Methods for Producing Polypeptides

Abstract

A method for producing a polypeptide, comprising the steps of constructing an engineered strain that expresses a polypeptide gene fused with a Sumo tag, and inducing the engineered strain to solublely express the polypeptide, purifying the engineered strain to obtain a crude protein containing a polypeptide precursor, enzymatically cleaving the crude protein containing the polypeptide precursor with Ulp1 protease to remove the Sumo tag, and purifying the product of enzymatic cleavage by Ulp1 protease using a method combining acetonitrile and heat precipitation or a method of precipitation with hexafluoroisopropanol to obtain a polypeptide. A highly efficient technology for expressing a medicinal polypeptide or its precursor based on soluble recombination has been established, and a simple purification process based on one-step precipitation purification has been established, which, when combined with HPLC purification, can achieve a polypeptide purity of 97% or more.

Description

[Technical field]

[0001] The present invention relates to the biopharmaceutical technology field, and more particularly to a method for producing polypeptides. [Background technology]

[0002] Polypeptide drugs have attracted attention due to their dual properties of albuminoids and small molecule drugs. In 2015 alone, the sales of polypeptide drugs reached $50 billion, accounting for 5% of the drug market, and are increasing at a rate of 9-10% per year, so there is an urgent need to establish high-efficiency, low-cost polypeptide synthesis and purification technology. Polypeptide synthesis mainly includes chemical methods, chemical / enzymatic methods, and biological methods. Here, chemical methods require complex protection and deprotection processes, need to use large amounts of toxic reagents, and may produce racemates. Chemical / biological methods generally involve synthesizing polypeptides by chemical methods and then linking multiple peptide segments with specific peptide ligases, which is a relatively complicated process, and the linking efficiency and specificity are affected by the polypeptide sequence. Biological methods include hydrolyzing plant or animal proteins with hydrolases and then extracting specific functional polypeptides, but generally have low yields, long cycles, and severe pollution, making industrialized production difficult to achieve. Another relatively common method is recombinant expression, that is, by using technical means of genetic engineering to introduce target gene expression elements into prokaryotes or eukaryotes, and then achieving highly efficient synthesis of the target polypeptide through microbial fermentation. However, since the polypeptide itself is short, it is difficult to form a specific spatial structure, and it is very susceptible to being decomposed by proteases in the expression host. In addition, the product yield is reduced due to the complicated purification process, and the cost is increased.

[0003] Currently, polypeptides produced by recombinant methods include polypeptide antibiotics, interferon, liraglutide precursor (GLP-1) and insulin, among which GLP-1 is a polypeptide drug developed by Novo Nordisk Pharma Ltd. for treating type II diabetes, with annual sales reaching several billion dollars. Its initial synthesis method was an engineering strain based on secretion expression of Saccharomyces cerevisiae, but the product is easily degraded by the action of extracellular proteases, resulting in low yields and the highest expression level after protease knockout was only 59mg / L. GLP-1 was fused and expressed in Pichia yeast, and the expression level after fermentation for 5 days was only 26mg / L. Escherichia coli is a commonly used host and has already been widely used in the biosynthesis of polypeptides, but there is also the risk of protease degradation. Fusion expression can solve this problem. At present, GLP-1 is mainly expressed in inclusion bodies, such as KSI tag, intein peptide intein and signal peptide-enterokinase enzyme cleavage site-GLP-1, and inclusion bodies have high expression levels and can avoid protease degradation, but the complex denaturation and regeneration process requires the use of large amounts of denaturants such as urea or guanidine hydrochloride, and the final yield is very low due to the complexity of the purification process. At the same time, enterokinase is usually used to completely remove the fusion tag, but the enzyme is not only difficult to express, but also leads to non-specific cleavage. Recently, inclusion body expression constructed with MFH fusion tag has been combined with the process of cleavage with formic acid and purification under denaturing conditions to avoid the regeneration process, but urea must be used, and GLP-1 containing one Gly at the N-terminus is obtained by Tev protease cleavage, and the Tev enzyme has low biological activity, non-specific cleavage occurs, the production steps are complicated, and the cost is high.Other fusion tags, such as GST, MBP, TrxA, etc., are often used as soluble expression tags, and some peptides have been soluble expressed through these tags, but the molecular weight of these tags is large relative to some target peptides, resulting in low yields of target peptides after tag removal. Furthermore, GLP-1 and its derivatives are often in a polymeric state, and purification must be performed under denaturing conditions, and the current purification steps are complicated and low yielding.

[0004] In summary, the prior art mainly has the following problems: 1) In chemical synthesis, the process is complicated, the chemical reagents are toxic, and racemic bodies may be produced, the cycle is long, and the quality control of the product is difficult. 2) In inclusion body expression, the purification process of denaturation and renaturation is complicated, and a large amount of urea is used, and the enterokinase or Tev used in the cleavage process is expensive and prone to non-specific cleavage, and the purification process is very complicated due to the complex denaturation and renaturation process, resulting in a low yield. 3) In soluble expression, the currently used soluble expression tags mainly include TrxA, GST, and MBP, and it is necessary to add an enzyme cleavage site to the target peptide segment and the tag, and the commonly used enzymes are generally difficult to express and lead to non-specific cleavage, and there is no research using Sumo tag for fusion expression of liraglutide precursor. Summary of the Invention [Problem to be solved by the invention]

[0005] The present invention aims to provide a method for producing a polypeptide to solve the technical problems in the prior art, such as complicated purification steps for the polypeptide and low yields. [Means for solving the problem]

[0006] In order to achieve the above object, according to one aspect of the present invention, there is provided a method for producing a polypeptide, which includes the steps of constructing an engineered strain that expresses a polypeptide gene fused with a Sumo tag and inducing the engineered strain to solublely express the polypeptide, obtaining a crude protein containing a polypeptide precursor by purification from the engineered strain, enzymatically cleaving the crude protein containing the polypeptide precursor with Ulp1 protease to remove the Sumo tag, and purifying the product of enzymatic cleavage by Ulp1 protease using a combination of acetonitrile and heat precipitation or hexafluoroisopropanol precipitation to obtain the polypeptide.

[0007] Further, the polypeptide is a Liraglutide precursor, Nesiritide or Teriparatide.

[0008] Furthermore, the Ulp1 protease is obtained by constructing an Ulp1 protease-expressing strain and inducing expression, in which the Ulp1 protease is co-expressed with a chaperone.

[0009] Furthermore, the chaperone is the GroEL / S chaperone.

[0010] Furthermore, a method combining acetonitrile and heat precipitation includes the steps of adjusting the pH of the product of enzymatic cleavage by Ulp1 protease to 5.6, subsequently adding acetonitrile and mixing uniformly, followed by heat treatment at 60 to 80°C for 0.5 to 3 hours (preferably, heat treatment at 70°C for 2 hours), and then centrifuging the supernatant and precipitate.

[0011] Furthermore, the acetonitrile is an aqueous solution of acetonitrile having a mass percentage of 20 to 70%.

[0012] Further, the step of purifying the engineered strain to obtain a crude protein containing the polypeptide precursor includes the steps of subjecting the engineered strain to ultrasonic disruption, centrifugation, and membrane filtration to obtain a crude enzyme solution, and then purifying the solution using affinity chromatography or an anion column to obtain the crude protein.

[0013] Furthermore, the method of precipitation with hexafluoroisopropanol includes the steps of adjusting the pH of the product of enzymatic cleavage by Ulp1 protease to 5.6, followed by adding hexafluoroisopropanol, mixing uniformly, and then precipitating at room temperature for 1 hour, and then centrifuging the supernatant and the precipitate.

[0014] Furthermore, the hexafluoroisopropanol is an aqueous hexafluoroisopropanol solution having a mass percentage of 20 to 70%, and preferably, the hexafluoroisopropanol is an aqueous hexafluoroisopropanol solution having a mass percentage of 50%.

[0015] Furthermore, the production method includes a step of purifying the target polypeptide using HPLC. Effect of the Invention

[0016] The present invention establishes a highly efficient technology for expressing medicinal polypeptides or their precursors based on soluble recombination, and establishes a simple purification process based on one-step precipitation purification, which, when combined with HPLC purification, can reach a polypeptide purity of more than 97%. [Brief description of the drawings]

[0017] The specification and drawings constituting a part of this application are used to provide a further understanding of the present invention, and the schematic examples of the present invention and their explanations are used to interpret the present invention and are not intended to unduly limit the present invention.

Figure 1

Figure 2

Figure 3

Figure 4

Figure 5

Figure 6

Figure 7

Figure 8

Figure 9

Figure 10

Figure 11

Figure 12

Figure 13

Figure 14

Figure 15

Figure 16

Figure 17

[0018] In addition, the embodiments and features of the embodiments in the present application can be combined with each other as long as they are not inconsistent. Hereinafter, the present invention will be described in detail in conjunction with the embodiments with reference to the drawings.

[0019] Interpretation of nouns Polypeptide, whose English name is polypeptide, is a peptide consisting of 10 to 50 amino acid residues.

[0020] Liraglutide is an analogue of human glucagon-like peptide-1 (GLP-1) and its English name is Liraglutide, abbreviated as Lira.

[0021] The English name of Nesiritide is Nesiritide, abbreviated as Nesi.

[0022] The English name of teriparatide is Teriparatide, abbreviated as Teri.

[0023] In the present invention, a polypeptide precursor refers to a polypeptide having a Sumo tag.

[0024] According to an exemplary embodiment of the present invention, there is provided a method for producing a polypeptide, comprising the steps of constructing an engineered strain expressing a polypeptide gene fused with a Sumo tag and inducing the engineered strain to soluble express the polypeptide, obtaining a crude protein containing a polypeptide precursor by purification from the engineered strain, enzymatically cleaving the crude protein containing the polypeptide precursor with Ulp1 protease to remove the Sumo tag, and purifying the product of enzymatic cleavage by Ulp1 protease using a combination of acetonitrile and heat precipitation or hexafluoroisopropanol precipitation to obtain the polypeptide.

[0025] The present invention provides an engineered strain that can promote soluble expression of proteins based on the Sumo tag, and the Sumo tag can be efficiently excised by Ulp1 protease (SUMO protease) which specifically recognizes the three-stage structure as a fusion tag, and does not lead to the acquisition of the target polypeptide by non-specific cleavage methods, thus avoiding the problem of inclusion body denaturation, and constructing an engineered strain that expresses a polypeptide gene fused with the Sumo tag.

[0026] Typically, the polypeptide in the present invention may be a liraglutide precursor, nesiritide or teriparatide.

[0027] In addition, to address the problems of the high cost of removing the necessary proteases using fusion expression tags and the occurrence of non-specific cleavage, a strategy was used in which Ulp1 specifically cleaves the Sumo tag, so that Ulp1 recognizes the spatial structure of the Sumo tag and cleaves only at specific sites. In order to obtain a highly efficient Ulp1 engineering strain and easily purify Ulp1, a strain was constructed in which Ulp1 is co-expressed with a chaperone, preferably the GroEL / S chaperone, which significantly improved the expression level of Ulp1.

[0028] According to a typical embodiment of the present invention, the method of combining acetonitrile and heat precipitation includes the steps of adjusting the pH of the product of enzymatic cleavage of Ulp1 protease to 5.6 (obtained by combining data on the isoelectric point), subsequently adding acetonitrile, mixing uniformly, and then heat-treating at 60-80°C for 0.5-3 h (preferably, heat-treating at 70°C for 2 h), and then centrifuging the supernatant and precipitate. Preferably, the acetonitrile is an aqueous acetonitrile solution with a mass percentage of 20-70%, and acetonitrile with a concentration of 20-70% has a good preliminary purification effect.

[0029] In one exemplary embodiment of the present invention, the step of purifying the engineered strain to obtain a crude protein containing the polypeptide precursor comprises subjecting the engineered strain to ultrasonic disruption, centrifugation, and membrane filtration to obtain a crude enzyme solution, followed by purification using affinity chromatography or an anion column to obtain the crude protein.

[0030] According to a typical embodiment of the present invention, the method for precipitation with hexafluoroisopropanol includes the steps of adjusting the pH of the product of enzymatic cleavage by Ulp1 protease to 5.6, subsequently adding hexafluoroisopropanol, mixing uniformly, and then precipitating at room temperature for 1 hour, and then centrifuging the supernatant and the precipitate, preferably, the hexafluoroisopropanol is an aqueous hexafluoroisopropanol solution with a mass percentage of 20 to 70%, and preferably, after selective precipitation using 50% hexafluoroisopropanol, the concentration of liraglutide precursor in the supernatant is about 90%.

[0031] Preferably, the preparation method further comprises purifying the target polypeptide using HPLC. Liraglutide precursor is prone to aggregation, and the present invention uses organic solvent treatment and reverse phase purification methods to avoid purification problems caused by aggregation effect.

[0032] The beneficial effects of the present invention will be further described below in conjunction with examples.

[0033] Example 1 Construction of a genetically engineered strain expressing liraglutide precursor (abbreviated as Lira) fused with Sumo tag The construction of the strategy based on soluble expression of polypeptide is specifically to fuse the target polypeptide sequence with Sumo tag and construct it into pET-28a(+) or pET-22b(+) expression vector. The total gene synthesis was performed by GENEWIZ, and the Sumo-Lira sequence after codon optimization was constructed into pUC57 clone vector with NdeI enzyme cleavage site introduced at 5' end and XhoI enzyme cleavage site introduced at 3' end of the sequence, and the sequence is as follows: SEQ ID NO: 1 is CATATG GGCGGCAGTCTGCAAGATAGCGAAGTGAATCAAGAAGCGAAGCCAGAAGTGAAACCGGAAGTTAAACCGGAGACCCACATCAATCTGAAGGTGAGCGACGGCAGCAGCGAGATCTTCTTCAAGATCAAGAAGACGACCCCGCTGCGTCGTCTGATGGAAGCCTTCGCCAAACGCCAAGGCAAAGAAATGGACAGTCTGCGCTTTCTGTACGATGGTATCCGCATCCAAGCCGATCAAGCCCCGGAAGATCTGGACATGGAGGACAACGACATCATCGAGGCGCATCGCGAACAGATCGGCGGC CATGCCGAAGGCACCTTCACCAGCGATGTTAGCAGCTATCTGGAAGGCCAAGCCGCCAAAGAATTCATCGCGTGGCTGGTTCGCGGCCGCGGTTAGCTCGAG, where the underlined portion is the Sumo tag, followed by the liraglutide precursor sequence.

[0034] The synthesized gene fragment was enzymatically digested from pUC57-Sumo-Lira with NdeI and XhoI, gel-cut and recovered, and then ligated with similarly enzymatically digested pET-28a(+) or pET-22b(+) at 16°C overnight, then transformed into BL21(DE3) competent cells, and sequence analysis of the monoclones was performed to obtain the correct clone expression vector pET-28a-Sumo-Lira or pET-22b-Sumo-Lira. Three correct clones were selected and activated for each transformation, and then pre-screened in 250mL flasks as seeds, and the optimal one was selected from them to become the final expression strain. 4mL of the BL21(DE3) strain containing the recombinant plasmid was inoculated into a 2L Erlenmeyer flask containing 600mL of LB medium, and cultured at 37℃ with shaking at 200rpm until the OD600 reached 1.0. IPTG was added to a final concentration of 1mM, and the cells were induced at 37℃ for 6h. After induction, the cells were collected by centrifugation at 4℃. The supernatant was collected by ultrasonic disruption, and the target protein was mainly expressed in soluble form as shown by the 12% separation gel SDS-PAGE results (Figure 1).

[0035] Example 2 Construction of a genetically engineered strain expressing Nesiritide (abbreviated as Nesi) fused with a Sumo tag Similarly, the strategy of fusion expression with Sumo tag was used, the vector construction strategy was the same as in Example 1, and the sequence of the synthetic gene is as follows: SEQ ID NO:2 is CATATG GGCGGCAGTCTGCAAGATAGCGAAGTGAATCAAGAAGCGAAGCCAGAAGTGAAACCGGAAGTTAAACCGGAGACCCACATCAATCTGAAGGTGAGCGACGGCAGCAGCGAGATCTTCTTCAAGATCAAGAAGACGACCCCGCTGCGTCGTCTGATGGAAGCCTTCGCCAAACGCCAAGGCAAAGAAATGGACAGTCTGCGCTTTCTGTACGATGGTATCCGCATCCAAGCCGATCAAGCCCCGGAAGATCTGGACATGGAGGACAACGACATCATCGAGGCGCATCGCGAACAGATCGGCGGC TCTCCGAAAATGGTTCAGGGTTCTGGTTGCTTCGGTCGTAAAATGGACCGTATCTCTTCTTCTTCTGGTCTGGGTTGCAAAGTTCTGCGTCGTCACTAGCTCGAG, where the underlined portion is the Sumo tag, followed by the nesiritide sequence.

[0036] The gene was constructed into pET-28a(+) through enzymatic digestion and ligation, and the correct expression plasmid pET-28a-Sumo-Nesi and the recombinant BL21(DE3) strain containing the expression were obtained by sequencing. Using the same method as Sumo-Lira, the fusion protein showed soluble expression after IPTG induction (Figure 2).

[0037] Example 3 Construction of genetically engineered strain expressing Teriparatide (abbreviated as Teri) fused with Sumo tag Similarly, the strategy of fusion expression with Sumo tag was used, the vector construction strategy was the same as in Example 1, and the sequence of the synthetic gene is as follows: SEQ ID NO:3 is CATATG GGCGGCAGTCTGCAAGATAGCGAAGTGAATCAAGAAGCGAAGCCAGAAGTGAAACCGGAAGTTAAACCGGAGACCCACATCAATCTGAAGGTGAGCGACGGCAGCAGCGAGATCTTCTTCAAGATCAAGAAGACGACCCCGCTGCGTCGTCTGATGGAAGCCTTCGCCAAACGCCAAGGCAAAGAAATGGACAGTCTGCGCTTTCTGTACGATGGTATCCGCATCCAAGCCGATCAAGCCCCGGAAGATCTGGACATGGAGGACAACGACATCATCGAGGCGCATCGCGAACAGATCGGCGGC TCTGTTTCTGAAATCCAGCTGATGCACAACCTGGGTAAACACCTGAACTCTATGGAACGTGTTGAATGGCTGCGTAAAAAACTGCAGGACGTTCACAACTTCTAACTCGAG, where the underlined portion is the Sumo tag, followed by the teriparatide sequence.

[0038] The gene was constructed into pET-28a(+) through enzymatic digestion and ligation with NdeI and XhoI, and the correct expression plasmid pET-28a-Sumo-Teri and the recombinant BL21(DE3) strain containing the expression were obtained by sequencing. Using the same expression conditions as Sumo-Lira, the fusion protein after IPTG induction showed soluble expression (Figure 2).

[0039] Example 4 Construction of Ulp1 protease-expressing strain The C-terminal portion of Ulp1 protease (D390-K621) was directly amplified from the Saccharomyces cerevisiae S288C genome by PCR. The primers used were Ulp1-F (SEQ ID NO: 4): gggcatatgGATCTTAAAAAAAAGAAAGAACAATTGGCCAAGAAGAAACTTG and Ulp1-R (SEQ ID NO: 5): Gggctcgaggtattttaaagcgtcggttaaaatcaaatgggc. The gene sequence is as follows (or it may be artificially synthesized according to the sequence): [ka]

[0040] The amplified gene fragment was ligated into pET-28a(+) after enzymatic digestion with NdeI and XhoI to obtain the expression vector pET-28a-Ulp1, which was then transformed into BL21(DE3), and the transformant was sequenced. Three clones with accurate sequencing were selected as seeds, and preliminary screening was performed in a 250mL flask, from which the optimal one was selected as the final expression strain. 4mL of the BL21(DE3) strain containing the recombinant plasmid was inoculated into a 2L Erlenmeyer flask containing 600mL of LB medium, and cultured at 37℃ with shaking at 200rpm until OD600 reached 1.0. IPTG was added to a final concentration of 1mM, and induction was performed at 37℃ for 6h. After the induction was completed, the cells were centrifuged at 4℃ to collect the bacterial cells. The supernatant was collected by ultrasonic disruption, and as can be seen from the 12% separation gel SDS-PAGE results, the target protein portion exhibited soluble expression. To further improve the expression level of Ulp1, the expression vector pET-28a-Ulp1 was coexpressed with the expression plasmid pGRO7 for the chaperone GroEL / S, and as shown by the SDS-PAGE results, the expression level of Ulp1 was further improved (Figure 3).

[0041] Example 5 Purification of Sumo-Lira The expressed Sumo-Lira bacterial sludge was resuspended at 20% bacterial concentration, disrupted by ultrasound (5s ultrasound, 6s interval, 35% power), centrifuged, and passed through a 0.45μm filter membrane to obtain a crude enzyme solution, which was then purified using affinity chromatography (AKTA system equipped with 5mL HisTrap HP). The specific flow is as follows: the sample was filtered through a filter membrane and loaded at a flow rate of 5mL / min, followed by washing with binding buffer (20mM Tris-HCl, 500mM NaCl, pH7.4) until the unbound protein was completely eluted, then eluting protein impurities with 60mM imidazole for 4 column volumes, followed by eluting the target protein with 500mM (Figure 1). The sample can be directly cleaved by Ulp1 enzyme without the need for desalting and imidazole removal. From 1 g of bacterial sludge, 35-40 mg of purified Sumo-Lira fusion protein can be obtained, from 1 g of bacterial sludge, 15.2 mg of purified Sumo-Nesi can be obtained, and from 1 g of bacterial sludge, 18.3 mg of purified Sumo-Teri can be obtained (the yield can be further improved by optimizing the conditions).

[0042] In order to reduce costs, we tried to purify the expressed Sumo-Lira with an anion column. The crude protein was obtained in the same manner as affinity chromatography. An AKTA system (Q FF, 5mL) equipped with an anion column was used, and the flow rate was 5mL / min. The binding buffer was 50mM Tris-HCl, pH 8.0. After loading, the binding buffer was used to wash the unbound protein until it was completely eluted. Then, 50mM Tris-HCl was used for gradient elution with 1M NaCl, pH 8.0, and the target protein was obtained with a 500mM gradient. As can be seen from SDS-PAGE analysis, the target protein achieved a purity of more than 80% (Figure 4). Tests showed that the sample purified in this step could also be directly enzymatically cleaved by Ulp1 without the need for desalting.

[0043] Example 6 Purification of Sumo-Teri and Sumo-Nesi Crude protein was obtained from bacterial sludge obtained by recombinantly inducing expression in the strain in the same manner as for the Sumo-Lira sample, and was then purified using the same affinity chromatography method to obtain the target fusion protein.

[0044] Example 7 Purification of Ulp1 The expressed Ulp1 bacterial sludge was resuspended at 10% bacterial concentration, disrupted by ultrasound (5 s ultrasound, 6 s interval, 35% power), centrifuged, passed through a 0.45 μm filter membrane, and then purified using affinity chromatography (AKTA system equipped with 5 mL of HisTrap HP). The specific flow is as follows: The sample was filtered through a filter membrane and loaded at a flow rate of 4 mL / min, followed by washing with binding buffer (20 mM Tris-HCl, 500 mM NaCl, pH 7.4) until unbound proteins were completely eluted, then eluting protein impurities with 4 column volumes using 60 mM imidazole, followed by eluting the target protein with 500 mM. As shown in the SDS-PAGE in Figure 5, the target protein purity reached about 70%, and the obtained target protein was well used for enzymatic cleavage of the conjugated fusion proteins Sumo-Lira, Sumo-Teri and Sumo-Nesi (products of Examples 5 and 6) without the need for desalting.

[0045] Example 8 Enzymatic cleavage The Ulp1 enzyme cleavage reaction was carried out at 30°C, and the specific process was as follows: The mass ratio of purified Sumo-Lira (the product of Example 5) and Ulp1 in 50 mM Tris-HCl, 10 mM DTT, pH 8.0 was 10:1 to 1:1 (mg / mg), samples were taken at different times, and the cleavage efficiency was detected using Tricine to detect whether the target polypeptide was produced, and the cleavage efficiency reached 80% or more in 24 hours. The enzyme cleavage conditions for Sumo-Teri and Sumo-Nesi were the same as those for Sumo-Lira.

[0046] Example 9 Purification of target polypeptides using acetonitrile / heat precipitation After the enzymatic cleavage of Example 8 is completed, the pH is adjusted to 5.6, and then different final concentrations of acetonitrile (20%, 30%, 40%, 50%, 60%, 70%) are added to the reaction system, mixed uniformly, and then heat-treated at 70 degrees for 2 hours. Then, the supernatant and precipitate are centrifuged at 12000 rpm, and the distribution of the polypeptide is detected by Tricine. The results show that under the combined conditions, acetonitrile in the concentration range of 20-70% all have good pre-purification effect, and the purity of the liraglutide precursor crude product after treatment can reach more than 90% (Figure 6), the purity of Nesi can reach 80%, and the purity of Teri can reach 50% (Figure 7). In addition, the acetonitrile in the polypeptide crude product was removed by rotary evaporation or freeze-drying, and then redissolved in 50 mM Tris-HCl at pH 7.0, and then subjected to production-level HPLC purification.

[0047] Precipitation of liraglutide precursor with hexafluoroisopropanol (HFIP) After the enzymatic cleavage of Example 8 is completed, the pH is adjusted to 5.6, and 10% to 70% (v / v) hexafluoroisopropanol is added to the reaction system, respectively, and precipitated at room temperature for 1 h, centrifuged, and the supernatant and precipitate are collected, and the selective precipitation effect of different concentrations of hexafluoroisopropanol on liraglutide precursor is detected using Tricine-SDS-PAGE, and the result is shown in Figure 9. After selective precipitation using 50% hexafluoroisopropanol, the concentration of liraglutide precursor in the supernatant is about 90% (Figure 8). Furthermore, the hexafluoroisopropanol in the crude polypeptide product is removed using rotary evaporation or freeze-drying, and then redissolved in 50 mM Tris-HCl at pH 7.0, and then subjected to production-level HPLC purification.

[0048] Example 10 Manufacture HPLC to purify target polypeptide The product of Example 9 was prepared using UniSil AQ C18 10μm 21.5*250mm, and the buffer used was 0.1% TFA for buffer A and acetonitrile for buffer B. The gradient elution method used for Lira was 5% B at 0min, 5% B at 5min, 50% B at 25min, 95% B at 27min, 95% B at 33min, and 5% B at 38min, with an ultraviolet detector at 210nm, a flow rate of 25mL / min, and a temperature of 25℃. As shown in Figure 9, Lira was eluted at about 24min, and then the sample was collected and rotatory evaporated to remove most of the solvent, followed by freeze-drying, and the purity was detected by HPLC method. As can be seen from the results, the purity of Lira reached 98% or more (Figure 10).

[0049] The gradient elution method used for Nesi is 5% B in 5 min, 30% B in 35 min, 95% B in 40 min, UV detector at 210 nm, flow rate at 25 mL / min, and temperature at 25° C. As shown in Figure 11, Nesi was eluted in 30 min, and then the sample was collected and rotary evaporated to remove most of the solvent, and then freeze-dried. The purity was detected by HPLC method, and the result showed that the purity of Nesi reached more than 98% (Figure 12).

[0050] The gradient elution method used for Teri was 5% B at 5 min, 30% B at 35 min, 42.8% B at 47.8 min, 42.8% B at 50.5 min, 50% B at 57.7 min, 95% B at 67.7 min, and 95% B at 40 min, with a UV detector at 210 nm, a flow rate of 25 mL / min, and a temperature of 25°C. As shown in Figure 13, Teri was eluted at about 43 min, then the sample was collected and rotatory evaporated to remove most of the solvent, and then lyophilized, and the purity was detected by HPLC method, the analytical column was Eclipse plus C18 4.6 x 100 mm 3.5 μm, detected at 210 nm, flow = 1.5 ml / min, and the elution gradient was 10% B at 0 min, 95% B at 9 min, 100% at 12 min, 10% B at 12.1 min, and 10% B at 15 min. As can be seen from the results, the purity of Teri reached ~ 78% (Figure 14).

[0051] Using this method to produce liraglutide precursor, 3-4 mg of liraglutide precursor with a purity of 98% can be obtained from 1 g of flask fermented bacterial sludge; using this method to produce 1 g of bacterial sludge, 1.26 mg of Nesi with a purity of 98% can be obtained; using this method to produce 1 g of bacterial sludge, 1.55 mg of Teri with a purity of 78% can be obtained; further fermentation and optimization are expected to improve the expression level of the fusion protein and further improve the yield of the target polypeptide.

[0052] Example 11 Detection of polypeptide molecular weights by mass spectrometry. The molecular weight of the prepared polypeptide (product of Example 10) was analyzed using LC-MS. Specifically, the sample was first separated by HPLC column (Agilent ZORBAX Edipse Plus C18, 4.6*100mm, 3.5μm, mobile phase A was 0.1% trifluoroacetic acid, mobile phase B was 0.1% trifluoroacetic acid acetonitrile solution, gradient elution method used was 10% B at 0min, 95% B at 9min, 100% B at 12min, 10% B at 12.1min, 10% B at 15min, column temperature was 40℃, UV detector was 210nm, and flow rate was 1.5mL / min), and the structure of the components after HPLC separation was identified using Agilent 6200 series time-of-flight liquid chromatograph mass spectrometer, and electrospray ion source (Dual AJS The positive ion mode was detected using an ESI (Electron Spin Induction Detector), the spray pressure was 35 psig, the ion source temperature was 300 °C, the flow rate of the drying gas (N2) was 10 L / min, the scan range was 100-2000 m / z, the fragmentor voltage was 70 V, and the mass spectrum data was collected and processed by Analyst software. Lira has a theoretical molecular weight of 3383.7 Da and a mass spectrometry molecular weight of 3382.7 (Figure 15), Nesi has a theoretical molecular weight of 3464.8 and a mass spectrometry molecular weight of 3463.7 (Figure 16), and Teri has a theoretical molecular weight of 4117.7 and a mass spectrometry molecular weight of 4118.7 (Figure 17).

[0053] The above is merely a preferred embodiment of the present invention, and is not intended to limit the present invention. Various modifications and variations of the present invention are possible for those skilled in the art. Any modifications, equivalent replacements, improvements, etc. made within the scope of the spirit and principles of the present invention should be included in the scope of protection of the present invention.

Claims

1. constructing an engineered strain that expresses a polypeptide gene fused with a Sumo tag, and inducing the engineered strain to soluble express the polypeptide; purifying said engineered strain to obtain a crude protein containing the polypeptide precursor; enzymatically cleaving the crude protein containing the polypeptide precursor with Ulp1 protease to remove the Sumo tag; and purifying the enzymatic cleavage product of the Ulp1 protease using a method combining acetonitrile and heat precipitation to obtain the polypeptide. fruit, The method for combining acetonitrile and heat precipitation is characterized in that the pH of the product obtained by enzymatic cleavage of the Ulp1 protease is adjusted to 5.6, acetonitrile is then added, the mixture is mixed uniformly, and the mixture is heat-treated at 60 to 80°C for 0.5 to 3 hours, and then the supernatant and precipitate are centrifuged.

2. The method of claim 1, wherein the polypeptide is a liraglutide precursor, nesiritide or teriparatide.

3. The method according to claim 1, characterized in that the Ulp1 protease is obtained by constructing an Ulp1 protease-expressing strain and inducing expression, wherein the Ulp1 protease is co-expressed with a chaperone.

4. The method of claim 3, wherein the chaperone is the GroEL / S chaperone.

5. 2. The method according to claim 1, wherein the acetonitrile is an aqueous solution of acetonitrile having a mass percentage of 20 to 70%.

6. The method of claim 1, wherein the step of purifying the engineered strain to obtain a crude protein containing a polypeptide precursor comprises the steps of subjecting the engineered strain to ultrasonic disruption, centrifugation, and membrane filtration to obtain a crude enzyme solution, and then purifying the solution using affinity chromatography or an anion column to obtain the crude protein.

7. The method according to claim 1, further comprising purifying the target polypeptide using HPLC.

Images