Cell-penetrating peptides

Abstract

The present invention relates to peptides, particularly cell-penetrating peptides, having a first hydrophobic domain located at the C-terminus of the peptide and a second hydrophobic domain located at the N-terminus of the peptide, and to conjugates of such cell-penetrating peptides with therapeutic molecules. The present invention further relates to the use of such peptides or conjugates in therapy or as drugs, particularly in the treatment of genetic diseases, especially muscle diseases, such as Duchenne muscular dystrophy.

Description

[Technical field]

[0001] The present invention relates to peptides, in particular cell penetrating peptides, and to conjugates of such cell penetrating peptides with therapeutic molecules. The present invention further relates to the use of said peptides or conjugates in therapy or as drugs, in particular in the treatment of genetic diseases, especially muscular diseases, such as Duchenne muscular dystrophy. [Background technology]

[0002] Nucleic acid medicines are genomic medicines that have the potential to transform human healthcare. Academic research indicates that such therapies have applications across a broad range of disease areas, including neuromuscular diseases. The application of antisense oligonucleotide approaches to modulate pre-mRNA splicing in the neuromuscular disease Duchenne muscular dystrophy (DMD) has placed this monogenic disorder at the forefront of advances in precision medicine.

[0003] However, the therapeutic development of these promising antisense drugs has been hindered by poor cell permeability and poor distribution properties, a challenge further accentuated by the bulky and distributed nature of the muscle tissue matrix in DMD.

[0004] DMD affects 1 in 3500 newborn boys. This harsh X-linked recessive disorder is caused by mutations in the DMD gene, which encodes the dystrophin protein. The disease is characterized by progressive muscle degeneration along with the development of respiratory failure and cardiac complications, ultimately leading to premature death. Many of the mutations that underpin DMD are genomic cut-of-frame deletions, including premature truncations in the open reading frame, that result in the absence of the dystrophin protein.

[0005] Exon skipping therapy utilizes splice-switching antisense oligonucleotides (SSOs) to target specific regions of the DMD transcript, causing the elimination of individual exons, leading to the restoration of the aberrant reading frame, and resulting in the production of an internally deleted, yet partially functional, dystrophin protein. Despite the undoubted potential of antisense oligonucleotide exon skipping therapy for DMD, successful application of this approach is currently limited by the relatively poor targeting of skeletal muscle, as well as inadequate targeting of single-stranded oligonucleotides to other affected tissues, e.g., the heart.

[0006] In September 2016, the Food and Drug Administration (FDA) granted accelerated approval for eteplirsen, a single-stranded oligonucleotide for modulating exon 51 splicing. This marks the first approved splicing-modulating oligonucleotide in the United States, but the level of dystrophin restoration was disappointing at approximately 1% of normal dystrophin levels. Comparison with the allelic disorder Becker muscular dystrophy and experiments in mdx mice indicate that homogeneous sarcolemmal dystrophin expression at least ~15% of wild-type is required to protect muscles against exercise-induced injury.

[0007] Therefore, there is a strong and urgent need to improve the delivery of antisense oligonucleotides to provide more effective treatments for devastating genetic diseases such as DMD.

[0008] The use of viruses as delivery vehicles has been proposed, but this is of limited use due to the immunotoxicity of viral coat proteins. Instead, a wide range of non-viral delivery vectors have been developed, among which peptides show the best promise due to their small size, targeting specificity, and ability to transcapillary deliver large biocargo. Several peptides have been reported for their ability to penetrate cells, either alone or carrying biocargo.

[0009] For several years, cell-penetrating peptides (CPPs) have been conjugated to SSOs (especially charge-neutral phosphorodiamidate morpholino oligomers (PMOs) and peptide nucleic acids (PNAs)) to enhance cellular delivery by effectively transporting SSOs across the cell membrane to reach their pre-mRNA target sites in the cell nucleus. PMO therapeutics conjugated to certain arginine-rich CPPs (known as peptide-PMOs or P-PMOs) have been shown to enrich dystrophin production in skeletal muscle in the mdx mouse model of DMD, allowing for subsequent systemic administration.

[0010] In particular, PNA / PMO internalization peptides (Pips) have been developed, which are arginine-rich CPPs consisting of two arginine-rich sequences separated by a short central hydrophobic sequence. These "Pip" peptides have been designed to improve plasma stability while maintaining high levels of exon skipping, initially by arriving at PNA. Furthermore, further derivatives of these peptides have been designed as complexes with PMOs, which have been shown to lead to systemic skeletal muscle dystrophin production, including, importantly, the heart, following systemic administration in mice. Despite the efficacy of these peptides, their therapeutic application has been hindered by the requirement for high doses and therefore the associated toxicity.

[0011] Other cell-penetrating peptides with a single arginine-rich domain, e.g., R6Gly, have also been produced. These CPPs have been used to generate peptide conjugates with reduced toxicity, although in this case the conjugates showed reduced potency compared to the Pip peptide.

[0012] Thus, currently available CPPs have yet to prove suitable for human treatment of diseases such as DMD. Summary of the Invention [Problem to be solved by the invention]

[0013] A challenge in the field of cell-penetrating peptide technology is to improve efficacy without increasing toxicity, and the inventors have identified, synthesized, and tested a number of improved CPPs having specific structures according to the present invention that address at least this challenge.

[0014] These peptides maintain good potency levels in skeletal muscle when tested in vitro and in vivo with cargo therapeutic molecules. Furthermore, the peptides of the present invention have improved potency levels in skeletal muscle when tested in vitro and in vivo with cargo therapeutic molecules. At the same time, these peptides, when used in the form of a complex, allow the therapeutic cargo molecule to penetrate cells and act effectively at surprisingly lower doses than complexes with previously available cell-penetrating peptides. Improved potency at low doses means that the peptides of the present invention do not need to be administered at high levels that would cause toxicity. Thus, the peptides of the present invention offer improved suitability for use in therapeutic complexes for human treatment than previously available peptides. [Means for solving the problem]

[0015] According to a first aspect of the present invention there is provided a peptide having a total length of 40 amino acid residues or less, comprising one or more cationic domains and two or more hydrophobic domains, each comprising at least three amino acid residues, one of the hydrophobic domains being located at the C-terminus of the peptide and one of the hydrophobic domains being located at the N-terminus of the peptide.

[0016] According to a second aspect of the invention there is provided a conjugate comprising a peptide of the first aspect covalently linked to a therapeutic molecule.

[0017] According to a third aspect of the invention there is provided a conjugate comprising a peptide of the first aspect covalently attached to an imaging molecule.

[0018] According to a fourth aspect of the invention there is provided a pharmaceutical composition comprising a conjugate according to the second aspect.

[0019] According to a fifth aspect of the invention there is provided a conjugate according to the second aspect for use as a medicament.

[0020] In one embodiment of the fifth aspect there is provided a pharmaceutical composition according to the fourth aspect for use as a medicament.

[0021] According to a sixth aspect of the invention there is provided a method of treating a disease in a patient comprising administering to the patient a therapeutically effective amount of a conjugate of the second aspect.

[0022] In one embodiment of the sixth aspect, there is provided a method of treating a disease in a patient, the method comprising administering to the patient a therapeutically effective amount of a pharmaceutical composition of the fourth aspect.

[0023] According to a seventh aspect of the invention there is provided an isolated nucleic acid encoding a peptide of the first aspect or a conjugate of the second aspect or a conjugate of the third aspect.

[0024] According to an eighth aspect of the present invention there is provided an expression vector comprising a nucleic acid sequence according to the seventh aspect.

[0025] According to a ninth aspect of the present invention there is provided a host cell comprising an expression vector of the eighth aspect. [Brief description of the drawings]

[0026] [Figure 1]FIG. 1 is a graph showing the in vitro exon 23 skipping efficiency of several DPEP2 series peptides conjugated to antisense therapeutic molecules at 0.25 μM, 0.5 μM and 1 μM in H2K-mdx cells as measured by densitometric analysis of nested RT-PCR (error bars: standard deviation n≧3). [Diagram 2] Graph showing in vivo efficacy of several DPEP2 series peptides conjugated to antisense therapeutic molecules in (A) tibialis anterior muscle, (B) diaphragm, and (C) cardiac muscle compared to currently available peptides conjugated to the same therapeutic molecules after a single intravenous dose of 10 mg / kg in mdx mice. Dystrophin protein restoration was assessed by Western blot and exon skipping was assessed by qRTPCR (error bars: standard deviation, n=3). DETAILED DESCRIPTION OF THE PREFERRED EMBODIMENTS

[0027] The inventors have generated a series of peptides suitable for use as cell penetrating peptides to deliver therapeutic molecules into cells.

[0028] Surprisingly, the inventors have found, leading to the present invention, a group of peptides having at least one cationic domain and at least two hydrophobic domains of defined length located at the N- and C-termini of the peptide, which provide increased cell permeability to molecules compared to currently available cell penetrating peptides, an effect observed when delivered to cells as a complex with an antisense oligonucleotide therapeutic or when administered in vivo.

[0029] In the context of the disease DMD, enhanced cell penetration by the peptides of the invention combined with a suitable therapeutic molecule is demonstrated by the exclusion of specific exons within the transcript. Targeting of antisense oligonucleotides to the appropriate sequences results in forced skipping of the exon, correction of the open reading frame, and restoration of an internally deleted, yet partially functional, dystrophin isoform.

[0030] It has been shown herein that peptides of the invention, when used as conjugates with antisense oligonucleotide therapeutics designed to target the dystrophin gene, have high levels of exon exclusion and restoration of dystrophin protein.

[0031] In vivo, the results described herein show an increase in exon skipping and expression of functional dystrophin when using the peptide conjugates of the present invention compared to exon skipping results of the same antisense oligonucleotide therapeutics conjugated to currently available cell-penetrating peptides, a significant improvement in the efficacy of such peptide carriers to penetrate muscle cells where neuromuscular diseases are affected.

[0032] Without wishing to be bound by any theory, the inventors believe that the presence of a terminal hydrophobic domain has the effect of boosting the delivery properties of the peptide to deliver a therapeutic cargo into cells. This is advantageous since increased cell permeability means increased delivery of the therapeutic molecule and increased therapeutic efficacy. Furthermore, these advantages are provided at lower doses, thereby reducing the potential for toxic effects of cell-penetrating peptides.

[0033] It was entirely unexpected that such a peptide structure would enhance the ability of arginine-rich cell-penetrating peptides to deliver therapeutic molecular cargo, such as oligonucleotides, to muscle.

[0034] By increasing such transport, it was unexpected that therapeutic molecules, such as antisense oligonucleotides, could successfully increase exon skipping and the production of functional dystrophin protein in a variety of different muscles, as demonstrated here.

[0035] For the avoidance of doubt and in order to clarify how this specification is interpreted, the following further definitions are provided for terms used in accordance with the present invention.

[0036] The present invention includes various combinations of the described aspects and features except where such combinations are clearly impermissible or clearly avoided.

[0037] The section headings used herein are for organizational purposes only and should not be construed as limiting the subject matter described.

[0038] "X" everywhere represents various forms of unnatural amino acids and aminohexanoic acid.

[0039] "B" everywhere represents the naturally occurring, but non-genetically encoded amino acid residue β-alanine.

[0040] "Ac" anywhere denotes acetylation of the relevant peptide.

[0041] "Hyp" everywhere represents the related genetically encoded amino acid hydroxyproline.

[0042] Other capital letters everywhere represent the relevant genetically encoded amino acid residue according to the agreed upon amino acid code.

[0043] Cationic Domain The present invention relates to short cell-penetrating peptides that have a unique structure in which at least one cationic domain is present.

[0044] "Cationic" herein refers to amino acids and domains of amino acids that carry an overall positive charge at physiological pH.

[0045] Suitably, the peptide comprises no more than 4 cationic domains, no more than 3 cationic domains, no more than 2 cationic domains.

[0046] Preferably, each cationic domain in the peptide is the same or different. Preferably, each cationic domain in the peptide is different.

[0047] Suitably, the peptide comprises one cationic domain.

[0048] Preferably, each cationic domain has a length of from 5 to 20 amino acid residues, preferably from 9 to 14 amino acid residues.

[0049] Suitably, each cationic domain has a length of 9, 10, 11, 12, 13, or 14 amino acid residues.

[0050] Preferably, each cationic domain is of similar length, and preferably each cationic domain is the same length.

[0051] Suitably, each cationic domain comprises cationic amino acids and may also contain polar and / or non-polar amino acids.

[0052] The non-polar amino acids are selected from alanine, β-alanine, proline, glycine, cysteine, valine, leucine, isoleucine, methionine, tryptophan, and phenylalanine. Preferably, the non-polar amino acids do not carry a negative charge.

[0053] The polar amino acids are selected from serine, asparagine, hydroxyproline, histidine, arginine, threonine, tyrosine, and glutamine. Preferably, the polar amino acids selected do not carry a negative charge.

[0054] The cationic amino acid is selected from arginine, histidine, and lysine. Preferably, the cationic amino acid has a positive charge at physiological pH.

[0055] Preferably, each cationic domain does not contain any anionic or negatively charged amino acid residues.

[0056] Suitably, each cationic domain comprises arginine, aminohexanoic acid, histidine, β-alanine, hydroxyproline and / or serine residues.

[0057] Suitably, each cationic domain comprises arginine, aminohexanoic acid, and / or β-alanine residues.

[0058] Suitably, each cationic domain comprises at least 40%, at least 45%, at least 50% cationic amino acids.

[0059] Preferably, each cationic domain comprises a majority of cationic amino acids. Preferably, each cationic domain comprises at least 55%, at least 60%, at least 65%, at least 70%, at least 75%, at least 80%, at least 85%, at least 90%, at least 95% cationic amino acids.

[0060] Suitably, each cationic domain has an isoelectric point (Ip) of at least 7.5, at least 8.0, at least 8.5, at least 9.0, at least 9.5, at least 10.0, at least 10.5, at least 11.0, at least 11.5, at least 12.0.

[0061] Suitably, each cationic domain has an isoelectric point (Ip) of at least 10.0.

[0062] Suitably, each cationic domain has an isoelectric point (Ip) of 11.0 to 13.0.

[0063] In one embodiment, each cationic domain has an isoelectric point (Ip) of 12.3 to 12.7.

[0064] Preferably, the isoelectric point of the cationic domain is calculated at physiological pH by using any suitable means available in the art, preferably IPC (www.isoelectric.org) (a web-based algorithm developed by Lukasz Kozlowski; Biol Direct. 2016; 11: 55. DOI: 10.1186 / s13062-016-0159-9).

[0065] Preferably, each cationic domain comprises at least 4 cationic amino acids, preferably from 4 to 8 cationic amino acids.

[0066] Preferably, each cationic domain is arginine-rich.

[0067] "Arginine-rich" means that at least 40% of the cationic domain is formed by said residues.

[0068] Preferably, each cationic domain consists of a majority of arginine residues.

[0069] Suitably, the cationic domain may comprise at least 40%, at least 45%, at least 50%, at least 55%, at least 60%, at least 60%, at least 65%, at least 70% arginine residues.

[0070] Suitably, the cationic domain comprises a total of 4 to 8 arginine residues.

[0071] Suitably, all of the cationic amino acids in a given cationic domain may be arginine.

[0072] Preferably, each cationic domain comprises one or more β-alanine residues. Preferably, each cationic domain may comprise a total of 3 to 7 β-alanine residues, preferably a total of 4 to 6 β-alanine residues.

[0073] Suitably, each cationic domain comprises one or more aminohexanoic acid residues.

[0074] Suitably, each cationic domain may contain a total of 1 to 4 β-aminohexanoic acid residues, suitably a total of 1 to 3 aminohexanoic acid residues.

[0075] Preferably, various amino acid residues are used, for example, 4-aminohexanoic acid, 5-aminohexanoic acid, or 6-aminohexanoic acid residues. Preferably, 6-aminohexanoic acid is used.

[0076] Suitably, the cationic domain may comprise one or more histidine, hydroxyproline or serine residues.

[0077] In one embodiment, the peptide comprises one arginine-rich cationic domain.

[0078] Suitably, each cationic domain comprises no more than 3 contiguous arginine residues, no more than 2 contiguous arginine residues.

[0079] Preferably, each cationic domain may comprise arginine, aminohexanoic acid, and / or β-alanine residues. Preferably, each cationic domain comprises a majority of arginine, aminohexanoic acid, and / or β-alanine residues. Preferably, at least 70%, at least 75%, at least 80%, at least 85%, at least 90%, at least 95%, 100% of the amino acid residues in each cationic domain are arginine, aminohexanoic acid, and / or β-alanine residues. Preferably, each cationic domain consists of arginine, aminohexanoic acid, and / or β-alanine residues.

[0080] Preferably, the peptide comprises one cationic domain, which forms the core of the peptide. Preferably, the cationic domain is located in the middle of the peptide. Thus, preferably, the cationic domain is known as the cationic core domain.

[0081] In one embodiment, the peptide comprises one arginine-rich cationic domain.

[0082] Suitably, each cationic domain comprises amino acid residues selected from the following: R, X, B, RR, BB, XX, RX,XR, RB, BR, BX,

[0083] Suitably, each cationic domain comprises any of the following sequences: RBRXRBRXB (SEQ ID NO:1), RBRXRBRXBRXRB (SEQ ID NO:2), RBRXRBRXBR (SEQ ID NO:3), RBRRXRBRXBRXRB (SEQ ID NO:4), RBRXRBRBRXRB (SEQ ID NO:5), RBRXRBRBRBRB (SEQ ID NO:6), RBRBRBRBRBRB (SEQ ID NO:7), RBRXRBRBRXR (SEQ ID NO:8), RBRRBRBRBRRB (SEQ ID NO:9), RBRRBRBRBRRXBRXRB (SEQ ID NO:10), RBRRBRBRBBRXRB (SEQ ID NO:11), RBRRBRBRBBRBRB (SEQ ID NO:12), or various combinations thereof.

[0084] Preferably, each cationic domain comprises any of the following sequences: RBRXRBRXB (SEQ ID NO:1), RBRXRBRXBRXRB (SEQ ID NO:2), RBRXRBRXBR (SEQ ID NO:3), RBRRXRBRXBRXRB (SEQ ID NO:4), RBRXRBRBRXRB (SEQ ID NO:5), RBRXRBRBRBRB (SEQ ID NO:6), RBRBRBRBRBRB (SEQ ID NO:7), RBRXRBRBRXR (SEQ ID NO:8), RBRRBRBRBRRB (SEQ ID NO:9), RBRRBRBRBRRXBRXRB (SEQ ID NO:10), RBRRBRBRBBRXRB (SEQ ID NO:11), RBRRBRBRBBRBRB (SEQ ID NO:12), or various combinations thereof.

[0085] Suitably, each cationic domain consists of one of the following sequences: RBRRXRBRXBRXRB (sequence number 4), RBRRBRBRBRRB (sequence number 9), RBRRBRBRBBRXRB (sequence number 11).

[0086] Preferably, each cationic domain in the peptidase is the same or different. Preferably, each cationic domain in the peptide is different.

[0087] Hydrophobic domain The present invention relates to short cell-penetrating peptides having a specific structure in which there are at least two hydrophobic domains of a specific length, the hydrophobic domains being located at each end of the peptide.

[0088] Here, "hydrophobic" refers to an amino acid or domain of amino acids that has the ability to repel water and / or not mix with water.

[0089] Suitably, the peptide comprises no more than four hydrophobic domains, no more than three hydrophobic domains.

[0090] Suitably, the peptide comprises two hydrophobic domains.

[0091] As defined above, a peptide comprises two or more hydrophobic domains, each having a length of at least three amino acid residues.

[0092] Preferably, each Hydrophobicity The domains have a length of 3 to 6 amino acids. Preferably, each hydrophobic domain has a length of 5 amino acids.

[0093] Suitably, each hydrophobic domain may comprise non-polar, polar and hydrophobic amino acid residues.

[0094] The hydrophobic amino acid residues are selected from alanine, valine, leucine, isoleucine, phenylalanine, tyrosine, methionine, and tryptophan.

[0095] The non-polar amino acid residues are selected from alanine, β-alanine, valine, leucine, isoleucine, phenylalanine, methionine, tryptophan, proline, glycine, and cysteine.

[0096] The polar amino acid residue is selected from serine, asparagine, hydroxyproline, histidine, arginine, threonine, tyrosine, and glutamine.

[0097] Suitably, the hydrophobic domain does not comprise any hydrophilic amino acid residues.

[0098] Preferably, each hydrophobic domain consists predominantly of hydrophobic amino acid residues. Preferably, each hydrophobic domain comprises at least 70%, at least 75%, at least 80%, at least 85%, at least 90%, at least 95%, 100% hydrophobic amino acid residues.

[0099] Preferably, each hydrophobic domain has a hydrophobicity of at least 0.3, at least 0.35, at least 0.4, at least 0.45.

[0100] Preferably, each hydrophobic domain has a hydrophobicity of 0.4 to 1.4.

[0101] In one embodiment, each hydrophobic domain has a hydrophobicity index of 0.45 to 0.48.

[0102] Preferably, hydrophobicity is measured according to White and Wimley: WC Wimley and SH White, "Experimentally determined hydrophobicity scale for membrane-bound proteins", Nature Struct Biol, 3:842 (1996).

[0103] Preferably, each hydrophobic domain comprises at least three, and at least four, hydrophobic amino acid residues.

[0104] Preferably, each hydrophobic domain comprises phenylalanine, leucine, isoleucine, tyrosine and glutamine residues.Preferably, each hydrophobic domain consists of phenylalanine, leucine, isoleucine, tyrosine and glutamine residues.

[0105] Preferably, the peptide comprises two hydrophobic domains. Preferably, the hydrophobic domains are located at the N-terminus and C-terminus of the peptide, preferably at either terminus of the peptide. Preferably, there are no further amino acids or domains at the N-terminus and C-terminus of the peptide, except for other groups, e.g. terminal modifications, linkers and / or therapeutic molecules. For the avoidance of doubt, such other groups may be present in addition to the "peptide" as described and claimed herein. Thus, preferably, each hydrophobic domain forms an end of the peptide. Preferably, this does not preclude the presence of further linker groups, as described herein.

[0106] Preferably, the hydrophobic domain is adjacent to the core domain. Preferably, the hydrophobic domain is considered an arm domain. Preferably, the core domain may comprise one or more cationic domains and one or more further hydrophobic domains. Preferably, the core domain comprises one cationic domain.

[0107] In one embodiment, the peptide comprises two hydrophobic arm domains flanking a core domain, the core domain comprising one cationic domain.

[0108] In one embodiment, the peptide consists of two hydrophobic arm domains flanking a core domain, the core domain comprising one cationic domain.

[0109] Suitably, the or each hydrophobic domain comprises one of the following sequences: YQFLI (SEQ ID NO: 13), FQILY (SEQ ID NO: 14), ILFQY (SEQ ID NO: 15) or various combinations thereof.

[0110] Suitably, the or each hydrophobic domain consists of one of the following sequences: YQFLI (SEQ ID NO: 13), FQILY (SEQ ID NO: 14), ILFQY (SEQ ID NO: 15) or various combinations thereof.

[0111] Suitably the or each hydrophobic domain consists of the sequence YQFLI (SEQ ID NO: 13).

[0112] Suitably, each hydrophobic domain in the peptide has the same sequence or a different sequence.

[0113] peptide The present invention relates to short cell-penetrating peptides for use in the delivery of therapeutic cargo molecules in the treatment of medical conditions.

[0114] The peptide has a single adjacent molecule. Preferably, the peptide comprises several domains linearly between the N-terminus and the C-terminus. Preferably, the domains are selected from the cationic and hydrophobic domains described above. Preferably, the peptide consists of a cationic domain and a hydrophobic domain, the domains being as defined above.

[0115] Each domain shares common sequence characteristics, as described in the appropriate sections above, but the exact sequence of each domain is subject to variation and modification. Thus, a range of sequences are possible for each domain. Combinations of each possible domain sequence give rise to a range of peptide structures, each of which forms an article of the invention. The characteristics of the peptide structures are described below.

[0116] Preferably, a cationic domain separates each hydrophobic domain. Preferably, each cationic domain is adjacent on either side to a hydrophobic domain.

[0117] Preferably, a hydrophobic domain is not adjacent to another hydrophobic domain.

[0118] In one embodiment, the peptide comprises one cationic domain flanked by two hydrophobic domains in the following sequence: [Hydrophobic domain]-[Cationic domain]-[Hydrophobic domain]

[0119] Thus, preferably the cationic domain is known as a core domain and each of the hydrophobic domains is known as an arm domain. Preferably, the hydrophobic arm domain is adjacent on either side to a cationic domain.

[0120] In one embodiment, the peptide consists of one cationic domain and two hydrophobic domains.

[0121] In one embodiment, the peptide consists of a cationic core domain flanked by two hydrophobic domains.

[0122] In one embodiment, the peptide consists of one cationic core domain comprising a sequence selected from RBRXRBRXB (SEQ ID NO:1), RBRXRBRXBRXRB (SEQ ID NO:2), RBRXRBRXBR (SEQ ID NO:3), RBRRXRBRXBRXRB (SEQ ID NO:4), RBRXRBRBRXRB (SEQ ID NO:5), RBRXRBRBRBRB (SEQ ID NO:6), RBRBRBRBRBRB (SEQ ID NO:7), RBRXRBRBRXR (SEQ ID NO:8), RBRRBRBRBRRB (SEQ ID NO:9), RBRRBRBRBRRXBRXRB (SEQ ID NO:10), RBRRBRBRBBRXRB (SEQ ID NO:11), RBRRBRBRBBRBRB (SEQ ID NO:12), flanked by two hydrophobic arm domains each comprising a sequence selected from YQFLI (SEQ ID NO:13), FQILY (SEQ ID NO:14), ILFQY (SEQ ID NO:15).

[0123] In one embodiment, the peptide consists of one cationic core domain comprising a sequence selected from RBRRXRBRXBRXRB (SEQ ID NO: 4), RBRRBRBRBRRB (SEQ ID NO: 9), RBRRBRBRBBRXRB (SEQ ID NO: 11), flanked by two hydrophobic arm domains each comprising the sequence YQFLI (SEQ ID NO: 13).

[0124] In any of these embodiments, further groups can be present, such as linkers, terminal modifications and / or therapeutic molecules.

[0125] Preferably, the peptide is N-terminally modified.

[0126] Preferably, the peptide is N-acetylated, N-methylated, N-trifluoroacetylated, N-trifluoromethylsulfonylated, or N-methylsulfonylated. Preferably, the peptide is N-acetylated.

[0127] Optionally, the N-terminus of the peptide may be unmodified.

[0128] In one embodiment, the peptide is N-acetylated.

[0129] Preferably, the peptide is C-terminally modified.

[0130] Suitably, the peptide comprises a C-terminal modification selected from a carboxy-, thioacid-, aminooxy-, hydrazino-, thioester-, azide, strained alkyne, strained alkene, aldehyde-, thio or haloacetyl-group.

[0131] Advantageously, the C-terminal modification provides a means for attaching the peptide to a therapeutic molecule.

[0132] Thus, the C-terminal modification may or may not include a linker.

[0133] Suitably, the C-terminal modification may or may not consist of a linker. Suitable linkers are described herein or elsewhere.

[0134] Suitably, the peptide comprises a C-terminal carboxyl group.

[0135] Suitably the C-terminal carboxyl group is provided by a glycine or β-alanine residue.

[0136] In one embodiment, the C-terminal carboxyl group is provided by a β-alanine residue.

[0137] Suitably, the C-terminal β-alanine residue is the linker.

[0138] Preferably, therefore, each hydrophobic domain may further comprise an N- or C-terminal modification. Preferably, the C-terminal hydrophobic domain comprises a C-terminal modification. Preferably, the N-terminal hydrophobic domain comprises an N-terminal modification. Preferably, the C-terminal hydrophobic domain comprises a linker group and preferably, the C-terminal hydrophobic domain comprises a C-terminal β-alanine. Preferably, the N-terminal hydrophobic domain is N-acetylated.

[0139] The peptides of the present invention are defined as having a total length of 40 or less amino acid residues. Therefore, the peptides are considered to be oligopeptides. Suitably, the peptides have a total length of 10 to 35 amino acid residues, preferably 12 to 33 amino acid residues, 15 to 30 amino acid residues, 17 to 27 amino acid residues, or 20 to 25 amino acid residues.

[0140] Suitably, the peptides have an overall length of at least 16, at least 17, at least 18, at least 19, at least 20 amino acid residues.

[0141] Advantageously, the peptide is capable of penetrating cells, and therefore the peptide is considered a cell penetrating peptide.

[0142] Preferably, the peptide is for attachment to a therapeutic molecule. Preferably, the peptide is for transporting a therapeutic molecule to a target cell. Preferably, the peptide is for delivery of a therapeutic molecule to a target cell. Hence, the peptide is considered to be a carrier peptide.

[0143] Preferably, the peptide is capable of penetrating cells and tissues, preferably the nucleus of cells, and preferably the peptide is capable of penetrating muscle tissue.

[0144] Preferably, the peptide is selected from the following sequences: YQFLIRBRXRBRXBYQFLI (SEQ ID NO:16) YQFLIRBRXRBRXBRXRBYQFLI (SEQ ID NO:17) YQFLIRBRXRBRXBRYQFLI (SEQ ID NO:18) YQFLIRBRRXRBRXBRXRBYQFLI (SEQ ID NO:19) YQFLIRBRXRBRBRXRBYQFLI (SEQ ID NO:20) YQFLIRBRXRBRBRBRBYQFLI (SEQ ID NO:21) YQFLIRBRBRBRBRBRBYQFLI (SEQ ID NO:22) YQFLIRBRXRBRBRXRYQFLI (SEQ ID NO:23) YQFLIRBRRBRBRBRRBYQFLI (SEQ ID NO:24) YQFLIRBRRBRBRXBRXRBYQFLI (SEQ ID NO:25) YQFLIRBRRBRBRBBRXRBYQFLI (SEQ ID NO:26) YQFLIRBRRBRBRBBRBRBYQFLI (SEQ ID NO:27) FQILYRBRRBRBRBBRBRBFQILY (SEQ ID NO:28) YQFLIRBRRXRBRXBRXRBFQILY (SEQ ID NO:29)

[0145] Suitably, the peptide consists of one of the following sequences: YQFLIRBRRXRBRXBRXRBYQFLI (SEQ ID NO:19) YQFLIRBRRBRBRBRRBYQFLI (SEQ ID NO:24) YQFLIRBRRBRBRBBRXRBYQFLI (SEQ ID NO:26)

[0146] In one embodiment, the peptide has the sequence: YQFLIRBRRXRBRXBRXRBYQFLI (SEQ ID NO:19) It consists of:

[0147] Complex The peptides of the invention are covalently attached to a therapeutic molecule to provide a conjugate.

[0148] Therapeutic molecules are various molecules for treating diseases. Therapeutic molecules are selected from nucleic acids, peptide nucleic acids, antisense oligonucleotides (e.g., PNA, PMO), short interfering RNA, microRNA, mRNA, gRNA (e.g., using CRISPR / Cas9 technology), antagomir RNA, peptides, cyclic peptides, proteins, drugs, drugs, or nanoparticles.

[0149] In one embodiment, the therapeutic molecule is an antisense oligonucleotide.

[0150] Preferably, the antisense oligonucleotides consist of phosphorodiamidate morpholino oligonucleotides (PMOs).

[0151] Alternatively, the oligonucleotide is a modified PMO, or other charge-neutral oligonucleotide, such as a peptide nucleic acid (PNA), a chemically modified PNA (e.g., γ-PNA (Bahal, Nat.Comm. 2016)), an oligonucleotide phosphoramidate (wherein the non-bridging oxygen of the phosphate is replaced by an amine or alkylamine, such as those described in WO 2016 / 028178), or other partially or completely charge-neutralized oligonucleotide.

[0152] Therapeutic antisense oligonucleotide sequences are selected from those available, for example, antisense oligonucleotides for exon skipping in DMD are described in https: / / research-repository.uwa.edu.au / en / publications / antisense-oligonucleotide-induced-exon-skipping-across-the-human-, and therapeutic antisense oligonucleotides complementary to ISSN1 or IN7 sequences for the treatment of SMA are described in Zhou, HGT, 2013; Hammond et al., 2016; and Osman et al., HMG, 2014.

[0153] Suitably, the antisense oligonucleotide sequences are for inducing exon skipping for use in the treatment of DMD.

[0154] Suitably, the antisense oligonucleotide sequence is for inducing exon skipping in the dystrophin gene for use in the treatment of DMD. Suitably, the antisense oligonucleotide sequence is capable of inducing exon skipping of one or multiple exons.

[0155] In one embodiment, the antisense oligonucleotide sequence is for inducing exon skipping of a single exon of the dystrophin gene for use in treating DMD. Preferably, the single exon is selected from various exons associated with DMD, such as various exons in the dystrophin gene, for example exons 45, 51, or 53.

[0156] PMO oligonucleotides of either sequence are commercially available (eg, from Gene Tools Inc., USA).

[0157] In one embodiment, the therapeutic molecule of the conjugate is an oligonucleotide complementary to the pre-mRNA of the gene target.

[0158] Preferably, an oligonucleotide complementary to the pre-mRNA of the gene target undergoes a steric blocking event which modifies the pre-mRNA, leading to a modified mRNA and thus a protein of modified sequence. Preferably, the gene target is the dystrophin gene.

[0159] Preferably, the steric blocking event is exon inclusion or exon skipping. In one embodiment, the steric blocking event is exon skipping, preferably exon skipping of a single exon of the dystrophin gene.

[0160] Optionally, lysine residues are added to one or both ends of the therapeutic molecule (eg, PMO or PNA) prior to attachment to the peptide to improve water solubility.

[0161] Suitably, the therapeutic molecule has a molecular weight of 5,000 Da or less, 3,000 Da or less, or 1,000 Da or less.

[0162] Preferably, the peptide is covalently attached to the therapeutic molecule at the C-terminus. Preferably, the peptide is covalently attached to the therapeutic molecule, optionally via a linker, which acts as a spacer to separate the peptide sequence from the therapeutic molecule. In one embodiment, the conjugate comprises a linker.

[0163] The linker may be selected from a variety of suitable sequences.

[0164] Preferably, the linker is part of the peptide or the therapeutic molecule. Preferably, the linker is between the peptide and the therapeutic molecule.

[0165] In one embodiment, the conjugate is covalently attached to the therapeutic molecule via a linker. In one embodiment, the conjugate comprises the following structure: [Peptide]-[Linker]-[Therapeutic molecule]

[0166] In one embodiment, the complex comprises the following sequence: [Peptide]-[Linker]-[Therapeutic molecule]

[0167] A conjugate according to the invention may use any of the peptides set forth herein. In one embodiment, the conjugate comprises a peptide selected from one of the following sequences: YQFLIRBRRXRBRXBRXRBYQFLI (SEQ ID NO: 19), YQFLIRBRRBRBRRBYQFLI (SEQ ID NO: 24), and YQFLIRBRRBRBRBBRXRBYQFLI (SEQ ID NO: 26).

[0168] Suitably, in either case, the peptide may further comprise an N-terminal modification as described above.

[0169] Suitable linkers include, for example, C-terminal cysteine ​​residues that allow the formation of disulfide, thioether, or thiol-maleimide bonds, C-terminal aldehydes that form oximes (click reactions or formation of a morpholine bond with a carboxylic acid moiety on a peptide covalently bound to a basic amino acid or amino group on the peptide to form a carboxamide bond).

[0170] Preferably, the linker is 1 to 5 amino acids in length. Preferably, the linker is any of the linkers known in the art.

[0171] Suitably, the linker is any one selected from the following sequences: G, BC, XC, C, GGC, BBC, BXC, XBC, X, XX, B, BB, BX, and XB.

[0172] Suitably the linker may be a polymer, for example PEG.

[0173] In one embodiment, the linker is β-alanine.

[0174] In one embodiment, the peptide is conjugated to the therapeutic molecule via a carboxamide bond.

[0175] The linker of the conjugate can form part of the therapeutic molecule to which the peptide is attached. Alternatively, the attachment of the therapeutic molecule is directly bonded to the C-terminus of the peptide. Preferably, in such an embodiment, a linker is not required.

[0176] Alternatively, the peptide is chemically coupled to the therapeutic molecule, for example via a disulfide, alkenyl, alkynyl, aryl, ether, thioether, triazole, amide, carboxamide, urea, thiourea, semicarbazide, carbazide, hydrazine, oxime, sulfate, phosphoramidate, thiophosphate, boranophosphate, iminophosphate, or thiol-maleimide bond.

[0177] Optionally, at the N-terminus of the therapeutic molecule, a cysteine ​​is added to allow for disulfide bond formation to the peptide, or the N-terminus can undergo bromoacetylation for thioether linkage to the peptide.

[0178] The peptides of the present invention may equally be covalently attached to an imaging molecule to form a complex.

[0179] Preferably, the imaging molecule is any molecule that allows visualization of the complex. Preferably, the imaging molecule is capable of indicating the location of the complex, preferably in vitro or in vivo. Preferably, a method of monitoring the location of a complex comprising an imaging molecule is provided, comprising administering the complex to a subject and imaging the subject to indicate the location of the complex.

[0180] Examples of imaging molecules include detection molecules, contrast molecules, or enhancement molecules. Suitable imaging molecules are selected from radionuclides, fluorophores, nanoparticles (e.g., nanoshells), nanocargoes, color-forming agents (e.g., enzymes), radioisotopes, dyes, radio-opaque materials, fluorescent compounds, and combinations thereof.

[0181] Preferably, imaging molecules are visualized using imaging technologies, which may be cellular imaging technologies or medical imaging technologies. Suitable cellular imaging technologies include, for example, cellular image analysis, fluorescence microscopy, phase contrast microscopy, SEM, TEM. Suitable medical imaging technologies include, for example, X-ray, fluoroscopy, MRI, scintigraphy, SPECT, PET, CT, CAT, FNRI.

[0182] In some cases, the imaging molecule is considered a diagnostic molecule. Preferably, the diagnostic molecule allows for the diagnosis of a disease using the conjugate. Preferably, diagnosis of the disease is achieved through measuring the location of the conjugate using the imaging molecule. Preferably, a method for diagnosing a disease is provided, the method comprising administering to a subject an effective amount of a conjugate comprising an imaging molecule and monitoring the location of the conjugate.

[0183] Suitably, further details such as the attachment of the conjugate comprising the imaging molecule are the same as above for the conjugate comprising the therapeutic molecule.

[0184] Suitably, the peptides of the invention are covalently linked to a therapeutic molecule and an imaging molecule to provide a conjugate.

[0185] Preferably, the complex is capable of penetrating cells and tissues, preferably the nucleus of a cell.

[0186] Pharmaceutical Compositions The conjugates of the present invention are formulated into pharmaceutical compositions.

[0187] Suitably, the pharmaceutical composition comprises a conjugate of the invention.

[0188] Suitably, the pharmaceutical composition may further comprise a pharma- ceutically acceptable diluent, adjuvant, or carrier.

[0189] Suitable pharma- ceutically acceptable diluents, adjuvants, and carriers are known in the art.

[0190] As used herein, the expression "pharmacologically acceptable" refers to a ligand, substance, formulation, and / or dosage form that is consistent with sound medical common sense, without excessive toxicity, irritation, allergic response, or other problem or complication, and commensurate with a reasonable benefit / risk ratio.

[0191] As used herein, the expression "pharmaceutical acceptable carrier" refers to a pharmaceutical acceptable substance or vehicle, such as a liquid or solid filler, diluent, additive, solvent or encapsulating substance, involved in carrying or transporting the complex from one organ or part of the body to another organ or part of the body. Each cell penetrating peptide must be "safe" in the sense that it is compatible with the other components of the composition, such as the peptide and the therapeutic molecule, and must not be harmful to humans. Lyophilized compositions (to be reconstituted and administered) are also within the scope of the compositions of the present invention.

[0192] Pharmaceutically acceptable carriers are, for example, additives, vehicles, diluents, and combinations thereof. For example, when compositions are administered orally, they are formulated as tablets, capsules, granules, powders, or syrups; for parenteral administration, they are formulated as injections, drops, or suppositories. These compositions are prepared by a common method, and if necessary, the active compound (i.e., the complex) is mixed with various common additives, such as excipients, binders, disintegrants, lubricants, flavorings, solubilizers, suspension aids, emulsifiers, coating agents, or combinations thereof.

[0193] It should be understood that the pharmaceutical compositions described herein may further include additional known therapeutic agents, drugs, modifications of compounds to prodrugs, etc., for pharmaceutical use to alleviate, mediate, and treat the diseases, disorders, and conditions described herein. Preferably, the pharmaceutical composition is for use as a medicament, preferably in the same manner as described herein for the conjugates. All features described herein for treatment using the conjugates apply to the pharmaceutical composition.

[0194] Thus, in a further aspect the invention provides a pharmaceutical composition according to the fourth aspect for use as a medicament.In a further aspect there is provided a method of treating a patient for a disease condition comprising administering to the patient an effective amount of a pharmaceutical composition according to the fourth aspect.

[0195] medical use Conjugates comprising the peptides of the invention are used as medicaments for the treatment of diseases.

[0196] The medicament is in the form of a pharmaceutical composition as defined above.

[0197] Also provided is a method of treating a patient or subject in need of treatment for a disease condition, the method comprising administering to the patient or subject a therapeutically effective amount of a conjugate.

[0198] Preferably, the medical treatment requires the delivery of a therapeutic molecule to a cell, preferably to the nucleus of the cell.

[0199] The diseases to be treated include a variety of diseases in which improved passage of the cellular and / or nuclear membrane by a therapeutic molecule would lead to improved therapeutic efficacy.

[0200] Suitably the conjugate is for use in the treatment of a disease of the neuromuscular system.

[0201] A complex comprising a peptide of the invention is suitable for the treatment of a genetic disease of the neuromuscular system. A complex comprising a peptide of the invention is suitable for the treatment of a genetic neuromuscular disease. In a preferred embodiment, a complex according to the second aspect is provided for use in the treatment of a genetic disease of the neuromuscular system. Suitably, the complex is for use in the treatment of a genetic disease of the neuromuscular system. Suitably, the complex is for use in the treatment of a genetic neuromuscular disease. Suitably, the complex is for use in the treatment of a genetic X-linked genetic disease of the neuromuscular system. Suitably, the complex is for use in the treatment of a genetic X-linked neuromuscular disease of the neuromuscular system.

[0202] Advantageously, the complex is for use in the treatment of a disease caused by a splicing defect, in such an embodiment, the therapeutic molecule may comprise an oligonucleotide capable of preventing or correcting the splicing defect and / or increasing correctly spliced ​​mRNA molecules.

[0203] Suitably, the conjugate is for use in the treatment of any of the following diseases: Duchenne muscular dystrophy (DMD), Bucher muscular dystrophy (BMD), Menkes disease, beta thalassemia, dementia, Parkinson's disease, spinal muscular atrophy (SMA), myotonic dystrophy (DM), Huntington's disease, Hutchinson-Gilford Progeria syndrome, ataxia telangiectasia, or cancer.

[0204] In one embodiment, the conjugate is for use in the treatment of DMD.

[0205] In one embodiment there is provided a conjugate according to the second aspect for use in the treatment of DMD.

[0206] Preferably, in such embodiments, the therapeutic molecule of the complex is capable of acting to increase expression of a dystrophin protein. Preferably, in such embodiments, the therapeutic molecule of the complex is capable of acting to increase expression of a functional dystrophin protein.

[0207] Preferably, the complex increases dystrophin expression by 10%, 15%, 20%, 25%, 30%, 35%, 40%, 45%, 50%, 55%, 60%, 65%, 70%. Preferably, the complex increases dystrophin expression by up to 50%.

[0208] Preferably, the complex restores dystrophin expression by 10%, 15%, 20%, 25%, 30%, 35%, 40%, 45%, 50%, 55%, 60%, 65%, 70%. Preferably, the complex restores dystrophin expression by up to 50%.

[0209] Preferably, the complex restores 10%, 15%, 20%, 25%, 30%, 35%, 40%, 45%, 50%, 55%, 60%, 65%, 70% of the function of the dystrophin protein. Preferably, the complex increases the function of the dystrophin protein by up to 50%.

[0210] Preferably, the therapeutic molecule of the complex may act to do so by causing the splicing of one or more exons during transcription of dystrophin.

[0211] Preferably, the complex causes 10%, 15%, 20%, 25%, 30%, 35%, 40%, 45%, 50%, 55%, 60%, 65%, 70%, 75%, 80%, 85% splicing of one or more exons of the dystrophin gene. Preferably, the complex causes up to 50% splicing of one or more exons of the dystrophin gene.

[0212] Preferably, the patient or subject to be treated is any animal or human. Preferably, the patient or subject to be treated is a non-human mammal. The patient or subject to be treated is male or female. In one embodiment, the subject is male.

[0213] Preferably, the patient or subject to be treated is of any age. Preferably, the patient or subject to be treated is aged 0-40 years, preferably 0-30 years, preferably 0-25 years, preferably 0-20 years.

[0214] Preferably, the conjugate is for administration to a subject systemically, for example, by intramedullary, intrathecal, intraventricular, enteral, parenteral, intravenous, intraarterial, intramuscular, intratumoral, subcutaneous, oral, or intranasal route.

[0215] In one embodiment, the conjugate is for intravenous administration to a subject. In one embodiment, the conjugate is for intravenous administration to a subject by injection.

[0216] Preferably, the conjugate is to be administered to a subject in a "therapeutically effective amount," meaning that the amount is sufficient to show benefit in an individual. The actual amount administered, and the rate and time-course of administration, will depend on the nature and severity of the disease being treated. Determination of dosage is within the responsibility of the general practitioner or physician. Examples of techniques and protocols can be found in Remington's Pharmaceutical Sciences, 20th Edition, 2000, published by Lippincott, Williams & Wilkins.

[0217] Exemplary doses are 0.01-50 mg / kg, 0.05-40 mg / kg, 0.1-30 mg / kg, 0.5-18 mg / kg, 1-16 mg / kg, 2-15 mg / kg, 5-10 mg / kg, 10-20 mg / kg, 12-18 mg / kg, 13-17 mg / kg.

[0218] Advantageously, the dosage of the complexes of the invention is on the order of or lower than the dosage required to see any effect from the therapeutic molecule alone, and lower than currently available cell penetrating peptides.

[0219] Nucleic Acids and Hosts The peptides of the invention can be produced by a variety of standard protein synthesis methods, such as chemical synthesis, semi-chemical synthesis, or through the use of an expression system.

[0220] The invention therefore also relates to a nucleotide sequence comprising or consisting of a DNA encoding the peptide, to expression systems, e.g. vectors comprising said sequence together with sequences necessary for the expression and control of expression, and to host cells and host organisms transformed with said expression systems.

[0221] Thus, nucleic acids encoding the peptides according to the invention are also provided.

[0222] Suitably, the nucleic acid is provided in isolated or purified form.

[0223] Also provided is an expression vector comprising a nucleic acid encoding a peptide according to the invention.

[0224] Preferably, the vector is a plasmid.

[0225] Suitably, the vector comprises a control sequence, such as a promoter, operably linked to the nucleic acid encoding the peptide according to the invention. Suitably, the expression vector is capable of expressing the peptide when transfected into a suitable cell, such as a mammalian, bacterial or fungal cell.

[0226] A host cell comprising an expression vector of the invention is also provided.

[0227] The expression vector is selected depending on the host cell into which the nucleic acid of the present invention is inserted. Such transformation of the host cell includes common techniques, such as those taught by Sambrook et al. (Sambrook, J., Russell, D. (2001), Molecular Cloning: A Practical Manual, Cold Spring Harbor Laboratory Press, NY, USA). The selection of a suitable vector is within the skill of the art. Suitable vectors include plasmids, bacteriophages, cosmids, and viruses.

[0228] The produced peptide is isolated and purified from the host cell by any suitable method, such as precipitation or chromatographic separation, for example affinity chromatography.

[0229] Suitable vectors, hosts and recombinant gene techniques are well known in the art.

[0230] As used herein, the term "operably linked" includes the situation where a selected nucleotide sequence and a control nucleotide sequence are covalently linked in a manner that allows expression of the nucleic acid coding sequence under the control of the control sequence, such that the control sequence is capable of effecting transcription of the nucleotide coding sequence that forms part or all of the selected nucleotide sequence. If necessary, the transcription achieved is then translated into the desired protein.

[0231] Specific embodiments of the invention will now be described with reference to the accompanying drawings and tables.

[0232] Throughout this specification and the claims, the terms "comprise" and "include" and variations thereof mean "including, but not limited to," and they are not intended to (and do not) exclude other moieties, additives, ingredients, integers, or steps. Throughout this specification and the claims, the singular includes the plural unless the content requires otherwise. In particular, where the indefinite article is used, the specification should be understood as contemplating the plural as well as the singular, unless the content requires otherwise.

[0233] It should be understood that any feature, integer, property, compound, chemical moiety, or group described in connection with a particular aspect, embodiment, or example of the invention is applicable to any other aspect, embodiment, or example described herein, unless incompatible. All of the features described in this specification (including the claims, abstract, and drawings), and / or all of the steps of the various methods described, may be combined in any combination, except where at least some of such features and / or steps are mutually exclusive.

[0234] The present invention is not limited to the details of the various preceding embodiments. The present invention extends to any one or any novel combination of features disclosed in this specification (including the claims, abstract, and drawings), or any one or any novel combination of process steps disclosed. The reader's attention is directed to all articles and documents filed contemporaneously with or prior to the specification of this application and published for inspection herewith, and the contents of all such articles and documents are incorporated herein by reference.

[0235] [Example] 1. Materials and Methods 1.1 Synthesis and preparation of P-PMO 9-Fluorenylmethoxycarbonyl (Fmoc) protected L-amino acids, benzotriazol-1-yl-oxy-tris-pyrrolidino-phosphonium (PyBOP), 2-(1H-benzotriazol-1-yl)-1,1,3,3-tetramethyluronium hexafluorophosphate (HBTU), and Fmoc-β-Ala-OH preloaded Wang resin (0.19 or 0.46 mmol / g) were obtained from Merck (Hohenbrunn, Germany). HPLC grade acetonitrile, methanol, and synthesis grade N-methyl-2-pyrrolidone (NMP) were purchased from Fisher Scientific (Loughborough, UK). Peptide synthesis grade N,N-dimethylformamide (DMF) and diethyl ether were obtained from VWR (Leicestershire, UK). Piperidine and trifluoroacetic acid (TFA) were obtained from Alfa Aesar (Heysham, England). PMO was purchased from Gene Tools Inc. (Philomas, USA). Chicken embryo extract and horse serum were obtained from Sera Laboratories International Ltd (West Sussex, UK). Interferon was obtained from Roche Applied Science (Penzberg, Germany). All reagents were obtained from Sigma-Aldrich (St. Louis, MO, USA) unless otherwise stated. MALDI-TOF mass spectrometry was performed using a Voyager DE Pro BioSpectrometry workstation. As matrix, a stock solution of 10 mg / ml of α-cyano-4-hydroxycinnamic acid or sinapic acid in 50% acetonitrile in water was used. Error bars: standard deviation is ±0.1%.

[0236] 1.2 Synthesis of P-PMO peptides for screening in H2k mdx cells a) Preparation of a library of peptide variants Peptides were prepared using Fmoc-β-Ala-OH preloaded Wang resin (0.19 or 0.46 mmol / g, Merck Millipore) on a 10 μmole scale using an Intavis Parallel peptide synthesizer or on a 100 μmole scale using a CEM Liberty Blue™ peptide synthesizer (Buckingham, UK) by applying standard Fmoc chemistry and following the manufacturer's recommendations. In the case of using the Intavis Parallel peptide synthesizer, double coupling steps were used with a PyBOP / NMM coupling mixture, with acetic anhydride coupling after each step. For syntheses using the CEM Liberty Blue peptide synthesizer, single standard couplings were performed for all amino acids except arginine, which were then carried out by double coupling. Couplings were performed once at 75° C. for 5 min at 60 W microwave power, with the exception of the arginine residue, which was coupled twice each. Each deprotection reaction was carried out twice at 75°C, once for 30 s and then for 3 min, at 35 W microwave power. Upon completion of the synthesis, the resin was washed with DMF (3 x 50 ml) and the N-terminus of the solid phase-bound peptide was acetylated with acetic anhydride in the presence of DIPEA at room temperature. After N-terminal acetylation, the peptide resin was washed with DMF (3 x 20 ml) and DCM (3 x 20 ml). The peptide was cleaved from the solid support by treatment with a cleavage cocktail consisting of trifluoroacetic acid (TFA):H2O:triisopropylsilane (TIPS) (95%:2.5%:2.5%; 3-10 ml) at room temperature for 3 h. After release of the peptide, excess TFA was removed by sparging with nitrogen. The crude peptide was precipitated by addition of cold diethyl ether (15-40 ml depending on the scale of the synthesis) and centrifuged at 3200 rpm for 5 min. The crude peptide pellet was washed three times with cold diethyl ether (3×15 ml) and purified by RP-HPLC using a Varian 940-LC HPLC system equipped with a 445-LC scale-up module and a 440-LC fraction collector.Purification was performed by semi-preparative HPLC on a RP-C18 column (10x250 mm, Phenomenex Jupiter) using a linear gradient of CH3CN in 0.1% TFA / H2O at a flow rate of 15 ml / min. Detection was performed at 220 nm and 260 nm. Fractions containing the desired peptide were combined and lyophilized to give the peptide as a white solid (see Table 2 for yields).

[0237] Table 1. Peptides with N-terminal acetylation and C-terminal β-alanine linker (X is 6-aminohexanoic acid) synthesized in each example. [Table 1]

[0238] Table 2. Yields of peptides synthesized for conjugation [Table 2]

[0239] b) Synthesis of a library of PMO-peptide conjugates A 25-mer PMO antisense sequence for mouse dystotrophin exon-23 (GGCCAAACCTCGGCTTACCTGAAAT (SEQ ID NO: 30)) was used. The peptide was attached to the 3'-end of the PMO via its C-terminal carboxyl group. This was done in NMP in the presence of 2.5 equivalents of DIPEA using 2.5 and 2 equivalents of PyBOP and HOAt, respectively, and a 2.5-fold excess of peptide over PMO dissolved in DMSO was used. In some examples, 2 equivalents of HBTU was used instead of PyBOP for activation of the C-terminal carboxyl group of the peptide. Typically, to a solution of peptide (2500 nmoles) in N-methylpyrrolidone (NMP, 80 μl) were added PyBOP (19.2 μl of a 0.3 M NMP solution), HOAt (16.7 μl of a 0.3 M NMP solution), DIPEA (1.0 μl), and PMO (100 μl of a 10 mM DMSO solution). The mixture was left at 40° C. for 2.5 h and the reaction was quenched by adding 0.1% aqueous TFA (300 μl). The solution was purified by ion exchange chromatography using a reverse Gilson HPLC system. The PMO-peptide conjugate was purified on an ion exchange column (Resource S4 ml, GE Healthcare) using a linear gradient of sodium sulfate buffer (25 mM, pH 7.0) containing 20% ​​CH3CN. The conjugate was eluted from the column using sodium chloride solution (1 M) at a flow rate of 4 l / min. Fractions containing the desired compound were combined and lyophilized to give the peptide-PMO derivative as a white solid. Excess salt was removed from the peptide-PMO complex via filtration of the fractions collected after ion exchange using an Amicon® ultra-15 3K stretch filter device. The complex was lyophilized and analyzed by MALDI-TOF. The complex was dissolved in sterile water and filtered through a 0.22 μm cellulose acetate membrane before use. The concentration of peptide-PMO was measured by molar absorption at 265 nm in 0.1 N HCl solution (see Table 3 for yields).

[0240] Table 3. Yields of P-PMO conjugates for cell culture (Yields are based on dry weight of lyophilized and purified P-PMO. Purity for P-PMO is greater than 95% as confirmed by normal phase HPLC at 220 nm and 260 nm.) [Table 3]

[0241] 1.3 Cell culture Mouse H2k myoblasts were cultured in gelatin (0.01%)-coated flasks in Dulbecco's Eagle's modified medium (DMEM; PAA laboratories) supplemented with 20% heat-inactivated fetal bovine serum (FBS Gold; PAA laboratories), 2% chicken embryo extract (Seralab), 1% penicillin-streptomycin-neomycin antibiotic mixture (PSN; Gibco), and 3 pg / μl γ-interferon (Roche) at 33°C under 10% CO2. Cells were plated in gelatin (0.01%)-coated 24-well plates at a density of 2 × 10 5 Cells were seeded at 200 cells / ml and left for 2 days at 33° C. and 10% CO2. To differentiate into myotubes, cells were further grown in DMEM supplemented with 5% horse serum (Sigma) and 1% PSN at 37° C. and 5% CO2 for 2 days.

[0242] 1.4 Transfection of cells Cells were incubated with peptide-PMO prepared as above formulated in serum-free Opti-MEM, 350 μl was added to each well in duplicate and incubated at 37° C. for 4 hours. The transfection medium was then replaced with DMEM supplemented with 5% horse serum and 1% PSN and the cells were incubated for an additional 20 hours at 37° C. Cells were washed with PBS and 0.5 ml of TRI RNA (Sigma) isolation agent was added to each well. Cells were frozen at −80° C. for 1 hour. 1.5 RNA harvest and nested RT-PCR analysis Total intracellular RNA was extracted using TRI Reagent with additional precipitation with ethanol. The purified RNA was quantified using Nanodrop® ND-1000 (Thermo Scientific). RNA (400 ng) was used as template for RT-PCR using OneStep RT-PCR Kit (Roche, Indianapolis, USA). See Table 5 for primer sequences. Cycling conditions for the initial reverse transcription were 50°C for 30 min and 94°C for 7 min for one cycle, followed by 30 cycles of 94°C for 20 s, 55°C for 40 s, and 68°C for 80 s. 1 μl of the RT-PCR product was used as template for the second PCR step. Amplification was performed using SuperTAQ0.5U in 25 cycles of 94°C for 30 s, 55°C for 1 min, and 72°C for 1 min. Products were separated by electrophoresis using a 1.5% agarose gel. Agarose gel images were taken using a Molecular Imager ChemiDoc™ XRS + Images were acquired on an imaging system (BioRad, UK) and analyzed using Image Lab (V4.1). Microsoft Excel was used to analyze and blot the exon skipping assay data and expressed as the percentage of exon-23 skipping from the last three independent experiments.

[0243] 1.6 Synthesis of PMO-peptide complexes for testing in H2k mdx mice a) Synthesis of peptide variants Peptides were synthesized on a 100 μmol scale using a CEM Liberty Blue™ microwave peptide synthesizer (Buckingham, UK) and Fmoc chemistry according to the manufacturer's recommendations. The side chain protecting groups used were labile to trifluoroacetic acid treatment and peptides were synthesized using a 5-fold excess of Fmoc-protected amino acids (0.25 mmol) activated using PyBOP (5-fold excess) in the presence of DIPEA. Piperidine (20% (v / v) in DMF) was used to remove the N-Fmoc protecting groups. Except for the arginine residues, one coupling was performed at 78°C for 5 min at 60 W microwave power, and two couplings were performed at each coupling. Each deprotection reaction was performed twice at 75°C, once for 30 s and once for 3 min at 35 W microwave power. Upon completion of the synthesis, the resin was washed with DMF (3×50 ml) and the N-terminus of the solid phase bound peptide was acetylated with acetic anhydride in the presence of DIPEA at room temperature. After N-terminal acetylation, the peptide resin was washed with DMF (3×20 ml) and DCM (3×20 ml). The peptide was cleaved from the solid support by treatment with a cleavage cocktail consisting of trifluoroacetic acid (TFA):H2O:triisopropylsilane (TIPS) (95%:2.5%:2.5%; 10 ml) at room temperature for 3 h. Excess TFA was removed by sparging with nitrogen. The cleaved peptide was precipitated by the addition of ice-cold diethyl ether and centrifuged at 3000 rpm for 5 min. The crude peptide pellet was washed three times with cold diethyl ether (3×40 ml) and purified by RP-HPLC using a Varian 940-LC HPLC system equipped with a 445-LC scale-up module and a 440-LC fraction collector. Purification was performed by semi-preparative HPLC on a RP-C18 column (10×250 mm, Phenomenex Jupiter) using a linear gradient of CH3CN in 0.1% TFA / H2O at a flow rate of 15 ml / min. Detection was performed at 220 nm and 260 nm (for yields see Table 4).

[0244] Table 4: Yields of peptides synthesized on a larger scale for conjugation. [Table 4]

[0245] b) Synthesis of PMO-peptide conjugates A 25-mer PMO antisense sequence for mouse dystotrophin exon-23 (GGCCAAACCTCGGCTTACCTGAAAT (SEQ ID NO: 30)) was used. The peptide was attached to the 3'-end of the PMO via its C-terminal carboxyl group. This was done in NMP in the presence of 2.5 equivalents of DIPEA using 2.5 and 2 equivalents of PyBOP and HOAt, respectively, and a 2.5-fold excess of peptide over PMO dissolved in DMSO was used. In some examples, HBTU (2 equivalents) was used instead of PyBOP for activation of the C-terminal carboxyl group of the peptide. Typically, to a solution of peptide (10 μmol) in N-methylpyrrolidone (NMP, 100 μl) was added HBTU (76.6 μl of a 0.3 M NMP solution), HOAt (66.7 μl of a 0.3 M NMP solution), DIPEA (4.0 μl), and PMO (400 μl of a 10 mM DMSO solution). The mixture was left at 40° C. for 2 hours and the reaction was quenched by adding 0.1% aqueous TFA (1 ml). The reaction mixture was purified on a cation exchange chromatography column (Resource S 6 ml column, GE Healthcare) using 25 mM sodium sulfate buffer (pH 7.0) containing 25% acetonitrile. The complex was eluted from the column using a sodium chloride solution (1 M) at a flow rate of 6 ml / min. Excess salt was removed from the peptide-PMO complex via filtration of the fractions collected after ion exchange using an Amicon® ultra-15 3K centrifugal filter device. The conjugates were lyophilized and analyzed by MALDI-TOF. Prior to use, the conjugates were dissolved in sterile water and filtered through a 0.22 μm cellulose acetate membrane. The concentrations of peptide-PMO were determined by molar absorbance of the conjugates at 265 nm in 0.1 N HCl solution. The overall yields were 29-46% based on PMO (Table 5).

[0246] Table 5. Yields of P-PMO conjugates synthesized on a large scale for in vivo analysis (Yields are based on dry weight of lyophilized and purified P-PMO. Purity of P-PMO is >95% as confirmed by normal phase HPLC at 220 nm and 260 nm.) [Table 5]

[0247] 1.7 In vivo assay of dystrophin restoration by P-PMO Experiments were performed at the Oxford University Biological Chemistry Unit under a Home Office Project License and in accordance with Institutional Review. Mice were housed in a minimal disease facility. The environment was temperature controlled and on a 12-h light-dark cycle. All animals had access to commercial rodent chow and water ad libitum. Experiments were performed in female mdx mice aged 10-12 weeks. Mdx mice were restrained prior to a single tail vein injection of 10 mg / kg P-PMO. One week after injection, animals were sacrificed and the TA, heart and diaphragm muscles were removed, flash frozen in dry ice-cooled isopentane and stored at -80°C.

[0248] 1.8 Western blot analysis To assess the duration of dystrophin restoration after a single dose, 1 / 3 of the muscle (for TA and diaphragm) or 90 7 μm thick transverse cryosections (for heart) were lysed in 300 μl of buffer (50 mM Tris (pH 8), 150 mM NaCl, 1% NP40, 0.5% sodium deoxycholate, 10% SDS and protease / phosphatase inhibitors) followed by centrifugation at 13000 rpm (Heraeus, #3325B) for 10 min. The supernatant was collected and heated at 100 °C for 3 min. Protein was quantified by BCA and 40 μg protein / sample was resolved in NuPAGE 3-8% Tris-Acetate gels as previously described (19). Proteins were transferred to a 0.45 μm pore size PVDF membrane at 30 V for 1 h, followed by 100 V for 1 h, and probed with monoclonal anti-dystrophin (1:200, NCL-DYS1, Novocastra) and anti-vinculin (loading control, 1:100000, hVIN-1, Sigma) antibodies as previously described (37). The second antibody (IRDye 800CW sheep anti-mouse) was used at a dilution of 1:20000 (LiCOR). The level of dystrophin restoration in P-PMO-treated mdx mice was expressed relative to C57BL / 10 wild-type control mice (assumed to be 100%). For this, 5 serial C57BL / 10 protein dilutions were included in parallel with the P-PMO-treated mice to generate a standard curve. The dilution series was as follows: 75%, 40%, 15%, 5% or 0% of the 40 μg total protein loaded per lane was from C57BL / 10 protein lysate, and the remainder was from untreated mdx protein lysate. These standards were quantified and used in Western blots in parallel with the treated mdx samples. Quantification of dystrophin intensity for all standards and treated samples was performed by a Fluorescence Odyssey imaging system and normalized by calculating the percentage relative to vinculin fluorescence intensity in all samples. The normalized values ​​of the standards were blotted against known dystrophin concentrations to obtain a best-fit equation, which was used to interpolate the normalized values ​​for each sample from P-PMO-treated mdx mice.

[0249] 1.9 RT-qPCR analysis of in vivo DMD exon 23 skipping Skeletal and cardiac muscle tissues treated with peptide-PMO were quantified for the exclusion of exon 23 from mouse DMD transcripts. Briefly, RNA was extracted from homogenized tissues using a Trizol-based extraction method, and cDNA was synthesized using random primers. Primers / probes were synthesized by Integrated DNA Technologies and designed to amplify a region spanning exons 23-24, representing the unskipped product (mDMD23-24, see Table 6), or to specifically amplify the transcript-deficient exon 23 using a probe spanning the boundary of exons 22 and 24 (mDMD22-24). The level of each transcript was measured by calibration to a standard curve prepared using known transcript amounts, and the skipping percentage was obtained by [skip] / [skip+unskip].

[0250] Table 6: Primer and probe sequences for quantification of exon 23 skipping by nested RT-PCR or quantitative RT-PCR. [Table 6]

[0251] 2.Results The results presented here demonstrate a clear dose-response effect on the exon skipping activity of the peptide-PMO complexes prepared here in cells (Figure 1), highlighting that all of the DPEP2 series peptides, i.e., the peptides of the present invention, have sufficient cell penetrating ability in cells and are considered therapeutic. The results presented here further highlight the in vivo activity of the peptide-PMO complexes of the present invention in mouse models of the appropriate disease (Figure 2). Overall, the results suggest that the activity of the peptide complexes of the present invention is greatest in tibialis anterior muscle > diaphragm > cardiac muscle. These results demonstrate that the DPEPs of the present invention have good in vivo exon skipping activity and provide increased in vivo expression of dystrophin. Furthermore, the DPEPs of the present invention compare favorably with conventional cell-penetrating peptides, such as "PIP" peptide and R6Gly, at least in skeletal muscle, when used in the same complex. It is noteworthy that all of the peptide complexes of the present invention have higher activity than the known R6Gly comparator when used in the same complex. Therefore, the DPEP2 peptide of the present invention provides a promising cell-penetrating peptide for improving the efficacy of therapeutic conjugates for the treatment of human neuromuscular diseases.

Claims

1. formula [Hydrophobic domain] - [Cationic domain] - [Hydrophobic domain] and having a total length of 40 or less amino acid residues, wherein the cationic domain consists of arginine, β-alanine, and aminohexanoic acid or arginine and β-alanine and has a length of 9 to 14 amino acid residues, and the hydrophobic domain consists of phenylalanine, leucine, isoleucine, tyrosine, and glutamine and has a length of 5 to 6 amino acid residues.

2. The peptide of claim 1, wherein the hydrophobic domain has one of the following sequences: YQFLI (SEQ ID NO: 13), FQILY (SEQ ID NO: 14), and ILFQY (SEQ ID NO: 15).

3. 3. The peptide of claim 1 or 2, wherein the cationic domain has one of the following sequences: RBRXRBRXB (SEQ ID NO:1), RBRXRBRXBRXRB (SEQ ID NO:2), RBRXRBRXBR (SEQ ID NO:3), RBRRXRBRXBRXRB (SEQ ID NO:4), RBRXRBRBRXRB (SEQ ID NO:5), RBRXRBRBRBRB (SEQ ID NO:6), RBRBRBRBRBRB (SEQ ID NO:7), RBRXRBRBRXR (SEQ ID NO:8), RBRRBRBRBRRB (SEQ ID NO:9), RBRRBRBRBRRXBRXRB (SEQ ID NO:10), RBRRBRBRBBRXRB (SEQ ID NO:11), and RBRRBRBRBBRBRB (SEQ ID NO:12), where B represents β-alanine and X represents aminohexanoic acid.

4. 4. A peptide according to any one of claims 1 to 3 having one of the following sequences: YQFLIRBRRXRBRXBRXRBYQFLI (SEQ ID NO: 19), YQFLIRBRRBRBRBRRBYQFLI (SEQ ID NO: 24) and YQFLIRBRRBRBRBBRXRBYQFLI (SEQ ID NO: 26).

5. A conjugate comprising a peptide according to any one of claims 1 to 4 covalently attached to a therapeutic molecule.

6. The conjugate of claim 5, further comprising a linker, which connects the peptide to a therapeutic molecule.

7. The conjugate of claim 6, wherein the linker is selected from G, BC, XC, C, GGC, BBC, BXC, XBC, X, XX, B, BB, BX, and XB.

8. The conjugate according to any one of claims 5 to 7, wherein the therapeutic molecule is an antisense oligonucleotide.

9. A conjugate according to any one of claims 5 to 8 for use as a medicament.

10. 10. A conjugate according to claim 9 for use as a medicament in the treatment of disorders of the neuromuscular or musculoskeletal system.

11. A complex according to claim 9 or 10 for use as a drug in the treatment of Duchenne muscular dystrophy (DMD).

Images