protein is in the following order: an additional signal peptide (or a cleavable fragment thereof) of the NS1 gene of a flavivirus at the C-terminus of the E protein and at the N-terminus of the NS1 protein; an arenavirus G protein lacking a functional signal peptide and a transmembrane sequence of the GP2 domain; Additional sequences are provided such that the chimeric virus is expressed to contain the G protein, which is C-terminal from the NS1 signal peptide. At the C-terminus of the G protein are sequences for the flavivirus TM1 and TM2 transmembrane domains of the flavivirus. Following the C-terminus of these TM sequences is the NS1 protein with its native signal peptide sequence.

[0072] Thus, the G protein and TM domains are flanked at the N- and C-termini of the NS1 sequence. In the embodiment disclosed in the Examples, the protein and DNA sequences of both NS1 are identical.

[0073] In an exemplary embodiment, both NS1 signal sequences have the sequence DQGCAINFG (SEQ ID NO:10).

[0074] The constructs of the present invention did not show recombination due to the presence of this repeated sequence. Sequence modifications can be introduced or NS1 sequences from different flaviviruses can be used to avoid the presence of identical sequences, as long as the encoded peptides remain targets for the proteases that process the N-terminal signal sequences of these NS1.

[0075] In an exemplary embodiment, as disclosed in the Examples, the G protein is the G protein of Lassa virus, preferably the G protein of the Josiah strain of Lassa virus.

[0076] To facilitate production of the virus in a mammalian host, the nucleotide sequence of the G protein has been codon-optimized.

[0077] It is believed that minor sequence modifications in the G protein and C-terminal tail can be introduced without losing the function of these sequence elements, examples being amino acid substitutions in which hydrophobic side chains are conserved in the transmembrane domain, or truncations of the cytoplasmic domain with sufficient length to allow proper localization of the transmembrane domain at the N- and C-termini of the cytoplasmic domain.

[0078] It has been found that the presence of a functional signal peptide of a G protein provides a negative selection pressure such that the portion of the G protein, including the signal peptide, is deleted or mutated. Thus, the constructs of the invention typically contain a defective G protein signal, either by partial or complete removal of this sequence or by introducing a mutation that renders the signal protein non-functional.

[0079] The TM domains located at the C-terminus of the G protein and at the N-terminus of NS1 are generally flavivirus TM domains, typically from the E protein, more typically from the E protein. In a preferred embodiment, these TM domains of the E protein are from a flavivirus different from the scaffold-forming virus. The examples of the present invention describe the TM1 and TM2 domains of the E protein of West Nile virus. These domains have the sequence GGMSWITQGLLGALLLWMGINARD (SEQ ID NO: 14) and the sequence RSIAMTFLAVGGVLLFLSVNVHA (SEQ ID NO: 15).

[0080] In the Examples section and schematic diagrams below, all sequence elements form contiguous sequences without any intervening sequence elements. It is contemplated that additional amino acids may be present between these sequence elements, as long as localization of the protein, either in the ER lumen or in the cytosol, is not hindered and proteolytic processing is maintained.

[0081] The above nucleotide sequences may be sequences of the virus itself or may refer to sequences within a vector. As explained in more detail below, suitable vectors for cloning flaviviruses and chimeric types are, among other techniques, bacterial artificial chromosomes.

[0082] The methods and compounds of the invention have medical applications in which the virus or vectors encoding the virus can be used to vaccinate against arenaviruses that contain G proteins cloned into the flavivirus. Furthermore, because proteins derived from flaviviruses similarly confer protection, the compounds of the invention can be used to vaccinate against flaviviruses and arenaviruses using a single virus or DNA vaccine.

[0083] The use of bacterial artificial chromosomes, and in particular the use of inducible BACS as disclosed by the inventors in WO2014174078, is particularly suitable for high yield, high quality amplification of cDNA of RNA viruses, such as the chimeric constructs of the present invention.

[0084] The BAC described in this publication is an inducible bacterial ori sequence that amplifies the BAC to 11 or more copies per bacterial cell; a viral expression cassette comprising a cDNA of an RNA virus genome and comprising cis-regulatory elements for transcription of the viral cDNA in mammalian cells and processing the transcribed RNA into an infectious RNA virus; Includes.

[0085] As in the present case, the RNA virus genome is a chimeric viral cDNA construct of an RNA virus genome and an arenavirus G protein.

[0086] In these BACS, the viral expression cassette is a cDNA of a positive-stranded RNA viral genome, typically an RNA polymerase-driven promoter preceding the 5' end of said cDNA which initiates transcription of said cDNA; an element for RNA self-cleavage following the 3' end of the viral cDNA which cleaves the RNA transcript of the cDNA at a defined position; Includes.

[0087] The BAC may further comprise a yeast autonomously replicating sequence that shuttles and maintains the bacterial artificial chromosome in yeast. Examples of yeast ori sequences are the origin of the 2μ plasmid or ARS1 (autonomously replicating sequence 1) or functionally homologous derivatives thereof.

[0088] The RNA polymerase driven promoter of this first aspect of the invention may be an RNA polymerase II promoter such as the cytomegalovirus immediate early (CMV-IE) promoter or the Simian Virus 40 promoter or a functionally homologous derivative thereof.

[0089] The RNA polymerase driven promoter may also be an RNA polymerase I promoter or an RNA polymerase III promoter.

[0090] The BAC may also contain an element for RNA self-cleavage, such as the cDNA of the Hepatitis D virus genomic ribozyme or a functionally homologous RNA element.

[0091] Formulation of DNA into vaccine preparations is known in the art and is described in detail, for example, in "DNA Vaccines" Methods in Molecular Medicine, 127th ed. (2006) SpringerSaltzman, Shen and Brandsma (eds.) Humana Press. (Totowa, NJ), Chapters 6-10, and in Alternative vaccine delivery methods, Chapter 61, pages 1200-1231, in Vaccines (6th ed.) (2013) (Plotkin et al. eds.). Details on acceptable carriers, diluents, additives and adjuvants suitable for the preparation of DNA vaccines can also be found in WO 2005042014, as set forth below.

[0092] "Acceptable carrier, diluent, or excipient" refers to an additional substance that is acceptable for use in human and / or veterinary medicine, particularly with respect to immunotherapy.

[0093] For example, acceptable carriers, diluents, or additives may be solid or liquid fillers, diluents, or encapsulating substances that can be safely used in systemic or local administration.Depending on the specific administration route, various carriers well known in the art can be used.These carriers may be selected from the group including sugars, starches, cellulose and their derivatives, malt, gelatin, talc, calcium sulfate and calcium carbonate, vegetable oils, synthetic oils, polyols, alginic acid, phosphate buffers, emulsifiers, isotonic saline, and salts such as inorganic acid salts including hydrochlorides, bromides, and sulfates, organic acids such as acetates, propionates, and malonates, and pyrogen-free water.

[0094] A useful reference describing pharma- ceutically acceptable carriers, diluents, and excipients is Remington's Pharmaceutical Sciences (Mack Publishing Co., NJ, USA) 2(091), incorporated herein by reference.

[0095] Any safe administration route can be used to deliver the DNA vaccine to the patient. For example, oral, rectal, parenteral, sublingual, buccal, intravenous, intraarticular, intramuscular, intradermal, subcutaneous, inhalation, intraocular, intraperitoneal, intracerebroventricular, transdermal, etc. Intramuscular and subcutaneous injections can be suitable for administration of, for example, immunotherapy compositions, protein vaccines, and nucleic acid vaccines. It is also contemplated that particle bombardment or electroporation can be particularly useful for delivery of nucleic acid vaccines.

[0096] Dosage forms include tablets, dispersions, suspensions, injections, solutions, syrups, lozenges, capsules, suppositories, aerosols, transdermal patches, and the like. These dosage forms may also include injection or implantation of controlled release devices specifically designed for this purpose or other forms of implants further modified to act in this manner. Controlled release of therapeutic agents may be achieved by coating the therapeutic agents with hydrophobic polymers including, for example, acrylic resins, waxes, higher aliphatic alcohols, polylactic and polyglycolic acids, and certain cellulose derivatives such as hydroxypropylmethylcellulose. Additionally, controlled release may be achieved by using other polymer matrices, liposomes, and / or microspheres.

[0097] DNA vaccines suitable for oral or parenteral administration may be provided as discrete units such as capsules, cachets or tablets, powders or granules, or solutions or suspensions in aqueous liquids, non-aqueous liquids, oil-in-water emulsions or water-in-oil liquid emulsions, each containing a predetermined amount of plasmid DNA. Such compositions may be prepared by any of the methods of pharmacy, but all methods include the step of bringing into association one or more of the above agents with the carrier which constitutes one or more necessary ingredients. In general, the compositions are prepared by uniformly and intimately admixing the DNA plasmid with liquid carriers or finely divided solid carriers, or both, and then, if necessary, shaping the product into the desired presentation.

[0098] The composition can be administered in a manner compatible with the dosage formulation and in an effective amount. The dosage administered to a patient should be sufficient to induce a beneficial response in the patient over a reasonable period of time. The amount of the agent(s) administered can depend on the subject being treated, including age, sex, weight, and their general health condition, factors that depend on the physician's judgment.

[0099] Furthermore, DNA vaccines can be delivered by bacterial transduction, such as using live attenuated strains of Salmonella transformed with the above DNA plasmids, as exemplified by Darji et al. (2000) FEMS Immunol Med Microbiol 27, 341-349 and Cicin-Sain et al. (2003) J Virol 77, 8249-8255, which are incorporated by reference.

[0100] Typically, DNA vaccines are used for preventive or therapeutic immunization in humans, but for certain viruses, they can also be applied to vertebrates (typically mammals, birds, and fish), including livestock and companion animals such as industrial animals. Vaccination is contemplated for animals that are live reservoirs of the virus (zoonotic diseases), such as monkeys, dogs, mice, rats, birds, and bats.

[0101] In certain embodiments, the vaccine may include an adjuvant, i.e., one or more substances that enhance the immunogenicity and / or efficacy of the vaccine composition. However, live vaccines may ultimately be harmed by adjuvants that may stimulate innate immune responses unrelated to viral replication. Non-limiting examples of suitable adjuvants include squalane and squalene (or other oils of animal origin), block copolymers, surfactants such as Tween-80, mineral oils such as Quil A, Drakeol, or Marcol, vegetable oils such as peanut oil, adjuvants derived from Corynebacterium such as Corynebacterium parvum, adjuvants derived from Propionibacterium such as Propionibacterium acnes, adjuvants derived from Mycobacterium bovis, adjuvants derived from Mycobacterium purpurea ... bovis (bacilli Calmette-Guerin, or BCG), interleukins such as interleukin 2 and interleukin 12, monokines such as interleukin 1, tumor necrosis factors, interferons such as gamma interferon, combinations such as saponin-aluminum hydroxide or Quil-A aluminum hydroxide, liposomes, ISCOMt) and ISCOMATRIX(B) adjuvants, mycobacterial cell wall extracts, synthetic glycopeptides or other derivatives such as muramyl dipeptide, avridine, lipid A derivatives, dextran sulfate, DEAE-dextran or aluminum phosphate together with carboxypolymethylenes such as Carbopol'EMA, acrylic copolymer emulsions such as Neocryl A640, vaccinia or animal poxvirus proteins, subviral particle adjuvants such as cholera toxin, or mixtures thereof. EXAMPLES

[0102] Example 1 YFV17D / Lassa Construct The Lassa glycoprotein precursor from strain Josiah (LASV-GPC) was inserted between YF-E / NS1 to generate two constructs as follows (Figure 1):

[0103] 1) PLLAV-YFV17D-LASV-GPC: Lassa glycoprotein with deleted N-terminal signal peptide sequence (SSP) and GP2 transmembrane domain (TM). The cleavage site of the LASV glycoprotein was mutated (R246A) to maintain the precursor GPC (linked GP1 and GP2). These point mutations R207C and G360C (covalently linking GP1 and GP2) and E329P (described in Hastie et al (2017) Science 356, 923-928) were introduced to improve stability. This Lassa GPC with these mutations was fused to the transmembrane domains (TM1 and TM2) of WNV to maintain the polyprotein topology required for YFV17D replication and to allow proper expression of LASV-GPC. In addition, a sequence encoding the first 9 amino acids of YF-NS1 was introduced before the LASV-GPC sequence to allow correct processing of the antigen.

[0104] 2) PLLAV-YFV17D-LASV-GPCcs: A construct similar to the above, but in this construct the cleavage site was restored (the R246A mutation was restored to R246R). The remaining mutations were similar, with the mutations R207C and G360C (which covalently link GP1 and GP2) and E329P (described in Hastie et al (2017) Science 356, 923-928) introduced to improve stability.

[0105] Example 2 Construct No. 1 PLLAV-YFV17D-LASV-GPC When PLLAV-YFV17D-LASV-GPC was transfected into BHK21J cells, not only did typical CPE appear, but the viral supernatants from these cells formed significantly smaller plaques compared to the plaque phenotype of YFV17D (Fig. 2A). Thus, the resulting transgenic virus (YFV17D-LASV-GPC) was further attenuated, with a virus yield at least 10-fold lower than that of YFV17D.

[0106] The stability of PLLAV-YFV17D-LASV-GPC was examined by performing RT-PCR to detect the transgene insert in virus samples collected during serial passage of YFV17D-LASV-GPC (Fig. 2B). Sequencing of RT-PCR products showed that the mutation-free LASV-GPC insert could be detected at least up to passage 5 in BHK21J cells.

[0107] Example 3 Immunogenicity of PLLAV-YFV17D-LASV-GPC in AG129 Mice The immunogenicity of PLLAV-YFV17D-LASV-GPC and derived live attenuated viruses (LAV) was evaluated in vivo in AG129 mice. Animals (n=9 / group) were vaccinated with either 25 μg of PLLAV-YFV17D-LASV-GPC or 375 PFU of YFV17D-LASV-GPC (Figure 3). YFV- and LASV-specific antibody responses were quantified by indirect immunofluorescence assay (IIFA), and cellular immune responses were quantified by ELISPOT (Figure 4).

[0108] Vaccinated mice were monitored daily for morbidity / mortality and blood was collected at baseline and at 2-week intervals for serological analysis. No adverse effects were observed in any of the vaccinated mice, so the vaccine was safe. Some animals (4 out of 9 mice) were boosted 2 weeks after the initial vaccination with PLLAV or LAV YFV17D-LASV-GPC using the same dose and route as the initial vaccination (Figure 3).

[0109] Immunogenicity analysis of YFV17D-LASV-GPC (PLLAV or LAV) revealed the presence of specific antibodies against LASV in 3 and 1 mice vaccinated with PLLAV or LAV, respectively, 14 days after vaccination. Of note, in the case of LASV, the CD8 +T cell responses are believed to be the main determinant responsible for conferring protection against LASV infection. Therefore, T cell responses were analyzed in both groups 4 months after vaccination. This analysis showed that T cell responses against LASV and YFV were present in all mice vaccinated with YFV17D-LASV-GPC (LAV) and in 7 out of 9 mice after vaccination with the PLLAV version (Figure 4). Therefore, these T cell responses can be considered to confer immunity and protection against LASV infection.

[0110] Example 4 Construct No. 2 PLLAV-YFV17D-LASV-GPCcs (cleavage site) We generated a second construct similar to the above, PLLAV-YFV17D-LASV-GPCcs, in which the native cleavage site between GP1 and GP2 was restored. When this construct was transfected into BHK21J cells, not only did we observe typical CPE, but the viral supernatants from these cells formed significantly smaller plaques compared to the plaque phenotype of YFV17D (Figure 5A). Thus, similar to the previous YFV17D / LASV construct, the resulting transgenic virus (YFV17D-LASV-GPC) was further attenuated, with a virus yield at least 10-fold lower than that of YFV17D.

[0111] Co-expression of the LASV-GPC together with the YFV polyprotein could be observed (FIG. 5B), thus indicating proper expression and folding of the LASV-GPC.

[0112] To evaluate the immunogenicity of this construct, AG129 mice were vaccinated subcutaneously (sc) with YFV17D-LASV-GPCcs (LAV) and T cell responses were examined 28 days after vaccination (Figure 6). This analysis shows that there were strong specific T cell responses against both LASV and YFV. These results suggest that the vaccine can function as a bivalent vaccine against both viruses, LASV and YFV. No adverse effects were observed in any of the vaccinated mice, so the vaccine was safe.

[0113] Sequences described in this application Construct No. 1: PLLAV-YFV17D-LASV-GPC (signal peptide deleted, transmembrane domain gp2 deleted, cleavage site mutated (r256a), and mutations r207c, e329p, and g360c) The final YF-E (amino acids 1-40) The first 27 nucleotides (9 amino acids) of SNS1 (amino acids 41 to 49) (bold and underlined) lasv-gp1 domain (without signal peptide and with mutation tgt(r207c)) (amino acids 50-250) Mutated cleavage site gcaagattgcta(r256a) (SEQ ID NO: 16) (amino acids 247-250) lasv-p2 (without TM and mutations cca(e329p), tgt(g360c)) (amino acids 251 to 418) TM1 of WNV (amino acids 418–442) (underlined) TM2 of WNV (amino acids 443–465) (underlined) The first yf-ns1 (amino acids 466 to 527) SEQ ID NO:1 DNA SEQ ID NO:2 Protein AAGGTCATCATGGGGGCGGTACTTATATGGGTTGGCATCAACACAAGAAACATGACAATG <h2 style=";text-align:left;direction:ltr">KVIMGAVLIWVGINTRNMTM 20<h2 style=";text-align:left;direction:ltr"> <h2 style=";text-align:left;direction:ltr"> TCCATGAGCATGATCTTGGTAGGAGTGATCATGATGTTTTTGTCTCTAGGAGTTGGcGCc<h2 style=";text-align:left;direction:ltr"> <h2 style=";text-align:left;direction:ltr"> SMSMILVGVIMMFLSLGVGA 40<h2 style=";text-align:left;direction:ltr"> <h2 style=";text-align:left;direction:ltr"> 40<h2 style=";text-align:left;direction:ltr"> <h2 style=";text-align:left;direction:ltr"> GACCAGGGCTGCGCGATAAATTTCGGT <h2 style=";text-align:left;direction:ltr"> accagtctttataaaggggtttatgagcttcag<h2 style=";text-align:left;direction:ltr"> <h2 style=";text-align:left;direction:ltr"> D Q G C A I N F G <h2 style=";text-align:left;direction:ltr"> TSLYKGVYELQ 60<h2 style=";text-align:left;direction:ltr"> <h2 style=";text-align:left;direction:ltr"> 41 49 51<h2 style=";text-align:left;direction:ltr"> <h2 style=";text-align:left;direction:ltr"> actctggaactaaacatggagacactcaatatgaccatgcctctctcctgcacaaagaac<h2 style=";text-align:left;direction:ltr"> <h2 style=";text-align:left;direction:ltr"> TLELNMETLNMTMPLSCTKN 80<h2 style=";text-align:left;direction:ltr"> <h2 style=";text-align:left;direction:ltr"> aacagtcatcattatataatggtggggcaatgagacaggactagaactgaccttgaccaac<h2 style=";text-align:left;direction:ltr"> <h2 style=";text-align:left;direction:ltr"> NSHHYIMVGNETGLELTLTN 100<h2 style=";text-align:left;direction:ltr"> <h2 style=";text-align:left;direction:ltr"> acgagcattattaatcacaaattttgcaatctgtctgatgcccacaaaaagaacctctat<h2 style=";text-align:left;direction:ltr"> <h2 style=";text-align:left;direction:ltr"> TSIINHKFCNLSDAHKKNLY 120<h2 style=";text-align:left;direction:ltr"> <h2 style=";text-align:left;direction:ltr"> gaccacgctcttatgagcataatctcaactttccacttgtccatccccaacttcaatcag<h2 style=";text-align:left;direction:ltr"> <h2 style=";text-align:left;direction:ltr"> DHALMSIISTFHLSIPNFNQ 140<h2 style=";text-align:left;direction:ltr"> <h2 style=";text-align:left;direction:ltr"> tatgaggcaatgagctgcgattttaatgggggaaagattagtgtgcagtacaacctgagt<h2 style=";text-align:left;direction:ltr"> <h2 style=";text-align:left;direction:ltr"> YEAMSCDFNGGKISVQYNLS 160<h2 style=";text-align:left;direction:ltr"> <h2 style=";text-align:left;direction:ltr">cacagctatgctggggatgcagccaaccattgtggtactgttgcaaatggtgtgttacag<h2 style=";text-align:left;direction:ltr"> <h2 style=";text-align:left;direction:ltr"> HSYAGDAANHCGTVANGVLQ 180<h2 style=";text-align:left;direction:ltr"> <h2 style=";text-align:left;direction:ltr"> acttttatgaggatggcttggggtgggagctacattgctcttgactcaggc<h2 style=";text-align:left;direction:ltr"> Tgt <h2 style=";text-align:left;direction:ltr"> ggcaac<h2 style=";text-align:left;direction:ltr"> <h2 style=";text-align:left;direction:ltr"> TFMRMAWGGSYIALDSG<h2 style=";text-align:left;direction:ltr"> C <h2 style=";text-align:left;direction:ltr"> GN 200<h2 style=";text-align:left;direction:ltr"> <h2 style=";text-align:left;direction:ltr"> R207C<h2 style=";text-align:left;direction:ltr"> <h2 style=";text-align:left;direction:ltr"> tgggactgtattatgactagttatcaatatctgataatccaaaatacaacctgggaagat<h2 style=";text-align:left;direction:ltr"> <h2 style=";text-align:left;direction:ltr"> WDCIMTSYQYLIIQNTTWED 220<h2 style=";text-align:left;direction:ltr"> <h2 style=";text-align:left;direction:ltr"> cactgccaattctcgagaccatctcccatcggttatctcgggctcctctcacaaaggact<h2 style=";text-align:left;direction:ltr"> <h2 style=";text-align:left;direction:ltr"> HCQFSRPSPIGYLGLLSQRT 240<h2 style=";text-align:left;direction:ltr"> <h2 style=";text-align:left;direction:ltr"> agagatatttatattagt<h2 style=";text-align:left;direction:ltr"> gcAAGATTGCTA <h2 style=";text-align:left;direction:ltr"> GGCACATTCACATGGACACTGTCAGATTCT<h2 style=";text-align:left;direction:ltr"> <h2 style=";text-align:left;direction:ltr"> RDIYIS<h2 style=";text-align:left;direction:ltr"> A R L L <h2 style=";text-align:left;direction:ltr"> GTFTWTLSDS 260<h2 style=";text-align:left;direction:ltr"> <h2 style=";text-align:left;direction:ltr"> R256A<h2 style=";text-align:left;direction:ltr"> <h2 style=";text-align:left;direction:ltr"> 247 250<h2 style=";text-align:left;direction:ltr"> <h2 style=";text-align:left;direction:ltr"> GAAGGTAAAGACACACCAGGGGGATATTGTCTGACCAGGTGGATGCTAATTGAGGCTGAA<h2 style=";text-align:left;direction:ltr"> <h2 style=";text-align:left;direction:ltr"> EGKDTPGGYCLTRWMLIEAE 280<h2 style=";text-align:left;direction:ltr"> <h2 style=";text-align:left;direction:ltr"> CTAAAATGCTTCGGGAACACAGCTGTGGCAAAATGTAATGAGAAGCATGATGAGGAATTT<h2 style=";text-align:left;direction:ltr"> <h2 style=";text-align:left;direction:ltr"> LKCFGNTAVAKCNEKHDEEF 300<h2 style=";text-align:left;direction:ltr"> <h2 style=";text-align:left;direction:ltr">TGTGACATGCTGAGGCTGTTTGACTTCAACAAACAAGCCATTCAAAGGTTGAAAGCT<h2 style=";text-align:left;direction:ltr"> ccA <h2 style=";text-align:left;direction:ltr"> <h2 style=";text-align:left;direction:ltr"> CDMLRLFDFNKQAIQRLKAP 320<h2 style=";text-align:left;direction:ltr"> <h2 style=";text-align:left;direction:ltr"> E329P<h2 style=";text-align:left;direction:ltr"> <h2 style=";text-align:left;direction:ltr"> GCACAAATGAGCATTCAGTTGATCAACAAAGCAGTAAATGCTTTTGATAAATGACCAACTT<h2 style=";text-align:left;direction:ltr"> <h2 style=";text-align:left;direction:ltr"> AQMSIQLINKAVNALINDQL 340<h2 style=";text-align:left;direction:ltr"> <h2 style=";text-align:left;direction:ltr"> ATAATGAAGAACCATCTACGGGACATCATG<h2 style=";text-align:left;direction:ltr"> tGt <h2 style=";text-align:left;direction:ltr"> ATTCCATACTGTAATTACAGCAAGTAT<h2 style=";text-align:left;direction:ltr"> <h2 style=";text-align:left;direction:ltr"> IMKNHLRDIMCIPYCNYSKY 360<h2 style=";text-align:left;direction:ltr"> <h2 style=";text-align:left;direction:ltr"> G360C<h2 style=";text-align:left;direction:ltr"> <h2 style=";text-align:left;direction:ltr"> TGGTACCTCAACCACACAACTACTGGGAGAACATCACTGCCCAAATGTTGGCTTTGTATCA<h2 style=";text-align:left;direction:ltr"> <h2 style=";text-align:left;direction:ltr"> WYLNHTTTGRTSLPKCWLVS 380<h2 style=";text-align:left;direction:ltr"> <h2 style=";text-align:left;direction:ltr"> AATGGTTCATACTTGAACGAGACCCACTTTTCTGATGATATTGAACAACAAGCTGACAAT<h2 style=";text-align:left;direction:ltr"> <h2 style=";text-align:left;direction:ltr"> NGSYLNETHFSDDIEQQADN 400<h2 style=";text-align:left;direction:ltr"> <h2 style=";text-align:left;direction:ltr"> <h2 style=";text-align:left;direction:ltr"> ATGATCACTGAGATGTTACAGAAGGAGTATATGGAGAGGCAGGGAAGACACCA<h2 style=";text-align:left;direction:ltr"> GGAGGG <h2 style=";text-align:left;direction:ltr"> <h2 style=";text-align:left;direction:ltr"> MITEMLQKEYMERQGKTP<h2 style=";text-align:left;direction:ltr"> G G <h2 style=";text-align:left;direction:ltr"> 420<h2 style=";text-align:left;direction:ltr"> <h2 style=";text-align:left;direction:ltr"> 418 419<h2 style=";text-align:left;direction:ltr"> <h2 style=";text-align:left;direction:ltr"> ATGTCCTGGATCACACAGGGACTTCTGGGAGCTCTTCTGTTGTGGATGGGAATCAATGCC <h2 style=";text-align:left;direction:ltr"> <h2 style=";text-align:left;direction:ltr"> M S W I T Q G L L G A L L L W M G I N A <h2 style=";text-align:left;direction:ltr"> 440<h2 style=";text-align:left;direction:ltr"> <h2 style=";text-align:left;direction:ltr"> CGTGACAGGTCAATTGCTATGACGTTTCTTGCGGTTGGAGGAGTTTTGCTCTTCCTTTCG <h2 style=";text-align:left;direction:ltr"> <h2 style=";text-align:left;direction:ltr"> R D R S I A M T F L A V G G V L L F L S <h2 style=";text-align:left;direction:ltr"> 460<h2 style=";text-align:left;direction:ltr"> <h2 style=";text-align:left;direction:ltr"> GTCAACGTCCATGCTGATCAAGGATGCGCCATCAACTTTGGCAAGAGAGAGCTCAAGTGC V N V H A DQGCAINFGKRELKC 480 465 466 474 475 GGAGATGGTATCTTCATATTTAGAGACTCTGATGACTGGCTGAACAAGTACTCATACTAT GDGIFIFRDSDDWLNKYSYY 500 CCAGAAGATCCTGTGAAGCTTGCATCAATAGTGAAAGCCTCTTTTGAAGAAGGGAAGTGT PEDPVKLASIVKASFEEGKC 520 GGCCTAAATTCAGTTGACTCC GLNSVDS 527 527

[0114] Construct No. 2: PLLAV-YFV17D-LASV-GPCCS (signal peptide deleted, transmembrane domain gp2 deleted, cleavage site restored (R246R), and mutations R207C, E329P, and G360C) Final YFE (amino acids 1-40) The first 27 nucleotides (9 amino acids) of ns1 (amino acids 41 to 49) lasv-gp1 (no signal peptide and mutation tgt(r207c)) (amino acids 50 to 250) The restored cleavage site agaagattgcta(r256r) (SEQ ID NO: 17) lasv-gp2 (without TM and mutations cca(e329p), tgt(g360c)) (amino acids 251 to 418) WNV-TM1 (amino acids 419-442) WNV-TM2 (amino acids 462-465) The first yf-ns1 (amino acids 466 to 527) Array number 3 Array number 4 AAGGTCATCATGGGGGCGGTACTTATATGGGTTGGCATCAACACAAGAAACATGACAATG K V I M G A V L I W V G I N T R N M T M 20 TCCATGAGCATGATCTTGGTAGGAGTGATCATGATGTTTTTGTCTCTAGGAGTTGGcGCc S M S M I L V G V I M M F L S L G V G A 40 40 GACCAGGGCTGCGCGATAAATTTCGGT accagtctttataaaggggtttatgagcttcag D Q G C A I N F G T S L Y K G V Y E L Q 60 41 49 50 actctggaactaaacatggagacactcaatatgaccatgcctctctcctgcacaaagaac T L E L N M E T L N M T M P L S C T K N 80 aacagtcatcattatataatggtgggcaatgagacaggactagaactgaccttgaccaac N S H H Y I M V G N E T G L E L T L T N 100 acgagcattattaatcacaaattttgcaatctgtctgatgcccacaaaaagaacctctat T S I I N H K F C N L S D A H K K N L Y 120 gaccacgctcttatgagcataatctcaactttccacttgtccatccccaacttcaatcag D H A L M S I I S T F H L S I P N F N Q 140 <h2 style=";text-align:left;direction:ltr">tatgaggcaatgagctgcgattttaatgggggaaagattagtgtgcagtacaacctgagt<h2 style=";text-align:left;direction:ltr"> <h2 style=";text-align:left;direction:ltr"> YEAMSCDFNGGKISVQYNLS 160<h2 style=";text-align:left;direction:ltr"> <h2 style=";text-align:left;direction:ltr"> cacagctatgctggggatgcagccaaccattgtggtactgttgcaaatggtgtgttacag 180<h2 style=";text-align:left;direction:ltr"> <h2 style=";text-align:left;direction:ltr"> HSYAGDAANHCGTVANGVLQ<h2 style=";text-align:left;direction:ltr"> <h2 style=";text-align:left;direction:ltr"> acttttatgaggatggcttggggtgggagctacattgctcttgactcaggc<h2 style=";text-align:left;direction:ltr"> Tgt <h2 style=";text-align:left;direction:ltr"> ggcaac<h2 style=";text-align:left;direction:ltr"> <h2 style=";text-align:left;direction:ltr"> TFMRMAWGGSYIALDSG<h2 style=";text-align:left;direction:ltr"> C <h2 style=";text-align:left;direction:ltr"> GN 200<h2 style=";text-align:left;direction:ltr"> <h2 style=";text-align:left;direction:ltr"> tgggactgtattatgactagttatcaatatctgataatccaaaatacaacctgggaagat<h2 style=";text-align:left;direction:ltr"> <h2 style=";text-align:left;direction:ltr"> WDCIMTSYQYLIIQNTTWED 220<h2 style=";text-align:left;direction:ltr"> <h2 style=";text-align:left;direction:ltr"> cactgccaattctcgagaccatctcccatcggttatctcgggctcctctcacaaaggact<h2 style=";text-align:left;direction:ltr"> <h2 style=";text-align:left;direction:ltr"> HCQFSRPSPIGYLGLLSQRT 240<h2 style=";text-align:left;direction:ltr"> <h2 style=";text-align:left;direction:ltr"> agagatatttatattagt<h2 style=";text-align:left;direction:ltr"> agAAGATTGCTA <h2 style=";text-align:left;direction:ltr"> GGCACATTCACATGGACACTGTCAGATTCT<h2 style=";text-align:left;direction:ltr"> <h2 style=";text-align:left;direction:ltr"> RDIYIS<h2 style=";text-align:left;direction:ltr"> R R L L <h2 style=";text-align:left;direction:ltr"> GTFTWTLSDS 260<h2 style=";text-align:left;direction:ltr"> <h2 style=";text-align:left;direction:ltr"> R256<h2 style=";text-align:left;direction:ltr"> <h2 style=";text-align:left;direction:ltr"> 247 250<h2 style=";text-align:left;direction:ltr"> <h2 style=";text-align:left;direction:ltr"> GAAGGTAAAGACACACCAGGGGGATATTGTCTGACCAGGTGGATGCTAATTGAGGCTGAA<h2 style=";text-align:left;direction:ltr"> <h2 style=";text-align:left;direction:ltr"> EGKDTPGGYCLTRWMLIEAE 280<h2 style=";text-align:left;direction:ltr"> <h2 style=";text-align:left;direction:ltr">CTAAAATGCTTCGGGAACACAGCTGTGGCAAAATGTAATGAGAAGCATGATGAGGAATTT<h2 style=";text-align:left;direction:ltr"> <h2 style=";text-align:left;direction:ltr"> LKCFGNTAVAKCNEKHDEEF 300<h2 style=";text-align:left;direction:ltr"> <h2 style=";text-align:left;direction:ltr"> TGTGACATGCTGAGGCTGTTTGACTTCAACAAACAAGCCATTCAAAGGTTGAAAGCT<h2 style=";text-align:left;direction:ltr"> ccA <h2 style=";text-align:left;direction:ltr"> <h2 style=";text-align:left;direction:ltr"> CDMLRLFDFNKQAIQRLKA p 320<h2 style=";text-align:left;direction:ltr"> <h2 style=";text-align:left;direction:ltr"> GCACAAATGAGCATTCAGTTGATCAACAAAGCAGTAAATGCTTTTGATAAATGACCAACTT<h2 style=";text-align:left;direction:ltr"> <h2 style=";text-align:left;direction:ltr"> AQMSIQLINKAVNALINDQL 340<h2 style=";text-align:left;direction:ltr"> <h2 style=";text-align:left;direction:ltr"> ATAATGAAGAACCATCTACGGGACATCATG<h2 style=";text-align:left;direction:ltr"> tGt <h2 style=";text-align:left;direction:ltr"> ATTCCATACTGTAATTACAGCAAGTAT<h2 style=";text-align:left;direction:ltr"> <h2 style=";text-align:left;direction:ltr"> IMKNHLRDIM c IPYCNYSKY 360<h2 style=";text-align:left;direction:ltr"> <h2 style=";text-align:left;direction:ltr"> TGGTACCTCAACCACACAACTACTGGGAGAACATCACTGCCCAAATGTTGGCTTTGTATCA<h2 style=";text-align:left;direction:ltr"> <h2 style=";text-align:left;direction:ltr"> WYLNHTTTGRTSLPKCWLVS 380<h2 style=";text-align:left;direction:ltr"> <h2 style=";text-align:left;direction:ltr"> AATGGTTCATACTTGAACGAGACCCACTTTTCTGATGATATTGAACAACAAGCTGACAAT<h2 style=";text-align:left;direction:ltr"> <h2 style=";text-align:left;direction:ltr"> NGSYLNETHFSDDIEQQADN 400<h2 style=";text-align:left;direction:ltr"> <h2 style=";text-align:left;direction:ltr"> ATGATCACTGAGATGTTACAGAAGGAGTATATGGAGAGGCAGGGAAGACACCA<h2 style=";text-align:left;direction:ltr"> GGAGGG <h2 style=";text-align:left;direction:ltr"> <h2 style=";text-align:left;direction:ltr"> MITEMLQKEYMERQGKTP<h2 style=";text-align:left;direction:ltr"> G G 420 <h2 style=";text-align:left;direction:ltr"> <h2 style=";text-align:left;direction:ltr"> ATGTCCTGGATCACACAGGGACTTCTGGGAGCTCTTCTGTTGTGGATGGGAATCAATGCC <h2 style=";text-align:left;direction:ltr"> <h2 style=";text-align:left;direction:ltr"> M S W I T Q G L L G A L L L W M G I N A 440 <h2 style=";text-align:left;direction:ltr"> <h2 style=";text-align:left;direction:ltr"> CGTGACAGGTCAATTGCTATGACGTTTCTTGCGGTTGGAGGAGTTTTGCTCTTCCTTTCG R D R S I A M T F L A V G G V L L F L S 460 GTCAACGTCCATGCT GATCAAGGATGCGCCATCAACTTTGGCAAGAGAGAGCTCAAGTGC V N V H A D Q G C A I N F G K R E L K C 480 GGAGATGGTATCTTCATATTTAGAGACTCTGATGACTGGCTGAACAAGTACTCATACTAT G D G I F I F R D S D D W L N K Y S Y Y 500 CCAGAAGATCCTGTGAAGCTTGCATCAATAGTGAAAGCCTCTTTTGAAGAAGGGAAGTGT P E D P V K L A S I V K A S F E E G K C 520 GGCCTAAATTCAGTTGACTCC G L N S V D S 527

[0115] Nucleotide sequence and amino acid sequence of the deleted signal peptide (SSP) SEQ ID NO: 5 SEQ ID NO: 6 atgggacaaatagtgacattcttccaggaagtgcctcatgtaatagaagaggtgatgaac M G Q I V T F F Q E V P H V I E E V M N 20 attgttctcattgcactgtctgtactagcagtgctgaaaggtctgtacaattttgcaacg I V L I A L S V L A V L K G L Y N F A T 40 tgtggccttgttggtttggtcactttcctcctgttgtgtggtaggtcttgcaca C G L V G L V T F L L L C G R S C T 58

[0116] Nucleotide and amino acid sequences of the deleted LASV-GP2 transmembrane domain and cytoplasmic tail: SEQ ID NO:7 SEQ ID NO:8 TTGGGTCTAGTTGACCTCTTTGTGTTCAGCACAAGTTTCTATCTTATTAGCATCTTCCTT LGLVDLFVFSTSFYLISIFL 20 CACCTAGTCAAAATACCAACTCATAGGCATATTGTAGGCAAGTCGTGTCCCAAACCTCAC HLVKIPTHRHIVGKSCPKPH 40 AGATTGAATCATATGGGCATTTGTTCCTGTGGACTCTACAAACAGCCTGGTGTGCCTGTG RLNHMGICSCGLYKQPGVPV 60 AAATGGAAGAGA KWKR64

[0117] Lassa Josiah strain G protein sequence SEQ ID NO:9 (amino acids 1-58: signal sequence) (amino acids 59-259: GP1 domain) (amino acids 260-437: GP2 domain) (amino acids 438-481: transmembrane domain and cytoplasmic tail) MGQIVTFFQE VPHVIEEVMN IVLIALSVLA VLKGLYNFATCGLVGLVTFL 50 LLCGRSCTTS LYKGVYELQT LELNMETLNM TMPLSCTKNNSHHYIMVGNE 100 58 TGLELTLTNT SIINHKFCNL SDAHKKNLYDHALMSIISTF HLSIPNFNQY 150 EAMSCDFNGG KISVQYNLSH SYAGDAANHCGTVANGVLQT FMRMAWGGSY 200 IALDSGRGNW DCIMTSYQYL IIQNTTWEDHCQFSRPSPIG YLGLLSQRTR 250 DIYISRRLLG TFTWTLSDSE GKDTPGGYCLTRWMLIEAEL KCFGNTAVAK 300 259 CNEKHDEEFC DMLRLFDFNK QAIQRLKAEAQMSIQLINKA VNALINDQLI 350 MKNHLRDIMG IPYCNYSKYW YLNHTTTGRTSLPKCWLVSN GSYLNETHFS 400 DDIEQQADNM ITEMLQKEYM ERQGKTPLGLVDLFVFSTSF YLISIFLHLV 450 437 KIPTHRHIVG KSCPKPHRLN HMGICSCGLY KQPGVPVKWKR 481

[0118] NS1 signal sequence (SEQ ID NO:10) DQGCAINFG

[0119] YFV NS1-Lassa GP1 domain junction (SEQ ID NO:11) AINFG TSLYK

[0120] Lassa GP2 domain-WNV TM1 domain junction (SEQ ID NO: 12) QGKTP GGMSW

[0121] WNV TM2 domain-YFV NS1 junction (SEQ ID NO: 13) VNVHA DQGCA

[0122] TM1 sequence of WNV (SEQ ID NO:14) GGMSWITQGLLGALLLWMGINARD

[0123] WNV TM2 sequence (SEQ ID NO: 15) RSIAMTFLAVGGVLLFLSVNVHA

[0124] Drawing translation Figure 1 mutated cleavagesite 9 aa NS1 9 amino acids of NS1 ER lumen Cytosol cleavage site Figure 2 Passage 2 Passage 5 Figure 3 mutated cleavagesite AG129 mice n=9 each Vaccination bleeding Day 14 Day 28 Figure 4 Lassa neg ctrl Negative control Spots / 6*10 5 Splenocytes 6×10 5 Number of spots per splenocyte Figure 5 cleavage site Merge Figure 6 cleavage site AG129 mice Vaccination bleeding Day 14 Day 28 Neg-ctrl Negative control spots / 3*10 5 Splenocytes 3×10 5 Number of spots per splenocyte Antigens

Claims

1. 1. A polynucleotide comprising a sequence of an infectious, attenuated live flavivirus, wherein a nucleotide sequence encoding at least a portion of an arenavirus glycoprotein is arranged in an intergenic region between the E gene and NS1 gene of said flavivirus so as to express a chimeric virus, wherein the encoded sequences C-terminal to the E protein of said flavivirus and N-terminal to the signal peptide of the NS1 protein of said flavivirus are in the following order: an additional signal peptide of the NS1 protein of a flavivirus; an arenavirus glycoprotein lacking the N-terminal signal sequence and the GP2 transmembrane domain; The TM1 and TM2 domains of the E protein of a flavivirus; A polynucleotide comprising:

2. 2. The polynucleotide of claim 1, wherein the sequence of the infectious live attenuated flavivirus is a sequence of a yellow fever virus.

3. The polynucleotide of claim 1 or 2, wherein the arenavirus is a Mammarenavirus.

4. The polynucleotide according to any one of claims 1 to 3, wherein the arenavirus is a Lassa virus.

5. 5. The polynucleotide according to any one of claims 1 to 4, wherein the encoded protein sequence comprises the sequence of SEQ ID NO:2 or SEQ ID NO:

4.

6. The polynucleotide of any one of claims 1 to 5, wherein the glycoprotein comprises the stabilizing mutations R207C, G360C, and E329P.

7. The polynucleotide of any one of claims 1 to 6, wherein the glycoprotein comprises a proteolytic cleavage site of R246A.

8. The polynucleotide according to any one of claims 1 to 7, wherein the signal peptide of the NS1 protein comprises or consists of the sequence DQGCAINFG (SEQ ID NO: 10).

9. A polynucleotide according to any one of claims 1 to 8, wherein the TM1 domain of the E protein of a flavivirus has the sequence of SEQ ID NO: 14, or the TM2 domain of the E protein of a flavivirus has the sequence of SEQ ID NO: 15, or the sequence of the junction of the NS1 signal sequence and the GP1 domain of the chimeric virus comprises the sequence of SEQ ID NO:

11.

10. A polynucleotide described in any one of claims 1 to 9, wherein the sequence of the junction of the GP2 domain and the TM1 domain of the chimeric virus comprises the sequence of SEQ ID NO: 12, or the sequence of the junction of the TM2 domain and the NS1 protein of the chimeric virus comprises the sequence of SEQ ID NO:

13.

11. 11. The polynucleotide of any one of claims 1 to 10, comprising SEQ ID NO:11, SEQ ID NO:12 and SEQ ID NO:13 and encoding a sequence having at least 95% sequence identity with SEQ ID NO:2 or SEQ ID NO:4 outside SEQ ID NO:11, SEQ ID NO:12 and SEQ ID NO:

13.

12. 1. A chimeric, infectious, attenuated, live flavivirus, comprising at least a portion of an arenavirus glycoprotein between an E protein and an NS1 protein of said flavivirus, C-terminal to the E protein and N-terminal to the signal peptide of the NS1 protein, said virus comprising, in the following order: an additional signal peptide of the NS1 protein of a flavivirus; an arenavirus glycoprotein lacking the N-terminal signal sequence and the GP2 transmembrane domain; The TM1 and TM2 domains of the E protein of a flavivirus; a chimeric, live, infectious, attenuated flavivirus,

13. The chimeric flavivirus of claim 12, wherein the flavivirus is YFV.

14. The chimeric flavivirus of claim 12 or 13, wherein the arenavirus is a Lassa virus.

15. A medicament comprising a polynucleotide according to any one of claims 1 to 11 or a chimeric virus according to any one of claims 12 to 14.

Images