Method for producing nucleic acid oligomer

Abstract

The present invention provides an efficient method for producing nucleic acid oligomers, particularly a method for efficiently producing nucleic acid molecules having a phosphotriester bond by oxidizing a nucleic acid precursor having a phosphite triester bond. Specifically, the present invention provides a method for producing a nucleic acid compound having a nucleotide represented by formula (I) at its 5'-end by the phosphoramidite method, which comprises the step of reacting a precursor having a phosphite triester bond represented by formula (II) (the substituents in formulas (I) and (II) are defined as in the specification) with an oxidation solution containing iodine, pyridine, and water and having been heated. TIFF2023514503000046.tif44124

Description

[Technical field]

[0001] This patent application claims priority to and the benefit of Japanese Patent Application No. 2020-012789 (filed January 29, 2020), the entire contents of which are incorporated herein by reference. The present invention relates to a method for producing a nucleic acid oligomer. [Background technology]

[0002] Nucleic acid oligomers such as DNA and RNA are useful materials that can be used as DNA probes, RNA probes, antisense, ribozymes, siRNAs, aptamers, and the like.

[0003] Nucleic acid oligomers can be synthesized by solid-phase synthesis, in which phosphoramidites of nucleosides (hereinafter referred to as "amidites") are used as raw materials. The nucleic acid oligomers synthesized on a solid-phase support by extending the nucleic acid through the steps of coupling, oxidation, and deprotection are cleaved from the solid-phase support, and the protecting groups are then removed to produce the desired nucleic acid oligomer. The purity of the nucleic acid oligomers synthesized in this way is not necessarily satisfactory, and the synthesis is not efficient (see Non-Patent Document 1). [Prior art documents] [Non-patent literature]

[0004] [Non-Patent Document 1] Tetrahedron 69 (2013) 3615-3637 Summary of the Invention [Problem to be solved by the invention]

[0005] An object of the present invention is to provide a method for efficiently producing a nucleic acid oligomer. [Means for solving the problem]

[0006] As a result of intensive research conducted by the present inventors to achieve the above object, it has been found that a nucleic acid oligomer can be efficiently produced by using an oxidizing solution containing iodine, water and pyridine and subjected to a heat treatment as an oxidizing solution used in oxidizing a phosphite produced by a coupling reaction using a phosphoramidite in the synthesis of the nucleic acid oligomer.The present invention provides an efficient method for producing a nucleic acid oligomer.

[0007] The present invention includes the following aspects, but is not limited to these. Item 1. Formula (I): [ka] (In the formula, G 1 and G 2 each independently represents a protecting group for a hydroxyl group; B a represents a nucleobase which may be protected by a protecting group, R represents a protected hydroxyl group, a hydrogen atom, a fluorine atom, a methoxy group, a 2-methoxyethyl group, or an OQ′ group; Q' represents a methylene group bonded to the 4' carbon atom of ribose, an ethylene group bonded to the 4' carbon atom, or an ethylidene group bonded to the 4' carbon atom of ribose, and The bond marked with * indicates a bond to the 3' end of the nucleic acid.) The present invention relates to a method for producing a nucleic acid compound having a nucleotide represented by the formula (II): at the 5'-terminus by a phosphoramidite method. [ka] (In the formula, G 1 , G 2 , B a , R and * are as defined above.) The present invention relates to a method for producing a phosphite triester compound, comprising the steps of: reacting a precursor having a phosphite triester bond represented by the following formula: with an oxidizing solution containing iodine, pyridine and water that have been heated to 40° C. or higher (hereinafter referred to as the "oxidizing solution of the present invention" in this specification).

[0008] Item 2. A precursor having a phosphite triester bond represented by formula (4): [ka] (In the formula, G 1 represents a protecting group for a hydroxyl group, G 2 each independently represents the same or different hydroxyl-protecting group, B a each independently represents the same or different nucleobase which may be protected by a protecting group; R are each independently the same or different and each independently represent a protected hydroxyl group, a hydrogen atom, a fluorine atom, a methoxy group, a 2-methoxyethyl group, or an OQ′ group; Q' are each independently the same or different and each represent a methylene group bonded to the carbon atom at 4' position of ribose, an ethylene group bonded to the carbon atom at 4' position, or an ethylidene group bonded to the carbon atom at 4' position of ribose; Y's are independently the same or different and each represents an oxygen atom or a sulfur atom; n represents an integer between 1 and 200, When X represents OZ, W represents an OV group, and V represents a protecting group for a hydroxyl group; When X represents an R group, W represents a group represented by OZ; Z is a group having a structure consisting of a solid phase carrier and a linking group. When n is an integer of 2 or more, the nucleic acid compound represented by formula (4) may incorporate a non-nucleotide linker in place of at least one nucleotide between the 5'-terminal and 3'-terminal nucleotides. and the compound having a phosphate triester bond is represented by the formula (5): [ka] (In the formula, G 1 , G 2 , B a , R, n, W, X, and Y are as defined above, and As defined in formula (4), a non-nucleotide linker may be incorporated in place of the nucleotide. Item 2. The method for producing a nucleic acid compound according to Item 1, wherein the nucleic acid compound is represented by the formula:

[0009] Item 3. The nucleic acid compound of formula (5) is optionally extended in chain length by the amidite method to give formula (5'): [ka] (In the formula, G 2 , B a , R, X and W are as defined for formula (5); G 5 represents a protecting group for a hydroxyl group or a hydrogen atom, m is an integer satisfying m≧n, Each Y independently represents oxygen or sulfur. However, at least one Y is an oxygen atom. obtaining a nucleic acid compound represented by From the compound of formula (5'), the compound of formula (6): [ka] (In the formula, G 5 , R and m are as defined above; B c each independently represents the same or different nucleobase; G 4 represents a hydrogen atom, an alkali metal ion, an ammonium ion, an alkylammonium ion, or a hydroxyalkylammonium ion; Each Y independently represents oxygen or sulfur, and at least one Y is an oxygen atom; and X1 represents a hydroxyl group and W1 represents an OV group, where V represents a protecting group for the hydroxyl group, or X1 represents an R group, and W1 represents a hydroxyl group. Cut out the compound represented by The compound of formula (6) is then deprotected to give the compound of formula (7): [ka] (In the formula, m, Y, G 4 and B. c is as defined above, R' are each independently the same or different and each independently represent a hydroxyl group, a hydrogen atom, a fluorine atom, a methoxy group, a 2-methoxyethyl group, or an OQ' group; Q' are each independently the same or different and each represent a methylene group bonded to the carbon atom at 4' position of ribose, an ethylene group bonded to the carbon atom at 4' position, or an ethylidene group bonded to the carbon atom at 4' position of ribose; and, X 10 and W 10 each independently represents a hydroxyl group, or X 10 represents an R' group, and W 10 represents a hydroxyl group.) Item 3. The method for producing a nucleic acid oligomer according to Item 2, further comprising the step of producing a deprotected nucleic acid oligomer represented by the formula:

[0010] Item 4. The method according to any one of items 2 or 3 above, wherein the non-nucleotide linker is a linker having an amino acid backbone.

[0011] Item 5. The method according to item 4 above, wherein the linker having an amino acid skeleton is a linker having a structure selected from the group consisting of the following formulae (A14-1), (A14-2) and (14-3): [ka]

[0012] Item 6. The method according to any one of items 1 to 5 above, wherein the iodine concentration in the oxidation solution is 0.005 to 2M. Item 7. The method according to any one of items 1 to 5 above, wherein the iodine concentration in the oxidation solution is 0.005 to 0.2 M. Item 8. The method according to any one of items 1 to 5 above, wherein the iodine concentration in the oxidation solution is 0.007 to 0.1 M. Item 9. The method according to any one of items 1 to 5 above, wherein the iodine concentration in the oxidation solution is 0.008 to 0.07 M. Item 10. The method according to any one of items 1 to 9 above, wherein the oxidizing solution is prepared by mixing iodine, pyridine and water. Item 11. The method according to item 10, wherein the oxidation solution contains at least one solvent selected from the group consisting of acetonitrile and tetrahydrofuran. Item 12. The method according to item 10 or 11 above, wherein the oxidation solution further contains an acetonitrile solvent. Item 13. The method according to item 11, wherein the solvent of the oxidation solution is a mixed solvent obtained by mixing pyridine, water, acetonitrile, and tetrahydrofuran in a volume ratio of 1-90:1-50:0-90:0-90. Item 14. The method according to item 11 or 12, wherein the solvent of the oxidation solution is a mixed solvent of pyridine, water, and acetonitrile in a volume ratio of 1-90:1-50:0-90. Item 15. The method according to any one of Items 1 to 14, wherein the oxidation solution is stored and aged at a temperature of 40° C. or higher and 60° C. or lower from the time of its preparation until its use in an oxidation reaction in nucleic acid synthesis. Item 16. The method according to any one of items 1 to 15 above, wherein the nucleic acid compound is a nucleic acid compound containing ribonucleoside (RNA). Item 17. The method according to any one of items 2 to 16 above, wherein the nucleic acid is a ribonucleoside (RNA) and the 2'-protecting group is a protecting group represented by formula (12). Equation (12): [ka] (In the formula, q represents an integer of 1 to 5; R a and R b are the same or different and each represents a methyl group, an ethyl group, or a hydrogen atom; The bond marked with an * is the oxygen of the OQ group, and E W The group represents an electron-withdrawing group. Section 18.R a and R b are simultaneously hydrogen atoms, and E W is a cyano group. Item 19. The method according to any one of items 1 to 18, wherein the nucleic acid is a ribonucleoside (RNA) having a chain length of 40 or more. Item 20. The method according to any one of items 1 to 19, further comprising the step of preparing the oxidizing solution according to item 1. Effect of the Invention

[0013] The present invention provides an efficient method for producing a nucleic acid oligomer. The production method of the present invention is expected to improve the purity of the produced nucleic acid oligomer. [Brief description of the drawings]

[0014] [Figure 1] 1 is a diagram showing a scheme of steps (1) to (6) of the production method of the present invention. DETAILED DESCRIPTION OF THE PREFERRED EMBODIMENTS

[0015] The present invention describes a method for producing a high-quality nucleic acid oligomer by the phosphoramidite method, which comprises a step of reacting a precursor having a phosphite triester bond represented by the formula (II) at the 5'-end with an oxidizing solution (the oxidizing solution of the present invention) that contains iodine, pyridine and water and has been heated.

[0016] A method for producing a nucleic acid compound is described, which comprises a step of reacting a nucleic acid precursor having a phosphite triester bond with an oxidation solution containing iodine, pyridine and water to oxidize the precursor to a phosphate triester bond, wherein the oxidation solution is a heat-treated oxidation solution.

[0017] Iodine can be used as the oxidizing agent, and the concentration of iodine in an oxidizing solution containing iodine, pyridine and water is usually adjusted to 0.005 to 2M, preferably 0.005 to 0.2M, more preferably 0.007 to 0.1M, and even more preferably 0.008 to 0.07M.

[0018] The oxidizing solution contains iodine, water, and pyridine, and the solvent may be acetonitrile, tetrahydrofuran (THF), or a mixture of these solvents in any ratio. A mixed solvent of pyridine and water, or a mixed solvent of pyridine, water, and acetonitrile is preferable.

[0019] The solution composition can be, typically, a solvent in which 1 to 90 volume % pyridine, 1 to 50 volume % water, 0 to 90 volume % acetonitrile, and 0 to 90 volume % tetrahydrofuran are mixed at random in volume ratios relative to the total volume of the solution to make 100 volume %, and preferably, a solvent in which 5 to 90 volume % pyridine, 2 to 30 volume % water, 0 to 80 volume % acetonitrile, and 0 to 80 volume % tetrahydrofuran are mixed at random in volume ratios to make 100 volume %, and more preferably, a solvent in which 90 volume % pyridine and 10 volume % water are mixed, or a solvent in which 6 volume % pyridine, 30 volume % water, and 64 volume % acetonitrile are mixed.

[0020] Although it is not essential to stir the reaction system when preparing the oxidizing solution, the stirring power Pv is usually set to 0.0 to 0.5 kW / m 3 Stirring is performed in the range of Pv 0.1 to 0.3 kW / m 3 It is preferable to stir the mixture in an amount of 1000g / ml.

[0021] The oxidizing solution may be heat-treated at a higher iodine concentration than the final iodine concentration of the oxidizing solution, in which case the iodine concentration is adjusted to the final iodine concentration by diluting with a solvent after storage and aging before use.

[0022] The temperature for storage and aging of the oxidation solution used in the oxidation step in the production method of the present invention from its preparation until its use in the oxidation reaction in nucleic acid synthesis is from 20° C. to 80° C., preferably from 40° C. to 60° C., typically 60° C. The storage and aging period is 1 hour or more, preferably from 24 hours to 1 week, typically 24 hours.

[0023] The oxidizing solution can be stored in a glass, plastic, or metal container. As the plastic container, a container made of polyethylene or polypropylene can be used, and as the metal container, a container made of SUS or Hastelloy can be used.

[0024] The oxidizing solution can be stored under an air atmosphere or an inert gas atmosphere, and the inert gas can be argon, nitrogen, carbon dioxide, helium, or the like.

[0025] An example of a compound containing a phosphite triester bond is the compound of the above formula (4). An example of a nucleic acid compound produced by the action of an oxidizing solution is the nucleic acid compound of the above formula (5). In formulas (4) and (5), Q' is independently the same or different and represents a methylene group bonded to the carbon atom at 4' position of ribose, an ethylene group bonded to the carbon atom at 4' position, or an ethylidene group bonded to the carbon atom at 4' position, and the compound has the structure of formula (8) below.

[0026] [ka] (In the formula, B arepresents an optionally protected nucleobase.

[0027] More specifically, Z represents a solid phase carrier and a linking portion connecting the solid phase carrier and the oxygen atom of the hydroxyl group at the 2'-position or 3'-position of ribose at the 3'-end of the nucleic acid oligomer, and Z represents a structure represented by the following formula (9): [ka] In formula (9), Sp represents a spacer. An example of the spacer (Sp) is one having the structural formula shown in formula (10) below.

[0028] [ka]

[0029] The Linker may be, for example, a structure shown in the following formula (11), or a structure not having a hexamethyleneamino group portion in the structure of formula (11) and having an aminopropyl group bonded to Si. Alternatively, the Linker may be a structure shown in the following formula (15). [ka] (In the formula, A may be any of a hydroxyl group, an alkoxy group, and an alkyl group. Examples of the alkoxy group include a methoxy group and an ethoxy group. Examples of the alkyl group include a methyl group, an ethyl group, an isopropyl group, and an n-propyl group. Si indicates that it is bonded to the oxygen of a hydroxyl group on the surface of the carrier. Examples of solid supports include inorganic porous supports and organic resin supports. Examples of inorganic porous supports include controlled pore glass (CPG). Examples of organic resin supports include supports made of polystyrene.

[0030] Nucleosides (ribose and deoxyribose) contained in the nucleic acid oligomer used in the present invention include, but are not limited to, DNA, RNA, 2'-O-MOE (2'-O-methoxyethyl), 2'-O-Me, 2'-F RNA, and the above-mentioned LNA.

[0031] The method for synthesizing a nucleic acid oligomer by a solid phase synthesis method including an oxidation step using an oxidizing solution typically includes the following steps. (1) deprotecting the 5'-hydroxyl group of a nucleoside having a protected hydroxyl group bound to a solid phase support via a linker; (2) a step of coupling the 5'-hydroxyl group generated in the above step with a phosphoramidite compound to obtain a phosphite triester compound; (3) oxidizing the phosphite triester produced in the previous step to convert it to a phosphate triester bond to produce an extended nucleic acid molecule, or, optionally, converting it to a thiophosphate triester; (4) synthesizing a nucleic acid molecule on a solid support by repeating a series of reaction cycles consisting of the steps (1) to (3), i.e., a step of deprotecting the hydroxyl group at the 5' position of the generated nucleic acid molecule, a step of coupling the hydroxyl group at the 5' position with an amidite compound, and a step of oxidizing the generated phosphite triester, any number of times; and (5) A step of excising the nucleic acid molecule on the solid phase carrier produced in step (4) and subjecting the excised nucleic acid molecule to a deprotection reaction to release it from the solid phase carrier, thereby producing a nucleic acid oligomer from which the protecting groups have been removed. However, the method for synthesizing the nucleic acid oligomer may include a step of capping the 5'-position hydroxyl group that has not undergone the coupling reaction with the phosphoramidite compound following step (2) or (3), and a capping step may be added between any of the steps in the series of reaction cycles that constitute step (4).

[0032] More specifically, the step (5) is carried out by subjecting the nucleic acid molecule on the solid phase carrier produced in step (4) to the following reactions in the order of steps (5-1) and (5-2), and then to the reaction in step (5-3). Here, the reaction in step (5-1) may be carried out as desired, and the reaction in step (5-2) may be carried out using the method described in Japanese Patent No. 4705716. As a result, a nucleic acid oligomer in which the protecting group has been removed from the nucleic acid molecule released from the solid phase carrier, or a nucleic acid oligomer in which the hydroxyl group has been protected, can be produced. (5-1) a reaction for deprotecting the protecting group of the hydroxyl group at the 5' end of a nucleic acid molecule; (5-2) a reaction for isolating and releasing the nucleic acid molecule from the solid phase carrier; and (5-3) A reaction for removing the protecting group at the 3'-position of the hydroxyl group at the 2'-position or 3'-terminal of ribose constituting a nucleic acid molecule.

[0033] The scheme of the steps (1) to (6) is shown in Figure 1. The oxidation reaction in step (3) or step (4) shown in Figure 1 is carried out using the above-mentioned oxidation solution. The definitions of the substituents in the chemical formula in Scheme A are as defined above.

[0034] The nucleic acid compound of formula (5) can be further extended to any desired chain length using a nucleotide or non-nucleotide linker by the amidite method, and used to produce the nucleic acid compound of formula (5'). The nucleic acid compound alone can be cut out from the nucleic acid compound bound to the solid support of formula (5') to obtain the nucleic acid oligomer of formula (6), which can then be deprotected to obtain the nucleic acid oligomer of formula (7). The substituents in each formula will be described in more detail below.

[0035] B aThe nucleic acid base that may be protected by a protecting group represented by the formula (I) is not particularly limited. Examples of the nucleic acid base include adenine, cytosine, guanine, uracil, thymine, 5-methylcytosine, pseudouracil, and 1-methylpseudouracil. The nucleic acid base may also be substituted with a substituent. Examples of such a substituent include halogen atoms such as fluoro, chloro, bromo, and iodine groups, acyl groups such as acetyl groups, alkyl groups such as methyl and ethyl groups, arylalkyl groups such as benzyl groups, alkoxy groups such as methoxy groups, alkoxyalkyl groups such as methoxyethyl groups, cyanoalkyl groups such as cyanoethyl groups, hydroxy groups, hydroxyalkyl groups, acyloxymethyl groups, amino groups, monoalkylamino groups, dialkylamino groups, carboxy groups, cyano groups, and nitro groups, as well as combinations of two or more of these substituents.

[0036] When a nucleic acid base has an amino group outside the ring, the protecting group for the amino group is not particularly limited, and any protecting group known in nucleic acid chemistry can be used. Examples of such protecting groups include benzoyl, 4-methoxybenzoyl, acetyl, propionyl, butyryl, isobutyryl, phenylacetyl, phenoxyacetyl, 4-tert-butylphenoxyacetyl, 4-isopropylphenoxyacetyl, and (dimethylamino)methylene groups, as well as combinations of two or more of these protecting groups.

[0037] B a More specifically, [ka]

[0038] (In the above formula, R 4 represents a hydrogen atom, a methyl group, a phenoxyacetyl group, a 4-tert-butylphenoxyacetyl group, a 4-isopropylphenoxyacetyl group, a phenylacetyl group, an acetyl group, or a benzoyl group, R5 represents a hydrogen atom, an acetyl group, an isobutyryl group, or a benzoyl group, R 6 represents a hydrogen atom, a phenoxyacetyl group, a 4-tert-butylphenoxyacetyl group, a 4-isopropylphenoxyacetyl group, a phenylacetyl group, an acetyl group, or an isobutyryl group, R 7 represents a 2-cyanoethyl group, R 8 represents a hydrogen atom, a methyl group, a benzoyl group, a 4-methoxybenzoyl group, or a 4-methylbenzoyl group, and R 9 represents a dimethylaminomethylene group. The group represented by any one of the following formulas:

[0039] G 1 As the protecting group, any protecting group that can function as a protecting group can be used without particular limitation, and a wide variety of known protecting groups used in amidite compounds can be used.

[0040] G 1 is preferably the following group: [ka] (In the formula, R 1 , R 2 and R 3 are each independently the same or different and represent a hydrogen atom or an alkoxy group.

[0041] R 1 , R 2 and R 3 It is preferred that one of them is hydrogen and the remaining two are the same or different (preferably the same) alkoxy groups, and the alkoxy group is particularly preferably a methoxy group.

[0042] G 2 As the protecting group, there is no particular limitation so long as it can function as a protecting group, and a wide variety of known protecting groups used in amidite compounds can be used. 2Examples of the alkyl group include an alkyl group, an alkenyl group, an alkynyl group, a cycloalkyl group, a haloalkyl group, an aryl group, a heteroaryl group, an arylalkyl group, a cycloalkenyl group, a cycloalkylalkyl group, a cyclylalkyl group, a hydroxyalkyl group, an aminoalkyl group, an alkoxyalkyl group, a heterocyclylalkenyl group, a heterocyclylalkyl group, a heteroarylalkyl group, a silyl group, a silyloxyalkyl group, a mono-, di-, or trialkylsilyl group, and a mono-, di-, or trialkylsilyloxyalkyl group, which may be substituted with one or more electron-withdrawing groups.

[0043] G 2 is preferably an alkyl group substituted with an electron-withdrawing group. Examples of the electron-withdrawing group include a cyano group, a nitro group, an alkylsulfonyl group, a halogen atom, an arylsulfonyl group, a trihalomethyl group, and a trialkylamino group, and is preferably a cyano group.

[0044] G 2 Particularly preferred as are, for example, the following groups: [ka]

[0045] G 3 is two G 3 may be bonded to each other to form a ring structure. 3 It is preferable that both of the groups are isopropyl groups.

[0046] R 1 , R 2 , R 3 and G 2The alkyl group in the definition may be either linear or branched, and is preferably an alkyl group having 1 to 12 carbon atoms, more preferably an alkyl group having 1 to 6 carbon atoms. Specific examples of the alkyl group include a methyl group, an ethyl group, an n-propyl group, an isopropyl group, an n-butyl group, an isobutyl group, a tert-butyl group, an n-pentyl group, an isopentyl group, and a hexyl group. The alkyl group moiety constituting the alkoxy group in the definition of the substituent has the same definition as the alkyl group here.

[0047] In the method of the present invention, the amidite compound can be used in a free state or in a salt state. The salt of the amidite compound can be, but is not particularly limited to, a base addition salt or an acid addition salt. Specific examples of the base addition salt include salts with inorganic bases such as sodium salts, magnesium salts, potassium salts, calcium salts, and aluminum salts; salts with organic bases such as methylamine, ethylamine, and ethanolamine; salts with basic amino acids such as lysine, ornithine, and arginine; and ammonium salts. Specific examples of the acid addition salt include mineral acids such as hydrochloric acid, hydrobromic acid, hydroiodic acid, sulfuric acid, nitric acid, and phosphoric acid; organic acids such as formic acid, acetic acid, propionic acid, oxalic acid, malonic acid, malic acid, tartaric acid, fumaric acid, succinic acid, lactic acid, maleic acid, citric acid, methanesulfonic acid, trifluoromethanesulfonic acid, and ethanesulfonic acid; and acid addition salts with acidic amino acids such as aspartic acid and glutamic acid. The amidite compounds also include salts, hydrates, solvates, crystal polymorphs, and other such forms.

[0048] When R represents a protected hydroxyl group, the protecting group may be any that can be used in the amidite method, such as 2'-tert-butyldimethylsilyl (TBDMS) group, 2'-bis(2-acetoxy)methyl (ACE) group, 2'-(triisopropylsilyloxy)methyl (TOM) group, 2'-(2-cyanoethoxy)ethyl (CEE) group, 2'-(2-cyanoethoxy)methyl (CEM) group, 2'-para-tolylsulfonylethoxymethyl (TEM) group, and 2'-EMM group (WO 2006 / 022323), as well as those described in WO 2013 / 027843 and WO 2019 / 208571. Of these ribonucleoside (RNA) 2' protecting groups, the protecting group represented by the formula (12) is exemplified as a preferred protecting group. More preferably, E W An example of the electron-withdrawing group represented by formula (13) is a protecting group having a cyano group. [ka] (In the formula, q, R a and R b is as defined above, except that R a and R b does not simultaneously represent a hydrogen atom.)

[0049] The protecting group represented by formula (13) can be synthesized, for example, according to the methods described in WO 2013 / 027843 and WO 2019 / 208571, and an amidite compound having such a protecting group can be used for producing a nucleic acid compound. For the extension reaction of nucleic acid, an amidite compound of formula (3) shown in Scheme A of FIG. 1 is used. Examples of non-nucleotide linkers include linkers consisting of an amino acid skeleton (for example, linkers consisting of an amino acid skeleton described in Japanese Patent No. 5157168 or Japanese Patent No. 5554881). Specifically, non-limiting examples include linkers represented by formula (A14-1), formula (A14-2) or formula (A14-3). In addition to these linkers, examples include linkers described in International Publication No. 2012 / 005368, International Publication No. 2018 / 182008 or International Publication No. 2019 / 074110. [ka]

[0050] Nucleotides and amidites having the R group in formula (3) and the R' group in formula (4) can also be produced from nucleosides synthesized by known methods described in Japanese Patent No. 3745226, WO 2001 / 053528, JP 2014-221817, and known methods cited therein. Furthermore, they can be produced using commercially available products according to the methods described in the Examples below or by appropriately modifying these methods.

[0051] In the synthesis of a nucleic acid compound by the amidite method in the steps (1) to (6), except for the oxidation reaction step related to the present invention in step (3) in the scheme of Figure 1, a nucleic acid extension reaction can be carried out by repeating each step of the deprotection step and the condensation step according to a generally known method (for example, the method described in the above-mentioned Japanese Patent No. 5157168 or Japanese Patent No. 5554881). Each step will be described below.

[0052] G 4represents a hydrogen atom, an alkali metal ion, an ammonium ion, an alkylammonium ion, or a hydroxyalkylammonium ion. Examples of the alkali metal ion include a sodium ion and a lithium ion. Examples of the alkylammonium ion include methyl, ethyl, n-propyl, isopropyl, n-butyl, isobutyl, tert-butyl, n-pentyl, isopentyl, and hexyl, and more specifically, examples of the alkyl group include an ammonium ion, a diethylammonium ion, a triethylammonium ion, a tetrabutylammonium ion, a hexylammonium ion, and a dibutylammonium ion. Examples of the hydroxyalkyl ammonium ion include hydroxymethyl, hydroxyethyl, hydroxy-n-propyl, hydroxyisopropyl, hydroxy-n-butyl, and trishydroxymethyl, and more specifically, examples of the hydroxyalkyl ammonium ion include a trishydroxymethylammonium ion.

[0053] G 5 represents a hydrogen atom or a protecting group, and when it represents a protecting group, it is G 1 It represents the same protecting group as G 5 is a hydrogen atom when deprotected, and the nucleotide compound in this case is also subjected to a series of steps in a nucleic acid extension reaction.

[0054] (Nucleic acid extension reaction) In this specification, the term "nucleic acid extension reaction" refers to a reaction in which nucleotides are sequentially linked via phosphodiester bonds to extend an oligonucleotide. The nucleic acid extension reaction can be carried out according to the general procedure of the phosphoramidite method. The nucleic acid extension reaction may be carried out using an automatic nucleic acid synthesizer that employs the phosphoramidite method.

[0055] The chain length of the nucleic acid oligomer may be, for example, 2 to 200 mer, 10 to 150 mer, or 15 to 110 mer.

[0056] The 5'-deprotection step of step (1) is a step of deprotecting the protecting group of the 5' hydroxyl group at the end of the RNA strand supported on the solid phase support. Common protecting groups include 4,4'-dimethoxytrityl group (DMTr group), 4-monomethoxytrityl group, and 4,4',4"-trimethoxytrityl group. Deprotection can be carried out using an acid. Examples of acids for deprotection include trifluoroacetic acid, dichloroacetic acid, trifluoromethanesulfonic acid, trichloroacetic acid, methanesulfonic acid, hydrochloric acid, acetic acid, and p-toluenesulfonic acid.

[0057] The condensation step of step (2) is a reaction in which a nucleoside phosphoramidite represented by the following formula (3) shown in scheme A of FIG. 1 is bonded to the 5' hydroxyl group at the end of the oligonucleotide chain deprotected by the deprotection step. The phosphoramidite used for nucleic acid elongation is an amidite compound represented by formula (3) or (A12). Other usable phosphoramidites include 2'-OMe, 2'-F, 2'-O-tert-butyldimethylsilyl group, 2'-O-methoxyethyl group, 2'-H, 2'-fluoro-2'-deoxy-β-D-arabinofuranosyl, and the like. The nucleoside phosphoramidite used has a 5' hydroxyl group protected by a protecting group (e.g., DMTr group). The condensation step can be carried out using an activator that activates the nucleoside phosphoramidite. Examples of the activator include 5-benzylthio-1H-tetrazole (BTT), 1H-tetrazole, 4,5-dicyanoimidazole (DCI), 5-ethylthio-1H-tetrazole (ETT), N-methylbenzimidazolium triflate (N-MeBIT), benzimidazolium triflate (BIT), N-phenylimidazolium triflate (N-PhIMT), imidazolium triflate (IMT), 5-nitrobenzimidazolium triflate (NBT), 1-hydroxybenzotriazole (HOBT), and 5-(bis-3,5-trifluoromethylphenyl)-1H-tetrazole.

[0058] The nucleotide phosphoramidite (hereinafter referred to as amidite) represented by formula (3) in Scheme A of FIG. 1 is as follows: formula: [ka] (In the formula, G 1 , G 2 , G 3 , B a and R is as defined above.

[0059] After the condensation step, the unreacted 5' hydroxyl group may be appropriately capped using a known capping solution such as an acetic anhydride-tetrahydrofuran solution or a phenoxyacetic anhydride / N-methylimidazole solution.

[0060] The oxidation step of step (3) is a step of converting the phosphorous acid group formed in the condensation step into a phosphorous or thiophosphoric acid group. This step is a reaction of converting trivalent phosphorus into pentavalent phosphorus using an oxidizing agent, and can be carried out by allowing the oxidizing agent to act on an oligonucleic acid derivative supported on a solid phase carrier. When converting a phosphorous group to a phosphoric group, for example, iodine can be used as an "oxidizing agent". The oxidizing agent can be prepared to have a concentration of 0.005 to 2M. Water can be used as an oxygen source for oxidation, and pyridine or the like can be used as a base to advance the reaction. The solvent is not particularly limited as long as it is not involved in the reaction, and acetonitrile, tetrahydrofuran (THF), or a mixture of these in any ratio can be used. For example, iodine / water / pyridine / acetonitrile, iodine / water / pyridine, or iodine / water / pyridine / THF can be used. The reaction temperature is preferably 5°C to 50°C. The reaction time is usually appropriate to be 1 minute to 30 minutes. The amount of the reagent used is preferably 1 to 100 moles, more preferably 1 to 10 moles, relative to 1 mole of the compound supported on the solid phase carrier.

[0061] When converting a phosphite triester group into a thiophosphate group, for example, sulfur, 3H-1,2-benzodithiol-3-one-1,1-dioxide (Beaucage reagent), 3-amino-1,2,4-dithiazole-5-thione (ADTT), 5-phenyl-3H-1,2,4-dithiazol-3-one (POS), [(N,N-dimethylaminomethylidene)amino]-3H-1,2,4-dithiazoline-3-thione (DDTT), and phenylacetyl disulfide (PADS) can be used as the "oxidizing agent". The oxidizing agent can be used after diluting with a suitable solvent to a concentration of 0.001 to 2M. The solvent used in the reaction is not particularly limited as long as it is not involved in the reaction, and examples thereof include dichloromethane, acetonitrile, pyridine, or any mixed solvent thereof. The oxidation step may be performed after the capping operation, or conversely, the capping operation may be performed after the oxidation step, and the order is not limited.

[0062] In step (5), after the synthesis of a nucleic acid having a desired sequence is completed, an amine compound is used to remove the protecting group of the phosphate moiety. Examples of the amine compound include diethylamine described in Japanese Patent No. 4705716.

[0063] The protecting group of the 5' hydroxyl group of the nucleoside introduced at the end of the elongation may be used for column purification using the 5' protecting group as a tag after cleavage from the solid phase support and deprotection of the protecting group as described below, or the protecting group of the 5' hydroxyl group may be deprotected after column purification.

[0064] In step (5), the nucleic acid oligomer that has been elongated to a desired length on the solid phase support is usually cleaved from the solid phase support using concentrated aqueous ammonia as a cleavage agent.

[0065] Furthermore, for example, the oligonucleotide chain is cleaved from the solid phase support and recovered using ammonia or an amine compound, etc. Examples of the amine compound include methylamine, ethylamine, isopropylamine, ethylenediamine, diethylamine, etc.

[0066] In step (6), the protecting group of the hydroxyl group at the 2nd or 3rd position of the ribose of the nucleic acid compound (6) cleaved from the solid phase support in step (5) can be removed according to the methods described in WO 2006 / 022323, WO 2013 / 027843, or WO 2019 / 208571 to obtain a deprotected nucleic acid oligomer (7).

[0067] Nucleic acid oligomers that can be produced using the production method of the present invention include, but are not limited to, nucleic acid oligomers in which the nucleosides contained therein are RNA, DNA, and RNA having 2'-O-MOE, 2'-O-Me, 2'-F, and LNA. For example, examples of various nucleosides described in Xiulong, Shen et al., Nucleic Acids Research, 2018, Vol. 46, No. 46, 1584-1600, and Daniel O'Reilly et al., Nucleic Acids Research, 2019, Vol. 47, No. 2, 546-558 can be mentioned.

[0068] Typical examples of nucleic acid oligomers that can be used in the production method of the present invention are shown below in addition to the examples described in the Examples, but are not limited to these. In the following explanation of the sequences, U represents uridine, C represents cytidine, A represents adenosine, and G represents guanosine. Examples of the nucleic acid oligomers described in International Publication No. 2019 / 060442 include those having the following sequences (B) and (C). Sequence (B): 5'-AUGGAAUmACUCUUGGUUmACdTdT-3' (Antisense) (SEQ ID NO: 3) 21mer Sequence (C): 5'-GUmAACmCmAAGAGUmAUmUmCmCmAUmdTdT-3' (Sense) (SEQ ID NO: 4) 21mer In sequences (B) and (C), Um represents 2'-O-methyluridine, Cm represents 2'-O-methylcytidine, and dT represents thymidine. Examples of such oligonucleotides include the nucleic acid oligomers described in Daniel O'Reilly et al., Nucleic Acids Research, 2019, Vol. 47, No. 2, 546-558 (see page 553). A typical example is a nucleic acid oligomer having the following sequence (D): Sequence (D): 5'-AGAGCCAGCCUUCUUAUUGUUUUAGAGCUAUGCUGU-3' (SEQ ID NO: 5) 36mer An example of such an oligonucleotide is the nucleic acid oligomer described in Japanese Patent No. 4965745. A typical example of such an oligonucleotide is the nucleic acid oligomer having the following sequence (E): Sequence (E): 5'-CCAUGAGAAGUAUGACAACAGCC-P-GGCUGUUGUCAUACUUCUCAUGGUU-3' 49mer. CCAUGAGAAGUAUGACAACAGCC (SEQ ID NO: 6), GGCUGUUGUCAUACUUCUCAUGGUU (SEQ ID NO: 7). In sequence (E), "P" is represented by the partial structure separated by a wavy line in the following formula (A5). An example is a nucleic acid oligomer having the following sequence (F), which is described in Nucleic Acids Research, 2019, Vol. 47, No. 2: 547. Sequence (F): 5'-ACAGCAUAGCAAGUUAAAAUAAGGCUAGUCCGUUAUCAACUUGAAAAAGUGGCACCGAGUCGGUGCU-3' (SEQ ID NO: 8) 67mer An example is a nucleic acid oligomer having the following sequence (G), which is described on page 173 of JP2015-523856. Sequence (E): 5'-GUUUUCCCUUUUCAAAGAAAUCUCCUGGGCACCUAUCUUCUUAGGUGCCCUCCCUUGUUUAAACCUGACCAGUUAACCGGCUGGUUAGGUUUUU-3' (SEQ ID NO: 9) 94mer Examples of such oligonucleotides include those described in Japanese Patent Application Publication No. 2017-537626. Typical examples of such oligonucleotides include nucleic acid oligomers having the following sequences (F), (G), (H), and (J). Sequence (F): 5'-AGUCCUCAUCUCCCUCAAGCGUUUUAGAGCUAGUAAUAGCAAGUUAAAAUAAGGCUAGUCCGUUAUCAACUUGAAAAAGUGGCACCGAGUCGGUGCUUUU-3' (SEQ ID NO: 10) 100mer Sequence (G): 5'-GCAGAUGUAGUGUUUCCACAGUUUAAGAGCUAUGCUGGAAACAGCAUAGCAAGUUUAAAUAAGGCUAGUCCGUUAUCAACUUGAAAAAGUGGCACCGAGUCGGUGCUUUUUUU-3' (SEQ ID NO: 11) 113mer Sequence (H): 5'-dAdGdTdCdCdTdCdAdTdCdTdCdCdCdTdCdAdAdGdCGUUUAAGAGCUAUGCUGGUAACAGCAUAGCAAGUUUAAAUAAGGCUAGUCCGUUAUCAACUUGAAAAAGUGGCACCGAGUCGGUGCUUUUUUU -3' (SEQ ID NO: 12) 113mer In the sequence (H), dT represents thymidine, dC represents 2'-deoxycytidine, dA represents 2'-deoxyadenosine, and dG represents 2'-deoxyguanosine. Sequence (J): 5'-AmsGmsUmsCCUCAUCUCCCUCAAGCGUUUAAGAGCUAUGCUGGUAACAGCAUAGCAAGUUUAAAUAAGGCUAGUCCGUUAUCAACUUGAAAAAGUGGCACCGAGUCGGUGCUUUUmsUmsU-3' (SEQ ID NO: 13) 113mer In sequence (J), Um represents 2'-O-methyluridine, Cm represents 2'-O-methylcytidine, Am represents 2'-O-methyladenosine, Gm represents 2'-O-methylguanosine, and s represents a phosphorothioate modification. EXAMPLES

[0069] The present invention will be described in more detail below with reference to examples, but the present invention is not limited to these examples.

[0070] <Measurement method> First, the various measurement methods used in the following tests are shown below.

[0071] Oligonucleotide purity was determined using HPLC. The HPLC measurement conditions are shown in Table 1 below. (Measurement method 1: Measurement of oligonucleotide purity) [Table 1]

[0072] (Measurement method 2: Measurement of oligonucleotide yield) The OD of the crude product 260 The OD was measured. 260 represents the UV260nm absorbance per 10mm path length in 1mL solution (pH=7.5). It is generally known that 1OD=40μg for RNA, so the above OD 260 The yield was calculated based on the measured values.

[0073] <Solid-phase synthesis of oligonucleotides> Sequence (I): 5'-AGCAGAGUACACACAGCAUAUACC-P-GGUAUAUGCUGUGUGUACUCUGCUUC-PG-3' (SEQ ID NOs: 1 and 2) 3mer In the sequence (I), "A" is represented by the partial structure separated by a wavy line in the following formula (A1). "C" is represented by the partial structure separated by a wavy line in the following formula (A2). "G" is represented by the partial structure separated by a wavy line in the following formula (A3). U is represented by the partial structure separated by a wavy line in the following formula (A4). "P" is represented by the partial structure separated by a wavy line in the following formula (A5). Incidentally, "A" at the 5'-end is represented by the partial structure separated by a wavy line in the following formula (A6). Also, "G" at the 3'-end is represented by the partial structure separated by a wavy line in the following formula (A7). AGCAGAGUAC ACACAGCAUA UACC (SEQ ID NO: 1) GGUAUAUGCU GUGUGUACUC UGCUUC (SEQ ID NO: 2)

[0074] [ka]

[0075] [ka]

[0076] [ka]

[0077] [ka]

[0078] [ka]

[0079] [ka]

[0080] [ka]

[0081] The oligonucleotide having the above sequence (I) was synthesized from the 3' to 5' end by phosphoramidite solid phase synthesis using Controlled Pore Glass (CPG) as a solid phase support and NTS M-4MX-E (Nihon Techno Service Co., Ltd.) as a nucleic acid synthesizer. When NTS M-4MX-E (Nihon Techno Service Co., Ltd.) was used, the synthesis was carried out on a scale of about 1 μmol. In addition, for the synthesis, the uridine EMM amidite described in Example 2 of US2012 / 0035246, the cytidine EMM amidite described in Example 3, the adenosine EMM amidite described in Example 4, the guanosine EMM amidite described in Example 5, and compound (3) described in International Publication No. 2017 / 188042 were used, a high-purity trichloroacetic acid toluene solution was used as the deblocking solution, 5-benzylmercapto-1H-tetrazole was used as the condensing agent, an iodine solution was used as the oxidizing agent, and a phenoxyacetic anhydride solution and N-methylimidazole solution were used as the capping solution.

[0082] [ka]

[0083] [ka]

[0084] [ka]

[0085] [ka]

[0086] [ka]

[0087] Next, specific examples of the production of nucleic acid oligomers produced by the method of the present invention will be described. Here, in the following examples, the oligonucleotides produced by the method of the present invention are nucleic acid oligomers having the above-mentioned SEQ ID NOs: 1 and 2. The guanosine derivative described in the following Examples and Comparative Examples means a compound represented by the following structural formula: The circle illustrated in the following structural formula is a schematic representation of CPG. [ka]

[0088] Example 1 Using a controlled pore glass (CPG) carrying 1.07 μmol of a guanosine derivative and an amidite shown in formula (A8), formula (A9), formula (A10), formula (A11), or formula (A12), the nucleic acid oligomer shown in sequence (I) was automatically synthesized from the 3' side to the 5' side by NTS M-4MX-E (manufactured by Nippon Techno Service Co., Ltd.). The procedure for automatic synthesis was as follows: first, 3% trichloroacetic acid toluene solution was fed to 1.4 mL CPG each time to deprotect the trityl protecting group at the 5' position, and then 0.3 mL of each amidite and 0.4 mL of 5-benzylmercapto-1H-tetrazole as a condensation agent were fed to the CPG, and a coupling reaction was carried out with the hydroxyl group at the 5' position. Next, a solution of acetonitrile:water:pyridine = 35.2:52.9:11.4 (wt%) containing 17 mM iodine was stored at 60 ° C for 161 hours, and then acetonitrile was added just before synthesis to prepare a solution of acetonitrile:water:pyridine = 58.2:34.2:7.4 (wt%) containing 10 mM iodine, and 0.7 mL of this solution was sent to convert the phosphorous group to a phosphate group. Next, 0.5 mL of 0.1 M phenoxyacetic anhydride acetonitrile solution and 0.5 mL of 10% N-methylimidazole / 10% 2,6-lutidine acetonitrile solution were used as capping solutions to cap the reaction points where coupling did not proceed. Furthermore, these steps were repeated a total of 52 times to synthesize a nucleic acid oligonucleotide of the sequence shown in sequence (I) on the CPG support, and then the trityl protecting group at the 5' position was deprotected with a 3% trichloroacetic acid toluene solution. After that, 752μL of aqueous ammonia and 252μL of ethanol were used to release the nucleic acid oligomer from the solid phase carrier for the CPG carrier carrying the entire amount of oligonucleotide, and then the aqueous ammonia and ethanol were removed by blowing nitrogen. Next, the free oligonucleotide was dissolved in 400μL of dimethyl sulfoxide, and after adding 5.3μL of nitromethane and a stirrer, 530μL of dimethyl sulfoxide solution of 1M tetra-n-butylammonium fluoride (TBAF) (the amount of TBAF is 10.2 moles per mole of protecting group) that had been dehydrated with molecular sieve 4A was poured in at 30℃ under stirring with a stirrer, and the mixture was kept warm for 4 hours to deprotect the 2'-EMM protecting group.A crude product was obtained by precipitation. The yield was 8.6 mg, and the purity was 61%. The purity of the oligonucleotide in the obtained crude product was measured using the method described in the above-mentioned Measurement Method 1. The yield of the oligonucleotide was measured using the method described in the above-mentioned Measurement Method 2.

[0089] Example 2 Using a controlled pore glass (CPG) carrying 1.02 μmol of a guanosine derivative and an amidite shown in formula (A8), formula (A9), formula (A10), formula (A11), or formula (A12), the nucleic acid oligomer shown in sequence (I) was automatically synthesized from the 3' side to the 5' side by NTS M-4MX-E (manufactured by Nippon Techno Service Co., Ltd.). The procedure for automatic synthesis was as follows: first, 3% trichloroacetic acid toluene solution was fed to 1.4 mL CPG each time to deprotect the trityl protecting group at the 5' position, and then 0.3 mL of each amidite and 0.4 mL of 5-benzylmercapto-1H-tetrazole as a condensation agent were fed to the CPG to allow a coupling reaction to proceed with the hydroxyl group at the 5' position. Next, a solution of acetonitrile:water:pyridine = 35.2:52.9:11.4 (wt%) containing 17 mM iodine was stored at 60 ° C for 24 hours, and then acetonitrile was added just before synthesis to prepare a solution of acetonitrile:water:pyridine = 58.2:34.2:7.4 (wt%) containing 10 mM iodine, and 0.7 mL of this solution was sent to convert the phosphorous group to a phosphate group. Next, 0.5 mL of 0.1 M phenoxyacetic anhydride acetonitrile solution and 0.5 mL of 10% N-methylimidazole / 10% 2,6-lutidine acetonitrile solution were used as capping solutions to cap the reaction points where coupling did not proceed. Furthermore, these steps were repeated a total of 52 times to synthesize a nucleic acid oligonucleotide of the sequence shown in sequence (I) on a CPG support, and then the trityl protecting group at the 5' position was deprotected with a 3% trichloroacetic acid toluene solution. After that, 752 μL of aqueous ammonia and 252 μL of ethanol were used to release the nucleic acid oligomer from the solid phase carrier for the CPG carrier carrying the entire amount of oligonucleotide, and then the aqueous ammonia and ethanol were removed by blowing nitrogen. Next, the free oligonucleotide was dissolved in 400 μL of dimethyl sulfoxide, and 5.3 μL of nitromethane and a stirrer were added, and then 530 μL of a dimethyl sulfoxide solution of 1 M tetra-n-butylammonium fluoride (TBAF) (the amount of TBAF is 10.2 moles per mole of protective group) that had been dehydrated with molecular sieves 4A was poured in at 30°C while stirring with a stirrer, and the mixture was kept warm for 4 hours to deprotect the 2'-EMM protective group. The crude product was obtained by precipitation.The yield was 7.3 mg, and the purity was 59%. The purity of the oligonucleotide in the obtained crude product was measured by the method described in the above-mentioned Measurement Method 1. The yield of the oligonucleotide was measured by the method described in the above-mentioned Measurement Method 2.

[0090] Example 3 Using a controlled pore glass (CPG) carrying 1.03 μmol of a guanosine derivative and an amidite shown in formula (A8), formula (A9), formula (A10), formula (A11), or formula (A12), the nucleic acid oligomer shown in sequence (I) was automatically synthesized from the 3' side to the 5' side by NTS M-4MX-E (manufactured by Nippon Techno Service Co., Ltd.). The procedure for automatic synthesis was as follows: first, 3% trichloroacetic acid toluene solution was fed to 1.4 mL CPG each time to deprotect the trityl protecting group at the 5' position, and then 0.3 mL of each amidite and 0.4 mL of 5-benzylmercapto-1H-tetrazole as a condensation agent were fed to the CPG to allow a coupling reaction to proceed with the hydroxyl group at the 5' position. Next, a solution of acetonitrile:water:pyridine = 35.2:52.9:11.4 (wt%) containing 17 mM iodine was stored at 40 ° C for 24 hours, and then acetonitrile was added just before synthesis to prepare a solution of acetonitrile:water:pyridine = 58.2:34.2:7.4 (wt%) containing 10 mM iodine, and 0.7 mL of this solution was sent to convert the phosphorous group to a phosphate group. Next, 0.5 mL of 0.1 M phenoxyacetic anhydride acetonitrile solution and 0.5 mL of 10% N-methylimidazole / 10% 2,6-lutidine acetonitrile solution were used as capping solutions to cap the reaction points where coupling did not proceed. Furthermore, these steps were repeated a total of 52 times to synthesize a nucleic acid oligonucleotide of the sequence shown in sequence (I) on the CPG support, and then the trityl protecting group at the 5' position was deprotected with a 3% trichloroacetic acid toluene solution. After that, 752 μL of aqueous ammonia and 252 μL of ethanol were used to release the nucleic acid oligomer from the solid phase carrier for the CPG carrier carrying the entire amount of oligonucleotide, and then the aqueous ammonia and ethanol were removed by blowing nitrogen. Next, the free oligonucleotide was dissolved in 400 μL of dimethyl sulfoxide, and 5.3 μL of nitromethane and a stirrer were added, and then 530 μL of a dimethyl sulfoxide solution of 1 M tetra-n-butylammonium fluoride (TBAF) (the amount of TBAF is 10.2 moles per mole of protective group) that had been dehydrated with molecular sieves 4A was poured in at 30°C while stirring with a stirrer, and the mixture was kept warm for 4 hours to deprotect the 2'-EMM protective group. The crude product was obtained by precipitation.The yield was 8.1 mg, and the purity was 57%. The purity of the oligonucleotide in the obtained crude product was measured by the method described in the above-mentioned Measurement Method 1. The yield of the oligonucleotide was measured by the method described in the above-mentioned Measurement Method 2.

[0091] (Reference example 1) Using a controlled pore glass (CPG) carrying 1.00 μmol of a guanosine derivative and an amidite shown in formula (A8), formula (A9), formula (A10), formula (A11), or formula (A12), the nucleic acid oligomer shown in sequence (I) was automatically synthesized from the 3' side to the 5' side by NTS M-4MX-E (manufactured by Nippon Techno Service Co., Ltd.). The procedure for the automatic synthesis was as follows: first, 3% trichloroacetic acid toluene solution was fed to 1.4 mL CPG each time to deprotect the trityl protecting group at the 5' position, and then 0.3 mL of each amidite and 0.4 mL of 5-benzylmercapto-1H-tetrazole as a condensation agent were fed to the CPG to allow a coupling reaction to proceed with the hydroxyl group at the 5' position. Then, 0.7 mL of a pyridine:water = 88.7:10.0 (wt%) solution containing 50 mM iodine was stored at 25 ° C for 24 hours, and the phosphorous group was converted to a phosphate group. Then, 0.5 mL of a 0.1 M phenoxyacetic anhydride acetonitrile solution and 0.5 mL of a 10% N-methylimidazole / 10% 2,6-lutidine acetonitrile solution were used as capping solutions to cap the reaction points where coupling did not proceed. Furthermore, these steps were repeated a total of 52 times to synthesize a nucleic acid oligonucleotide of the sequence shown in sequence (I) on the CPG carrier, and then the trityl protecting group at the 5' position was deprotected with a 3% trichloroacetic acid toluene solution. Then, 752 μL of ammonia water and 252 μL of ethanol were used for the CPG carrier carrying the entire amount of oligonucleotide to release the nucleic acid oligomer from the solid phase carrier, and the ammonia water and ethanol were removed by blowing nitrogen. Next, the free oligonucleotide was dissolved in 400 μL of dimethyl sulfoxide, and then 5.3 μL of nitromethane and a stirrer were added. Then, 530 μL of a dimethyl sulfoxide solution of 1 M tetra-n-butylammonium fluoride (TBAF) (the amount of TBAF was 10.2 moles per mole of protective group) that had been dehydrated with molecular sieves 4A was poured in at 30° C. under stirring with a stirrer, and the mixture was kept warm for 4 hours to deprotect the 2'-EMM protective group. The crude product was obtained by precipitation. The yield was 7.9 mg, and the purity was 42%. The purity of the oligonucleotide was measured for the obtained crude product using the method described in the above-mentioned measurement method 1.In addition, the yield of oligonucleotide was measured using the method described in Measurement Method 2 above.

[0092] (Reference example 2) Using a controlled pore glass (CPG) carrying 1.04 μmol of a guanosine derivative and an amidite shown in formula (A8), formula (A9), formula (A10), formula (A11), or formula (A12), the nucleic acid oligomer shown in sequence (I) was automatically synthesized from the 3' side to the 5' side by NTS M-4MX-E (manufactured by Nippon Techno Service Co., Ltd.). The procedure for automatic synthesis was as follows: first, 3% trichloroacetic acid toluene solution was fed to 1.4 mL CPG each time to deprotect the trityl protecting group at the 5' position, and then 0.3 mL of each amidite and 0.4 mL of 5-benzylmercapto-1H-tetrazole as a condensation agent were fed to the CPG to proceed with a coupling reaction with the hydroxyl group at the 5' position. Next, 0.7 mL of a solution of acetonitrile:water:pyridine = 58.2:34.4:7.2 (wt%) containing 10 mM iodine stored at 25 ° C for 24 hours was transferred to convert the phosphorous group to a phosphate group. Then, 0.5 mL of a 0.1 M phenoxyacetic anhydride acetonitrile solution and 0.5 mL of a 10% N-methylimidazole / 10% 2,6-lutidine acetonitrile solution were used as capping solutions to cap the reaction points where coupling did not proceed. Furthermore, these steps were repeated a total of 52 times to synthesize a nucleic acid oligonucleotide of the sequence shown in sequence (I) on the CPG carrier, and then the trityl protecting group at the 5' position was deprotected with a 3% trichloroacetic acid toluene solution. Then, 752 μL of ammonia water and 252 μL of ethanol were used for the CPG carrier carrying the entire amount of oligonucleotide to release the nucleic acid oligomer from the solid phase carrier, and the ammonia water and ethanol were removed by blowing nitrogen. Next, the free oligonucleotide was dissolved in 400 μL of dimethyl sulfoxide, and then 5.3 μL of nitromethane and a stirrer were added. Then, 530 μL of 1M tetra-n-butylammonium fluoride (TBAF) in dimethyl sulfoxide (TBAF: 10.2 moles per mole of protecting group) that had been dehydrated with molecular sieves 4A was poured in at 30° C. under stirring with a stirrer, and the mixture was kept warm for 4 hours to deprotect the 2'-EMM protecting group. The crude product was obtained by precipitation. The yield was 7.8 mg, and the purity was 35%. The purity of the oligonucleotide was measured for the obtained crude product using the method described in the above-mentioned measurement method 1.In addition, the yield of oligonucleotide was measured using the method described in Measurement Method 2 above.

[0093] The results of Examples 1 to 3 and Reference Examples 1 and 2 are shown in Table 2. [Table 2]

[0094] The results in the above table show that when the oxidizing solution of the present invention heated to 40°C or higher was used, nucleic acid oligomers of higher purity were obtained compared to when the oxidizing solutions of Reference Examples 1 and 2 were used. [Industrial Applicability]

[0095] The present invention provides an efficient method for producing a nucleic acid oligomer. Also, improvement in the purity of the nucleic acid oligomer produced by the method for producing a nucleic acid oligomer can be expected. [Sequence List Free Text]

[0096] SEQ ID NOs: 1 to 13 in the sequence listing represent the base sequences of oligonucleotides produced according to the production method of the present invention.

Claims

1. Formula (I): 【Chemistry 1】 (In the formula, G 1 and G 2 each independently represents a protecting group for a hydroxyl group; B a represents a nucleobase which may be protected by a protecting group, R represents a protected hydroxyl group, a hydrogen atom, a fluorine atom, a methoxy group, a 2-methoxyethyl group, or an OQ′ group; Q' represents a methylene group bonded to the 4' carbon atom of ribose, an ethylene group bonded to the 4' carbon atom, or an ethylidene group bonded to the 4' carbon atom of ribose, and The bond marked with * indicates a bond to the 3' end of the nucleic acid.) The present invention relates to a method for producing a nucleic acid compound having a nucleotide represented by formula (II): at the 5'-terminus by a phosphoramidite method. 【Chemistry 2】 (In the formula, G 1 , G 2 , B a , R and * are as defined above.) The method includes a step of reacting a precursor having a phosphite triester bond represented by the formula: with an oxidizing solution containing iodine, pyridine and water that has been heated to 40° C. or higher.

2. The precursor having a phosphite triester bond is represented by the formula (4): 【Chemistry 3】 (In the formula, G 1 represents a protecting group for a hydroxyl group, G 2 each independently represents the same or different hydroxyl-protecting group, B a each independently represents the same or different nucleobase which may be protected by a protecting group; R's are each independently the same or different and each independently represent a protected hydroxyl group, a hydrogen atom, a fluorine atom, a methoxy group, a 2-methoxyethyl group, or an OQ' group; Q' are each independently the same or different and each represent a methylene group bonded to the 4' carbon atom of ribose, an ethylene group bonded to the 4' carbon atom, or an ethylidene group bonded to the 4' carbon atom of ribose, Each Y is independently the same or different and represents an oxygen atom or a sulfur atom; n represents an integer of 1 to 200, When X represents OZ, W represents an OV group, and V represents a protecting group for a hydroxyl group; When X represents an R group, W represents a group represented by OZ; Z is a group having a structure consisting of a solid phase carrier and a linking group. When n is an integer of 2 or more, the nucleic acid compound represented by formula (4) may incorporate a non-nucleotide linker in place of at least one nucleotide between the 5'-terminal and 3'-terminal nucleotides. The nucleic acid compound obtained by the step of reacting the oxidizing solution is represented by the formula (5): 【Chemistry 4】 (In the formula, G 1 , G 2 , B a , R, n, W, X, and Y are as defined above, and As defined in formula (4), a non-nucleotide linker may be incorporated in place of the nucleotide. A nucleic acid compound represented by the formula: The non-nucleotide linker is a linker consisting of an amino acid backbone, The method according to claim 1, wherein the linker having an amino acid skeleton is a linker having a structure selected from the following formulae (A14-1), (A14-2) and (14-3): 【Chemistry 5】

3. The nucleic acid compound of formula (5) is optionally extended in chain length by the amidite method to obtain a compound of formula (5'): 【Chemistry 6】 (In the formula, G 2 , B a , R, X and W are as defined for formula (5); G 5 represents a protecting group for a hydroxyl group or a hydrogen atom, m is an integer satisfying m≧n, Each Y is independently the same or different and represents oxygen or sulfur. However, at least one Y is an oxygen atom. obtaining a nucleic acid compound represented by From the compound of formula (5'), a compound of formula (6): 【Chemistry 7】 (In the formula, G 5 , R and m are as defined above; B c each independently represents the same or different nucleobase; G 4 represents a hydrogen atom, an alkali metal ion, an ammonium ion, an alkylammonium ion, or a hydroxyalkylammonium ion; Each Y independently represents oxygen or sulfur, and at least one Y is an oxygen atom; and X 1 represents a hydroxyl group, and W 1 represents an OV group, where V represents a protecting group for a hydroxyl group, or X 1 represents an R group, and W 1 represents a hydroxyl group.) Cut out the compound represented by The compound of formula (6) is then deprotected to give the compound of formula (7): 【Chemistry 8】 (In the formula, m, Y, G 4 and B c is as defined above, R' are each independently the same or different and each independently represent a hydroxyl group, a hydrogen atom, a fluorine atom, a methoxy group, a 2-methoxyethyl group, or an OQ' group; Q' are each independently the same or different and each represent a methylene group bonded to the carbon atom at 4' position of ribose, an ethylene group bonded to the carbon atom at 4' position, or an ethylidene group bonded to the carbon atom at 4' position of ribose, and, X 10 and W. 10 each independently represents a hydroxyl group, or X 10 represents an R′ group, and W 10 represents a hydroxyl group.) 3. The method for producing a nucleic acid oligomer according to claim 2, comprising the step of producing a deprotected nucleic acid oligomer represented by the formula:

4. The method according to any one of claims 1 to 3, wherein the iodine concentration of the oxidation solution is 0.005 to 2M.

5. The method according to any one of claims 1 to 3, wherein the iodine concentration of the oxidation solution is 0.005 to 0.2M.

6. The method according to any one of claims 1 to 3, wherein the iodine concentration of the oxidation solution is 0.007 to 0.1 M.

7. The method according to any one of claims 1 to 3, wherein the iodine concentration of the oxidation solution is 0.008 to 0.07M.

8. The method according to any one of claims 1 to 7, wherein the oxidizing solution is prepared by mixing iodine, pyridine and water.

9. The method according to claim 8, wherein the oxidation solution contains at least one solvent selected from the group consisting of acetonitrile and tetrahydrofuran.

10. The method according to claim 8 or 9, wherein the oxidation solution further comprises an acetonitrile solvent.

11. The method according to claim 9, wherein the solvent of the oxidation solution is a mixed solvent obtained by mixing pyridine, water, acetonitrile, and tetrahydrofuran in a volume ratio of 1-90:1-50:0-90:0-90.

12. The method according to claim 9 or 10, wherein the solvent of the oxidation solution is a mixed solvent of pyridine, water, and acetonitrile in a volume ratio of 1-90:1-50:0-90.

13. The method according to any one of claims 1 to 12, wherein the temperature for storage and aging of the oxidation solution from its preparation until its use in the oxidation reaction in nucleic acid synthesis is 40°C or higher and 60°C or lower.

14. The method according to any one of claims 1 to 13, wherein the nucleic acid compound is a nucleic acid compound containing ribonucleoside (RNA).

15. The method according to any one of claims 2 to 14, wherein the nucleic acid is a ribonucleoside (RNA) and the 2'-protecting group is a protecting group represented by formula (12). Formula (12): 【Chemistry 9】 (In the formula, q represents an integer of 1 to 5; R a and R b are the same or different and each represents a methyl group, an ethyl group, or a hydrogen atom; The bond marked with an * is the oxygen of the OQ group, and E W The group represents an electron-withdrawing group.

16. R a and R b are simultaneously hydrogen atoms, and E W The method according to claim 15, wherein is a cyano group.

17. The method according to any one of claims 1 to 14, wherein when R is a protected hydroxyl group, the protecting group is selected from the group consisting of a 2'-tert-butyldimethylsilyl (TBDMS) group, a 2'-bis(2-acetoxy)methyl (ACE) group, a 2'-(triisopropylsilyloxy)methyl (TOM) group, a 2'-(2-cyanoethoxy)ethyl (CEE) group, a 2'-(2-cyanoethoxy)methyl (CEM) group, and a 2'-para-tolylsulfonylethoxymethyl (TEM) group.

18. The method according to any one of claims 1 to 17, wherein the nucleic acid is a ribonucleoside (RNA) having a chain length of 40 or more.

19. The method of any one of claims 1 to 18, further comprising the step of preparing the oxidizing solution of claim 1.

20. G 1 The following base 【Chemistry 10】 (In the formula, R 1 , R 2 and R 3 are each independently the same or different and represent a hydrogen atom or an alkoxy group. The method according to any one of claims 1 to 19,

21. The method according to any one of claims 2 to 20, wherein the solid phase carrier comprises an inorganic porous carrier.

Images