Method for determining viral resistance in pigs and its use

Abstract

To clarify the genetic characteristics that help improving the virus resistance of pigs.SOLUTION: There is provided a method for discriminating the virus resistance in pigs, the method for discriminating that the genome of a pig to be targeted is virus resistant when at least one of (A) and (B) below is satisfied: (A) ASGA0096716 (position 1001 in the nucleotide sequence of SEQ ID NO: 1) on chromosome 13 is G; and (B) ALGA0102661 (position 1001 in the nucleotide sequence of SEQ ID NO: 3) on chromosome 13 is G. This discrimination method is expected to be applied to the breeding of virus resistant pigs and the production of virus resistant pigs.SELECTED DRAWING: None

Description

[Technical field]

[0001] The present invention relates to a genetic marker for distinguishing viral resistance in pigs, and a method for distinguishing pigs using the marker. [Background technology]

[0002] In the pig farming industry, the control of infectious diseases is one of the most important factors. There are many diseases that are widespread in Japan and have a major impact on pig farming management. However, there are problems such as the difficulty of developing vaccines and the global trend of restricting the use of antibacterial agents, so it is also important to improve the disease resistance of pigs themselves. Therefore, there is a need for measures that utilize genetic factors to improve pigs' resistance to infectious diseases and reduce the damage caused by diseases.

[0003] As for the correlation between traits related to pig diseases and genome regions, there are QTL analysis for Aujeszky's disease response and resistance to pathogenic Escherichia coli (F18+ E. coli). In addition, as a genetic factor related to the response to porcine circovirus type 2 (PCV2), SNPs related to the amount of virus in the blood have been detected on chromosome 7 (near the major histocompatibility complex; Non-Patent Document 1 and Non-Patent Document 2) and chromosome 12 (Non-Patent Document 1, cited above) by experimental infection using crossbred pigs. Furthermore, it has been reported that in the Duroc population, genome regions with chromosomes 7 and 13 were detected near the ends of the q arms, respectively, in relation to death due to postweaning multisystemic wasting syndrome (PMWS) (Non-Patent Document 3). [Prior art documents] [Non-patent literature]

[0004] [Non-Patent Document 1] Engle et al., WCGALP 2014 [Non-Patent Document 2] Dunkelberger et al., BMC Genomics 18:865, 2017 [Non-Patent Document 3] Research and development for innovation in production systems: Technology development for advanced DNA marker breeding, National Agriculture and Food Research Organization, March 2017 Summary of the Invention [Problem to be solved by the invention]

[0005] Although there have been reports on the association between specific genome regions and blood viral load in experimental PCV2 infections, there have been no studies that have clearly shown the association with actual damage caused by PCV2, such as death. In addition, it is not desirable to reduce the diversity of the MHC region (chromosome 7) in order to maintain disease resistance as a population, and there are limitations to its use as a selection marker.

[0006] In the present invention, the association between the frequent deaths that occurred during the spread of PCV2 (especially the highly virulent PCV2b) infection and a specific single nucleotide polymorphism (SNP) was clarified using purebred Duroc, which is used as a stopper male in pork pig production and has a large genetic impact. This polymorphism does not exist in the vicinity of SNPs that have been reported to be associated with PCV2 virus load. Furthermore, it was revealed that the gene frequency of the susceptible genotype of this polymorphism was significantly reduced after the frequent deaths caused by PCV2, and that the survival rate at birth of sows born with the susceptible genotype was significantly reduced and the number of stillbirths was significantly increased. In Duroc populations other than the population analyzed, the susceptible genotype for the corresponding SNP remained at a high frequency, and it can be used as a genetic marker that enables improvement using resistance to viruses as an indicator.

[0007] The present invention provides the following: [1] A method for determining the viral resistance of pigs, comprising: determining at least one site selected from the group consisting of 1 to 107 in the following table of the genome of a target pig;

[0008] [Table 1]

[0009] [2] A method for determining whether a pig is resistant to a virus, the method comprising: determining that a pig is resistant to a virus when the pig's genome satisfies at least one of the following (A) and (B): (A) position 45 as defined in chromosome 13 is G (position 1001 in the nucleotide sequence of SEQ ID NO:1 is G); (B) Position 102 as defined in chromosome 13 is C (position 1001 in the nucleotide sequence of SEQ ID NO:3 is G). [3] The method according to 2, A method for identifying a subject pig as a virus-resistant pig if the genome of the subject pig satisfies both (A) and (B). [4] The method of any one of 1 to 3, wherein the virus is porcine circovirus type 2. [5] A probe or primer for use in the discrimination method according to any one of 1 to 3, which is complementary to a part of the base sequence set forth in SEQ ID NO: 1 and has a length of 15 or more bases. [6] A method for breeding virus-resistant pigs, comprising selecting virus-resistant pigs by the discrimination method described in any one of 1 to 3. [7] A method for breeding virus-resistant pigs, comprising selecting virus-resistant pigs by the discrimination method described in any one of 1 to 3, and using the selected pigs or their progeny for breeding. [8] A method for producing virus-resistant pigs, comprising selecting virus-resistant pigs by the discrimination method described in any one of 1 to 3, and using the selected pigs or their progeny for breeding. [9] A pig population in which the proportion of individuals (susceptible homozygotes or heterozygotes) having a virus-susceptible genotype of ALGA0102661 on chromosome 13 (A at position 1001 in the nucleotide sequence of SEQ ID NO: 3) is 35% or less.

[0010] The present invention provides the following: [1] A method for determining whether a pig is resistant to a virus, the method comprising: determining that a pig is resistant to a virus when the pig's genome satisfies at least one of the following (A) and (B): (A) ASGA0096716 (position 1001 in the nucleotide sequence of SEQ ID NO:1) on chromosome 13 is G; (B) ALGA0102661 on chromosome 13 (position 1001 in the nucleotide sequence of SEQ ID NO:3) is G. Alternatively, ALGA0102661 on chromosome 13 (position 1001 in the nucleotide sequence of SEQ ID NO:2) is C or T. Alternatively, ALGA0102661 on chromosome 13 (position 1001 in the nucleotide sequence of SEQ ID NO:2) is G. [2] The method according to claim 1, A method for identifying a subject pig as a virus-resistant pig if the genome of the subject pig satisfies both (A) and (B). [3] The method of determining whether or not a virus is porcine circovirus type 2, as described in 1 or 2. [4] A probe or primer for use in the discrimination method according to 1 or 2, which is complementary to a portion of the base sequence set forth in SEQ ID NO: 1 and has a length of 15 or more bases. [5] A method for breeding virus-resistant pigs, comprising selecting virus-resistant pigs by the discrimination method described in 1 or 2. [6] A method for breeding virus-resistant pigs, comprising selecting virus-resistant pigs by the discrimination method described in 1 or 2, and using the selected pigs or their progeny for breeding. [7] A method for producing virus-resistant pigs, comprising selecting virus-resistant pigs by the discrimination method described in 1 or 2, and using the selected pigs or their progeny for breeding. [8] A pig population in which the proportion of individuals (susceptible homozygotes or heterozygotes) having a virus susceptible genotype in which ALGA0102661 on chromosome 13 (position 1001 in the nucleotide sequence of SEQ ID NO: 3) is A is 35% or less. Alternatively, a pig population in which the proportion of individuals (susceptible homozygotes or heterozygotes) having a virus susceptible genotype in which ALGA0102661 on chromosome 13 (position 1001 in the nucleotide sequence of SEQ ID NO: 2) is T is 35% or less. Alternatively, a pig population in which the proportion of individuals (susceptible homozygotes or heterozygotes) having a virus susceptible genotype in which ALGA0102661 on chromosome 13 (position 1001 in the nucleotide sequence of SEQ ID NO: 2) is A is 35% or less. Effect of the Invention

[0011] INDUSTRIAL APPLICABILITY The present invention makes it possible to produce pig populations with improved resistance to viruses, particularly PCV2, in the field of livestock breeding.

[0012] Furthermore, by incorporating the markers of the present invention into indicators for pig breed development, it is possible to improve disease resistance in addition to other useful traits such as meat quality, meat quantity, and growth rate.

[0013] Furthermore, by improving pigs' resistance to viral diseases, it is expected that the aggravation of symptoms resulting from secondary infections such as bacteria and the associated excessive use of antibacterial agents can be suppressed. [Brief description of the drawings]

[0014] [Figure 1] Haplotype transition [Diagram 2] Farrowing performance according to differences in sow SSC13 [Diagram 3] Sequence near ASGA0096716 and ALGA0102661 on chromosome 13. The sequence of 1000 bp upstream and downstream near the SNP ([A / G] in the figure) is shown. The sequence is based on the latest pig genome sequence, Sscrofa11.1. [Figure 4]A haplotype block containing two basic markers on chromosome 13. It contains five more markers that are relatively strongly linked to the markers that are most strongly correlated with PCVAD resistance. It occupies a region of approximately 413 kb including the adjacent markers. The distribution of polymorphisms strongly linked to the basic markers was examined for this region. [Diagram 5] Diversity analysis of resistant / susceptible haplotype blocks in areas related to PCVAD resistance using a next-generation sequencer. In the population where the PCVAD resistance region was detected (Gifu Animal Research Institute Duroc population), polymorphisms linked to the markers currently under development that show the strongest correlation with PCVAD were concentrated in a 54kb region of the 413kb haplotype block, and outside of that range, no polymorphisms showing common behavior with the markers currently under development were detected in resistant / susceptible chromosomes. In Duroc breeds from other farms, many of the polymorphisms in the 54kb region showed similar behavior to the markers currently under development (see Figure 6). [Figure 6] Linkage status in population B of polymorphisms that were linked to ALGA0102661 (basic application marker) in population A. Although some polymorphisms could not be detected, there were 90 markers (excluding those shown in black) that showed the same behavior as the basic application marker for individuals determined to be resistant, susceptible, or heterozygous by the basic application marker. DETAILED DESCRIPTION OF THE PREFERRED EMBODIMENTS

[0015] When a numerical range is expressed as "m to n," the range includes the endpoints m and n, unless otherwise specified.

[0016] [Discrimination method] The present invention provides a method for identifying pigs with high virus resistance (sometimes referred to as virus-resistant pigs) by detecting polymorphisms present in the pig genome. Viral resistance includes direct and indirect traits. Direct immune traits include resistance to viral infection, low viral load in the blood, resistance to onset, and resistance to aggravation if onset. Indirect traits refer to traits that do not directly support the virus resistance of pigs, such as the ability to produce cytokines and the ability to produce cytokine receptor genes, but from which a relationship between the trait and virus resistance can be inferred.

[0017] In the present invention, the term "virus" refers to a pathogenic virus that can infect pigs, unless otherwise specified, and includes DNA viruses such as porcine circovirus, porcine parvovirus, Aujeszky's disease virus, African swine fever virus, and swinepox virus, and RNA viruses such as encephalomyocarditis virus, vesicular ecchymoses of swine virus, hepatitis E virus, CSF (hog cholera) virus, Japanese encephalitis virus, swine influenza virus, avian influenza virus, vesicular stomatitis virus, and Nipah virus.

[0018] The method of the present invention can be suitably used to determine whether or not a cat is resistant to porcine circovirus, particularly whether or not a cat is resistant to porcine circovirus type 2 (PCV2). Porcine circovirus is a DNA virus belonging to the genus Circovirus and the family Circoviridae, and type 2 (PCV2) is considered to be the cause of postweaning multisystemic wasting syndrome (PMWS). PCV2 does not possess an envelope. PMSV causes symptoms such as poor growth, emaciation, difficulty in breathing, and diarrhea. No treatment has been established.

[0019] In the present invention, when referring to pigs, there is no particular limitation on the breed. The identification method of the present invention can be applied to pigs of the Duroc breed, Large Yorkshire breed, Landrace breed, Berkshire breed, Hampshire breed, and crossbreeds thereof. Crossbreeds include ordinary pigs (three-way crossbreed pigs). The identification method of the present invention can be particularly suitably used for identifying Duroc pigs.

[0020] Discrimination includes discriminating with a technically significant degree of certainty that the subject pig (the pig subjected to the discrimination method of the present invention) is a virus-resistant pig, and discriminating with a technically significant degree of certainty that the subject pig is not a non-virus-resistant pig (a pig not having virus resistance). Discrimination is also expressed as identification, appraisal, discrimination, judgment, inspection, etc. It is considered that the certainty of discrimination can be increased by considering the type, number, combination, etc. of polymorphisms used.

[0021] Polymorphism refers to the existence of different genotypes among individuals of the same species or different gene / DNA sequences. Polymorphisms include single nucleotide polymorphisms (SNPs), insertion / deletion polymorphisms, restriction fragment length polymorphisms, variable number of tandem repeats (VNTRs), hypervariable regions, minisatellites, dinucleotide repeats, trinucleotide repeats, tetranucleotide repeats, and simple sequence repeats.

[0022] A single nucleotide polymorphism (SNP) occurs when a single nucleotide is replaced by another (a nucleotide, or a di-, tetra-, oligo- or polynucleotide) at a polymorphic site consisting of a single nucleotide. A single nucleotide polymorphism can also occur when a single nucleotide is deleted or inserted compared to a reference allele. When expressing a polymorphism, the type of nucleotide involved may be conveniently indicated by the type of base (A, G, T or C) that constitutes the nucleotide.

[0023] In the discrimination method of the present invention, SNPs present in the pig genome are used as markers. More specifically, resistance / susceptibility is discriminated for at least one site, for example, 1 to 9 sites, or 2 to 19 sites, or 4 to 29 sites selected from the group consisting of 1 to 106 in the table below, according to the table below:

[0024] [Table 2]

[0025] In another preferred embodiment, a strain is determined to be virus-resistant when at least one of the following (A) and (B) is satisfied: (A) ASGA0096716 on chromosome 13, i.e., position 45 as defined in the table above is G (position 1001 in the nucleotide sequence of SEQ ID NO: 1 is G); (B) ALGA0102661 on chromosome 13, i.e., position 102 as defined in the table above is C (position 1001 in the nucleotide sequence of SEQ ID NO:3 is G).

[0026] In a particularly preferred embodiment, the following two methods can be carried out simultaneously to distinguish the genotype of a genomic region assumed to be involved in PCVAD resistance / susceptibility.

[0027] [Method 1: Identification of chromosome 13, position 191800420 (ALGA0102661)] Using the genomic DNA of the pig to be evaluated as a template, PCR is performed with the following primers.

[0028] AMPL3962989-F: CATAAGTGAGCCCAGCCAAGATC(SEQ ID NO: 6) AMPL3962989-R: GGATTCATGGATCAAGTCTGTGACTG(SEQ ID NO: 7)

[0029] This PCR yields an amplicon that corresponds to the following sequence A in the pig genome reference sequence (Sscrofa11.1 chromosome 13 191800365-191800726).

[0030] [Array A] CATAAGTGAGCCCAGCCAAGATCAGCTGAGCTTGGCCTAATTCAGCAGAACCACTTAGCCAGTCCTAAAATTATCTACAAAAATAAGTGTTAATTGTTACACATCACTGCAGTCTTGTGGTTGTTGATTATACATATTGGTATGTCATAAATAACTGATGCAAACTTATCTCTAACTACTAAT TCTGGACTTGCATATGAACATGCTCCAAAACAGACAGCTAGGCTCAAGTGCATGTCTACATAAGACTATTCAATGGATAATTGTCAATTTTCACAGATTTATCTCACTTGCTGTATCTATTCTACTTCCTTGCCTGCTTTGTCAAGCTCCATTCAGTCACAGACTTGATCCATGAATCC(SEQ ID NO: 8)

[0031] The amplicon obtained by the PCR described above is sequenced using a Sanger DNA sequencer with the AMPL3962989-R primer. In the sequencing results, if the 56th position of sequence A is C (G in the case of the complementary strand), it is determined to be resistant, and if it is T (A in the case of the complementary strand), it is determined to be sensitive.

[0032] [Method 2: Identification of eight SNPs at positions 191771583 to 191771761 on chromosome 13] Using the genomic DNA of the pig to be evaluated as a template, PCR is performed with the following primers.

[0033] SSC13-73404-4F: CTGCATCTATTAATCCCAAGCACC(SEQ ID NO: 9) SSC13-73404-4R: AGTGATAGAGATAGGAGAATGAGTAGA(SEQ ID NO: 10) This PCR yields an amplicon that corresponds to the following sequence B in the pig genome reference sequence (Sscrofa11.1 chromosome 13 191771342-191772032).

[0034] [Array B] (SEQ ID NO: 11)

[0035] The PCR amplicon obtained in the previous section is sequenced using a Sanger DNA sequencer with the SSC13-73404-4F primer. By observing the following bases in sequence B in the sequencing results, it is possible to determine whether the strain is resistant or susceptible.

[0036] [Table 3]

[0037] The nucleotide sequence of 1000 bp each upstream and downstream of ASGA0096716 on porcine chromosome 13 is shown in the sequence listing as SEQ ID NO: 1. The nucleotide sequence of 1000 bp each upstream and downstream of ALGA0102661 on porcine chromosome 13 is shown in the sequence listing as SEQ ID NO: 3. The sequences of SEQ ID NO: 1 and SEQ ID NO: 3 are based on the latest porcine genome sequence, Sscrofa11.1 (https: / / www.ncbi.nlm.nih.gov / assembly / GCF The sequence of the complementary strand of the polynucleotide consisting of the sequence of SEQ ID NO: 3 is shown as SEQ ID NO: 4 (the 1001st position is t or c). The sequence of SEQ ID NO: 2 is the sequence of SEQ ID NO: 4 in which the 1001st position is a or g.

[0038] [Polymorphic markers and probes for detecting them] The present invention also provides a polymorphic marker described in either (A) or (B) above, and a polynucleotide comprising such a polymorphic marker for use in identifying virus-resistant pigs, as well as an amplification product of such a polynucleotide, a composition comprising such a polynucleotide (e.g., comprising such a polynucleotide and a buffer), a kit, a reagent, or a product, etc.

[0039] The present invention provides a polynucleotide comprising the polymorphic marker according to any one of (A) and (B) above. Such a polynucleotide is used to determine virus resistance in pigs.

[0040] The length of the polynucleotide is not particularly limited, but may be, for example, 4,000 bases or less, 3,000 bases or less, 2,000 bases or less, 1,000 bases or less, 500 bases or less, 300 bases or less, 100 bases or less, 50 bases or less, 30 or 20 bases or less.

[0041] The present invention also provides an identification or discrimination reagent for use in a method for identifying virus-resistant pigs. A preferred embodiment of the reagent is a test drug for identifying virus-resistant pigs, the test drug comprising either the following substance (a) or (b) as an active ingredient: (a) An oligonucleotide that hybridizes under stringent conditions to the base sequence set forth in SEQ ID NO:1 or its complementary strand, and is used as a PCR primer for amplifying a region containing any one of the polymorphic sites (A) and (B) present in the base sequence. (b) An oligonucleotide for use as a probe, which hybridizes under stringent conditions to the base sequence set forth in SEQ ID NO:1 or its complementary strand, and which hybridizes to a DNA region containing any one of the polymorphic sites (A) and (B) present in the base sequence.

[0042] Here, "hybridize" means that under normal hybridization conditions, preferably stringent hybridization conditions (e.g., the conditions described in Sambrook et al., Molecular Cloning, Cold Spring Harbour Laboratory Press, New York, USA, 2nd ed. 1989), there is no need for the polynucleotide to be completely complementary to the base sequence to be detected, so long as it is capable of specific hybridization.

[0043] A person skilled in the art can appropriately select the hybridization conditions. Examples of hybridization conditions include low stringency conditions. Low stringency conditions include, for example, 42°C, 0.1xSSC, 0.1% SDS, and preferably 50°C, 0.1xSSC, 0.1% SDS in washing after hybridization. More preferred hybridization conditions include high stringency conditions. High stringency conditions include, for example, 65°C, 5xSSC, and 0.1% SDS. Under these conditions, it is expected that DNA with high homology can be obtained more efficiently as the temperature is increased. However, multiple factors such as temperature and salt concentration are considered to affect the stringency of hybridization, and a person skilled in the art can achieve similar stringency by appropriately selecting these factors.

[0044] Such polynucleotides can be used as probes or primers in the discrimination method of the present invention. When a polynucleotide is used as a primer, its length is usually 15 to 100 bases, preferably 17 to 30 bases. The primer is not particularly limited as long as it can amplify DNA containing the polymorphic marker of the present invention. When a polynucleotide is used as a probe, the probe is not particularly limited as long as it specifically hybridizes to a DNA region containing the polymorphic marker of the present invention. The probe may be a synthetic polynucleotide, and usually has at least 15 bases. The primers and probes can be appropriately designed with reference to conventional primer design methods and probe design methods. Software for primer design methods is commercially available and can be used for the present invention.

[0045] The polynucleotides used as primers or probes can be prepared, for example, by a commercially available polynucleotide synthesizer. The probes can also be prepared as double-stranded DNA fragments obtained by restriction enzyme treatment or the like.

[0046] When the polynucleotide of the present invention is used as a probe, it is preferable to label it appropriately. As a method for labeling, the 5' end of the polynucleotide is labeled with T4 polynucleotide kinase. 32 Labeling by phosphorylation with P, or using DNA polymerase such as Klenow enzyme and random hexamer polynucleotides as primers 32 Examples of such methods include a method of incorporating a substrate base labeled with an isotope such as P, a fluorescent dye, or biotin (random prime method, etc.).

[0047] In the above-mentioned identification or discrimination reagent (test agent of the present invention), in addition to the polynucleotide which is the active ingredient, for example, sterile water, physiological saline, vegetable oil, surfactant, lipid, solubilizing agent, buffer, protein stabilizer (such as BSA or gelatin), preservative, etc. may be mixed as necessary.

[0048] The present invention also includes a kit for identifying virus-resistant pigs, which contains at least the reagent of the present invention. The kit may contain, in addition to the substances described in either (a) or (b) above, various reagents, reaction solutions, control samples, reaction vessels, operating tools, and the like, which are used in the method of the present invention.

[0049] [Breeding method] As described above, the present invention provides a method for distinguishing virus-resistant pigs. Therefore, the present invention makes it possible to predict pigs with a target trait (virus resistance) at an early stage, which is useful for efficiently creating a pig population or line with a desired trait. Therefore, the present invention provides a method for breeding virus-resistant pigs, which includes selecting virus-resistant pigs by the distinguishing method of the present invention.

[0050] As a pig breeding method for selecting and raising or breeding pigs with a predetermined trait, for example, a virus-resistant pig selected by the present invention or its progeny can be mated with a pig having a certain desirable trait (e.g., high meat production ability, robustness, high reproductive ability, etc.) in a certain line to create a pig line that is virus-resistant and has a certain trait. Thus, the present invention provides a breeding method for virus-resistant pigs, which includes selecting virus-resistant pigs by the discrimination method of the present invention and using the selected pigs or their progeny for mating, and a production method for virus-resistant pigs, which includes selecting virus-resistant pigs by the discrimination method of the present invention and using the selected pigs or their progeny for mating. In addition, breeding pigs produced by the production method for virus-resistant pigs, which includes selecting virus-resistant pigs by the discrimination method of the present invention and using the selected pigs for mating, to obtain progeny is also included in the scope of the production method of the present invention, as long as virus-resistant progeny associated with the polymorphic markers provided by the present invention are obtained, regardless of whether or not virus-resistant pigs are selected for the progeny by the discrimination method of the present invention.

[0051] [Pig group] The present invention provides a pig population having a low percentage of individuals having a virus-susceptible genotype in which ALGA0102661 (position 1001 in the nucleotide sequence of SEQ ID NO: 1) on chromosome 13 is A. A low percentage of individuals having a virus-susceptible genotype means that the percentage of susceptible homozygotes or heterozygotes is 35% or less. This percentage is preferably 30% or less, more preferably 20% or less, even more preferably 10% or less, even more preferably 5% or less, and even more preferably 1% or less. In the present invention, when referring to a pig population, unless otherwise specified, it refers to a group of at least 10 pigs that are kept so as to be distinguishable from other individuals or populations. A preferred example of such a pig population may be a Duroc pig population.

[0052] [Verification of polymorphism effects, etc.] The polymorphisms disclosed in the present application can be verified by various methods to have the desired effect. For example, they can be verified by isolating cells with different genotypes from blood and observing their response to viruses. They can also be verified by investigating the association between polymorphisms and immune function or disease-related traits (e.g., pneumonia morbidity, etc.) using virus-resistant pig populations and populations other than the base population. Such verification means are well known to those skilled in the art, and those skilled in the art can appropriately plan and carry out experiments.

[0053] The present invention also provides breeding materials, as well as meat and meat products (e.g., ham, sausage, bacon, roast pork, etc.) obtained from the virus-resistant pigs bred according to the present invention or produced by the methods of the present invention. EXAMPLES

[0054] The present invention will now be described in more detail with reference to examples, but the present invention is not limited to these examples.

[0055] [Association between frequent deaths during the spread of PCV2 infection and specific single nucleotide polymorphisms] Using purebred Duroc pigs, which are used as sires in pork production and have a large genetic impact, we clarified the association between the frequent mortality that occurred during the spread of PCV2 (especially the highly virulent PCV2b) infection and specific single nucleotide polymorphisms (SNPs). Specifically, in a population where mortality due to PCV2 infection was frequent, the breeding value for the presence or absence of mortality was estimated using a threshold trait model with sex, parity, and year as parameter effects. The genotypes of SNPs in each individual pig were determined using Illumina's Porcine SNP60 BeadChip version 2. When we verified the correlation between SNP genotypes and breeding values ​​for mortality, we detected an SNP on chromosome 13 that showed a strong correlation with breeding values ​​for mortality (Table 1).

[0056] [Table 4]

[0057] This polymorphism does not occur near any SNPs that have been previously reported to be associated with PCV2 viral load (Engle et al., 10 th World Congress of Genetics Applied to Livestock Production).

[0058] [Haplotype transition] In the above-mentioned population where there were many fatalities due to PCV2 infection, the distribution of SNP genotypes (represented by ALGA0102661) indicating resistance and susceptibility was examined by year. It was found that the gene frequency of the susceptibility genotype of this polymorphism significantly decreased after the frequent fatalities due to PCV2 (Figure 1).

[0059] [Proportion of babies alive at birth, number of stillbirths] When we examined the effect of SNPs (represented by ALGA0102661) that indicate resistance / susceptibility genotypes on the reproductive ability of sows, we found that the survival rate at birth of offspring from sows with the susceptible genotype was significantly reduced and the number of stillbirths was significantly increased (Figure 2).

[0060] [Genotype distribution of ALGA0102661] In a Duroc population where there were many cases of mortality due to PCV2 infection and the effect of SNPs representing resistance / susceptibility genotypes on mortality was detected, the susceptibility genotype for the relevant SNP (represented by ALGA0102661) remained at a high frequency (table below).

[0061] [Table 5]

[0062] Therefore, the SNP can be used as a genetic marker that enables improvement using virus resistance as an indicator.

[0063] [Polymorphism analysis of chromosome 13 between 191,623,054 and 192,036,342]

[0064] In the above experiment, two SNP markers (hereinafter referred to as basic application markers) that show resistance to PCV2 were presented. When the markers were searched using Illumina's Porcine SNP60 BeadChip v2 (equipped with 61,572 SNPs, https: / / jp.illumina.com / products / by-type / microarray-kits / porcine-snp60.html) (Ramos AM et al. PLoS ONE 4(8): e6524), it was found that seven markers, including the marker in question, formed a strongly linked haplotype block, and when extended to adjacent markers, it was shown that a genomic region of approximately 413 kb may be associated with PCV2 resistance (Figure 4).

[0065] 1) Polymorphism analysis was performed on six individuals (three resistant homozygotes and three heterozygotes) from a Duroc population (Iris Nagara, Bono Brown) (Population A) related to the population in which the genomic region associated with PCVAD-induced mortality was detected, and on individuals (Population B) from a Duroc population with no direct blood relationship in which the basic application marker was resistant (2), heterozygote (3), and susceptible (1). Specifically, PCR primers (ABI AmpliSeq) were designed in the range of 191,623,054 to 192,036,342 on chromosome 13, and the amplified products were decoded using a next-generation sequencer (NGS) (ionPGM), and polymorphism analysis was performed using GATK software. Polymorphisms with QV≧1000 were extracted using GATK software for a total of 12 individuals from Population A and Population B.

[0066] 2) In group A, polymorphisms linked to the basic application markers were selected, and the selected markers were extracted from all six animals. 105 polymorphisms were detected in a 57 kb range (191,745,857 to 191,802,573) (including ALGA0102661, one of the basic application markers) (Figure 5). The patent application marker ASGA0096716 could not be decoded by NGS.

[0067] 3) In group B, for polymorphisms that were successfully genotyped (GQ>20 in GATK software, 7 or more reads for homozygotes, or 2 or more reads for the lower read for heterozygotes), primers were designed to amplify PCR and the polymorphisms of these markers were examined. 90 polymorphisms were linked to the basic application markers (Figure 6).

[0068] 4) Furthermore, polymorphism analysis was performed by deciphering PCR products using a Sanger sequencer around the only ORF detected in the 57 kb genomic region (ORF / 191,771,422-191,771,997 in Ensembl Gene: ENSSSCG00000048685.1). Fifteen polymorphisms were detected at 191,771,394-191,771,989 (13 within the ORF). All polymorphisms except for the 191,771,888 polymorphism (14 markers) were linked to the basic markers in both populations A and B (12 within the ORF) (see table below).

[0069] [Table 6]

[0070] 5) In total, 104 new markers were detected, excluding the basic application markers. By using at least one of the 106 markers, including the two basic application markers, it is possible to select pigs that show resistance to viruses such as PCV2, and the method of detecting resistant types can be implemented more reliably. [Industrial Applicability]

[0071] The present invention is believed to contribute to the creation of pig populations with improved resistance to viruses, particularly PCV2, in the field of livestock breeding. By incorporating this into the indicators for pig breed development, it will be easier to improve viral resistance in addition to other useful traits such as meat quality, meat quantity, and growth rate. In addition, improving pigs' resistance to viral diseases will lead to the suppression of the aggravation of symptoms caused by secondary infections such as bacteria, and the associated excessive use of antibacterial agents, and is expected to contribute from the perspective of livestock hygiene. [Sequence List Free Text]

[0072] SEQ ID NO: 1 Sequence around ASGA0096716 on chromosome 13 SEQ ID NO: 2 SEQ ID NO: 3 Sequence around ALGA0102661 on chromosome 13 SEQ ID NO: 4 Complementary strand sequence of SEQ ID NO: 3 SEQ ID NO: 5 >13 dna:chromosome chromosome:Sscrofa11.1:13:191745001:191803000:1 SEQ ID NO: 6 PCR primer, AMPL3962989-F SEQ ID NO: 7 PCR primer, AMPL3962989-R SEQ ID NO: 8 Sequence A SEQ ID NO: 9 PCR primer, SSC13-73404-4F SEQ ID NO: 10 PCR primer, SSC13-73404-4R SEQ ID NO: 11 Sequence B

Claims

1. A method for determining virus resistance in pigs, comprising: determining whether the virus is porcine circovirus type 2; determining whether the virus is resistant to the pig; and determining whether the virus is resistant to the pig by judging at least one site selected from the group consisting of (1) to (106) in the table below. If the base or base sequence is one of those listed in the resistance type column, the pig is determined to be resistant to the virus. 【Table 1】

2. A method for determining virus resistance in pigs, comprising: determining that a pig is resistant to the virus when the virus is porcine circovirus type 2 and the genome of the pig satisfies at least one of the following (A) and (B): (A) position (45) as defined in claim 1 is G; (B) The position (102) defined in claim 1 is C.

3. 3. The method of claim 2, A method for determining that a subject pig is resistant to a virus if the genome of the subject pig satisfies both (A) and (B).

4. A primer for use in the method according to any one of claims 1 to 3, comprising any one of the base sequences selected from SEQ ID NOs: 6, 7, 9, and 10.

5. A method for breeding pigs resistant to porcine circovirus type 2, comprising selecting pigs resistant to porcine circovirus type 2 by the method according to any one of claims 1 to 3.

6. A method for breeding pigs resistant to porcine circovirus type 2, comprising selecting pigs resistant to porcine circovirus type 2 by the method according to any one of claims 1 to 3, and using the selected pigs or their progeny for breeding.

7. A method for producing porcine circovirus type 2-resistant pigs, comprising selecting pigs resistant to porcine circovirus type 2 by the method according to any one of claims 1 to 3, and using the selected pigs or their progeny for breeding.

Images