SFTS virus vaccine

Abstract

Provided herein are compositions, systems, kits, and methods for immunizing a subject against severe fever with thrombocytopenia syndrome virus (SFTS virus) using a composition comprising: i) a plurality of nanoparticles self-assembled from a plurality of fusion proteins comprising a) at least a portion of a ferritin protein, and b) at least a portion of an immunogenic protein comprising at least a portion of the SFTS virus Gn and / or Gc envelope glycoprotein; or ii) a polynucleotide encoding the fusion protein (e.g., an mRNA sequence present in a lipid nanoparticle).

Description

[Technical Field]

[0001] This application claims priority to U.S. Provisional Application No. 63 / 433,294, filed December 16, 2022, and U.S. Provisional Application No. 63 / 588,891, filed October 9, 2023, both of which are incorporated by reference in their entireties.

[0002] This invention was made with government support under awards AI152190 and AI140705 from the National Institutes of Health. The government has certain rights in this invention.

[0003] Provided herein are compositions, systems, kits, and methods for immunizing a subject against severe fever with thrombocytopenia syndrome virus (SFTS virus) using a composition comprising: i) a plurality of nanoparticles self-assembled from a plurality of fusion proteins comprising a) at least a portion of a ferritin protein, and b) at least a portion of an immunogenic protein comprising at least a portion of the SFTS virus Gn and / or Gc envelope glycoprotein; or ii) a polynucleotide encoding the fusion protein (e.g., an mRNA sequence present in a lipid nanoparticle). [Background technology]

[0004] Severe fever with thrombocytopenia syndrome (SFTS) is caused by the SFTSV (SFTS virus), also known as Dabie bandavirus (DBV). It is characterized by clinical symptoms of fever, thrombocytopenia, leukopenia, and multiple organ failure accompanied by bleeding, with a mortality rate of up to 30%. It was first reported in East Asia in 2009 and has become endemic in the region. The primary route of human infection is via tick bites, but animal-to-human and human-to-human transmission has also been reported. The case fatality rate is particularly high among the elderly, ranging from 12 to 30%. Over 8,500 cases have been reported, with the majority of fatal cases occurring in the elderly, suggesting a strong age-related risk. The virus is transmitted by the Asian chigger tick, which was first detected in the United States in 2017. SFTSV-carrying ticks are distributed across more than 19 states in the United States, suggesting that the disease may be endemic outside of East Asia. Therefore, there is an increasing need for a safe vaccine against SFTSV, particularly for the elderly. Currently, no treatments or vaccines are licensed. Recently, SFTSV has been listed as one of the priority pathogens by WHO and NIH. Summary of the Invention

[0005] Provided herein are compositions, systems, kits, and methods for immunizing a subject against severe fever with thrombocytopenia syndrome virus (SFTS virus) using a composition comprising: i) a plurality of nanoparticles self-assembled from a plurality of fusion proteins comprising a) at least a portion of a ferritin protein, and b) at least a portion of an immunogenic protein comprising at least a portion of the SFTS virus Gn and / or Gc envelope glycoprotein; or ii) a polynucleotide encoding the fusion protein (e.g., an mRNA sequence present in a lipid nanoparticle).

[0006] In some embodiments, provided herein is a composition comprising a plurality of fusion proteins, each of which comprises a) at least a portion of a ferritin protein and b) an immunogenic protein comprising at least a portion of i) the thrombocytopenic syndrome severe fever virus (SFTS) Gn envelope glycoprotein and / or ii) the SFTS virus Gc envelope glycoprotein, wherein the plurality of fusion proteins self-assemble (or will self-assemble under appropriate conditions) into a plurality of nanoparticles, and wherein each of the plurality of nanoparticles displays the immunogenic protein on its surface.

[0007] In certain embodiments, provided herein is a method of immunizing a subject (e.g., a human subject), comprising administering to the subject at least a portion of a plurality of nanoparticles described above and herein, such that an immune response against an immunogenic protein is produced in the subject (e.g., such that SFTS virus-neutralizing antibodies are produced in the subject).

[0008] In another embodiment, provided herein is a method for producing a plurality of nanoparticles, the method comprising: a) culturing a plurality of cells in a culture medium, wherein each of the plurality of cells comprises a vector comprising a nucleic acid sequence encoding a fusion protein comprising i) at least a portion of a ferritin protein and ii) an immunogenic protein comprising at least a portion of i) the thrombocytopenic syndrome severe fever virus (SFTS) Gn envelope glycoprotein and / or ii) the SFTS virus Gc envelope glycoprotein, wherein the culturing is under conditions such that each of the plurality of cells expresses a plurality of fusion proteins that self-assemble into a plurality of nanoparticles, and wherein the plurality of nanoparticles display the immunogenic protein on their surfaces; and b) recovering the plurality of nanoparticles to produce a first composition.

[0009] In some embodiments, the method further comprises purifying the first composition to substantially remove non-nanoparticulate material, thereby producing a second composition. In further embodiments, the method further comprises combining the second composition with an adjuvant.

[0010] In certain embodiments, provided herein is a nucleic acid molecule encoding any of the fusion proteins described herein, including the Figures.

[0011] In certain embodiments, the composition further comprises an adjuvant. In other embodiments, at least a portion of the ferritin protein comprises at least 25 contiguous amino acids (e.g., 25...50...75...100...125...150...or beyond) from a ferritin protein. In some embodiments, at least a portion of the ferritin protein comprises at least 25 contiguous amino acids, or at least 100 contiguous amino acids, or at least about 150 contiguous amino acids, or the entire amino acid sequence from an amino acid sequence selected from SEQ ID NOs: 4, 5, 6, 7, and 8. In further embodiments, at least a portion of the ferritin protein comprises an amino acid sequence at least about 90% identical, or at least 95% identical, or at least 99% identical, or 100% identical to an amino acid sequence selected from SEQ ID NOs: 4, 5, 6, 7, and 8. In certain embodiments, at least a portion of the ferritin protein comprises an amino acid sequence selected from SEQ ID NOs: 4, 5, 6, 7, 8, or from SEQ ID NOs: 4, 5, 6, 7, and 8 with one or two conservative amino acid changes. In some embodiments, at least a portion of the ferritin protein is a hybrid protein comprising at least a portion of a bullfrog (Rana catesbeiana) ferritin protein joined to at least a portion of a ferritin protein selected from the group consisting of a Helicobacter pylori ferritin protein and an Escherichia coli ferritin protein.

[0012] In certain embodiments, at least a portion of the SFTS virus Gn envelope glycoprotein comprises at least 25 or at least 50 contiguous amino acids, or at least 100 contiguous amino acids, or at least about 200 contiguous amino acids (e.g., 50...100...125...150...175...or 200 contiguous amino acids), or the entire amino acid sequence from SEQ ID NOs: 2, 9, 11, 25, and 27, or from an amino acid sequence selected from SEQ ID NOs: 2, 9, 11, 25, and 27 with one or two conservative amino acid changes or terminal deletions. In other embodiments, at least a portion of the SFTS virus Gc envelope glycoprotein comprises at least 25 contiguous amino acids, or at least 100 contiguous amino acids, or at least about 200 contiguous amino acids, or the entire amino acid sequence from SEQ ID NOs: 3, 13, and 15, or from an amino acid sequence selected from SEQ ID NOs: 3, 13, and 15 with one or two conservative amino acid changes. In some embodiments, the fusion protein further comprises a linker sequence.

[0013] In some embodiments, provided herein is a polynucleotide encoding at least a portion of a fusion protein, the fusion protein comprising: a) at least a portion of a ferritin protein; and b) an immunogenic protein comprising at least a portion of i) the thrombocytopenic syndrome severe fever virus (SFTS) Gn envelope glycoprotein and / or ii) the SFTS virus Gc envelope glycoprotein. In certain embodiments, the polynucleotide is optimized, at least in part, for enhanced expression, reduced immunogenicity, improved stability, or a combination thereof.

[0014] In certain embodiments, the polynucleotide comprises at least 24 or 35 contiguous nucleotides from any of SEQ ID NOs: 1, 10, 12, 14, 16, 18, 20, 22, 24, 26, 31, or 33-40, where T is optionally substituted with U and / or any of the nucleotides containing U is substituted with a modified base. In some embodiments, at least a portion of the ferritin protein comprises at least 25 contiguous amino acids from a ferritin protein. In further embodiments, at least a portion of the ferritin protein comprises at least 25 contiguous amino acids, or at least 100 contiguous amino acids, or at least about 150 contiguous amino acids, or the entire amino acid sequence from an amino acid sequence selected from SEQ ID NOs: 4, 5, 6, 7, and 8. In further embodiments, at least a portion of the ferritin protein comprises an amino acid sequence at least about 90% identical, or at least 95% identical, or at least 99% identical, or 100% identical to an amino acid sequence selected from SEQ ID NOs: 4, 5, 6, 7, and 8. In certain embodiments, at least a portion of the ferritin protein comprises an amino acid sequence selected from SEQ ID NOs: 4, 5, 6, 7, 8, or from SEQ ID NOs: 4, 5, 6, 7, and 8 with one or two conservative amino acid changes.

[0015] In some embodiments, at least a portion of the ferritin protein is a hybrid protein comprising at least a portion of a bullfrog ferritin protein joined to at least a portion of a ferritin protein selected from the group consisting of a Helicobacter pylori ferritin protein and an Escherichia coli ferritin protein. In other embodiments, at least a portion of the SFTS virus Gn envelope glycoprotein comprises at least 25 or at least 50 contiguous amino acids, or the entire amino acid sequence, from SEQ ID NOs: 2, 9, 11, 25, and 27, or from an amino acid sequence selected from SEQ ID NOs: 2, 9, 11, 25, and 27 with one or two conservative amino acid changes or terminal deletions. In further embodiments, at least a portion of the SFTS virus Gc envelope glycoprotein comprises at least 25 contiguous amino acids, or at least 100 contiguous amino acids, or at least about 200 contiguous amino acids, or the entire amino acid sequence selected from SEQ ID NOs: 3, 13, and 15, or from an amino acid sequence selected from SEQ ID NOs: 3, 13, and 15 with one or two conservative amino acid changes. In certain embodiments, the fusion protein further comprises a linker sequence.

[0016] In some embodiments, the polynucleotide comprises RNA. In further embodiments, the polynucleotide is partially or fully human codon-optimized or partially or fully HSV-1 glycoprotein B codon-optimized, and optionally is RNA. In other embodiments, the polynucleotide further comprises or encodes a 5' untranslated region (UTR), a 5' cap, a 3' UTR, an IRES, a 3' tail sequence, or any combination thereof. In other embodiments, the 3' tail sequence comprises a poly-A tail, a poly-G quadruplex, a stem-loop sequence, a triple-helix forming sequence, a tRNA-like sequence, or any combination thereof.

[0017] In certain embodiments, the polynucleotide comprises at least one chemically modified nucleotide (e.g., 1%, 2%, 25%, 50%, 75%, or 100% of the uracils). In further embodiments, the at least one chemically modified nucleotide comprises a modified uracil. In other embodiments, at least 60% of the uracils in the polynucleotide are chemically modified. In further embodiments, the at least one chemically modified nucleotide comprises 5-methylcytosine or N1-methylpseudouridine (m1Ψ). In some embodiments, the polynucleotide comprises i) a nucleotide sequence having at least 75%, 85%, or 95% identity to SEQ ID NO: 1, 10, 12, 14, 16, 18, 20, 22, 24, 26, 31, or 33-40, or a complement or reverse complement thereof, wherein T may be replaced with U or modified U, and / or any nucleotides containing U are replaced with a modified base.

[0018] In some embodiments, provided herein is a vaccine comprising a composition described above or herein, and at least one adjuvant (e.g., AddaVax or MF59), a delivery vehicle, or a combination thereof. In certain embodiments, the delivery vehicle comprises a lipid nanoparticle encapsulating the composition. In certain embodiments, the lipid nanoparticle comprises a cationic lipid, a neutral and / or non-cationic lipid, a sterol, or any combination thereof. In some embodiments, the non-cationic lipid comprises a phospholipid. In certain embodiments, the sterol comprises cholesterol or a modified form or ester thereof. In some embodiments, the lipid nanoparticle comprises a polyethylene glycol (PEG)-lipid conjugate. [Brief explanation of the drawings]

[0019] [Figure 1]A shows a schematic diagram of the SFTS virus M fragment precursor protein (1073 amino acids), which is processed intracellularly (at the cleavage site) to generate the coat protein Gn and coat protein Gc. B shows a schematic diagram of the head of Gn fused to ferritin protein (Gn head-FT or GnH-FT). C shows a schematic diagram of the head and stem of Gn fused to ferritin protein (Gn head-FT or GnHS-FT). D shows a schematic diagram of domains 1-3 of Gc fused to ferritin protein (Gc domain 1-3-FT or GcD-FT). E shows a schematic diagram of Gc Ecto-FT or GcE-FT. [Figure 2] An exemplary method for expression and purification of Gn / Gc-ferritin nanoparticles is shown, for example, using a plasmid vector encoding the construct shown in Figure 1. For example, HEK 293T cells in serum-free medium are transfected with such a plasmid in a Petri dish, the supernatant is subjected to tangential flow filtration and collected, the retentate is collected, and size exclusion chromatography is performed in a column to isolate Gn-ferritin or Gc-ferritin nanoparticles. [Figure 3] A shows computer-aided 3D modeling of empty ferritin (eFT) (top panel) and cryo-electron microscopy of empty ferritin (eFT) (bottom panel). B shows computer-aided 3D modeling of sGnH-FT (top panel) and cryo-electron microscopy of sGnH-FT. Comparing bottom panel A and bottom panel B, the SFTSV Gn head domain is supported on the surface of the ferritin nanoparticle and appears as a white ring. [Figure 4] For example, after transfecting cells with a plasmid vector encoding the construct shown in Figure 1, three exemplary methods (immunoprecipitation, immunoblotting, and ELISA) that can be performed using Gn or Gc antibodies to determine whether Gn or Gc is presented on the nanoparticle surface in a manner similar to that of SFTSV. [Figure 5](A) shows the immunization, blood collection, and sacrifice schedule for mice immunized with soluble GnH-FT nanoparticles. Five Balb / C (female) mice per group were immunized intramuscularly (hind leg) with eFT (empty ferritin nanoparticles) (3.3 μg) and sGnH-FT (1 μg, 5 μg, 10 μg). (B) ELISA using sGnH-10His coating to measure specific reciprocal antibody titers against sGnH. (C) ELISA using sGnH-FT coating to measure reciprocal antibody titers against sGnH-FT. (D) ELISA using eFT coating to measure reciprocal antibody titers against eFT. [Figure 6] A shows the amino acid sequence of the Gn coat protein of the SFTS virus (SEQ ID NO: 2). B shows the amino acid sequence of the Gc coat protein of the SFTS virus (SEQ ID NO: 3). These sequences, or immunogenic portions thereof, may be employed with the ferritin constructs herein. [Figure 7] A shows the amino acid sequence of the ferritin protein of Helicobacter pylori (SEQ ID NO: 4), and B shows the amino acid sequence of the ferritin protein of Escherichia coli (SEQ ID NO: 5). [Figure 8] A shows the amino acid sequence of the Rana catesbeiana (bullfrog) ferritin protein (SEQ ID NO: 6), and B shows the amino acid sequence of the H. pylori ferritin-bullfrog ferritin fusion (SEQ ID NO: 7). [Figure 9] The amino acid sequence of the Escherichia coli ferritin-bullfrog ferritin fusion (SEQ ID NO: 8) is shown. [Figure 10] A shows the nucleic acid sequence (SEQ ID NO: 1) encoding the GnH (Gn head group) protein employed in Example 1. B shows the amino acid sequence (SEQ ID NO: 9) of the GnH (Gn head group) protein. [Figure 11] A shows the nucleic acid sequence encoding the Gn head+stem (GnHS) protein (SEQ ID NO: 10), and B shows the amino acid sequence of the Gn head+stem (GnHS) protein (SEQ ID NO: 11). [Figure 12] A shows the nucleic acid sequence encoding the Gc domain 1-3 (GcD) protein (SEQ ID NO: 12), and B shows the amino acid sequence of the Gc domain 1-3 (GcD) protein (SEQ ID NO: 13). [Figure 13] A shows the nucleic acid sequence encoding the Gc Ecto (GcE) protein (SEQ ID NO: 14), and B shows the amino acid sequence of the Gc Ecto (GcE) protein (SEQ ID NO: 15). [Figure 14] A shows the nucleic acid sequence (SEQ ID NO: 16) encoding the Gn head group-FT (GnH-FT) fusion protein employed in Example 1. B shows the amino acid sequence (SEQ ID NO: 17) of the Gn head group-FT (GnH-FT) fusion protein. [Figure 15A] The nucleic acid sequence encoding the Gn head+stem-FT (GnHS-FT) fusion protein (SEQ ID NO: 18) is shown. [Figure 15B] The amino acid sequence of the Gn head+stem-FT (GnHS-FT) fusion protein (SEQ ID NO: 19) is shown. [Figure 16] A shows the nucleic acid sequence (SEQ ID NO: 20) encoding the Gc domain 1-3-FT (GcD-FT) fusion protein, and B shows the amino acid sequence (SEQ ID NO: 21) of the Gc domain 1-3-FT (GcD-FT) fusion protein. [Figure 17] A shows the nucleic acid sequence (SEQ ID NO: 22) encoding the Gc Ecto-FT (GcE-FT) fusion protein. B shows the amino acid sequence (SEQ ID NO: 23) of the Gc Ecto-FT (GcE-FT) fusion protein. [Figure 18] A shows the nucleic acid sequence of Gn domain 2 (SEQ ID NO: 24). B shows the amino acid sequence of Gn domain 2 (SEQ ID NO: 25). C shows the nucleic acid sequence of Gn domain 3 (SEQ ID NO: 26). D shows the amino acid sequence of Gn domain 3 (SEQ ID NO: 27). [Figure 19]Molecular design, biochemical, and antigenic characterization of ferritin nanoparticles (FT) and DBV Gn head-ferritin (GnH-FT) nanoparticles. (A) Schematic diagram of GnH-FT, based on the previously elucidated structures and domains of DBV Gn and Gc. This construct was transfected into HEK293T cells, and cell supernatants were collected 72 h posttransfection and purified (SP: signal peptide; TM: transmembrane domain). (B, C) Size-exclusion chromatograms using Superdex 200 for the purification of FT (B) and GnH-FT (C). Bio-Rad NGC chromatography systems equipped with an Increase 10 / 300 GL column and a Superose6 Increase 10 / 300 GL column, respectively. Fractions corresponding to the colored arrows were collected separately for further analysis. (D, E) Fractions obtained from the size-exclusion chromatograms of FT and GnH-FT were further analyzed by gradient (7%-20%) SDS-PAGE and Coomassie Brilliant Blue staining. To characterize the head-mediated degradation of the 24-mer nanoparticles, fractions corresponding to the black and red arrows from FT and GnH-FT purification were loaded onto SDS-PAGE gels without (NB) and with (B) boiling. The expected molecular weights of intact FT and GnH-FT nanoparticles are approximately 432 kDa and 1,560 kDa, respectively. The expected molecular weights of degraded FT and GnH-FT monomers are 18 kDa and 65 kDa, respectively. (F) Western blot analysis of different fractions collected from the GnH-FT size-exclusion chromatogram. A mouse monoclonal antibody recognizing the DBV Gn head region was used to detect the GnH-FT subunit monomer. [Figure 20]Predicted and observed structures of FT and GnH-FT nanoparticles. (A, B) Computer-aided 3D models of A (FT nanoparticles) and B (GnH-FT nanoparticles) based on the previously solved structures of DBV Gn (PDB: 5Y11) and FT nanoparticles (PDB: 3EGM). (C, D) Cryo-electron microscopy (cryo-EM) of C (FT) and D (GnH-FT) nanoparticles. (E, F) Representative 2D class averages of E (FT) and F (GnH-FT). (F) The white ring surrounding the FT nanoparticle core is due to the flexible linker and DBV Gn head domain. [Figure 21]Immunization with GnH-FT induces humoral and cellular immunity in vivo. (A) Timeline of mouse immunization and blood collection. Six BALB / c mice per antigen group were immunized intramuscularly in the hind leg with 3.3 μg of FT or 1 μg, 5 μg, or 10 μg of GnH-FT. 3.3 μg of FT is equimolar to 10 μg of GnH-FT. (B) Reciprocal IgG titers measured by ELISA using purified GnH-10His protein coated on a plate. Sera from blood samples collected at weeks 0, 2, 3, 5, 6, and 8 were used to quantify total IgG recognizing the DBV Gn head. Endpoint titers are expressed as log10 values. Asterisks indicate statistical significance of endpoint titers between mice immunized with GnH-FT and mice immunized with FT, assessed using one-way analysis of variance with Dunnett's multiple comparison test. (C) Neutralizing antibody titers were measured by luciferase assay using rVSV-DBV G carrying the luciferase gene. Reciprocal IC50 titers, representing the induction of neutralizing antibodies upon immunization with different antigens, were quantified using serum from blood samples collected at weeks 0, 2, 5, and 8. One-way analysis of variance with Dunnett's multiple comparison test was performed. (D) ELISpot assays were performed to detect DBV Gn head-specific T cells secreting IFN-γ by ex vivo stimulation of whole splenocytes with a pool of overlapping peptides (OLPs). Data are presented as spot-forming units (SFU) per million splenocytes. Statistical significance was assessed using one-way analysis of variance with Dunnett's multiple comparison test. (E) Intracellular cytokine staining assays were performed to examine the activity of cellular immunity induced upon antigen immunization. Spleen cells were stimulated ex vivo as in the ELISpot assay, treated with a protein transport inhibitor, and then stained for anti-TNF-α or IL-2 antibodies. An unpaired two-tailed t-test was performed to assess statistical significance: *P<0.05, **P<0.01, ***P<0.001, and ****P<0.00001. [Figure 22]Elderly ferrets develop humoral immunity when immunized with GnH-FT. (A) Timeline of immunization, lethal DBV challenge, and organ harvesting in elderly ferrets. Based on the effective induction of humoral and cellular immunity in the mouse model, elderly ferrets were immunized with 15 μg of GnH-FT or FT for a total of three doses. Each antigen group contained 12 ferrets. Two weeks after the final booster immunization, elderly ferrets were challenged with a lethal dose of DBV (107.6746 TCID50 / mL) and then observed for clinical signs of SFTS. On days 2, 4, and 6 postchallenge, three ferrets per antigen group were sacrificed, and serum, spleen, liver, and kidney were collected for organ viral titration and to examine accelerated viral clearance. (B) To characterize the humoral immunity induced by immunization with FT or GnH-FT, reciprocal IgG titers were measured by ELISA using blood samples collected on days -42, -28, -14, and 0. Optical density (OD) was measured using a spectrophotometer (VarioSkan, Thermo) at a detection wavelength of 450 nm. Asterisks indicate statistical significance of OD measurements from ferrets immunized with GnH-FT relative to ferrets immunized with FT, as assessed by one-way analysis of variance with Dunnett's multiple comparison test. (C) Neutralizing antibody responses to DBV elicited by immunization with FT or GnH-FT were characterized as FRNT50 values ​​from blood samples collected on days -28, -14, and 0, representing 2-week time points after the first, second, and third vaccinations. Asterisks indicate statistical significance of FRNT50 from ferrets immunized with GnH-FT relative to ferrets immunized with FT as assessed by one-way ANOVA with Dunnett's multiple comparison test. *P<0.05, **P<0.01, ***P<0.001, ****P<0.00001. [Figure 23](A, B, C) Protective immunity against lethal DBV infection in elderly ferrets immunized with GnH-FT nanoparticles. (A) Body weight of elderly ferrets was monitored for 14 days after lethal challenge. (B) Survival curve of elderly ferrets was monitored for 14 days after lethal challenge. (C) Body temperature of elderly ferrets was monitored for 14 days after lethal challenge. Body weight and body temperature are shown as mean ± SEM, and statistical significance was analyzed by one-way analysis of variance with Dunnett's multiple comparison test. Statistical significance of survival rates between antigens was analyzed by two-tailed Mantel-Cox method. (D, E) (D) White blood cell counts (WBC) were measured from blood samples collected 14 days after lethal challenge. (E) Platelet counts were measured from blood samples collected 14 days after lethal challenge. Data are presented as box plots with upper (75%) and lower (25%) quartiles, horizontal lines (median), and whiskers (maximum and minimum). Statistical significance between antigens was assessed by unpaired two-tailed t-test: *P<0.05, **P<0.01, ***P<0.001, ****P<0.00001. [Figure 24] Viral titers from serum, spleen, liver, and kidney. Organs were harvested on days 2, 4, and 6 from three animals per time point. (A) DBV titers from serum were measured by real-time PCR. (B) DBV titers from spleen were measured by real-time PCR. (C) DBV titers from liver were measured by real-time PCR. (D) DBV titers from kidney were measured by real-time PCR. Data are shown as mean ± SEM. Asterisks indicate statistical significance between ferrets immunized with FT nanoparticles and ferrets immunized with GnH-FT nanoparticles by unpaired two-tailed t-test. *P<0.05, **P<0.01, ***P<0.001, ****P<0.00001. [Figure 25]Expression of SFTSV Gn-H and Gn-H-FT after transfection with DNA encoding Gn-H and Gn-H-FT and in vitro transcribed mRNA. (A) Molecular design of mRNA encoding SFTSV Gn-H and Gn-H-FT. SFTSV Gn-H was codon-optimized for human codon usage and cloned into a vector containing a 5' UTR, signal peptide, and 3' UTR. N1-methyl-pseudo-UTP and a 5' cap analog were incorporated during in vitro transcription using a linearized DNA template. The mRNA construct was enzymatically polyadenylated to generate functional mRNA for inclusion in lipid nanoparticles (LNPs). SP: signal peptide. (B) RNA gel electrophoresis on a MOPS / formaldehyde gel. mRNA without polyadenylation ("C") and with polyadenylation ("+Poly A") were analyzed by RNA gel electrophoresis. The left panel shows the mRNA encoding sGn-H, and the right panel shows the mRNA encoding sGn-H-FT. The size of sGn-H is 960 base pairs, and the size of the linker and FT is 555 base pairs. "M" indicates the size marker. (C) Western blot analysis of the supernatant of HEK293T cells transfected with sGn-H and sGn-H-FT expression vectors using a mouse monoclonal antibody that recognizes SFTSV Gn-H. The control ("Control") lane represents mock transfection. The "With Boiling" panel shows an additional step of boiling at 95°C for 10 minutes to decompose Gn-H-FT nanoparticles into monomers. (D) Western blot analysis of whole cell lysates (WCLs) and supernatants from HEK293T cells transfected with polyadenylated sGn-H and sGn-H-FT mRNA using a mouse monoclonal antibody that recognizes SFTSV Gn-H. The "with boiling" and "without boiling" diagrams are illustrated in Figure 25C. The control ("Control") lane represents mock transfection. The expected molecular weights are 45 kDa for Gn-H, 65 kDa for Gn-H-FT monomer, 1,560 kDa for Gn-H-FT nanoparticles, and 124 kDa for vinculin. [Figure 26]Timeline of immunization and sample collection for BALB / c mice immunized with sGn-H and sGn-H-FT. (A) Timeline of animal immunization and blood collection with mRNA vaccine candidates. 6- to 8-week-old BALB / c mice were immunized twice with 1 μg of sGn-H or sGn-H-FT at weeks 0 and 3. Blood samples were collected at weeks 0, 2, 5, 9, 12, and 15 to characterize antibody formation at each time point and the ability to maintain neutralizing antibody titers over time. (B) Reciprocal serum endpoint titers were measured by ELISA to characterize total IgG titers recognizing SFTSV Gn-H. ELISA plates were coated with purified sGn-H-10His protein. Blood serum was serially diluted 10-fold, and endpoint titers are expressed as log10. Asterisks indicate statistical significance between animals immunized with sGn-H mRNA and animals immunized with sGn-H-FT mRNA. "Control" refers to immunization with the same volume of PBS as sGn-H and sGn-H-FT immunizations. (C) Neutralizing antibody titers measured in a mock virus neutralization assay using rVSV-SFTSV G-Luc. Titers are plotted as log10 reciprocal IC50 titers. Numbers above the histograms represent the geometric mean and fold difference in titers for mice immunized with Gn-H versus Gn-H-FT mRNA. Dotted lines represent the limit of detection. * indicates p<0.05, ** indicates p<0.01, *** indicates p<0.001, and ns indicates not significant. [Figure 27]Mice immunized with Gn-H mRNA and Gn-H-FT mRNA are completely protected from lethal SFTSV infection. (A) Timeline of immunization of 6- to 8-week-old type I interferon receptor (Ifnar1) knockout mice (A129). Mice were immunized twice with 3 μg of mRNA encoding sGn-H or sGn-H-FT, at weeks 0 and 3, before being infected with 2E4 pfu of SFTSV for lethal infection. Mice were monitored for clinical signs of weight loss and mortality for 15 days postinfection. (B) Mortality rates of immunized and challenged mice 15 days postinfection. Data are presented as survival rates over the period. (C) Weight curves of immunized and challenged mice 15 days postinfection. Data are presented as percentage weight change from the initial weight of 100% at the time of viral infection. * denotes p-value <0.05, ** denotes p-value <0.01, *** denotes p-value <0.001, and ns denotes not significant. [Figure 28] A shows the mRNA sequence (SEQ ID NO: 31) of the fusion protein used in Example 3. B shows the mRNA signal peptide used. [Figure 29] A shows an exemplary human codon-optimized sGn-head DNA sequence and is labeled SEQ ID NO: 33. B shows an exemplary human-optimized sGn-head RNA sequence and is labeled SEQ ID NO: 34. [Figure 30] A shows an exemplary human codon-optimized sGn-head-ferritin DNA sequence and is labeled SEQ ID NO: 35. B shows an exemplary human codon-optimized sGn-head-ferritin RNA sequence and is labeled SEQ ID NO: 36. [Figure 31] A shows an exemplary herpes simplex virus (HSV-1) glycoprotein B codon-optimized sGn-head DNA sequence and is labeled SEQ ID NO: 37. B shows an exemplary HSV-1 glycoprotein B codon-optimized sGn-head RNA sequence and is labeled SEQ ID NO: 38. [Figure 32] A shows an exemplary HSV-1 glycoprotein B codon-optimized sGn-head-ferritin DNA sequence and is labeled SEQ ID NO: 39. B shows an exemplary HSV-1 glycoprotein B codon-optimized sGn-head-ferritin RNA sequence and is labeled SEQ ID NO: 40. [Figure 33] This figure shows how viral glycoprotein codon optimization was applied to the design of an mRNA vaccine for severe fever with thrombocytopenia syndrome virus (SFTSV). mRNA vaccines encoding the SFTSV Gn head only (sGn-H) (SEQ ID NO: 38) or Gn head and ferritin (sGn-H-FT) (SEQ ID NO: 40) were designed so that the codon usage of the sGn-H portion was optimized to match the usage pattern of HSV-1 glycoprotein B (gB). A comparison of the codon usage between the SFTSV Gn-head and HSV-1 gB is shown in Figure 33. Codon usage was analyzed using the graphical codon usage analyzer (GCUA) software and Prism 9 software. Codon-optimized sequences were synthesized in vitro. [Figure 34] (A) When the Gn-head region was codon-optimized to HSV-1 gB, increased SFTSV Gn-head / ferritin antigen expression was observed by Western blot analysis of cell lysates following HEK293T mRNA transfection compared to human codon optimization. Specifically, this figure shows Western blot analysis of whole cell lysates from HEK293T cells transfected with sGn-H (human codon-optimized), sGn-H (HSV gB codon-optimized), sGN-H-FT (human codon-optimized), and sGn-H-FT (HSV gB codon-optimized) mRNA using a mouse monoclonal antibody that recognizes SFTSV Gn-H. (B) Expression was further enhanced after mRNA nanoparticle (LNP) transfection. Specifically, this figure shows Western blot analysis of whole cell lysates from HEK293T cells transfected with LNP using a mouse monoclonal antibody that recognizes SFTSV Gn-H. DETAILED DESCRIPTION OF THE INVENTION

[0020] Provided herein are compositions, systems, kits, and methods for immunizing a subject against severe fever with thrombocytopenia syndrome virus (SFTS virus) using a composition comprising: i) a plurality of nanoparticles self-assembled from a plurality of fusion proteins comprising a) at least a portion of a ferritin protein, and b) at least a portion of an immunogenic protein comprising at least a portion of the SFTS virus Gn and / or Gc envelope glycoprotein; or ii) a polynucleotide encoding the fusion protein (e.g., an mRNA sequence present in a lipid nanoparticle).

[0021] SFTSV encodes two envelope glycoproteins (Gn and Gc). For example, Gn has been shown to contain major neutralizing epitopes. In work conducted during the development of embodiments herein, the inventors fused the head region of Gn to self-assembling ferritin to enhance antigen presentation and purified Gn head nanoparticles for use as a vaccine (e.g., in humans).

[0022] In certain embodiments, Gn or Gc-ferritin nanoparticles are provided in a composition that further comprises an adjuvant.Any suitable adjuvant can be used.Examples of adjuvants include, but are not limited to, AddaVax, aluminum hydroxide, aluminum phosphate, and aluminum potassium sulfate.

[0023] The nanoparticle vaccine compositions herein can be introduced into a subject by any suitable route, such as intramuscularly, intradermally, subcutaneously, transdermally, or intravenously, hi certain embodiments, the nanoparticle vaccine composition is injected into a subject via intramuscular injection.

[0024] The present disclosure is not limited by the type of ferritin protein employed. In certain embodiments, the Gn or Gc protein (or an immunogenic portion thereof) is conjugated (e.g., directly or via a linker or other moiety) to at least 25, at least 50, at least 75, at least 100, or at least 150 consecutive amino acids from an amino acid sequence selected from the group consisting of SEQ ID NO:4, SEQ ID NO:5, SEQ ID NO:6, SEQ ID NO:7, and SEQ ID NO:8, wherein the fusion protein is capable of self-assembly into nanoparticles. In certain embodiments, the Gn or Gc protein (or an immunogenic portion thereof) is conjugated (e.g., directly or via a linker or other moiety) to a protein that is at least 85%, at least 90%, at least 95%, at least 97%, or at least 99% identical to an amino acid sequence selected from the group consisting of SEQ ID NO:4, SEQ ID NO:5, SEQ ID NO:6, SEQ ID NO:7, and SEQ ID NO:8. Amino acid sequences from representative ferritin proteins of the present disclosure are disclosed herein as SEQ ID NO: 4 (H. pylori ferritin), SEQ ID NO: 5 (E. coli ferritin), SEQ ID NO: 6 (bullfrog ferritin), SEQ ID NO: 7 (H. pylori ferritin-bullfrog ferritin fusion), and SEQ ID NO: 8 (E. coli ferritin-bullfrog ferritin fusion).

[0025] In certain embodiments, the sequences within the Gn / Gc fusion-ferritin fusion protein are directly joined, although in some embodiments, linkers, spacers, or other types of sequences may be used.

[0026] In certain embodiments, the proteins of the present disclosure are encoded by nucleic acid molecules and expressed by nucleic acid constructs. As used herein, a nucleic acid construct is a recombinant expression vector (i.e., a vector linked to a protein-encoding nucleic acid molecule) such that the nucleic acid molecule can result in expression of the protein when the nucleic acid construct is administered to, for example, a subject or an organ, tissue, or cell. A vector also allows for the delivery of a nucleic acid molecule to cells within an environment, such as, but not limited to, an organism, tissue, or cell culture. A nucleic acid construct can be DNA, RNA, or a variant thereof. A vector can be, for example, a DNA plasmid, a viral vector, or another vector. Examples of such vectors include, for example, cytomegalovirus (CMV), retrovirus, adenovirus, adeno-associated virus, herpesvirus, vaccinia virus, poliovirus, or any other DNA or RNA viral vector. The nucleic acid molecule herein may be operably linked to a promoter. In certain embodiments, provided herein is a cell containing the aforementioned nucleic acid molecule.

[0027] In certain embodiments, the Gn or Gc coat protein employed in the fusion protein can be full-length (see, e.g., Figure 6) or a portion thereof that is capable of eliciting an immune response in a subject. Examples of specific Gn or Gc proteins (and nucleic acid sequences encoding such proteins) are shown in Figures 6, 10-13, and 18.

[0028] In some embodiments, variants of such amino acid and nucleic acid sequences may be employed. A variant refers to a protein or nucleic acid molecule whose sequence is similar but not identical to a reference sequence, and the activity of the variant protein (or protein encoded by the variant nucleic acid molecule) is not significantly altered. Such sequence variants may be naturally occurring or may be engineered using genetic engineering techniques known to those skilled in the art. Examples of such techniques are found in Sambrook J, Fritsch EF, Maniatis T et al., Molecular Cloning—A Laboratory Manual, 2nd Edition, Cold Spring Harbor Laboratory Press, 1989, pp. 9.31-9.57, or Current Protocols in Molecular Biology, John Wiley & Sons, NY (1989), 6.3.1-6.3.6, both of which are incorporated herein by reference in their entirety. With respect to variants, any type of change in the amino acid or nucleic acid sequence is permissible, as long as the resulting variant protein retains the ability to induce neutralizing antibodies against, for example, the SFTS virus. Examples of such mutations include, but are not limited to, deletions, insertions, substitutions, and combinations thereof. For example, it is well understood by those skilled in the art that with respect to proteins, one or more (e.g., 2, 3, 4, 5, 6, 7, 8, 9, or 10) amino acids can often be removed from the amino and / or carboxy termini of a protein without significantly affecting the activity of the protein. Similarly, one or more (e.g., 2, 3, 4, 5, 6, 7, 8, 9, or 10) amino acids can often be inserted into a protein without significantly affecting the activity of the protein.

[0029] In some embodiments, a polynucleotide or mRNA herein encoding a fusion protein herein contains at least one chemical modification or chemically modified base, nucleoside, or nucleotide. The chemical modification may include any modification not naturally occurring in RNA or any naturally occurring modification of adenosine (A), guanosine (G), uridine (U), or cytidine (C) ribonucleosides. For example, a single polynucleotide or mRNA may contain both naturally occurring and non-naturally occurring modifications. The chemical modification may be located in any part of the polynucleotide or mRNA molecule, and the polynucleotide or mRNA molecule may contain any percentage of modified nucleosides (1-100%, e.g., at least 20%, at least 40%, or at least 60%). In some embodiments, all of the specified bases or nucleosides may be modified (e.g., all uridines are modified uridines). In some embodiments, at least 20%, 50%, or 80% of any single nucleotide (e.g., uracil) in a polynucleotide or mRNA is chemically modified. In some embodiments, specific modifications are used for each specific nucleoside or base type (e.g., all uridines are modified to 1-methyl-pseudouridine). Exemplary RNA modifications can be found in the RNA Modification Database (see mods.rna.albany.edu / home).

[0030] In some embodiments, the at least one chemical modification comprises a modified uridine residue. Exemplary modified uridine residues include, but are not limited to, pseudouridine, 1-methylpseudouridine, 1-ethylpseudouridine, 2-thiouridine, 4'-thiouridine, 5-methyluridine, 2-thio-l-methyl-1-deaza-pseudouridine, 2-thio-l-methyl-pseudouridine, 2-thio-5-aza-uridine, 2-thio-dihydropseudouridine, 2-thio-dihydrouridine, 2-thio-pseudouridine, 4-methoxy-2-thio-pseudouridine, 4-methoxy-pseudouridine, 4-thio-l-methyl-pseudouridine, 4-thio-pseudouridine, 5-aza-uridine, dihydropseudouridine, 5-methoxyuridine, and 2'-O-methyluridine.

[0031] In some embodiments, the at least one chemical modification comprises a modified cytosine residue. Exemplary nucleosides having modified cytosines include 5-aza-cytidine, 6-aza-cytidine, pseudoisocytidine, 3-methyl-cytidine, N4-acetyl-cytidine, 5-formyl-cytidine, N4-methyl-cytidine, 5-methyl-cytidine, 5-halo-cytidine, 5-hydroxymethyl-cytidine, 1-methyl-pseudoisocytidine, pyrrolo-cytidine, pyrrolo-pseudoisocytidine, 2-thio-cytidine, 2-thio-5-methyl-cytidine, 4-thio-pseudoisocytidine, 4-thio-1-methyl-pseudoisocytidine, 4-thio-1-methyl-1-deaza-pseudoisocytidine, 1-methyl-1-deaza-pseudoisocytidine, zebularine, These include 5-aza-zebularine, 5-methyl-zebularine, 5-aza-2-thio-zebularine, 2-thio-zebularine, 2-methoxy-cytidine, 2-methoxy-5-methyl-cytidine, 4-methoxy-pseudoisocytidine, 4-methoxy-1-methyl-pseudoisocytidine, lysidine, α-thio-cytidine, 2′-O-methyl-cytidine, 5,2′-O-dimethyl-cytidine, N4-acetyl-2′-O-methyl-cytidine, N4,2′-O-dimethyl-cytidine, 5-formyl-2′-O-methyl-cytidine, N4,N4,2′-O-trimethyl-cytidine, 1-thio-cytidine, 2′-F-aracytidine, 2′-F-cytidine, and 2′-OH-aracytidine.

[0032] In some embodiments, the at least one chemical modification comprises a modified adenine residue. Exemplary nucleosides having a modified adenine include 2-amino-purine, 2,6-diaminopurine, 2-amino-6-halo-purine, 6-halo-purine, 2-amino-6-methyl-purine, 8-azidoadenosine, 7-deaza-adenine, 7-deaza-8-aza-adenine, 7-deaza-2-amino-purine, 7-deaza-8-aza-2-amino-purine, 7-deaza-2,6-diaminopurine, 7-deaza-8-aza-2,6-diaminopurine, 1-Methyl-adenosine, 2-methyl-adenine, N6-methyl-adenosine, 2-methylthio-N6-methyl-adenosine, N6-isopentenyl-adenosine, 2-methylthio-N6-isopentenyl-adenosine, N6-(cis-hydroxyisopentenyl)adenosine, 2-methylthio-N6-(cis-hydroxyisopentenyl)adenosine, N6-glycinylcarbamoyl-adenosine, N6-threonylcarbamoyl-adenosine, N6 -Methyl-N6-threonylcarbamoyl-adenosine, 2-methylthio-N6-threonylcarbamoyl-adenosine, N6,N6-dimethyl-adenosine, N6-hydroxynorylcarbamoyl-adenosine, 2-methylthio-N6-hydroxynorylcarbamoyl-adenosine, N6-acetyl-adenosine, 7-methyl-adenine, 2-methylthio-adenine, 2-methoxy-adenine, α-thio-adenosine, 2'-O-methyl-adenine adenosine, N6,2'-O-dimethyl-adenosine, N6,N6,2'-O-trimethyl-adenosine, 1,2'-O-dimethyl-adenosine, 2'-O-ribosyladenosine (phosphate), 2-amino-N6-methyl-purine, 1-thio-adenosine, 8-azido-adenosine, 2'-F-ara-adenosine, 2'-F-adenosine, 2'-OH-ara-adenosine, and N6-(19-amino-pentaoxanonadecyl)-adenosine.

[0033] In some embodiments, the at least one chemical modification comprises a modified guanine residue. Exemplary nucleosides having modified guanine include inosine, 1-methyl-inosine, wyosine, methylwyosine, 4-demethylwyosine, isowyosine, wybutosine, peroxywybutosine, hydroxywybutosine, undermodified hydroxywybutosine, 7-deaza-guanosine, queosine, epoxyqueosine, galactosyl-queosine, mannosyl-queosine, 7-cyano-7-deaza-guanosine, 7-aminomethyl-7-deaza-guanosine, archeosine, 7-deaza-8-aza-guanosine, 6-thio-guanosine, 6-thio-7-deaza-guanosine, 6-thio-7-deaza-8-aza-guanosine, 7-methyl-guanosine, 6-thio-7-methyl-guanosine, 7-methyl-inosine, 6-methoxy-guanosine, 1-methyl-guanosine, 1-methyl-7 ... Thio-guanosine, N2-methyl-guanosine, N2,N2-dimethyl-guanosine, N2,7-dimethyl-guanosine, N2,N2,7-dimethyl-guanosine, 8-oxo-guanosine, 7-methyl-8-oxo-guanosine, 1-methyl-6-thio-guanosine, N2-methyl-6-thio-guanosine, N2,N2-dimethyl-6-thio-guanosine, α-thio-guanosine 2'-O-methyl-guanosine, 2'-O-methyl-guanosine, N2-methyl-2'-O-methyl-guanosine, N2,N2-dimethyl-2'-O-methyl-guanosine, 1-methyl-2'-O-methyl-guanosine, N2,7-dimethyl-2'-O-methyl-guanosine, 2'-O-methyl-inosine, 1,2'-O-dimethyl-inosine, and 2'-O-ribosylguanosine (phosphate).

[0034] In certain embodiments, the nucleic acid sequence encoding the fusion protein described herein is present in lipid nanoparticles (e.g., for intravenous delivery to humans). Lipid nanoparticle compositions may comprise one or more cationic and / or ionizable lipids, phospholipids, neutral or non-cationic lipids, polyethylene glycol (PEG)-lipid conjugates, and / or sterols. In some embodiments, lipid nanoparticles comprise cationic and / or ionizable lipids, neutral or non-cationic lipids, and cholesterol. Examples of cationic and / or ionizable lipids include amine-containing lipids, which can be readily protonated and may have a positive or partial positive charge at physiological pH due to their pKa values ​​between pH 5 and 8. The polar head groups of the cationic lipids preferably include amine derivatives such as primary, secondary, and / or tertiary amines, quaternary ammonium, various combinations of amines, amidinium salts, or guanidine and / or imidazole groups, as well as pyridinium, piperazine, and amino acid head groups such as lysine, arginine, ornithine, and / or tryptophan. Cationic lipids include, but are not limited to, 1,2-dimyristoyl-sn-glycero-3-ethylphosphocholine (DMEPC), 1,2-di-O-octadecenyl-3-trimethylammonium propane (DOTMA), and / or 1,2-dioleoyl-3-trimethylammonium propane (DOTAP), 1,2-dimyristoyl-3-trimethylammonium propane (DMTAP), 2,3-di(tetradecoxy)propyl-(2-hydroxyethyl)-dimethylazanium bromide (DMRIE), didodecyl(dimethyl)ammonium bromide (DDAB), 1,2-dioleyloxypropyl-3-dimethyl-hydroxyethylammonium bromide (DORIE), 3β-[N-(N\N'-dimethylamino-ethane)carbamoyl]cholesterol (DC-Chol), or dioleyl ether phosphatidylcholine (DOEPC). Ionizable lipids include, but are not limited to, 1,2-dioleyloxy-3-dimethylamino-propane (DODMA).

[0035] In some embodiments, the lipid nanoparticles comprise polyethylene glycol (PEG)-lipid conjugates, which may include, but are not limited to, PEG-modified phosphatidylethanolamine, PEG-modified phosphatidic acid, PEG-modified ceramide, PEG-modified dialkylamine, PEG-modified diacylglycerol, PEG-modified dialkylglycerol, and mixtures thereof. For example, the PEG lipid can be PEG-DMG (1,2-dimyristoyl-rac-glycero-3-methoxypolyethylene glycol), PEG-c-DOMG (R-3-[(ω-methoxypoly(ethylene glycol)2000)carbamoyl)]-1,2-dimyristyloxypropyl-3-amine), PEG-DMA (PEG-dimethacrylate), PEG-DLPE (1,2-didodecanoyl-sn-glycero-3-phosphoethanolamine-PEG), PEG-DMPE (PEG-1,2-dimyristoyl-sn-glycero-3-phosphoethanolamine), PEG-DPPC (PEG-dipalmitoylphosphatidylcholine), PEG-N,N-di(tetradecyl)acetamide, or PEG-DSPE (1,2-distearoyl-sn-glycero-3-phosphoethanolamine-poly(ethylene glycol)) lipid. In some embodiments, the lipid nanoparticles comprise PEG-DMG and / or PEG-N,N-di(tetradecyl)acetamide.

[0036] The sterol may include cholesterol, fecosterol, ergosterol, campesterol, sitosterol, stigmasterol, brassicasterol, or sterol esters, such as cholesteryl hemisuccinate, cholesteryl sulfate, or any other derivative of cholesterol. The neutral or non-cationic lipid may include one or more phospholipids. The phospholipid comprises a phospholipid moiety and one or more fatty acid moieties. The phospholipid moiety may include, but is not limited to, phosphatidylcholine, phosphatidylethanolamine, phosphatidylglycerol, phosphatidylserine, phosphatidic acid, 2-lysophosphatidylcholine, and sphingomyelin. The fatty acid moieties may include, but are not limited to, lauric acid, myristic acid, myristoleic acid, palmitic acid, palmitoleic acid, stearic acid, oleic acid, linoleic acid, alpha-linolenic acid, erucic acid, phytanic acid, arachidic acid, arachidonic acid, eicosapentaenoic acid, behenic acid, docosapentaenoic acid, and docosahexaenoic acid.

[0037] Suitable phospholipids for use in the compositions include phosphatidylglycerols (PG), including dimyristoylphosphatidylglycerol (DMPG) and 1,2-dioleoyl-sn-glycero-3-phospho-rac-(1-glycerol) sodium salt (DOPG), egg yolk phosphatidylcholine, dimyristoylphosphatidylcholine (DMPC), 1,2-distearoyl-sn-glycero-3-phosphocholine (DSPC), 1,2-dilinoleoyl-sn-glycero-3-phosphocholine (DLPC), 1,2-dioleoyl- sn-glycero-3-phosphocholine (DOPC), 1,2-dipalmitoyl-sn-glycero-3-phosphocholine (DPPC), 1,2-diundecanoyl-sn-glycero-3-phosphocholine (DUPC), 1-palmitoyl-2-oleoyl-sn-glycero-3-phosphocholine (POPC), 1,2-di-O-octadecenyl-sn-glycero-3-phosphocholine (18:0 diether PC), 1-oleyl-2-cholesterylhemisuccinoyl-sn-glycero-3-phosphocholine (OChemsPC), 1-hexadec ... Phosphatidylcholines (PCs) including 1,2-dilinolenoyl-sn-glycero-3-phosphocholine (C16 lysoPC), 1,2-didocosahexaenoyl-sn-glycero-3-phosphocholine, 1,2-diarachidonoyl-sn-glycero-3-phosphocholine, 1,2-dioleoyl-sn-glycero-3-phosphoethanolamine (DOPE), 1,2-diphytanoyl-sn-glycero-3-phosphoethanolamine (ME16.0PE), and 1,2-distearoyl-sn-glycero-3-phosphoethanolamine (ME16.0PE) were used. Examples of suitable phospholipids include, but are not limited to, phosphatidylethanolamines (PEs) including 1,2-dilinoleoyl-sn-glycero-3-phosphoethanolamine, 1,2-dilinolenoyl-sn-glycero-3-phosphoethanolamine, 1,2-diarachidonoyl-sn-glycero-3-phosphoethanolamine, 1,2-didocosahexaenoyl-sn-glycero-3-phosphoethanolamine, phosphatidic acid (PA), phosphatidylinositol (PI), phosphatidylserine (PS), and sphingomyelin (SM).

[0038] The positively charged lipid structures described herein may also contain other components commonly used in vesicle formation (e.g., for stabilization), including, but not limited to, fatty alcohols, fatty acids, and / or any other pharmaceutically acceptable excipients that may affect surface charge, membrane fluidity, and aid in the incorporation of lipids into lipid assemblies. [Example]

[0039] Example 1 Preparation of SFTSV Gn-ferritin protein nanoparticles This example describes the procedures used to prepare Gn-ferritin protein nanoparticles that can be used for immunization (e.g., with an adjuvant). Materials and methods for purifying SFTSV Gn-ferritin protein nanoparticles were generally as described in Kim et al. (March / April 2021 Volume 12 Issue 2 e00230-21, which is incorporated herein by reference in its entirety, particularly for methods for preparing ferritin nanoparticles with antigens and methods for immunizing test animals).

[0040] Construction of expression vectors A gene encoding a recombinant ferritin engineered from residues 2-9 of Helicobacter pylori non-heme ferritin and the bullfrog (Rana catesbeiana) ferritin lower subunit was employed (SEQ ID NO: 7) (see Kanekiyo, M. et al. Cell, 162, and U.S. Patent No. 10,744,199 to Kanekiyo et al., both of which are incorporated herein by reference). The gene encoding SFTSV Gn (Hubei strain) was codon-optimized for human codon usage, synthesized by Genscript (New Jersey, United States), and shown in Figure 10 (SEQ ID NO: 1). This gene was used to generate a fragment encoding SFTSV Gn-SSGGASVLA linker-recombinant ferritin (shown in Figure 14A, SEQ ID NO: 16). For the expression plasmid, the commercially available pFUSE vector (Invivogen, California, United States) was engineered to replace the human ferritin light chain gene promoter with the Simian Virus 40 (SV40) promoter. Genes encoding recombinant ferritin and the SFTSV Gn-linker-ferritin fragment were cloned into the plasmid vector. The leader sequence used for expression was ATGGAAATCAAGGTGCTGTTTGCCCTCATCTGTATTGCTGTTGCTGAGGCA (SEQ ID NO: 28).

[0041] Nanoparticle expression and purification HEK293T cells were purchased from the American Type Culture Collection (ATCC, Virginia, United States) and maintained in Dulbecco's modified Eagle's medium (DMEM) supplemented with 10% fetal bovine serum (FBS; Gibco, Massachusetts, United States) and 1% penicillin / streptomycin (Gibco). Cells were transiently transfected with the respective vector plasmids in FreeStyle 293 medium (Gibco) supplemented with polyethyleneimine (Polysciences, Pennsylvania, United States) and Opti-MEM and 3 mM valproic acid. The supernatant containing the nanoparticles was collected 72 hours after transfection and initially purified by anion exchange chromatography using a Resource Q column (Cytiva Lifesciences, Massachusetts, United States) mounted on an NGC fast protein liquid chromatography system (Bio-Rad). The running buffer was phosphate-buffered saline (PBS) with an increasing gradient of NaCl from 0 to 1M. Fractions eluted at 300 mM NaCl were pooled and further purified by size-exclusion chromatography using Superdex 200 10 / 300 GL and Superose 6 PG (Cytiva) on an NGC column with PBS as the running buffer. The fraction with a column volume (CV) of 0.45 from size-exclusion chromatography using Superdex 200 10 / 300 GL was further analyzed for the purity of eFT (empty ferritin nanoparticles), and the fraction with a CV of 0.5 from size-exclusion chromatography using Superose 6 PG was further analyzed for the purity of sGnH-FT. Purity analysis was performed by Coomassie blue staining and Western blot analysis using a homemade monoclonal mouse antibody that recognizes SFTSV Gn.

[0042] Successful generation of antibodies in mice All animals were purchased from Jackson Laboratory (Maine, United States) and housed at the Lerner Research Institute Biological Resource Unit (BRU) in accordance with approved animal experimental protocols. Six- to eight-week-old female Balb / C mice were immunized intramuscularly in the hind leg with 1 μg, 5 μg, or 10 μg of sGnH-FT or 3.3 μg of eFT (equivalent to 10 μg of sGnH-FT). Immunizations occurred at weeks 0, 3, and 6 (see Figure 5A). All immunizations included AddaVax adjuvant (Invivogen) and were supplemented with PBS to a final volume of 50 μl per immunization. Immunized animals were bled at weeks 0, 2, 3, 5, 6, and 8, and antibody development was examined by retroorbital bleeds.

[0043] Figure 5B shows the endpoint titration results for the SFTSV GnH-10His antigen coated on an ELISA plate. Antibody titers were measured directly against the major viral antigen, SFTSV GnH, and the results show no significant differences in the antibody titers generated from immunization doses of 1 μg, 5 μg, or 10 μg. In contrast, animals immunized with eFT did not develop significant antibody titers against SFTSV GnH, with minimal induction observed only at the final bleed.

[0044] Specific antibody titers against sGnH-FT and eFT are shown in Figures 5C and 5D. For the endpoint titration in Figure 5C, the vaccine candidate sGnH-FT was used as the antigen to coat the ELISA plate. Therefore, the titers shown in Figure 5C represent antibodies that recognize both sGnH and ferritin nanoparticles. For the endpoint titration in Figure 5D, eFT was used as the antigen to coat the ELISA plate. Therefore, the titers shown in Figure 5D represent antibodies that recognize only the carrier portion of the vaccine.

[0045] Example 2 SFTSV Gn-ferritin protein nanoparticles protect against SFTSV challenge This example describes a protocol for testing a protein subunit vaccine using 24-mer self-assembling ferritin (FT) nanoparticles displaying the SFTSV Gn head region (GnH) for enhanced immunogenicity. GnH-FT nanoparticles were easily purified to homogeneity by anion exchange and size exclusion chromatography while retaining their structural integrity. Mice immunized with GnH-FT nanoparticles induced robust NAb responses and T cell immunity against DBV Gn. Furthermore, elderly ferrets immunized with GnH-FT nanoparticles were completely protected from DBV challenge without experiencing SFTS symptoms such as weight loss, thrombocytopenia, leukopenia, or lethality. This example demonstrates that DBV GnH-FT nanoparticles are an efficient vaccine that can be administered to patients with lethal SFTSV (also known as DBV) infection.

[0046] result Molecular design, purification, and characterization of DBV GnH-ferritin nanoparticles The majority of DBV-neutralizing antibodies in human convalescent sera target the Gn head, which mediates viral attachment to host cells (13, 14). Furthermore, our recent studies on DBV DNA vaccines revealed that the viral glycoprotein is the most immunogenic antigen among viral proteins. The DBV Gn head (GnH) gene was first codon-optimized and fused to the N-terminus of the IL-2 signal peptide and the C-terminus of the H. pylori-bullfrog hybrid ferritin to generate GnH-ferritin (GnH-FT) (Figure 19A). HEK293T cells were transfected with the GnH-FT expression plasmid or the hybrid ferritin (FT) carrying the signal peptide, and the cell supernatant was collected. GnH-FT and FT nanoparticles were purified by anion exchange and size exclusion chromatography. The purified FT nanoparticles (Figure 19B) and GnH-FT nanoparticles (Figure 19C) were homogeneous, as demonstrated by size-exclusion chromatography using specific columns with maximum separation resolution of several hundred kilodaltons and several megadaltons, respectively. Furthermore, the chromatograms of GnH-FT nanoparticles and FT nanoparticles showed peaks at fractions corresponding to the expected molecular weight of 24-mer nanoparticles. Furthermore, we tested whether the purified FT and GnH-FT nanoparticles retained their 24-mer nanoparticle structure by loading purified fractions without boiling ("NB" indicates no boiling) or with boiling ("B" indicates boiling). The purified nanoparticles retained their higher-order structure without boiling, but disintegrated into subunit monomers upon boiling (Figures 19D and 19E). Consequently, a band appeared at the expected molecular weight of the monomer calculated based on the previously elucidated GnH structure (15). Immunoblot analysis of different fractions (indicated by colored arrows) from size-exclusion chromatography with anti-DBV Gn antibody also confirmed the presence of GnH-ferritin with an intensity consistent with the peak height in the size-exclusion chromatogram (Figure 19F). These results indicate that the purified GnH-FT nanoparticles retain their self-assembled higher-order structure.

[0047] Purified GnH-FT nanoparticles maintain their high-order structure and display GnH on their surface. Based on previous reports using ferritin nanoparticles as a carrier platform, computer-aided modeling predicted that the GnH antigen would protrude radially from the triple junction of the nanoparticles (Figures 20A and 20B). Negative-stain transmission electron microscopy (EM) and cryo-EM of FT nanoparticles revealed homogeneous, smooth FT nanoparticles with an average diameter of 9.5 nm (Figure 20C). On the other hand, EM of GnH-FT nanoparticles revealed distinct protrusions protruding from the ferritin core, with an average diameter of 14.7 nm (Figure 20D). These protrusions appeared as an extra layer of a white, mottled ring surrounding the ferritin core in the cryo-EM2D class average of GnH-FT nanoparticles (Figure 20F) compared with that of FT nanoparticles (Figure 20E). These data indicated that GnH is flexible on the surface of ferritin particles and its presence does not affect ferritin particle assembly.

[0048] Immunization with GnH-FT nanoparticles induces humoral and cellular immunity in vivo To enhance the relatively weak immunogenicity of protein subunit vaccines, various adjuvants have been administered in combination with protein vaccine candidates. One of the safest adjuvants is MF59, an oil-water emulsion adjuvant used in adjuvanted influenza vaccines (29-32). We combined AddaVax, the veterinary equivalent of MF59, with FT or GnH-FT nanoparticles for immunization. Eight- to 10-week-old BALB / c mice (n = 6 per antigen) were immunized intramuscularly with 3.3 μg of FT nanoparticles (200 equimolar to 10 μg of GnH-FT nanoparticles), 1 μg, 5 μg, or 10 μg of GnH-FT nanoparticles, three times at 3-week intervals. Blood samples were collected before immunization (week 0) and weekly starting 2 weeks after the first immunization. The total amount of IgG antibody against GnH soluble protein reached a maximum 2 weeks after the second immunization (first booster) among all three administrations of GnH-FT nanoparticles, and did not increase further after the third immunization (second booster) (Figure 21B). Interestingly, there was no statistically significant difference in the induction of total anti-GnH IgG across different doses of GnH-FT nanoparticles, indicating that a dose of 1 μg of GnH-FT was sufficient to induce a strong antibody response.

[0049] We performed neutralization assays using a replication-deficient recombinant vesicular stomatitis virus (rVSV) carrying DBV glycoproteins Gn and Gc and a luciferase reporter gene (rVSV-DBV G). Unlike the total anti-GnH antibody response, which reached a maximum level after the second immunization, neutralizing antibody (NAb) titers continuously increased over three immunizations with GnH-FT nanoparticles (Figure 21C). Immunization with 1 μg of GnH-FT nanoparticles induced the most robust neutralizing antibody response against DBV, followed by 5 μg and 10 μg. Consistent with the case of total IgG, immunization with FT nanoparticles alone did not significantly induce NAb against DBV (Figure 21C). These data suggest that, in some embodiments, 1 μg of GnH-FT may be the optimal dose of a three-dose regimen for eliciting a strong NAb response against DBV infection.

[0050] Although NAb titers are an important indicator of vaccine efficacy, many studies have demonstrated the importance of cellular immunity in antiviral immunity (33, 34). To perform IFN-γ ELISpot, spleens were harvested from immunized mice at week 8 (2 weeks after the third immunization) and stimulated in vitro with a pool of overlapping peptides spanning GnH (OLPs). Subsequently, IFN-γ ELISpot was performed. Results showed that IFN-γ secretion was induced by all doses of GnH-FT nanoparticles, whereas immunization with 1 μg of GnH-FT nanoparticles induced the strongest IFN-γ secretion (Figure 21D). Furthermore, immunization with GnH-FT nanoparticles successfully induced TNF-α and IL-2 production from CD4+ T cells stimulated with OLPs, whereas immunization with FT nanoparticles failed to induce these cytokines (Figure 21E).

[0051] Finally, no significant production of TNF-α or IL-2 was observed from CD8+ T cells stimulated with OLP (data not shown). These results indicate that the maximal induction of NAb, IFN-γ, TNF-α, and IL-2 was observed from immunization with a 1 μg dose of GnH-FT nanoparticles. These data are consistent with previous reports of robust activation of protective immunity by low-dose immunization with nanoparticle vaccines (25-27) and adenovirus vector vaccines (35). Collectively, these results demonstrate that immunization with DBV GnH-FT nanoparticles effectively induces both NAb production and T cell responses in mice.

[0052] Aged ferrets immunized with GnH-FT nanoparticles develop antibody responses against DBV Naive, 4-year-old ferrets (n = 12 per antigen) were immunized three times, two weeks apart, by intramuscular injection with FT or GnH-FT nanoparticles containing AddaVax adjuvant. Blood samples were collected from the immunized ferrets on the day of immunization to characterize antibody responses (Figure 22A). Total anti-GnH IgG titers increased dramatically after the first or second vaccination, and further increased after the third vaccination, suggesting that a three-dose vaccination protocol maximizes antibody responses in older ferrets. No significant increase in IgG levels was observed with booster immunizations, possibly due to saturation of the assay (Figure 22B). Consistently, serum NAb titers against the DBV CB1 / 2014 strain sustained increases after the primary vaccination and subsequent booster vaccinations (Figure 22C). In contrast, neither anti-GnH nor anti-DBV NAbs were detected in control ferrets immunized with FT nanoparticles. These data demonstrate that GnH-FT nanoparticles effectively induce antibody responses against DBV in an aged ferret model.

[0053] Immunization with GnH-FT nanoparticles provides complete protection against lethal DBV challenge in aged ferrets To evaluate the protective effect of the GnH-FT vaccine, elderly ferrets vaccinated with either FT or GnH-FT were challenged intramuscularly with a lethal dose of DBV CB1 / 2014 strain (107.6 252 TCID50) 2 weeks after the third vaccination. Clinical signs of infection, blood virus titers and platelet counts, body weight, body temperature, and survival rates were monitored every other day for the following 14 days. Blood samples were collected every other day to measure platelet and white blood cell counts to monitor thrombocytopenia and leukopenia (Figure 22A). Remarkably, all ferrets immunized with GnH-FT nanoparticles were completely protected from lethal DBV challenge, whereas ferrets immunized with FT nanoparticles exhibited significant weight loss, losing up to 20%, and died (Figures 23A and 23B). Elderly ferrets immunized with GnH-FT nanoparticles showed minimal increases in body temperature, while ferrets immunized with FT nanoparticles developed severe fever (Figure 23C). Platelet and white blood cell counts were also measured from blood samples to examine the characteristic symptoms of thrombocytopenia and leukopenia. Consistent with body weight, body temperature, and survival rate, elderly ferrets immunized with GnH-FT nanoparticles showed little or no significant decrease in platelet and white blood cell counts (Figure 23D). In contrast, elderly ferrets immunized with FT nanoparticles showed a dramatic decrease in platelet and white blood cell counts prior to the fatal outcome (Figure 23E).

[0054] To assess viral load in multiple organs after lethal DBV challenge, three ferrets were sacrificed on days 2, 4, and 6 postinfection, and serum, spleen, liver, and kidney were collected. Viral titers were measured as RNA copy numbers using real-time PCR. Elderly ferrets immunized with GnH-FT nanoparticles exhibited significant viremia in the liver and kidney after lethal DBV challenge and succumbed to the virus challenge (Figures 6C and 6D). However, elderly ferrets immunized with GnH-FT nanoparticles rapidly cleared the challenge virus, with viral titers rapidly dropping to or below the detection limit (Figures 24C and 24D). These data indicate that immunization with GnH-FT nanoparticles completely prevents the pathogenesis of SFTS after lethal DBV challenge and promotes viral clearance in elderly ferrets.

[0055] DBV (formerly SFTSV) is an emerging pathogen that causes fatal SFTS in infected patients. Since its initial discovery in China, epidemic infections have become established in Korea, Japan, and China and have spread to Southeast Asian countries (3, 4, 8). A clear age-dependent pathogenesis of human DBV infection is evident, with the majority of hospitalized cases and fatal infections occurring in people over the age of 50 (7). The vector tick, Haemaphysalis longicornis, previously had a relatively restricted range in East Asia. However, its parthenogenesis has enabled its recent rapid spread to other continents, including Australia and North America (36, 37). This, coupled with tick spread, has raised concerns about the spread of DBV beyond East Asia (1, 7, 37, 38). In this study, we demonstrate the immunogenicity of self-assembling GnH-FT nanoparticles as an effective DBV vaccine. Mice immunized with the FT nanoparticle vaccine induced strong antibody responses and cellular immunity. Immunized elderly ferrets were completely protected from lethal DBV infection. Our results strongly suggest that DBV GnH-FT nanoparticles are a promising vaccine that confers immunity that protects against DBV infection and subsequent SFTS pathology.

[0056] Among DBV viral proteins, the Gn and Gc glycoproteins are first translated as precursor glycoproteins from the M fragment of the viral genome and then processed into separate proteins by host proteases (11). Among DBV viral proteins, Gn and Gc glycoproteins were first identified through structural analysis of the closely related bunyaviruses Heartland banda virus (HRTV) and Rift Valley fever virus (RVFV), revealing that Gn and Gc form heterodimers and form higher-order structures on the viral surface (39, 40). Gn and Gc contribute to viral infection by attaching Gn to the host cell membrane and mediating membrane fusion for endocytosis (12, 41). Our previous studies showed that the strongest immunogenicity was observed upon immunization of mice and aged ferrets with M fragment DNA containing Gn / Gc (16).

[0057] Previous studies have shown that nanoparticle vaccines, compared with conventional protein vaccines, exhibit higher immunogenicity at lower doses while maintaining the advantage of lower reactogenicity (26, 27). To develop a vaccine that is safe yet sufficiently immunogenic for the immunocompromised elderly population, we formulated GnH-FT nanoparticles using adjuvants with established safety profiles in elderly populations. Purified GnH-FT nanoparticles demonstrated the integrity of DBV GnH displayed on the carrier nanoparticles. Mice and elderly ferrets immunized with GnH-FT nanoparticles induced robust DBV-recognizing IgG and NAb.

[0058] While NAb titers increased with booster immunizations, the highest NAb titers were observed with 1 μg of GnH-FT nanoparticles. Mice immunized with 1 μg of GnH-FT nanoparticles also demonstrated the strongest T cell responses. This is consistent with previous findings that immunization with low doses of ferritin-fused nanoparticles confers protective immunity against influenza virus (0.22 μg) (27), Epstein-Barr virus (0.5 μg) (26), and SARS-CoV-2 vaccine (15 μg) (25). Similar results were recently reported in a large-scale clinical trial investigating the immunogenicity of an adenovirus vector (Ad26.COV2.S)-based vaccine against SARS-CoV-2. Immunization with a low dose (5E10) of Ad26.COV2.S particles induced stronger immunity with milder side effects than a high dose (1E11) of Ad26.COV2.S particles (35). These studies further support the strong immunogenicity of low-dose ferritin nanoparticles as a vaccine carrier. Our in vivo mouse studies demonstrated that immunization with 1 μg of GnH-FT induced the most robust NAbs and T cell responses. Because the dose is closely related to vaccine-related side effects, further studies are needed to optimize GnH-FT immunization protocols that enhance vaccine-mediated immunity while minimizing reactogenicity.

[0059] To date, six DBV genotypes (A–F) have been reported in Korea, Japan, and China (7). The number of these genotypes varies in DBV endemic areas, resulting in different lethality rates. GnH is encoded in the M segment of the DBV genome and exhibits less than 10% viral nucleotide variation (42, 43) and 6% amino acid variation (44), although the number varies depending on the genotype. Other studies have reported broad cross-reactivity between the HB29 strain of DBV (used in this study) and autologous and heterologous DBV genotypes (16, 45). Our previously developed DBV vaccine also demonstrated cross-protection with live HB29 vaccines (16, 46). This suggests that HB29 may be an optimal standard strain for DBV vaccine development. As a "plug-and-play" platform, the GnH on the FT nanoparticles can be swapped with GnH of other genotypes to further expand protective immunity and achieve broader protection.

[0060] Materials and Methods Nanoparticle expression and purification The expression vector for nanoparticle purification was prepared as described in our previous paper (25). The Dabi-Banda virus (DBV) glycoprotein Gn gene (GenBank NC_018138.1) was optimized for human codon usage (Genscript) and cloned into the expression vector. At 70% confluency, HEK293T cells (ATCC) were transfected with FreeStyle 293 medium (Gibco) and the medium was changed to 100 kDa or 500 kDa MWCO filters in a Labscale TFF (Sigma). The concentrated supernatant was loaded onto an anion Resource Q column (Cytiva) and subjected to anion exchange chromatography at 3.0 ml / min in 20 mM Tris-Cl, pH 8.0, with a gradient of 0 to 1 M NaCl on an NGC FPLC (Bio-Rad). Fractions with NaCl concentrations between 200 mM and 500 mM were collected and further purified by size-exclusion chromatography. The chromatography was performed using an NGC FPLC equipped with a Superdex 200 Increase 10 / 300 GL column (for FT nanoparticles) and a Superose 6 Increase 10 / 300 GL column (for GnH-FT nanoparticles) (Cytiva) at 0.1 ml / min with PBS. The collected fractions were loaded onto SDS-PAGE with or without boiling for 10 min at 95°C and analyzed by staining with Coomassie Brilliant Blue. Western blots of the fractions were performed using an in-house mouse monoclonal antibody against DBV Gn.

[0061] To purify DBV GnH-10His protein, HEK293T cells were transfected with a mammalian expression vector under the same conditions as for nanoparticle purification. The supernatant was loaded onto a HisTrap HP column (Cytiva) using an NGC at a flow rate of 5 ml / min and eluted with an increasing imidazole gradient from 0 to 500 mM in 150 mM NaCl and 20 mM Tris-Cl, pH 8.0. Fractions were examined for yield and purity by SDS-PAGE and stored in 10% glycerol at -80°C.

[0062] Computer-aided 3D modeling of FT and GnH-FT nanoparticles The virtual structures of the FT nanoparticles and GnH-FT nanoparticles were designed using Chimera (University of California, San Francisco), PyMol (Schroedinger), and Meshmixer (Autodesk) based on the previously solved DBV Gn (PDB: 5Y11) and H. pylori-bullfrog hybrid ferritin (PDB: 3EGM). The models were modified to take into account the size ratio of the FT nanoparticles and GnH-FT nanoparticles.

[0063] Transmission electron microscopy and cryo-EM analysis of FT and GnH-FT nanoparticles For negative-stain transmission electron microscopy (EM), carbon-coated grids were hydrophilized by glow discharge and then a drop of purified nanoparticles was applied to DPBS. After 1 min of absorption, excess sample was wiped off, and the grids were stained with 1% (w / v) uranyl acetate. After drying, the grids were imaged at 200 kV on a Talos F200X G2 microscope. To prepare cryo-EM grids, a 3.5 μL aliquot of purified nanoparticles at approximately 1 mg / mL concentration was applied to a glow-discharge-pretreated 300-mesh Quantifoil R1.2 / 1.3 Cu grid, blotted (blot force -5, time 3 s) using a Vitrobot Mark IV instrument, and quenched by immersion in liquid ethane. The grids were then mounted on a Titan Krios microscope equipped with a Gatan BioQuantum K3 contrast filter and camera. A 20 eV slit was used for the filter. Data collection was performed using serial EM (47). Images were recorded at 81,000x magnification, corresponding to a pixel size of 1.06 Å / pixel. The blur range was -1.0 μm to -1.8 μm. Each exposure had a total dose of 50 e / Ų, divided into 50 frames. The first two frames of the movie stack were not included in the motion correction. Cryo-EM data processing was performed on the fly using cryoSPARC Live (48) following the usual single-particle procedure.

[0064] Viral propagation and dose setting DBV was propagated and titrated using our previously published method (16, 17). Briefly, Vero E6 (ATCC, CRL-1586) cells were cultured in Dulbecco's modified Eagle's medium (DMEM) supplemented with 10% FBS at 37°C and 5% CO2. Cells were infected with DBV CB1 / 2014 strain at confluency, and the supernatant was collected 7 days later. The supernatant was centrifuged to remove cellular debris and stored at -80°C until use. Virus titers (TCID50) were measured by immunofluorescence assay (IFA) using a homemade mouse monoclonal antibody recognizing DBV nucleoprotein (Np).

[0065] Animal care Six- to eight-week-old BALB / c mice (Jackson Laboratories, Maine) were housed in the Biological Resource Unit facility at the Lerner Research Institute, Cleveland Clinic, and maintained on a 12-hour light / dark cycle with water and food provided. Forty-eight- to 50-month-old ferrets (ID Bio, Cheongju, South Korea) were housed at the Laboratory Animal Research Center, Chungbuk National University (LARC), Cheongju, South Korea, and maintained on a 12-hour light / dark cycle with water and food provided. All mice and ferrets were maintained in accordance with the institutional animal care guidelines and experimental protocols approved by the Institutional Biosafety Committee (IBC) and Institutional Animal Care and Use Committee (IACUC) of Cleveland Clinic and Chungbuk National University, respectively. After virus challenge, animals were monitored more frequently by the authors or the on-call veterinarian. The virus was handled in a modified biosafety level 3 containment laboratory approved by the Korean Centers for Disease Control and Prevention (KCDC-14-3-07).

[0066] Animal immunization and sample collection Mice were immunized intramuscularly in the hind leg with 3.3 μg of FT nanoparticles or 1 μg, 5 μg, or 10 μg of GnH-FT nanoparticles. The antigen was prepared in 50 μl of DPBS and mixed with 50 μl of AddaVax adjuvant (veterinary equivalent of MF59, Invivogen). Blood was collected from the saphenous vein or retroorbital sinus to measure neutralizing antibody titers. Ferrets were immunized with 15 μg of FT nanoparticles or GnH-FT nanoparticles in 300 μl mixed with 300 μl of AddaVax adjuvant and injected intramuscularly in the leg under anesthesia. Blood was also collected during anesthesia. Ferrets were then infected intramuscularly with 107.6 TCID50 / mL of DBV, which showed 100% mortality in our previous study (46). Body weight and body temperature were measured, and veterinary clinical signs were observed. Blood was collected for hematological analysis every other day until 14 days post-infection. Three animals from each group were sacrificed on days 2, 4, and 6, and serum, spleen, liver, and kidney were collected using separate scissors to avoid cross-contamination.

[0067] Dose setting of DBV Gn-recognizing antibodies and DBV-neutralizing antibodies in serum To measure total mouse IgG against GnH, FT, and GnH-FT, ELISA plates (MaxiSorp, ThermoFisher) were coated with each antigen at a concentration of 0.1 μg / well. The plates were blocked with 5% nonfat milk in 0.05% PBS-Tween 20. Heat-inactivated serum was diluted 10-fold with DPBS, and 100 μl of the diluted solution was incubated in the wells overnight at 4°C. The plates were washed and incubated with HRP-conjugated anti-mouse IgG antibody (Jackson Immunoresearch). To detect the antibody, the plates were coated with TMB substrate (ThermoFisher) and 1 M sulfuric acid.

[0068] To measure mouse neutralizing antibody titers against DBV, we performed a pseudovirus neutralization assay as previously described (41). Briefly, serially two-fold diluted serum samples were co-incubated with a recombinant VSV (rVSV-DBV-Luc) carrying DBV glycoproteins and a reporter luciferase gene. This inoculum was added to HEK293T cells and cultured at 37°C and 5% CO. Luciferase signals were analyzed using a luciferase assay kit (Promega).

[0069] For titration of ferret total IgG and neutralizing antibodies against DBV, ELISA and serum neutralization titration were performed as previously described (16, 46). To titrate total ferret IgG, ELISA plates were coated with antigen and blocked in the same manner as for mouse IgG. Ferret serum was diluted from 1:50 to 1:50,000 with 2% nonfat milk in 0.05% PBS-Tween 20. 100 μL of diluted ferret serum was incubated in the ELISA plate at room temperature for 2 h. The plate was then washed and incubated with HRP-conjugated anti-ferret IgG (KPL, South Korea). Color development was achieved by adding o-phenylenediamine dihydrochloride substrate, followed by the addition of 1 M sulfuric acid stop solution. After washing, the GnH-coated ELISA plate was blocked and incubated with HRP-conjugated anti-ferret IgG (KPL, South Korea). O-phenylenediamine dihydrochloride (ThermoFisher) was added to the plate, and 1 M sulfuric acid was added to stop color development. The OD value at 450 nm was measured using a plate reader (iMark Microplate reader, Bio-Rad).

[0070] Serum neutralization titers were measured as previously described (49). Briefly, heat-inactivated serum samples were serially diluted 2-fold from 1:2 to 1:128. Next, 50 μl of diluted serum was mixed with an equal volume of 200 focus-forming units of DBV at 37°C for 1 h. This mixture was then adsorbed onto confluent Vero E6 cells in a 96-well plate at 37°C for 1 h. The medium was replaced with maintenance medium, and the cells were maintained in an incubator for 5 days. The cells were then fixed with 10% formalin and stained with a homemade anti-DBV Np antibody. For FRNT50, the cells were also stained with an HRP-conjugated anti-mouse IgG antibody. The serum neutralizing antibody titer was expressed as the reciprocal of the highest DBV Np neutralizing fluorescence signal at each serum dilution.

[0071] Profiling T cell immunity by IFN-γ ELISpot The present inventors' previous publication (16) was referenced. Briefly, 100 μl of anti-mouse IFN-γ antibody (clone AN-18, eBioscience, South Korea) was coated onto a Multiscreen 96-well plate equipped with a PVDF membrane (Milipore) overnight at 4°C. Mouse splenocytes were stimulated ex vivo in a 96-well plate with an overlapping peptide pool (OLP) of 78 15-mer peptides, including DBV GnH, prepared at 0.625 μg / ml for each peptide in RPMI medium (Gibco). 10 ng / ml PMA and 500 ng / ml ionomycin were included as positive controls, and 0.5% DMSO was included as a negative control. After 24 hours of stimulation in a 5% CO2, 37°C incubator, the plates were washed to remove the cells and incubated with 100 μl of biotinylated anti-mouse IFN-γ antibody for 1 hour at room temperature. Then, after washing, the plates were incubated with 100 μL of streptavidin-alkaline phosphatase (Invitrogen) for 1 hour at room temperature. 100 μl of BCIP / NBT was added and the plates were incubated for 10 minutes at room temperature. The number of spot-forming units (SFU) per cell was calculated by subtracting the SFU from the negative control wells stimulated with 0.5% DMSO (final concentration).

[0072] Intracellular cytokine staining Spleen cells from immunized animals were suspended in 100 μl of RPMI-1640 medium according to the protocol previously reported (16). The cells were stimulated ex vivo with 100 μl of anti-CD107a antibody (BD Biosciences, 553792), anti-CD28 / CD49d antibody (BD Biosciences, 347690), and OLP or DMSO. The mixture was incubated for 1 h in a 5% CO2, 37°C incubator and then treated with 4 μl of a 55:3:2 mixture of complete RPMI-1640 medium, Brefeldin A (GolgiPlug, BD Biosciences, 555029), and Monensin (GolgiStop, BD Biosciences, 554715). After 12 hours of incubation at 37°C under 5% CO2, the cells were washed with PBS and stained with surface antibodies (anti-CD44 BV421 [BD Biosciences, 536970], anti-CD8a BV510 [BD Biosciences, 563068], anti-CD62L BV650 [BD Biosciences, 564108], anti-CD3 BV786 [BD Biosciences, 564010], anti-CD4 PerCP-Cy5.5 [BD Biosciences, 561115], and anti-CD19 APC [BD Biosciences, 561738]) for 15 minutes at room temperature, then washed. The cells were then fixed and permeabilized with 4% paraformaldehyde in PBS. Cells were then washed and stained with FACS antibodies (anti-IL-2 FITC [BD Biosciences, 562040], anti-TNF PE [BD Biosciences, 554419], anti-IFN-γ [BD Biosciences, 557735], anti-CD107a [BD Biosciences, 560647]) by incubation for 20 min at room temperature, washed twice with permeabilization buffer, and resuspended in 300 μl of PBS.

[0073] Hematological analysis of challenged ferrets and viral dose determination Hematological profiles were measured and viremia titrated as previously described (17). Total white blood cell and platelet counts in ferret whole blood samples were analyzed using a Celltac hematology analyzer (MEK-6550J / K, Nihon Kohden, Japan). Total RNA was extracted with TRIzol reagent (ThermoFisher) and reverse transcribed to generate cDNA using the QuantiTect Reverse Transcription System (Qiagen). Primers for real-time RT-PCR (F:AATTCACATTTGAGGGTAGTT (SEQ ID NO: 29), R:TATCCAAGGAGGATGACAATAAT (SEQ ID NO: 30)) were designed to recognize the M fragment of the DBV genome. Real-time PCR was performed using SYBR Green supermix and a CFX Real-Time PCR Detection System (Bio-Rad). Copy numbers were normalized to the GAPDH gene.

[0074] References for Example 2 1.Casel et al., Severe fever with thrombocytopenia syndrome virus:emerging novel phlebovirus and their control strategy.Experimental & Molecular Medicine 53:713-722. 2.Yu et al.,2011.Fever with thrombocytopenia associated with a novel bunyavirus in China.N Engl J Med 546 364:1523-32. 3.Rattanakomol et al.,2022.Severe Fever with Thrombocytopenia Syndrome Virus Infection,Thailand,2019-2020.Emerg.Infect Dis 28:2572-2574. 4.Tran et al.,2019,Endemic Severe Fever with Thrombocytopenia Syndrome,Vietnam.Emerg Infect Dis 25:1029-552 1031. 5.Jiang et al.,2015.A cluster of person-to-person transmission cases caused by SFTS virus in Penglai,China.Clin Microbiol Infect 21:274-9. 6.Zhang et al.,2012.Hemorrhagic fever caused by a novel Bunyavirus in China:pathogenesis and correlates of fatal outcome.Clin Infect Dis 54:527-33. 7.Yun et al.,2020.Genetic and pathogenic diversity of severe fever wit thrombocytopenia syndrome virus (SFTSV) in South Korea.JCI Insight 5. 8.Li et al.,2021.Severe fever with thrombocytopenia syndrome virus:a highly lethal bunyavirus.Crit Rev Microbiol 47:112-125. 9.Anonymous.2018.Annual review of diseases prioritized under the Research and Development Blueprint,Informal consultation.World Health Organization,https: / / www.who.int / docs / default-source / blue-print / 2018-annual-review-of-diseases-568 prioritized-under-the-research-and-development-blueprint.pdf?sfvrsn=4c22e36_2. 10.Diseases NIoAaI.2018.NIAID Emerging Infectious Diseases / Pathogens-Category C.Diseases BaEI. 11.Plegge et al.,2016.Evidence that Processing of the Severe Fever with Thrombocytopenia Syndrome Virus Gn / Gc Polyprotein Is Critical for Viral Infectivity and Requires an Internal Gc Signal Peptide.PLoS One 11:e0166013. 12.Halldorsson et al.,2016.Structure of a phleboviral envelope glycoprotein reveals a consolidated model of membrane fusion.Proc Natl Acad Sci USA 113:7154-9. 13.Guo et al.,2013.Human antibody neutralizes severe Fever with thrombocytopenia syndrome virus,an emerging hemorrhagic Fever virus.Clin Vaccine Immunol 20:1426-32. 14.Kim et al.,2019.An anti-Gn glycoprotein antibody from a convalescent patient potently inhibits the infection of severe fever with thrombocytopenia syndrome virus.PLoS Pathog 15:e1007375. 15.Wu et al.,2017.Structures of phlebovirus glycoprotein Gn and identification of a neutralizing antibody epitope.Proc Natl Acad Sci USA 114:E7564-E7573. 16.Kwak et al.,2019.Development of a SFTSV DNA vaccine that confers complete protection against lethal infection in ferrets.Nature Communications 10:3836. 17.Park et al.,2019.Ferret animal model of severe fever with thrombocytopenia syndrome phlebovirus for human lethal infection and pathogenesis.Nat Microbiol 4:438-446. 18.Choi et al.,2020.Severe Fever with Thrombocytopenia Syndrome Virus NSs Interacts with TRIM21 To Activate the p62-Keap1-Nrf2 Pathway.J Virol 94. 19.Zimmermann P,Curtis N.2019.Factors That Influence the Immune Response to Vaccination.Clinical Microbiology Reviews 32:e00084-18. 20.Pollard AJ,Bijker EM.2021.A guide to vaccinology:from basic principles to new developments,Nature Reviews Immunology 21:83-100. 21.Gause et al.,2017.Immunological Principles Guiding the Rational Design of Particles for Vaccine Delivery.ACS Nano 11:54-68. 22.Porter CJH,Trevaskis NL.2020.Targeting immune cells within lymph nodes.Nature Nanotechnology 15:423-425. 23.Kelly et al.,2020.Self-assembling influenza nanoparticle vaccines drive extended germinal center activity and memory B cell maturation.JCI Insight 5. 24.Link et al.,2012.Innate immunity mediates follicular transport of particulate but not soluble protein antigen.J Immunol 188:3724-33. 25.Kim et al.,2021.Development of Spike Receptor-Binding Domain Nanoparticles as a Vaccine Candidate against SARS-CoV-2 Infection in Ferrets.mBio 12. 26.Kanekiyo et al.,2015,Rational Design of an Epstein-Barr Virus Vaccine Targeting the Receptor-Binding Site.Cell,162:1090-100. 27.Kanekiyo et al.,2013.Self-assembling influenza nanoparticle vaccines elicit broadly neutralizing H1N1 antibodies.Nature 499:102-6. 28.Kim et al.,2018.Chaperna-Mediated Assembly of Ferritin-Based Middle East Respiratory Syndrome-Coronavirus Nanoparticles.Front Immunol 9:1093. 29.Domnich et al.,2017.Effectiveness of MF59-adjuvanted seasonal influenza vaccine in the elderly:A systematic review and meta-analysis.Vaccine 35:513-520. 30.Podda A,Del Giudice G.2003.MF59-adjuvanted vaccines:increased immunogenicity with an optimal safety profile.Expert Review of Vaccines 2:197-204. 31.Pellegrini et al.,2009.MF59-adjuvanted versus non- adjuvanted influenza vaccines:integrated analysis from a large safety database.Vaccine 27:6959-65. 32.Tsai TF.2013.Fluad(R)-MF59(R)-Adjuvanted Influenza Vaccine in Older Adults.Infect Chemother,45:159-74. 33.Maini MK,Pallett LJ.2018.Defective T-cell immunity in hepatitis B virus infection:why therapeutic vaccination needs a helping hand.Lancet Gastroenterol Hepatol 3:192-202. 34.Thimme R.2021.T cell immunity to hepatitis C virus:Lessons for a prophylactic vaccine.J Hepatol 74:220-229. 35.Sadoff et al.,2021.Interim Results of a Phase 1-2a Trial of Ad26.COV2.S Covid-19 Vaccine.New England Journal of Medicine 384:1824-1835. 36.(CDC) CfDCaP.2023.What you need to know about Asian longhorned ticks-a new tick in the United States. 37.Zhang et al.,2022.Rapid Spread of Severe Fever with Thrombocytopenia,Syndrome Virus by Parthenogenetic Asian Longhorned Ticks.Emerg Infect Dis 28:363-372. 38.Yun et al.,2014.Severe fever with thrombocytopenia syndrome virus in ticks collected from humans,South Korea,2013,Emerg Infect Dis 20:1358-61. 39.Kimura et al.,2021.Characterization of pseudotyped vesicular stomatitis virus bearing the heartland virus envelope glycoprotein,Virology 556:124-132. 40.Lam et al.,2013,Evolutionary and molecular analysis of the emergent severe fever with thrombocytopenia syndrome virus.Epidemics 5:1-10. 41.Xia et al.,2023,Glucosylceramide is essential for Heartland and Dabie bandavirus glycoprotein-induced membrane fusion.PLOS Pathogens 19:e1011232. 42.Yoshikawa et al.,2015.Phylogenetic and Geographic Relationships of Severe Fever With Thrombocytopenia Syndrome Virus in China,South Korea,and Japan.J Infect.Dis 212:889-98. 43.Li et al.,2021.Molecular evolution and genetic diversity analysis of SFTS virus based on next-generation sequencing.Biosafety and Health 3:105-115. 44.Yun et al.,2017.Molecular genomic characterization of tick- and human-derived severe fever with thrombocytopenia syndrome virus isolates from South Korea.PLoS Negl Trop Dis 11:e0005893. 45.Jia et al.,2017.Identification of a candidate standard strain of severe fever with thrombocytopenia syndrome virus for vaccine quality control in China using a cross-neutralization assay.Biologicals 46:92-98. 46.Kwang-Min et al.,2019.Cross-genotype protection of live-attenuated vaccine candidate for severe fever with thrombocytopenia syndrome virus in a ferret model.PNAS 116:26900-26908. 47.Mastronarde DN.2005.Automated electron microscope tomography using robust prediction of specimen movements.J Struct Biol 152:36-51. 48.Punjani et al.,2017.cryoSPARC:algorithms for rapid unsupervised cryo-EM structure determination.Nat Methods 14:290-296. 49.Yu et al.,2018,Seroprevalence and genetic characterization of severe fever with thrombocytopenia syndrome virus in domestic goats in South Korea.Ticks Tick Borne Dis 9:1202-1206.

[0075] Example 3 SFTSV Gn head ferritin nanoparticle mRNA vaccine provides efficient protection against lethal challenge This example describes the immunogenicity of mRNA vaccines encoding SFTSV Gn-H and Gn-H-FT nanoparticles as SFTSV vaccine candidates. This example includes the expression of sGn-H, encapsulation of mRNA in lipid nanoparticles (LNPs) for efficient delivery, and immunization of mice to evaluate the induction of humoral immunity against SFTSV. Both sGn-H and sGn-H-FT mRNA vaccines elicited significant levels of SFTSV neutralizing antibodies (NAbs), which remained elevated for up to 12 weeks after the booster dose. Furthermore, we challenged mice immunized with the sGn-H or sGn-H-FT mRNA LNP vaccine candidates with a lethal dose of SFTSV and evaluated protection against SFTS symptoms, including weight loss and mortality. The results demonstrated that SFTSV Gn-H and Gn-H-FT mRNA LNPs are promising vaccine candidates capable of providing protection against lethal SFTSV infection.

[0076] Materials and Methods Molecular design of mRNA encoding SFTSV Gn-H and Gn-H-FT The GnH-FT construct was generated as previously described in our publication (26, incorporated herein by reference and shown in Figure 28, SEQ ID NO:31). The head region of SFTSV was cloned into a vector engineered to incorporate a T7 promoter and 5' and 3' UTRs (43). sGn-H was then fused to hybrid ferritin via a linker. This construct was also cloned into the same vector to generate the sGn-H-FT construct. Linearized purified DNA templates of sGn-H and sGn-H-FT with their UTRs were subjected to in vitro transcription (IVT) using T7 RNA polymerase (NEB). Co-transcriptional capping introduced N1-methyl-pseudo-UTP and the CleanCap AG cap1 analog (TriLink), which is (3'OMe):N-7413-10. Enzymatic polyadenylation was performed using Poly-A polymerase (NEB). The resulting 5'-capped and polyadenylated mRNA products were purified by spin column (Zymo Research) and evaluated by RNA agarose gel electrophoresis.

[0077] DNA and mRNA transfection to characterize expression Mammalian expression vectors were transfected into HEK293T cells. DNA transfection was performed using PolyJet transfection reagent (SignaGen). mRNA transfection was performed in HEK293T cells with 1 μg of 5'-capped and polyadenylated linear mRNA using TransIT-mRNA transfection reagent (Mirus). Supernatants and / or cell lysates were harvested 24 hours after transfection for subsequent analysis by SDS-PAGE and Western blot analysis.

[0078] Encapsulation of mRNA into lipid nanoparticles (LNPs) The mRNA encapsulation process was performed using a NanoAssemblr Ignite+ microfluidic device (Precision nanosystems) at a ratio of 3:1 (mRNA aqueous solution:lipid ethanol solution). The lipid used was GenVoy-ILM (catalog #NWW0042, which stands for ionizable lipid mixture). (The manufacturer describes this as a 10:37.5:50:2.5 ratio of DSPC (1,2-distearoyl-sn-glycero-3-phosphocholine):cholesterol:ionizable lipid:stabilizer.) The mRNA-containing LNPs (mRNA-LNPs) were then diluted with DPBS (Gibco) and concentrated using an Amicon centrifugal filter (Millipore) to remove ethanol. The resulting mRNA-LNP product was stored at 4 °C until immunization. The encapsulation efficiency and mRNA concentration within the LNPs were verified using a Ribogreen RNA assay (ThermoFisher), confirming that the encapsulation efficiency was 95% or higher.

[0079] Viral propagation and dose setting Vero E6 cells (CRL-1586), confirmed to be negative for mycoplasma contamination, were procured from ATCC. Confluent Vero E6 cells were infected with the CB1 / 2014 strain of SFTSV. Supernatants were collected 7 days postinfection and stored at -80°C. Virus titers were determined by infecting Vero E6 cells with serial dilutions of virus in a layered medium containing DMEM supplemented with 3% FBS, 1% penicillin / streptomycin, 1.2% Avicel (FMC BioPolymer), 0.5% Glutamax, and 0.5% sodium pyruvate. Cells were maintained for 14 days, and monolayers were fixed with 10% formaldehyde in PBS and stained with a solution containing 20% ​​ethanol and 1% crystal violet for plaque quantification.

[0080] Mouse immunization and SFTSV infection The study was conducted in accordance with IBC (202 and FLIB002) and IACUC-approved protocols (2452 and 2503). Six- to eight-week-old BALB / c mice (Jackson laboratory) were immunized intramuscularly with 1 μg of sGn-H or sGn-H-FT mRNA-containing LNPs at weeks 0 and 3. Blood samples were collected to obtain serum for subsequent immunological profiling. Age-matched type I interferon receptor (Ifnar1) knockout mice (A129) (Jackson laboratory) were administered 3 μg of GnH or GnH-FT mRNA-LNPs at the same time points as the BALB / c mice. Mice were then transported to the Florida Research and Innovation Center's Animal Biosafety Level-3 (ABSL-3) facility and housed there until the end of the study. For the challenge study, mice were infected intramuscularly with a lethal dose of 2E4 plaque-forming units (pfu) of SFTSV. Clinical symptoms, characterized by changes in body weight and survival rate, were monitored over a 14-day period.

[0081] Dosage setting for the whole IgG antibody that recognizes SFTSV GnH SFTSV Gn head protein, purified according to our previous publication (26), was coated onto MaxiSorp ELISA plates (ThermoFisher) at a concentration of 1 μg / ml. The plates were then blocked overnight at 4°C with 3% BSA in PBS-T. Serial dilutions of heat-inactivated serum in PBS were added to the wells and incubated overnight at 4°C. After washing with PBS-T, the wells were treated with HRP-conjugated anti-mouse IgG antibody (ThermoFisher). After another wash with PBS-T, TMB substrate (BioLegend) and 1 M sulfuric acid were added to the wells. The endpoint titer was determined by calculating the dilution at which the absorbance exceeded twofold the background absorbance.

[0082] Dose determination of SFTSV-neutralizing antibodies by pseudovirus neutralization assay A recombinant vesicular stomatitis virus (rVSV) pseudovirus carrying the SFTSV glycoprotein and luciferase reporter gene (rVSV-SFTSV G-Luc) was produced according to procedures outlined previously (26, 44). Heat-inactivated serum was serially diluted in PBS and mixed with rVSV-SFTSV G-Luc and incubated at 37°C for 1 h. This mixture was added to confluent HEK293T cells and allowed to infect for 1 h. After washing, the cells were incubated at 37°C in 5% CO2 for 24 h. Cells were lysed, and luciferase signals were measured as relative light units (RLU) using a luciferase assay system (Promega). Neutralization efficacy was normalized by defining the RLU value of serum-free wells (cells infected with rVSV-SFTSV G-Luc without serum) as 100% neutralization and the RLU value of rVSV-SFTSV G-Luc-free wells (medium alone) as 0% neutralization. Neutralization potency was quantified as IC50 using a nonlinear function (logarithm of agonist vs. normalized response, variable slope) in GraphPad Prism.

[0083] statistical analysis Statistical analysis was performed using GraphPad Prism and Microsoft Excel. Error bars representing the mean and standard deviation are shown for experiments with three or more replicates. Geometric means and 95% confidence intervals were used to express the levels of SFTSV GnH-recognizing antibodies and SFTSV-neutralizing antibodies. Comparisons between groups were performed using two-way analysis of variance (ANOVA) and Student's t-test. Survival curves were statistically compared using the Mantel-Cox test.

[0084] result Expression of sGn-H monomers and sGn-H-FT nanoparticles The Gn head region of SFTSV (sGn-H) not only plays an important role in binding to the host cell receptor CCR2 (22), but also serves as an important target epitope for NAbs in convalescent human serum (23, 24). To ensure efficient expression, sGn-H and sGn-H-FT were codon-optimized to match human codon usage and cloned into vectors containing a 5' untranslated region (UTR), signal peptide (SP), and 3' UTR. Linearized and amplified DNA templates were used for cotranscription and 5' capping with N1-methyl-pseudo-UTP. The resulting in vitro transcribed mRNA was enzymatically polyadenylated (Figure 1A). The mRNA products before and after polyadenylation were purified and subjected to size analysis by MOPS / formaldehyde RNA gel electrophoresis. The results demonstrated efficient polyadenylation of sGn-H and sGn-H-FT mRNA (Figure 2B).

[0085] HEK293T cells were transfected with mammalian vectors and characterized for the expression of sGn-H or sGn-H-FT. Supernatants were collected from transfected cells and analyzed for expression by immunoblotting using an anti-Gn antibody. To assess the oligomerization of sGn-H-FT 24-mer nanoparticles, samples were then loaded onto gels with or without a boiling step. The results showed efficient expression of sGn-H and sGn-H-FT with the expected molecular weights of 45 kDa and 65 kDa under boiling and non-boiling conditions, respectively (Figure 25C). Notably, under non-boiling conditions, the high-molecular-weight sGn-H-FT was present near the overlay gel in SDS-PAGE, suggesting the homopolymeric structure of the 24-mer nanoparticles was maintained, as previously shown (26). Cells transfected with 5'-capped and polyadenylated mRNA also showed efficient expression of sGn-H and sGn-H-FT in their whole cell lysates (WLCs) and supernatants, with or without boiling (Fig. 25D). Comparison of band intensities between WLCs and supernatants indicated that most of sGn-H and sGn-H-FT were secreted from the transfected cells, consistent with our previous study (26) (Fig. 25D). Equivalent levels of vinculin (serving as a loading control) were present in fractions other than the supernatant (Fig. 25C, D). Taken together, these data indicate that the sGn-H and sGn-H-FT mRNA formats exhibit efficient expression in transfected cells.

[0086] Vaccination with sGn-H and sGn-H-FT mRNA LNPs induces strong humoral immunity in immunized mice sGn-H or sGn-H-FT mRNA was encapsulated in lipid nanoparticles (LNPs) with an mRNA delivery efficiency of approximately 90–95%. Six- to 8-week-old BALB / c mice were immunized at weeks 0 and 3 with 1 μg of sGn-H mRNA LNPs (n = 10) or sGn-H-FT mRNA LNPs (n = 10), or PBS (n = 5) as a control (Figure 2A). Purified sGn-H was coated onto ELISA plates to measure total antibody responses, and a recombinant vesicular stomatitis virus carrying the SFTSV Gn-Gc glycoprotein and luciferase reporter gene (rVSV-SFTSV G-Luc) was used in a pseudovirus neutralization assay, as previously described (26). Blood samples were collected at weeks 0, 2, 5, 9, 12, and 15 to assess overall sGn-H-recognizing total antibody and NAb levels over 15 weeks. Mice immunized with sGn-H or sGn-H-FT mRNA LNPs showed a significant increase in anti-sGn-H total IgG after the first immunization, which further increased after the second immunization ( Figure 26B ). Due to the enhanced immunogenicity achieved by the sGn-H-FT nanoparticles, the overall anti-sGn-H antibody titers in mice immunized with sGn-H-FT mRNA LNPs were detectably higher than those in mice immunized with sGn-H mRNA LNPs at weeks 2, 5, 9, and 15. Surprisingly, anti-sGn-H antibody titers remained high even at week 15 (12 weeks after the second immunization), suggesting the potential for prolonged protection after immunization with sGn-H or sGn-H-FT mRNA LNPs. In contrast, the PBS control group did not show any detectable induction of anti-sGn-H IgG in ELISA after immunization (Figure 26B). Mice immunized with sGn-H mRNA or sGn-H-FT mRNA LNPs showed robust induction of NAb against SFTSV infection. Interestingly, NAb titers continued to increase until week 9 (6 weeks after the second immunization) (Figure 26C).Similarly, the geometric mean NAb titers of mice immunized with sGn-H-FT mRNA LNPs were 1.56-fold (week 5), 2.28-fold (week 9), 1.28-fold (week 12), and 1.92-fold (week 15) higher than those of mice immunized with sGn-H mRNA LNPs, but these differences were not statistically significant (Figure 26C). In contrast, the PBS control group did not show any detectable induction of NAbs after immunization (Figure 26B). Taken together, these results demonstrated the robust activity of sGn-H and sGn-H-FT mRNA LNPs to induce effective humoral immunity in vaccinated mice.

[0087] Immunization with sGn-H mRNA or sGn-H-FT mRNA LNPs provides protective immunity against lethal SFTSV infection IFNαβR (- / -) A129 mouse model was developed for SFTSV infection and pathogenesis (see references). A129 mice were immunized with PBS control, sGn-H mRNA LNPs, or sGn-H-FT mRNA LNPs at 3 μg doses at weeks 0 and 3. Two weeks after the second immunization, mice were infected with a lethal dose of 2E4 plaque-forming units (pfu) of SFTSV and monitored for clinical signs of mortality and weight loss over a 15-day postinfection (dpi) period (Figure 27A). Mice immunized with sGn-H or sGn-H-FT mRNA LNPs were completely protected from lethal challenge, whereas all mice in the PBS control group succumbed to lethal infection by 4 dpi (Figure 27B). Consistently, mice immunized with sGn-H mRNA or sGn-H-FT mRNA LNPs did not lose weight throughout the postinfection period, whereas mice in the PBS control group exhibited rapid weight loss (Figure 27C). These results demonstrate the strong protective effect of sGn-H and sGn-H-FT mRNA LNPs in the A129 mouse model.

[0088] References for Example 3 1.Casel et al.,Severe fever with thrombocytopenia syndrome virus:emerging novel phlebovirus and their control strategy.Experimental & Molecular Medicine.2021;53(5):713-22. 2.Kwang-Min et al.,Cross-genotype protection of live-attenuated vaccine candidate for severe fever with thrombocytopenia syndrome virus in a ferret model.PNAS.2019;116(52):26900-8. 3.Yu et al.Fever with thrombocytopenia associated with a novel bunyavirus in China.N Engl J Med.2011;364(16):1523-32. 4.Zhang et al.Hemorrhagic fever caused by a novel Bunyavirus in China:pathogenesis and correlates of fatal outcome.Clin Infect Dis.2012;54(4):527-33. 5.Yoshikawa et al.Phylogenetic and Geographic Relationships of Severe Fever With Thrombocytopenia Syndrome Virus in China,South Korea,and Japan.J Infect Dis.2015;212(6):889-98. 6.Yoo et al.,Application of therapeutic plasma exchange in patients having severe fever with thrombocytopenia syndrome.Korean J Intern Med.2019;34(4):902-9. 7.Yun et al.Genetic and pathogenic diversity of severe fever with thrombocytopenia syndrome virus (SFTSV) in South Korea.JCI Insight.2020;5(2). 8.Lam et al.Evolutionary and molecular analysis of the emergent severe fever with thrombocytopenia syndrome virus.Epidemics.2013;5(1):1-10. 9.Li et al.,Severe fever with thrombocytopenia syndrome virus:a highly lethal bunyavirus.Crit Rev Microbiol.2021;47(1):112-25. 10.Jiang et al.A cluster of person-to-person transmission cases caused by SFTS virus in Penglai,China.Clin Microbiol Infect.2015;21(3):274-9. 11.Yun et al.Molecular genomic characterization of tick- and human-derived severe fever with thrombocytopenia syndrome virus isolates from South Korea.PLoS Negl Trop Dis.2017;11(9):e0005893. 12.Zhang et al.Rapid Spread of Severe Fever with Thrombocytopenia Syndrome Virus by Parthenogenetic Asian Longhorned Ticks.Emerg Infect Dis.2022;28(2):363-72. 13.Animal and Plant Health Inspection Service USDoA.National Haemaphysalis longicornis (Asian longhorned tick) Situation Report.aphis.usda.gov2023. 14.(CDC)CfDCaP.What you need to know about Asian longhorned ticks-a new tick in the United States 2023.Available from:https: / / www.cdc.gov / ticks / longhorned-tick / index.html. 15.Diseases NIoAaI.NIAID Emerging Infectious Diseases / Pathogens-Category C.In:Diseases BaEI,editor.2018. 16.Annual review of diseases prioritized under the Research and Development Blueprint,Informal consultation.World Health Organization;2018. 17.Li et al.Molecular evolution and genetic diversity analysis of SFTS virus based on next-generation sequencing.Biosafety and Health.2021;3(2):105-15. 18.Sun et al.Architecture of severe fever with thrombocytopenia syndrome virus.Protein & Cell.2023. 19.Xia et al.Glucosylceramide is essential for Heartland and Dabie bandavirus glycoprotein-induced membrane fusion.PLOS Pathogens.2023;19(3):e1011232. 20.Jia et al.Identification of a candidate standard strain of severe fever with thrombocytopenia syndrome virus for vaccine quality control in China using a cross-neutralization assay.Biologicals.2017;46:92-8. 21.Plegge et al.,Evidence that Processing of the Severe Fever with Thrombocytopenia Syndrome Virus Gn / Gc Polyprotein Is Critical for Viral Infectivity and Requires an Internal Gc Signal Peptide.PLoS One.2016;11(11):e0166013. 22.Zhang et al.CCR2 is a host entry receptor for severe fever with thrombocytopenia syndrome virus.Science Advances.2023;9(31):eadg6856. 23.Guo et al.Human antibody neutralizes severe Fever with thrombocytopenia syndrome virus,an emerging hemorrhagic Fever virus.Clin Vaccine Immunol.2013;20(9):1426-32. 24.Kim et al.An anti-Gn glycoprotein antibody from a convalescent patient potently inhibits the infection of severe fever with thrombocytopenia syndrome virus.PLoS Pathog.2019;15(2):e1007375. 25.Kwak et al.Development of a SFTSV DNA vaccine that confers complete protection against lethal infection in ferrets.Nature Communications.2019;10(1):3836. 26.Kim et al.Self-assembling Gn head ferritin nanoparticle vaccine provides full protection from lethal challenge of Dabie bandavirus in aged ferrets.mBio.2023:e0186823. 27.Pollard AJ,Bijker EM.A guide to vaccinology:from basic principles to new developments.Nature Reviews Immunology.2021;21(2):83-100. 28.Gause et al.,Immunological Principles Guiding the Rational Design of Particles for Vaccine Delivery.ACS Nano.2017;11(1):54-68. 29.Kelly et al.Self-assembling influenza nanoparticle vaccines drive extended germinal center activity and memory B cell maturation.JCI Insight.2020;5(10). 30.Kanekiyo et al.Rational Design of an Epstein-Barr Virus Vaccine Targeting the Receptor-Binding Site.Cell.2015;162(5):1090-100. 31.Kim et al.Development of Spike Receptor-Binding Domain Nanoparticles as a Vaccine Candidate against SARS-CoV-2 Infection in Ferrets.mBio.2021;12(2). 32.Kim et al.Chaperna-Mediated Assembly of Ferritin-Based Middle East Respiratory Syndrome-Coronavirus Nanoparticles.Front Immunol.2018;9:1093. 33.Park et al.Ferret animal model of severe fever with thrombocytopenia syndrome phlebovirus for human lethal infection and pathogenesis.Nat Microbiol.2019;4(3):438-46. 34.Li et al.Safety and immunogenicity of the SARS-CoV-2 BNT162b1 mRNA vaccine in younger and older Chinese adults:a randomized,placebo-controlled,double-blind phase 1 study.Nature Medicine.2021;27(6):1062-70. 35.Brailovskaia et al.,To vaccinate or not to vaccinate!? Predictors of willingness to receive Covid-19 vaccination in Europe,the U.S.,and China.PLOS ONE.2021;16(12):e0260230. 36.Jackson et al.,The promise of mRNA vaccines:a biotech and industrial perspective.npj Vaccines.2020;5(1):11. 37.Pardi et al.,mRNA vaccines-a new era in vaccinology.Nature Reviews Drug Discovery.2018;17(4):261-79. 38.Baden et al.Efficacy and Safety of the mRNA-1273 SARS-CoV-2 Vaccine.New England Journal of Medicine.2020;384(5):403-16. 39.Polack et al.Safety and Efficacy of the BNT162b2 mRNA Covid-19 Vaccine.New England Journal of Medicine.2020;383(27):2603-15. 40.Watson et al.,Global impact of the first year of COVID-19 vaccination:a mathematical modelling study.Lancet Infect Dis.2022;22(9):1293-302. 41.Wu et al.Long-term effectiveness of COVID-19 vaccines against infections,hospitalisations,and mortality in adults:findings from a rapid living systematic evidence synthesis and meta-analysis up to December,2022.Lancet Respir Med.2023;11(5):439-52. 42.Barbier et al.,The clinical progress of mRNA vaccines and immunotherapies.Nature Biotechnology.2022;40(6):840-54. 43.Richner et al.Modified mRNA Vaccines Protect against Zika Virus Infection.Cell.2017;168(6):1114-25 e10. 44.Kimura et al.Characterization of pseudotyped vesicular stomatitis virus bearing the heartland virus envelope glycoprotein.Virology.2021;556:124-32. 45.Yu et al.Seroprevalence and genetic characterization of severe fever with thrombocytopenia syndrome virus in domestic goats in South Korea.Ticks Tick Borne Dis.2018;9(5):1202-6. 46.LaMori et al.,Hepatitis vaccination adherence and completion rates and factors associated with low compliance:A claims-based analysis of U.S.adults.PLoS One.2022;17(2):e0264062. 47.Sandoval et al.,Effectiveness of mRNA,protein subunit vaccine and viral vectors vaccines against SARS-CoV-2 in people over 18 years old:a systematic review.Expert Review of Vaccines.2023;22(1):35-53. 48.Matheson et al,J.Increasing HPV Vaccination Series Completion Rates via Text Message Reminders.Journal of Pediatric Health Care.2014;28(4):e35-e9. 49.Zhang et al.Rapid development of an updated mRNA vaccine against the SARS-CoV-2 Omicron variant.Cell Research.2022;32(4):401-3. 50.Abu,et al.Effect of mRNA Vaccine Boosters against SARS-CoV-2 Omicron Infection in Qatar.New England Journal of Medicine.2022;386(19):1804-16.

[0089] All publications and patents described herein and / or listed below are incorporated herein by reference. Various modifications and variations of the described methods and systems of the invention will be apparent to those skilled in the art without departing from the scope and spirit of the invention. Although the invention has been described in connection with specific embodiments, it should be understood that the invention as claimed should not be unduly limited to such specific embodiments. Indeed, various modifications of the described modes for carrying out the invention that are obvious to those skilled in the relevant fields are intended to be within the scope described herein.

Claims

1. 1. A composition comprising a plurality of fusion proteins and / or polynucleotides encoding said fusion proteins, wherein each of said plurality of fusion proteins comprises: a) at least a portion of a ferritin protein, and b) an immunogenic protein comprising at least a portion of i) severe fever with thrombocytopenic syndrome virus (SFTS) Gn envelope glycoprotein, and / or ii) SFTS virus Gc envelope glycoprotein; wherein the plurality of fusion proteins are self-assembled into a plurality of nanoparticles; and wherein each of said plurality of nanoparticles displays an immunogenic protein on its surface.

2. The composition of claim 1 , wherein the composition further comprises an adjuvant.

3. 2. The composition of claim 1, wherein the at least a portion of the ferritin protein comprises at least 25 consecutive amino acids from the ferritin protein.

4. 2. The composition of claim 1, wherein the at least a portion of the ferritin protein comprises at least 25 contiguous amino acids, or at least 100 contiguous amino acids, or at least about 150 contiguous amino acids, or the entire amino acid sequence selected from an amino acid sequence selected from SEQ ID NOs: 4, 5, 6, 7, and 8.

5. 2. The composition of claim 1, wherein the at least a portion of the ferritin protein comprises an amino acid sequence that is at least about 90% identical, or at least 95% identical, or at least 99% identical, or 100% identical to an amino acid sequence selected from SEQ ID NOs: 4, 5, 6, 7, and 8.

6. 2. The composition of claim 1, wherein the at least a portion of the ferritin protein comprises an amino acid sequence selected from SEQ ID NO: 4, 5, 6, 7, 8, or SEQ ID NO: 4, 5, 6, 7, and 8 with one or two conservative amino acid changes.

7. 2. The composition of claim 1, wherein the at least a portion of the ferritin protein is a hybrid protein in which at least a portion of a bullfrog ferritin protein is joined to at least a portion of a ferritin protein selected from the group consisting of a Helicobacter pylori ferritin protein and an Escherichia coli ferritin protein.

8. 2. The composition of claim 1, wherein the at least a portion of the SFTS virus Gn envelope glycoprotein comprises at least 25, or at least 50 contiguous amino acids, or the entire amino acid sequence selected from SEQ ID NOs: 2, 9, 11, 25, and 27, or from an amino acid sequence selected from SEQ ID NOs: 2, 9, 11, 25, and 27 with one or two conservative amino acid changes or terminal deletions.

9. 2. The composition of claim 1, wherein the at least a portion of the SFTS virus Gc envelope glycoprotein comprises at least 25 contiguous amino acids, or at least 100 contiguous amino acids, or at least about 200 contiguous amino acids, or the entire amino acid sequence selected from SEQ ID NOs: 3, 13, and 15, or from SEQ ID NOs: 3, 13, and 15 with one or two conservative amino acid changes.

10. The composition of claim 1 , wherein each of the fusion proteins further comprises a linker sequence.

11. 2. The composition of claim 1, wherein the polynucleotide comprises at least 24 or 35 contiguous nucleotides from any of SEQ ID NOs: 1, 10, 12, 14, 16, 18, 20, 22, 24, 26, 31, and 33-40, wherein T is optionally substituted with U and / or any nucleotides including U are substituted with a modified base.

12. The composition of claim 1 , wherein the polynucleotide comprises RNA.

13. 2. The composition of claim 1, wherein the polynucleotide is partially or fully human codon-optimized or HSV-1 glycoprotein B codon-optimized, and optionally is RNA.

14. 2. The composition of claim 1, wherein the polynucleotide further comprises or encodes a 5' untranslated region (UTR), a 5' cap, a 3' UTR, an IRES, a 3' tail sequence, or any combination thereof.

15. 15. The composition of claim 14, wherein the 3' tail sequence comprises a poly-A tail, a poly-G quadruplex, a stem-loop sequence, a triple helix-forming sequence, a tRNA-like sequence, or any combination thereof.

16. The composition of claim 1 , wherein the polynucleotide comprises at least one chemically modified nucleotide.

17. 17. The composition of claim 16, wherein the at least one chemically modified nucleotide comprises a modified uracil.

18. 18. The composition of claim 17, wherein at least 60% of the uracils in the polynucleotide are chemically modified.

19. 17. The composition of claim 16, wherein the at least one chemically modified nucleotide comprises 5-methylcytosine or N1-methylpseudouridine (m1Ψ).

20. 2. The composition of claim 1, wherein the polynucleotide comprises i) a nucleotide sequence having at least 75%, or 85%, or 95% identity to SEQ ID NO: 1, 10, 12, 14, 16, 18, 20, 22, 24, 26, 31, or 33-40, or a complement or reverse complement thereof, wherein T is optionally substituted with U or modified U, and / or any nucleotide including U is substituted with a modified base.

21. 1. A method of immunizing a subject, comprising: a) administering to the subject at least a portion of the plurality of nanoparticles according to any one of claims 1 to 10, such that an immune response against the immunogenic protein is generated in the subject; and / or b) administering the polynucleotide of any of claims 1 to 20, optionally present in an expression vector or delivery vehicle, such that the nanoparticles are expressed in the subject and an immune response against the immunogenic protein is produced in the subject; The method includes at least one of the following:

22. 22. The method of claim 21, wherein the subject is a human.

23. 22. The method of claim 21, wherein the delivery vehicle comprises lipid nanoparticles encapsulating the composition.

24. 24. The method of claim 23, wherein the lipid nanoparticles comprise cationic lipids, neutral and / or non-cationic lipids, sterols, or any combination thereof.

Images