Novel aptamers and compositions for improving cognitive function and anti-aging containing the aptamers as active ingredients

Abstract

The present invention relates to an aptamer described in SEQ ID NO: 1, and a composition for improving cognitive function and anti-aging, which contains the aptamer and vitamin C as active ingredients. Compared to other previously known aptamers, the aptamer of the present invention has a superior effect of delaying the oxidation of vitamin C, and the complex of the aptamer and / or vitamin C shows an effect of improving cognitive function and anti-aging in an aging animal model, and can be used in the pharmaceutical, food and / or cosmetics fields.

Description

Technical Field

[0001] The present invention relates to a novel aptamer and a composition for improving cognitive function and anti-aging containing the aptamer as an active ingredient.

Background Art

[0002] According to data from Statistics Korea, the elderly aged 65 and over in Korea in 2017 accounted for 13.8% of the total population, indicating that Korea has already entered a rapidly aging society. If aging continues at the current rate, it is estimated that the proportion of elderly households aged 65 and over will reach 47.7% by 2045. The "The Aging World: 2015" report published by the US Census Bureau in 2016 also predicted that the proportion of the population aged 65 and over in Korea in 2050 will be 35.9% (second in the world after Japan among the 141 countries surveyed), reporting that the aging rate in Korea is the fastest in the world.

[0003] As aging progresses, a decline in cognitive function, including information processing, learning, perception, reasoning, problem-solving, and memory, naturally appears. However, in old age when aging progresses rapidly, cognitive decline appears more significantly compared to other age groups. The decline in the physical function of the elderly acts in combination with the aging phenomenon to have a negative impact on brain function. The decline in brain function induces severe cognitive decline and makes it impossible to maintain normal daily life. Senile cognitive decline ultimately results in isolating the individual from social activities and seriously impairing the quality of life in old age.

[0004] Among cognitive functions, memory and learning are known to be mainly formed in the hippocampal formation, which is mainly composed of the hippocampus, dentate gyrus, and subiculum. When specific neurons located in the hippocampal formation are repeatedly stimulated with high-frequency electric current, a phenomenon called long-term potentiation (LTP) is reported, in which excitatory postsynaptic potential (EPSP) increases in adjacent neurons connected by synapses for a long time. Such an LTP phenomenon means that the interaction ability with adjacent neurons connected by synapses is strengthened, and together with long-term depression (LTD), which is the opposite phenomenon of LTP, it is accepted as the physiological mechanism of memory / learning and forgetting.

[0005] A decline in memory and learning ability is one of the functional changes in the brain that occur due to aging. As aging progresses, it is known that the synaptic density between hippocampal neurons decreases rapidly. As a result, the ability of synaptic plasticity also decreases significantly. As aging progresses, a larger stimulus is required to induce LTP, or it becomes more easily prone to LTD. Such a decrease in LTP has been reported as the main cause of senile cognitive decline.

[0006] The rapid aging and the increase in the life expectancy of the elderly population, along with the increasing social concern for the quality of life, have amplified the demand to live a healthy and long life. As a result, there is an urgent need to develop health foods and drugs that can improve and prevent the decline of senile cognitive function. Currently, several drugs and health foods for improving senile cognitive decline are available, but they are biased towards specific senile diseases such as Alzheimer's disease, and there is a continuous search for active substances that can effectively improve cognitive decline due to natural aging.

[0007] On the one hand, an aptamer is a nucleic acid molecule that has a specific binding affinity for a molecule through interactions other than typical Watson-Crick base pairing.

[0008] An aptamer can specifically bind to a selected target and can modulate the activity of the target. For example, through binding, the aptamer can block the target's ability to function. It is generated by an in vitro selection process from a pool of random sequence oligonucleotides and has been generated against over 100 proteins including growth factors, transcription factors, enzymes, immunoglobulins, and receptors. A typical aptamer is on the order of 10 - 15 kDa (30 - 45 nucleotides) in size, binds to its target with sub-nanomolar affinity, and is discriminated from closely related targets (e.g., an aptamer typically does not bind to other proteins from the same gene family). A series of structural studies have shown that aptamers can utilize the same types of binding interactions (e.g., hydrogen bonding, electrostatic complementarity, hydrophobic contacts, steric exclusion) that induce affinity and the specificity in antibody-antigen complexes.

[0009] Aptamers have a number of properties that make them desirable for use as therapeutic and diagnostic agents, including high specificity and affinity, biological efficacy, and excellent pharmacokinetic properties. Additionally, aptamers offer specific competitive advantages compared to antibodies and other protein biologics. For example, as follows. 1) Speed and control. Aptamers are generated entirely by in vitro processes, allowing for the rapid generation of initial leads, including therapeutic leads. In vitro selection allows for stringent modulation of aptamer specificity and affinity and allows for the generation of leads, including leads against both toxic and non-immunogenic targets.

[0010] 2) Toxicity and immunogenicity. Aptamers as a class show little or no toxicity or immunogenicity. When high doses of aptamers (10 mg / kg per day for 90 days) were administered to rats and woodchucks over a long period, no toxicity was observed by any clinical, cellular, or biochemical measurements. While the efficacy of many monoclonal antibodies is severely limited by the immune response of the antibody itself, aptamers are surely unable to be produced by T cells via MHC, and since the immune response is generally trained not to recognize nucleic acid fragments, it is extremely difficult to induce antibodies against aptamers.

[0011] 3) Administration. Most currently approved antibody therapeutics are administered by intravenous infusion (usually over 2 - 4 hours), whereas aptamers can be administered by subcutaneous injection (in monkey studies, the bioavailability of aptamers through subcutaneous administration is >80%).

[0012] This difference is due to the originally relatively low solubility and thus the need for a large volume for most therapeutic mAbs. With excellent solubility (>150 mg / mL) and a relatively low molecular weight (aptamer: 10 - 50 kDa; antibody: 150 kDa), aptamers can be delivered by injection in a volume of 0.5 mL or less for weekly administration. Moreover, the small size of aptamers allows penetration into regions with conformational restrictions, while antibodies or antibody fragments cannot penetrate, and this still provides other advantages for aptamer - based therapies or prophylaxis.

[0013] 4) Scalability and cost. Therapeutic aptamers are chemically synthesized and can thus be easily scaled to the amount required to meet production demands. The difficulties in scaling production currently limit some of their biological utility, while the capital costs of mass-scale protein production plants are enormous, whereas a single large-scale oligonucleotide synthesizer can produce over 100 kg / year and requires a relatively low initial investment. With continuous improvements in process development, it is expected that the cost of resources will be reduced to <$100 / g.

[0014] 5) Stability. Therapeutic aptamers are chemically robust. They are inherently adapted to recover activity after exposure to factors such as heat and denaturants and can be stored as lyophilized powders at room temperature for long periods (>1 yr).

Prior Art Documents

Patent Documents

[0015]

Patent Document 1

Summary of the Invention

Problems to be Solved by the Invention

[0016] The present invention was devised in response to the above needs, and an object of the present invention is to provide an aptamer having an improved cognitive function and an anti-aging effect.

[0017] Another object of the present invention is to provide a novel composition for improving cognitive function.

[0018] Still another object of the present invention is to provide a novel anti-aging composition.

[0019] Another object of the present invention is to provide a composition for treating and / or improving dementia.

Means for Solving the Problems

[0020] In order to achieve the above object, the present invention provides an aptamer consisting of the nucleotide sequence set forth in SEQ ID NO: 1 that delays the oxidation of vitamin C.

[0021] The present invention also provides a pharmaceutical composition for improving cognitive function containing the aptamer of the present invention and vitamin C as active ingredients.

[0022] The present invention also provides a pharmaceutical composition for anti-aging containing the aptamer of the present invention and vitamin C as active ingredients.

[0023] The present invention also provides a food composition for improving cognitive function containing the aptamer of the present invention and vitamin C as active ingredients.

[0024] The present invention also provides a food composition for anti-aging containing the aptamer of the present invention and vitamin C as active ingredients.

[0025] The present invention also provides a pharmaceutical composition for treating dementia containing the aptamer of the present invention and vitamin C as active ingredients.

[0026] The present invention also provides a food composition for alleviating dementia containing the aptamer of the present invention and vitamin C as active ingredients.

[0027] Hereinafter, the present invention will be described.

[0028] Pharmaceutical composition using a complex of aptamer and / or vitamin C When the composition of the present invention is a pharmaceutical composition, it can be used for the indication intended by the present invention. For the administration of the composition of the present invention, in addition to the active ingredient described above, it can contain a pharmaceutically acceptable carrier, excipient or diluent. Examples of the carrier, excipient and diluent include lactose, dextrose, sucrose, sorbitol, mannitol, xylitol, erythritol, maltitol, starch, acacia gum, alginate, gelatin, calcium phosphate, calcium silicate, cellulose, methyl cellulose, microcrystalline cellulose, polyvinyl pyrrolidone, water, methyl hydroxybenzoate, propyl hydroxybenzoate, talc, magnesium stearate and mineral oil.

[0029] The pharmaceutical composition of the present invention can be formulated and used in the form of oral dosage forms such as powders, granules, tablets, capsules, suspensions, emulsions, syrups, aerosols, external preparations, suppositories or sterile injection solutions by ordinary methods, respectively. Specifically, when formulating, it can be prepared using diluents or excipients such as fillers, extenders, binders, wetting agents, disintegrants, surfactants, etc. commonly used. Solid preparations for oral administration include, but are not limited to, tablets, pills, powders, granules, capsules, etc. Such solid preparations may be prepared by mixing at least one or more excipients, such as starch, calcium carbonate, sucrose, lactose, gelatin, etc., in addition to the active ingredient. In addition to simple excipients, lubricants such as magnesium stearate and talc may also be used. For oral liquids, in addition to liquid paraffin, various excipients, such as wetting agents, sweeteners, fragrances, preservatives, etc., can be added and prepared. Preparations for parenteral administration include sterile aqueous solutions, non-aqueous solvents, suspensions, emulsions, freeze-dried preparations and suppositories. As non-aqueous solvents and suspensions, propylene glycol, polyethylene glycol, vegetable oils such as olive oil, injectable esters such as ethyl oleate, etc. can be used. As the base of suppositories, witepsol, macrogol, tween 61, cocoa butter, laurin fat, glycerogelatin, etc. can be used.

[0030] The suitable dosage of the pharmaceutical composition of the present invention varies depending on the patient's condition and body weight, the degree of the disease, the form of the drug, and time, but can be appropriately selected by those skilled in the art. The daily dosage of the composition is preferably 0.001 mg / kg body weight to 500 mg / kg body weight, and can be administered once to several times a day as needed.

[0031] Food and beverage and food composition using a complex of aptamer and / or vitamin C The present invention provides a food composition or a beverage composition containing the aptamer of the present invention alone or a complex of the aptamer and vitamin C as an active ingredient.

[0032] In one embodiment of the present invention, the composition preferably further contains one or more of collagen, elastin, hyaluronic acid, and peptides, but is not limited thereto.

[0033] In one embodiment of the present invention, the food composition is preferably confectioneries, candies, dairy products, gums, sauces, breads, or ice creams, but is not limited thereto.

[0034] Application examples of aptamer-based cosmetics The present invention provides a cosmetic composition containing an aptamer that reduces the oxidation rate of vitamin C and additional components.

[0035] The additional components of the present invention can use all raw materials used in cosmetics, regardless of the type of extract or active substance. Examples include green tea extract, licorice extract, mulberry bark extract, white mulberry root bark extract, yellowhorn extract, kudzu root extract, red ginseng extract, apricot extract, oil extract, orange extract, lemon extract, bamboo extract, guava extract, rosemary extract, evodia extract, jujube extract, ginkgo extract, xishiyurongsan extract, ziyindan extract, loquat extract, centella asiatica extract, paprika extract, aloe extract, loofah extract, seaweed extract, carrot extract, soybean extract, grapefruit seed extract, grape seed extract, spermaceti extract, caviar, pomegranate, ginseng extract, peach extract, gentiana extract, tuberose extract, chamomile extract, purple root extract, sophora flavescens extract, bupleurum extract, peppermint extract, Saururus chinensis extract, houttuynia cordata extract, peony extract, wood vinegar, dandelion extract, calendula extract, phellodendron amurense extract, bitter orange extract, yellowhorn extract, aster extract, coneflower extract, chestnut peel extract, green tea extract, glycerin, panthenol, hyaluronic acid, ceramide, beta-glucan, arbutin, vitamin C, whitening agent, retinol, astaxanthin, resveratrol, polyphenol, elastin, collagen, coenzyme Q10, effectin, EGF, propolis, allantoin, phytosterol, infra-acid, antioxidant vitamin E (natural tocopherol), rosemary oil extract, grapefruit seed extract and various other extracts are applicable.

[0036] Suitable dosage forms of the cosmetics of the present invention may be provided, for example, in the form of solutions, gels, creams in semi-solid or solid form, lotions, powders, ointments, sprays or concealer sticks. It may also be manufactured in the form of a foam or an aerosol composition further containing a compressed propellant.

[0037] In addition, the cosmetic composition of the present invention may additionally contain a fatty substance, a solvent, a thickening agent and a gelling agent, a softening agent, an antioxidant, a suspending agent, a stabilizer, a foaming agent, a fragrance, a surfactant, water, an ionic or non-ionic emulsifier, a filler, a sequestering agent and a chelating agent, a preservative, a vitamin, a blocker, a wetting agent, an essential oil, a dye, a pigment, a hydrophilic or lipophilic activator, a lipid vesicle, or an auxiliary agent commonly used in the field of cosmetics or dermatology. And the above components can be introduced in amounts commonly used in the field of dermatology.

[0038] The cosmetic composition of the present invention can be manufactured into any dosage form commonly manufactured in the industry. Specific dosage forms include skin lotion, skin softener, skin toner, astringent, lotion, milk lotion, moisturizing lotion, nutritional lotion, massage cream, nutritional cream, moisturizing cream, hand cream, essence, nutritional essence, pack, soap, shampoo, cleansing foam, cleansing lotion, cleansing cream, body lotion, body cleanser, bath assisting agent and other dosage forms.

Advantages of the Invention

[0039] As can be seen from the present invention, the aptamer (GCCAGTCTCGCGGTGGCGGC) of a specific sequence of the present invention has an excellent oxidation delaying effect on vitamin C compared with other aptamers known in the prior art. The complex of the aptamer and / or vitamin C of the present invention shows an improvement in cognitive function and an anti-aging effect in an aging animal model, and by maintaining the reduced state of vitamin C, its antioxidant function is maintained for a long period, and it can be used in various dosage forms of functional cosmetics, and various health drinks, antioxidant drinks and antioxidant foods, etc., and is also applicable as a candidate substance requiring improvement in cognitive function and anti-aging effect.

Brief Description of the Drawings

[0040]

Figure 1

Figure 2

Figure 3

Figure 4

Figure 5

Figure 6

Figure 7

Figure 8

Figure 9

Figure 10 - 11

Figure 12

Mode for Carrying Out the Invention

[0041] Hereinafter, the present invention will be described in more detail through non-limiting examples. However, the following examples are described for the purpose of illustrating the present invention, and the scope of the present invention should not be construed as being limited by the following examples.

[0042] Example 1. Discovery of substances Aptamers were discovered through SELEX. However, aptamer C320 was created by truncating the length of the aptamer that binds to vitamin C of 32mer (C332) owned by existing Nexmos to 20mer. For comparative experiments, 20mer aptamers were synthesized and used.

[0043] 1) Structural analysis Using the mFold program, sequence-based secondary structure analysis was performed. Through the secondary structure analysis of the 32mer DNA aptamer, it was truncated to 20mer DNA that maintains the secondary structure.

[0044] 2) OPDA assay The aptamer dissolved in annealing buffer was heated to 95°C, and then the temperature was gradually decreased to room temperature to form the secondary structure of the aptamer. After that, it was mixed with reduced L-ascorbic acid and reacted for about 30 minutes so that the aptamer could bind to L-ascorbic acid. At this time, L-ascorbic acid and the aptamer were mixed at a ratio of 0.1% and 0.001%, respectively. Then, after adding hydrogen peroxide solution to create an oxidation condition, the oxidation of L-ascorbic acid was measured by adding OPDA (o-phenylenediamine), which is a fluorescent dye. The degree of DHA production can be quantitatively analyzed by measuring the fluorescence amount from DHA-OPDA generated by the reaction of DHA, which is the oxide of L-ascorbic acid, with OPDA. Under the above conditions, the fluorescence amount of DHA-OPDA was measured every 2 minutes for a total of 900 minutes.

[0045] The results are shown in FIGS. 1 and 2.

[0046] FIG. 1 relates to aptamer C332 (left) and aptamer C320 (right). When analyzing the structure of 32mer by mFold, the secondary structure of two stem-loop structures was confirmed, and 20mer (aptamer C320) that maintains this stem-loop was designed.

[0047] FIG. 2 is a diagram showing the confirmation of the oxidation delay effect of vitamin C of aptamer C320 through the OPDA assay. The sequences in FIG. 2 are as follows. The overlapping part of the 32mer DNA (C332) and the 20mer DNA from C320 to C3a below is underlined. C332, GTGGAGGCGGTGGCCAGTCTCGCGGTGGCGGC (SEQ ID NO: 2) C320, GCCAGTCTCGCGGTGGCGGC (SEQ ID NO: 1) C1a, GAGGCGGTGGCCAGTCTC AT (SEQ ID NO: 3) C1b, GCCGCGGC GGTG GCCGCGGC (SEQ ID NO: 4) C1c, G GAGGCGGTGGCCAGTCTC A (SEQ ID NO: 5) C2c, GAGCTCGCGCCGGAGTTCTC (SEQ ID NO: 6) C3a GGCGGTGGCCAGTCTCGCGG (SEQ ID NO: 7)

[0048] As shown in Figure 2, through the OPDA assay, it was confirmed whether the existing 32-mer (aptamine C332) and the aptamine C320 shortened to 20-mer in length could delay the oxidation of vitamin C, and other aptamers obtained by cleaving aptamine C to 20-mer were used as a comparison group for the experiment together. As can be seen from Figure 2, aptamine C320 most effectively delayed the oxidation of vitamin C.

[0049] Therefore, among a large number of 20-mer aptamers, aptamine C320 was used as a candidate substance for subsequent experiments.

[0050] Example 2. Confirmation of efficacy maintenance upon oral ingestion To confirm whether the effect of the substance decreases or disappears due to the pH environment in the stomach when the substance is ingested orally, the OPDA assay was used to confirm whether the effect of aptamine C320 in delaying the oxidation of vitamin C is maintained in a low pH environment similar to gastric acid.

[0051] In summary, the aptamer dissolved in annealing buffer was heated to 95°C, and then the temperature was gradually lowered to room temperature to form the secondary structure of the aptamer. After that, it was mixed with reduced L-ascorbic acid and reacted for about 30 minutes so that the aptamer could bind to L-ascorbic acid. Then, hydrogen peroxide solution was added to create oxidation conditions. At this time, hydrochloric acid was used to adjust the pH to be between 1.4 and 1.6, and then the oxidation of L-ascorbic acid was measured by adding the fluorescent dye OPDA (o-phenylenediamine). The amount of fluorescence from DHA-OPDA generated by the reaction of DHA, the oxide of L-ascorbic acid, with OPDA can be measured to quantitatively analyze the degree of DHA production. Under the above conditions, the fluorescence intensity of DHA-OPDA was measured every 2 minutes for a total of 900 minutes.

[0052] The results are shown in Figure 3.

[0053] Figure 3 is a diagram for confirming the maintenance of the vitamin C oxidation delay effect of aptamine C320 in an environment similar to gastric acid through the OPDA assay. As can be seen from Figure 3, it was confirmed that the vitamin C oxidation delay effect of aptamine C320 was maintained without significant decrease under acidic condition as compared with the normal condition. Therefore, considering that the effect of aptamine C320 is maintained even under strong acidic conditions, it is predicted that the effect will not be lost while passing through the gastrointestinal tract during the intake of aptamine C320.

[0054] Example 3. Confirmation of effects in an aging experimental animal model As behavioral tests, an open field test, a novel object recognition test, and a radial 8 - arm maze test were conducted. Regarding the changes in neurons in the hippocampus (CA1, CA3) and motor cortex (MC) in the brain, immunohistochemistry experiments using the NeuN marker were performed. Regarding the changes in microglial cells in the hippocampus in the brain, immunohistochemistry experiments using the Iba - 1 and GFAP markers were performed. For observing the changes in oxidative stress in the hippocampus and motor cortex regions in the brain, immunohistochemistry experiments using the 4HNE marker were performed. For confirming the changes in DNA damage in the hippocampus and motor cortex in the brain, immunohistochemistry using Lamin A as a marker and immunofluorescence experiments using the phospho - histone 2AX (p - H2AX) marker were performed. For confirming the changes in antioxidant capacity in vivo, immunofluorescence and western blot were performed using Nrf2, Keap1, SOD1, and GSTO1 / 2 as antioxidant markers.

[0055] In summary, 1) Animals To standardize the application of the special physical state in old age, imported animals from Charles River Japan were introduced. Male B6J at 70 weeks of age was imported through Orient Bio. After customs clearance procedures, the imported animals are scheduled to be delivered to this laboratory using a vibration-free train, separated into two animals per cage, and bred in a thermostatic-humidistat that maintains the set environment (23 ± 2 °C, 50 ± 1%, 12-hour light / dark cylces). Water and feed were allowed to be freely ingested.

[0056] 2) Tests After allowing the B6J mice to have a one-week adaptation period in the experimental environment, they were randomly grouped into groups of ten. Thereafter, every day, the mice in all groups were orally administered an Aptamin C320 / vitamin C complex, Aptamin C320 alone, or vitamin C alone for 8 weeks according to the intervention of each group. After applying the experimental intervention for 2 weeks, the cognitive function was evaluated through behavioral experiments. The behavioral experiments were conducted using a Novel object recognition test, an 8-arm radical maze test to confirm the cognitive function, and an open field test to confirm the motor function. On the day after the behavioral experiments were completed, the animals were anesthetized by inhalation using ethyl ether, and then sacrificed painlessly by cervical dislocation to obtain tissues.

[0057] 3) Histological analysis To confirm histological differences, tissues were collected after sacrificing the animals. After obtaining the brain tissues, they were fixed in a 10% formalin solution for 1 hour. The tissues fixed in formalin were made into paraffin blocks and cut into sections with a thickness of 5 μm from the outside. After removing the paraffin with xylene and washing with alcohol and distilled water, markers for neurons (NeuN), inflammation (Iba-1, GFAP), oxidation (4-HNE), antioxidant (Nrf2 / Keap1), and aging (Lamin A, p-H2AX) were stained using primary antibodies. After the reaction of the secondary antibody, observations were made under a microscope to collect data.

[0058] 4) Western blotting The brain tissue was placed in a lysis buffer (Trizma base, NaCl, 10% NP40, 10% Na-dedoxycholate, 100 mM EDTA, and 10% SDS) containing a protease inhibitor and pulverized to make a homogenate. Then, it was placed in a centrifuge and separated at a speed of 13,000 rpm for 30 minutes while maintaining 4°C. The supernatant was taken to obtain proteins, and the proteins were separated by electrophoresis on an SDS PAGE gel with a uniform amount of protein. Subsequently, the proteins were transferred from the gel to a PVDF membrane, blocked with 5% skim milk for 1 hour, and then reacted with the primary antibody overnight at 4°C. The primary antibodies used were SOD-1 and GSTO1 / 2 to confirm the antioxidant effect. Each was reacted with a secondary antibody conjugated with HRP for 2 hours at room temperature and then reacted with an ECL (enhanced chemiluminescence) solution and developed on a film. The amount of the expressed target protein was compared as a ratio to β-actin, which is the positive control group, and the measurement of this expression level was performed using the Image J program.

[0059] 5) Statistical analysis To evaluate the therapeutic effects of aptamine C320 and the vitamin C complex, analysis was performed using the SPSS 25.0 program. When the collected data was normal, one-way ANOVA was used; otherwise, analysis was performed through the Kruskal Wallis test, a non-parametric analysis. When differences occurred between groups, the Tukey test was performed as a post hoc test. The significance of the statistical difference was limited to a p-value of less than 0.05. All data values were shown as the mean ± standard error of the mean (S.E.M.). (*p < 0.05, compared with the Young group. #p < 0.05, compared with the Aging group)

[0060] In the present example, the dosage of the drug is 200 mg / kg of vitamin C 4 mg / kg of Aptamin C320 4 mg / 200 mg / kg of Aptamin C320 + vitamin C, and the results of the above example will be described below.

[0061] Figure 4 is a diagram showing the change in the weight of aging animals during the administration period. During the 8-week administration period, the weight of aging animals was measured once a week. As can be seen from Figure 4, there was no change in the body weight of animals due to the administration of the substance, and there was no significant difference between the groups.

[0062] Figure 5 is a diagram showing the measurement of general motility through the open field test. Through the open field test, general and spontaneous motility was analyzed. As can be seen from Figure 5, there was no statistically significant difference between the overall groups in the aspect of animals moving in the overall space and the central part of the space. Therefore, it is considered that there is no significant difference in spontaneous motility.

[0063] Figure 6 is a diagram showing the evaluation of cognitive memory and learning ability through the novel object recognition test and the radial 8-arm maze test. [A] Novel object recognition test The novel object recognition test is a cognitive memory evaluation model that uses the characteristic of mice showing curiosity about new things. As can be seen from Figure 6A, the aging-vehicle group showed a decline in cognitive function compared with the young group, and in the aging-AptaminC320+VitaminC group, it was found that compared with the aging-vehicle group, more interest was shown in the new substance and cognitive memory was improved.

[0064] [B] Radial 8-arm maze test The 8-direction radial maze test is a method for measuring spatial learning ability. In a maze composed of 8 arms, entering a previously visited arm again is counted as an error, and the number of correct selections is calculated until the first error occurs. As can be seen from Figure 6B, in the radial 8-arm maze, the aging-vehicle group made fewer correct selections and more errors compared to the young group. The aging-AptaminC320+VitaminC group made more correct selections and fewer error selections compared to this.

[0065] Therefore, it is considered that the intake of the complex of AptaminC320+VitaminC improved spatial learning and memory functions.

[0066] Figure 7 shows the observation of changes in neurons in the hippocampus (CA1, CA3) and motor cortex (MC) in the brain by NeuN staining. The regions of CA1, CA3 in the hippocampus and the motor cortex are involved in spatial and working memory and are important in memory search and formation. As can be seen from Figure 7, NeuN is a marker for neurons. In the aging group, the number of NeuN-positive cells decreased significantly, while in the group taking AptaminC320+VitaminC, the number of NeuN-positive cells increased. Therefore, it was confirmed that the intake of the AptaminC320+VitaminC complex inhibited the death of neurons due to aging.

[0067] Figure 8 shows the observation of changes in microglial cells in the hippocampus in the brain by Iba-1 and GFAP staining. Microglial cells and astrocytes increase when the damage and stress in the central nervous system increase. As can be seen from Figure 8, in the hippocampus, Iba-1, an inflammatory marker of microglial cells, and GFAP, an inflammatory marker of astrocytes, increased during aging, and were statistically significantly reduced by the intake of the AptaminC320+VitaminC complex.

[0068] Figure 9 shows the observation of the changes in oxidative stress in the hippocampus and motor cortex regions of the brain by 4HNE staining. 4HNE is an oxidative stress biomarker generated by lipid peroxidation. As can be seen from Figure 9, it was confirmed that the number of 4HNE-positive cells increased in the regions of hippocampal CA1, CA3, and motor cortex, indicating an increase in oxidative stress in aging cells. By the intake of the AptaminC320 + VitaminC complex, the 4HNE accumulated in aging cells decreased significantly statistically.

[0069] Figures 10 and 11 show the confirmation of the changes in DNA damage in the hippocampus and motor cortex of the brain through Lamin A (Figure 10) and p-H2AX (Figure 11) staining. [Figure 10] Lamin A is an indicator showing aging-related nuclear damage. It accumulates during natural aging and is activated when cells are exposed to oxidative stress. It was confirmed that the expression of Lamin A in the hippocampal CA1, CA3, and motor cortex of aging animals increased compared with that of young animals. As can be seen from Figure 10, in the group taking the AptaminC320 + VitaminC complex, the number of Lamin A-positive cells decreased significantly statistically compared with the aging group.

[0070] [Figure 11] p-H2AX is closely related to the repair of damaged DNA. The expression of p-H2AX in the regions of hippocampal CA1, CA3, and motor cortex of aged mice decreased significantly statistically compared with that of young mice. However, by taking the AptainC320 + VitaminC complex, the expression of p-H2AX increased significantly statistically.

[0071] Figure 12 shows the confirmation of the changes in the antioxidant capacity in vivo through the confirmation of the expression of Nrf2 / keap1, SOD1, and GSTO1 / 2. Nrf2 is a transcription factor that regulates the expression of various antioxidant genes and is related to the regulation of cell defense and antioxidant mechanisms.

[0072] As can be seen from Fig. 12, in the aging group, Nrf2 was mainly located in the cytoplasm, and its expression was decreased compared with the young group. In contrast, administration of the Aptamin C320 + Vitamin C combination increased the expression of Nrf2, which had decreased due to aging. In addition, it was confirmed that SOD-1 and GSTO1 / 2, antioxidant enzymes regulated by Nrf2, were increased compared with the aging group.

Claims

1. An aptamer consisting of the nucleotide sequence set forth in SEQ ID NO: 1 that retards the oxidation of vitamin C.

2. A pharmaceutical composition for improving cognitive function, comprising the aptamer according to Claim 1 and vitamin C as active ingredients.

3. A pharmaceutical composition for anti-aging, comprising the aptamer according to Claim 1 and vitamin C as active ingredients.

4. A food composition for improving cognitive function, comprising the aptamer according to Claim 1 and vitamin C as active ingredients.

5. A food composition for anti-aging, comprising the aptamer according to Claim 1 and vitamin C as active ingredients.

6. A pharmaceutical composition for treating dementia, comprising the aptamer according to Claim 1 and vitamin C as active ingredients.

7. A food composition for alleviating dementia, comprising the aptamer according to Claim 1 and vitamin C as active ingredients.

Images