Oligonucleotide Composition and Method Thereof

By employing oligonucleotides with controlled structural elements, the challenges of stability and permeability are addressed, resulting in enhanced therapeutic efficacy and reduced toxicity.

JP7696310B2Active Publication Date: 2025-06-20WAVE LIFE SCI LTD
View PDF 8 Cites 0 Cited by

Patent Information

Application Number
JP2022052547
Authority / Receiving Office
JP · JP
Patent Type
Patents
Current Assignee / Owner
Priority Date
2016-05-04
Filing Date
2022-03-28
Publication Date
2025-06-20
Estimated Expiration
2036-10-07

AI Technical Summary

Technical Problem

Existing oligonucleotides face challenges due to their instability and poor cell permeability, which limits their therapeutic and diagnostic applications.

Method used

The development of oligonucleotide compositions with controlled structural elements, such as chemical modifications and stereochemistry, to enhance their stability, activity, and reduce toxicity.

Benefits of technology

These modified oligonucleotides demonstrate improved properties, including enhanced splicing modulation, reduced toxicity, and increased efficacy in therapeutic applications.

✦ Generated by Eureka AI based on patent content.

Smart Images

  • Figure 0007696310000567
    Figure 0007696310000567
  • Figure 0007696310000568
    Figure 0007696310000568
  • Figure 0007696310000569
    Figure 0007696310000569
Patent Text Reader

Abstract

Designed oligonucleotides, compositions and methods thereof are provided. [Solution] The present invention provides an oligonucleotide composition comprising a first plurality of oligonucleotides of a specific oligonucleotide type defined by (1) a base sequence, (2) a backbone crosslinking pattern, (3) a pattern of chiral centers in the backbone, and (4) a pattern of phosphorus modifications in the backbone, wherein the composition has controlled chirality in that it is enriched in oligonucleotides of the specific oligonucleotide type compared to a substantially racemic preparation of oligonucleotides having the same base sequence, and wherein when the oligonucleotide composition is contacted with a transcript in a transcription splicing system, splicing of the transcript is altered relative to that observed under reference conditions selected from the group consisting of the absence of the composition, the presence of a reference composition, and combinations thereof.
Need to check novelty before this filing date? Find Prior Art

Description

Cross - reference to related applications

[0001] This application claims priority to U.S. Provisional Application No. 62 / 239,839, filed October 9, 2015; No. 62 / 331,961, filed May 4, 2016; and No. 62 / 331,966, filed May 4, 2016, which are hereby incorporated by reference herein.

Background Art

[0002] Oligonucleotides are useful in therapeutic or diagnostic research and in the application of nanomaterials. Naturally occurring nucleic acids (e.g., unmodified DNA or RNA) are limited in therapeutic use due to their instability against extracellular and intracellular nucleases and / or their poor cell permeability and cell distribution properties. There is a need for newly improved oligonucleotides and oligonucleotide compositions, such as novel antisense oligonucleotides, siRNA oligonucleotides, and oligonucleotide compositions.

Summary of the Invention

[0003] In particular, the present disclosure encompasses the recognition that oligonucleotide properties, such as oligonucleotide structural elements, e.g., base sequence, chemical modifications (e.g., modifications of sugar, base and / or internucleotide linkages, and patterns thereof), and / or stereochemistry (e.g., stereochemistry of backbone chiral centers (chiral internucleotide linkages), and / or patterns thereof), can be mediated, e.g., by characteristics of protein binding, stability, ability to alter splicing, etc., such that they can have a significant impact on oligonucleotide properties, such as activity, toxicity. In some embodiments, the present disclosure shows that oligonucleotide compositions comprising oligonucleotides having controlled structural elements (e.g., controlled chemical modifications and / or controlled backbone stereochemistry patterns) can confer unexpected properties, including but not limited to, certain activities, toxicities, etc. In some embodiments, the present disclosure shows that oligonucleotide properties, such as activity, toxicity, etc., can be modulated by chemical modifications (e.g., modifications of sugar, base, internucleotide linkages, etc.), chiral structures (e.g., stereochemistry of chiral internucleotide linkages and patterns thereof, etc.), and / or combinations thereof.

[0004] In particular, in some embodiments, the present disclosure provides compositions and methods for altering the splicing of transcripts. Splicing of transcripts such as pre-mRNAs is an essential step for transcripts to perform their biological functions in many higher eukaryotes. Defects and / or dysfunctions in the splicing process can affect biological functions and / or have pathological consequences. For example, many human genetic diseases are caused by mutations that cause splicing defects, and many diseases are associated with splicing defects that do not result from obvious mutations. In some embodiments, the present disclosure recognizes that targeted splicing, particularly targeted splicing by compositions comprising oligonucleotides having the chemical modifications and / or stereochemical patterns described herein, can effectively correct aberrant splicing associated with diseases and / or introduce, and / or enhance, beneficial splicing that results in desired products (e.g., mRNAs, proteins, etc.) that can repair, restore, or add new desired biological functions. For example, in some embodiments, inclusion of mutant exon 51 of DMD can cause frameshifts, premature stop codons, and / or deletion of one or more downstream exons. In some embodiments, the present disclosure provides compositions and methods for effectively skipping DMD exon 51 to restore the reading frame, resulting in the production of a shorter but partially functional dystrophin. In some embodiments, the present disclosure provides compositions and methods for effectively skipping mutant exon 51 of DMD to restore the reading frame, resulting in the production of a shorter but partially functional dystrophin. In some embodiments, the compositions and methods provided can modify the splicing of transcripts to effectively reduce the amount of undesired splicing products.For example, in some embodiments, the compositions and methods provided by skipping one or more exons of a pre-mRNA that result in an mRNA having a frameshift and / or premature stop codon effectively knock down a gene. In some embodiments, such a gene is a mutant gene. One of ordinary skill in the art will understand that the techniques provided (oligonucleotides, compositions, methods, etc.) can also be used to skip other DMD exons, or one or more exons of other transcripts, such as those described in U.S. Patent No. 7,534,879 and incorporated herein by reference in accordance with the present disclosure for treating a disease and / or condition.

[0005] In some embodiments, the present disclosure encompasses the recognition that chemical modifications, stereochemistry, and combinations thereof can be used to improve the properties of oligonucleotide compositions, including, but not limited to, the ability to modulate splicing of a transcript. In some embodiments, the present disclosure provides chemical modifications and patterns thereof that are useful for improving transcriptional splicing by oligonucleotides.

[0006] In particular, the present disclosure shows that stereochemistry can be used to modulate splicing of transcripts by oligonucleotide compositions. In some embodiments, the present disclosure provides combinations of chemical modifications and stereochemistry that improve the properties of oligonucleotides, such as the ability to alter splicing of transcripts. In some embodiments, the present disclosure provides a stereochemically controlled oligonucleotide composition that, compared to reference conditions (e.g., the absence of the composition, a reference composition (e.g., a stereorandom composition of oligonucleotides having the same base sequence, the same chemical modifications, etc., an oligonucleotide composition with controlled chirality of another stereoisomer, etc.) and the presence of combinations thereof), confers altered splicing that can result in one or more desired biological effects, such as an increase in the production of a desired protein, knockdown of a gene by producing an mRNA having a frameshift mutation and / or an early termination codon, knockdown of a gene expressing an mRNA having a frameshift mutation and / or an early termination codon, etc. In some embodiments, the stereochemically controlled oligonucleotide composition provided is surprisingly effective compared to reference conditions. In some embodiments, the desired biological effect (e.g., as measured by an increase in the amount of a desired mRNA, protein, etc., a decrease in the amount of an undesired mRNA, protein, etc.) is 5-fold, 10-fold, 15-fold, 20-fold, 25-fold, 30-fold, 40-fold, 50-fold or 100-fold.

[0007] The present disclosure recognizes the problem of providing oligonucleotide compositions and methods with low toxicity. In some embodiments, the present disclosure provides oligonucleotide compositions and methods with reduced toxicity. In some embodiments, the present disclosure provides oligonucleotide compositions and methods with a reduced immune response. In some embodiments, the present disclosure recognizes that various toxicities induced by oligonucleotides are related to complement activation. In some embodiments, the present disclosure provides oligonucleotide compositions and methods with reduced complement activation. In some embodiments, the present disclosure provides oligonucleotide compositions and methods with reduced complement activation via the alternative pathway. In some embodiments, the present disclosure provides oligonucleotide compositions and methods with reduced complement activation via the classical pathway. In some embodiments, the present disclosure provides oligonucleotide compositions and methods with reduced drug-induced vascular damage. In some embodiments, the present disclosure provides oligonucleotide compositions and methods with reduced inflammation at the injection site. In some embodiments, the reduction in toxicity is widely known to those skilled in the art and can be evaluated by one or more assays performed by those skilled in the art (e.g., evaluation of the amount of complete activation products, protein binding, etc., as described herein).

[0008] In some embodiments, the present disclosure provides oligonucleotides having enhanced antagonistic activity against hTLR9. In some embodiments, certain diseases (e.g., DMD) are associated with, for example, inflammation in muscle tissue. In some embodiments, the technologies provided (e.g., oligonucleotides, compositions, methods, etc.) provide both a protein having hTLR9 antagonist activity that can be beneficial for one or more conditions and / or diseases associated with protein and inflammation (e.g., exon skipping of mutant exon 51 of DMD (or other exons depending on the genotype)). In some embodiments, the oligonucleotides and / or their compositions provided exhibit both exon skipping ability and hTLR9 antagonist activity. In some embodiments, oligonucleotides comprising one or more lipid moieties (e.g., oligonucleotides conjugated to a lipid) result in unexpectedly high exon skipping efficiency and hTLR9 antagonist activity. In some embodiments, an oligonucleotide composition with controlled chirality comprising a predetermined amount of an oligonucleotide comprising one or more lipid moieties (e.g., an oligonucleotide conjugated to a lipid) results in unexpectedly high exon skipping efficiency and hTLR9 antagonist activity.

[0009] In some embodiments, the present disclosure demonstrates that oligonucleotide properties, such as activity, toxicity, etc., can be adjusted by chemical modification. In some embodiments, the present disclosure provides an oligonucleotide composition comprising a first plurality of oligonucleotides, the first plurality of oligonucleotides having a common base sequence and comprising one or more modified sugar moieties, one or more native phosphate linkages, or combinations thereof. In some embodiments, the present disclosure provides an oligonucleotide composition comprising a first plurality of oligonucleotides, the first plurality of oligonucleotides having a common base sequence and comprising one or more modified internucleotide linkages, one or more modified sugar moieties, one or more native phosphate linkages, or combinations thereof. For example, in some embodiments, the present disclosure provides an oligonucleotide composition comprising a first plurality of oligonucleotides, the first plurality of oligonucleotides having a common base sequence and comprising one or more modified sugar moieties. In some embodiments, the present disclosure provides an oligonucleotide composition comprising a first plurality of oligonucleotides, the first plurality of oligonucleotides having a common base sequence and comprising one or more modified sugar moieties and one or more native phosphate linkages. In some embodiments, the present disclosure provides an oligonucleotide composition comprising a first plurality of oligonucleotides, the first plurality of oligonucleotides having a common base sequence and comprising one or more modified sugar moieties and one or more modified internucleotide linkages. In some embodiments, the present disclosure provides an oligonucleotide composition comprising a first plurality of oligonucleotides, the first plurality of oligonucleotides having a common base sequence and comprising one or more modified sugar moieties, one or more native phosphate linkages, and one or more modified internucleotide linkages. In some embodiments, the provided oligonucleotide composition comprising the first plurality of oligonucleotides has a predetermined amount of the first plurality of oligonucleotides, and the chirality is controlled in that the first plurality of oligonucleotides share a common stereochemical configuration with one or more chiral internucleotide linkages.For example, in some embodiments, the first plurality of oligonucleotides share a common stereochemical configuration with 1, 2, 3, 4, 5, 6, 7, 8, 9, 10, 11, 12, 13, 14, 15, 16, 17, 18, 19, 20, 21, 22, 23, 24, 25, 26, 27, 28, 29, 30, 35, 40, 45, 50, or more chiral nucleotide crosslinks, and each stereochemical configuration is independently Rp or Sp. In some embodiments, the first plurality of oligonucleotides share a common stereochemical configuration with each chiral nucleotide crosslink. In some embodiments, a chiral nucleotide crosslink in which a predetermined amount of oligonucleotides of the composition share a common stereochemical configuration (independently Rp or Sp) is referred to as a chirality-controlled nucleotide crosslink. In some embodiments, a predetermined amount of oligonucleotides of the provided composition (e.g., the first plurality of oligonucleotides of a particular composition example) includes 1, 2, 3, 4, 5, 6, 7, 8, 9, 10, 11, 12, 13, 14, 15, 16, 17, 18, 19, 20, 21, 22, 23, 24, 25, 26, 27, 28, 29, 30, 35, 40, 45, 50, or more chirality-controlled nucleotide crosslinks. In some embodiments, at least 5 nucleotide crosslinks are chirality-controlled. In some embodiments, at least 10 nucleotide crosslinks are chirality-controlled. In some embodiments, at least 10 nucleotide crosslinks are chirality-controlled. In some embodiments, each nucleotide crosslink is chirality-controlled. In some embodiments, the first plurality of oligonucleotides has a wing-core-wing structure. In some embodiments, each wing region independently includes one or more modified phosphate bridges and does not include natural phosphate bridges, and the core includes one or more modified nucleotide crosslinks and one or more natural phosphate bridges.In some embodiments, each wing region independently includes one or more native phosphate linkages and optionally one or more modified internucleotide linkages, and the core includes one or more modified internucleotide linkages and optionally one or more native phosphate linkages. In some embodiments, each wing region independently includes one or more native phosphate linkages and one or more modified internucleotide linkages, and the core includes one or more modified internucleotide linkages and one or more native phosphate linkages. In some embodiments, each wing region independently includes one or more native phosphate linkages and one or more modified internucleotide linkages, and the core includes one or more modified internucleotide linkages and does not include native phosphate linkages. In some embodiments, the wing includes a modified sugar moiety. In some embodiments, the modified internucleotide linkage is a phosphorothioate. In some embodiments, the modified internucleotide linkage is a substituted phosphorothioate. In some embodiments, the modified internucleotide linkage has the structure of Formula I described herein. In some embodiments, the modified sugar moiety is 2'-modified. In some embodiments, the 2'-modification is 2'-R. 1 is. In some embodiments, the 2'-modification is 2'-OR 1 is. In some embodiments, the 2'-modification is 2'-F. As described in more detail, the provided oligonucleotide may include more than one type of sugar modification. In some embodiments, the provided oligonucleotide is 2'-F and 2'-OR 1It includes both modifications. In some embodiments, the provided oligonucleotide includes both 2'-F and 2'-OMe modifications. In some embodiments, the provided oligonucleotide includes both 2'-F and 2'-OMe modifications, as well as both phosphorothioate and natural phosphate linkages. In some embodiments, chiral internucleotide linkages, such as phosphorothioate linkages, are each chirally controlled. In some embodiments, such provided compositions are of low toxicity. In some embodiments, the provided compositions have low complement activation.

[0010] In some embodiments, the present disclosure provides oligonucleotide compositions having an improved protein binding profile, e.g., reduced detrimental protein binding and / or increased beneficial protein binding. In some embodiments, the present disclosure provides a method for improved delivery of an oligonucleotide composition, which includes providing an oligonucleotide composition having an improved protein binding profile. In some embodiments, the present disclosure demonstrates that protein binding by an oligonucleotide composition can be adjusted by chemical modification, stereochemistry, or a combination thereof. In some embodiments, protein binding by an oligonucleotide composition can be adjusted by incorporation of modified internucleotide linkages. In some embodiments, as the proportion of modified internucleotide linkages increases, the binding of the oligonucleotide to a particular protein increases. In some embodiments, replacement of one or more modified internucleotide linkages with natural phosphate linkages results in decreased binding to a particular protein. In some embodiments, replacement of one or more natural phosphate linkages with modified internucleotide linkages results in increased binding to a particular protein. In some embodiments, a particular chemical modification increases protein binding to a particular protein. In some embodiments, a particular chemical modification decreases protein binding to a particular protein. In some embodiments, different chemical modifications of the same type give different protein bindings. For example, in some embodiments, 2'-MOE reduces protein binding compared to 2'-OMe (e.g., in certain contexts such as at least sequence, stereochemistry, etc.).

[0011] In particular, the present disclosure encompasses the recognition that a stereorandom oligonucleotide preparation contains a plurality of distinct chemical moieties that differ from one another, for example, in the stereochemical structure of the individual backbone chiral centers in the oligonucleotide chain. Without controlling the stereochemistry of the backbone chiral centers, a stereorandom oligonucleotide preparation gives an uncontrolled composition that contains an undetermined amount of oligonucleotide stereoisomers. These stereoisomers can have the same base sequence and / or chemical modification, and these stereoisomers are at least different chemical moieties due to their different backbone stereochemistries and can have different properties (e.g., activity, toxicity, distribution, etc.) as shown herein. In particular, the present disclosure provides a composition with controlled chirality that is a particular stereoisomer of the oligonucleotide of interest or contains a particular stereoisomer of the oligonucleotide of interest. In contrast to a composition with uncontrolled chirality, a composition with controlled chirality contains a predetermined amount of a particular stereoisomer of the oligonucleotide. In some embodiments, the particular stereoisomer may be defined, for example, by its base sequence, its length, its backbone crosslinking pattern, and the pattern of chiral centers in its backbone. As understood in the art, in some embodiments, the base sequence may refer to the identity and / or modification state of the nucleoside residues in the oligonucleotide (e.g., the identity and / or modification state of the sugar and / or base elements relative to standard natural nucleotides, such as adenine, cytosine, guanosine, thymine, and uracil) and / or the hybridization characteristics of such residues (i.e., the ability to hybridize to specific complementary residues).In some embodiments, the present disclosure shows that improvements in properties (e.g., improved activity, low toxicity, etc.) achieved by including and / or arranging specific chiral structures in oligonucleotides can be comparable to or better than those achieved by using chemical modifications, such as cross-linking of specific backbones, modification of residues, etc. (e.g., by using specific types of modified phosphates [e.g., phosphorothioates, substituted phosphorothioates, etc.], sugar modifications [e.g., 2'-modifications, etc.], and / or base modifications [e.g., methylation, etc.]). In some embodiments, the present disclosure shows that oligonucleotide compositions with controlled chirality of oligonucleotides containing certain chemical modifications (e.g., 2'-F, 2'-OMe, phosphorothioate nucleotide internucleotide cross-linking, lipid conjugation, etc.) exhibit unexpectedly high exon skipping efficiency.

[0012] In particular, the present disclosure shows that stereochemistry can be used to modulate the toxicity of oligonucleotide compositions. In some embodiments, the present disclosure provides chirally controlled oligonucleotide compositions that are less toxic compared to corresponding stereorandom (or non-chirality controlled) oligonucleotide compositions of oligonucleotides having the same base sequence and chemical modifications. In some embodiments, chirally controlled oligonucleotide compositions of oligonucleotides containing more Rp chiral nucleotide internucleotide linkages are less toxic. In some embodiments, a chirally controlled oligonucleotide composition of an oligonucleotide having one Rp chiral nucleotide internucleotide linkage is more toxic compared to other chirally controlled oligonucleotide compositions and / or corresponding stereorandom oligonucleotide compositions of oligonucleotides having the same base sequence and chemical modifications. In some embodiments, one Rp chiral nucleotide internucleotide linkage is in the middle of the sequence. In some embodiments, chirally controlled oligonucleotide compositions of oligonucleotides containing one or more Rp chiral nucleotide internucleotide linkages at the 5'-end and / or 3'-end are less toxic. In some embodiments, chirally controlled oligonucleotide compositions of oligonucleotides containing one or more native phosphate linkages at the 5'-end and / or 3'-end are less toxic. In some embodiments, the chiral nucleotide internucleotide linkage has the structure of Formula I. In some embodiments, the chiral nucleotide internucleotide linkage is a phosphorothioate linkage. In some embodiments, the chiral nucleotide internucleotide linkage is a substituted phosphorothioate linkage.

[0013] In particular, the present disclosure recognizes that, in some embodiments, the properties of oligonucleotides (e.g., activity, toxicity, distribution, pharmacokinetics, etc.) can be modulated by optimizing the pattern of chiral centers in the backbone, optionally in combination with the modulation / optimization of one or more other features of the oligonucleotide (e.g., chemical modifications, modification patterns, e.g., cross-linking patterns, nucleoside modification patterns, conjugation to lipids or other moieties, etc.). In some embodiments, the present disclosure recognizes that, in some embodiments, the properties of oligonucleotides (e.g., activity, toxicity, etc.) can be modulated by optimizing the pattern of chiral centers in the backbone, optionally in combination with the modulation / optimization of one or more other features of the oligonucleotide (e.g., chemical modifications, modification patterns, e.g., cross-linking patterns, nucleoside modification patterns, etc.). In some embodiments, the present disclosure recognizes and shows that chemical modifications, e.g., modifications of nucleosides and internucleotide linkages, can provide enhanced properties. In some embodiments, the present disclosure shows that a combination of chemical modification and stereochemistry can provide unexpectedly improved properties (e.g., activity, toxicity, distribution, pharmacokinetics, etc.). In some embodiments, the present disclosure shows that a combination of chemical modification and stereochemistry can provide unexpectedly improved properties (e.g., activity, toxicity, distribution, pharmacokinetics, etc.). In some embodiments, a chemical combination (e.g., modification of sugars, bases, and / or internucleotide linkages) is combined with a stereochemical pattern to provide oligonucleotides and compositions thereof having surprising enhanced properties, including low toxicity, better protein binding profiles, etc. In some embodiments, the provided oligonucleotide composition comprising a first plurality of oligonucleotides has controlled chirality, and the first plurality of oligonucleotides comprises a combination of 2'-modifications of one or more sugar moieties, one or more native phosphate linkages, and one or more chiral internucleotide linkages.In some embodiments, the provided oligonucleotide composition comprising a first plurality of oligonucleotides has controlled chirality, and the first plurality of oligonucleotides comprises a combination of 2'-modifications of one or more sugar moieties, one or more native phosphate linkages, and one or more chiral internucleotide linkages, wherein the internucleotide linkages at the 5'-end and / or 3'-end are chiral. In some embodiments, the internucleotide linkages at both the 5'-end and 3'-end are chiral. In some embodiments, the internucleotide linkages at both the 5'-end and 3'-end are chiral and are Sp. In some embodiments, the provided oligonucleotide composition comprising a first plurality of oligonucleotides has controlled chirality, and the first plurality of oligonucleotides comprises a combination of 2'-modifications of one or more sugar moieties, one or more native phosphate linkages, one or more chiral internucleotide linkages, and a stereochemical pattern of (Rp)n(Sp)m, (Np)t(Rp)n(Sp)m, or (Sp)t(Rp)n(Sp)m, where m > 2. In some embodiments, the chiral internucleotide linkage has the structure of Formula I. In some embodiments, the chiral internucleotide linkage is a phosphorothioate linkage. In some embodiments, the chiral internucleotide linkage is a substituted phosphorothioate linkage.

[0014] In some embodiments, the provided oligonucleotide comprises a wing and a core region. In some embodiments, the provided oligonucleotide has a wing-core-wing structure, and the core region comprises one or more sugar moieties and / or internucleotide linkages not present in the wing region. In some embodiments, the provided oligonucleotide has a wing-core-wing structure, and the core region comprises one or more sugar moieties and internucleotide linkages not present in the wing region. In some embodiments, the provided oligonucleotide has a wing-core-wing structure, and the core region comprises one or more sugar moieties not present in the wing region. In some embodiments, the provided oligonucleotide has a wing-core-wing structure, and the core region comprises one or more internucleotide linkages not present in the wing region. In some embodiments, the core region comprises a modified sugar moiety. In some embodiments, each sugar moiety of the core region is modified. Examples of sugar modifications are widely known in the art and include, but are not limited to, those described in the present disclosure. In some embodiments, the core comprises at least one internucleotide linkage with controlled chirality (e.g., phosphorothioate in the Sp configuration or Rp configuration) and at least one achiral internucleotide linkage (e.g., phosphodiester or phosphorodithioate). In some embodiments, the core comprises at least one internucleotide linkage that is a phosphorothioate with controlled chirality in the Sp configuration and at least one achiral internucleotide linkage (e.g., phosphodiester or phosphorodithioate). In some embodiments, each wing region does not comprise a modified sugar moiety. In some embodiments, the core region comprises one or more native phosphate linkages. In some embodiments, each internucleotide linkage following the core nucleoside is a native phosphate linkage.In some embodiments, the wing comprises at least one nucleotide crosslink with controlled chirality (e.g., phosphorothioate in Sp configuration or Rp configuration) and at least one nucleotide crosslink that is not chiral (e.g., phosphodiester or phosphorodithioate). In some embodiments, the wing comprises at least one nucleotide crosslink that is a phosphorothioate with controlled chirality in Sp configuration and at least one nucleotide crosslink that is not chiral (e.g., phosphodiester or phosphorodithioate). In some embodiments, the wing comprises one or more modified nucleotide crosslinks. In some embodiments, each nucleotide crosslink after the core nucleoside is a modified nucleotide crosslink. See, e.g., WV-1111. In some embodiments, the oligonucleotide comprises at least one nucleotide crosslink with controlled chirality (e.g., phosphorothioate in Sp configuration or Rp configuration) and at least one nucleotide crosslink that is not chiral at the phosphorus of the crosslink (e.g., phosphodiester or phosphorodithioate). In some embodiments, the oligonucleotide comprises at least one nucleotide crosslink that is a phosphorothioate with controlled chirality in Sp configuration and at least one nucleotide crosslink that is not chiral at the phosphorus of the crosslink (e.g., phosphodiester or phosphorodithioate).

[0015] In some embodiments, the oligonucleotide provided is a blockmer. In some embodiments, the oligonucleotide provided is an altmer. In some embodiments, the oligonucleotide provided is an altmer comprising alternating blocks. In some embodiments, a blockmer or altmer can be defined by chemical modifications (including whether present or absent), e.g., base modifications, sugar modifications, nucleotide crosslink modifications, stereochemistry, etc.

[0016] In some embodiments, the provided oligonucleotides include blocks that contain different internucleotide crosslinks. In some embodiments, the provided oligonucleotides include blocks that contain modified internucleotide crosslinks and natural phosphate linkages. In some embodiments, the provided oligonucleotides include blocks that contain different modified internucleotide crosslinks. In some embodiments, the provided oligonucleotides include alternating blocks that contain different internucleotide crosslinks. In some embodiments, the provided oligonucleotides include alternating blocks that contain modified internucleotide crosslinks and natural phosphate linkages. In some embodiments, the provided oligonucleotides include alternating blocks that contain different modified internucleotide crosslinks. In some embodiments, the blocks that contain modified internucleotide crosslinks have the pattern of backbone chiral centers described herein. In some embodiments, each block that contains modified internucleotide crosslinks has the same pattern of backbone chiral centers. In some embodiments, the blocks that contain modified internucleotide crosslinks have different patterns of backbone chiral centers. In some embodiments, the blocks that contain modified internucleotide crosslinks have different lengths and / or modifications. In some embodiments, the blocks that contain modified internucleotide crosslinks have the same length and / or modification. In some embodiments, the blocks that contain modified internucleotide crosslinks have the same length. In some embodiments, the blocks that contain modified internucleotide crosslinks have the same internucleotide crosslink. In some embodiments, the provided oligonucleotides include a first block (5'-block) at the 5'-end and a second block (3'-block) at the 3'-end, each independently including one or more modified internucleotide crosslinks. In some embodiments, the 5'-block and the 3'-block each independently include 2, 3, 4, 5, 6, 7, 8, 9, 10, 11, 12, 13, 14, 15, 16, 17, 18, 19, 20, or more modified internucleotide crosslinks. In some embodiments, the 5'-block comprises four or more modified nucleotide crosslinks. In some embodiments, the 5'-block comprises five or more modified nucleotide crosslinks. In some embodiments, the 5'-block comprises six or more modified nucleotide crosslinks. In some embodiments, the 5'-block comprises seven or more modified nucleotide crosslinks. In some embodiments, the 3'-block comprises four or more modified nucleotide crosslinks. In some embodiments, the 3'-block comprises five or more modified nucleotide crosslinks. In some embodiments, the 3'-block comprises six or more modified nucleotide crosslinks. In some embodiments, the 3'-block comprises seven or more modified nucleotide crosslinks. In some embodiments, the 5'-block and the 3'-block each independently comprise at least four modified nucleotide crosslinks. In some embodiments, the 5'-block and the 3'-block each independently comprise at least five modified nucleotide crosslinks. In some embodiments, the 5'-block and the 3'-block each independently comprise at least six modified nucleotide crosslinks. In some embodiments, the 5'-block and the 3'-block each independently comprise at least seven modified nucleotide crosslinks. In some embodiments, the modified nucleotide crosslinks within the block are contiguous. In some embodiments, each crosslink of the 5'-block is independently a modified nucleotide crosslink. In some embodiments, each crosslink of the 5'-block is independently a phosphorothioate crosslink. In some embodiments, each crosslink of the 5'-block is independently chirally controlled. In some embodiments, each crosslink of the 5'-block is independently Sp. In some embodiments, each crosslink of the 3'-block is independently a modified nucleotide crosslink. In some embodiments, each crosslink of the 3'-block is independently a phosphorothioate crosslink.In some embodiments, each crosslink of the 3'-block is independently chirality-controlled. In some embodiments, each crosslink of the 3'-block is Sp.

[0017] In some embodiments, the provided oligonucleotide comprises a block containing a sugar modification. In some embodiments, the provided oligonucleotide comprises one or more blocks (2'-F blocks) containing one or more 2'-F modifications. In some embodiments, the provided oligonucleotide comprises a block containing consecutive 2'-F modifications. In some embodiments, the block comprises 2, 3, 4, 5, 6, 7, 8, 9, 10, 11, 12, 13, 14, 15, 16, 17, 18, 19, 20, or more consecutive 2'-F modifications. In some embodiments, the block comprises 4 or more 2'-F modifications. In some embodiments, the block comprises 5 or more 2'-F modifications. In some embodiments, the block comprises 6 or more 2'-F modifications. In some embodiments, the block comprises 7 or more 2'-F modifications. In some embodiments, the provided oligonucleotide comprises one or more 2'-OR 1 modifications in one or more blocks (2'-OR 1 blocks). In some embodiments, the provided oligonucleotide comprises both 2'-F blocks and 2'-OR 1 blocks. In some embodiments, the provided oligonucleotide comprises alternating 2'-F blocks and 2'-OR 1It includes blocks. In some embodiments, the provided oligonucleotide includes a first 2'-F block at the 5'-end and a second 2'-F block at the 3'-end, each independently including 2, 3, 4, 5, 6, 7, 8, 9, 10, 11, 12, 13, 14, 15, 16, 17, 18, 19, 20, or more consecutive 2'-F modifications. In some embodiments, each independently includes 4 or more 2'-F modifications. In some embodiments, each independently includes 5 or more 2'-F modifications. In some embodiments, each independently includes 6 or more 2'-F modifications. In some embodiments, each independently includes 7 or more 2'-F modifications. In some embodiments, the provided oligonucleotide includes a 5'-block, where each sugar moiety of the 5'-block includes a 2'-F modification. In some embodiments, the provided oligonucleotide includes a 3'-block, where each sugar moiety of the 3'-block includes a 2'-F modification. In some embodiments, the oligonucleotide provided as such includes, between the 2'-F blocks at 5' and 3', one or more 2'-OR 1 blocks, and optionally may include one or more 2'-F blocks. In some embodiments, the oligonucleotide provided as such includes, between the 2'-F blocks at 5' and 3', one or more 2'-OR 1 blocks and one or more 2'-F blocks (e.g., WV-3407, WV-3408, etc.).

[0018] In some embodiments, the block is a stereochemical block. In some embodiments, the block is an Rp block such that each internucleotide bridge of the block is Rp. In some embodiments, the 5'-block is an Rp block. In some embodiments, the 3'-block is an Rp block. In some embodiments, the block is an Sp block such that each internucleotide bridge of the block is Sp. In some embodiments, the 5'-block is an Sp block. In some embodiments, the 3'-block is an Sp block. In some embodiments, the provided oligonucleotide comprises both Rp blocks and Sp blocks. In some embodiments, the provided oligonucleotide comprises one or more Rp's but does not comprise an Sp block. In some embodiments, the provided oligonucleotide comprises one or more Sp's but does not comprise an Rp block. In some embodiments, the provided oligonucleotide comprises one or more PO blocks in which each internucleotide bridge is a native phosphate bridge.

[0019] In some embodiments, the 5'-block is an Sp-block and each sugar moiety comprises a 2'-F modification. In some embodiments, the 5'-block is an Sp-block, where each internucleotide bridge is a modified internucleotide bridge and each sugar moiety comprises a 2'-F modification. In some embodiments, the 5'-block is an Sp-block, where each internucleotide bridge is a phosphorothioate bridge and each sugar moiety comprises a 2'-F modification. In some embodiments, the 5'-block comprises 4 or more nucleoside units. In some embodiments, the 5'-block comprises 5 or more nucleoside units. In some embodiments, the 5'-block comprises 6 or more nucleoside units. In some embodiments, the 5'-block comprises 7 or more nucleoside units. In some embodiments, the 3'-block is an Sp-block and each sugar moiety comprises a 2'-F modification. In some embodiments, the 3'-block is an Sp-block, where each internucleotide bridge is a modified internucleotide bridge and each sugar moiety comprises a 2'-F modification. In some embodiments, the 3'-block is an Sp-block, where each internucleotide bridge is a phosphorothioate bridge and each sugar moiety comprises a 2'-F modification. In some embodiments, the 3'-block comprises 4 or more nucleoside units. In some embodiments, the 3'-block comprises 5 or more nucleoside units. In some embodiments, the 3'-block comprises 6 or more nucleoside units. In some embodiments, the 3'-block comprises 7 or more nucleoside units.

[0020] In some embodiments, following a certain type of nucleoside in a region or oligonucleotide, there follows a specific type of nucleotide cross-bridge, such as a natural phosphate cross-bridge, a modified nucleotide cross-bridge, an Rp chiral nucleotide cross-bridge, an Sp chiral nucleotide cross-bridge, and the like. In some embodiments, Sp follows A. In some embodiments, Rp follows A. In some embodiments, a natural phosphate cross-bridge (PO) follows A. In some embodiments, Sp follows U. In some embodiments, Rp follows U. In some embodiments, a natural phosphate cross-bridge (PO) follows U. In some embodiments, Sp follows C. In some embodiments, Rp follows C. In some embodiments, a natural phosphate cross-bridge (PO) follows C. In some embodiments, Sp follows G. In some embodiments, Rp follows G. In some embodiments, a natural phosphate cross-bridge (PO) follows G. In some embodiments, Sp follows C and U. In some embodiments, Rp follows C and U. In some embodiments, a natural phosphate cross-bridge (PO) follows C and U. In some embodiments, Sp follows A and G. In some embodiments, Rp follows A and G. In some embodiments, a natural phosphate cross-bridge (PO) follows A and G. See, for example, WV-1111, WV-1112, WV-XXX1, etc.

[0021] In some embodiments, the provided oligonucleotide comprises alternating blocks including a modified sugar moiety and an unmodified sugar moiety. In some embodiments, the modified sugar moiety comprises a 2'-modification. In some embodiments, the provided oligonucleotide comprises alternating 2'-OMe modified sugar moieties and unmodified sugar moieties. See, for example, WV-1112, WV-1113, etc.

[0022] In some embodiments, the provided oligonucleotides include alternating blocks that include different modified sugar moieties and / or unmodified sugar moieties. In some embodiments, the provided oligonucleotides include alternating blocks that include different modified sugar moieties and unmodified sugar moieties. In some embodiments, the provided oligonucleotides include alternating blocks that include different modified sugar moieties. In some embodiments, the provided oligonucleotides include alternating blocks that include different modified sugar moieties, and the modified sugar moieties include different 2'-modifications. For example, in some embodiments, the provided oligonucleotides include alternating blocks that include 2'-OMe and 2'-F, respectively. See, e.g., WV-1712, WV1713, WV-1714, etc.

[0023] In some embodiments, certain nucleosides within a region or oligonucleotide may be modified by different modifications, if any, as compared to another type of nucleoside. In some embodiments, certain nucleosides within a region or oligonucleotide are modified by different modifications as compared to another type of nucleoside. For example, in some embodiments, pyrimidine nucleosides include a 2'-F modification and purine nucleosides include a 2'-OMe modification. In some other embodiments, pyrimidine nucleosides include a 2'-OMe modification and purine nucleosides include a 2'-F modification. In some embodiments, G and C have one type of sugar modification and A and U have another type of sugar modification. In some embodiments, G and C include a 2'-OMe modification and A and U include a 2'-F modification. In some embodiments, G and C include a 2'-F modification and A and U include a 2'-OMe modification.

[0024] In some embodiments, the internucleotide bridge following the unmodified sugar moiety is a modified internucleotide bridge. In some embodiments, the internucleotide bridge following the unmodified sugar moiety is a phosphorothioate bridge. In some embodiments, each internucleotide bridge following the unmodified sugar moiety is a modified internucleotide bridge. In some embodiments, each internucleotide bridge following the unmodified sugar moiety is a phosphorothioate bridge. In some embodiments, the internucleotide bridge following the modified sugar moiety is a native phosphate bridge. In some embodiments, each internucleotide bridge following the modified sugar moiety is a native phosphate bridge. See, for example, WV-1111, WV1112, etc.

[0025] In some embodiments, the provided oligonucleotide comprises one or more 2'-F modified sugar moieties where the 3'-internucleotide bridge is a modified internucleotide bridge. In some embodiments, the modified internucleotide bridge is phosphorothioate. In some embodiments, the modified internucleotide bridge has controlled chirality and is Rp. In some embodiments, the modified internucleotide bridge has controlled chirality and is Sp. In some embodiments, the provided oligonucleotide comprises one or more 2'-OR modified sugar moieties where the 3'-internucleotide bridge is a native phosphate bridge 1 comprising a modified sugar moiety.

[0026] In some embodiments, the pattern of chiral centers of the provided backbone includes repeats of (Sp)m(Rp)n units, (Rp)n(Sp)m units, (Np)t(Rp)n(Sp)m units, or (Sp)t(Rp)n(Sp)m units. In some embodiments, the repeating unit is (Sp)m(Rp)n. In some embodiments, the repeating unit is SpRp. In some embodiments, the repeating unit is SpSpRp. In some embodiments, the repeating unit is SpRpRp. In some embodiments, the repeating unit is RpRpSp. In some embodiments, the repeating unit is (Rp)n(Sp)m. In some embodiments, the repeating unit is (Np)t(Rp)n(Sp)m. In some embodiments, the repeating unit is (Sp)t(Rp)n(Sp)m.

[0027] In some embodiments, the pattern of the provided backbone chiral centers includes (Rp / Sp)-(all Rp or all Sp)-(Rp / Sp). In some embodiments, the pattern of the provided backbone chiral centers includes (Rp)-(all Sp)-(Rp). In some embodiments, the pattern of the provided backbone chiral centers includes (Sp)-(all Sp)-(Sp). In some embodiments, the pattern of the provided backbone chiral centers includes (Sp)-(all Rp)-(Sp). In some embodiments, the pattern of the provided backbone chiral centers includes (Rp / Sp)-(repeating (Sp)m(Rp)n)-(Rp / Sp). In some embodiments, the pattern of the provided backbone chiral centers includes (Rp / Sp)-(repeating SpSpRp)-(Rp / Sp).

[0028] In some embodiments, the pattern of backbone chiral centers provided is (Rp / Sp)-(all Rp or all Sp)-(Rp / Sp). In some embodiments, the pattern of backbone chiral centers provided is (Sp)-(all Sp)-(Sp). In some embodiments, each chiral nucleotide crosslink is Sp. In some embodiments, the pattern of backbone chiral centers provided is (Rp)-(all Sp)-(Rp). In some embodiments, the pattern of backbone chiral centers provided is (Sp)-(all Rp)-(Sp). In some embodiments, the pattern of backbone chiral centers provided is (Rp / Sp)-(repeating (Sp)m(Rp)n)-(Rp / Sp). In some embodiments, the pattern of backbone chiral centers provided is (Rp / Sp)-(repeating SpSpRp)-(Rp / Sp).

[0029] In some embodiments, the present disclosure provides oligonucleotide compositions that are less toxic. In some embodiments, the present disclosure provides oligonucleotide compositions having an improved protein binding profile. In some embodiments, the present disclosure provides oligonucleotide compositions having improved binding to albumin. In some embodiments, the compositions provided are less toxic and have improved binding to certain desirable proteins. In some embodiments, the compositions provided are less toxic and have improved binding to certain desirable proteins. In some embodiments, the oligonucleotide compositions provided simultaneously provide the same amount of, or a highly improved stability and / or activity, such as a better target cleavage pattern, a better target efficiency, a better target specificity, etc.

[0030] In some embodiments, the present disclosure is an oligonucleotide composition comprising a first plurality of oligonucleotides, (1) having a common base sequence complementary to a target sequence in a transcript; Provided is an oligonucleotide composition comprising (2) one or more modified sugar moieties and modified internucleotide linkages.

[0031] In some embodiments, the provided oligonucleotide composition is characterized in that when contacting a transcript in a transcription splicing system, the splicing of the transcript is altered relative to what is observed under reference conditions selected from the group consisting of the absence of the composition, the presence of a reference composition, and combinations thereof.

[0032] In some embodiments, the reference condition is the absence of the composition. In some embodiments, the reference condition is the presence of a reference composition. Exemplary reference compositions that include a plurality of reference oligonucleotides are described extensively herein. In some embodiments, the plurality of reference oligonucleotides have different structural elements (such as chemical modifications, stereochemistry, etc.) compared to the first plurality of oligonucleotides in the provided composition. In some embodiments, the reference composition is a stereorandom preparation of oligonucleotides having the same chemical modification. In some embodiments, the reference composition is a mixture of stereoisomers, while the provided composition is an oligonucleotide composition with the chirality of one stereoisomer controlled. In some embodiments, the plurality of reference oligonucleotides have the same base sequence as the first plurality of oligonucleotides in the provided composition. In some embodiments, the plurality of reference oligonucleotides have the same chemical modification as the first plurality of oligonucleotides in the provided composition. In some embodiments, the plurality of reference oligonucleotides have the same sugar modification as the first plurality of oligonucleotides in the provided composition. In some embodiments, the plurality of reference oligonucleotides have the same base modification as the first plurality of oligonucleotides in the provided composition. In some embodiments, the plurality of reference oligonucleotides have the same internucleotide bridge modification as the first plurality of oligonucleotides in the provided composition. In some embodiments, the plurality of reference oligonucleotides have the same stereochemistry as the first plurality of oligonucleotides in the provided composition but have different chemical modifications, such as base modifications, sugar modifications, internucleotide bridge modifications, etc.

[0033] Examples of splicing systems are widely known in the art. In some embodiments, the splicing system is an in vivo or in vitro system that contains components sufficient to achieve splicing of a relevant target transcript. In some embodiments, the splicing system is a spliceosome (e.g., its protein and / or RNA components), or contains a spliceosome. In some embodiments, the splicing system is an organelle membrane (e.g., the nuclear membrane) and / or an organelle (e.g., the nucleus), or contains these. In some embodiments, the splicing system is a cell or a collection thereof, or contains these. In some embodiments, the splicing system is a tissue, or contains a tissue. In some embodiments, the splicing system is an organism, such as an animal, such as a mammal such as a mouse, rat, monkey, human, etc., or contains a mammal.

[0034] In some embodiments, the present disclosure provides an oligonucleotide composition comprising a first plurality of oligonucleotides, (1) having a common base sequence complementary to a target sequence in a transcript; (2) containing one or more modified sugar moieties and modified internucleotide linkages, wherein when the oligonucleotide composition contacts the transcript in a transcription splicing system, splicing of the transcript is altered relative to that observed under reference conditions selected from the group consisting of the absence of the composition, the presence of a reference composition, and combinations thereof.

[0035] In some embodiments, the present disclosure provides (1) a base sequence; (2) a cross-linking pattern of the backbone; (3) a pattern of chiral centers of the backbone; and a first plurality of oligonucleotides of a particular oligonucleotide type defined by (4) a pattern of phosphorus modification of the backbone.

[0036] In some embodiments, the present disclosure is an oligonucleotide composition comprising (1) a base sequence; (2) a backbone cross-linking pattern; (3) a pattern of chiral centers in the backbone; and (4) a pattern of phosphorus modification of the backbone comprising a first plurality of oligonucleotides of a particular oligonucleotide type defined by, wherein the composition is chirally controlled in that it is enriched for oligonucleotides of a particular oligonucleotide type having the same base sequence compared to a substantially racemic preparation of oligonucleotides, and wherein splicing of the transcript is altered when the oligonucleotide composition contacts the transcript in a transcription splicing system as compared to that observed under reference conditions selected from the group consisting of the absence of the composition, the presence of a reference composition, and combinations thereof. Provided is an oligonucleotide composition.

[0037] In some embodiments, the present disclosure is an oligonucleotide composition comprising a first plurality of oligonucleotides comprising one or more wing regions and one core region, wherein the first plurality of oligonucleotides have the same base sequence; each wing region independently comprises one or more modified internucleotide linkages and optionally one or more native phosphodiester linkages, and the core region independently comprises one or more modified internucleotide linkages; or each wing region independently comprises one or more modified sugar moieties, and the core region comprises one or more unmodified sugar moieties. Provided is an oligonucleotide composition.

[0038] In some embodiments, the present disclosure is an oligonucleotide composition comprising Comprising a first plurality of oligonucleotides comprising one or more wing regions and one core region, The first plurality of oligonucleotides have the same base sequence; Each wing region independently has a length of 2 bases or more and independently comprises one or more modified nucleotide cross-links and optionally one or more natural phosphate cross-links; and The core region independently has a length of 2 bases or more and independently comprises one or more modified nucleotide cross-links, providing an oligonucleotide composition.

[0039] In some embodiments, the present disclosure is an oligonucleotide composition comprising A first plurality of oligonucleotides comprising one or more wing regions and one core region, The first plurality of oligonucleotides have the same base sequence; Each wing region independently has a length of 2 bases or more and independently comprises one or more modified nucleotide cross-links and one or more natural phosphate cross-links; and The core region independently has a length of 2 bases or more and independently comprises one or more modified nucleotide cross-links, providing an oligonucleotide composition.

[0040] In some embodiments, the present disclosure is an oligonucleotide composition comprising A first plurality of oligonucleotides comprising two or more wing regions and one core region, The first plurality of oligonucleotides have the same base sequence; Each wing region independently has a length of 2 bases or more and independently comprises one or more modified nucleotide cross-links and one or more natural phosphate cross-links; and The core region independently has a length of 2 bases or more and independently comprises one or more modified nucleotide cross-links, providing an oligonucleotide composition.

[0041] In some embodiments, the present disclosure is an oligonucleotide composition comprising a first plurality of oligonucleotides comprising two wing regions and one core region, the first plurality of oligonucleotides having the same nucleotide sequence; each wing region independently having a length of at least two bases and independently comprising one or more modified nucleotide crosslinks and one or more native phosphate crosslinks; the wing region relative to the 5'-end of the core region comprising a native phosphate crosslink following at least one modified nucleotide crosslink in the wing; and the wing region relative to the 3'-end of the core region comprising a native phosphate crosslink following at least one modified nucleotide crosslink in the wing; the core region independently having a length of at least two bases and independently comprising one or more modified nucleotide crosslinks, providing an oligonucleotide composition.

[0042] In some embodiments, the present disclosure is an oligonucleotide composition comprising a first plurality of oligonucleotides comprising one wing region and one core region, the first plurality of oligonucleotides having the same nucleotide sequence; the wing region having a length of at least two bases and comprising one or more modified nucleotide crosslinks and one or more native phosphate crosslinks; the wing region being relative to the 5'-end of the core region and comprising a native phosphate crosslink between two nucleosides at its 3'-end, or the wing region being relative to the 3'-end of the core region and comprising a native phosphate crosslink between two nucleosides at its 5'-end; and the core region independently having a length of at least two bases and independently comprising one or more modified nucleotide crosslinks, providing an oligonucleotide composition.

[0043] In some embodiments, the present disclosure is an oligonucleotide composition comprising comprising a first plurality of oligonucleotides comprising two wing regions and one core region, the first plurality of oligonucleotides having the same base sequence; each wing region independently having a length of two bases or more and independently comprising one or more modified nucleotide crosslinks and one or more native phosphate crosslinks; the wing region relative to the 5'-end of the core region comprising a native phosphate crosslink between two nucleosides at its 3'-end; the wing region relative to the 3'-end of the core region comprising a native phosphate crosslink between two nucleosides at its 5'-end; and providing an oligonucleotide composition, wherein the core region independently has a length of two bases or more and independently comprises one or more modified nucleotide crosslinks.

[0044] In some embodiments, the disclosure is an oligonucleotide composition comprising a first plurality of oligonucleotides comprising one or more wing regions and one core region, the first plurality of oligonucleotides having the same base sequence; each wing region independently comprising one or more modified nucleotide crosslinks and optionally one or more native phosphate crosslinks, and the core region independently comprising one or more modified nucleotide crosslinks; and providing an oligonucleotide composition, wherein each wing region independently comprises one or more modified sugar moieties and the core region comprises one or more unmodified sugar moieties.

[0045] In some embodiments, the disclosure is an oligonucleotide composition comprising a first plurality of oligonucleotides comprising one or more wing regions and one core region, the first plurality of oligonucleotides having the same base sequence; Each wing region independently comprises one or more modified nucleotide cross - links and one or more native phosphate cross - links, and the core region independently comprises one or more modified nucleotide cross - links; and Each wing region independently comprises one or more modified sugar moieties, and the core region comprises one or more unmodified sugar moieties, to provide an oligonucleotide composition.

[0046] In some embodiments, the present disclosure is an oligonucleotide composition comprising a first plurality of oligonucleotides, wherein the first plurality of oligonucleotides (1) have a common base sequence; (2) comprise one or more wing regions and one core region; each wing region comprises at least one modified sugar moiety; and each core region comprises at least one unmodified sugar moiety, to provide an oligonucleotide composition.

[0047] In some embodiments, the present disclosure provides: 1) a common base sequence and length; 2) a common pattern of backbone linkages; and 3) a common pattern of backbone chiral centers to provide a chirally - controlled oligonucleotide composition comprising oligonucleotides defined thereby, wherein the composition is a substantially pure preparation of a single oligonucleotide, wherein a predetermined level of oligonucleotides in the composition have a common base sequence and length, a common pattern of backbone linkages, and a common pattern of backbone chiral centers.

[0048] In some embodiments, the present disclosure provides: 1) a common base sequence and length; 2) a common pattern of backbone linkages; and 3) a common pattern of backbone chiral centers; Provided is a chirally controlled oligonucleotide composition comprising oligonucleotides of a specific oligonucleotide type, characterized by, which composition is chirally controlled in that it is enriched with respect to oligonucleotides of a specific oligonucleotide type compared to a substantially racemic preparation of oligonucleotides having the same base sequence and length.

[0049] In some embodiments, the present disclosure: 1) a common base sequence and length; 2) a common pattern of backbone linkages; and 3) a common pattern of backbone chiral centers Provided is a chirally controlled oligonucleotide composition comprising oligonucleotides of a specific oligonucleotide type, characterized by, wherein at least about 10% of the oligonucleotides in the composition are a substantially pure preparation of a single oligonucleotide having a common base sequence and length, a common pattern of backbone linkages, and a common pattern of backbone chiral centers.

[0050] In particular, the present disclosure recognizes that combinations of oligonucleotide components (e.g., patterns of chemical modifications, backbone linkages, backbone chiral centers, and / or backbone phosphorus modifications) can provide properties such as surprisingly improved biological activity. In some embodiments, the present disclosure provides an oligonucleotide composition comprising oligonucleotides of a given level comprising one or more wing regions and a common core region, wherein: each wing region independently has a length of two or more bases and independently optionally contains one or more chiral internucleotide linkages; the core region independently has a length of two or more bases and independently contains one or more chiral internucleotide linkages, and the common core region: 1) a common base sequence and length; 2) a common pattern of backbone linkages; and 3) a common pattern of backbone chiral centers has.

[0051] In some embodiments, the present disclosure provides an oligonucleotide composition comprising a first plurality of oligonucleotides comprising two or more wing regions and one core region, wherein the first plurality of oligonucleotides have the same nucleotide sequence; each wing region independently has a length of two or more bases and independently comprises one or more modified nucleotide crosslinks and one or more modified sugar moieties; and the core region independently has a length of two or more bases and independently comprises one or more native phosphate crosslinks, the oligonucleotide composition is provided.

[0052] In some embodiments, each wing region of the provided oligonucleotides independently comprises 3, 4, 5, 6, 7, 8, 9, 10, or more bases. In some embodiments, each wing region independently comprises 3 or more bases. In some embodiments, each wing region independently comprises 4 or more bases. In some embodiments, each wing region independently comprises 5 or more bases. In some embodiments, each wing region independently comprises 6 or more bases. In some embodiments, each wing region independently comprises 7 or more bases. In some embodiments, each sugar moiety of the wing is modified. In some embodiments, one modification is a 2'-modification. In some embodiments, each modification is a 2'-modification. In some embodiments, one modification is 2'-F. In some embodiments, each modification is 2'-F. In some embodiments, one modification is 2'-OR 1 is. In some embodiments, each modification is 2'-OR 1 is. In some embodiments, one modification is 2'-OR 1It is. In some embodiments, each modification is 2'-OMe. In some embodiments, each modification is 2'-OMe. In some embodiments, each modification is 2'-MOE. In some embodiments, each modification is 2'-MOE. In some embodiments, the modification is an LNA sugar modification. In some embodiments, each modification is an LNA sugar modification. In some embodiments, each nucleotide cross-bridge in the wing is a chiral nucleotide cross-bridge. In some embodiments, each nucleotide cross-bridge in the wing is an Sp chiral nucleotide cross-bridge. In some embodiments, the chiral nucleotide cross-bridge is a phosphorothioate bridge. In some embodiments, the core region comprises one or more natural phosphate bridges and one or more modified nucleotide cross-bridges. In some embodiments, the core region comprises one or more natural phosphate bridges and one or more chiral nucleotide cross-bridges. In some embodiments, the core region comprises one or more natural phosphate bridges and one or more Sp chiral nucleotide cross-bridges. In some embodiments, the core region comprises one or more natural phosphate bridges and one or more Sp phosphorothioate bridges.

[0053] In some embodiments, the amount of oligonucleotide in the provided composition, e.g., the amount of a plurality of oligonucleotides (e.g., a first plurality of oligonucleotides, a plurality of reference oligonucleotides, etc.) is predetermined. For example, as will be readily understood by those skilled in the art, a provided oligonucleotide composition in which the chirality of a plurality of oligonucleotides (e.g., a first plurality of oligonucleotides) is controlled contains a predetermined amount of such a plurality of oligonucleotides.

[0054] In some embodiments, the provided oligonucleotide has a base sequence of UCAAGGAAGAUGGCAUUUCU. In some embodiments, the provided oligonucleotide has a base sequence that includes UCAAGGAAGAUGGCAUUUCU and has a length of up to 30 bases. In some embodiments, the provided oligonucleotide has a base sequence that includes UCAAGGAAGAUGGCAUUUCU and has a length of up to 40 bases. In some embodiments, the provided oligonucleotide has a base sequence that includes UCAAGGAAGAUGGCAUUUCU and has a length of up to 50 bases. In some embodiments, the provided oligonucleotide has a base sequence that includes at least 15 consecutive bases of UCAAGGAAGAUGGCAUUUCU and has a length of up to 30 bases. In some embodiments, the provided oligonucleotide has a base sequence that includes at least 15 consecutive bases of UCAAGGAAGAUGGCAUUUCU and has a length of up to 40 bases. In some embodiments, the provided oligonucleotide has a base sequence that includes at least 15 consecutive bases of UCAAGGAAGAUGGCAUUUCU and has a length of up to 50 bases. In some embodiments, the provided oligonucleotide has a base sequence that includes a sequence having no more than 5 mismatches from the base sequence of UCAAGGAAGAUGGCAUUUCU and has a length of up to 30 bases. In some embodiments, the provided oligonucleotide has a base sequence that includes a sequence having no more than 5 mismatches from the base sequence of UCAAGGAAGAUGGCAUUUCU and has a length of up to 40 bases. In some embodiments, the provided oligonucleotide has a base sequence that includes a sequence having no more than 5 mismatches from the base sequence of UCAAGGAAGAUGGCAUUUCU and has a length of up to 50 bases.

[0055] In some embodiments, the common nucleotide sequence of the plurality of oligonucleotides is UCAAGGAAGAUGGCAUUUCU. In some embodiments, the common nucleotide sequence comprises UCAAGGAAGAUGGCAUUUCU and the oligonucleotide has a length of up to 30 bases. In some embodiments, the common nucleotide sequence comprises UCAAGGAAGAUGGCAUUUCU and the oligonucleotide has a length of up to 40 bases. In some embodiments, the common nucleotide sequence comprises UCAAGGAAGAUGGCAUUUCU and the oligonucleotide has a length of up to 50 bases. In some embodiments, the common nucleotide sequence comprises at least 15 consecutive bases of UCAAGGAAGAUGGCAUUUCU and the oligonucleotide has a length of up to 30 bases. In some embodiments, the common nucleotide sequence comprises at least 15 consecutive bases of UCAAGGAAGAUGGCAUUUCU and the oligonucleotide has a length of up to 40 bases. In some embodiments, the common nucleotide sequence comprises at least 15 consecutive bases of UCAAGGAAGAUGGCAUUUCU and the oligonucleotide has a length of up to 50 bases. In some embodiments, the common nucleotide sequence comprises a sequence having no more than 5 mismatches from the nucleotide sequence of UCAAGGAAGAUGGCAUUUCU and the oligonucleotide has a length of up to 30 bases. In some embodiments, the common nucleotide sequence comprises a sequence having no more than 5 mismatches from the nucleotide sequence of UCAAGGAAGAUGGCAUUUCU and the oligonucleotide has a length of up to 40 bases. In some embodiments, the common nucleotide sequence comprises a sequence having no more than 5 mismatches from the nucleotide sequence of UCAAGGAAGAUGGCAUUUCU and the oligonucleotide has a length of up to 50 bases.

[0056] In some embodiments, the common base sequence of the plurality of oligonucleotides is UCAAGGAAGAUGGCAUUUCU, and the common pattern of backbone chiral centers includes at least one center with controlled chirality. In some embodiments, the common base sequence includes UCAAGGAAGAUGGCAUUUCU, the oligonucleotide has a length of up to 30 bases, and the common pattern of backbone chiral centers includes at least one center with controlled chirality. In some embodiments, the common base sequence includes UCAAGGAAGAUGGCAUUUCU, the oligonucleotide has a length of up to 40 bases, and the common pattern of backbone chiral centers includes at least one center with controlled chirality. In some embodiments, the common base sequence includes UCAAGGAAGAUGGCAUUUCU, the oligonucleotide has a length of up to 50 bases, and the common pattern of backbone chiral centers includes at least one center with controlled chirality. In some embodiments, the common base sequence includes at least 15 consecutive bases of UCAAGGAAGAUGGCAUUUCU, the oligonucleotide has a length of up to 30 bases, and the common pattern of backbone chiral centers includes at least one center with controlled chirality. In some embodiments, the common base sequence includes at least 15 consecutive bases of UCAAGGAAGAUGGCAUUUCU, the oligonucleotide has a length of up to 40 bases, and the common pattern of backbone chiral centers includes at least one center with controlled chirality. In some embodiments, the common base sequence includes at least 15 consecutive bases of UCAAGGAAGAUGGCAUUUCU, the oligonucleotide has a length of up to 50 bases, and the common pattern of backbone chiral centers includes at least one center with controlled chirality. In some embodiments, the common base sequence includes a sequence having up to 5 mismatches from the base sequence of UCAAGGAAGAUGGCAUUUCU, the oligonucleotide has a length of up to 30 bases, and the common pattern of backbone chiral centers includes at least one center with controlled chirality.In some embodiments, the common base sequence includes a sequence having 5 or fewer mismatches from the base sequence of UCAAGGAAGAUGGCAUUUCU, the oligonucleotide has a length of up to 40 bases, and the common pattern of backbone chiral centers includes at least one center with controlled chirality. In some embodiments, the common base sequence includes a sequence having 5 or fewer mismatches from the base sequence of UCAAGGAAGAUGGCAUUUCU, the oligonucleotide has a length of up to 50 bases, and the common pattern of backbone chiral centers includes at least one center with controlled chirality.

[0057] In some embodiments, the common base sequence is UCAAGGAAGAUGGCAUUUCU, and the common pattern of backbone chiral centers includes at least one chirality-controlled center that is a phosphorothioate in the Sp configuration. In some embodiments, the common base sequence includes UCAAGGAAGAUGGCAUUUCU, the oligonucleotide has a length of up to 30 bases, and the common pattern of backbone chiral centers includes at least one chirality-controlled center that is a phosphorothioate in the Sp configuration. In some embodiments, the common base sequence includes UCAAGGAAGAUGGCAUUUCU, the oligonucleotide has a length of up to 40 bases, and the common pattern of backbone chiral centers includes at least one chirality-controlled center that is a phosphorothioate in the Sp configuration. In some embodiments, the common base sequence includes UCAAGGAAGAUGGCAUUUCU, the oligonucleotide has a length of up to 50 bases, and the common pattern of backbone chiral centers includes at least one chirality-controlled center that is a phosphorothioate in the Sp configuration. In some embodiments, the common base sequence includes at least 15 consecutive bases of UCAAGGAAGAUGGCAUUUCU, the oligonucleotide has a length of up to 30 bases, and the common pattern of backbone chiral centers includes at least one chirality-controlled center that is a phosphorothioate in the Sp configuration. In some embodiments, the common base sequence includes at least 15 consecutive bases of UCAAGGAAGAUGGCAUUUCU, the oligonucleotide has a length of up to 40 bases, and the common pattern of backbone chiral centers includes at least one chirality-controlled center that is a phosphorothioate in the Sp configuration. In some embodiments, the common base sequence includes at least 15 consecutive bases of UCAAGGAAGAUGGCAUUUCU, the oligonucleotide has a length of up to 50 bases, and the common pattern of backbone chiral centers includes at least one chirality-controlled center that is a phosphorothioate in the Sp configuration.In some embodiments, the common base sequence includes a sequence having no more than 5 mismatches from the base sequence of UCAAGGAAGAUGGCAUUUCU, the oligonucleotide has a length of up to 30 bases, and the common pattern of backbone chiral centers includes at least one chirality-controlled center that is a phosphorothioate with an Sp configuration. In some embodiments, the common base sequence includes a sequence having no more than 5 mismatches from the base sequence of UCAAGGAAGAUGGCAUUUCU, the oligonucleotide has a length of up to 40 bases, and the common pattern of backbone chiral centers includes at least one chirality-controlled center that is a phosphorothioate with an Sp configuration. In some embodiments, the common base sequence includes a sequence having no more than 5 mismatches from the base sequence of UCAAGGAAGAUGGCAUUUCU, the oligonucleotide has a length of up to 50 bases, and the common pattern of backbone chiral centers includes at least one chirality-controlled center that is a phosphorothioate with an Sp configuration.

[0058] In some embodiments, the common base sequence is UCAAGGAAGAUGGCAUUUCU, and the common pattern of backbone chiral centers includes at least 3 centers with controlled chirality. In some embodiments, the common base sequence includes UCAAGGAAGAUGGCAUUUCU, the oligonucleotide has a length of up to 30 bases, and the common pattern of backbone chiral centers includes at least 3 centers with controlled chirality. In some embodiments, the common base sequence includes UCAAGGAAGAUGGCAUUUCU, the oligonucleotide has a length of up to 40 bases, and the common pattern of backbone chiral centers includes at least 3 centers with controlled chirality. In some embodiments, the common base sequence includes UCAAGGAAGAUGGCAUUUCU, the oligonucleotide has a length of up to 50 bases, and the common pattern of backbone chiral centers includes at least 3 centers with controlled chirality. In some embodiments, the common base sequence includes at least 15 consecutive bases of UCAAGGAAGAUGGCAUUUCU, the oligonucleotide has a length of up to 30 bases, and the common pattern of backbone chiral centers includes at least 3 centers with controlled chirality. In some embodiments, the common base sequence includes at least 15 consecutive bases of UCAAGGAAGAUGGCAUUUCU, the oligonucleotide has a length of up to 40 bases, and the common pattern of backbone chiral centers includes at least 3 centers with controlled chirality. In some embodiments, the common base sequence includes at least 15 consecutive bases of UCAAGGAAGAUGGCAUUUCU, the oligonucleotide has a length of up to 50 bases, and the common pattern of backbone chiral centers includes at least 3 centers with controlled chirality. In some embodiments, the common base sequence includes a sequence having 5 or fewer mismatches from the base sequence of UCAAGGAAGAUGGCAUUUCU, the oligonucleotide has a length of up to 30 bases, and the common pattern of backbone chiral centers includes at least 3 centers with controlled chirality.In some embodiments, the common base sequence includes a sequence having no more than 5 mismatches from the base sequence of UCAAGGAAGAUGGCAUUUCU, the oligonucleotide has a length of up to 40 bases, and the common pattern of backbone chiral centers includes at least 3 centers with controlled chirality. In some embodiments, the common base sequence includes a sequence having no more than 5 mismatches from the base sequence of UCAAGGAAGAUGGCAUUUCU, the oligonucleotide has a length of up to 50 bases, and the common pattern of backbone chiral centers includes at least 3 centers with controlled chirality.

[0059] In some embodiments, the common base sequence is UCAAGGAAGAUGGCAUUUCU, and the common pattern of backbone chiral centers includes at least 5 chirality-controlled centers each of which is a phosphorothioate with Sp configuration. In some embodiments, the common base sequence includes UCAAGGAAGAUGGCAUUUCU, the oligonucleotide has a length of up to 30 bases, and the common pattern of backbone chiral centers includes at least 5 chirality-controlled centers each of which is a phosphorothioate with Sp configuration. In some embodiments, the common base sequence includes UCAAGGAAGAUGGCAUUUCU, the oligonucleotide has a length of up to 40 bases, and the common pattern of backbone chiral centers includes at least 5 chirality-controlled centers each of which is a phosphorothioate with Sp configuration. In some embodiments, the common base sequence includes UCAAGGAAGAUGGCAUUUCU, the oligonucleotide has a length of up to 50 bases, and the common pattern of backbone chiral centers includes at least 5 chirality-controlled centers each of which is a phosphorothioate with Sp configuration. In some embodiments, the common base sequence includes at least 15 consecutive bases of UCAAGGAAGAUGGCAUUUCU, the oligonucleotide has a length of up to 30 bases, and the common pattern of backbone chiral centers includes at least 5 chirality-controlled centers each of which is a phosphorothioate with Sp configuration. In some embodiments, the common base sequence includes at least 15 consecutive bases of UCAAGGAAGAUGGCAUUUCU, the oligonucleotide has a length of up to 40 bases, and the common pattern of backbone chiral centers includes at least 5 chirality-controlled centers each of which is a phosphorothioate with Sp configuration. In some embodiments, the common base sequence includes at least 15 consecutive bases of UCAAGGAAGAUGGCAUUUCU, the oligonucleotide has a length of up to 50 bases, and the common pattern of backbone chiral centers includes at least 5 chirality-controlled centers each of which is a phosphorothioate with Sp configuration.In some embodiments, the common base sequence includes a sequence having no more than 5 mismatches from the base sequence of UCAAGGAAGAUGGCAUUUCU, the oligonucleotide has a length of up to 30 bases, and the common pattern of backbone chiral centers includes at least 5 chirality-controlled centers each of which is a phosphorothioate with an Sp configuration. In some embodiments, the common base sequence includes a sequence having no more than 5 mismatches from the base sequence of UCAAGGAAGAUGGCAUUUCU, the oligonucleotide has a length of up to 40 bases, and the common pattern of backbone chiral centers includes at least 5 chirality-controlled centers each of which is a phosphorothioate with an Sp configuration. In some embodiments, the common base sequence includes a sequence having no more than 5 mismatches from the base sequence of UCAAGGAAGAUGGCAUUUCU, the oligonucleotide has a length of up to 50 bases, and the common pattern of backbone chiral centers includes at least 5 chirality-controlled centers each of which is a phosphorothioate with an Sp configuration. In some embodiments, a mismatch is a difference in base sequence or length when two sequences are maximally aligned and compared. As a non-limiting example, a mismatch is counted if there is a difference between the base at a particular position in one sequence and the base at the corresponding position in another sequence. Thus, for example, if a particular base (e.g., A) is at one position within a sequence and a different base (e.g., G, C, or U) is at the corresponding position on another sequence, a mismatch is counted. If a base (e.g., A) is at one position within a sequence and there is no base at the corresponding position on another sequence (e.g., if that position is a abasic nucleotide that includes a phosphate-sugar backbone but no base), or if that position is skipped, a mismatch is also counted. A single-strand nick in either sequence (or the sense or antisense strand) may not be counted as a mismatch. For example, if one sequence includes the sequence 5'-AG-3' and another sequence includes the sequence 5'-AG-3' having a single-strand nick between A and G, a mismatch would not be counted. Base modifications are generally not considered to be mismatches.For example, if one array contains C and another array contains C modified at the same position (e.g., having a 2'-modification), the mismatch will not be counted.

[0060] In some embodiments, the common pattern of backbone chiral centers includes SSS, SSSS, SSSSS, SSSSSS, SSSSSSS, SOS, SSOSS, SSSOSSS, SSSSSOSSSS, SSSSSSOSSSSS, SSSSSSSOSSSSSS, SSSSSSSSOSSSSSSS, SSSSSSSSSOSSSSSSSS, SOSOSOSOS, SSOSOSOSOSS, SSSOSOSOSOSSS, SSSSOSOSOSOSSSS, SSSSSOSOSOSOSSSSS, SSSSSSOSOSOSOSSSSSS, SOSOSSOOS, SSOSOSSOOSS, SSSOSOSSOOSSS, SSSSOSOSSOOSSSS, SSSSSOSOSSOOSSSSS, SSSSSSOSOSSOOSSSSSS, SOSOOSOOS, SSOSOOSOOSS, SSSOSOOSOOSSS, SSSSOSOOSOOSSSS, SSSSSOSOOSOOSSSSS, SSSSSSOSOOSOOSSSSSS, SOSOSSOOS, SSOSOSSOOSO, SSSOSOSSOOSOS, SSSSOSOSSOOSOSS, SSSSSOSOSSOOSOSSS, SSSSSSOSOSSOOSOSSSS, SOSOOSOOSO, SSOSOOSOOSOS, SSSOSOOSOOSOS, SSSSOSOOSOOSOSS, SSSSSOSOOSOOSOSSS, SSSSSSOSOOSOOSOSSSS, SSOSOSSOO, SSSOSOSSOOS, SSSSOSOSSOOS, SSSSSOSOSSOOSS, SSSSSSOSOSSOOSSS, OSSSSSSOSOSSOOSSS, OOSSSSSSOSOSSOOS, OOSSSSSSOSOSSOOSS, OOSSSSSSOSOSSOOSSS, OOSSSSSSOSOSSOOSSSS, OOSSSSSSOSOSSOOSSSSS or OOSSSSSSOSOSSOOSSSSSS, where O is an achiral center and S is a chiral center with an Sp configuration.In some embodiments, the common pattern of backbone chiral centers is selected from SSS, SSSS, SSSSS, SSSSSS, SSSSSSS, SOS, SSOSS, SSSOSSS, SSSSOSSSS, SSSSSOSSSSS, SSSSSSOSSSSSS, SSSSSSSOSSSSSSS, SSSSSSSSOSSSSSSSS, SOSOSOSOS, SSOSOSOSOSS, SSSOSOSOSOSSS, SSSSOSOSOSOSSSS, SSSSSOSOSOSOSSSSS, SSSSSSOSOSOSOSSSSSS, SOSOSSOOS, SSOSOSSOOSS, SSSOSOSSOOSSS, SSSSOSOSSOOSSSS, SSSSSOSOSSOOSSSSS, SSSSSSOSOSSOOSSSSSS, SOSOOSOOS, SSOSOOSOOSS, SSSOSOOSOOSSS, SSSSOSOOSOOSSSS, SSSSSOSOOSOOSSSSS, SSSSSSOSOOSOOSSSSSS, SOSOSSOOS, SSOSOSSOOSO, SSSOSOSSOOSOS, SSSSOSOSSOOSOSS, SSSSSOSOSSOOSOSSS, SSSSSSOSOSSOOSOSSSS, SOSOOSOOSO, SSOSOOSOOSOS, SSSOSOOSOOSOS, SSSSOSOOSOOSOSS, SSSSSOSOOSOOSOSSS, SSSSSSOSOOSOOSOSSSS, SSOSOSSOO, SSSOSOSSOOS, SSSSOSOSSOOS, SSSSSOSOSSOOSS, SSSSSSOSOSSOOSSS, OSSSSSSOSOSSOOSSS, OOSSSSSSOSOSSOOS, OOSSSSSSOSOSSOOSS, OOSSSSSSOSOSSOOSSS, OOSSSSSSOSOSSOOSSSS, OOSSSSSSOSOSSOOSSSSS and OOSSSSSSOSOSSOOSSSSSS, where O is an achiral center and S is a chiral center in the Sp configuration. In some embodiments, the achiral center is a phosphodiester (natural phosphate bridge). In some embodiments, the chiral center in the Sp configuration is an Sp phosphorothioate bridge.

[0061] In some embodiments, the common pattern of backbone crosslinks comprises at least 10 modified nucleotide crosslinks. In some embodiments, the common pattern of backbone crosslinks comprises at least 11 modified nucleotide crosslinks. In some embodiments, the common pattern of backbone crosslinks comprises at least 12 modified nucleotide crosslinks. In some embodiments, the common pattern of backbone crosslinks comprises at least 13 modified nucleotide crosslinks. In some embodiments, the common pattern of backbone crosslinks comprises at least 14 modified nucleotide crosslinks. In some embodiments, the common pattern of backbone crosslinks comprises at least 15 modified nucleotide crosslinks. In some embodiments, the common pattern of backbone crosslinks comprises at least 16 modified nucleotide crosslinks. In some embodiments, the common pattern of backbone crosslinks comprises at least 17 modified nucleotide crosslinks. In some embodiments, the common pattern of backbone crosslinks comprises at least 18 modified nucleotide crosslinks. In some embodiments, the common pattern of backbone crosslinks comprises at least 19 modified nucleotide crosslinks. In some embodiments, the common pattern of backbone crosslinks comprises 19 or fewer modified nucleotide crosslinks. In some embodiments, the common pattern of backbone crosslinks comprises 18 or fewer modified nucleotide crosslinks. In some embodiments, the common pattern of backbone crosslinks comprises 17 or fewer modified nucleotide crosslinks. In some embodiments, the common pattern of backbone crosslinks comprises 16 or fewer modified nucleotide crosslinks. In some embodiments, the common pattern of backbone crosslinks comprises 15 or fewer modified nucleotide crosslinks. In some embodiments, the common pattern of backbone crosslinks comprises 14 or fewer modified nucleotide crosslinks. In some embodiments, the common pattern of backbone crosslinks comprises 14 to 18 modified nucleotide crosslinks. In some embodiments, the common pattern of backbone crosslinks comprises 13 to 19 modified nucleotide crosslinks.In some embodiments, the common pattern of the backbone crosslinks comprises between 12 and 20 modified nucleotide internucleotide crosslinks. In some embodiments, the common pattern of the backbone crosslinks comprises between 11 and 21 modified nucleotide internucleotide crosslinks. In some embodiments, the common pattern of the backbone crosslinks comprises 0 phosphodiesters. In some embodiments, the common pattern of the backbone crosslinks comprises 1 phosphodiester. In some embodiments, the common pattern of the backbone crosslinks comprises 2 phosphodiesters. In some embodiments, the common pattern of the backbone crosslinks comprises 3 phosphodiesters. In some embodiments, the common pattern of the backbone crosslinks comprises 4 phosphodiesters. In some embodiments, the common pattern of the backbone crosslinks comprises 5 phosphodiesters. In some embodiments, the common pattern of the backbone crosslinks comprises 6 phosphodiesters. In some embodiments, the common pattern of the backbone crosslinks comprises 7 phosphodiesters. In some embodiments, the common pattern of the backbone crosslinks comprises between 0 and 7 phosphodiesters. In some embodiments, the common pattern of the backbone crosslinks comprises between 1 and 6 phosphodiesters. In some embodiments, the common pattern of the backbone crosslinks comprises between 2 and 5 phosphodiesters. In some embodiments, the common pattern of the backbone crosslinks comprises between 3 and 4 phosphodiesters. In some embodiments, the common pattern of the backbone crosslinks comprises between 1 and 6 phosphodiesters and between 13 and 19 modified nucleotide internucleotide crosslinks. In some embodiments, the phosphodiesters may optionally be contiguous or non-contiguous. In some embodiments, the modified nucleotide internucleotide crosslinks may optionally be contiguous or non-contiguous.

[0062] In some embodiments, the common pattern of the backbone crosslinks includes at least 10 phosphorothioate crosslinks. In some embodiments, the common pattern of the backbone crosslinks includes at least 11 phosphorothioate crosslinks. In some embodiments, the common pattern of the backbone crosslinks includes at least 12 phosphorothioate crosslinks. In some embodiments, the common pattern of the backbone crosslinks includes at least 13 phosphorothioate crosslinks. In some embodiments, the common pattern of the backbone crosslinks includes at least 14 phosphorothioate crosslinks. In some embodiments, the common pattern of the backbone crosslinks includes at least 15 phosphorothioate crosslinks. In some embodiments, the common pattern of the backbone crosslinks includes at least 16 phosphorothioate crosslinks. In some embodiments, the common pattern of the backbone crosslinks includes at least 17 phosphorothioate crosslinks. In some embodiments, the common pattern of the backbone crosslinks includes at least 18 phosphorothioate crosslinks. In some embodiments, the common pattern of the backbone crosslinks includes at least 19 phosphorothioate crosslinks. In some embodiments, the common pattern of the backbone crosslinks includes 19 or fewer phosphorothioate crosslinks. In some embodiments, the common pattern of the backbone crosslinks includes 18 or fewer phosphorothioate crosslinks. In some embodiments, the common pattern of the backbone crosslinks includes 17 or fewer phosphorothioate crosslinks. In some embodiments, the common pattern of the backbone crosslinks includes 16 or fewer phosphorothioate crosslinks. In some embodiments, the common pattern of the backbone crosslinks includes 15 or fewer phosphorothioate crosslinks. In some embodiments, the common pattern of the backbone crosslinks includes 14 or fewer phosphorothioate crosslinks. In some embodiments, the common pattern of the backbone crosslinks includes 14 to 18 phosphorothioate crosslinks. In some embodiments, the common pattern of the backbone crosslinks includes 13 to 19 phosphorothioate crosslinks. In some embodiments, the common pattern of the backbone crosslinks includes 12 to 20 phosphorothioate crosslinks.In some embodiments, the common pattern of backbone crosslinks includes 11 to 21 phosphorothioate crosslinks. In some embodiments, the common pattern of backbone crosslinks includes 0 phosphodiesters. In some embodiments, the common pattern of backbone crosslinks includes 1 phosphodiester. In some embodiments, the common pattern of backbone crosslinks includes 2 phosphodiesters. In some embodiments, the common pattern of backbone crosslinks includes 3 phosphodiesters. In some embodiments, the common pattern of backbone crosslinks includes 4 phosphodiesters. In some embodiments, the common pattern of backbone crosslinks includes 5 phosphodiesters. In some embodiments, the common pattern of backbone crosslinks includes 6 phosphodiesters. In some embodiments, the common pattern of backbone crosslinks includes 7 phosphodiesters. In some embodiments, the common pattern of backbone crosslinks includes 0 to 7 phosphodiesters. In some embodiments, the common pattern of backbone crosslinks includes 1 to 6 phosphodiesters. In some embodiments, the common pattern of backbone crosslinks includes 2 to 5 phosphodiesters. In some embodiments, the common pattern of backbone crosslinks includes 3 to 4 phosphodiesters. In some embodiments, the common pattern of backbone crosslinks includes 1 to 6 phosphodiesters and 13 to 19 phosphorothioate crosslinks. In some embodiments, the phosphodiesters may optionally be contiguous or non-contiguous. In some embodiments, the phosphorothioate crosslinks may optionally be contiguous or non-contiguous.

[0063] In some embodiments, the common pattern of backbone chiral centers includes at least 5 nucleotide cross-links in the Sp configuration. In some embodiments, the common pattern of backbone chiral centers includes at least 6 nucleotide cross-links in the Sp configuration. In some embodiments, the common pattern of backbone chiral centers includes at least 7 nucleotide cross-links in the Sp configuration. In some embodiments, the common pattern of backbone chiral centers includes at least 8 nucleotide cross-links in the Sp configuration. In some embodiments, the common pattern of backbone chiral centers includes at least 9 nucleotide cross-links in the Sp configuration. In some embodiments, the common pattern of backbone chiral centers includes at least 10 nucleotide cross-links in the Sp configuration. In some embodiments, the common pattern of backbone chiral centers includes at least 11 nucleotide cross-links in the Sp configuration. In some embodiments, the common pattern of backbone chiral centers includes at least 12 nucleotide cross-links in the Sp configuration. In some embodiments, the common pattern of backbone chiral centers includes at least 13 nucleotide cross-links in the Sp configuration. In some embodiments, the common pattern of backbone chiral centers includes at least 14 nucleotide cross-links in the Sp configuration. In some embodiments, the common pattern of backbone chiral centers includes at least 15 nucleotide cross-links in the Sp configuration. In some embodiments, the common pattern of backbone chiral centers includes at least 16 nucleotide cross-links in the Sp configuration. In some embodiments, the common pattern of backbone chiral centers includes at least 17 nucleotide cross-links in the Sp configuration. In some embodiments, the common pattern of backbone chiral centers includes at least 18 nucleotide cross-links in the Sp configuration. In some embodiments, the common pattern of backbone chiral centers includes at least 19 nucleotide cross-links in the Sp configuration. In some embodiments, the common pattern of backbone chiral centers includes at most 8 nucleotide cross-links in the Rp configuration. In some embodiments, the common pattern of backbone chiral centers includes at most 7 nucleotide cross-links in the Rp configuration.In some embodiments, the common pattern of backbone chiral centers includes nucleotide cross-bridges of six or fewer in the Rp configuration. In some embodiments, the common pattern of backbone chiral centers includes nucleotide cross-bridges of five or fewer in the Rp configuration. In some embodiments, the common pattern of backbone chiral centers includes nucleotide cross-bridges of four or fewer in the Rp configuration. In some embodiments, the common pattern of backbone chiral centers includes nucleotide cross-bridges of three or fewer in the Rp configuration. In some embodiments, the common pattern of backbone chiral centers includes nucleotide cross-bridges of two or fewer in the Rp configuration. In some embodiments, the common pattern of backbone chiral centers includes nucleotide cross-bridges of one or fewer in the Rp configuration. In some embodiments, the common pattern of backbone chiral centers includes non-chiral (as a non-limiting example, phosphodiester) nucleotide cross-bridges of eight or fewer. In some embodiments, the common pattern of backbone chiral centers includes non-chiral nucleotide cross-bridges of seven or fewer. In some embodiments, the common pattern of backbone chiral centers includes non-chiral nucleotide cross-bridges of six or fewer. In some embodiments, the common pattern of backbone chiral centers includes non-chiral nucleotide cross-bridges of five or fewer. In some embodiments, the common pattern of backbone chiral centers includes non-chiral nucleotide cross-bridges of four or fewer. In some embodiments, the common pattern of backbone chiral centers includes non-chiral nucleotide cross-bridges of three or fewer. In some embodiments, the common pattern of backbone chiral centers includes non-chiral nucleotide cross-bridges of two or fewer. In some embodiments, the common pattern of backbone chiral centers includes non-chiral nucleotide cross-bridges of one or fewer. In some embodiments, the common pattern of backbone chiral centers includes at least 10 nucleotide cross-bridges in the Sp configuration and non-chiral nucleotide cross-bridges of eight or fewer. In some embodiments, the common pattern of backbone chiral centers includes at least 11 nucleotide cross-bridges in the Sp configuration and non-chiral nucleotide cross-bridges of seven or fewer.In some embodiments, the common pattern of backbone chiral centers includes at least 12 nucleotide crosslinks in the Sp configuration and no more than 6 achiral nucleotide crosslinks. In some embodiments, the common pattern of backbone chiral centers includes at least 13 nucleotide crosslinks in the Sp configuration and no more than 6 achiral nucleotide crosslinks. In some embodiments, the common pattern of backbone chiral centers includes at least 14 nucleotide crosslinks in the Sp configuration and no more than 5 achiral nucleotide crosslinks. In some embodiments, the common pattern of backbone chiral centers includes at least 15 nucleotide crosslinks in the Sp configuration and no more than 4 achiral nucleotide crosslinks. In some embodiments, the nucleotide crosslinks in the Sp configuration may or may not be continuous. In some embodiments, the nucleotide crosslinks in the Rp configuration may or may not be continuous. In some embodiments, the achiral nucleotide crosslinks may or may not be continuous.

[0064] The wing and the core can be defined by any structural element. In some embodiments, the wing and the core are defined by nucleoside modifications, and the wing contains nucleoside modifications that are not present in the core region. In some embodiments, the oligonucleotides in the provided compositions have a nucleoside-modified wing-core structure. In some embodiments, the oligonucleotides in the provided compositions have a nucleoside-modified core-wing structure. In some embodiments, the oligonucleotides in the provided compositions have a nucleoside-modified wing-core-wing structure. In some embodiments, the wing and the core are defined by modifications of the sugar moiety. In some embodiments, the wing and the core are defined by modifications of the base moiety. In some embodiments, each sugar moiety in the wing region has the same 2'-modification that is not found in the core region. In some embodiments, each sugar moiety in the wing region has the same 2'-modification that is different from any sugar modification in the core region. In some embodiments, each sugar moiety in the wing region has the same 2'-modification and the core region has no 2'-modification. In some embodiments, when there are two or more wings, each sugar moiety in one wing region has the same 2'-modification, but the common 2'-modification in the first wing region may be the same as or different from the common 2'-modification in the second wing region. In some embodiments, the wing and the core are defined by the pattern of backbone nucleotide cross-links. In some embodiments, the wing contains certain nucleotide cross-links and / or a pattern of nucleotide cross-links that are not found in the core. In some embodiments, the wing region contains both modified nucleotide cross-links and native phosphate cross-links. In some embodiments, the nucleotide cross-link at the 5'-end of the wing relative to the 5'-end of the core region is a modified nucleotide cross-link. In some embodiments, the nucleotide cross-link at the 3'-end of the wing relative to the 3'-end of the core region is a modified nucleotide cross-link.In some embodiments, the modified nucleotide crosslink is a chiral nucleotide crosslink.

[0065] In some embodiments, the wing comprises at least 3 2'-F modifications. In some embodiments, the wing comprises at least 4 2'-F modifications. In some embodiments, the wing comprises at least 5 2'-F modifications. In some embodiments, the wing comprises at least 6 2'-F modifications. In some embodiments, the wing comprises at least 3 consecutive 2'-F modifications. In some embodiments, the wing comprises at least 4 consecutive 2'-F modifications. In some embodiments, the wing comprises at least 5 consecutive 2'-F modifications. In some embodiments, the wing comprises at least 6 consecutive 2'-F modifications. In some embodiments, the nucleotide crosslink of each nucleotide unit having one of the consecutive 2'-F modifications is a modified nucleotide crosslink. In some embodiments, the nucleotide crosslink of each nucleotide unit having one of the consecutive 2'-F modifications is independently an Sp chiral nucleotide crosslink. In some embodiments, the nucleotide crosslink of each nucleotide unit having one of the consecutive 2'-F modifications is an Sp phosphorothioate bridge. In some embodiments, the core is a 2'-F modification, 2'-OR 1It includes any two or more of the modifications or 2'-OH. In some embodiments, the core includes any two or more of the 2'-F modification, 2'-OMe modification, or 2'-OH. In some embodiments, the core includes at least one 2'-OMe modification. In some embodiments, the core includes at least two 2'-OMe modifications. In some embodiments, the core includes at least three 2'-OMe modifications. In some embodiments, the core includes at least two 2'-OMe modifications. In some embodiments, the core includes at least four 2'-OMe modifications. In some embodiments, the core includes at least one 2'-F modification. In some embodiments, the core includes at least two 2'-F modifications. In some embodiments, the core includes at least three 2'-F modifications. In some embodiments, the core includes at least two 2'-F modifications. In some embodiments, the core includes at least four 2'-F modifications. In some embodiments, the core includes at least one 2'-F modification and at least one 2'-OMe modification. In some embodiments, the core includes at least one 2'-F modification and at least two 2'-OMe modifications. In some embodiments, the core includes at least two 2'-F modifications and at least one 2'-OMe modification. In some embodiments, the core includes at least two 2'-F modifications and at least two 2'-OMe modifications. In some embodiments, the 2'-F modifications in the core and / or the wing are continuous or discontinuous. In some embodiments, the 2'-OMe modifications in the core and / or the wing are continuous or discontinuous. In some embodiments, the 2'-OH in the core and / or the wing is continuous or discontinuous. In some embodiments, the core includes one or more natural phosphate linkages.

[0066] In some embodiments, each wing comprises at least one chiral nucleotide cross-bridge and at least one native phosphate cross-bridge. In some embodiments, each wing comprises at least one modified sugar moiety. In some embodiments, the sugar moiety of each wing is modified. In some embodiments, the sugar moiety of the wing is modified by a modification that is not present in the core region. In some embodiments, the wing region has modified nucleotide cross-bridges only at one or both of its ends. In some embodiments, the wing region has modified nucleotide cross-bridges only at its 5'-end. In some embodiments, the wing region has modified nucleotide cross-bridges only at its 3'-end. In some embodiments, the wing region has modified nucleotide cross-bridges only at its 5'-end and 3'-ends. In some embodiments, the wing is relative to the 5'-end of the core, and the wing has modified nucleotide cross-bridges only at its 5'-end. In some embodiments, the wing is relative to the 5'-end of the core, and the wing has modified nucleotide cross-bridges only at its 3'-end. In some embodiments, the wing is relative to the 5'-end of the core, and the wing has modified nucleotide cross-bridges only at both its 5'-end and 3'-ends. In some embodiments, the wing is relative to the 3'-end of the core, and the wing has modified nucleotide cross-bridges only at its 5'-end. In some embodiments, the wing is relative to the 3'-end of the core, and the wing has modified nucleotide cross-bridges only at its 3'-end. In some embodiments, the wing is relative to the 3'-end of the core, and the wing has modified nucleotide cross-bridges only at both its 5'-end and 3'-ends.

[0067] In some embodiments, each nucleotide cross-bridge in the core region is modified. In some embodiments, each nucleotide cross-bridge in the core region is chiral. In some embodiments, the core region comprises a pattern of chiral centers of a backbone of (Sp)m(Rp)n, (Rp)n(Sp)m, (Np)t(Rp)n(Sp)m or (Sp)t(Rp)n(Sp)m. In some embodiments, the pattern of chiral centers of the backbone of the core region is (Sp)m(Rp)n, (Rp)n(Sp)m, (Np)t(Rp)n(Sp)m or (Sp)t(Rp)n(Sp)m. In some embodiments, the core region comprises a pattern of chiral centers of a backbone of (Rp)n(Sp)m, (Np)t(Rp)n(Sp)m or (Sp)t(Rp)n(Sp)m, where m>2. In some embodiments, the pattern of chiral centers of the backbone of the core region is (Sp)m(Rp)n, (Rp)n(Sp)m, (Np)t(Rp)n(Sp)m or (Sp)t(Rp)n(Sp)m, where m>2. In particular, in some embodiments, such patterns can provide or enhance the controlled cleavage of a target sequence (e.g., an RNA sequence).

[0068] In some embodiments, the wing comprises at least 4 phosphorothioates (phosphorothioate bridges). In some embodiments, the wing comprises at least 5 phosphorothioates. In some embodiments, the wing comprises at least 6 phosphorothioates. In some embodiments, the core comprises at least 2 phosphorothioates. In some embodiments, the core comprises at least 3 phosphorothioates. In some embodiments, the core comprises at least 4 phosphorothioates. In some embodiments, the core comprises at least 5 phosphorothioates. In some embodiments, the core comprises at least 6 phosphorothioates. In some embodiments, the core comprises at least 2 phosphodiesters (natural phosphate bridges). In some embodiments, the core comprises at least 3 phosphodiesters. In some embodiments, the core comprises at least 4 phosphodiesters. In some embodiments, the core comprises at least 5 phosphodiesters. In some embodiments, the core comprises at least 6 phosphodiesters. In some embodiments, the core comprises at least 1 phosphodiester and at least 1 phosphorothioate. In some embodiments, the core comprises at least 1 phosphodiester and at least 2 phosphorothioates. In some embodiments, the core comprises at least 2 phosphodiesters and at least 1 phosphorothioate. In some embodiments, the core comprises at least 2 phosphodiesters and at least 2 phosphorothioates. In some embodiments, the core comprises at least 2 phosphodiesters and at least 3 phosphorothioates. In some embodiments, the core comprises at least 3 phosphodiesters and at least 2 phosphorothioates. In some embodiments, the core comprises at least 3 phosphodiesters and at least 3 phosphorothioates.In some embodiments, the phosphodiesters in the core and / or one or both wings may or may not be continuous. In some embodiments, the phosphorothioates in the core and / or one or both wings may or may not be continuous.

[0069] In some embodiments, the oligonucleotides in the provided composition have a common pattern of backbone phosphorus modification. In some embodiments, the provided composition is an oligonucleotide composition that is chirally controlled in that it contains a predetermined level of oligonucleotides of an individual oligonucleotide type, where the oligonucleotide type is: 1) Base sequence; 2) Pattern of backbone linkages; 3) Pattern of backbone chiral centers; and 4) Pattern of backbone phosphorus modification as defined by.

[0070] As described above and as understood in the art, in some embodiments, the base sequence of the oligonucleotide may refer to the identity and / or modified state of the nucleoside residues (e.g., sugar component and / or base component compared to standard natural nucleotides such as adenine, cytosine, guanosine, thymine, and uracil) within the oligonucleotide, and / or the hybridization properties (i.e., the ability to hybridize with specific complementary residues) of such residues.

[0071] In some embodiments, a particular oligonucleotide type may be 1A) Base identity; 1B) Pattern of base modification; 1C) Pattern of sugar modification; 2) Pattern of backbone linkages; 3) Pattern of backbone chiral centers; and 4) Pattern of backbone phosphorus modification as defined by. Thus, in some embodiments, specific types of oligonucleotides may share the same bases, but may have different patterns of base modifications and / or sugar modifications. In some embodiments, specific types of oligonucleotides may share the same bases and pattern of base modifications (e.g., including the absence of base modifications), but may have different patterns of sugar modifications.

[0072] In some embodiments, specific types of oligonucleotides have the same base sequence (including length), the same pattern of chemical modifications to the sugar and base moieties, the same pattern of backbone linkages (e.g., patterns of natural phosphate linkages, phosphorothioate linkages, phosphorothioate triesters, and combinations thereof), the same pattern of backbone chiral centers (e.g., the stereochemistry (Rp / Sp) pattern of chiral internucleotide linkages), and the same pattern of backbone phosphorus modifications (e.g., -S - , and the pattern of modifications to internucleotide phosphorus atoms such as -L-R of formula I 1 and are chemically identical in this regard.

[0073] In some embodiments, the present disclosure provides oligonucleotide compositions with controlled oligonucleotide chirality for oligonucleotides comprising a plurality (e.g., 5, 6, 7, 8, 9, or more than 10) nucleotide crosslinks, particularly a plurality (e.g., 5, 6, 7, 8, 9, or more than 10) chiral nucleotide crosslinks. In some embodiments, in a stereorandom or racemic preparation of an oligonucleotide, at least one chiral nucleotide crosslink is made with a diastereoselectivity less than 90:10, 95:5, 96:4, 97:3, or 98:2. In some embodiments, in a stereoselective or chirality-controlled preparation of an oligonucleotide, each chiral nucleotide crosslink is made with a diastereoselectivity greater than 90:10, 95:5, 96:4, 97:3, or 98:2. In some embodiments, in a stereoselective or chirality-controlled preparation of an oligonucleotide, each chiral nucleotide crosslink is made with a diastereoselectivity greater than 95:5. In some embodiments, in a stereoselective or chirality-controlled preparation of an oligonucleotide, each chiral nucleotide crosslink is made with a diastereoselectivity greater than 96:4. In some embodiments, in a stereoselective or chirality-controlled preparation of an oligonucleotide, each chiral nucleotide crosslink is made with a diastereoselectivity greater than 97:3. In some embodiments, in a stereoselective or chirality-controlled preparation of an oligonucleotide, each chiral nucleotide crosslink is made with a diastereoselectivity greater than 98:2. In some embodiments, in a stereoselective or chirality-controlled preparation of an oligonucleotide, each chiral nucleotide crosslink is made with a diastereoselectivity greater than 99:1.In some embodiments, the diastereoselectivity of the chiral nucleotide internucleotide bridge in the oligonucleotide may be measured by a model reaction (e.g., generation of a dimer under essentially the same conditions or comparable conditions where the dimer has the same internucleotide bridge as the chiral nucleotide internucleotide bridge, the 5'-nucleoside of the dimer is the same as the nucleoside relative to the 5'-end of the chiral nucleotide internucleotide bridge, and the 3'-nucleoside of the dimer is the same as the nucleoside relative to the 3'-end of the chiral nucleotide internucleotide bridge).

[0074] In particular, the present disclosure provides oligonucleotide compositions and techniques for optimizing properties such as activity, toxicity, and the like. In some embodiments, the present disclosure provides methods for reducing the toxicity of oligonucleotides and their compositions. In some embodiments, the present disclosure provides methods for reducing an immune response associated with the administration of oligonucleotides and their compositions (i.e., methods of administering an oligonucleotide composition in which an unwanted immune response to the oligonucleotide in the composition is reduced relative to, for example, that observed using a reference composition of nucleotides of a comparable or identical nucleotide sequence). In some embodiments, the present disclosure provides methods for reducing complement activation associated with the administration of oligonucleotides and their compositions. In some embodiments, the present disclosure provides methods for improving the protein binding profile of oligonucleotides and their compositions. In some embodiments, the present disclosure provides methods for enhancing the binding of oligonucleotides and their compositions to a specific protein. In some embodiments, the present disclosure provides methods for enhancing the delivery of oligonucleotides and their compositions. In particular, the present disclosure encompasses the recognition that, in some embodiments, optimal delivery of an oligonucleotide to a target involves a balance between the binding of the oligonucleotide to a specific protein such that the oligonucleotide can be carried to a desired location, and the release of the oligonucleotide from the specific protein such that the oligonucleotide can appropriately exert desired functions such as hybridization to these targets, cleavage of these targets, inhibition of translation, modulation of the transcription process. As illustrated in the present disclosure, the present disclosure recognizes that improvements in oligonucleotide properties can, in particular, be achieved by chemical modification and / or stereochemistry.

[0075] As described herein, the provided compositions and methods can alter the splicing of transcripts. In some embodiments, the provided compositions and methods provide an improved splicing pattern of a transcript as compared to a reference condition selected from the group consisting of the absence of the composition, the presence of a reference composition, and combinations thereof. The improvement can be an improvement in any desired biological function. In some embodiments, e.g., in DMD, the improvement is the production of mRNA that produces dystrophin protein with improved biological activity. In some other embodiments, e.g., the improvement is the downregulation of STAT3, HNRNPH1 and / or KDR to reduce tumor progression, malignancy and angiogenesis by nonsense mutation-dependent decay (DSD-NMD) induced by forced splicing.

[0076] In some embodiments, the disclosure provides a method of altering the splicing of a target transcript, the method comprising administering a composition comprising a first plurality of oligonucleotides, wherein the splicing of the target transcript is altered relative to a reference condition selected from the group consisting of the absence of the composition, the presence of a reference composition, and combinations thereof.

[0077] In some embodiments, the disclosure provides a method of generating a set of spliced products from a target transcript, the method comprising contacting, for a predetermined amount of time and under conditions sufficient to generate a set of spliced products different from the set generated under a reference condition selected from the group consisting of the absence of the composition, the presence of a reference composition, and combinations thereof, a splicing system comprising the target transcript with an oligonucleotide composition comprising a first plurality of oligonucleotides.

[0078] As is widely known in the art, many diseases and / or conditions are associated with transcriptional splicing. See, for example, Garcia-Blanco et al., Alternative splicing in disease and therapy, Nat. Biotechnol. May 2004;22(5):535-46; Wang et al., Splicing in disease: disruption of the splicing code and the decoding machinery, Nat. Rev. Genet. Oct. 2007;8(10):749-61; Havens et al., Targeting RNA splicing for disease therapy, Wiley Interdiscip. Rev. RNA. May-Jun. 2013;4(3):247-66. In some embodiments, the present disclosure provides compositions and methods for treating or preventing a disease.

[0079] In some embodiments, the present disclosure provides a method for treating or preventing a disease, comprising administering to a subject an oligonucleotide composition described herein.

[0080] In some embodiments, the present disclosure (1) having a common base sequence complementary to a target sequence in a transcript; (2) comprising administering to a subject an oligonucleotide composition comprising a first plurality of oligonucleotides comprising one or more modified sugar moieties and modified internucleotide linkages, wherein when the oligonucleotide composition contacts the transcript in a transcriptional splicing system, splicing of the transcript is altered relative to that observed under reference conditions selected from the group consisting of the absence of the composition, the presence of a reference composition, and combinations thereof, a method for treating or preventing a disease.

[0081] In some embodiments, the present disclosure (1) a base sequence; (2) Skeletal crosslinking pattern; (3) Pattern of chiral centers in the skeleton; and (4) Pattern of phosphorus modification of the skeleton administering to a subject an oligonucleotide composition comprising a first plurality of oligonucleotides of a particular oligonucleotide type defined by, the composition being chirally controlled in that the oligonucleotides of the particular oligonucleotide type are enriched relative to a substantially racemic preparation of oligonucleotides having the same base sequence, wherein when the oligonucleotide composition contacts a transcript in a transcription splicing system, splicing of the transcript is altered relative to that observed under reference conditions selected from the group consisting of the absence of the composition, the presence of a reference composition, and combinations thereof, to provide a method for treating or preventing a disease.

[0082] In some embodiments, the disease is one in which, after administration of the provided composition, one or more spliced transcripts repair, recover, or introduce a new beneficial function. For example, in DMD, after skipping one or more exons, the function of dystrophin can be restored, or partially restored, via a cleaved but (partially) active form. In some embodiments, the disease is one in which, after administration of the provided composition, one or more spliced transcripts repair and the gene is effectively knocked down by altering the splicing of the gene transcript.

[0083] In some embodiments, the disease is Duchenne muscular dystrophy. In some embodiments, the disease is spinal muscular atrophy. In some embodiments, the disease is cancer.

[0084] In some embodiments, the present disclosure provides a method of treating a disease by administering a composition comprising a first plurality of oligonucleotides having a common nucleotide sequence that shares a common base sequence and wherein the nucleotide sequence is complementary to a target sequence of a target transcript. The improvement comprises using a stereocontrolled oligonucleotide composition, which as an oligonucleotide composition, when contacted with a transcript in a transcription splicing system, causes the splicing of the transcript to be altered relative to that observed under reference conditions selected from the group consisting of the absence of the composition, the presence of a reference composition, and combinations thereof.

[0085] In some embodiments, the present disclosure provides a method of treating a disease by administering a composition comprising a first plurality of oligonucleotides having a common nucleotide sequence that shares a common base sequence and wherein the nucleotide sequence is complementary to a target sequence of a target transcript. The improvement comprises using a stereocontrolled oligonucleotide composition, which as an oligonucleotide composition, when contacted with a transcript in a transcription splicing system, causes the splicing of the transcript to be altered relative to that observed under reference conditions selected from the group consisting of the absence of the composition, the presence of a reference composition, and combinations thereof.

[0086] In some embodiments, the common sequence comprises a sequence selected from Table A1. In some embodiments, the common sequence is a sequence selected from Table A1.

[0087] In some embodiments, the present disclosure is a method of administering an oligonucleotide composition comprising a first plurality of oligonucleotides having a common nucleotide sequence, Administering an oligonucleotide composition comprising a first plurality of oligonucleotides with controlled chirality, wherein the first plurality of oligonucleotides are characterized by lower toxicity compared to a reference oligonucleotide composition having the same common nucleotide sequence, thereby providing an improved method.

[0088] In some embodiments, the present disclosure provides a method of administering an oligonucleotide composition comprising a first plurality of oligonucleotides having a common nucleotide sequence, wherein the method comprises administering an oligonucleotide composition in which each oligonucleotide of the plurality of oligonucleotides comprises one or more modified sugar moieties, and the composition is characterized by lower toxicity compared to a reference oligonucleotide composition having the same common nucleotide sequence but lacking at least one of the one or more modified sugar moieties, thereby providing an improved method.

[0089] In some embodiments, the present disclosure provides a method of administering an oligonucleotide composition comprising a first plurality of oligonucleotides having a common nucleotide sequence, wherein the method comprises administering an oligonucleotide composition in which each oligonucleotide of the plurality of oligonucleotides comprises one or more natural phosphate linkages and one or more modified phosphate linkages, and the oligonucleotide composition is characterized by lower toxicity when tested in at least one assay measured using a corresponding reference composition except that the oligonucleotide does not comprise a natural phosphate linkage, thereby providing an improved method.

[0090] In some embodiments, the present disclosure provides a method of administering an oligonucleotide composition comprising a first plurality of oligonucleotides having a common nucleotide sequence, Administering an oligonucleotide composition in which each oligonucleotide among a plurality of oligonucleotides comprises one or more modified sugar moieties, the composition being less toxic compared to a reference oligonucleotide composition having the same common nucleotide sequence but lacking at least one of the one or more modified sugar moieties, which is an improvement method characterized by this.

[0091] In some embodiments, the present disclosure provides a method comprising administering to a subject an oligonucleotide composition comprising a first plurality of oligonucleotides each having a common base sequence and comprising a modified sugar moiety, wherein the oligonucleotide composition has the same common base sequence but comprises a plurality of reference oligonucleotides that do not comprise a modified sugar moiety, and is less toxic when tested in at least one assay measured using a corresponding reference composition.

[0092] In some embodiments, the present disclosure provides a method comprising administering to a subject an oligonucleotide composition comprising a first plurality of oligonucleotides each having a common base sequence and comprising one or more natural phosphate linkages and one or more modified phosphate linkages, wherein the oligonucleotide composition has the same common base sequence but comprises a plurality of reference oligonucleotides that do not comprise natural phosphate linkages, and is less toxic when tested in at least one assay measured using a corresponding reference composition.

[0093] In some embodiments, the present disclosure provides a method comprising administering to a subject an oligonucleotide composition with controlled chirality, wherein the oligonucleotide composition with controlled chirality comprises oligonucleotides having the same base sequence and comprises an oligonucleotide composition with different controlled chirality or a stereorandom oligonucleotide composition, and is less toxic when tested in at least one assay measured using a corresponding reference oligonucleotide composition.

[0094] In some embodiments, the reduction in toxicity is a reduction in complement activation or includes a reduction in complement activation. In some embodiments, the reduction in toxicity includes a reduction in complement activation. In some embodiments, the reduction in toxicity is a reduction in complement activation or includes a reduction in complement activation. In some embodiments, the reduction in toxicity includes a reduction in complement activation via an alternative pathway.

[0095] In some embodiments, the oligonucleotide can induce an inflammatory response. In some embodiments, the present disclosure provides compositions and methods for reducing inflammation. In some embodiments, the present disclosure provides compositions and methods for reducing an inflammatory response. In some embodiments, the present disclosure provides a method for reducing inflammation at an injection site using the provided composition. In some embodiments, the present disclosure provides a method for reducing drug-induced vascular damage using the provided composition.

[0096] In some embodiments, the present disclosure is a method comprising administering a composition comprising a first plurality of oligonucleotides, wherein the composition exhibits a reduction in inflammation at the injection site as compared to a reference composition comprising a plurality of oligonucleotides, each of the plurality of reference oligonucleotides also having a common base sequence, but the first plurality of oligonucleotides differ from the individual oligonucleotides in the plurality of reference oligonucleotides differ from each other in stereochemical structure; and / or at least some of the oligonucleotides in the plurality of reference oligonucleotides have a structure different from the structure represented by the plurality of oligonucleotides of the composition; and / or at least some of the oligonucleotides in the plurality of reference oligonucleotides are structurally different in that they do not include a wing region and a core region, a method is provided.

[0097] In some embodiments, the present disclosure provides a method of administering an oligonucleotide composition comprising a first plurality of oligonucleotides having a common nucleotide sequence, which comprises administering an oligonucleotide comprising a first plurality of oligonucleotides, which is characterized by lower inflammation at the injection site compared to a reference oligonucleotide composition of the same common nucleotide sequence.

[0098] In some embodiments, the present disclosure provides a method comprising administering a composition comprising a first plurality of oligonucleotides, wherein the composition exhibits altered protein binding compared to a reference composition comprising a plurality of oligonucleotides, and each of the reference plurality of oligonucleotides has a common base sequence, but the first plurality of oligonucleotides the individual oligonucleotides in the reference plurality of oligonucleotides differ from each other in stereochemical structure; and / or at least some of the oligonucleotides in the reference plurality of oligonucleotides have a structure different from the structure represented by the plurality of oligonucleotides of the composition; and / or at least some of the oligonucleotides in the reference plurality of oligonucleotides are structurally different in that they do not include a wing region and a core region.

[0099] In some embodiments, the present disclosure provides a method of administering an oligonucleotide composition comprising a first plurality of oligonucleotides having a common nucleotide sequence, which comprises administering an oligonucleotide composition comprising a first plurality of oligonucleotides, which is characterized by altered protein binding compared to a reference oligonucleotide composition of the same common nucleotide sequence.

[0100] In some embodiments, the present disclosure provides a method comprising administering a composition comprising a first plurality of oligonucleotides, wherein the composition exhibits improved delivery as compared to a reference composition comprising a plurality of oligonucleotides, and wherein each of the plurality of reference oligonucleotides has a common nucleotide sequence but differs from the first plurality of oligonucleotides in that individual oligonucleotides among the plurality of reference oligonucleotides differ from each other in stereochemical structure; and / or at least some of the plurality of reference oligonucleotides have a structure different from the structure represented by the plurality of oligonucleotides of the composition; and / or at least some of the plurality of reference oligonucleotides are structurally different in that they do not include a wing region and a core region.

[0101] In some embodiments, the present disclosure provides a method of administering an oligonucleotide composition comprising a first plurality of oligonucleotides having a common nucleotide sequence, wherein the improvement comprises administering the first plurality of oligonucleotides, which is characterized by improved delivery as compared to a reference oligonucleotide composition having the same common nucleotide sequence.

[0102] In some embodiments, the present disclosure provides a composition comprising a composition of an oligonucleotide having controlled chirality selected from WV-887, WV-892, WV-896, WV-1714, WV-2444, WV-2445, WV-2526, WV-2527, WV-2528, WV-2530, WV-2531, WV-2578, WV-2580, WV-2587, WV-3047, WV-3152, WV-3472, WV-3473, WV-3507, WV-3508, WV-3509, WV-3510, WV-3511, WV-3512, WV-3513, WV-3514, WV-3515, WV-3545, and WV-3546. In some embodiments, the present disclosure provides a composition comprising a composition of an oligonucleotide having controlled chirality selected from WV-887, WV-892, WV-896, WV-1714, WV-2444, WV-2445, WV-2526, WV-2527, WV-2528, and WV-2530. In some embodiments, the present disclosure provides a composition of an oligonucleotide having controlled chirality selected from WV-887, WV-892, WV-896, WV-1714, WV-2444, WV-2445, WV-2526, WV-2527, WV-2528, WV-2530, WV-2531, WV-2578, WV-2580, WV-2587, WV-3047, WV-3152, WV-3472, WV-3473, WV-3507, WV-3508, WV-3509, WV-3510, WV-3511, WV-3512, WV-3513, WV-3514, WV-3515, WV-3545, or WV-3546. In some embodiments, the present disclosure provides a composition of an oligonucleotide having controlled chirality of WV-887. In some embodiments, the present disclosure provides a composition of an oligonucleotide having controlled chirality of WV-892. In some embodiments, the present disclosure provides a composition of an oligonucleotide having controlled chirality of WV-896. In some embodiments, the present disclosure provides a composition of an oligonucleotide having controlled chirality of WV-1714. In some embodiments, the present disclosure provides a composition of an oligonucleotide having controlled chirality of WV-2444.In some embodiments, the present disclosure provides oligonucleotide compositions with controlled chirality of WV-2445. In some embodiments, the present disclosure provides oligonucleotide compositions with controlled chirality of WV-2526. In some embodiments, the present disclosure provides oligonucleotide compositions with controlled chirality of WV-2527. In some embodiments, the present disclosure provides oligonucleotide compositions with controlled chirality of WV-2528. In some embodiments, the present disclosure provides oligonucleotide compositions with controlled chirality of WV-2530. In some embodiments, the present disclosure provides oligonucleotide compositions with controlled chirality of WV-2531. In some embodiments, the present disclosure provides oligonucleotide compositions with controlled chirality of WV-2578. In some embodiments, the present disclosure provides oligonucleotide compositions with controlled chirality of WV-2580. In some embodiments, the present disclosure provides oligonucleotide compositions with controlled chirality of WV-2587. In some embodiments, the present disclosure provides oligonucleotide compositions with controlled chirality of WV-3047. In some embodiments, the present disclosure provides oligonucleotide compositions with controlled chirality of WV-3152. In some embodiments, the present disclosure provides oligonucleotide compositions with controlled chirality of WV-3472. In some embodiments, the present disclosure provides oligonucleotide compositions with controlled chirality of WV-3473. In some embodiments, the present disclosure provides oligonucleotide compositions with controlled chirality of WV-3507. In some embodiments, the present disclosure provides oligonucleotide compositions with controlled chirality of WV-3508. In some embodiments, the present disclosure provides oligonucleotide compositions with controlled chirality of WV-3509. In some embodiments, the present disclosure provides oligonucleotide compositions with controlled chirality of WV-3510.In some embodiments, the present disclosure provides oligonucleotide compositions with controlled chirality of WV-3511. In some embodiments, the present disclosure provides oligonucleotide compositions with controlled chirality of WV-3512. In some embodiments, the present disclosure provides oligonucleotide compositions with controlled chirality of WV-3513. In some embodiments, the present disclosure provides oligonucleotide compositions with controlled chirality of WV-3514. In some embodiments, the present disclosure provides oligonucleotide compositions with controlled chirality of WV-3515. In some embodiments, the present disclosure provides oligonucleotide compositions with controlled chirality of WV-3545. In some embodiments, the present disclosure provides oligonucleotide compositions with controlled chirality of WV-3546. As will be readily understood by those skilled in the art, such oligonucleotide compositions with controlled chirality include a predetermined amount of WV-887, WV-892, WV-896, WV-1714, WV-2444, WV-2445, WV-2526, WV-2527, WV-2528, WV-2530, WV-2531, WV-2578, WV-2580, WV-2587, WV-3047, WV-3152, WV-3472, WV-3473, WV-3507, WV-3508, WV-3509, WV-3510, WV-3511, WV-3512, WV-3513, WV-3514, WV-3515, WV-3545 or WV-3546.

[0103] In some embodiments, the present disclosure provides a composition comprising an oligonucleotide composition with controlled chirality, wherein the sequence of the oligonucleotide comprises or consists of the sequence of an oligonucleotide selected from WV-887, WV-892, WV-896, WV-1714, WV-2444, WV-2445, WV-2526, WV-2527, WV-2528, WV-2530, WV-2531, WV-2578, WV-2580, WV-2587, WV-3047, WV-3152, WV-3472, WV-3473, WV-3507, WV-3508, WV-3509, WV-3510, WV-3511, WV-3512, WV-3513, WV-3514, WV-3515, WV-3545, and WV-3546. In some embodiments, the present disclosure provides a composition comprising an oligonucleotide composition with controlled chirality, wherein the sequence of the oligonucleotide comprises or consists of the sequence of an oligonucleotide selected from WV-887, WV-892, WV-896, WV-1714, WV-2444, WV-2445, WV-2526, WV-2527, WV-2528, and WV-2530.

[0104] In some embodiments, the present disclosure provides an oligonucleotide composition with controlled chirality, wherein the sequence of the oligonucleotide comprises the sequence of WV-887. In some embodiments, the present disclosure provides an oligonucleotide composition with controlled chirality, wherein the sequence of the oligonucleotide comprises the sequence of WV-892. In some embodiments, the present disclosure provides an oligonucleotide composition with controlled chirality, wherein the sequence of the oligonucleotide comprises the sequence of WV-896. In some embodiments, the present disclosure provides an oligonucleotide composition with controlled chirality, wherein the sequence of the oligonucleotide comprises the sequence of WV-1714. In some embodiments, the present disclosure provides an oligonucleotide composition with controlled chirality, wherein the sequence of the oligonucleotide comprises the sequence of WV-2444. In some embodiments, the present disclosure provides an oligonucleotide composition with controlled chirality, wherein the sequence of the oligonucleotide comprises the sequence of WV-2445. In some embodiments, the present disclosure provides an oligonucleotide composition with controlled chirality, wherein the sequence of the oligonucleotide comprises the sequence of WV-2526. In some embodiments, the present disclosure provides an oligonucleotide composition with controlled chirality, wherein the sequence of the oligonucleotide comprises the sequence of WV-2527. In some embodiments, the present disclosure provides an oligonucleotide composition with controlled chirality, wherein the sequence of the oligonucleotide comprises the sequence of WV-2528. In some embodiments, the present disclosure provides an oligonucleotide composition with controlled chirality, wherein the sequence of the oligonucleotide comprises the sequence of WV-2530. In some embodiments, the present disclosure provides an oligonucleotide composition with controlled chirality, wherein the sequence of the oligonucleotide consists of the sequence of WV-887. In some embodiments, the present disclosure provides an oligonucleotide composition with controlled chirality, wherein the sequence of the oligonucleotide consists of the sequence of WV-892. In some embodiments, the present disclosure provides an oligonucleotide composition with controlled chirality, wherein the sequence of the oligonucleotide consists of the sequence of WV-896.In some embodiments, the present disclosure provides an oligonucleotide composition with controlled chirality, wherein the sequence of the oligonucleotide consists of the sequence of WV-1714. In some embodiments, the present disclosure provides an oligonucleotide composition with controlled chirality, wherein the sequence of the oligonucleotide consists of the sequence of WV-2444. In some embodiments, the present disclosure provides an oligonucleotide composition with controlled chirality, wherein the sequence of the oligonucleotide consists of the sequence of WV-2445. In some embodiments, the present disclosure provides an oligonucleotide composition with controlled chirality, wherein the sequence of the oligonucleotide consists of the sequence of WV-2526. In some embodiments, the present disclosure provides an oligonucleotide composition with controlled chirality, wherein the sequence of the oligonucleotide consists of the sequence of WV-2427. In some embodiments, the present disclosure provides an oligonucleotide composition with controlled chirality, wherein the sequence of the oligonucleotide consists of the sequence of WV-2528. In some embodiments, the present disclosure provides an oligonucleotide composition with controlled chirality, wherein the sequence of the oligonucleotide consists of the sequence of WV-2530. In some embodiments, the present disclosure provides an oligonucleotide composition with controlled chirality, wherein the sequence of the oligonucleotide consists of the sequence of WV-2531. In some embodiments, the present disclosure provides an oligonucleotide composition with controlled chirality, wherein the sequence of the oligonucleotide consists of the sequence of WV-2578. In some embodiments, the present disclosure provides an oligonucleotide composition with controlled chirality, wherein the sequence of the oligonucleotide consists of the sequence of WV-2587. In some embodiments, the present disclosure provides an oligonucleotide composition with controlled chirality, wherein the sequence of the oligonucleotide consists of the sequence of WV-3047. In some embodiments, the present disclosure provides an oligonucleotide composition with controlled chirality, wherein the sequence of the oligonucleotide consists of the sequence of WV-3152. In some embodiments, the present disclosure provides an oligonucleotide composition with controlled chirality, wherein the sequence of the oligonucleotide consists of the sequence of WV-3472.In some embodiments, the present disclosure provides an oligonucleotide composition with controlled chirality, wherein the sequence of the oligonucleotide consists of the sequence of WV-3473. In some embodiments, the present disclosure provides an oligonucleotide composition with controlled chirality, wherein the sequence of the oligonucleotide consists of the sequence of WV-3507. In some embodiments, the present disclosure provides an oligonucleotide composition with controlled chirality, wherein the sequence of the oligonucleotide consists of the sequence of WV-3508. In some embodiments, the present disclosure provides an oligonucleotide composition with controlled chirality, wherein the sequence of the oligonucleotide consists of the sequence of WV-3509. In some embodiments, the present disclosure provides an oligonucleotide composition with controlled chirality, wherein the sequence of the oligonucleotide consists of the sequence of WV-3510. In some embodiments, the present disclosure provides an oligonucleotide composition with controlled chirality, wherein the sequence of the oligonucleotide consists of the sequence of WV-3511. In some embodiments, the present disclosure provides an oligonucleotide composition with controlled chirality, wherein the sequence of the oligonucleotide consists of the sequence of WV-3512. In some embodiments, the present disclosure provides an oligonucleotide composition with controlled chirality, wherein the sequence of the oligonucleotide consists of the sequence of WV-3513. In some embodiments, the present disclosure provides an oligonucleotide composition with controlled chirality, wherein the sequence of the oligonucleotide consists of the sequence of WV-3514. In some embodiments, the present disclosure provides an oligonucleotide composition with controlled chirality, wherein the sequence of the oligonucleotide consists of the sequence of WV-3515. In some embodiments, the present disclosure provides an oligonucleotide composition with controlled chirality, wherein the sequence of the oligonucleotide consists of the sequence of WV-3545. In some embodiments, the present disclosure provides an oligonucleotide composition with controlled chirality, wherein the sequence of the oligonucleotide consists of the sequence of WV-3546.

[0105] In some embodiments, the present disclosure provides an oligonucleotide composition with controlled chirality, wherein the sequence of the oligonucleotide comprises or consists of the sequence of WV-887, and the composition further comprises a lipid. In some embodiments, the present disclosure provides an oligonucleotide composition with controlled chirality, wherein the sequence of the oligonucleotide comprises or consists of the sequence of WV-892, and the composition further comprises a lipid. In some embodiments, the present disclosure provides an oligonucleotide composition with controlled chirality, wherein the sequence of the oligonucleotide comprises or consists of the sequence of WV-896, and the composition further comprises a lipid. In some embodiments, the present disclosure provides an oligonucleotide composition with controlled chirality, wherein the sequence of the oligonucleotide comprises or consists of the sequence of WV-1714, and the composition further comprises a lipid. In some embodiments, the present disclosure provides an oligonucleotide composition with controlled chirality, wherein the sequence of the oligonucleotide comprises or consists of the sequence of WV-2444, and the composition further comprises a lipid. In some embodiments, the present disclosure provides an oligonucleotide composition with controlled chirality, wherein the sequence of the oligonucleotide comprises or consists of the sequence of WV-2445, and the composition further comprises a lipid. In some embodiments, the present disclosure provides an oligonucleotide composition with controlled chirality, wherein the sequence of the oligonucleotide comprises or consists of the sequence of WV-2526, and the composition further comprises a lipid. In some embodiments, the present disclosure provides an oligonucleotide composition with controlled chirality, wherein the sequence of the oligonucleotide comprises or consists of the sequence of WV-2527, and the composition further comprises a lipid. In some embodiments, the present disclosure provides an oligonucleotide composition with controlled chirality, wherein the sequence of the oligonucleotide comprises or consists of the sequence of WV-2528, and the composition further comprises a lipid. In some embodiments, the present disclosure provides an oligonucleotide composition with controlled chirality, wherein the sequence of the oligonucleotide comprises or consists of the sequence of WV-2530, and the composition further comprises a lipid.In some embodiments, the present disclosure provides an oligonucleotide composition with controlled chirality, wherein the sequence of the oligonucleotide comprises or consists of the sequence of WV-2531 and the composition further comprises a lipid. In some embodiments, the present disclosure provides an oligonucleotide composition with controlled chirality, wherein the sequence of the oligonucleotide comprises or consists of the sequence of WV-2578 and the composition further comprises a lipid. In some embodiments, the present disclosure provides an oligonucleotide composition with controlled chirality, wherein the sequence of the oligonucleotide comprises or consists of the sequence of WV-2580 and the composition further comprises a lipid. In some embodiments, the present disclosure provides an oligonucleotide composition with controlled chirality, wherein the sequence of the oligonucleotide comprises or consists of the sequence of WV-2587 and the composition further comprises a lipid. In some embodiments, the present disclosure provides an oligonucleotide composition with controlled chirality, wherein the sequence of the oligonucleotide comprises or consists of the sequence of WV-3047 and the composition further comprises a lipid. In some embodiments, the present disclosure provides an oligonucleotide composition with controlled chirality, wherein the sequence of the oligonucleotide comprises or consists of the sequence of WV-3152 and the composition further comprises a lipid. In some embodiments, the present disclosure provides an oligonucleotide composition with controlled chirality, wherein the sequence of the oligonucleotide comprises or consists of the sequence of WV-3472 and the composition further comprises a lipid. In some embodiments, the present disclosure provides an oligonucleotide composition with controlled chirality, wherein the sequence of the oligonucleotide comprises or consists of the sequence of WV-3473 and the composition further comprises a lipid. In some embodiments, the present disclosure provides an oligonucleotide composition with controlled chirality, wherein the sequence of the oligonucleotide comprises or consists of the sequence of WV-3507 and the composition further comprises a lipid. In some embodiments, the present disclosure provides an oligonucleotide composition with controlled chirality, wherein the sequence of the oligonucleotide comprises or consists of the sequence of WV-3508 and the composition further comprises a lipid.In some embodiments, the present disclosure provides an oligonucleotide composition with controlled chirality, wherein the sequence of the oligonucleotide comprises or consists of the sequence of WV-3509 and the composition further comprises a lipid. In some embodiments, the present disclosure provides an oligonucleotide composition with controlled chirality, wherein the sequence of the oligonucleotide comprises or consists of the sequence of WV-3510 and the composition further comprises a lipid. In some embodiments, the present disclosure provides an oligonucleotide composition with controlled chirality, wherein the sequence of the oligonucleotide comprises or consists of the sequence of WV-3511 and the composition further comprises a lipid. In some embodiments, the present disclosure provides an oligonucleotide composition with controlled chirality, wherein the sequence of the oligonucleotide comprises or consists of the sequence of WV-3512 and the composition further comprises a lipid. In some embodiments, the present disclosure provides an oligonucleotide composition with controlled chirality, wherein the sequence of the oligonucleotide comprises or consists of the sequence of WV-3513 and the composition further comprises a lipid. In some embodiments, the present disclosure provides an oligonucleotide composition with controlled chirality, wherein the sequence of the oligonucleotide comprises or consists of the sequence of WV-3514 and the composition further comprises a lipid. In some embodiments, the present disclosure provides an oligonucleotide composition with controlled chirality, wherein the sequence of the oligonucleotide comprises or consists of the sequence of WV-3515 and the composition further comprises a lipid.

[0106] In some embodiments, the present disclosure provides an oligonucleotide composition in which the chirality of WV-887 conjugated to a lipid is controlled. In some embodiments, the present disclosure provides an oligonucleotide composition in which the chirality of WV-892 conjugated to a lipid is controlled. In some embodiments, the present disclosure provides an oligonucleotide composition in which the chirality of WV-896 conjugated to a lipid is controlled. In some embodiments, the present disclosure provides an oligonucleotide composition in which the chirality of WV-1714 conjugated to a lipid is controlled. In some embodiments, the present disclosure provides an oligonucleotide composition in which the chirality of WV-2444 conjugated to a lipid is controlled. In some embodiments, the present disclosure provides an oligonucleotide composition in which the chirality of WV-2445 conjugated to a lipid is controlled. In some embodiments, the present disclosure provides an oligonucleotide composition in which the chirality of WV-2526 conjugated to a lipid is controlled. In some embodiments, the present disclosure provides an oligonucleotide composition in which the chirality of WV-2527 conjugated to a lipid is controlled. In some embodiments, the present disclosure provides an oligonucleotide composition in which the chirality of WV-2528 conjugated to a lipid is controlled. In some embodiments, the present disclosure provides an oligonucleotide composition in which the chirality of WV-2530 conjugated to a lipid is controlled. In some embodiments, the present disclosure provides an oligonucleotide composition in which the chirality of WV-2531 conjugated to a lipid is controlled. In some embodiments, the present disclosure provides an oligonucleotide composition in which the chirality of WV-2578 conjugated to a lipid is controlled. In some embodiments, the present disclosure provides an oligonucleotide composition in which the chirality of WV-2580 conjugated to a lipid is controlled. In some embodiments, the present disclosure provides an oligonucleotide composition in which the chirality of WV-2587 conjugated to a lipid is controlled.In some embodiments, the present disclosure provides an oligonucleotide composition in which the chirality of WV-3047 conjugated to a lipid is controlled. In some embodiments, the present disclosure provides an oligonucleotide composition in which the chirality of WV-3152 conjugated to a lipid is controlled. In some embodiments, the present disclosure provides an oligonucleotide composition in which the chirality of WV-3472 conjugated to a lipid is controlled. In some embodiments, the present disclosure provides an oligonucleotide composition in which the chirality of WV-3473 conjugated to a lipid is controlled. In some embodiments, the present disclosure provides an oligonucleotide composition in which the chirality of WV-3507 conjugated to a lipid is controlled. In some embodiments, the present disclosure provides an oligonucleotide composition in which the chirality of WV-3508 conjugated to a lipid is controlled. In some embodiments, the present disclosure provides an oligonucleotide composition in which the chirality of WV-3509 conjugated to a lipid is controlled. In some embodiments, the present disclosure provides an oligonucleotide composition in which the chirality of WV-3510 conjugated to a lipid is controlled. In some embodiments, the present disclosure provides an oligonucleotide composition in which the chirality of WV-3511 conjugated to a lipid is controlled. In some embodiments, the present disclosure provides an oligonucleotide composition in which the chirality of WV-3512 conjugated to a lipid is controlled. In some embodiments, the present disclosure provides an oligonucleotide composition in which the chirality of WV-3513 conjugated to a lipid is controlled. In some embodiments, the present disclosure provides an oligonucleotide composition in which the chirality of WV-3514 conjugated to a lipid is controlled. In some embodiments, the present disclosure provides an oligonucleotide composition in which the chirality of WV-3515 conjugated to a lipid is controlled. In some embodiments, the present disclosure provides an oligonucleotide composition in which the chirality of an oligonucleotide selected from any of the tables is controlled.In some embodiments, the present disclosure provides an oligonucleotide composition with controlled chirality of an oligonucleotide selected from any of the tables, wherein the oligonucleotide is conjugated to a lipid.

[0107] In some embodiments, the oligonucleotide is 25 bases or less in length. In some embodiments, the oligonucleotide is 25 bases or less in length. In some embodiments, the oligonucleotide is 30 bases or less in length. In some embodiments, the oligonucleotide is 35 bases or less in length. In some embodiments, the oligonucleotide is 40 bases or less in length. In some embodiments, the oligonucleotide is 45 bases or less in length. In some embodiments, the oligonucleotide is 50 bases or less in length. In some embodiments, the oligonucleotide is 55 bases or less in length. In some embodiments, the oligonucleotide is 60 bases or less in length.

[0108] In some embodiments, the lipid is a fatty acid. In some embodiments, the oligonucleotide conjugates to the fatty acid. In some embodiments, the fatty acid contains 10, 11, 12, 13, 14, 15, 16, 17, 18, 19, 20, 21, 22, 23, 24, 25, 26, 27, 28, 29, 30, or more carbon atoms. In some embodiments, the fatty acid contains 10 or more carbon atoms. In some embodiments, the fatty acid contains 11 or more carbon atoms. In some embodiments, the fatty acid contains 12 or more carbon atoms. In some embodiments, the fatty acid contains 13 or more carbon atoms. In some embodiments, the fatty acid contains 14 or more carbon atoms. In some embodiments, the fatty acid contains 15 or more carbon atoms. In some embodiments, the fatty acid contains 16 or more carbon atoms. In some embodiments, the fatty acid contains 17 or more carbon atoms. In some embodiments, the fatty acid contains 18 or more carbon atoms. In some embodiments, the fatty acid contains 19 or more carbon atoms. In some embodiments, the fatty acid contains 20 or more carbon atoms. In some embodiments, the fatty acid contains 21 or more carbon atoms. In some embodiments, the fatty acid contains 22 or more carbon atoms. In some embodiments, the fatty acid contains 23 or more carbon atoms. In some embodiments, the fatty acid contains 24 or more carbon atoms. In some embodiments, the fatty acid contains 25 or more carbon atoms. In some embodiments, the fatty acid contains 26 or more carbon atoms. In some embodiments, the fatty acid contains 27 or more carbon atoms. In some embodiments, the fatty acid contains 28 or more carbon atoms. In some embodiments, the fatty acid contains 29 or more carbon atoms. In some embodiments, the fatty acid contains 30 or more carbon atoms.

[0109] In some embodiments, the lipid is stearic acid or terminal acid. In some embodiments, the lipid is stearic acid. In some embodiments, the lipid is terminal acid.

[0110] In some embodiments, the lipid comprises a saturated or partially unsaturated aliphatic group of C 10 -C 80 wherein one or more methylene units are optionally and independently replaced by a group optionally substituted by C1-C6 alkylene, C1-C6 alkenylene, -C≡C-, C1-C6 heteroaliphatic moiety, -C(R’)2-, -Cy-, -O-, -S-, -S-S-, -N(R’)-, -C(O)-, -C(S)-, -C(NR’)-, -C(O)N(R’)-, -N(R’)C(O)N(R’)-, -N(R’)C(O)-, -N(R’)C(O)O-, -OC(O)N(R’)-, -S(O)-, -S(O)2-, -S(O)2N(R’)-, -N(R’)S(O)2-, -SC(O)-, -C(O)S-, -OC(O)- and -C(O)O-, and each variable is independently defined as described herein.

[0111] In some embodiments, the lipid comprises a saturated or partially unsaturated aliphatic chain of C 10 -C 60 as described.

[0112] In some embodiments, the lipid comprises a straight-chain saturated or partially unsaturated aliphatic chain of C 10 -C 60 as described.

[0113] In some embodiments, the lipid comprises a straight-chain saturated or partially unsaturated aliphatic chain optionally substituted with one or more C 1-4 aliphatic groups of C 10 -C 60 as described.

[0114] In some embodiments, the lipid comprises a C 10 -C 60comprising a saturated or partially unsaturated aliphatic group, wherein one or more methylene units are optionally and independently replaced by a group optionally substituted by C1-C6 alkylene, C1-C6 alkenylene, -C≡C-, C1-C6 heteroaliphatic moiety, -C(R’)2-, -Cy-, -O-, -S-, -S-S-, -N(R’)-, -C(O)-, -C(S)-, -C(NR’)-, -C(O)N(R’)-, -N(R’)C(O)N(R’)-, -N(R’)C(O)-, -N(R’)C(O)O-, -OC(O)N(R’)-, -S(O)-, -S(O)2-, -S(O)2N(R’)-, -N(R’)S(O)2-, -SC(O)-, -C(O)S-, -OC(O)- and -C(O)O-, and each variable is independently defined as described herein.

[0115] In some embodiments, the lipid comprises a C 10 -C 60 saturated or partially unsaturated aliphatic chain.

[0116] In some embodiments, the lipid comprises a C 10 -C 60 linear saturated or partially unsaturated aliphatic chain.

[0117] In some embodiments, the lipid comprises a C 1-4 optionally substituted with one or more C 10 -C 60 linear saturated or partially unsaturated aliphatic chain.

[0118] In some embodiments, the lipid comprises a C 10 -C 40comprising a saturated or partially unsaturated aliphatic group, wherein one or more methylene units are optionally and independently replaced by a group optionally substituted by C1-C6 alkylene, C1-C6 alkenylene, -C≡C-, C1-C6 heteroaliphatic moiety, -C(R’)2-, -Cy-, -O-, -S-, -S-S-, -N(R’)-, -C(O)-, -C(S)-, -C(NR’)-, -C(O)N(R’)-, -N(R’)C(O)N(R’)-, -N(R’)C(O)-, -N(R’)C(O)O-, -OC(O)N(R’)-, -S(O)-, -S(O)2-, -S(O)2N(R’)-, -N(R’)S(O)2-, -SC(O)-, -C(O)S-, -OC(O)- and -C(O)O-, and each variable is independently defined as described herein.

[0119] In some embodiments, the lipid comprises a C 10 -C 60 saturated or partially unsaturated aliphatic chain.

[0120] In some embodiments, the lipid comprises a C 10 -C 60 linear saturated or partially unsaturated aliphatic chain.

[0121] In some embodiments, the lipid comprises a C 1-4 optionally substituted with one or more C 10 -C 60 linear saturated or partially unsaturated aliphatic chain.

[0122] In some embodiments, the lipid comprises an unsubstituted C 10 -C 80 linear saturated or partially unsaturated aliphatic chain.

[0123] In some embodiments, the lipid comprises one or fewer C 10 -C 60contains a straight-chain saturated or partially unsaturated aliphatic chain.

[0124] In some embodiments, the lipid is two or more optionally substituted C 10 -C 60 contains a straight-chain saturated or partially unsaturated aliphatic chain.

[0125] In some embodiments, the lipid is unsubstituted C 10 -C 60 contains a straight-chain saturated or partially unsaturated aliphatic chain.

[0126] In some embodiments, the lipid is one or fewer optionally substituted C 10 -C 60 contains a straight-chain saturated or partially unsaturated aliphatic chain.

[0127] In some embodiments, the lipid is two or more optionally substituted C 10 -C 60 contains a straight-chain saturated or partially unsaturated aliphatic chain.

[0128] In some embodiments, the lipid is unsubstituted C 10 -C 40 contains a straight-chain saturated or partially unsaturated aliphatic chain.

[0129] In some embodiments, the lipid is one or fewer optionally substituted C 10 -C 60 contains a straight-chain saturated or partially unsaturated aliphatic chain.

[0130] In some embodiments, the lipid is two or more optionally substituted C 10 -C 60 contains a straight-chain saturated or partially unsaturated aliphatic chain.

[0131] In some embodiments, the lipid is C 10 -C40 It contains a straight-chain saturated or partially unsaturated aliphatic chain.

[0132] In some embodiments, the lipid is optionally a C 1-4 optionally substituted with one or more C 10 -C 40 It contains a straight-chain saturated or partially unsaturated aliphatic chain.

[0133] In some embodiments, the lipid is selected from the group consisting of lauric acid, myristic acid, palmitic acid, stearic acid, oleic acid, linoleic acid, α-linolenic acid, γ-linolenic acid, docosahexaenoic acid (DHA or cis-DHA), terminal acid, and dilinoleyl.

[0134] In some embodiments, the lipid is not conjugated to an oligonucleotide.

[0135] In some embodiments, the lipid is conjugated to an oligonucleotide.

[0136] In some embodiments, the lipid is conjugated to an oligonucleotide using a linker. In some embodiments, the linker has a structure of -L-. In some embodiments, the conjugate has a structure of A c -[-L LD -(R LD ) a b having the structure of.

[0137] In some embodiments, the present disclosure provides A c -[-L LD -(R LD ) a b or [(A c ) a -L LD b -R LD An oligonucleotide composition comprising a plurality of oligonucleotides having the structure of,​​​ Here, A c is an oligonucleotide chain ([H] b -A c is an oligonucleotide); a is from 1 to 1000; b is from 1 to 1000; Each L LD is independently a linker moiety; Each R LD is independently a lipid moiety or a targeting element, providing an oligonucleotide composition.

[0138] In some embodiments, the present disclosure provides an oligonucleotide composition comprising a plurality of oligonucleotides having the structure of A c -[-L LD -(R LD ) a b or [(A c ) a -L LD b -R LD wherein, Here, A c is an oligonucleotide chain ([H] b -A c is an oligonucleotide); a is from 1 to 1000; b is from 1 to 1000; Each L LD is independently a covalent bond or a saturated or partially unsaturated aliphatic group of C1-C 80 which may be optionally substituted, wherein one or more methylene units may be optionally and independently T LD ​​may be replaced, or may be replaced by a group optionally substituted when selected from C1-C6 alkylene, C1-C6 alkenylene, -C≡C-, C1-C6 heteroaliphatic moiety, -C(R’)2-, -Cy-, -O-, -S-, -S-S-, -N(R’)-, -C(O)-, -C(S)-, -C(NR’)-, -C(O)N(R’)-, -N(R’)C(O)N(R’)-, -N(R’)C(O)-, -N(R’)C(O)O-, -OC(O)N(R’)-, -S(O)-, -S(O)2-, -S(O)2N(R’)-, -N(R’)S(O)2-, -SC(O)-, -C(O)S-, -OC(O)- and -C(O)O-; each R LD is independently a C1-C 80 saturated or partially unsaturated aliphatic group, where one or more methylene units may optionally and independently be replaced by a group optionally substituted when selected from C1-C6 alkylene, C1-C6 alkenylene, -C≡C-, C1-C6 heteroaliphatic moiety, -C(R’)2-, -Cy-, -O-, -S-, -S-S-, -N(R’)-, -C(O)-, -C(S)-, -C(NR’)-, -C(O)N(R’)-, -N(R’)C(O)N(R’)-, -N(R’)C(O)-, -N(R’)C(O)O-, -OC(O)N(R’)-, -S(O)-, -S(O)2-, -S(O)2N(R’)-, -N(R’)S(O)2-, -SC(O)-, -C(O)S-, -OC(O)- and -C(O)O-; T LD is

Chemical formula

[0139] In some embodiments, [H] b -Ac (where b is from 1 to 1000) is any one of the oligonucleotides in the table. In some embodiments, [H] b -Ac is the oligonucleotide in Table 2. In some embodiments, [H] b -Ac is the oligonucleotide in Table 3. In some embodiments, [H] b -Ac is the oligonucleotide in Table 4. In some embodiments, [H] b -Ac is the oligonucleotide in Table 4 that does not contain a lipid moiety.

[0140] In some embodiments, T LD The P within is P * is. In some embodiments, the conjugate has the structure [(A c ) a -L LD b -R LD In some embodiments, the conjugate is (A c ) a -L LD -R LD ​It has the structure. In some embodiments, a is from 1 to 100. In some embodiments, a is from 1 to 50. In some embodiments, a is from 1 to 40. In some embodiments, a is from 1 to 30. In some embodiments, a is from 1 to 20. In some embodiments, a is from 1 to 15. In some embodiments, a is from 1 to 10. In some embodiments, a is from 1 to 9. In some embodiments, a is from 1 to 8. In some embodiments, a is from 1 to 7. In some embodiments, a is from 1 to 6. In some embodiments, a is from 1 to 5. In some embodiments, a is from 1 to 4. In some embodiments, a is from 1 to 3. In some embodiments, a is from 1 to 2. In some embodiments, a is 1. In some embodiments, a is 2. In some embodiments, a is 3. In some embodiments, a is 4. In some embodiments, a is 5. In some embodiments, a is 6. In some embodiments, a is 7. In some embodiments, a is 8. In some embodiments, a is 9. In some embodiments, a is 10. In some embodiments, a is greater than 10. In some embodiments, b is from 1 to 100. In some embodiments, b is from 1 to 50. In some embodiments, b is from 1 to 40. In some embodiments, b is from 1 to 50. In some embodiments, b is from 1 to 30. In some embodiments, b is from 1 to 20. In some embodiments, b is from 1 to 15. In some embodiments, b is from 1 to 10. In some embodiments, b is from 1 to 9. In some embodiments, b is from 1 to 8. In some embodiments, b is from 1 to 7. In some embodiments, b is from 1 to 6. In some embodiments, b is from 1 to 5. In some embodiments, b is from 1 to 4. In some embodiments, b is from 1 to 3.In some embodiments, b is from 1 to 2. In some embodiments, b is 1. In some embodiments, b is 2. In some embodiments, b is 3. In some embodiments, b is 4. In some embodiments, b is 5. In some embodiments, b is 6. In some embodiments, b is 7. In some embodiments, b is 8. In some embodiments, b is 9. In some embodiments, b is greater than 10. In some embodiments, the conjugate is A. c -L LD -R LD has the structure of. In some embodiments, A c is conjugated via one or more of its sugar, base, and / or internucleotide bridging moieties. In some embodiments, A c is conjugated via its 5'-OH (5'-O-). In some embodiments, A c is conjugated via its 3'-OH (3'-O-). In some embodiments, prior to conjugation, A c -(H) b (where b is an integer from 1 to 1000 depending on the valence of A c ) is an oligonucleotide as described herein, for example, an oligonucleotide described in any one of the tables. In some embodiments, L LD is -L-. In some embodiments, L LD contains phosphorothioate groups. In some embodiments, L LD is -C(O)NH-(CH2)6-OP(=O)(S - )-O-. In some embodiments, the -C(O)NH terminus is linked to R LD , and the -O- terminus is linked to the oligonucleotide, for example, via the 5'- or 3'- terminus. In some embodiments, R LD is optionally substituted C 10 , C 15 , C 16 , C 17, C 18 , C 19 , C 20 , C 21 , C 22 , C 23 , C 24 or C 25 ~C 20 , C 21 , C 22 , C 23 , C 24 , C 25 , C 26 , C 27 , C 28 , C 29 , C 30 , C 35 , C 40 , C 45 , C 50 , C 60 , C 70 or C 80 is aliphatic. In some embodiments, R LD is optionally substituted C 10-80 aliphatic. In some embodiments, R LD is optionally substituted C 20-80 aliphatic. In some embodiments, R LD is optionally substituted C 10-70 aliphatic. In some embodiments, R LD is optionally substituted C 20-70 aliphatic. In some embodiments, R LD is optionally substituted C 10-60 aliphatic. In some embodiments, R LD is optionally substituted C 20-60 aliphatic. In some embodiments, R LD is optionally substituted C 10-50 aliphatic. In some embodiments, R LD is optionally substituted C 20-50 aliphatic. In some embodiments, R LD is optionally substituted C 10-40It is aliphatic. In some embodiments, R LD is an optionally substituted C 20-40 aliphatic. In some embodiments, R LD is an optionally substituted C 10-30 aliphatic. In some embodiments, R LD is an optionally substituted C 20-30 aliphatic. In some embodiments, R LD is an unsubstituted C 10 、C 15 、C 16 、C 17 、C 18 、C 19 、C 20 、C 21 、C 22 、C 23 、C 24 or C 25 ~C 20 、C 21 、C 22 、C 23 、C 24 、C 25 、C 26 、C 27 、C 28 、C 29 、C 30 、C 35 、C 40 、C 45 、C 50 、C 60 、C 70 or C 80 aliphatic. In some embodiments, R LD is an unsubstituted C 10-80 aliphatic. In some embodiments, R LD is an unsubstituted C 20-80 aliphatic. In some embodiments, R LD is an unsubstituted C 10-70 aliphatic. In some embodiments, R LD is an unsubstituted C 20-70 aliphatic. In some embodiments, R LD is an unsubstituted C 10-60It is aliphatic. In some embodiments, R LD is unsubstituted C 20-60 is aliphatic. In some embodiments, R LD is unsubstituted C 10-50 is aliphatic. In some embodiments, R LD is unsubstituted C 20-50 is aliphatic. In some embodiments, R LD is unsubstituted C 10-40 is aliphatic. In some embodiments, R LD is unsubstituted C 20-40 is aliphatic. In some embodiments, R LD is unsubstituted C 10-30 is aliphatic. In some embodiments, R LD is unsubstituted C 20-30 is aliphatic.

[0141] In some embodiments, the oligonucleotide composition with controlled chirality is any one of the above compositions further comprising one or more additional components.

[0142] In some embodiments, the conjugation of a lipid to an oligonucleotide improves at least one property of the oligonucleotide. In some embodiments, the properties that are improved include an increase in activity (e.g., an increase in the ability to induce the desired skipping of a harmful exon), a decrease in toxicity, and / or an improved distribution to tissues. In some embodiments, the tissue is muscle tissue. In some embodiments, the tissue is skeletal muscle, gastrocnemius muscle, triceps muscle, heart, or diaphragm. In some embodiments, the properties that are improved include a decrease in hTLR9 agonist activity. In some embodiments, the properties that are improved include hTLR9 antagonist activity. In some embodiments, the properties that are improved include an increase in hTLR9 antagonist activity.

[0143] Generally, the properties of the oligonucleotide compositions described herein can be evaluated using any suitable assay. The relative toxicity and / or protein binding properties for different compositions (e.g., those with controlled and uncontrolled stereochemistry and / or different stereochemically controlled compositions) are typically, desirably, determined in the same assay and, in some embodiments, substantially simultaneously and, in some embodiments, with reference to historical results.

[0144] One of ordinary skill in the art will recognize and / or be able to readily develop assays suitable for a particular oligonucleotide composition. The present disclosure provides descriptions of particular assays that may be useful for evaluating one or more characteristics of the behavior of an oligonucleotide composition, e.g., assays that may be useful for evaluating complement activation, inflammation at the injection site, protein binding, and the like.

[0145] For example, particular assays that may be useful for evaluating the toxicity and / or protein binding properties of an oligonucleotide composition may include any assay described and / or exemplified herein. Definitions

[0146] Aliphatic: As used herein, the term "aliphatic" or "aliphatic group" refers to a straight-chain (i.e., unbranched) or branched-chain, substituted or unsubstituted hydrocarbon chain having one point of attachment to another molecule, which is completely saturated or contains one or more unsaturated units, or a monocyclic or polycyclic hydrocarbon that contains one or more unsaturated units but is not aromatic (also referred to herein as a "carbocyclic", "alicyclic" or "cycloalkyl"). In some embodiments, the aliphatic group contains 1 to 50 aliphatic carbon atoms. Unless otherwise specified, the aliphatic group contains 1 to 10 aliphatic carbon atoms. In some embodiments, the aliphatic group contains 1 to 6 aliphatic carbon atoms. In some embodiments, the aliphatic group contains 1 to 5 aliphatic carbon atoms. In other embodiments, the aliphatic group contains 1 to 4 aliphatic carbon atoms. In still other embodiments, the aliphatic group contains 1 to 3 aliphatic carbon atoms, and in still other embodiments, the aliphatic group contains 1 to 2 aliphatic carbon atoms. In some embodiments, "alicyclic" (or "carbocyclic" or "cycloalkyl") represents a monocyclic or bicyclic C3-C 10 hydrocarbon having one point of attachment to another molecule, which is completely saturated or contains one or more unsaturated units but is not aromatic. Suitable aliphatic groups include, but are not limited to, straight-chain or branched-chain, substituted or unsubstituted alkyl groups, alkenyl groups, alkynyl groups, and their composites such as (cycloalkyl)alkyl, (cycloalkenyl)alkyl or (cycloalkyl)alkenyl.

[0147] Alkylene: The term "alkylene" represents a divalent alkyl group. An "alkylene chain" is a polymethylene group, i.e., -(CH2) n- and in the formula, n is a positive integer, preferably 1 to 6, 1 to 4, 1 to 3, 1 to 2, or 2 to 3. The substituted alkylene chain is a polymethylene group in which one or more methylene hydrogen atoms are substituted with substituents. Suitable substituents include those described below for substituted aliphatic groups.

[0148] Alkenylene: The term "alkenylene" represents a divalent alkenyl group. The substituted alkenylene group is a polymethylene group containing at least one double bond in which one or more hydrogen atoms are substituted with substituents. Suitable substituents include those described below for substituted aliphatic groups.

[0149] Animal: As used herein, the term "animal" represents any member of the animal kingdom. In some embodiments, "animal" represents a human at any stage of development. In some embodiments, "animal" represents a non-human animal at any stage of development. In certain embodiments, the non-human animal is a mammal (e.g., rodents, mice, rats, rabbits, monkeys, dogs, cats, sheep, cows, primates, and / or pigs). In some embodiments, animals include, but are not limited to, mammals, birds, reptiles, amphibians, fish, and / or worms. In some embodiments, the animal can be a transgenic animal, a genetically modified animal, and / or a clone.

[0150] Approximately: As used herein, the term "approximately" or "about" when representing a number generally includes numbers within the range of 5%, 10%, 15%, or 20% in either direction (greater or less) of the number, unless specifically stated or otherwise apparent from the context (except when such number is a possible value less than 0% or greater than 100%). In some embodiments, the use of the term "about" when representing a dosage means ±5 mg / kg / day.

[0151] Aryl: As used alone or as part of a larger moiety as "aralkyl", "aralkoxy", or "aryloxyalkyl", the term "aryl" represents monocyclic and bicyclic ring structures having a total of 5 to 14 ring members, with at least one ring of the structure being aromatic and each ring of the structure containing 3 to 7 ring members. The term "aryl" may be used interchangeably with the term "aryl ring". In certain embodiments of the present invention, "aryl" represents an aromatic ring structure, including but not limited to, phenyl, biphenyl, naphthyl, anthracyl, etc., which may have one or more substituents. Groups in which an aromatic ring is fused to one or more non-aromatic rings, such as indanyl, phthalimidyl, naphthimidyl, phenanthridinyl, or tetrahydronaphthyl, are also included within the scope of the term "aryl" herein.

[0152] Characteristic moiety: As used herein, the phrase "characteristic moiety" of a protein or polypeptide generally refers to a continuous series of amino acids, or a collection of continuous series of amino acids, that are characteristic of the protein or polypeptide as a whole. Each such continuous chain will generally contain at least two amino acids. Further, one of ordinary skill in the art will generally recognize that at least 5, 10, 15, 20 or more amino acids are necessary for a sequence to be characteristic of a protein. Generally, a characteristic moiety shares at least one functional characteristic with a related intact protein in addition to the specific sequence homology described above.

[0153] Characteristic sequence: A "characteristic sequence" is a sequence found among all members of a family of polypeptides or nucleic acids and can thus be used by one of ordinary skill in the art to define the members of that family.

[0154] Characteristic structural element: The term "characteristic structural element" refers to a distinct structural element (e.g., backbone structure, collection of pendant moieties, sequence elements, etc.) found among all members of a family of polypeptides, small molecules, or nucleic acids and can thus be used by one of ordinary skill in the art to define the members of that family.

[0155] Equivalent: The term "equivalent" is used herein to denote two (or more) sets of conditions or environments that are sufficiently similar to each other to enable comparison of the resulting outcomes or observed phenomena. In some embodiments, equivalent sets of conditions or environments are characterized by a plurality of substantially identical features and one or a few modified features. One of ordinary skill in the art will recognize that when two sets of conditions or environments are characterized by a sufficient number and type of substantially identical features such that the differences in the resulting outcomes or observed phenomena obtained under the different sets of conditions or environments can reasonably be attributed to or indicative of the differences among those features that are modified, the two sets are equivalent to each other.

[0156] Dosing regimen: As used herein, "dosing regimen" or "treatment regimen" generally refers to a set of unit doses (usually one or more) that are administered individually to a subject over a period of time. In some embodiments, a given therapeutic agent has a required dosing regimen that may include one or more doses. In some embodiments, the dosing regimen includes multiple doses that are each separated from one another by the same length of time; in some embodiments, the dosing regimen includes multiple doses and at least two different periods separating the individual doses. In some embodiments, all of the doses within a dosing regimen are the same unit dose. In some embodiments, the different doses within a dosing regimen are different amounts. In some embodiments, the dosing regimen includes a first dose at a first dosage, followed by one or more additional doses at a second dosage that is different from the first dosage. In some embodiments, the dosing regimen includes a first dose at a first dosage, followed by one or more additional doses at a second dosage that is the same as the first dosage.

[0157] Equivalent Agents: Reading this disclosure, one of ordinary skill in the art will recognize that the scope of useful agents in the context of the present invention is not limited to those specifically recited or exemplified herein. Specifically, one of ordinary skill in the art will recognize that an active agent typically has a structure consisting of a backbone and attached pendant moieties, and thus will understand that simple modifications to such a backbone and / or pendant moieties will not significantly change the activity of the agent. For example, in some embodiments, substitution of one or more pendant moieties having equivalent three-dimensional structures and / or chemical reactivity characteristics may result in a substituted compound or moiety equivalent to the parent reference compound or moiety. In some embodiments, addition or removal of one or more pendant moieties may result in a compound substituted equivalently to the parent reference compound. In some embodiments, for example, modification of the backbone structure by addition or removal of a small number of bonds (usually 5, 4, 3, 2 or less, or 1 bond, and often single bonds only) may result in a compound substituted equivalently to the parent reference compound. In many embodiments, equivalent compounds may be synthesized, for example, using readily available materials, reagents, and conventional or provided synthetic procedures, by the methods shown in the following general reaction schemes, or variations thereof. Modifications that are known per se but not recited herein may also be utilized in these reactions.

[0158] Equivalent dosage: The term "equivalent dosage" is used herein to compare the dosages of different pharmaceutically active agents that produce the same biological result. The dosages of two different agents are considered to be "equivalent" to each other according to the present invention if they achieve an equivalent level or degree of biological result. In some embodiments, the equivalent dosages of different pharmaceuticals used according to the present invention are determined using the in vitro and / or in vivo assays described herein. In some embodiments, one or more lysosomal activators used according to the present invention are utilized at a dosage equivalent to the dosage of a reference lysosomal activator; in some embodiments, a reference lysosomal activator for such purposes is selected from the group consisting of small molecule allosteric activators (e.g., pyrazolpyrimidines), imminosugars (e.g., isofagomine), antioxidants (e.g., n-acetylcysteine), and regulators of cellular trafficking (e.g., Rab1a polypeptide).

[0159] Heteroaliphatic: The term "heteroaliphatic" represents an aliphatic group in which one or more units selected from C, CH, CH2, or CH3 are independently replaced by a heteroatom. In some embodiments, the heteroaliphatic group is a heteroalkyl. In some embodiments, the heteroaliphatic group is a heteroalkenyl.

[0160] Heteroaryl: The terms "heteroaryl" and "heteroal-" used alone or as part of a larger moiety, such as "heteroalkyl" or "heteroalkoxy", have 5 to 10 ring atoms, preferably 5, 6, or 9 ring atoms; have 6, 10, or 14 π electrons shared in a cyclic array; and represent a group having 1 to 5 heteroatoms in addition to carbon atoms. The term "heteroatom" represents nitrogen, oxygen, or sulfur, and includes any oxidized form of nitrogen or sulfur and any quaternized form of any basic nitrogen. Examples of heteroaryl groups include, but are not limited to, thienyl, furanyl, pyrrolyl, imidazolyl, pyrazolyl, triazolyl, tetrazolyl, oxazolyl, isoxazolyl, oxadiazolyl, thiazolyl, isothiazolyl, thiadiazolyl, pyridyl, pyridazinyl, pyrimidinyl, pyrazinyl, indolizinyl, purinyl, naphthyridinyl, and pteridinyl. As used herein, the terms "heteroaryl" and "heteroal-" also include groups in which a heteroaromatic ring is fused to one or more aryl, cycloaliphatic, or heterocyclyl rings where the radical or point of attachment is on the aromatic ring. Non-limiting examples include indolyl, isoindolyl, benzothienyl, benzofuranyl, dibenzofuranyl, indazolyl, benzimidazolyl, benzothiazolyl, quinolyl, isoquinolyl, cinnolinyl, phthalazinyl, quinazolinyl, quinoxalinyl, 4H-quinolizinyl, carbazolyl, acridinyl, phenazinyl, phenothiazinyl, phenoxazinyl, tetrahydroquinolinyl, tetrahydroisoquinolinyl, and pyrido[2,3-b]-1,4-oxazin-3(4H)-one. A heteroaryl group can be monocyclic or bicyclic. The term "heteroaryl" can be used interchangeably with the terms "heteroaryl ring", "heteroaryl group", or "aromatic heterocycle", and any of these terms includes rings that may be substituted. The term "heteroalkyl" represents an alkyl group substituted by heteroaryl, and the alkyl and heteroaryl moieties may be independently substituted.

[0161] Heteroatom: The term "heteroatom" means one or more oxygen, sulfur, nitrogen, phosphorus, boron, selenium or silicon (any oxidized form of nitrogen, boron, selenium, sulfur, phosphorus or silicon; any quaternized form of basic nitrogen; or a heterocyclic ring, e.g., N (in 3,4-dihydro-2H-pyrrolyl), NH (in pyrrolidinyl) or NR + (including substitutable nitrogen in N-substituted pyrrolidinyl)).

[0162] Heterocycle: As used herein, the terms "heterocycle", "heterocyclyl", "heterocyclic radical", and "heterocyclic ring" are used interchangeably and represent a stable 3- to 7-membered monocyclic or 7- to 10-membered bicyclic heterocyclic moiety that is saturated or partially unsaturated and has, in addition to carbon atoms, one or more, preferably 1 to 4, of the above heteroatoms. When used to represent the ring atoms of a heterocycle, the term "nitrogen" includes substituted nitrogen. For example, a saturated or partially unsaturated ring having 0 to 3 heteroatoms selected from oxygen, sulfur or nitrogen, wherein the nitrogen can be N (such as in 3,4-dihydro-2H-pyrrolyl), NH (such as in pyrrolidinyl) or + NR (such as in N-substituted pyrrolidinyl).

[0163] The complex ring can be bonded to any heteroatom or side group on the carbon atom that provides a stable structure, and any ring atom may be substituted. Examples of such saturated or partially unsaturated heterocyclic radicals include, but are not limited to, tetrahydrofuranyl, tetrahydrothiophenyl, pyrrolidinyl, piperidinyl, pyrrolinyl, tetrahydroquinolinyl, tetrahydroisoquinolinyl, decahydroquinolinyl, oxazolidinyl, piperazinyl, dioxanyl, dioxolanyl, diazepinyl, oxazepinyl, thiazepinyl, morpholinyl, and quinuclidinyl. The terms "heterocyclic ring", "heterocyclyl", "heterocyclic ring", "heterocyclic group", "heterocyclic moiety", and "heterocyclic radical" are used interchangeably herein and include groups in which a heterocyclic ring is fused to one or more aryl groups, heteroaryl groups, or aliphatic rings, such as indolinyl, 3H-indolyl, chromanyl, phenanthridinyl, or tetrahydroquinolinyl, and the radical or point of attachment is on the heterocyclic ring. The heterocyclic ring can be monocyclic or bicyclic. The term "heterocyclylalkyl" represents an alkyl group substituted by heterocyclyl, and the alkyl and heterocyclyl moieties may be independently substituted.

[0164] Intraperitoneal: As used herein, the phrases "intraperitoneal administration" and "administered intraperitoneally" have the meaning understood in the art to represent the administration of a compound or composition into the peritoneum of a subject.

[0165] In vitro: As used herein, the term "in vitro" refers to events that occur not within a living organism (e.g., an animal, a plant, and / or a microorganism), but in an artificial environment, such as in a test tube or reactor, in cell culture medium, or otherwise.

[0166] In vivo: As used herein, the term "in vivo" refers to events that occur within a living organism (e.g., an animal, a plant, and / or a microorganism).

[0167] Lower alkyl: The term "lower alkyl" refers to C 1~4It represents a linear or branched alkyl group. As an example, lower alkyl groups are methyl, ethyl, propyl, isopropyl, butyl, isobutyl, and tert-butyl.

[0168] Lower haloalkyl: The term "lower haloalkyl" refers to a C substituted with one or more halogen atoms 1~4 It represents a linear or branched alkyl group.

[0169] Optionally substituted: When described herein, the compounds of the present invention may contain an "optionally substituted" moiety. In general, the term "substituted" means that one or more hydrogens of the designated moiety are replaced with a suitable substituent, whether or not the term "optionally" is present. Unless otherwise indicated, an "optionally substituted" group may have a suitable substituent at each substitutable position of the group when one or more positions in any given structure may be the same or different for each position. Combinations of substituents contemplated by the present invention preferably result in the formation of stable or chemically possible compounds. As used herein, the term "stable" refers to compounds that do not substantially change when in a state that allows their manufacture, detection, and, in certain embodiments, their recovery, purification, and use for one or more of the purposes disclosed herein.

[0170] Suitable monovalent substituents on a substitutable carbon atom of an "optionally substituted" group are independently halogen; -(CH2) 0~4 R ○ ; -(CH2) 0~4 OR ○ ; -O(CH2) 0~4 R ○ , -O-(CH2) 0~4 C(O)OR ○ ; -(CH2) 0~4 CH(OR ○ )2; -(CH2) 0~4 SR ○ ; R ○ optionally substituted with (CH2) 0~4 Ph; R ○ optionally substituted with (CH2) 0~4O(CH2) 0~1 Ph; R ○ CH=CHPh; R which may be substituted ○ (CH2) which may be substituted 0~4 O(CH2) 0~1 -pyridyl; -NO2; -CN; -N3; (CH2) 0~4 N(R ○ )2; -(CH2) 0~4 N(R ○ )C(O)R ○ ; -N(R ○ )C(S)R ○ ; -(CH2) 0~4 N(R ○ )C(O)NR ○ 2; N(R ○ )C(S)NR ○ 2; -(CH2) 0~4 N(R ○ )C(O)OR ○ ; -N(R ○ )N(R ○ )C(O)R ○ ; N(R ○ )N(R ○ )C(O)NR ○ 2; N(R ○ )N(R ○ )C(O)OR ○ ; -(CH2) 0~4 C(O)R ○ ; -C(S)R ○ ; -(CH2) 0~4 C(O)OR ○ ; -(CH2) 0~4 C(O)SR ○ ; (CH2) 0~4 C(O)OSiR ○ 3; -(CH2) 0~4 OC(O)R ○ ; -OC(O)(CH2) 0~4 SR-, SC(S)SR ○ ; -(CH2) 0~4 SC(O)R ○ ; -(CH2) 0~4 C(O)NR ○ 2; -C(S)NR ○ 2; -C(S)SR ○ ; -SC(S)SR ○ , (CH2)0~4 OC(O)NR ○ 2;C(O)N(OR ○ )R ○ ;-C(O)C(O)R○;-C(O)CH2C(O)R○;-C(NOR○)R ○ ;(CH2) 0~4 SSR ○ ;-(CH2) 0~4 S(O)2R ○ ;-(CH2) 0~4 S(O)2OR ○ ;-(CH2) 0~4 OS(O)2R ○ ;-S(O)2NR ○ 2;(CH2) 0~4 S(O)R ○ ;N(R ○ )S(O)2NR ○ 2;-N(R ○ )S(O)2R ○ ;-N(OR ○ )R ○ ;-C(NH)NR ○ 2;-P(O)2R ○ ;P(O)R ○ 2;OP(O)R ○ 2;-OP(O)(OR ○ )2;-SiR○3;-(C 1~4 linear or branched alkylene)O-N(R ○ )2; or -(C 1~4 linear or branched alkylene)C(O)O-N(R ○ )2(wherein each R ○ may be substituted as follows and is independently hydrogen, C 1~6 aliphatic, -CH2Ph, -O(CH2) 0~1 Ph, -CH2-(5-6 membered heteroaryl ring) or a 5-6 membered saturated, partially unsaturated, or aryl ring having 0-4 heteroatoms independently selected from nitrogen, oxygen, or sulfur, or, notwithstanding the above definition, two R's independently occurring ○may, together with the intervening atoms, be substituted as follows and independently form a 3- to 12-membered saturated, partially unsaturated, or aryl monocyclic or bicyclic ring having 0 to 4 heteroatoms selected from nitrogen, oxygen, or sulfur.)

[0171] R ○ The above suitable monovalent substituents (or rings formed together by two independently occurring Rs ○ are independently halogen, -(CH2) 0~2 R ● , -(haloR ● ), -(CH2) 0~2 OH, -(CH2) 0~2 OR ● , -(CH2) 0~2 CH(OR ● )2; O(haloR ● ), -CN, -N3, -(CH2) 0~2 C(O)R ● , -(CH2) 0~2 C(O)OH, -(CH2) 0~2 C(O)OR ● , -(CH2) 0~2 SR ● , -(CH2) 0~2 SH, -(CH2) 0~2 NH2, -(CH2) 0~2 NHR ● , -(CH2) 0~2 NR ● 2, -NO2, -SiR ● 3, -OSiR ● 3, C(O)SR ● , -(C 1~4 linear or branched alkylene)C(O)OR ● , or -SSR ● (wherein each R ● is unsubstituted or, when preceded by "halo", substituted only with one or more halogens and, independently, C 1~4 aliphatic, -CH2Ph, -O(CH2) 0~1(selected from Ph, or an aryl ring having 0 to 4 heteroatoms independently selected from 5- or 6-membered saturated, partially unsaturated, or nitrogen, oxygen, or sulfur). R ○ Suitable divalent substituents on the saturated carbon atoms of R include =O and =S.

[0172] Suitable divalent substituents on the saturated carbon atoms of the "optionally substituted" group include the following: =O, =S, =NNR * 2, =NNHC(O)R * , =NNHC(O)OR * , =NNHS(O)2R * , =NR * , =NOR * , -O(C(R * 2)) 2~3 O-, or -S(C(R * 2)) 2~3 S- (where each R that appears independently * is hydrogen, a C that can be substituted as described below 1~6 aliphatic, or selected from an unsubstituted 5- or 6-membered saturated, partially unsaturated, or aryl ring having 0 to 4 heteroatoms independently selected from nitrogen, oxygen, or sulfur). Suitable divalent substituents bonded to the adjacent substitutable carbon of the "optionally substituted" group: -O(CR * 2) 2~3 O- (where each R that appears independently * is hydrogen, a C that can be substituted as described below 1~6 aliphatic, or selected from an unsubstituted 5- or 6-membered saturated, partially unsaturated, or aryl ring having 0 to 4 heteroatoms independently selected from nitrogen, oxygen, or sulfur).

[0173] Suitable substituents on the aliphatic group of R* include halogen, -R ● , -(haloR ● ), -OH, -OR ● , -O(haloR ● ), -CN, -C(O)OH, -C(O)OR ● , -NH2, -NHR ● , -NR ●2. or -NO2 (wherein each R ● is unsubstituted or, when preceded by "halo", substituted only with one or more halogens, and, independently, C 1~4 aliphatic, -CH2Ph, -O(CH2) 0~1 Ph, or an aryl ring having 0 to 4 heteroatoms independently selected from nitrogen, oxygen, or sulfur, which is 5- to 6-membered saturated, partially unsaturated, or aryl) is exemplified.

[0174] Suitable substituents on the substitutable nitrogen of the "optionally substituted" group include -R † , -NR † 2, -C(O)R † , -C(O)OR † , -C(O)C(O)R † , -C(O)CH2C(O)R † , -S(O)2R † , S(O)2NR † 2, -C(S)NR † 2, -C(NH)NR † 2, or -N(R † )S(O)2R † ; (wherein each R † is independently halogen, the following substitutable C 1~6 aliphatic, unsubstituted -OPh, or an aryl ring having 0 to 4 heteroatoms independently selected from nitrogen, oxygen, or sulfur, which is 5- to 6-membered saturated, partially unsaturated, or aryl, or, notwithstanding the above definition, two independently occurring R † together with the intervening atoms form, independently, an unsubstituted 3- to 12-membered saturated, partially unsaturated, or aryl monocyclic or bicyclic ring having 0 to 4 heteroatoms selected from nitrogen, oxygen, or sulfur) is exemplified.

[0175] Suitable substituents on the aliphatic group of R† are, independently, halogen, -R●, -(haloR●), -OH, -OR●, -O(haloR●), -CN, -C(O)OH, -C(O)OR●, -NH2, -NHR●, -NR●2, or -NO2 (wherein each R● is unsubstituted or, when preceded by "halo", substituted only by one or more halogens and, independently, is C1-4 aliphatic, -CH2Ph, -O(CH2)0-1Ph, or an aryl ring having 0-4 heteroatoms independently selected from nitrogen, oxygen, or sulfur and being saturated, partially unsaturated, or having 5-6 members).

[0176] Oral: As used herein, the terms "oral administration" and "administered orally" refer to the oral administration of a compound or composition and have the meaning understood in the art.

[0177] Parenteral: As used herein, the terms "parenteral administration" and "administered parenterally" refer to a method of administration other than enteral and topical administration, usually by injection, and have the meaning understood in the art and include, but are not limited to, intravenous, intramuscular, intraarterial, intrathecal, intracapsular, intraorbital, intracardiac, intradermal, intraperitoneal, intratracheal, subcutaneous, subepidermal, intraarticular, subcapsular, subdural, intraspinal, and intrasternal injections and infusions.

[0178] Partially unsaturated: As used herein, the term "partially unsaturated" refers to a ring moiety containing at least one double or triple bond. The term "partially unsaturated" is intended to encompass rings having multiple unsaturated moieties but is not intended to include aryl or heteroaryl moieties as defined herein.

[0179] As used herein, the term "pharmaceutical composition" refers to an active agent formulated together with one or more pharmaceutically acceptable carriers. In some embodiments, the active agent is present in a unit dosage amount appropriate for administration in a therapeutic regimen that, when administered to a suitable population, exhibits a statistically significant probability of achieving a predetermined therapeutic effect. In some embodiments, the pharmaceutical composition may be specifically formulated for administration in solid or liquid form, for the following uses: oral administration, for example, aqueous solutions or suspensions (aqueous or non-aqueous), tablets, for example, for buccal, sublingual, and systemic absorption uses, boluses, powders, granules, pastes applied to the tongue; parenteral administration, for example, by subcutaneous, intramuscular, intravenous, or epidural injection, as a sterile solution or suspension, or as a sustained release formulation; topical administration, for example, as creams, ointments, or sustained release patches or sprays applied to the skin, lung, or mouth; intravaginally or rectally, for example, as pessaries, creams, or foams; sublingually; ophthalmically; transdermally; or nasally, to the lung, and other mucosal surfaces.

[0180] Pharmaceutically acceptable: As used herein, the phrase "pharmaceutically acceptable" means a compound, substance, composition, and / or dosage form that, within the scope of sound medical judgment, is commensurate with a reasonable benefit / risk ratio and is suitable for use in contact with the tissues of humans and animals without excessive toxicity, irritation, allergic response, or other problems or complications.

[0181] Pharmaceutically acceptable carrier: As used herein, the term "pharmaceutically acceptable carrier" means a pharmaceutically acceptable material, composition or medium such as a liquid or solid filler, diluent, excipient, or solvent encapsulating material involved in the transport or conveyance from one organ, or part of the body, to another organ, or part of the body. Each carrier must be "acceptable" in the sense of being compatible with the other ingredients of the formulation and not injurious to the patient. Some examples of materials that can serve as pharmaceutically acceptable carriers are: sugars such as lactose, glucose and sucrose; starches such as corn starch and potato starch; celluloses and their derivatives such as sodium carboxymethyl cellulose, ethyl cellulose and cellulose acetate; tragacanth; malt; gelatin; talc; excipients such as cocoa butter and suppository wax; oils such as peanut oil, cottonseed oil, safflower oil, sesame oil, olive oil, corn oil and soybean oil; glycols such as propylene glycol; polyols such as glycerin, sorbitol, mannitol and polyethylene glycol; esters such as ethyl oleate and ethyl laurate; agar; buffering agents such as magnesium hydroxide and aluminum hydroxide; alginic acid; pyrogen-free water; isotonic saline; Ringer's solution; ethyl alcohol; pH buffering solutions; polyesters, polycarbonates and / or polyanhydrides; and other innocuous compatible substances used in pharmaceutical formulations.

[0182] Pharmaceutically acceptable salts: As used herein, the term "pharmaceutically acceptable salts" refers to salts of such compounds that are suitable for use in a pharmaceutical context, i.e., within the sound medical judgment, commensurate with a reasonable benefit / risk ratio, without undue toxicity, irritation, allergic response, etc., and are suitable for use in contact with the tissues of humans and lower animals. Pharmaceutically acceptable salts are well known in the art. For example, S.M. Berge et al. describe pharmaceutically acceptable salts in detail in J. Pharmaceutical Sciences, 66: 1-19 (1977). In some embodiments, pharmaceutically acceptable salts include adipate, alginate, ascorbate, aspartate, benzenesulfonate, benzoate, bisulfate, borate, butyrate, camphorate, camphorsulfonate, citrate, cyclopentanepropionate, digluconate, dodecyl sulfate, ethanesulfonate, formate, fumarate, glucoheptanoate, glycerophosphate, gluconate, hemisulfate, heptanoate, hexanoate, hydroiodide, 2-hydroxy-ethanesulfonate, lactobionate, lactate, laurate, lauryl sulfate, malate, maleate, malonate, methanesulfonate, 2-naphthalenesulfonate, nicotinate, nitrate, oleate, oxalate, palmitate, pamoate, pectinate, persulfate, 3-phenylpropionate, phosphate, picrate, pivalate, propionate, stearate, succinate, sulfate, tartrate, thiocyanate, p-toluenesulfonate, undecanoate, valerate, etc., but are not limited thereto. Representative alkali or alkaline earth metal salts include sodium, lithium, potassium, calcium, magnesium, etc. In some embodiments, pharmaceutically acceptable salts include, where appropriate, harmless ammonium, quaternary ammonium, and amine cations formed using counterions such as halides, hydroxides, carboxylates, sulfates, phosphates, nitrates, alkylsulfonates having 1 to 6 carbon atoms, and arylsulfonates.

[0183] Prodrug: Generally, as the term is used herein and as understood in the art, a “prodrug” is an entity that, when administered to a living being, is metabolized in the body to deliver an agent of interest (e.g., a therapeutic or diagnostic) activity. Typically, such metabolism causes the removal of at least one “prodrug moiety” such that the active agent is generated. Various forms of “prodrugs” are well known in the art. Examples of such prodrug moieties include: a) Design of Prodrugs, edited by H. Bundgaard, (Elsevier, 1985) and Methods in Enzymology, 42:309-396, edited by K. Widder, et al. (Academic Press, 1985); b) Prodrugs and Targeted Delivery, edited by by J. Rautio (Wiley, 2011); c) Prodrugs and Targeted Delivery, edited by by J. Rautio (Wiley, 2011); d) A Textbook of Drug Design and Development, edited by Krogsgaard-Larsen; e) Bundgaard, Chapter 5 “Design and Application of Prodrugs”, by H. Bundgaard, p. 113-191 (1991); f) Bundgaard, Advanced Drug Delivery Reviews, 8:1-38 (1992); g) Bundgaard, et al., Journal of Pharmaceutical Sciences, 77:285 (1988); and h) Kakeya, et al., Chem. Pharm. Bull., 32:692 (1984) See reference.

[0184] Like the other compounds described herein, prodrugs can be provided in various forms, such as crystalline form, salt form, among others. In some embodiments, the prodrug is provided as its pharmaceutically acceptable salt.

[0185] Protecting Group: As used herein, the term "protecting group" is well known in the art and includes those described in detail in Protecting Groups in Organic Synthesis, T. W. Greene and P. G. M. Wuts, 3rd edition, John Wiley & Sons, 1999 (which is hereby incorporated by reference in its entirety). Also included are protecting groups specifically adapted to nucleotides and nucleotide chemistry as described in Current Protocols in Nucleic Acid Chemistry, edited by Serge L. Beaucage et al. 06 / 2012 (the entire chapter 2 is hereby incorporated by reference). Suitable amino protecting groups include methyl carbamate, ethyl carbamate, 9-fluorenylmethyl carbamate (Fmoc), 9-(2-sulfo)fluorenylmethyl carbamate, 9-(2,7-dibromo)fluorenylmethyl carbamate, 2,7-di-t-butyl-[9-(10,10-dioxo-10,10,10,10-tetrahydrothioxanthyl)]methyl carbamate (DBD-Tmoc), 4-methoxyphenanthryl carbamate (Phenoc), 2,2,2-trichloroethyl carbamate (Troc), 2-trimethylsilylethyl carbamate (Teoc), 2-phenylethyl carbamate (hZ), 1-(1-adamantyl)-1-methylethyl carbamate (Adpoc), 1,1-dimethyl-2-haloethyl carbamate, 1,1-dimethyl-2,2-dibromoethyl carbamate (DB-t-BOC), 1,1-dimethyl-2,2,2-trichloroethyl carbamate (TCBOC), 1-methyl-1-(4-biphenylyl)ethyl carbamate (Bpoc), 1-(3,5-di-t-butylphenyl)-1-methylethyl carbamate (t-Bumeoc), 2-(2'- and 4'-pyridyl)ethyl carbamate (Pyoc), 2-(N,N-dicyclohexylcarboxamide) ethyl carbamate, t-butyl carbamate (BOC), 1-adamantyl carbamate (Adoc), vinyl carbamate (Voc), allyl carbamate (Alloc), 1-isopropylallyl carbamate (Ipaoc), cinnamyl carbamate (Coc), 4-nitrocinnamyl carbamate (Noc), 8-quinolyl carbamate, N-hydroxypiperidinyl carbamate, alkyldithiocarbamate, benzyl carbamate (Cbz), p-methoxybenzyl carbamate (Moz), p-nitrobenzyl carbamate, p-bromobenzyl carbamate, p-chlorobenzyl carbamate, 2,4-dichlorobenzyl carbamate, 4-methylsulfinylbenzyl carbamate (Msz), 9-anthrylmethyl carbamate, diphenylmethyl carbamate, 2-methylthioethyl carbamate, 2-methylsulfonylethyl carbamate, 2-(p-toluenesulfonyl)ethyl carbamate, [2-(1,3-dithianyl)]methyl carbamate (Dmoc), 4-methylthiophenyl carbamate (Mtpc), 2,4-dimethylthiophenyl carbamate (Bmpc), 2-phosphonioethyl carbamate (Peoc), 2-triphenylphosphonioisopropyl carbamate (Ppoc), 1,1-dimethyl-2-cyanoethyl carbamate, m-chloro-p-acryloxybenzyl carbamate, p-(dihydroxyboryl)benzyl carbamate, 5-benzisoxazolylmethyl carbamate, 2-(trifluoromethyl)-6-chromonylmethyl carbamate (Tcroc), m-nitrophenyl carbamate, 3,5-dimethoxybenzyl carbamate, o-nitrobenzyl carbamate, 3,4-dimethoxy-6-nitrobenzyl carbamate, phenyl(o-nitrophenyl)methyl carbamate, phenothiazinyl-(10)-carbonyl derivative, N'-p-toluenesulfonylaminocarbonyl derivative, N'-phenylaminothiocarbonyl derivative, t-amyl carbamate, S-benzylthiocarbamate, p-cyanobenzyl carbamate, cyclobutyl carbamate, cyclohexyl carbamate, cyclopentyl carbamate, cyclopropylmethyl carbamate, p-decyloxybenzyl carbamate, 2,2-dimethoxycarbonylvinyl carbamate, o-(N,N-dimethylcarboxamide)benzyl carbamate, 1,1-dimethyl-3-(N,N-dimethylcarboxamide)propyl carbamate, 1,1-dimethylpropynyl carbamate, di(2-pyridyl)methyl carbamate, 2-furanylmethyl carbamate, 2-iodoethyl carbamate, isobornyl carbamate, isobutyl carbamate, isonicotinyl carbamate, p-(p’-methoxyphenylazo)benzyl carbamate, 1-methylcyclobutyl carbamate, 1-methylcyclohexyl carbamate, 1-methyl-1-cyclopropylmethyl carbamate, 1-methyl-1-(3,5-dimethoxyphenyl)ethyl carbamate, 1-methyl-1-(p-phenylazophenyl)ethyl carbamate, 1-methyl-1-phenylethyl carbamate, 1-methyl-1-(4-pyridyl)ethyl carbamate, phenyl carbamate, p-(phenylazo)benzyl carbamate, 2,4,6-tri-t-butylphenyl carbamate, 4-(trimethylammonium)benzyl carbamate, 2,4,6-trimethylbenzyl carbamate, formamide, acetamide, chloroacetamide, trichloroacetamide, trifluoroacetamide, phenylacetamide, 3-phenylpropanamide, picolinamide, 3-pyridylcarboxamide, N-benzoylphenylalanyl derivative, benzamide, p-phenylbenzamide, o-nitrophenylacetamide, o-nitrophenoxyacetamide, acetoacetamide, (N’-dithiobenzyloxycarbonylamino)acetamide, 3-(p-hydroxyphenyl)propanamide, 3-(o-nitrophenyl)propanamide, 2-methyl-2-(o-nitrophenoxy)propanamide, 2-methyl-2-(o-phenylazophenoxy)propanamide, 4-chlorobutanamide, 3-methyl-3-nitrobutanamide, o-nitrocinnamide, N-acetylmethionine derivative, o-nitrobenzamide, o-(benzoyloxymethyl)benzamide, 4,5-diphenyl-3-oxazolin-2-one, N-phthalimide, N-dithiosuccinimide (Dts), N-2,3-diphenylmaleimide, N-2,5-dimethylpyrrole, N-1,1,4,4-Tetramethyldisilylazacyclopentane adduct (STABASE), 5-substituted 1,3-dimethyl-1,3,5-triazacyclohexan-2-one, 5-substituted 1,3-dibenzyl-1,3,5-triazacyclohexan-2-one, 1-substituted 3,5-dinitropyridone, N-methylamine, N-allylamine, N-[2-(trimethylsilyl)ethoxy]methylamine (SEM), N-3-acetoxypropylamine, N-(1-isopropyl-4-nitro-2-oxo-3-pyrroline-3-yl)amine, quaternary ammonium salts, N-benzylamine, N-di(4-methoxyphenyl)methylamine, N-5-dibenzosuberlylamine, N-triphenylmethylamine (Tr), N-[(4-methoxyphenyl)diphenylmethyl]amine (MMTr), N-9-phenylfluorenylamine (PhF), N-2,7-dichloro-9-fluorenylmethyleneamine, N-ferrocenylmethylamino (Fcm), N-2-picolylamino N'-oxide, N-1,1-dimethylthiomethyleneamine, N-benzylideneamine, N-p-methoxybenzylideneamine, N-diphenylmethyleneamine, N-[(2-pyridyl)mesityl]methyleneamine, N-(N',N'-dimethylaminomethylene)amine, N,N'-isopropylideneamine, N-p-nitrobenzylideneamine, N-salicylideneamine, N-5-chlorosalicylideneamine, N-(5-chloro-2-hydroxyphenyl)phenylmethyleneamine, N-cyclohexylideneamine, N-(5,5-dimethyl-3-oxo-1-cyclohexenyl)amine, N-borane derivatives, N-diphenylboric acid derivatives, N-[phenyl(pentacarbonylchromium- or tungsten)carbonyl]amine, N-copper chelates, N-zinc chelates, N-nitroamines, N-nitrosoamines, amine N-oxides, diphenylphosphine amide (Dpp), dimethylthiophosphine amide (Mpt), diphenylthiophosphine amide (Ppt), dialkyl phosphoramidates, dibenzyl phosphoramidate, diphenyl phosphoramidate, benzenesulfenamide, o-nitrobenzenesulfenamide (Nps), 2,4-Dinitrobenzenesulfenamide, pentachlorobenzenesulfenamide, 2-nitro-4-methoxybenzenesulfenamide, triphenylmethylsulfenamide, 3-nitropyridinesulfenamide (Npys), p-toluenesulfonamide (Ts), benzenesulfonamide, 2,3,6-trimethyl-4-methoxybenzenesulfonamide (Mtr), 2,4,6-trimethoxybenzenesulfonamide (Mtb), 2,6-dimethyl-4-methoxybenzenesulfonamide (Pme), 2,3,5,6-tetramethyl-4-methoxybenzenesulfonamide (Mte), 4-methoxybenzenesulfonamide (Mbs), 2,4,6-trimethylbenzenesulfonamide (Mts), 2,6-dimethoxy-4-methylbenzenesulfonamide (iMds), 2,2,5,7,8-pentamethylchroman-6-sulfonamide (Pmc), methanesulfonamide (Ms), β-trimethylsilylethanesulfonamide (SES), 9-anthracenesulfonamide, 4-(4’,8’-dimethoxynaphthylmethyl)benzenesulfonamide (DNMBS), benzylsulfonamide, trifluoromethylsulfonamide, and phenacylsulfonamide are included.,

[0186] Suitably protected carboxylic acids include, but are not limited to, silyl-, alkyl-, alkenyl-, aryl-, and arylalkyl-protected carboxylic acids. Examples of suitable silyl groups include trimethylsilyl, triethylsilyl, t-butyldimethylsilyl, t-butyldiphenylsilyl, triisopropylsilyl, and the like. Examples of suitable alkyl groups include methyl, benzyl, p-methoxybenzyl, 3,4-dimethoxybenzyl, trityl, t-butyl, tetrahydropyran-2-yl. Examples of suitable alkenyl groups include allyl. Examples of suitable aryl groups include optionally substituted phenyl, biphenyl, or naphthyl. Examples of suitable arylalkyl groups include optionally substituted benzyl (e.g., p-methoxybenzyl (MPM), 3,4-dimethoxybenzyl, O-nitrobenzyl, p-nitrobenzyl, p-halobenzyl, 2,6-dichlorobenzyl, p-cyanobenzyl), and 2- and 4-picolyl.

[0187] Suitable hydroxyl protecting groups include methyl, methoxymethyl (MOM), methylthiomethyl (MTM), t-butylthiomethyl, (phenyldimethylsilyl)methoxymethyl (SMOM), benzyloxymethyl (BOM), p-methoxybenzyloxymethyl (PMBM), (4-methoxyphenoxy)methyl (p-AOM), guaiacolmethyl (GUM), t-butoxymethyl, 4-pentenyl oxymethyl (POM), siloxymethyl, 2-methoxyethoxymethyl (MEM), 2,2,2-trichloroethoxymethyl, bis(2-chloroethoxy)methyl, 2-(trimethylsilyl)ethoxymethyl (SEMOR), tetrahydropyranyl (THP), 3-bromotetrahydropyranyl, tetrahydrothiopyranyl, 1-methoxycyclohexyl, 4-methoxytetrahydropyranyl (MTHP), 4-methoxytetrahydrothiopyranyl, 4-methoxytetrahydrothiopyranyl S,S-dioxide, 1-[(2-chloro-4-methyl)phenyl]-4-methoxypiperazin-4-yl (CTMP), 1,4-dioxan-2-yl, tetrahydrofuranyl, tetrahydrothiofuranyl, 2,3,3a,4,5,6,7,7a-octahydro-7,8,8-trimethyl-4,7-methanobenzofuran-2-yl, 1-ethoxyethyl, 1-(2-chloroethoxy)ethyl, 1-methyl-1-methoxyethyl, 1-methyl-1-benzyloxyethyl, 1-methyl-1-benzyloxy-2-fluoroethyl, 2,2,2-trichloroethyl, 2-trimethylsilylethyl, 2-(phenylselenyl)ethyl, t-butyl, allyl, p-chlorophenyl, p-methoxyphenyl, 2,4-dinitrophenyl, benzyl, p-methoxybenzyl, 3,4-dimethoxybenzyl, o-nitrobenzyl, p-nitrobenzyl, p-halobenzyl, 2,6-dichlorobenzyl, p-cyanobenzyl, p-phenylbenzyl, 2-picolyl, 4-picolyl, 3-methyl-2-picolyl N-oxide, diphenylmethyl, p,p'-dinitrobenzhydryl, 5-dibenzosuberyl, triphenylmethyl, α-naphthyldiphenylmethyl, p-methoxyphenyldiphenylmethyl, di(p-methoxyphenyl)phenylmethyl, tri(p-methoxyphenyl)methyl, 4-(4'-bromophenacyloxyphenyl)diphenylmethyl, 4,4',4''-tris(4,5-dichlorophthalimidophenyl)methyl, 4,4',4''-tris(levulinoyloxyphenyl)methyl, 4,4',4''-tris(benzoyloxyphenyl)methyl, 3-(imidazol-1-yl)bis(4',4''-dimethoxyphenyl)methyl, 1,1-bis(4-methoxyphenyl)-1'-pyrenylmethyl, 9-anthryl, 9-(9-phenyl)xanthenyl, 9-(9-phenyl-10-oxo)anthryl, 1,3-benzodithiolan-2-yl, benzisothiazolyl S,S-dioxide, trimethylsilyl (TMS), triethylsilyl (TES), triisopropylsilyl (TIPS), dimethylisopropylsilyl (IPDMS), diethylisopropylsilyl (DEIPS), dimethyltexylsilyl, t-butyldimethylsilyl (TBDMS), t-butyldiphenylsilyl (TBDPS), tribenzylsilyl, tri-p-xylylsilyl, triphenylsilyl, diphenylmethylsilyl (DPMS), t-butylmethoxyphenylsilyl (TBMPS), formate, benzoylformate, acetate, chloroacetate, dichloroacetate, trichloroacetate, trifluoroacetate, methoxyacetate, triphenylmethoxyacetate, phenoxyacetate, p-chlorophenoxyacetate, 3-phenylpropionate, 4-oxopentanoate (levulinate), 4,4-(ethylenedithio)pentanoate (levulinoyldithioacetal), pivalate, adamantate, crotonate, 4-methoxycrotonate, benzoate, p-phenylbenzoate, 2,4,6-trimethylbenzoate (mesitoate), alkylmethyl carbonate, 9-fluorenylmethyl carbonate (Fmoc), alkyl ethyl carbonate, alkyl 2,2,2-trichloroethyl (Troc), 2-(trimethylsilyl)ethyl carbonate (TMSEC), 2-(phenylsulfonyl)ethyl carbonate (Psec), 2-(triphenylphosphonio)ethyl carbonate (Peoc), alkyl isobutyl carbonate, alkyl vinyl carbonate, alkyl allyl carbonate, alkyl p-nitrophenyl carbonate, alkyl benzyl carbonate, alkyl p-methoxybenzyl carbonate, alkyl 3,4-dimethoxybenzyl carbonate, alkyl o-nitrobenzyl carbonate, alkyl p-nitrobenzyl carbonate, alkyl S-benzyl thiocarbonate, 4-ethoxy-1-naphthyl carbonate, methyl dithiocarbonate, 2-iodobenzoate, 4-azidobutyrate, 4-nitro-4-methylpentanoate, o-(dibromomethyl)benzoate, 2-formylbenzenesulfonate, 2-(methylthiomethoxy)ethyl, 4-(methylthiomethoxy)butyrate, 2-(methylthiomethoxymethyl)benzoate, 2,6-dichloro-4-methylphenoxyacetate, 2,6-dichloro-4-(1,1,3,3-tetramethylbutyl)phenoxyacetate, 2,4-bis(1,1-dimethylpropyl)phenoxyacetate, chlorodiphenylacetate, isobutyrate, monosuccinate, (E)-2-methyl-2-butenoate, o-(methoxycarbonyl)benzoate, α-naphthoate, nitrate ester, alkyl N,N,N’,N’-tetramethylphosphorodiamidate, alkyl N-phenylcarbamate, borate ester, dimethylphosphinothionyl, alkyl 2,4-dinitrophenylsulfenate, sulfate ester, methanesulfonate (mesylate), benzylsulfonate, and tosylate (Ts). To protect 1,2- or 1,3-diols, the protecting groups include methylene acetal, ethylidene acetal, 1-t-butylethylidene ketal, 1-phenylethylidene ketal, (4-methoxyphenyl)ethylidene acetal, 2,2,2-trichloroethylidene acetal, acetonide, cyclopentylidene ketal, cyclohexylidene ketal, cycloheptylidene ketal, benzylidene acetal, p-methoxybenzylidene acetal, 2,4-dimethoxybenzylidene ketal, 3,4-dimethoxybenzylidene acetal, 2-nitrobenzylidene acetal, methoxymethylene acetal, ethoxymethylene acetal, dimethoxymethylene orthoester, 1-methoxyethylidene orthoester, 1-ethoxyethylidene orthoester, 1,2-dimethoxyethylidene orthoester, α-methoxybenzylidene orthoester, 1-(N,N-dimethylamino)ethylidene derivative, α-(N,N'-dimethylamino)benzylidene derivative, 2-oxacyclopentylidene orthoester, di-t-butylsilylene group (DTBS), 1,3-(1,1,3,3-tetraisopropyldisiloxanilidene) derivative (TIPDS), tetra-t-butoxydisiloxane-1,3-diylidene derivative (TBDS), cyclic carbonates, cyclic boronic esters, ethyl boronate, and phenyl boronate are mentioned.,

[0188] In some embodiments, the hydroxyl protecting group is acetyl, t-butyl, t-butoxymethyl, methoxymethyl, tetrahydropyranyl, 1-ethoxyethyl, 1-(2-chloroethoxy)ethyl, 2-trimethylsilylethyl, p-chlorophenyl, 2,4-dinitrophenyl, benzyl, benzoyl, p-phenylbenzoyl, 2,6-dichlorobenzyl, diphenylmethyl, p-nitrobenzyl, triphenylmethyl (trityl), 4,4'-dimethoxytrityl, trimethylsilyl, triethylsilyl, t-butyldimethylsilyl, t-butyldiphenylsilyl, triphenylsilyl, triisopropylsilyl, benzoylglycolate, chloroacetyl, trichloroacetyl, trifluoroacetyl, pivaloyl, 9-fluorenylmethyl carbonate, mesylate, tosylate, triflate, trityl, monomethoxytrityl (MMTr), 4,4'-dimethoxytrityl, (DMTr) and 4,4',4''-trimethoxytrityl (TMTr), 2-cyanoethyl (CE or Cne), 2-(trimethylsilyl)ethyl (TSE), 2-(2-nitrophenyl)ethyl, 2-(4-cyanophenyl)ethyl 2-(4-nitrophenyl)ethyl (NPE), 2-(4-nitrophenylsulfonyl)ethyl, 3,5-dichlorophenyl, 2,4-dimethylphenyl, 2-nitrophenyl, 4-nitrophenyl, 2,4,6-trimethylphenyl, 2-(2-nitrophenyl)ethyl, butylthiocarbonyl, 4,4',4''-tris(benzoyloxy)trityl, diphenylcarbamoyl, levulinyl, 2-(dibromomethyl)benzoyl (Dbmb), 2-(isopropylthiomethoxymethyl)benzoyl (Ptmt), 9-phenylxanthen-9-yl (pixyl) or 9-(p-methoxyphenyl)xanthen-9-yl (MOX). In some embodiments, each of the hydroxyl protecting groups is independently selected from acetyl, benzyl, t-butyldimethylsilyl, t-butyldiphenylsilyl and 4,4'-dimethoxytrityl. In some embodiments, the hydroxyl protecting group is selected from the group consisting of trityl, monomethoxytrityl and 4,4'-dimethoxytrityl groups.

[0189] In some embodiments, the phosphorus protecting group is a group that is attached to the internucleotide phosphorus bridge during oligonucleotide synthesis. In some embodiments, the phosphorus protecting group is attached to the sulfur atom of an internucleotide phosphorothioate bridge. In some embodiments, the phosphorus protecting group is attached to the oxygen atom of an internucleotide phosphorothioate bridge. In some embodiments, the phosphorus protecting group is attached to the oxygen atom of an internucleotide phosphate bridge. In some embodiments, the phosphorus protecting group is 2-cyanoethyl (CE or Cne), 2-trimethylsilylethyl, 2-nitroethyl, 2-sulfonylethyl, methyl, benzyl, o-nitrobenzyl, 2-(p-nitrophenyl)ethyl (NPE or Npe), 2-phenylethyl, 3-(N-tert-butylcarboxamido)-1-propyl, 4-oxopentyl, 4-methylthio-1-butyl, 2-cyano-1,1-dimethylethyl, 4-N-methylaminobutyl, 3-(2-pyridyl)-1-propyl, 2-[N-methyl-N-(2-pyridyl)]aminoethyl, 2-(N-formyl,N-methyl)aminoethyl, 4-[N-methyl-N-(2,2,2-trifluoroacetyl)amino]butyl.

[0190] Protein: As used herein, the term "protein" refers to a polypeptide (i.e., a chain of at least two amino acids joined to another by a peptide bond). In some embodiments, the protein comprises only naturally occurring amino acids. In some embodiments, the protein comprises one or more non-naturally occurring amino acids (e.g., moieties that form one or more peptide bonds with adjacent amino acids). In some embodiments, one or more residues of the protein chain comprise non-amino acid moieties (e.g., glycans, others). In some embodiments, the protein comprises more than one polypeptide chain joined, for example, by one or more disulfide bonds or associated by other means. In some embodiments, the protein comprises L-amino acids, D-amino acids, or both; in some embodiments, the protein comprises one or more amino acid modifications or analogs well known in the art. Useful modifications include, for example, terminal acetylation, amidation, methylation, others. The term "peptide" is generally used to denote a polypeptide having a length of less than about 100 amino acids, less than about 50 amino acids, less than about 20 amino acids, or less than about 10 amino acids. In some embodiments, the protein is an antibody, an antibody fragment, a biologically active portion thereof, and / or a characteristic portion thereof.

[0191] Sample: As used herein, a "sample" is a specific organism or material from which it is obtained. In some embodiments, the sample is a biological sample obtained from or derived from the subject source described herein. In some embodiments, the subject source includes an organism such as an animal or a human. In some embodiments, the biological sample includes biological tissue or biological fluid. In some embodiments, the biological sample includes bone marrow; blood; blood cells; ascites; tissue or fine needle biopsy samples; cell-containing body fluids; cell-free nucleic acids; sputum; saliva; urine; cerebrospinal fluid, ascites; pleural effusion; feces; lymph fluid; gynecological fluid; skin swab; vaginal swab; oral swab; nasal swab; washings or lavages such as catheter washings or bronchoalveolar lavages; aspirates; scrapings; bone marrow specimens; tissue biopsy specimens; surgical specimens; feces, other body fluids, secretions, and / or cells therefrom, among others, or any one or more of them. In some embodiments, the biological sample is or includes cells obtained from an individual. In some embodiments, the sample is a "primary sample" obtained directly from the subject source by any suitable means. For example, in some embodiments, the primary biological sample is obtained by a method selected from the group consisting of biopsy (e.g., fine needle aspiration or tissue biopsy), surgery, collection of body fluids (e.g., blood, lymph fluid, feces, etc.). In some embodiments, as will be apparent from the context, the term "sample" refers to a preparation obtained by treating the primary sample (e.g., by removing one or more of its components and / or adding one or more agents thereto). For example, filtration using a semi-permeable membrane. Such a "processed sample" may include, for example, nucleic acids or proteins obtained by extracting from the sample or treating the primary sample by techniques such as amplification or reverse transcription of mRNA, isolation and / or purification of specific components, among others. In some embodiments, the sample is a biological entity. In some embodiments, the sample is a plant. In some embodiments, the sample is an animal. In some embodiments, the sample is a human. In some embodiments, the sample is a non-human organism.

[0192] Stereochemical isomers: As used herein, the term "stereochemical isomers" refers to different compounds assembled from the same atoms bonded by the same series of bonds but having non-superposable different three-dimensional structures. In some embodiments of the present invention, the provided chemical composition may be, or may include, a pure composition of the individual stereochemical isomers of the compound; in some embodiments, the provided chemical composition may be, or may include, a mixture of two or more stereochemical isomers of the compound. In certain embodiments, such a mixture contains equal amounts of different stereochemical isomers; in certain embodiments, such a mixture contains different amounts of at least two different stereochemical isomers. In some embodiments, the chemical composition may include all of the diastereomers and / or enantiomers of the compound. In some embodiments, the chemical composition may include less than all of the diastereomers and / or enantiomers of the compound. In some embodiments, if a particular enantiomer of a compound of the present invention is desired, it may be synthesized, for example, by asymmetric synthesis or by derivation using a chiral auxiliary, and the resulting mixture of diastereomers is separated and the auxiliary is cleaved to obtain the pure desired enantiomer. Alternatively, when the molecule contains a basic functional group such as an amino group, diastereomeric salts are formed using an appropriate optically active acid and resolved, for example, by fractional recrystallization.

[0193] Subject: As used herein, the term "subject" or "patient" refers to any organism to which the provided compound or composition is administered according to the present invention for, for example, experimental, diagnostic, prophylactic, and / or therapeutic purposes. Typical subjects include animals (e.g., mice, rats, rabbits, non-human primates, and humans; insects; worms; other mammals such as) and plants. In some embodiments, the subject suffers from, and / or is susceptible to, a disease, disorder, and / or condition.

[0194] Substantially: As used herein, the term "substantially" represents a qualitative state indicating all or almost all of the range or degree of the feature or characteristic in question. One of ordinary skill in the art of biotechnology will understand that biological and chemical phenomena rarely avoid completion and / or consummation or achievement or absolute results. Thus, the term "substantially" is used herein to account for the potential lack of perfection inherent in many biological and / or chemical phenomena.

[0195] Affected: An individual "affected" with a disease, disorder, and / or condition has been diagnosed with and / or exhibits one or more symptoms of the disease, disorder, and / or condition.

[0196] (Prone to) Susceptible: An individual "susceptible" to a disease, disorder, and / or condition is at a higher risk of developing the disease, disorder, and / or condition than a member of the general population. In some embodiments, an individual susceptible to a disease, disorder, and / or condition may not be diagnosed with the disease, disorder, and / or condition. In some embodiments, an individual susceptible to a disease, disorder, and / or condition may exhibit symptoms of the disease, disorder, and / or condition. In some embodiments, an individual susceptible to a disease, disorder, and / or condition may not exhibit symptoms of the disease, disorder, and / or condition. In some embodiments, an individual susceptible to a disease, disorder, and / or condition will develop the disease, disorder, and / or condition. In some embodiments, an individual susceptible to a disease, disorder, and / or condition will not develop the disease, disorder, and / or condition.

[0197] Systemic: As used herein, the phrases "systemic administration", "systemically administered", "peripheral administration", and "peripherally administered" have the meaning understood in the art to represent the administration of a compound or composition such that it enters the entire body of the recipient.

[0198] Tautomers: As used herein, the term "tautomers" is used to denote organic compounds of different isomers that are readily convertible. Tautomers can be characterized by the formal migration of a hydrogen atom or proton, which occurs simultaneously with the conversion of a single bond and an adjacent double bond. In some embodiments, tautomers can result from proton tautomerism (i.e., rearrangement of protons). In some embodiments, tautomers can result from valence tautomerism (i.e., rapid rearrangement of bonding electrons). All such tautomers are intended to be included within the scope of the present invention. In some embodiments, the tautomers of a compound are present in a mobile equilibrium with each other such that attempts to synthesize separate substances result in the formation of a mixture. In some embodiments, the tautomers of a compound are separable and isolable compounds. In some embodiments of the present invention, a chemical composition can be provided that is a pure composition of a single tautomer of a compound or includes the same. In some embodiments of the present invention, a chemical composition can be provided as a mixture of two or more tautomers of a compound. In certain embodiments, such a mixture contains equal amounts of different tautomers; in certain embodiments, such a mixture contains different amounts of at least two tautomers of a compound. In some embodiments of the present invention, a chemical composition can contain all the tautomers of a compound. In some embodiments of the present invention, a chemical composition can contain fewer tautomers than all of the compound. In some embodiments of the present invention, a chemical composition can contain one or more tautomers of a compound in amounts that change over time as a result of interconversion. In some embodiments of the present invention, the tautomerism is keto-enol tautomerism. One skilled in the art of chemistry can "capture" (i.e., chemically modify to retain the "enol" form) keto-enol tautomerism using any suitable reagent well known in the art of chemistry and obtain an enol derivative that can subsequently be isolated using one or more suitable techniques well known in the art. Unless otherwise indicated, the present invention encompasses all tautomers of the relevant compounds, whether in pure form or in mixtures with each other.

[0199] Therapeutic agent: As used herein, the term "therapeutic agent" refers to any agent that, when administered to a subject, elicits a therapeutic and / or desired biological and / or pharmacological effect. In some embodiments, a therapeutic agent can be any substance that can be used to reduce, relieve, alleviate, suppress, prevent, delay onset, reduce severity, and / or decrease incidence of one or more symptoms or characteristics of a disease, disorder, and / or condition.

[0200] Therapeutically effective amount: As used herein, the term "therapeutically effective amount" means the amount of a substance (e.g., a therapeutic agent, composition, and / or formulation) that, when administered as part of a treatment regimen, elicits a desired biological response. In some embodiments, a therapeutically effective amount of a substance is an amount sufficient to treat, diagnose, prevent, and / or delay onset of a disease, disorder, and / or condition in a subject afflicted with or susceptible to the disease, disorder, and / or condition. As will be appreciated by those of skill in the art, the effective amount of a substance can vary depending on factors such as the desired biological endpoint, the substance being delivered, the target cell or tissue, among others. For example, the effective amount of a compound in a formulation for treating a disease, disorder, and / or condition is an amount that reduces, relieves, alleviates, suppresses, prevents, delays onset, reduces severity, and / or decreases incidence of one or more symptoms or characteristics of the disease, disorder, and / or condition. In some embodiments, a therapeutically effective amount is administered in a single dose; in some embodiments, multiple unit doses are required to deliver a therapeutically effective amount.

[0201] Treatment: As used herein, the terms "treating," "treatment," or "to treat" refer to any method used to partially or completely alleviate, relieve, relieve, suppress, prevent, delay the onset, reduce the severity, and / or reduce the incidence of one or more symptoms or characteristics of a disease, disorder, and / or condition. Treatment can be administered to a subject who does not exhibit symptoms of the disease, disorder, and / or condition. In some embodiments, for example, treatment can be administered to a subject who exhibits only the initial symptoms of the disease, disorder, and / or condition for the purpose of reducing the risk of developing the pathology associated with the disease, disorder, and / or condition.

[0202] Unsaturated: As used herein, the term "unsaturated" means that the moiety has one or more unsaturated units.

[0203] Unit Dose: As used herein, the expression “unit dose” refers to the single dose of a pharmaceutical composition and / or the amount administered in physically discrete units. In many embodiments, the unit dose contains a predetermined amount of the active agent. In some embodiments, the unit dose contains the entire single dose of the agent. In some embodiments, one or more unit doses are administered to achieve the entire single dose. In some embodiments, administration of multiple unit doses is necessary or expected to be necessary to achieve the intended effect. The unit dose can be, for example, a volume of liquid (e.g., an acceptable carrier) containing a predetermined amount of one or more therapeutic agents, a predetermined amount of a solid form, a sustained release formulation, or a drug delivery device containing a predetermined amount of one or more therapeutic agents, among others. It will be appreciated that the unit dose can be present in a formulation containing any of a variety of additional components in addition to the therapeutic agent. For example, acceptable carriers (e.g., pharmaceutically acceptable carriers), diluents, stabilizers, buffers, preservatives, among others, can be included, as described below. In many embodiments, it will be understood by those skilled in the art that the appropriate total daily dosage of a particular therapeutic agent can comprise a portion, or multiple unit doses, and can be determined, for example, by the attending physician within the scope of sound medical judgment. In some embodiments, the specific effective dosage level for any particular subject or organism can depend on a variety of factors including the disorder being treated and the severity of the disorder; the activity of the specific active compound being used; the specific composition being used; the age, weight, health status, gender and diet of the subject; the frequency of administration, and the excretion rate of the specific compound being used; the duration of the treatment; drugs and / or additional therapies being used in combination with or concurrently with the specific compound being used, and similar factors well known in the medical arts.

[0204] Wild-Type: As used herein, the term “wild-type” has the meaning understood in the art, representing an entity having the structure and / or activity actually found in a “normal” (as contrasted with mutant, diseased, altered, etc.) state or context. Those skilled in the art will recognize that wild-type genes and polypeptides often exist in multiple different forms (e.g., alleles).

[0205] Nucleic acid: The term "nucleic acid" includes any nucleotide, its modified variants, its analogs, and its polymers. The term "polynucleotide" as used herein refers to a multimeric form of nucleotides of any length, either ribonucleotides (RNA) or deoxyribonucleotides (DNA) or any of their modified variants or analogs. These terms refer to the primary structure of the molecule and thus include double-stranded and single-stranded DNA as well as double-stranded and single-stranded RNA. These terms include, as equivalents, RNA or DNA analogs made from nucleotide analogs and modified polynucleotides such as, but not limited to, methylated, protected, and / or capped nucleotides or polynucleotides. These terms include poly- or oligo-ribonucleotides (RNA) and poly- or oligo-deoxyribonucleotides (DNA); RNA or DNA derived from N-glycosides or C-glycosides of nucleobases and / or modified nucleobases; nucleic acids derived from sugars and / or modified sugars; and nucleic acids derived from phosphate bridges and / or modified phosphorus atom bridges (also referred to herein as "internucleotide linkages"). This term includes nucleic acids containing any combination of nucleobases, modified nucleobases, sugars, modified sugars, phosphate bridges, or modified phosphorus atom bridges. Examples include, but are not limited to, nucleic acids containing a ribose moiety, nucleic acids containing a deoxy-ribose moiety, nucleic acids containing both a ribose moiety and a deoxyribose moiety, and nucleic acids containing a ribose moiety and a modified ribose moiety. The prefix poly- refers to nucleic acids containing 2 to about 10,000 nucleotide monomer units, where the prefix oligo- refers to nucleic acids containing 2 to about 200 nucleotide monomer units.

[0206] Nucleotide: As used herein, the term "nucleotide" refers to the monomeric unit of a polynucleotide consisting of a heterocyclic base, a sugar, and one or more phosphate groups or phosphorus-containing internucleotide linkages. Naturally occurring bases (guanine (G), adenine (A), cytosine (C), thymine (T), and uracil (U)) are derivatives of purine or pyrimidine, but it should be understood that natural and non-natural base analogs are also included. Natural sugars are pentoses (five-carbon sugars), deoxyribose (forming DNA), or ribose (forming RNA), but it should be understood that natural and non-natural sugar analogs are also included. Nucleotides are linked via internucleotide linkages to form nucleic acids or polynucleotides. Many internucleotide linkages are known in the art (e.g., but not limited to phosphate, phosphorothioate, boranophosphate, etc.). Artificial nucleic acids include PNA (peptide nucleic acid), phosphotriester, phosphorothionate, H-phosphonate, phosphoramidate, boranophosphate, methylphosphonate, phosphonoacetate, thiophosphonoacetate, and other variants of the phosphate backbone of natural nucleic acids such as those described herein. Other analogs (e.g., artificial nucleic acids or components that can be incorporated into nucleic acids or artificial nucleic acids) include the following: boranophosphate RNA, FANA, locked nucleic acid (LNA), morpholino, peptide nucleic acid (PNA), threose nucleic acid (TNA), and glycol nucleic acid (GNA). Those skilled in the art recognize various modified nucleotides or nucleotide analogs, including, for example, those described in any of the following: Gryaznov, S; Chen, J.-K. J. Am. Chem. Soc. 1994, 116, 3143; Hendrix et al., 1997 Chem. Eur. J. 3:110; Hyrup et al., 1996 Bioorg. Med. Chem. 4:5; Jepsen et al., 2004 Oligo. 14:130-146; Jones et al., J. Org. Chem. 1993, 58, 2983; Koizumi et al., 2003 Nuc. Acids Res.12:3267 - 3273; Koshkin et al., 1998 Tetrahedron 54:3607 - 3630; Kumar et al., 1998 Bioo.Med.Chem.Let. 8:2219 - 2222; Lauritsen et al., 2002 Chem.Comm. 5:530 - 531; Lauritsen et al., 2003 Bioo.Med.Chem.Lett. 13:253 - 256; Mesmaeker et al., Angew.Chem., Int.Ed.Engl. 1994, 33, 226; Morita et al., 2001 Nucl.Acids Res.Supp. 1:241 - 242; Morita et al., 2002 Bioo.Med.Chem.Lett. 12:73 - 76; Morita et al., 2003 Bioo.Med.Chem.Lett. 2211 - 2226; Nielsen et al., 1997 Chem.Soc.Rev. 73; Nielsen et al., 1997 J.Chem.Soc.PerkinsTransl. 1:3423 - 3433; Obika et al., 1997 Tetrahedron Lett. 38(50):8735 - 8; Obika et al., 1998 Tetrahedron Lett. 39:5401 - 5404; Pallan et al., 2012 Chem.Comm. 48:8195 - 8197; Petersen et al., 2003 TRENDS Biotech. 21:74 - 81; Rajwanshi et al., 1999 Chem.Commun. 1395 - 1396; Schultz et al., 1996 Nucleic Acids Res. 24:2966; Seth et al., 2009 J. Med.Chem. 52:10 - 13; Seth et al., 2010 J.Med.Chem. 53:8309 - 8318; Seth et al., 2010 J.Org.Chem. 75:1569 - 1581; Seth et al., 2012 Bioo.Med.Chem.Lett. 22:296 - 299; Seth et al., 2012 Mol.Ther - Nuc.Acids.1. e47; Seth, Punit P; Siwkowski, Andrew; Allerson, Charles R; Vasquez, Guillermo; Lee, Sam; Prakash, Thazha P; Kinberger, Garth; Migawa, Michael T; Gaus, Hans; Bhat, Balkrishen; et al., From Nucleic Acids Symposium Series (2008), 52(1), 553 - 554; Singh et al., 1998 Chem.Comm. 1247 - 1248; Singh et al., 1998 J.Org.Chem. 63:10035 - 39; Singh et al., 1998 J.Org.Chem. 63:6078 - 6079; Sorensen 2003 Chem.Comm. 2130 - 2131; Ts’o et al., Ann.N.Y.Acad.Sci. 1988, 507, 220; Van Aerschot et al., 1995 Angew.Chem.Int.Ed.Engl. 34:1338; Vasseur et al., J.Am.Chem.Soc. 1992, 114, 4006; International Publication No. 20070900071 Pamphlet; International Publication No. 20070900071 Pamphlet; or International Publication No. 2016 / 079181 Pamphlet.

[0207] Nucleoside: The term "nucleoside" refers to the moiety in which a nucleobase or modified nucleobase is covalently attached to a sugar or modified sugar.

[0208] Sugar: The term "sugar" refers to monosaccharides in closed and / or open forms. Examples of saccharides include, but are not limited to, ribose, deoxyribose, pentofuranose, pentopyranose, and hexopyranose moieties. As used herein, the term also encompasses structural analogs that are used in place of normal sugar molecules such as glycols whose polymers form the backbone of nucleic acid analogs, glycol nucleic acid ("GNA").

[0209] Modified sugar: The term "modified sugar" refers to a moiety that can replace a sugar. The modified sugar mimics the configuration, electronic state, or some other physicochemical property of the sugar.

[0210] Nucleobase: The term "nucleobase" refers to the nucleic acid moiety associated with the hydrogen bonds that bind one nucleic acid strand to another complementary strand in a sequence-specific manner. Most natural nucleobases are adenine (A), guanine (G), uracil (U), cytosine (C), and thymine (T). In some embodiments, the natural nucleobases are modified adenine, guanine, uracil, cytosine, or thymine. In some embodiments, the natural nucleobases are methylated adenine, guanine, uracil, cytosine, or thymine. In some embodiments, the nucleobase is a "modified nucleobase", for example, a nucleobase other than adenine (A), guanine (G), uracil (U), cytosine (C), and thymine (T). In some embodiments, the modified nucleobase is methylated adenine, guanine, uracil, cytosine, or thymine. In some embodiments, the modified nucleobase mimics the configuration, electronic state, or some other physicochemical property of the nucleobase and retains the properties of the hydrogen bonds that bind one nucleic acid strand to another complementary strand in a sequence-specific manner. In some embodiments, the modified nucleobase can pair with the five all-natural bases (uracil, thymine, adenine, cytosine, or guanine) without substantially affecting the melting behavior, recognition by intracellular enzymes, or activity of the oligonucleotide duplex.

[0211] Chiral ligand: The term "chiral ligand" or "chiral auxiliary" refers to a part that is chiral and can be incorporated into a reactant so that the reaction can be carried out with a specific stereoselectivity.

[0212] Condensing reagent: In a condensation reaction, the term "condensing reagent" refers to a reagent that activates a less reactive site and makes it more sensitive to the action of another reagent. In some embodiments, such another reagent is a nucleophile.

[0213] Blocking group: The term "blocking group" refers to a group that shields the reactivity of a functional group. The functional group can subsequently have the shielding removed by removal of the blocking group. In some embodiments, the blocking group is a protecting group.

[0214] Part: The term "part" refers to a specific segment or functional group of a molecule. Chemical parts are often recognized as chemical entities incorporated or added into a molecule.

[0215] Solid support: The term "solid support" refers to any support that enables the synthesis of nucleic acids. In some embodiments, the term refers to a glass or polymer that is insoluble in the medium used in the reaction step of performing nucleic acid synthesis and derivatizing to introduce reactive groups. In some embodiments, the solid support is highly cross-linked polystyrene (HCP) or controlled pore glass (CPG). In some embodiments, the solid support is controlled pore glass (CPG). In some embodiments, the solid support is a composite support of controlled pore glass (CPG) and highly cross-linked polystyrene (HCP).

[0216] Linking moiety: The term "linking moiety" refers to any moiety that may be located between the terminal nucleotide and the solid support or between a terminal nucleoside and another nucleoside, nucleotide, or nucleic acid.

[0217] DNA molecule: The term "DNA molecule" refers to its single-stranded form or the polymeric form of double-stranded deoxyribonucleotides (adenine, guanine, thymine, or cytosine). This term refers only to the primary and secondary structures of the molecule and is not limited to any particular tertiary form. Thus, the term includes, inter alia, linear DNA molecules (e.g., restriction enzyme fragments), viruses, plasmids, and double-stranded DNA found in chromosomes. In discussing a particular double-stranded DNA molecule structure, sequences may be described herein according to the convention of giving only the sequence in the 5' to 3' direction along the non-transcribed strand of DNA (i.e., the strand having a sequence homologous to the mRNA).

[0218] Coding sequence: A DNA "coding sequence" or "coding region" is double-stranded DNA that is transcribed and translated into a polypeptide in vivo when placed under the control of appropriate expression control sequences. The boundaries of the coding sequence (the "open reading frame" or "ORF") are determined by the start codon at the 5' (amino) terminus and the translation stop codon at the 3' (carboxylic acid) terminus. Coding sequences include, but are not limited to, prokaryotic sequences, cDNA from prokaryotic mRNA, genomic DNA sequences from prokaryotes (e.g., mammals), and synthetic DNA sequences. Polyadenylation signals and transcription termination sequences are usually located on the 3' side of the coding sequence. The term "non-coding sequence" or "non-coding region" refers to regions of polynucleotide sequences that are not translated into amino acids (e.g., 5' and 3' untranslated regions).

[0219] Reading frame: The term "reading frame" refers to one of six possible reading frames (three in each direction) in a double-stranded DNA molecule. The reading frame used determines which codons are used to encode the amino acids within the coding sequence of the DNA molecule.

[0220] Antisense: As used herein, an “antisense” nucleic acid molecule comprises a nucleotide sequence that is complementary to, for example, the coding strand of a double-stranded cDNA molecule, complementary to an mRNA sequence, or complementary to a “sense” nucleic acid encoding a protein that is complementary to the coding strand of a gene. Thus, an antisense nucleic acid molecule can associate with a sense nucleic acid molecule via hydrogen bonding. In some embodiments, an antisense oligonucleotide is an oligonucleotide that participates in RNaseH-mediated cleavage; for example, an antisense oligonucleotide hybridizes sequence specifically to a portion of the target mRNA and thus targets the mRNA for cleavage by RNaseH. In some embodiments, an antisense oligonucleotide can distinguish between the wild type and a mutant allele of the target. In some embodiments, an antisense oligonucleotide is highly involved in RNaseH-mediated cleavage of the mutant allele but is much less involved, if at all, in RNaseH-mediated cleavage of the wild type allele (e.g., is not highly involved in RNaseH-mediated cleavage of the wild type allele of the target).

[0221] Wobble position: As used herein, “wobble position” refers to the third position of a codon. In some embodiments, a mutation in a DNA molecule within the wobble position of a codon results in a silent or conservative mutation at the amino acid level. For example, there are four codons that encode glycine, namely GGU, GGC, GGA, and GGG, and thus a mutation of a nucleotide at any wobble position to another nucleotide selected from A, U, C, and G does not result in a change at the amino acid level of the encoded protein and is thus a silent substitution.

[0222] Silent substitution: A "silent substitution" or "silent mutation" is one in which the nucleotide within a codon is changed, but this results in no change in the amino acid residue encoded by that codon. Examples include mutations not only at the first position of certain codons such as the codon "CGG" which still encodes Arg when mutated to AGG, but also mutations at the third position of the codon.

[0223] Gene: As used herein, the terms "gene", "recombinant gene" and "gene construct" refer to a DNA molecule, or a portion of a DNA molecule, that encodes a protein or a portion thereof. The DNA molecule may contain an open reading frame that encodes the protein (as an exon sequence) and may further contain intron sequences. As used herein, the term "intron" refers to a DNA sequence that is present within a given gene that is not translated into protein and that, although not in all cases, is in some cases found between exons. As is well known in the art, it may be desirable for a gene to be operably linked to (or to contain) one or more promoters, enhancers, repressors and / or other regulatory sequences that regulate the activity or expression of the gene.

[0224] Complementary DNA: As used herein, "complementary DNA" or "cDNA" includes recombinant polynucleotides synthesized by reverse transcription of mRNA, from which intervening sequences (introns) have been removed.

[0225] Homology: "Homology" or "identity" or "similarity" refers to the sequence similarity between two nucleic acid molecules. Homology and identity can each be determined by comparison of the positions of each sequence that can be aligned for comparison purposes. When the corresponding positions of the sequences being compared are occupied by the same base, then the molecules are identical at that position; when the corresponding positions are occupied by the same or similar nucleic acid residues (e.g., similar in steric and / or electronic state), then the molecules can be said to be homologous (similar) at that position. Expression as a percentage of homology / similarity or identity represents a function of the number of identical or similar nucleic acids at positions shared by the sequences being compared. "Unrelated" or "non-homologous" sequences share less than 40% identity, less than 35% identity, less than 30% identity, or less than 25% identity with the sequences described herein. When comparing two sequences, the absence of residues (amino acids or nucleic acids) or the presence of extra residues also reduces the identity and homology / similarity.

[0226] In some embodiments, the term "homology" describes a mathematically based comparison of sequence similarity used for genes with similar functions or motifs. The nucleic acid sequences described herein can be used, for example, as "query sequences" to perform searches against public databases to identify other family members, related sequences or homologs. In some embodiments, such searches can be performed using the NBLAST and XBLAST programs (version 2.0) of Altschul, et al. (1990) J. Mol. Biol. 215:403-10. In some embodiments, the BLAST nucleotide search can be performed with the NBLAST program, score = 100, word length = 12 to obtain nucleotide sequences homologous to the nucleic acid molecules of the invention. In some embodiments, to obtain a gap alignment for comparison purposes, gapped BLAST can be utilized as described in Altschul et al., (1997) Nucleic Acids Res. 25(17):3389-3402. When using the BLAST and gapped BLAST programs, the default parameters of each program (e.g., XBLAST and BLAST) can be used (see www.ncbi.nlm.nih.gov).

[0227] Identity: As used herein, "identity" means the percentage of identical nucleotide residues at corresponding positions in two or more sequences when the sequences are aligned to maximize sequence matching, i.e., taking into account gaps and insertions. Identity can be readily calculated by known methods, including but not limited to those described in Computational Molecular Biology, Lesk, A.M., ed., Oxford University Press, New York, 1988; Biocomputing: Informatics and Genome Projects, Smith, D.W., ed., Academic Press, New York, 1993; Computer Analysis of Sequence Data, Part I, Griffin, A.M., and Griffin, H.G., eds., Humana Press, New Jersey, 1994; Sequence Analysis in Molecular Biology, von Heinje, G., Academic Press, 1987; and Sequence Analysis Primer, Gribskov, M. and Devereux, J., eds., M Stockton Press, New York, 1991; and Carillo, H., and Lipman, D., SIAM J. Applied Math., 48: 1073 (1988). Methods for determining identity are designed to maximize matches between the test sequences. Further, methods for determining identity are encoded in publicly available computer programs.Examples of computer program methods for determining identity between two arrays include, but are not limited to, the GCG program package (Devereux, J., et al., Nucleic Acids Research 12(1): 387 (1984)), BLASTP, BLASTN, and FASTA (Altschul, S. F. et al., J. Molec. Biol. 215: 403-410 (1990) and Altschul et al. Nuc. Acids Res. 25: 3389-3402 (1997)). The BLAST X program is publicly available from NCBI and elsewhere (BLAST Manual, Altschul, S., et al., NCBI NLM NIH Bethesda, Md. 20894; Altschul, S., et al., J. Mol. Biol. 215: 403-410 (1990)). The well-known Smith-Waterman algorithm can also be used for identity determination.

[0228] Non-homologous: A "non-homologous" region of a DNA sequence is an identifiable segment of DNA within a larger DNA sequence that is not found at all in relation to the larger sequence. Thus, when a non-homologous region encodes a mammalian gene, the gene can typically be on the DNA side that is not adjacent to the mammalian genomic DNA in the source organism's genome. Another example of a non-homologous coding sequence is a sequence in which the coding sequence itself is not found at all (e.g., a cDNA containing an intron or synthetic sequence with codons or motifs different from the unmodified gene in the genomic coding sequence). Allelic variations or natural mutation events do not result in non-homologous regions of DNA as defined herein.

[0229] Transversion mutation: The term "transversion mutation" refers to a change in a base in a DNA sequence in which a pyrimidine (cytidine (C) or thymidine (T)) is replaced by another pyrimidine, or a purine (adenosine (A) or guanosine (G)) is replaced by another purine.

[0230] Base substitution mutation: The term "base substitution mutation" refers to a change in the bases in a DNA sequence where a pyrimidine (cytidine (C) or thymidine (T)) is replaced by a purine, or a purine (adenosine (A) or guanosine (G)) is replaced by a pyrimidine.

[0231] Oligonucleotide: The term "oligonucleotide" refers to a polymer or oligomer of nucleotide monomers that includes any combination of nucleobases, modified nucleobases, sugars, modified sugars, phosphate linkages, or modified phosphorus atom linkages (also referred to herein as "inter-nucleotide linkages" as further defined herein).

[0232] An oligonucleotide can be single-stranded or double-stranded. As used herein, the term "oligonucleotide strand" includes single-stranded oligonucleotides. A single-stranded oligonucleotide can have double-stranded regions, and a double-stranded oligonucleotide can have single-stranded regions. Exemplary oligonucleotides include, but are not limited to, structural genes, genes including regulatory and terminal regions, viral or plasmid DNA, self-replicating systems such as single-stranded and double-stranded siRNA and other RNA interference agents (RNAi agents or iRNA agents), shRNA, antisense oligonucleotides, ribozymes, microRNA, microRNA mimics, supermir, aptamers, antimir, antagomir, Ul adapter, triple helix-forming oligonucleotides, guanine quadruplex oligonucleotides, RNA activators, immunostimulatory oligonucleotides, and decoy oligonucleotides.

[0233] Double-stranded and single-stranded oligonucleotides that are effective in inducing RNA interference are also referred to herein as siRNA, RNAi agents, or iRNA agents. In some embodiments, these RNA interference-inducing oligonucleotides associate with a cytoplasmic multi-protein complex known as the RNAi-induced silencing complex (RISC). In many embodiments, single-stranded and double-stranded RNAi agents are long enough to be cleaved by endogenous molecules, such as Dicer, so that they can enter the RISC machinery and produce smaller oligonucleotides that can participate in RISC-mediated cleavage of a target sequence, such as a target mRNA.

[0234] The oligonucleotides of the present invention can be of various lengths. In certain embodiments, the oligonucleotide can range in length from about 2 to about 200 nucleotides. In various related embodiments, single-stranded, double-stranded, and triple-stranded oligonucleotides can range in length from about 4 to about 10 nucleotides, about 10 to about 50 nucleotides, about 20 to about 50 nucleotides, about 15 to about 30 nucleotides, about 20 to about 30 nucleotides. In some embodiments, the oligonucleotide is about 9 to about 39 nucleotides in length. In some embodiments, the oligonucleotide is at least 4 nucleotides in length. In some embodiments, the oligonucleotide is at least 5 nucleotides in length. In some embodiments, the oligonucleotide is at least 6 nucleotides in length. In some embodiments, the oligonucleotide is at least 7 nucleotides in length. In some embodiments, the oligonucleotide is at least 8 nucleotides in length. In some embodiments, the oligonucleotide is at least 9 nucleotides in length. In some embodiments, the oligonucleotide is at least 10 nucleotides in length. In some embodiments, the oligonucleotide is at least 11 nucleotides in length. In some embodiments, the oligonucleotide is at least 12 nucleotides in length. In some embodiments, the oligonucleotide is at least 15 nucleotides in length. In some embodiments, the oligonucleotide is at least 20 nucleotides in length. In some embodiments, the oligonucleotide is at least 25 nucleotides in length. In some embodiments, the oligonucleotide is at least 30 nucleotides in length. In some embodiments, the oligonucleotide is the complementary strand of a double-stranded at least 18 nucleotides in length. In some embodiments, the oligonucleotide is the complementary strand of a double-stranded at least 21 nucleotides in length.

[0235] Inter-nucleotide linkage: As used herein, the phrase "inter-nucleotide linkage" generally refers to a phosphorus-containing linkage between nucleotide units of an oligonucleotide and is synonymous herein and above with "sugar-sugar linkage" and "phosphorus atom bridge". In some embodiments, the inter-nucleotide linkage is a phosphodiester linkage found in natural DNA and RNA molecules. In some embodiments, the inter-nucleotide linkage is a "modified inter-nucleotide linkage" in which each oxygen atom of the phosphodiester linkage is optionally and independently replaced by an organic or inorganic moiety. In some embodiments, such organic or inorganic moieties are selected from, but not limited to, =S, =Se, =NR', -SR', -SeR', -N(R')2, B(R')3, -S-, -Se-, and -N(R')- (wherein each R' is independently as defined and described below). In some embodiments, the inter-nucleotide linkage is a phosphotriester linkage, a phosphorothioate diester linkage [Chemical formula] or a modified phosphorothioate triester linkage. Those skilled in the art will understand that the inter-nucleotide linkage may exist as an anion or a cation at a given pH due to the presence of an acid or base moiety of the linkage.

[0236] Unless otherwise specified, when used with an oligonucleotide sequence, s, s1, s2, s3, s4, s5, s6 and s7 each independently represent the following modified inter-nucleotide bridges as shown below. [Table 1] TIFF0007696310000004.tif184166TIFF0007696310000005.tif66166

[0237] For example, (Rp,Sp)-ATsCs1GA is 1) a phosphorothioate inter-nucleotide linkage between T and C ( [Chemistry] ) ; and 2) the [Chemistry] has a phosphorothioate triester nucleotide internucleoside linkage. Unless otherwise specified, the Rp / Sp notation preceding an oligonucleotide sequence refers to the configuration of the chiral linking phosphorus atom of the internucleoside linkages of the nucleotides in the oligonucleotide sequence in sequential 5' to 3' order. For example, in (Rp,Sp)-ATsCs1GA, the phosphorus of the "s" linkage between T and C has an Rp configuration, and the phosphorus of the "s1" linkage between C and G has an Sp configuration. In some embodiments, "all (Rp)" or "all (Sp)" is used to indicate that all chiral linking phosphorus atoms of the oligonucleotide have the same Rp or Sp configuration, respectively. For example, all (Rp)-GsCsCsTsCsAsGsTsCsTsGsCsTsTsCsGsCsAsCsC indicates that all of the chiral linking phosphorus atoms of the oligonucleotide have an Rp configuration; all (Sp)-GsCsCsTsCsAsGsTsCsTsGsCsTsTsCsGsCsAsCsC indicates that all of the chiral linking phosphorus atoms of the oligonucleotide have an Sp configuration.

[0238] Oligonucleotide type: As used herein, the phrase "oligonucleotide type" is used to define an oligonucleotide having a specific base sequence, backbone linkage pattern (i.e., internucleoside linkage type pattern, e.g., phosphate, phosphorothioate, etc.), backbone chiral center pattern (i.e., linking phosphorus stereochemistry pattern (Rp / Sp)), and backbone phosphorus modification pattern (e.g., the pattern of the "-XLR 1 " group of Formula I). Oligonucleotides of a commonly designated "type" are structurally identical to each other.

[0239] One of ordinary skill in the art will recognize that the synthetic method of the present invention provides a degree of control during the synthesis of an oligonucleotide chain such that each nucleotide unit of the oligonucleotide chain can be designed and / or preselected to have a specific stereochemistry at the linking phosphorus and / or a specific modification at the linking phosphorus and / or a specific base and / or a specific sugar. In some embodiments, the oligonucleotide chain is designed and / or determined to have a specific combination of modifications at the linking phosphorus. In some embodiments, the oligonucleotide chain is designed and / or selected to have a specific combination of bases. In some embodiments, the oligonucleotide chain is designed and / or selected to have a specific combination of one or more of the above structural features. The present invention provides a composition comprising or consisting of a plurality of oligonucleotide molecules (e.g., a chirally controlled oligonucleotide composition). In some embodiments, all such molecules are of the same type (i.e., structurally identical to each other). However, in many embodiments, the composition provided will typically contain a plurality of oligonucleotides of different types in a predetermined relative amount.

[0240] Chiral control: As used herein, "chiral control" refers to the ability to control the stereochemical representation of any chiral linking phosphorus within an oligonucleotide chain. The phrase "chirally controlled oligonucleotide" refers to an oligonucleotide that exists in a single diastereomeric form with respect to the chiral linking phosphorus. A chirally controlled oligonucleotide is prepared from a chirally controlled oligonucleotide synthesis.

[0241] Chiral-Controlled Oligonucleotide Composition: As used herein, the phrase "chiral-controlled oligonucleotide composition" refers to an oligonucleotide composition that includes a predetermined level of individual oligonucleotide types. For example, in some embodiments, the chiral-controlled oligonucleotide composition includes one oligonucleotide type. In some embodiments, the chiral-controlled oligonucleotide composition includes a mixture of multiple oligonucleotide types. Exemplary chiral-controlled oligonucleotide compositions are further described herein.

[0242] Chirally Pure: As used herein, the phrase "chirally pure" is used to refer to a chiral-controlled oligonucleotide composition in which all oligonucleotides are present as a single diastereoisomer with respect to the linking phosphorus.

[0243] Chirally Homogeneous: As used herein, the phrase "chirally homogeneous" is used to refer to an oligonucleotide molecule or type in which all nucleotide units have the same stereochemistry at the linking phosphorus. For example, an oligonucleotide in which all of its nucleotide units have Rp stereochemistry at the linking phosphorus is chirally homogeneous. Similarly, an oligonucleotide in which all of its nucleotide units have Sp stereochemistry at the linking phosphorus is chirally homogeneous.

[0244] Predetermined: As used herein, "predetermined" means, for example, randomly occurring or, as the antonym of achievement, selected in a planned manner. One of ordinary skill in the art, upon reading this specification, will understand that the present invention provides a novel and surprising technique that enables the selection of a specific oligonucleotide type for the formulation and / or encapsulation of the provided composition, and further enables the precisely controlled formulation of the selected specific type in the specific relative amounts that are optionally selected such that the provided composition is formulated. Such provided compositions are "predetermined" as described herein. Compositions that may contain specific individual oligonucleotide types are not "predetermined" compositions because they were created through a process that could not accidentally control the intentional creation of specific oligonucleotide types. In some embodiments, a predetermined composition is one that can be intentionally replicated (e.g., through repeated controlled processes).

[0245] Linking phosphorus: As defined herein, the phrase "linking phosphorus" is used to indicate that the particular phosphorus atom represented is present during the internucleotide linkage and that the phosphorus atom corresponds to the phosphorus atom of the phosphodiester of the internucleotide linkage that occurs in native DNA and RNA. In some embodiments, the linking phosphorus atom is in the modified internucleotide linkage and each oxygen atom of the phosphodiester bond is optionally and independently substituted by an organic or inorganic moiety. In some embodiments, the linking phosphorus atom is P of Formula I * as set forth. In some embodiments, the linking phosphorus atom is chiral. In some embodiments, the chiral linking phosphorus atom is P of Formula I * as set forth.

[0246] P modification: As used herein, the term "P modification" refers to any modification in the linking phosphorus other than stereochemical modification. In some embodiments, the P modification includes the addition, substitution, or removal of a pendant moiety covalently attached to the linking phosphorus. In some embodiments, the "P modification" is -X-L-R 1 (wherein X, L, and R 1 are as defined and described herein and below).

[0247] Blockmer: As used herein, the term "blockmer" refers to an oligonucleotide chain characterized by a pattern of structural features that characterize each of its individual nucleotide units, which is characterized by the presence of at least two consecutive nucleotide units that share a common structural feature in the internucleotide phosphodiester bond. The common structural feature means a common stereochemistry at the linking phosphorus or a common modification at the linking phosphorus. In some embodiments, the at least two consecutive nucleotide units that share a common structural feature in the internucleotide phosphodiester bond are referred to as "blocks".

[0248] In some embodiments, the blockmer is a "stereoblockmer", for example, at least two consecutive nucleotide units have the same stereochemistry at the linking phosphorus. Such at least two consecutive nucleotide units form a "stereoblockmer". For example, since at least two consecutive nucleotide units, Ts and Cs1, have the same stereochemistry at the linking phosphorus (both Sp), (Rp,Sp)-ATsCs1GA is a stereoblockmer. In the same oligonucleotide, (Rp,Sp)-ATsCs1 forms a block, and it is a stereoblock.

[0249] In some embodiments, the blockmer is a "P-modified blockmer", for example, at least two consecutive nucleotide units have the same modification at the linking phosphorus. Such at least two consecutive nucleotide units form a "P-modified block". For example, (Rp,Sp)-ATsCsGA is a P-modified blockmer because at least two consecutive nucleotide units, Ts and Cs, have the same P-modification (i.e., both are phosphorothioate diesters). In the same oligonucleotide of (Rp,Sp)-ATsCsGA, TsCs forms a block, and it is a P-modified block.

[0250] In some embodiments, the blockmer is a "coupling blockmer", for example, at least two consecutive nucleotide units have the same stereochemistry and the same modification at the coupling link. At least two consecutive nucleotide units form a "coupling block". For example, since at least two consecutive nucleotide units, Ts and Cs, have the same stereochemistry (both Rp) and P modification (both phosphorothioate), (Rp,Rp)-ATsCsGA is a coupling blockmer. In the same oligonucleotide of (Rp,Rp)-ATsCsGA, TsCs forms a block and is a coupling block.

[0251] In some embodiments, the blockmer independently comprises one or more blocks selected from a stereoblock, a P-modified block, and a coupling block. In some embodiments, the blockmer is a stereoblockmer for one block, and / or a P-modified blockmer for another block, and / or a coupling blockmer for yet another block. For example, (Rp,Rp,Rp,Rp,Rp,Sp,Sp,Sp)-AAsTsCsGsAs1Ts1Cs1Gs1ATCG is a stereoblockmer with respect to the stereoblock AsTsCsGsAs1 (all Rp at the coupling link) or Ts1Cs1Gs1 (all Sp at the coupling link), a P-modified blockmer with respect to the P-modified block AsTsCsGs (all s linkages) or As1Ts1Cs1Gs1 (all s1 linkages), or a coupling blockmer with respect to the coupling block AsTsCsGs (all Rp and all s linkages at the coupling link) or Ts1Cs1Gs1 (all Sp and all s1 linkages at the coupling link).

[0252] Altmer: As used herein, the term "altmer" refers to an oligonucleotide strand characterized by the absence of two consecutive nucleotide units in the oligonucleotide strand whose structural feature patterns characterizing each individual nucleotide unit share specific structural features in the internucleotide phosphodiester bond. In some embodiments, the altmer is designed to contain a repeating pattern. In some embodiments, the altmer is designed not to contain a repeating pattern.

[0253] In some embodiments, the altmer is a "stereoaltmer", e.g., there are no two consecutive nucleotide units having the same stereochemistry at the linking phosphodiester. For example, (Rp,Sp,Rp,Sp,Rp,Sp,Rp,Sp,Rp,Sp Rp,Sp,Rp,Sp,Rp,Sp,Rp,Sp,Rp)-GsCsCsTsCsAsGsTsCsTsGsCsTsTsCsGsCsAsCsC.

[0254] In some embodiments, the altmer is a "P-modified altmer", e.g., there are no two consecutive nucleotide units having the same modification at the linking phosphodiester. For example, all (Sp)CAs1GsT where each linking phosphodiester has a different P-modification from the others.

[0255] In some embodiments, the altmer is a "linking altmer", e.g., there are no two consecutive nucleotide units having the same stereochemistry or the same modification at the linking phosphodiester. For example, (Rp,Sp,Rp,Sp,Rp,Sp,Rp,Sp,Rp,Sp Rp,Sp,Rp,Sp,Rp,Sp,Rp,Sp,Rp)-GsCs1CsTs1CsAs1GsTs1CsTs1GsCs1TsTs2CsGs3CsAs4CsC.

[0256] Unimer: As used herein, the term "unimer" refers to an oligonucleotide chain in which the structural feature pattern characterizing each individual nucleotide unit is such that all nucleotide units in the chain share at least one common structural feature in the internucleotide linkage. The common structural feature means a common stereochemistry at the linking phosphorus or a common modification at the linking phosphorus.

[0257] In some embodiments, the unimer is a "stereounimer", for example, all nucleotide units have the same stereochemistry at the linking phosphorus. For example, all (Sp)-CsAs1GsT where all linkages have Sp phosphorus.

[0258] In some embodiments, the unimer is a "P-modified unimer", for example, all nucleotide units have the same modification at the linking phosphorus. For example, (Rp,Sp,Rp,Sp,Rp,Sp,Rp,Sp,Rp,Sp Rp,Sp,Rp,Sp,Rp,Sp,Rp,Sp,Rp)-GsCsCsTsCsAsGsTsCsTsGsCsTsTsCsGsCsAsCsC where all internucleotide linkages are phosphorothioate diesters.

[0259] In some embodiments, the unimer is a "linking unimer", for example, all nucleotide units have the same stereochemistry and the same modification at the linking phosphorus. For example, all (Sp)-GsCsCsTsCsAsGsTsCsTsGsCsTsTsCsGsCsAsCsC where all internucleotide linkages are phosphorothioate diesters with Sp-linked phosphorus.

[0260] Gapmer: As used herein, the term "gapmer" refers to an oligonucleotide strand characterized in that at least one internucleotide linkage of the oligonucleotide strand is a phosphodiester linkage, such as those found in natural DNA or RNA. In some embodiments, one or more internucleotide linkages of the oligonucleotide strand are phosphodiester linkages such as those found in natural DNA or RNA. For example, all (Sp)-CAs1GsT, where the internucleotide linkage between C and A is a phosphodiester linkage.

[0261] Skipmer: As used herein, the term "skipmer" refers to a type of gapmer in which every other internucleotide linkage of the oligonucleotide strand is a phosphodiester linkage, such as those found in natural DNA or RNA, and every other internucleotide linkage of the oligonucleotide strand is a modified internucleotide linkage. For example, all (Sp)-AsTCs1GAs2TCs3G.

[0262] For the purposes of the present invention, chemical elements are identified according to the periodic table of the elements on the inside cover of the CAS Registry, Handbook of Chemistry and Physics, 67th Edition, 1986 - 87.

[0263] The methods and structures described herein with respect to the compounds and compositions of the present invention also apply to pharmaceutically acceptable acids or base addition salts and to all stereoisomers of these compounds and compositions. BRIEF DESCRIPTION OF THE DRAWINGS

[0264]

Figure 1

[0265]

Figure 2

[0266]

Figure 3A

Figure 3B

Figure 3C

Figure 3D

Figure 3E

Figure 3F

[0267]

Figure 4

[0268]

Figure 5

[0269]

Figure 6

[0270]

Figure 7A

Figure 7B

[0271]

Figure 8

[0272]

Figure 9A

Figure 9B

[0273]

Figure 10

[0274]

Figure 11A

Figure 11B

[0275]

Figure 12

[0276]

Figure 13A

Figure 13B

[0277]

Figure 14

[0278]

Figure 15

[0279]

Figure 16

[0280]

Figure 17

[0281]

Figure 18

[0282]

Figure 19

[0283]

Figure 20

[0284]

Figure 21

[0285]

Figure 22

[0286]

Figure 23

[0287]

Figure 24

[0288]

Figure 25

[0289]

Figure 26

[0290]

Figure 27A

Figure 27B

Figure 27C

Figure 27D

Figure 27E

Figure 27F

Figure 27G

Figure 27H

Figure 27I

Figure 27J

Figure 27K

Figure 27L

Figure 27M

Figure 27N

Figure 27O

[0291]

Figure 28

[0292]

Figure 29

[0293]

Figure 30

[0294]

Figure 31

[0295]

Figure 32

[0296]

Figure 33

[0297]

Figure 34

[0298]

Figure 35

[0299]

Figure 36

[0300]

Figure 37

[0301]

Figure 38A

Figure 38B

Figure 38C

Figure 38D

DETAILED DESCRIPTION OF THE INVENTION

[0302] Synthetic oligonucleotides provide useful molecular tools for various applications. For example, oligonucleotides are useful for therapeutic, diagnostic, research, and new nanomaterial applications. The use of natural nucleic acids (e.g., unmodified DNA or RNA) is limited, for example, by their susceptibility to endonucleases and exonucleases. Thus, various synthetic counterparts have been developed to avoid these drawbacks. These synthetic counterparts include chemically modified oligonucleotides, including chemical modifications such as base modifications, sugar modifications, backbone modifications, etc., particularly chemical modifications that make these molecules less prone to denaturation and improve other properties of the oligonucleotides. Chemical modifications may also cause certain undesirable effects such as an increase in toxicity. From a structural perspective, modifications to the phosphate bridge between nucleotides introduce chirality, and certain properties of the oligonucleotide may be affected by the arrangement of the phosphorus atoms that form the backbone of the oligonucleotide. For example, in vitro tests have shown that the properties of antisense nucleotides, such as binding affinity, sequence specifically binding to complementary RNA, and stability against nucleases, are particularly affected by the chirality of the backbone (e.g., the arrangement of phosphorus atoms).

[0303] In particular, the present disclosure encompasses the recognition that structural elements of oligonucleotides, such as base sequences, chemical modifications (e.g., modifications of sugars, bases, and / or internucleotide linkages, and patterns thereof), and / or stereochemistry (e.g., stereochemistry of backbone chiral centers (chiral internucleotide linkages), and / or patterns thereof), can significantly affect properties such as, for example, characteristics that can be mediated by, e.g., protein binding characteristics, stability, ability to alter splicing, etc., such as activity, toxicity. In some embodiments, oligonucleotide properties can be modulated by optimizing chemical modifications (modifications of bases, sugars, and / or internucleotide linkages) and / or stereochemistry (patterns of chiral centers in the backbone).

[0304] In some embodiments, the present disclosure shows that oligonucleotide compositions comprising oligonucleotides having controlled structural elements (e.g., controlled chemical modifications and / or controlled backbone stereochemistry patterns) confer unexpected properties including, but not limited to, those described herein. In some embodiments, provided compositions comprising oligonucleotides having chemical modifications (e.g., modifications of bases, sugars, internucleotide linkages, etc.) have improved properties such as, for example, improved ability to alter splicing, low toxicity, or improved protein binding profiles and / or improved delivery. In particular, in some embodiments, the present disclosure provides compositions and methods for altering splicing of transcripts. In some embodiments, the present disclosure provides compositions and methods for improving splicing of transcripts. In some embodiments, the altered transcriptional splicing by the provided compositions and methods can have desired and / or improved biological functions, and / or result in the production of products with knockdown of undesired products, such as by modifying splicing products so as to suppress or eliminate undesired biological functions.

[0305] In some embodiments, the transcript is pre-mRNA. In some embodiments, the splicing product is mature RNA. In some embodiments, the splicing product is mRNA. In some embodiments, the alteration includes skipping one or more exons. In some embodiments, splicing of the transcript is improved in that exon skipping increases the amount of mRNA and protein with improved beneficial activity compared to the state without exon skipping. In some embodiments, an exon that causes a frameshift is skipped. In some embodiments, an exon containing an undesirable mutation is skipped. In some embodiments, an exon containing an early termination codon is skipped. The undesirable mutation may be a mutation that causes a change in the protein sequence or a silent mutation. In some embodiments, an exon containing an undesirable SNP is skipped.

[0306] In some embodiments, splicing of the transcript is improved in that exon skipping decreases the amount of mRNA and protein with undesirable activity compared to the state without exon skipping. In some embodiments, the target is knocked down by skipping an exon such that skipping the exon causes a premature stop codon and / or a frameshift mutation.

[0307] Correction of the reading frame is achieved by skipping one or two exons adjacent to the deletion, by skipping an exon within the frame that contains a nonsense mutation, or by skipping a duplicated exon.

[0308] In some embodiments, the present disclosure provides compositions and methods for reducing certain undesirable repeats (e.g., CAG repeats) by altering splicing (e.g., exon skipping) (see, e.g., Evers et al., Targeting several CAG expansion diseases by a single antisense oligonucleotide, PLoS One. 2011;6(9):e24308.doi:10.1371 / journal.pone.0024308; Mulders et al., Triplet-repeat oligonucleotide-mediated reversal of RNA toxicity in myotonic dystrophy, Proc Natl Acad Sci U S A. August 18, 2009;106(33):13915-20, etc.). Examples of targets include, but are not limited to, HTT, ATXN3, DMPK, CNBP, AR, C9ORF72 (targets for familial frontotemporal dementia and amyotrophic lateral sclerosis), and those listed below. [Table 2] TIFF0007696310000009.tif83166

[0309] In some embodiments, the provided oligonucleotides (e.g., the first plurality of oligonucleotides) in the provided composition include modifications of the bases, sugars, and / or internucleotide linkages. In some embodiments, the provided oligonucleotides include modifications of the bases and sugars. In some embodiments, the provided oligonucleotides include modifications of the bases and internucleotide linkages. In some embodiments, the provided oligonucleotides include modifications of the sugars and internucleotide linkages. In some embodiments, the provided composition includes modifications of the bases, sugars, and internucleotide linkages. Examples of chemical modifications (e.g., base modifications, sugar modifications, internucleotide linkage modifications, etc.) are well known in the art and include, but are not limited to, those described in the present disclosure. In some embodiments, the modified base is a substituted A, T, C, G, or U. In some embodiments, the sugar modification is a 2'-modification. In some embodiments, the 2'-modification is a 2-F modification. In some embodiments, the 2'-modification is 2'-OR 1 is. In some embodiments, the 2'-modification is 2'-OR 1 is, where R 1is an alkyl which may optionally be substituted. In some embodiments, the 2'-modification is 2'-OMe. In some embodiments, the 2'-modification is 2'-MOE. In some embodiments, the modified sugar moiety is a bridged bicyclic or polycyclic ...

Claims

1. A method for producing an oligonucleotide composition for preventing or treating Duchenne muscular dystrophy, wherein the oligonucleotide composition (1) a base sequence; (2) a cross-linking pattern of the backbone; (3) a pattern of chiral centers of the backbone; and (4) a pattern of phosphorus modification of the backbone contains a plurality of oligonucleotides of a specific oligonucleotide type defined by, the oligonucleotide composition is chirally controlled in that it is rich in oligonucleotides having the same base sequence compared to a substantially racemic preparation of oligonucleotides of the specific oligonucleotide type, the oligonucleotides of the specific oligonucleotide type have 5 or more consecutive phosphorothioate linkages in the Sp configuration at the 5'-end, 5 or more consecutive phosphorothioate linkages in the Sp configuration at the 3'-end, and between the phosphorothioate linkage at the 5'-end and the phosphorothioate linkage at the 3'-end, contains one or more phosphodiester nucleotide linkages and / or one or more phosphorothioate linkages in the Rp configuration, and the oligonucleotides of the specific oligonucleotide type contain a first block of 2'-F sugar modification containing 5 or more consecutive 2'-F sugar modifications at the 5'-end and a second block of 2'-F sugar modification containing 5 or more consecutive 2'-F sugar modifications at the 3'-end, wherein the base sequence contains UCAAGGAAGAUGGCAUUUCU, A method for producing an oligonucleotide composition.

2. wherein the oligonucleotides of the specific oligonucleotide type contain one or more sugar modifications selected from 2'-O-methyl, 2'-MOE, morpholino and bicyclic sugar moieties, The method according to claim 1.

3. wherein the sugar modification comprises one or more 2'-O-methyl sugar moieties The method according to claim 2.

4. Each of the plurality of oligonucleotides comprises 15 bases or more sharing a common stereochemical configuration with 11 or more chiral nucleotide internucleotide linkages The method according to claim 3.

5. The method according to claim 1, wherein each of the plurality of oligonucleotides is 20, 21, 22, 23, 24 or 25 bases in length.

6. The method according to any one of claims 1 to 5, wherein the base sequence comprises a sequence complementary to the sequence of dystrophin pre-mRNA 20, 21, 22, 23, 24 or 25 bases in length.

7. At least 10% of the oligonucleotides having the base sequence of a specific oligonucleotide type are oligonucleotides of the specific oligonucleotide type The method according to any one of claims 1 to 6.

8. At least 10% of the oligonucleotides having the base sequence, the cross-linking pattern of the backbone, and the pattern of backbone phosphorus modification of a specific oligonucleotide type are oligonucleotides of the specific oligonucleotide type The method according to any one of claims 1 to 6.

9. The oligonucleotide composition is administered to skip an exon of the dystrophin gene The method according to any one of claims 1 to 8.

10. The oligonucleotide composition is administered to skip exon 51 of the dystrophin gene The method according to claim 9.

11. An oligonucleotide composition, comprising: (1) a base sequence; (2) Cross-linking pattern of the backbone; (3) Pattern of chiral centers of the backbone; and (4) Pattern of phosphorus modification of the backbone comprising a first plurality of oligonucleotides of a specific oligonucleotide type defined by: the oligonucleotide composition is chirally controlled in that it is rich in oligonucleotides having the same base sequence compared to a substantially racemic preparation of oligonucleotides of the specific oligonucleotide type, the oligonucleotides of the specific oligonucleotide type have 5 or more consecutive phosphorothioate bonds in the Sp configuration at the 5'-end, 5 or more consecutive phosphorothioate bonds in the Sp configuration at the 3'-end, and between the phosphorothioate bond at the 5'-end and the phosphorothioate bond at the 3'-end, include one or more phosphodiester internucleotide cross-links and / or one or more phosphorothioate bonds in the Rp configuration, the oligonucleotides of the specific oligonucleotide type include a first block of 2'-F sugar modification containing 5 or more consecutive 2'-F sugar modifications at the 5'-end and a second block of 2'-F sugar modification containing 5 or more consecutive 2'-F sugar modifications at the 3'-end, the base sequence includes UCAAGGAAGAUGGCAUUUCU, oligonucleotide composition.

12. the oligonucleotides of the specific oligonucleotide type include one or more sugar modifications selected from 2'-O-methyl, 2'-MOE, morpholino and bicyclic sugar moieties, The oligonucleotide composition according to claim 11.

13. the sugar modification includes one or more 2'-O-methyl sugar moieties, The oligonucleotide composition according to claim 12.

14. Each of the plurality of oligonucleotides contains 15 bases or more that share a common stereochemical configuration with 11 or more chiral nucleotide internucleotide linkages. The oligonucleotide composition according to claim 13.

15. The oligonucleotide composition according to claim 11, wherein each of the plurality of oligonucleotides is 20, 21, 22, 23, 24, or 25 bases in length.

16. The oligonucleotide composition according to claim 11, wherein the base sequence includes a sequence complementary to the sequence of dystrophin pre-mRNA that is 20, 21, 22, 23, 24, or 25 bases in length.

17. At least 10% of the oligonucleotides having the base sequence of a specific oligonucleotide type are oligonucleotides of the specific oligonucleotide type. The oligonucleotide composition according to any one of claims 11 to 16.

18. At least 10% of the oligonucleotides having the base sequence, backbone cross-linking pattern, and backbone phosphorus modification pattern of a specific oligonucleotide type are oligonucleotides of the specific oligonucleotide type. The oligonucleotide composition according to any one of claims 11 to 16.

Citation Information

Patent Citations

  • Oligonucleotides having site-specific chiral phosphorothioate-nucleoside bonds

    JP2002520420A

  • Means and methods for offsetting muscle damage

    JP2011502118A

  • Oligonucleotides for the treatment of muscular dystrophy patients

    JP2015522275A

  • Oligonucleotides having chiral phosphorus linkages

    US5852188A

  • Compositions and methods for the synthesis of chirally pure organophosphorus nucleoside derivatives

    US5856465A