Fusion gene, recombinant novel coronavirus highly efficient immune DNA vaccine, construction method thereof and use

JP7686302B2Active Publication Date: 2025-06-02AURORA GENEVAC BIOTECH CO LTD
View PDF 0 Cites 0 Cited by

Patent Information

Application Number
JP2023514153
Authority / Receiving Office
JP · JP
Patent Type
Patents
Current Assignee / Owner
Priority Date
2020-11-20
Filing Date
2021-11-19
Publication Date
2025-06-02
Estimated Expiration
2041-11-19

AI Technical Summary

Technical Problem

Current coronavirus vaccines face challenges in providing effective prevention and treatment, with concerns over antibody-dependent enhancement (ADE) and the need for high immunogenicity, stability, and scalability.

Method used

A recombinant novel coronavirus DNA vaccine (ZD-nCor19) is developed using a fusion gene that includes specific segments of the S2 subunit and N protein of the virus, combined with immunosynergistic molecules like CTB, TT, Foldon-CPPCP, Furin 2A, ERISS, and OX40L, expressed via a pZDVac vector to induce both humoral and cellular immune responses.

Benefits of technology

The vaccine achieves high safety, efficiency, long-acting immunity, and broad protection against mutations, with the ability to induce rapid and comprehensive immune responses, suitable for large-scale production and use in both prevention and treatment.

✦ Generated by Eureka AI based on patent content.

Smart Images

  • Figure 00000022_0000
    Figure 00000022_0000
  • Figure 00000022_0001
    Figure 00000022_0001
  • Figure 00000023_0000
    Figure 00000023_0000
Patent Text Reader

Abstract

Fusion gene, recombinant novel coronavirus highly efficient immune DNA vaccine, and their construction and use. The immune DNA vaccine ZD-nCor19 provided herein uses the novel coronavirus RBD protein, segment 301-538aa of the S2 subunit, and segment 138-369aa of the N protein as target antigens, and has specific immune synergistic molecules introduced into appropriate positions, thus efficiently inducing humoral and cellular immunity simultaneously and avoiding the safety issues associated with ADE that may be caused by the full-length S protein and full-length N protein, thereby achieving the dual effects of prevention and treatment.
Need to check novelty before this filing date? Find Prior Art

Description

[Technical Field]

[0001] [CROSS-REFERENCE TO RELATED APPLICATIONS] This application claims priority to Chinese Patent Application No. 202011310160.8, filed on November 20, 2020, the entire contents of which are incorporated herein by reference.

[0002] The present invention relates to the field of biomedical technology, in particular to a fusion gene, a recombinant novel coronavirus highly efficient immune DNA vaccine (named ZD-nCor19), and methods for their construction and use. [Background technology]

[0003] The novel coronavirus (COVID-19) is a new strain of coronavirus not previously found in humans. Common signs of human infection with the novel coronavirus include respiratory symptoms, fever, cough, shortness of breath, and difficulty breathing. In more severe cases, infection can lead to pneumonia, severe acute respiratory syndrome, kidney failure, and even death.

[0004] To date, the cumulative number of COVID-19 infections worldwide has reached tens of millions, with the cumulative death toll exceeding one million, posing a significant threat to the lives, health, and safety of all humankind. However, the COVID-19 pandemic continues to spread rapidly in many parts of the world. The virus has been proven to be highly contagious, pathogenic, and harmful. 7.8 billion people worldwide are at risk of infection, morbidity, and death. Safe and effective vaccination is internationally recognized as an important and effective measure for protecting human safety and health. Therefore, there is an urgent need to develop an effective and safe vaccine that can be used for both prevention and treatment of COVID-19.

[0005] Currently, there are nearly 200 novel coronavirus vaccines in various stages of development worldwide, 10 of which are in Phase III clinical trials (as of October 13, 2020), including inactivated novel coronavirus vaccines, recombinant subunit vaccines, adenovirus vector vaccines, attenuated influenza virus vector vaccines, and nucleic acid vaccines. While progress has been made in the research and development of novel coronavirus vaccines, there is still an urgent need to develop novel coronavirus vaccine varieties that can be used for both prevention and treatment. Summary of the Invention [Problem to be solved by the invention]

[0006] The present invention aims to provide fusion gene and recombinant novel coronavirus highly efficient immune DNA vaccines, as well as methods for their construction and use. [Means for solving the problem]

[0007] In a first aspect of the present invention, there is provided a fusion gene comprising at least two of the following (1) to (4): (1) Genes expressing the RBD segment of the novel coronavirus COVID-19; (2) A gene expressing the S2 subunit of the novel coronavirus COVID-19 or a partial fragment thereof; (3) A gene expressing the N protein of the novel coronavirus COVID-19 or a partial fragment thereof; (4) A gene expressing an amino acid fragment selected from the group consisting of CTB, TT, PADRE, Foldon, CPPCP, furin2A, ERISS, IRES, and OX40L, or a combination thereof.

[0008] In one embodiment, the fusion gene comprises at least three of the following (1) to (4): (1) Genes expressing the RBD segment of the novel coronavirus COVID-19; (2) a gene expressing residues 301–538 of the S2 subunit of the novel coronavirus COVID-19; (3) a gene expressing residues 138 to 369 of the N protein of the novel coronavirus COVID-19; (4) Genes expressing the following amino acid fragments: CTB, TT, PADRE, Foldon, CPPCP, Furin2A, ERISS, IRES, and OX40L.

[0009] In one embodiment, a gene expressing the RBD segment and a gene expressing residues 301-538 of the S2 subunit are linked to form a fusion fragment; in a preferred embodiment, the nucleotide sequence of the fusion fragment comprises the sequence set forth in SEQ ID NO:6, and the nucleotide sequence of the gene expressing residues 138-369 of the N protein comprises the sequence set forth in SEQ ID NO:10.

[0010] In another embodiment, the fusion gene comprises: The nucleotide sequence of the gene expressing the CTB amino acid fragment is set forth in SEQ ID NO:2; The nucleotide sequence of the gene expressing the TT amino acid fragment is set forth in SEQ ID NO:3; The nucleotide sequence of the gene expressing the PADRE amino acid fragment is set forth in SEQ ID NO:4; a gene expressing a Foldon amino acid fragment and a gene expressing a CPPCP amino acid fragment are ligated to form a synthetic fragment, the nucleotide sequence of which is set forth in SEQ ID NO:7; The nucleotide sequence of the gene expressing the furin 2A amino acid fragment is set forth in SEQ ID NO:8; The nucleotide sequence of the gene expressing the ERISS amino acid fragment is set forth in SEQ ID NO:9; the nucleotide sequence of the gene expressing the IRES amino acid fragment is set forth in SEQ ID NO: 11, and / or The nucleotide sequence of the gene expressing the OX40L amino acid fragment is set forth in SEQ ID NO:12.

[0011] In one embodiment, a fusion gene comprises a gene expressing an RBD segment and a gene expressing residues 301-538 of the S2 subunit linked to form a fusion fragment, the upstream side of which is sequentially linked to genes expressing amino acid fragments of CTB, TT, and PADRE, and the downstream side of which is sequentially linked to genes expressing amino acid fragments of Foldon, CPPCP, and furin 2A, and / or a gene expressing an ERISS amino acid fragment is linked upstream of a gene expressing residues 138-369 of the N protein, and genes expressing an IRES and OX40L amino acid fragment are linked downstream of the gene expressing residues 138-369 of the N protein.

[0012] In a preferred embodiment, the gene expressing the RBD segment and the gene expressing residues 301 to 538 of the S2 subunit are linked by a gene expressing a (G4S)2 linker, the upstream of the fusion fragment and the gene expressing the PADRE amino acid fragment are linked by a gene expressing the linker G6, the nucleotide sequence of which is set forth in SEQ ID NO:5.

[0013] In a further preferred embodiment, the nucleotide sequence of the fusion gene is set forth in SEQ ID NO:13.

[0014] In a second aspect, the present invention provides a fusion protein obtained by expressing the above-mentioned fusion gene.

[0015] In a third aspect of the present invention, there is provided a recombinant novel coronavirus highly efficient immune DNA vaccine named ZD-nCor19, which comprises the above-mentioned fusion gene and vector.

[0016] In one embodiment, the vector is a pZDVac vector.

[0017] A fourth aspect of the present invention is a method for constructing the above-mentioned recombinant novel coronavirus highly efficient immune DNA vaccine, comprising: 1) synthesizing the fusion gene; 2) inserting the fusion gene into the pZDVac vector to obtain a recombinant novel coronavirus highly efficient immune DNA vaccine; A method is also provided, including:

[0018] In a fifth aspect of the present invention, the present invention also relates to the use of the above-mentioned recombinant novel coronavirus highly efficient immune DNA vaccine in the preparation of a medicament for preventing and / or treating novel coronavirus infection.

[0019] In the recombinant novel coronavirus highly effective immunogenic DNA vaccine provided by the present invention, the RBD segment of the S1 subunit, residues 301-538 of the S2 segment, and residues 138-369 of the N protein segment are fused in-frame and expressed as a target antigen. Furthermore, the fusion gene can be further combined with other designs, such as linking the upstream and downstream of the target antigen gene to genes expressing immune synergistic molecules, respectively, and placing a furin 2A protease cleavage site between the target antigen-expressing genes. This design not only effectively avoids potential ADE-related problems caused by the full-length S protein and full-length N protein, but also ensures that the fusion protein expressed by the fusion gene can cover more epitopes of the novel coronavirus and achieve more comprehensive protection than using only the S1 protein or only the RBD, or only the S1 protein (RBD) and the N protein, as target antigens. In designing the target antigen, the vaccine uses only the RBD, residues 301-538 of the S2 subunit, and residues 138-369 of the N protein. This smaller fragment is beneficial for vaccine construction compared to the full-length S and N proteins, and also facilitates cellular entry, resulting in higher expression efficiency and enhanced immunological efficacy. Furthermore, the presence of a furin 2A protease cleavage site allows the extracellular secretion of the two antigenic segments derived from the S protein (residues 301-538 of the RBD and S2 subunit) to induce a better humoral immune response, while the antigenic segment derived from the N protein (residues 138-369 of the N protein) can be expressed intracellularly to induce a T cell immune response. Therefore, the vaccine constructed and obtained according to the present invention can efficiently induce both humoral and T cell immune responses, synergistically enhancing the immunoprotective effect of the vaccine.

[0020] Compared with the prior art, the present invention has the following beneficial effects: 1) High safety: The vaccine of the present invention belongs to the category of RNA vaccines in the form of DNA and is not integrated into chromosomes, so it will not cause malignant transformation of cells. Furthermore, after the vaccine enters cells, RNA transcription can occur on a large scale, which leads to rapid apoptosis of the cells, further avoiding the possibility of malignant transformation. Furthermore, the vaccine is a naked plasmid product without additional liposomes, aluminum adjuvants, etc., and basically does not induce additional nonspecific inflammatory reactions. Therefore, from the perspective of safety, it is the most advantageous and most guaranteed of all types of vaccines.

[0021] 2) Highly Efficient Immunity: The vaccine of the present invention belongs to the class of highly efficient immune DNA vaccines ((ipDNA vaccine) ZD-nCor19) that combine the dual advantages of DNA and RNA vaccines. Experimental results show that by using vaccination via intradermal injection and electric pulse-assisted delivery (two injections, 28 days apart, or 1 to 4 weeks apart in emergencies), the vaccine can efficiently induce mucosal-like surface immune protective efficacy and highly efficient systemic cellular immune responses, not only producing strong surface immune protective effects but also strong deep protective effects. This type of immune response belongs to high-level immune responses, which are characterized by "rapid immune decision mobilization," "group army annihilation campaign," and "thorough active defense clearance in depth," providing efficient and sustained immune protection to the human body. Once attacked by the virus, systemic immune mobilization, including immune responses at the surface mucosa level as well as systemic innate immunity, humoral immunity, and cellular immunity, is carried out rapidly and efficiently to rapidly kill and clear the novel coronavirus that invades the body, preventing the virus from causing disease and aggravating serious disease conditions, protecting lives, avoiding various sequelae, and completing efficient killing and clearance of the virus while the body is asymptomatic or only exhibits mild symptoms, thus enabling a rapid recovery of health.

[0022] Furthermore, the highly effective immunity of this vaccine is also reflected in its ability to enhance systemic immunity in the human body. For the elderly with weak immune systems and people with serious underlying diseases, this vaccine is an excellent life-saving vaccine, helping to protect the lives and health of the elderly and immunocompromised groups.

[0023] 3) Long-lasting immunity and anti-mutation: In addition to the highly efficient immune protection of the vaccine of the present invention, the antigen-specific cellular immunity induced by the vaccine retains immunological memory for many years, so the vaccine can also provide long-lasting immune protection. Furthermore, in the vaccine design, a partial fragment of the internal N protein of the virus is used as the target antigen, which is very stable and rarely undergoes confirmed mutations. Therefore, the vaccine of the present invention can also effectively resist viral mutation. Even after some vaccines lose their immune protection efficacy due to significant mutation of the viral surface antigen, the vaccine of the present invention can still provide highly efficient immune protection.

[0024] 4) Used for both prevention and treatment: The vaccine of the present invention can be used not only as a preventive vaccine, but also for emergency immunotherapy for people who test positive for the virus. The vaccine can rapidly induce a highly efficient cellular immune response, timely and efficiently eliminate the virus from the body, prevent the condition from worsening, help protect lives, and reduce the mortality rate caused by the virus. Therefore, the vaccine of the present invention may be a vaccine that can truly protect and save lives.

[0025] 5) Large-scale production capacity and low cost: The vaccine of the present invention can use the E. coli prokaryotic system for biofermentation production, so that a new industrial system can be established using the existing biofermentation industrial system, and therefore the vaccine production can be built with large production capacity and the cost is relatively low, which is expected to meet the domestic and international demand for this vaccine variety.

[0026] 6) High stability: DNA vaccines generally have strong stability and can be stored and transported at room temperature, but RNA vaccines, protein subunit vaccines, viral vector vaccines, and inactivated vaccines require cold chain transport, which is a special advantage of DNA vaccines compared to other types of vaccine varieties. The vaccine provided is a DNA vaccine, and therefore has a significant advantage in terms of stability, making it an excellent choice among national COVID-19 vaccine foreign aid varieties.

[0027] 7) Broad Market: Currently, there is no COVID-19 vaccine on the market against the novel coronavirus, and therefore, it is not possible to determine the effectiveness of current clinical or developmental vaccines. It is necessary to use various vaccines under development in a "combined approach" to build vaccine complementarity. The vaccines provided herein can not only provide highly efficient protection from the novel coronavirus when used alone, but can also be used as boosters for other types of vaccines to enhance immune protection in conjunction with other types of vaccines. Furthermore, the vaccines provided herein can overcome the potential ADE (antibody-dependent enhancement) effect of some vaccines, helping to avoid the serious problem of the ADE effect, which can worsen disease.

[0028] In conclusion, the vaccine (ipDNA vaccine) ZD-nCor19 provided herein is expected to have the following characteristics and advantages: safety, high efficiency, long-lasting activity, anti-mutation, high stability, and large manufacturing capacity. This vaccine is a DNA vaccine with efficient immune effects and can be used for routine population prevention, specific immune protection of immune-vulnerable groups such as the elderly, immune enhancement of specific groups, emergency vaccination after viral exposure, coordinated immune enhancement of different types of vaccines, and as a national foreign aid vaccine. As an excellent vaccine for both prevention and treatment, this vaccine is expected to be further developed and utilized. [Brief explanation of the drawings]

[0029] [Figure 1] FIG. 1 is a schematic diagram showing the linkage structure of the target antigen and immune synergistic molecule in a recombinant novel coronavirus highly efficient immune DNA vaccine provided by an example of the present invention. [Figure 2] 1 is a photograph of gel electrophoresis of the double-digested pZDVac-CCCPO plasmid. [Figure 3] 1 is a photograph of gel electrophoresis of double-digested pUC57-CRSNP plasmid. [Figure 4] 1 is a photograph of a gel electrophoresis showing the recovery and identification of the target gene fragment and vector backbone of the recombinant plasmid pZDVac-CRSNPO. [Figure 5] 1 is a schematic diagram of the construction of the recombinant plasmid pZDVac-CRSNPO. [Figure 6] 1 is a photograph of a gel electrophoresis showing the identification of positive clones by colony PCR. [Figure 7] 1 is a photograph of a gel electrophoresis showing identification by digestion of a plasmid extracted from a small number of positive clones. [Figure 8] 1 is a bar graph of the secretion frequency of cytokines IFN-γ and IL-4 in mouse splenocytes using N protein as a stimulator after immunizing mice with the recombinant plasmid pZDVac-CRSNPO. [Figure 9] 1 is a bar graph of the secretion frequency of cytokines IFN-γ and IL-4 in mouse splenocytes using RBD protein as a stimulator after immunizing mice with the recombinant plasmid pZDVac-CRSNPO. [Figure 10] FIG. 10 is a scatter plot of the type bias analysis of T cell responses induced by the recombinant plasmid pZDVac-CRSNPO in a mouse model. [Figure 11]FIG. 1 is a scatter plot of the secretion of the cytokine IFN-γ in human PBMCs using N protein and RBD protein as stimulators before and after immunization of human subjects with the recombinant plasmid pZDVac-CRSNPO. [Figure 12] FIG. 1 is a scatter plot of the secretion of the cytokine IFN-γ in human PBMCs using N protein and RBD protein as stimulators before and after immunization of human subjects with different doses of the recombinant plasmid pZDVac-CRSNPO. [Figure 13] FIG. 1 is a scatter plot of the results of the detection of antibodies induced by immunizing mice with the recombinant plasmid pZDVac-CRSNPO under different immunization routes and different electrotransfer conditions. [Figure 14] 1 is a bar chart of the results of Elispot assays of N, RBD, and S2 antigens induced after immunization of mice with the recombinant plasmid pZDVac-CRSNPO under different immunization routes and different electrotransfer conditions. DETAILED DESCRIPTION OF THE INVENTION

[0030] The present invention aims to provide a recombinant novel coronavirus highly efficient immune DNA vaccine (ipDNA vaccine) ZD-nCor19 with both preventive and therapeutic functions, as well as methods for constructing and using the same, which are largely realized based on the following technical means:

[0031] The alphavirus replicase-based DNA (replicon) vector pZDVac was used in the construction of a recombinant novel coronavirus highly efficient immunogenic DNA vaccine. The pZDVac vector was derived from the existing pSFV1 plasmid through the following modifications: replacing the original SP6 promoter with the human cytomegalovirus (CMV) promoter, adding a polyadenylate tail (SV40 poly(A)), and replacing the resistance gene of the pSFV1 plasmid with a kanamycin resistance gene, which has better clinical safety. After the above modifications were successful, the replicon was finally expressed in eukaryotes, and the resulting vector was named pZDVac vector (i.e., pSFVK1, as disclosed in Chinese Patent Application Publication No. 105343874). The use of this vector avoids the tedious process of in vitro RNA preparation. This vector, in the form of a DNA plasmid, can be directly transfected into human and animal cells, achieving high-level expression of foreign proteins. This vector inherits the ability of alphavirus vectors to induce the production of type I IFN to confer an adjuvant effect to the expressed antigen, which has the effect of enhancing immunogenicity.

[0032] The following factors in antigen design are fully considered, and an optimized design scheme is proposed:

[0033] (1) Currently, there is little basic research on the novel coronavirus, and no novel coronavirus vaccine is currently on the market. Therefore, there are no precise standards for selecting target antigens for novel coronavirus vaccines, i.e., no criteria for determining which segments of novel coronavirus antigens are more effective as vaccine target antigens. Therefore, researchers generally select novel coronavirus antigens based on the development of SARS virus vaccines. In selecting target antigens, researchers generally use the full-length spike glycoprotein (spike protein, S protein, which consists of two subunits, S1 and S2) or truncated S protein (S1 subunit and its receptor-binding domain RBD) form and the highly conserved nucleocapsid protein N (SARS-CoV-2 nucleocapsid) of novel coronaviruses. It is generally considered safer to select the full-length S protein, which contains most of the antigenic epitopes and provides broader coverage. The RBD was selected because it contains an important neutralizing domain (CND), which can induce strong neutralizing antibody responses and potentially cross-protect against mutant strains. The N protein was selected because it is highly immunogenic and can induce not only specific antibodies but also specific cytotoxic cell activity. It is a conserved phosphoprotein among coronaviruses and is highly conserved among various coronaviruses, making it relatively unlikely to mutate, thereby avoiding the risk of vaccine failure due to viral mutations (the S protein is an antigen that is likely to mutate within the virus, which could affect the immune efficacy of the vaccine). Among these, the S1 subunit and N protein of the novel coronavirus are generally considered to be the major viral antigens that induce strong immune responses and are the best viral antigens for vaccine development, due to the structure of the novel coronavirus and its mechanism of infection in patients.

[0034] (2) The inventors suspected that the full-length S protein and full-length N protein of the novel coronavirus might cause ADE-related problems. Therefore, the inventors optimized the design and ultimately determined that the RBD of the S1 subunit of the S protein, residues 301-538 of the S2 subunit, and residues 138-369 of the N protein were the target antigens selected for design. Among these, the RBD of the S1 subunit contains the neutralizing region important for vaccine development, residues 301-538 of the S2 subunit contain the majority of T cell epitopes, and residues 138-369 of the N protein also contain multiple T cell antigen epitopes. Such target antigen design not only effectively avoids ADE-related problems that may be caused by the full-length S protein and full-length N protein, but also ensures that the designed fusion protein covers more antigen epitopes and achieves more comprehensive protection than those using only the S1 protein, only the RBD, or a fusion protein of the S1 protein (or RBD) and the N protein. At the same time, the target antigen design of the present invention uses the RBD, residues 301-538 of the S2 subunit, and residues 138-369 of the N protein, which have smaller fragments than the full-length S protein and N protein. This target antigen design not only contributes to vaccine construction, but also facilitates the vaccine's entry into cells, resulting in high expression efficiency and enhanced immunological efficacy. Furthermore, in the target antigen design, two antigen segments derived from the S protein (residues 301-538 of the RBD and S2 subunit) are designed for secretory expression, which can induce a better humoral immune response, and the antigen segment derived from the N protein (residues 138-369 of the N protein) is designed for intracellular expression, which can further enhance the induced T cell immune response. Therefore, a vaccine constructed based on this design can efficiently induce humoral and T cell immune responses simultaneously, and these two responses synergistically enhance the immunoprotective effect of the vaccine.

[0035] (3) The present inventors also considered that the immunogenicity of DNA vaccines or viral vector vaccines using antigens alone may be insufficient. Therefore, in order to further improve the immunogenicity of the recombinant novel coronavirus DNA vaccine obtained by the construction, and thereby improve its immunoprotective efficacy, they also screened and determined immune synergistic molecules suitable for the target antigen in the vaccine constructed by the present invention, including: (i) Cholera toxin B subunit (CTB): it can elicit innate immunity, activate DCs, enhance immune responses, support antigen translocation into cells, induce TH1 and TH2 immune pathways, and act as an adjuvant for mucosal immunity; (ii) tetanus toxin helper T cell epitope (TT) and pan-DR helper T cell epitope (PARDE), which can enhance CD4+ T cell responses; (iii) Foldon-CPPCP: Foldon is a domain that enables non-covalent oligomerization of target proteins. It is derived from the C-terminus of fibrin from T4 bacteriophage and consists of 27 amino acids. The oligomerized structure formed by non-covalent forces has high stability. The structure depolymerizes at temperatures above 75°C or in the presence of more than 2% SDS at room temperature. After depolymerization, it can still reform trimers in the appropriate environment. CPPCP (cysteine-proline-proline-cysteine-proline) is similar to the antibody hinge region and is suitable for bispecific antibodies and fusion proteins, easily granulating trimeric proteins. This type of immunopotentiating molecule can induce antigens expressed by vaccines to form multimers and granules, further enhancing their immunogenicity. (iv) ERISS sequence: This is an adenovirus E3 leader sequence, which is an endoplasmic reticulum insertion signal sequence, i.e., ER insertion signal sequence (ERISS), which can bind to the endoplasmic reticulum signal recognition particle (SRP). Through the ability of SRP to bind to the SRP receptor on the surface of the ER membrane, the fused target antigen can be effectively transported to the ER, enhancing antigen processing and MHC class I molecule presentation by APCs, thereby enhancing the induction of effective protective CTL production; (v) OX40L: It can provide a costimulatory signal for T cell activation.

[0036] A series of fusion genes can be obtained by incorporating part or all of the genes expressing these immunopotentiating molecules into any one of the genes expressing RBD, residues 301-538 of the S2 subunit, or residues 138-369 of the N protein, or a combination thereof. To construct and obtain the recombinant novel coronavirus DNA vaccine of the present invention, these fusion genes are inserted into a designated pZDVac vector.

[0037] Fusion genes include various combinations such as (the following explanation is based on the protein structure after fusion gene expression):

[0038] Combination 1: Residues 301-538 of the RBD protein and the S2 subunit are linked to each other via a (G4S)2 linker, followed by the cholera toxin B subunit, tetanus toxin T helper cell epitope (TT), and pan-DR helper T cell epitope (the pan-DR helper T cell epitope and the RBD protein are linked via a G6 flexible linker) linked sequentially to the amino terminus (N-terminus) of the RBD protein. Surprisingly, compared with other linking sequences (e.g., tetanus toxin T helper T cell epitope, pan-DR helper T cell epitope, and cholera toxin B subunit, or tetanus toxin T helper T cell epitope, cholera toxin B subunit, and pan-DR helper T cell epitope), the linking sequence of these three immunopotentiating molecules is more conducive to target antigen presentation and enhanced immune responses induced by the target antigen.

[0039] Combination 2: Foldon-CPPCP is linked to the carboxyl terminus (C-terminus) of the S2 subunit, residues 301-538. The function of Foldon is to facilitate antigen trimerization, and CPPCP further granulates the trimeric antigen. The combination of Foldon and CPPCP facilitates target antigen multimerization and granulation after expression. Compared to soluble antigens, this is more easily phagocytosed by APCs and can simultaneously activate Th cells, CTL cells, and B cells, which can stimulate both cellular and humoral immunity, thereby generating a comprehensive immune response and greatly enhancing the immunoprotective effect of the vaccine. In this combination, we unexpectedly found that combining the two adjuvant molecules, Foldon and CPPCP, and placing them after the fusion fragment of residues 301-538 of the RBD protein and S2 subunit in the Foldon-CPPCP linking sequence is more conducive to the presentation of Foldon and CPPCP after expression, compared with other linking sequences (e.g., CPPCP-Foldon) and other positions. If the adjuvant molecule Foldon-CPPCP were placed at other positions in the fusion fragment, the two adjuvant molecules might be easily encapsulated in the center of the antigen protein due to their small molecular weight after expression. Therefore, the spatial structure of the two adjuvant molecules would not be presented, and they would not play a role in polymerizing and granulating the target antigen after expression. The combination of Combination 2 and Combination 1 may result in a stacking effect or synergistic effect.

[0040] Combination 3: Furin 2A, ERISS, and residues 138-369 of the N protein are sequentially linked to the carboxy terminus of the CPPCP based on Combination 2 or to residues 301-538 of the S2 subunit based on Combination 1. ERISS enhances antigen processing by APCs and presentation by MHC class I molecules, thereby enhancing T cell immune responses to the N protein segment expressed in cells. Furin 2A is a protease cleavage site, allowing residues 138-369 of the N protein to be independently expressed in cells and induce T cell immune responses.

[0041] Combination 4: Based on combination 3, an internal ribosome entry site (IRES) sequence is linked to the C-terminus of residues 138-369 of the N protein, and an OX40L molecule is further linked downstream of the IRES sequence, which can deliver a second signal for T cell activation, further stimulate the immune response, and induce the immune response to a high-level Th1-type immune response.

[0042] Furthermore, a Kozak sequence and a signal peptide sequence (which may be added in advance to the backbone vector) can be sequentially introduced upstream of each of the above-mentioned combinations of fusion genes, and the signal peptide can be selected from signal peptides suitable for expression in eukaryotes.

[0043] Figure 1 shows an example of the linkage structure of the target antigen and immune-enhancing molecule in a recombinant novel coronavirus highly efficient immune DNA vaccine, including a fusion gene incorporating the above combinations 1 to 4, as well as a Kozak sequence and a signal peptide sequence upstream of the fusion gene.

[0044] The structure of the recombinant novel coronavirus DNA vaccine provided by a preferred embodiment of the present invention is designed to generate synergistic interactions between target antigens, between immune-enhancing molecules, and between target antigens and immune-enhancing molecules to improve the immunoprotective effect of the DNA vaccine. At the same time, the DNA vaccine is designed to express a segment of the S protein (residues 301-538 of the RBD and S2 subunit) and a segment of the N protein (residues 138-369), respectively. The S protein segment is expressed extracellularly, while the N protein segment is expressed intracellularly. This allows for the simultaneous induction of favorable humoral and T cell immune responses, further improving the immunoprotective effect of the DNA vaccine.

[0045] The present invention will now be described in detail with reference to specific examples and the accompanying drawings.

[0046] The following briefly describes certain illustrative embodiments. As those skilled in the art will recognize, the described embodiments can be modified in a variety of different ways, all without departing from the spirit or scope of the invention. Accordingly, the drawings and description should be regarded as illustrative in nature and not restrictive.

[0047] The methods used in the following examples are conventional methods unless otherwise specified, and the specific steps can be found in "Molecular Cloning: A Laboratory Manual" Sambrook, J., Russell, David W., Molecular Cloning: A Laboratory Manual, 3rd edition, 2001, NY, Cold Spring Harbor.

[0048] The methods of obtaining various biological materials described in the Examples are intended merely to provide experimental methods for achieving the objectives of a particular disclosure and are not intended to limit the sources of the biological materials of the present invention. Indeed, the sources of biological materials used are wide-ranging, and any biological material that can be obtained without violating laws and ethics may be exchanged and used in accordance with the teachings in the Examples.

[0049] All primers and sequences referred to in this invention were synthesized using conventional techniques. [Example]

[0050] Example 1: Construction of a highly efficient recombinant novel coronavirus immunogen, DNA vaccine ZD-nCor19 In this example, a recombinant novel coronavirus highly efficient immunogenic DNA vaccine was constructed using the pZDVac vector as a DNA vaccine carrier. The novel coronavirus RBD, a segment of the S2 subunit (residues 301-538), and a segment of the N protein (residues 138-369) were used as target antigens, and cholera toxin B, tetanus toxin T helper cell epitope, pan-DR T helper cell epitope, foldon-CPPCP, furin 2A, ERISS, IRES, and OX40L (the corresponding nucleotide sequences of which are shown in Table 1 below; the RBD and the S2 subunit segment (residues 301-538) are linked by (G4S)2 (RBD-(G4S)2-S2), and the linker G6 in Table 1 is shown as the linker sequence between the RBD and PARDE; the nucleotide sequence of the N protein segment (residues 138-369) is provided as NP in Table 1) were also used as immune synergistic molecules. The construction method specifically includes the following steps.

[0051] 1.1. Preparation and identification of expression vector backbone The pZDVac-CCCPO plasmid (obtained by cloning the synthetic gene CTB-TT-CTLA-4+PD-L1 extracellular domain-PADRE-IRES-OX40L into the pZDVac vector, with the structure pZDVac-CTB-TT-CTLA-4+PD-L1 extracellular domain-PADRE-IRES-OX40L and the corresponding nucleotide sequence set forth in SEQ ID NO: 1) was digested with AclI and XbaI restriction enzymes. A 0.45% gel electrophoresis photograph is shown in Figure 2, with lanes 1 and 2 representing the pZDVac-CCCPO plasmid after double digestion with AclI and XbaI. The recovered large fragment of approximately 12 kb was pZDVac-IRES-OX40L. The recovered fragment was identified by gel electrophoresis in lane 2 of Figure 4, and could be used as an expression vector backbone for constructing a novel coronavirus highly efficient immunogenic DNA vaccine.

[0052] 1.2. Synthesis and Identification of Gene Fragments As shown in Figure 1, gene synthesis was performed according to the gene ligation sequence CTB-TT-PARDE-G6-RBD-(G4S)2-S2-Foldon-CPPCP-Furin2A-ERISS-NP (first target gene, abbreviated CRSNP). Restriction sites XbaI, NruI, and PmeI were introduced upstream of the first target gene, and a single restriction site AclI was introduced downstream of the first target gene. Thus, a recombinant plasmid carrying the target gene fragment CRSNP (designated pUC57-CRSNP recombinant plasmid) was obtained. This process was carried out by Beijing Biomed Gene Co., Ltd.

[0053] The pUC57-CRSNP recombinant plasmid was digested with AclI and XbaI restriction enzymes (purchased from New England Biolabs (NEB) Inc.) and subjected to 0.45% agarose gel electrophoresis (Regular Agarose G-10, Biowest) is shown in Figure 3. Lane 1 shows the electrophoresis result of the pUC57-CRSNP recombinant plasmid, and lane 2 shows the electrophoresis result of the pUC57-CRSNP recombinant plasmid after double digestion with AclI and XbaI. The 3.6 kb target fragment was recovered (using an agarose gel DNA recovery kit (spin column) from TIANGEN) to obtain the target gene fragment CRSNP (indicated by an arrow in Figure 3 and designated the first target gene fragment). The results of gel electrophoresis of the recovered first target gene fragment are shown in lane 1 of Figure 4. In this example, the inventors also synthesized two other target gene fragments: RBD-(G4S)2-S2-NP (designated the second target gene fragment, which differs from the first target gene fragment only in that it was not linked to an immune synergy molecule) and Foldon-CPPCP-TT-PARDE-G6-RBD-(G4S)2-S2-CTB-Furin2A-ERISS-NP (designated the third target gene fragment, which differs from the first target gene fragment in the positions of the immune adjuvant molecules, Foldon-CPPCP and CTB).

[0054] [Table 1] TIFF2023550004000003.tif231170

[0055] 1.3. Construction of a highly effective recombinant novel coronavirus immunogenic DNA vaccine As shown in Figure 5, the expression vector backbone pZDVac-IRES-OX40L obtained in step 1.1 above was ligated to the first target gene CRSNP obtained in step 1.2 using T4 ligase, and a recombinant expression vector carrying the first target gene fragment CRSNP was obtained by colony PCR. A positive clone: ​​pZDVac-CTB-TT-PARDE-G6-RBD-(G4S)2-S2-Foldon-CPPCP-Furin2A-ERISS-NP-IRES-OX40L (designated pZDVac-CRSNPO recombinant plasmid; the nucleotide sequence corresponding to the fusion gene CTB-TT-PARDE-G6-RBD-(G4S)2-S2-Foldon-CPPCP-Furin2A-ERISS-NP-IRES-OX40L is set forth in SEQ ID NO: 13, which, in addition to the nucleotide sequence shown in Table 1 above, also contains restriction sites) was screened. The recombinant expression vector is the recombinant novel coronavirus highly efficient immune DNA vaccine ZD-nCor19, and the specific construction steps include:

[0056] 1.3.1.T4 Ligation The expression vector backbone pZDVac-IRES-OX40L (approximately 12 kb) obtained by gel recovery in step 1.1 above was ligated to the first target gene fragment CRSNP (approximately 3.6 kb) obtained by gel recovery in step 1.2, and the ligation product was incubated overnight at 16°C. This system is shown in Table 2.

[0057] [Table 2]

[0058] 1.3.2. Screening for positive clones 100 μL of stable competent cells were placed in an ice bath. After thawing the competent cells, 10 μL of the ligation product obtained in step 1.3.1 above was added to the competent cell suspension, mixed gently, and placed in an ice bath for 30 minutes. The cells were then immediately transferred to a 42°C water bath for a 90-second heat shock, followed by a quick transfer to an ice bath for 2 minutes. 500 μL of sterile LB medium without antibiotics was added to the transformed cells, mixed evenly, and then incubated at 37°C for 60 minutes with shaking at 150 rpm. The mixture was then centrifuged at 12,000 rpm for 1 minute, and 500 μL of the supernatant was discarded. 100 μL of the transformed cells were harvested and evenly spread onto an LB agar plate containing kanamycin (50 μg / mL) and cultured at 37°C for 48 hours in an inverted Petri dish.

[0059] Single colonies were picked and positive clones were screened by colony PCR. An upstream primer F and a downstream primer R were designed for PCR amplification (primer sequences were synthesized by Beijing Biomed): Upstream primer F: CCCAGGAGACCCGGTTCTAGAGACGGACATT (SEQ ID NO: 14); Downstream primer R: AAGCGGGCTTCGGCCAGTAACGTTAGGGGGGG (SEQ ID NO: 15).

[0060] The PCR system (25 μL) contained the following: 12.5 μL of 2x PCR mix (purchased from Beijing Biomed); 11.5 μL of ddH2O; 0.5 μL of F (10 μM) and 0.5 μL of R (10 μM). The PCR reaction conditions for PCR amplification of colonies transformed with the ligation products were 95°C for 5 minutes, 1 cycle; 94°C for 30 seconds, 55°C for 30 seconds, and 72°C for 50 seconds, 35 cycles; and 72°C for 7 minutes. The PCR products were analyzed by 0.45% agarose DNA gel electrophoresis. The results are shown in Figure 6, where lanes 1 to 5 represent PCR results from different single colonies.

[0061] 1.3.3. Plasmid extraction and identification of positive clones by restriction enzyme digestion Positive colonies screened by colony PCR were streaked onto LB agar plates containing kanamycin (50 μg / mL) and cultured overnight at 37°C in an inverted Petri dish. A single clone was then selected and inoculated into 1.5 mL of LB medium containing kanamycin (50 μg / mL) and cultured overnight at 37°C at 200 rpm. The resulting bacterial suspension was then inoculated into 20 mL of LB medium containing kanamycin (50 μg / mL) at a 1:50 ratio and cultured overnight at 37°C at 200 rpm. In a sterile environment, 12 mL of the bacterial suspension was collected and prepared into a glycerol bacteria solution based on a ratio of 1.2 mL of bacterial suspension + 0.6 mL of 60% glycerol. The remaining bacterial suspension was centrifuged, and plasmids were extracted and identified by single and double digestion with AclI and XbaI, respectively. The single and double digestion systems are shown in Tables 3 and 4 below.

[0062] [Table 3]

[0063] [Table 4]

[0064] The sample was mixed according to the enzyme digestion system in Table 3 or Table 4 above and centrifuged briefly to allow the sample and enzyme(s) to settle to the bottom of the tube. The centrifuge tube was placed in a 37°C water bath and incubated for 2 hours. Bands of the expected size were identified by 0.45% agarose gel electrophoresis. The results are shown in Figure 7. Lanes 1 to 3 are the results of plasmids derived from positive clones 1, 2, and 4, respectively, screened by colony PCR in Figure 6. Lanes 4 to 6 are the results of AclI single digestion of the plasmids derived from positive clones 1, 2, and 4, respectively. Lanes 7 to 9 are the results of XbaI single digestion of the plasmids derived from positive clones 1, 2, and 4, respectively. Lanes 10 to 12 are the results of AclI and XbaI double digestion of the plasmids derived from positive clones 1, 2, and 4, respectively. These included a band of approximately 12 kb and a band of approximately 3.6 kb, demonstrating the construction of the recombinant plasmid pZDVac-CRSNPO, i.e., a recombinant novel coronavirus highly efficient immunogenic DNA vaccine.

[0065] In this example, the recombinant plasmid pZDVac-RBD-(G4S)2-S2-NP (empty vector pZDVac was used as the backbone vector and designated Control Plasmid 1) harboring the second target gene (RBD-(G4S)2-S2-NP) and the recombinant plasmid pZDVac-Foldon-CPPCP-TT-PARDE-G6-RBD-(G4S)2-S2-CTB-Furin2A-ERISS-NP-IRES-OX40L (designated Control Plasmid 2) harboring the third target gene (Foldon-CPPCP-TT-PARDE-G6-RBD-(G4S)2-S2-CTB-Furin2A-ERISS-NP) were constructed in a manner similar to that described in step 1.3.

[0066] Example 2: Immunogenicity induced by pZDVac-CRSNPO recombinant plasmid in a mouse model In this example, the pZDVac-CRSNPO recombinant plasmid constructed and obtained in Example 1 above was used to verify its immunogenic effect induced in a mouse model, which particularly includes the following steps:

[0067] 2.1. Twenty 6- to 8-week-old SPF female BALB / c mice (purchased from Beijing Weitong Lihua Laboratory Animal Technology Co., Ltd.) were randomly divided into four groups of five mice each and immunized three times by intramuscular injection plus electrical pulse stimulation, with an interval of 7 days between immunizations. The experimental groups and doses are shown in Table 5.

[0068] [Table 5]

[0069] 2.2. Two weeks after the final immunization, mice were sacrificed and splenic lymphocytes were isolated. After 20 hours of culture with stimulation using the N and RBD proteins of the novel coronavirus, immunological detection was performed according to the instructions for MabTech's mouse IFN-γ and IL-4 ELISPOT plate. The statistical results for detecting the secretion frequency of cytokines IFN-γ and IL-4 under different protein stimuli are shown in Figures 8 and 9, respectively (p<0.05 is statistically significant). The statistical results for antigen-specific T cell immune response bias are shown in Figure 10.

[0070] The results shown in Figures 8-10 indicate that different doses of the pZDVac-CRSNPO recombinant plasmid were able to induce N- and RBD-specific T cell immune responses in immunized mice, secreting not only IFN-γ, which indicates a Th1-type response, but also IL-4, which indicates a Th2-type response. The frequency of secretion of the Th1 cytokine IFN-γ was significantly higher than that of the Th2 cytokine IL-4. These results indicate that the T cell immune response induced by the pZDVac-CRSNPO recombinant plasmid was Th1-biased, with 1 μg being the optimal immunization dose compared to the 0.3 μg and 10 μg groups.

[0071] Following the same methods as those described in steps 2.1 and 2.2 above, the immunogenicity induced by immunization of 6- to 8-week-old SPF female BALB / c mice with control plasmid 1 and control plasmid 2 was detected, respectively. The results showed that the immunogenic effects induced by control plasmid 1 and control plasmid 2 were not as good as those induced by the pZDVac-CRSNPO recombinant plasmid.

[0072] Example 3: Detection of immunogenicity of pZDVac-CRSNPO recombinant plasmid in humans In this example, the pZDVac-CRSNPO recombinant plasmid constructed and obtained in Example 1 was used to immunize human subjects to verify the immunogenic effect induced in the human body, which includes the following steps:

[0073] 3.1. Fifteen selected volunteers (internal staff of the applicant unit who signed up to volunteer to participate in the clinical trial) were randomly divided into three groups with five members in each group. The immunization interval was 28 days, and three immunizations were performed. PBMCs were collected from the volunteers for ELISPOT detection before the first immunization, 14 days after the second immunization, and 21 days after the third immunization. The first two immunizations were intramuscular injection + electric pulse stimulation, and the third immunization was intradermal injection + electric pulse stimulation. The experimental groups and doses are shown in Table 6 below.

[0074] [Table 6]

[0075] Fresh PBMCs obtained from volunteers were extracted, stimulated and cultured with the novel coronavirus N protein and RBD protein for 20 hours, and immunological detection was performed according to the instructions for MabTech's human IFN-γ ELISPOT plate. The statistical results of detecting the secretion frequency of cytokine IFN-γ under different protein stimuli after three immunizations are shown in Figure 11 (p<0.05 indicates a significant statistical difference, and p<0.01 indicates a highly significant statistical difference). The statistical results of the three immunization responses using different doses are shown in Figure 12 (p<0.05 indicates a significant statistical difference, and p<0.01 indicates a highly significant statistical difference).

[0076] The results in Figure 11 show that strong cellular immune responses could be induced after the second and third immunizations compared with those before immunization, and the frequency of cytokine IFN-γ secretion in PBMCs was significantly increased when the N protein and RBD protein were used as stimuli, respectively. The frequency of cytokine IFN-γ secretion after the third immunization was higher than that after the second immunization when the N protein was used as a stimuli, and the frequency of cytokine IFN-γ secretion after the second immunization was higher than that after the third immunization when the RBD protein was used as a stimuli. The results in Figure 12 show that the number of spots in different dose groups significantly increased after immunization compared with that before immunization, indicating that specific cellular immunity could be effectively induced at each dose. However, when the N protein and RBD protein were used as stimuli, there was a significant difference in the number of spots among the dose groups after the second immunization (p = 0.0343, as a result of analysis of variance between the three dose groups: low, medium, and high doses). Compared with the high-dose and low-dose groups, the immune effect of the medium-dose group was better, and the number of spots did not increase significantly after the third immunization. Therefore, when using the pZDVac-CRSNPO recombinant plasmid as a novel coronavirus DNA vaccine, two immunizations at the medium dose (e.g., 28 days between the two immunizations) can be used.

[0077] Furthermore, the 15 volunteers screened in this example underwent regular follow-up and physical examinations (at least 3 months) after vaccine injection, and all volunteers did not experience any discomfort, which preliminarily indicates that the pZDVac-CRSNPO recombinant plasmid provided by the present invention has a good safety profile when used as a vaccine.

[0078] Example 4: Immunization route and electrotransfer conditions of pZDVac-CRSNPO recombinant plasmid In this example, the pZDVac-CRSNPO recombinant plasmid constructed and obtained in Example 1 was used to immunize mice via different immunization routes (intramuscular injection or intradermal injection) and under different electrotransfer conditions to evaluate the strength of the immune response induced via different immunization routes and under different electrotransfer conditions, which particularly includes the following steps:

[0079] 4.1. Forty healthy 6- to 8-week-old female Balb / c mice (purchased from Viton Lever) were randomly divided into five groups, with eight mice in each group, according to the groups shown in Table 7 below. Mice in each group were immunized by single-point administration to the left hind limb of the mice via intramuscular or intradermal injection and electrotransfer (1 Hz x 6 times, 0.5 cm electrode needle spacing). A blank control group was set up without treatment, and mice in the other groups were given 1 μg / mouse of the pSFVK1-CRSNPO recombinant plasmid. The day of administration was counted as day 0, and mice in the five groups were immunized twice, on days 0 and 21, respectively.

[0080] [Table 7]

[0081] 4.2. For antibody detection, serum was collected two weeks after the final immunization. Specifically, an antibody detection kit from ACRO Biosystems was used to detect serum antibodies (RBD IgG). Mouse serum was diluted 1:100, and a positive result was determined by an absorbance value of OD450nm > 0.1. Two weeks after the final immunization, mice from each group were sacrificed, and ELISPOT detection (IFN-γ) was performed according to the instructions for the MabTech IFN-γ ELISPOT plate. The number of spots in the ELISPOT experiment is expressed as spot-forming units (SFU) / 10 6 The criterion for determining whether an experimental well was positive was that the number of spots in the experimental well was greater than the mean spot value of the negative control wells + 2 SD. The calculation method for the number of positive spots for each mouse was as follows: five replicate wells were prepared for the splenocytes of one mouse, and if at least three wells were positive, the data for that mouse was considered valid. The number of spots for that mouse = the mean number of spots in the experimental wells - the number of spots in the negative control wells. The calculation method for the number of spots in each mouse group was as follows: the data for each valid mouse in the group was averaged and expressed as the mean ± standard deviation. Statistical analysis of the data was performed using GraphPad Prism8 software. Differences between two groups were analyzed using Student's t-test, and differences between multiple groups were compared using one-way analysis of variance. p<0.05 indicates a statistically significant difference, and p<0.01 indicates a highly significant difference.

[0082] The results of antibody detection are shown in Figure 13. It was found that the pSFVK1-CRSNPO recombinant plasmid was able to induce antibody responses after immunization of mice via different routes (intramuscular injection and intradermal injection) or under different electrotransfer conditions. Compared with the blank control group, the antibody levels induced by intramuscular injection group (60 V, 50 ms, 1 Hz × 6 times, 0.5 cm electrode needle spacing, and 120 V / cm electric field strength) were statistically different. The antibody levels induced by intradermal injection group a (60 V, 50 ms, 1 Hz × 6 times, 0.5 cm electrode needle spacing, and 120 V / cm electric field strength) were also statistically significantly different from those of the blank control group. Meanwhile, the antibody levels induced by intradermal injection group b (36 V, 50 ms) and intradermal injection group c (36 V, 10 ms) were not statistically significantly different from those of the blank control group. These results indicated that under intramuscular and subcutaneous injection conditions, electrotransfer conditions with a voltage of 60 V and a pulse width of 50 ms had a relatively better immune effect than electrotransfer conditions with a voltage of 36 V and a pulse width of 50 ms. Furthermore, under the same electrotransfer conditions, the antibody levels induced by intradermal injection group a were not statistically different from those of the intramuscular injection group, but in general, immunization with the pSFVK1-CRSNPO recombinant plasmid via the intramuscular injection route had a relatively better humoral immune effect.

[0083] The results of the ELISPOT assay are shown in Figure 14. The pSFVK1-CRSNPO recombinant plasmid was found to be able to induce N-, RBD-, and S2-antigen-specific T cell immune responses after immunization of mice by different routes (intramuscular and intradermal injection) and under different electrotransfer conditions. All experimental groups (intramuscular injection group, subcutaneous injection group a, subcutaneous injection group b, and subcutaneous injection group c) were statistically significantly different from the blank control group. Among them, the N-, RBD-, and S2-antigen-specific T cell immune responses induced by intradermal immunization under various electrotransfer conditions were different from those induced by intramuscular immunization.

[0084] In summary, the results showed that the pSFVK1-CRSNPO recombinant plasmid vaccine provided by the present invention was able to induce strong and specific T cell immune responses in mice stimulated via different immunization routes and under different electrotransfer conditions, with no significant difference in the cellular immune responses induced between the intramuscular and intradermal injection groups. The provided pSFVK1-CRSNPO recombinant plasmid vaccine had a relatively better induction effect in terms of inducing humoral immune responses under conditions of a voltage of 60 V and a pulse width of 50 ms, and in general, vaccines administered intramuscularly produced relatively better humoral immune responses. Therefore, the pSFVK1-CRSNPO recombinant plasmid provided by the present invention can induce good cellular and humoral immune responses when used as a vaccine and can exert good protective effects of vaccination, which is consistent with the results of Examples 2 and 3 above.

[0085] Example 5: Immune challenge test In this example, hACE2 transgenic mice or rhesus macaques were immunized with the pSFVK1-CRSNPO recombinant plasmid according to the vaccine immunization method described in Example 4 above (intramuscular or subcutaneous injection and electrotransfer (60 V, 50 ms, 1 Hz x 6 times, 0.5 cm electrode needle spacing, 120 V / cm field strength)). A negative control group was also administered saline. The day of administration was counted as day 0, and animals in each group were immunized twice, on days 0 and 21, respectively. Two weeks after the final immunization, animals in each group were challenged with a novel coronavirus liquid. The reduction in lung viral load and lung pathology in animals in each group was investigated. A reduction in lung viral load (≥2 log) and improvement in lung pathology were essential requirements for efficacy evaluation. The results showed that after challenge, animals in the negative control group showed typical clinical symptoms of COVID-19 (e.g., fever, lethargy, weight loss, and even death), while at least 4 / 5 of animals in the immunized group were protected, did not show any of the typical clinical symptoms of COVID-19, had a reduction in lung viral load (more than 2 logs), and significantly improved lung pathology. These results demonstrate the efficacy and safety of the recombinant novel coronavirus highly efficient immune DNA vaccine ZD-nCor19 provided by the present invention.

[0086] In summary, the results of the above examples demonstrate that the recombinant novel coronavirus highly effective immune DNA vaccine (i.e., pZDVac-CRSNPO recombinant plasmid) constructed and obtained according to the present invention can effectively induce highly efficient immune responses, including innate and antigen-specific cellular immune responses, in animal-level immunological function tests, demonstrating that this vaccine is a new type of coronavirus DNA vaccine with great potential for development. After immunizing human subjects with this vaccine, it was found that all three dose groups (100 μg, 300 μg, and 500 μg) were able to induce high levels of innate and antigen-specific cellular immune responses, with the 300 μg dose group inducing the highest level of immune response. All human subjects participating in the study did not experience any obvious adverse reactions, such as fever, allergies, headache, or general weakness, during regular follow-up and physical examinations. By comparing the strength of immune responses induced via different immunization routes and under different electrotransfer conditions, it was shown that the recombinant novel coronavirus highly efficient immune DNA vaccine provided by the present invention can be administered via intramuscular and subcutaneous injection, both of which can induce good specific T cell and humoral immune responses. The results of immune challenge tests also demonstrate that the recombinant novel coronavirus highly efficient immune DNA vaccine of the present invention has good safety and immunoprotective effects. All of the above results preliminarily confirm that the vaccine constructed by the present invention is a type of vaccine that can induce high-level immune responses while at the same time being very mild and safe.

[0087] The examples described herein are for illustrative purposes only (by way of example), and various modifications or alterations made by those skilled in the art should fall within the essential scope of this patent application. [Industrial Applicability]

[0088] The present invention provides a fusion gene and a recombinant novel coronavirus highly efficient immune DNA vaccine based on the fusion gene, as well as methods for constructing and using the same. The recombinant novel coronavirus highly efficient immune DNA vaccine has the dual effects of preventing and treating novel coronavirus infection, suitable for industrial use.

Claims

1. A fusion gene comprising at least two of the following (1) to (4): (1) A gene expressing the RBD segment of the novel coronavirus COVID-19; (2) a gene expressing the S2 subunit of the novel coronavirus COVID-19 or a partial fragment thereof; (3) A gene expressing the N protein of the novel coronavirus COVID-19 or a partial fragment thereof; (4) A gene expressing an amino acid fragment selected from the group consisting of CTB, TT, PADRE, Foldon, CPPCP, furin2A, ERISS, IRES, and OX40L, or a combination thereof.

2. The fusion gene according to claim 1, comprising at least three of the following (1) to (4): (1) a gene expressing the RBD segment of the novel coronavirus COVID-19; (2) a gene expressing residues 301 to 538 of the S2 subunit of the novel coronavirus COVID-19; (3) a gene expressing residues 138 to 369 of the N protein of the novel coronavirus COVID-19; (4) Genes expressing the following amino acid fragments: CTB, TT, PADRE, Foldon, CPPCP, Furin2A, ERISS, IRES, and OX40L.

3. a gene expressing the RBD segment and a gene expressing residues 301-538 of the S2 subunit are joined to form a fusion fragment; Preferably, the nucleotide sequence of the fusion fragment comprises the sequence set forth in SEQ ID NO:6, and the nucleotide sequence of the gene expressing residues 138 to 369 of the N protein comprises the sequence set forth in SEQ ID NO:

10.

4. (1) The nucleotide sequence of the gene expressing the CTB amino acid fragment is set forth in SEQ ID NO: 2; (2) the nucleotide sequence of the gene expressing the TT amino acid fragment is set forth in SEQ ID NO: 3; (3) The nucleotide sequence of the gene expressing the PADRE amino acid fragment is set forth in SEQ ID NO: 4; (4) a gene expressing the Foldon amino acid fragment and a gene expressing the CPPCP amino acid fragment are linked to form a synthetic fragment, and the nucleotide sequence of the synthetic fragment is set forth in SEQ ID NO:7; (5) The nucleotide sequence of the gene expressing the furin 2A amino acid fragment is set forth in SEQ ID NO: 8; (6) The nucleotide sequence of the gene expressing the ERISS amino acid fragment is set forth in SEQ ID NO: 9; (7) The nucleotide sequence of the gene expressing the IRES amino acid fragment is set forth in SEQ ID NO: 11, and / or (8) The nucleotide sequence of the gene expressing the OX40L amino acid fragment is set forth in SEQ ID NO:

12. The fusion gene according to any one of claims 1 to 3.

5. a gene expressing the RBD segment and a gene expressing residues 301 to 538 of the S2 subunit are linked to form a fusion fragment, and the upstream of the fusion fragment is sequentially linked to genes expressing the amino acid fragments of CTB, TT, and PADRE, and the downstream of the fusion fragment is sequentially linked to genes expressing amino acid fragments of Foldon, CPPCP, and Furin 2A; and / or a gene expressing the ERISS amino acid fragment is linked upstream of a gene expressing residues 138 to 369 of the N protein, and genes expressing the IRES and OX40L amino acid fragments are sequentially linked downstream of the gene expressing residues 138 to 369 of the N protein; Preferably, the gene expressing the RBD segment and the gene expressing residues 301-538 of the S2 subunit are (G4S) 2 the upstream of the fusion fragment and the gene expressing the PADRE amino acid fragment are linked by a gene expressing a linker G6, and the nucleotide sequence of the gene expressing the linker G6 is set forth in SEQ ID NO:5; More preferably, the nucleotide sequence of the fusion gene is set forth in SEQ ID NO:

13. The fusion gene according to any one of claims 2 to 4.

6. A fusion protein obtained from the expression of the fusion gene according to any one of claims 1 to 5.

7. A recombinant novel coronavirus highly efficient immunogenic DNA vaccine named ZD-nCor19, comprising the fusion gene of any one of claims 1 to 5 and a vector.

8. The recombinant novel coronavirus highly efficient immune DNA vaccine of claim 7, wherein the vector is a pZDVac vector.

9. A method for constructing the recombinant novel coronavirus highly efficient immune DNA vaccine according to claim 7 or 8, comprising: 1) synthesizing the fusion gene according to any one of claims 1 to 5; 2) inserting the fusion gene into the pZDVac vector to obtain the recombinant novel coronavirus highly efficient immune DNA vaccine; A method comprising:

10. The recombinant novel coronavirus highly efficient immune DNA vaccine according to claim 7 or 8, which is used in the preparation of a medicament for preventing and / or treating novel coronavirus infection.