Use of protoporphyrinogen oxidase
Patent Information
- Application Number
- JP2023568593
- Authority / Receiving Office
- JP · JP
- Patent Type
- Patents
- Current Assignee / Owner
- Priority Date
- 2021-05-12
- Filing Date
- 2022-04-27
- Publication Date
- 2025-07-23
- Estimated Expiration
- 2042-04-27
AI Technical Summary
Existing methods for providing plants with resistance to PPO-inhibiting herbicides are insufficient for various crops and crop varieties, as different herbicides have varying spectra of weeds to control and environmental advantages, necessitating new approaches to confer resistance.
Utilizing protoporphyrinogen oxidase derived from prokaryotes, integrated into the genome of transgenic plants, which encodes for a protein with high sequence identity to specific amino acid sequences, conferring resistance to PPO-inhibiting herbicides.
Transgenic plants exhibit reduced damage and higher yield when exposed to PPO-inhibiting herbicides, demonstrating enhanced resistance and improved agricultural resilience.
Smart Images

Figure 0007712392000011 
Figure 0007712392000012 
Figure 0007712392000013
Abstract
Description
Technical Field
[0001] The present invention relates to the use of protoporphyrinogen oxidase, and in particular to a method for conferring resistance to PPO-inhibiting herbicides to plants using protoporphyrinogen oxidase derived from prokaryotes, and to its use.
Background Art
[0002] The porphyrin biosynthesis pathway is used for the synthesis of chlorophyll and heme, which play important roles in plant metabolism, and this pathway occurs in chloroplasts. In this pathway, protoporphyrinogen oxidase (PPO) catalyzes the oxidation of protoporphyrinogen IX to protoporphyrin IX. After protoporphyrin IX is produced, protoporphyrin IX binds to magnesium by magnesium chelatase to synthesize chlorophyll, or protoporphyrin IX binds to iron by ferrochelatase to synthesize heme.
[0003] Examples of herbicides that act by inhibiting PPO mainly include types of PPO-inhibiting herbicides such as diphenyl ethers, oxadiazolones, N-phenylphthalimides, oxazolinones, phenylpyrazoles, uracils, thiadiazoles, triazolinones, and triazinones. In plants, PPO inhibitors inhibit the enzyme activity of PPO, and as a result, the synthesis of chlorophyll and heme is inhibited, and the substrate protoporphyrinogen IX accumulates. The accumulated protoporphyrinogen IX is rapidly transported from the chloroplast to the cytoplasm, where protoporphyrinogen IX is converted to protoporphyrin IX by a non-enzymatic reaction. Protoporphyrin IX forms more reactive singlet oxygen ( 1 O2) in the presence of light and oxygen molecules, thereby damaging the cell membrane and rapidly causing the death of plant cells.
[0004] Methods for providing plants resistant to PPO-inhibiting herbicides mainly include the following: 1) Detoxify the herbicide with an enzyme that converts the herbicide or its active metabolite into a non-toxic product. 2) By overexpressing the sensitive PPO, generate a sufficient amount of the target enzyme in the plant body against the herbicide, and considering the kinetic constants of this enzyme, ensure that the functional enzyme can be fully utilized even in the presence of the inhibitor. 3) Provide a functional PPO with low sensitivity to the herbicide or its active metabolite and retain the ability to catalyze the oxidation of protoporphyrinogen IX to protoporphyrin IX. Regarding the functional PPO, although certain functional PPO enzymes may provide useful levels of resistance to some PPO-inhibiting herbicides, the same functional PPO may be completely insufficient to provide commercial-level resistance to different and more desirable PPO-inhibiting herbicides. For example, for each PPO-inhibiting herbicide, the spectrum of weeds to be controlled, their respective manufacturing costs, and their respective environmental advantages may vary. Therefore, there is a need for new methods to confer PPO-inhibiting herbicide resistance to various crops and crop variety groups.
Summary of the Invention
[0005] An object of the present invention is to provide the use of protoporphyrinogen oxidase. The protoporphyrinogen oxidase is derived from prokaryotes, and plants transformed with the polynucleotide sequence encoding the protoporphyrinogen oxidase according to the present invention have good resistance to PPO-inhibiting herbicides.
[0006] To achieve the above object, the present invention provides a method for controlling weeds, which comprises applying a herbicide containing an effective amount of a PPO inhibitor to a field where at least one transgenic plant is present. In this method, the transgenic plant contains a polynucleotide sequence encoding protoporphyrinogen oxidase in its genome, and compared with other plants having no polynucleotide sequence encoding protoporphyrinogen oxidase, the transgenic plant has less plant damage and / or higher plant yield, and protoporphyrinogen oxidase has at least 88% sequence identity with an amino acid sequence selected from the group consisting of SEQ ID NOs: 1 to 14.
[0007] Preferably, protoporphyrinogen oxidase has at least 90% sequence identity with an amino acid sequence selected from the group consisting of SEQ ID NOs: 1 to 14.
[0008] Preferably, protoporphyrinogen oxidase has at least 95% sequence identity with an amino acid sequence selected from the group consisting of SEQ ID NOs: 1 to 14.
[0009] More preferably, protoporphyrinogen oxidase has at least 99% sequence identity with an amino acid sequence selected from the group consisting of SEQ ID NOs: 1 to 14.
[0010] Even more preferably, protoporphyrinogen oxidase is selected from the amino acid sequences of the group consisting of SEQ ID NOs: 1 to 14.
[0011] Preferably, the transgenic plants include monocotyledonous and dicotyledonous plants. More preferably, the transgenic plants are Avena sativa, Triticum aestivum, Hordeum vulgare, Setaria italica, Zea mays, Sorghum bicolor, Brachypodium distachyo, Oryza sativa, Nicotiana tabacum, Helianthus annuus, Medicago sativa, Glycine max, Cicer arietinum, Arachis hypogaea, Beta vulgaris, Cucumis sativus, Gossypium hirsutum, Brassica napus, Solanum tuberosum, Solanum lycopersicum, or Arabidopsis thaliana. Even more preferably, the transgenic plants are glyphosate-tolerant plants and the weeds are glyphosate-resistant weeds.
[0012] Preferably, the PPO-inhibiting herbicides include PPO-inhibiting herbicides of the types of diphenyl ethers, oxadiazonones, N-phenylphthalimides, oxazolinones, phenylpyrazoles, uracils, thiadiazoles, triazolinones and / or triazinones.
[0013] Even more preferably, the PPO-inhibiting herbicides include oxyfluorfen, sulfufenacil, sulfentrazone, and / or flumioxazin.
[0014] Preferably, the polynucleotide sequence of protoporphyrinogen oxidase includes the following.
[0015] (a) A polynucleotide sequence encoding an amino acid sequence having at least 88% sequence identity with a sequence selected from SEQ ID NOs: 1 to 14 and not including SEQ ID NOs: 15 to 28, or (b) A polynucleotide sequence shown in any one of SEQ ID NOs: 29 to 42 or SEQ ID NOs: 62 to 64.
[0016] Furthermore, the transgenic plant further comprises at least one second polynucleotide encoding a second herbicide-tolerant protein, which is different from the polynucleotide sequence encoding protoporphyrinogen oxidase.
[0017] The second polynucleotide encodes a selectable marker protein, a protein having synthetic activity, a protein having degrading activity, a biotic stress resistance protein, an abiotic stress resistance protein, a male sterility protein, a protein affecting plant yield, and / or a protein affecting plant quality.
[0018] In particular, the second polynucleotide encodes 5-enolpyruvylshikimate-3-phosphate synthase, glyphosate oxidoreductase, glyphosate-N-acetyltransferase, glyphosate decarboxylase, glufosinate acetyltransferase, alpha-ketoglutarate-dependent dioxygenase, dicamba monooxygenase, 4-hydroxyphenylpyruvate dioxygenase, acetolactate synthase, and / or a cytochrome-like protein.
[0019] Alternatively, the herbicide containing an effective amount of a PPO inhibitor may further contain a glyphosate herbicide, a glufosinate herbicide, an auxin-like herbicide, a weed control agent, a pre-emergence selective herbicide, and / or a post-emergence selective herbicide.
[0020] To achieve the above object, the present invention further provides a planting combination for suppressing weed growth, which comprises a PPO-inhibiting herbicide and at least one transgenic plant. Here, the herbicide containing an effective amount of a PPO inhibitor is applied to a field where at least one transgenic plant is present. The transgenic plant contains a polynucleotide sequence encoding protoporphyrinogen oxidase in its genome. Compared with other plants that do not have the polynucleotide sequence encoding protoporphyrinogen oxidase, the transgenic plant has less plant damage and / or higher plant yield. Further, protoporphyrinogen oxidase has at least 88% sequence identity with an amino acid sequence selected from the group consisting of SEQ ID NOs: 1 to 14.
[0021] Preferably, protoporphyrinogen oxidase has at least 90% sequence identity with an amino acid sequence selected from the group consisting of SEQ ID NOs: 1 to 14.
[0022] Preferably, protoporphyrinogen oxidase has at least 95% sequence identity with an amino acid sequence selected from the group consisting of SEQ ID NOs: 1 to 14.
[0023] More preferably, protoporphyrinogen oxidase has at least 99% sequence identity with an amino acid sequence selected from the group consisting of SEQ ID NOs: 1 to 14.
[0024] Even more preferably, protoporphyrinogen oxidase is selected from the amino acid sequences of the group consisting of SEQ ID NOs: 1 to 14.
[0025] Preferably, the transgenic plant includes monocotyledonous plants and dicotyledonous plants, more preferably, the transgenic plant is Triticum carthlicum, Triticum aestivum, Hordeum vulgare, Pennisetum glaucum, Zea mays, Sorghum bicolor, Spergularia marina, Oryza sativa, Nicotiana tabacum, Helianthus annuus, Medicago sativa, Glycine max, Phaseolus vulgaris, Arachis hypogaea, Beta vulgaris, Cucumis sativus, Gossypium hirsutum, Brassica napus, Solanum tuberosum, Solanum lycopersicum, or Arabidopsis thaliana, still more preferably, the transgenic plant is a glyphosate-tolerant plant, and the weed is a glyphosate-resistant weed.
[0026] Preferably, the PPO-inhibiting herbicide includes PPO-inhibiting herbicides of the types of diphenyl ethers, oxadiazolones, N-phenylphthalimides, oxazolinones, phenylpyrazoles, uracils, thiadiazoles, triazolinones, and / or triazinones.
[0027] More preferably, the PPO-inhibiting herbicide includes oxyfluorfen, sulfufenacil, sulfentrazone, and / or flumioxazin.
[0028] Preferably, the polynucleotide sequence of protoporphyrinogen oxidase includes the following.
[0029] (a) A polynucleotide sequence encoding an amino acid sequence having at least 88% sequence identity with a sequence selected from SEQ ID NOs: 1 to 14 and not including SEQ ID NOs: 15 to 28, or (b) A polynucleotide sequence shown in any one of SEQ ID NOs: 29 to 42 or SEQ ID NOs: 62 to 64.
[0030] Furthermore, the transgenic plant further includes at least one second polynucleotide encoding a second herbicide-tolerant protein, which is different from the polynucleotide sequence encoding protoporphyrinogen oxidase.
[0031] The second polynucleotide encodes a selectable marker protein, a protein having synthetic activity, a protein having degrading activity, a biotic stress resistance protein, an abiotic stress resistance protein, a male sterility protein, a protein affecting plant yield, and / or a protein affecting plant quality.
[0032] In particular, the second polynucleotide encodes 5-enolpyruvylshikimate-3-phosphate synthase, glyphosate oxidoreductase, glyphosate-N-acetyltransferase, glyphosate decarboxylase, glufosinate acetyltransferase, alpha-ketoglutarate-dependent dioxygenase, dicamba monooxygenase, 4-hydroxyphenylpyruvate dioxygenase, acetolactate synthase, and / or a cytochrome-like protein.
[0033] Alternatively, herbicides containing an effective amount of a PPO inhibitor may further include glyphosate herbicides, glufosinate herbicides, auxin-like herbicides, weed control agents, pre-emergence selective herbicides and / or post-emergence selective herbicides.
[0034] To achieve the above object, the present invention further provides a method for producing a plant resistant to a PPO-inhibiting herbicide. The method includes introducing a polynucleotide sequence encoding protoporphyrinogen oxidase into the genome of a plant, and when a herbicide containing an effective amount of a PPO inhibitor is applied to at least a field where the plant exists, the plant has less plant damage and / or more plant yield compared to other plants that do not have the polynucleotide sequence encoding protoporphyrinogen oxidase. Here, protoporphyrinogen oxidase has at least 88% sequence identity with an amino acid sequence selected from the group consisting of SEQ ID NOs: 1 to 14.
[0035] Preferably, protoporphyrinogen oxidase has at least 90% sequence identity with an amino acid sequence selected from the group consisting of SEQ ID NOs: 1 to 14.
[0036] Preferably, the protoporphyrinogen oxidase has at least 95% sequence identity with an amino acid sequence selected from the group consisting of SEQ ID NOs: 1 to 14.
[0037] More preferably, the protoporphyrinogen oxidase has at least 99% sequence identity with an amino acid sequence selected from the group consisting of SEQ ID NOs: 1 to 14.
[0038] Even more preferably, the protoporphyrinogen oxidase is selected from the amino acid sequences of the group consisting of SEQ ID NOs: 1 to 14.
[0039] Preferably, the method of introduction includes genetic transformation, genome editing, or gene mutation methods.
[0040] Preferably, the plants include monocotyledonous plants and dicotyledonous plants. More preferably, the plants are Triticum monococcum, Triticum aestivum, Triticum turgidum, Setaria italica, Zea mays, Sorghum bicolor, Chenopodium album, Oryza sativa, Nicotiana tabacum, Helianthus annuus, Medicago sativa, Glycine max, Phaseolus vulgaris, Arachis hypogaea, Beta vulgaris, Cucumis sativus, Gossypium hirsutum, Brassica napus, Solanum tuberosum, Solanum lycopersicum, or Arabidopsis thaliana.
[0041] Preferably, the PPO-inhibiting herbicide includes PPO-inhibiting herbicides of the types of diphenyl ethers, oxadiazolones, N-phenylphthalimides, oxazolinones, phenylpyrazoles, uracils, thiadiazoles, triazolinones, and / or triazinones.
[0042] Even more preferably, the PPO-inhibiting herbicide includes oxyfluorfen, sulfufenacil, sulfentrazone, and / or flumioxazin.
[0043] To achieve the above object, the present invention further provides a method for cultivating a plant resistant to a PPO-inhibiting herbicide, and the cultivation method is A plant propagule, wherein the plant propagule contains a polynucleotide encoding protoporphyrinogen oxidase in its genome, and the protoporphyrinogen oxidase has at least 88% sequence identity with an amino acid sequence selected from the group consisting of SEQ ID NOs: 1 to 14, and planting at least one of the plant propagules; Growing the plant propagule into a plant; Applying a herbicide containing an effective amount of a PPO inhibitor to a field containing at least the plant, and harvesting the plant with less plant damage and / or higher plant yield compared to other plants having no polynucleotide sequence encoding protoporphyrinogen oxidase comprising.
[0044] Preferably, the protoporphyrinogen oxidase has at least 90% sequence identity with an amino acid sequence selected from the group consisting of SEQ ID NOs: 1 to 14.
[0045] Preferably, the protoporphyrinogen oxidase has at least 95% sequence identity with an amino acid sequence selected from the group consisting of SEQ ID NOs: 1 to 14.
[0046] More preferably, the protoporphyrinogen oxidase has at least 99% sequence identity with an amino acid sequence selected from the group consisting of SEQ ID NOs: 1 to 14.
[0047] Even more preferably, the protoporphyrinogen oxidase is selected from the amino acid sequences of the group consisting of SEQ ID NOs: 1 to 14.
[0048] Preferably, the plants include monocotyledonous plants and dicotyledonous plants, and more preferably, the plants are Triticum aestivum, Triticum durum, Triticum aestivum, Setaria italica, Zea mays, Sorghum bicolor, Chenopodium album, Oryza sativa, Nicotiana tabacum, Helianthus annuus, Medicago sativa, Glycine max, Cicer arietinum, Arachis hypogaea, Beta vulgaris, Cucumis sativus, Gossypium hirsutum, Brassica rapa, Solanum tuberosum, Solanum lycopersicum, or Arabidopsis thaliana.
[0049] Preferably, the PPO-inhibiting herbicide comprises a PPO-inhibiting herbicide of the types of diphenyl ethers, oxadiazolones, N-phenylphthalimides, oxazolinones, phenylpyrazoles, uracils, thiadiazoles, triazolinones and / or triazinones.
[0050] More preferably, the PPO-inhibiting herbicide comprises oxyfluorfen, sulfofenacil, sulfentrazone, and / or flumioxazin.
[0051] To achieve the above object, the present invention further provides a method for protecting a plant from damage caused by a PPO-inhibiting herbicide or endowing a plant with tolerance to a PPO-inhibiting herbicide. The method includes applying a herbicide containing an effective amount of a PPO inhibitor to a field where at least one transgenic plant is present. The transgenic plant contains a polynucleotide sequence encoding protoporphyrinogen oxidase in its genome. Compared with other plants without the polynucleotide sequence encoding protoporphyrinogen oxidase, the transgenic plant has less plant damage and / or higher plant yield. Protoporphyrinogen oxidase has at least 88% sequence identity with an amino acid sequence selected from the group consisting of SEQ ID NOs: 1 to 14.
[0052] Preferably, protoporphyrinogen oxidase has at least 90% sequence identity with an amino acid sequence selected from the group consisting of SEQ ID NOs: 1 to 14.
[0053] Preferably, protoporphyrinogen oxidase has at least 95% sequence identity with an amino acid sequence selected from the group consisting of SEQ ID NOs: 1 to 14.
[0054] More preferably, protoporphyrinogen oxidase has at least 99% sequence identity with an amino acid sequence selected from the group consisting of SEQ ID NOs: 1 to 14.
[0055] More preferably, the protoporphyrinogen oxidase is selected from the amino acid sequences consisting of SEQ ID NOs: 1 to 14.
[0056] Preferably, the transgenic plants include monocotyledonous plants and dicotyledonous plants, and more preferably, the transgenic plants are Triticum monococcum, wheat, barley, millet, corn, sorghum, Portulaca oleracea L., rice, tobacco, sunflower, alfalfa, soybean, chickpea, peanut, sugar beet, cucumber, cotton, rape, potato, tomato, or Arabidopsis thaliana.
[0057] Preferably, the PPO-inhibiting herbicide includes PPO-inhibiting herbicides of the types of diphenyl ethers, oxadiazolones, N-phenylphthalimides, oxazolinones, phenylpyrazoles, uracils, thiadiazoles, triazolinones, and / or triazinones.
[0058] More preferably, the PPO-inhibiting herbicide includes oxyfluorfen, sulfphenacyl, sulfentrazone, and / or flumioxazin.
[0059] To achieve the above object, the present invention further provides the use of protoporphyrinogen oxidase for conferring resistance to PPO-inhibiting herbicides to plants, and the protoporphyrinogen oxidase has at least 88% sequence identity with an amino acid sequence selected from the group consisting of SEQ ID NOs: 1 to 14.
[0060] Preferably, the protoporphyrinogen oxidase has at least 90% sequence identity with an amino acid sequence selected from the group consisting of SEQ ID NOs: 1 to 14.
[0061] Preferably, the protoporphyrinogen oxidase has at least 95% sequence identity with an amino acid sequence selected from the group consisting of SEQ ID NOs: 1 to 14.
[0062] More preferably, protoporphyrinogen oxidase has at least 99% sequence identity with an amino acid sequence selected from the group consisting of SEQ ID NOs: 1 to 14.
[0063] Even more preferably, protoporphyrinogen oxidase is selected from the amino acid sequences of the group consisting of SEQ ID NOs: 1 to 14.
[0064] Preferably, the use of protoporphyrinogen oxidase to confer resistance to PPO-inhibiting herbicides in plants comprises applying a herbicide containing an effective amount of a PPO inhibitor to a field in which there is at least one transgenic plant, the transgenic plant comprising in its genome a polynucleotide sequence encoding protoporphyrinogen oxidase, and the transgenic plant having less plant damage and / or higher plant yield compared to other plants that do not have the polynucleotide sequence encoding protoporphyrinogen oxidase.
[0065] Preferably, the plants include monocotyledonous and dicotyledonous plants, and more preferably, the plants are rye, wheat, barley, millet, corn, sorghum, seashore paspalum, rice, tobacco, sunflower, alfalfa, soybean, chickpea, peanut, sugar beet, cucumber, cotton, rape, potato, tomato, or Arabidopsis thaliana.
[0066] Preferably, the PPO-inhibiting herbicides include PPO-inhibiting herbicides of the types diphenyl ethers, oxadiazonones, N-phenylphthalimides, oxazolinones, phenylpyrazoles, uracils, thiadiazoles, triazolinones, and / or triazinones.
[0067] Even more preferably, the PPO-inhibiting herbicide includes oxyfluorfen, sulfufenacil, sulfentrazone, and / or flumioxazin.
[0068] Preferably, the polynucleotide sequence of protoporphyrinogen oxidase includes the following.
[0069] (a) A polynucleotide sequence encoding an amino acid sequence having at least 88% sequence identity with a sequence selected from SEQ ID NOs: 1 to 14 and not including SEQ ID NOs: 15 to 28, or (b) A polynucleotide sequence shown in any one of SEQ ID NOs: 29 to 42 or SEQ ID NOs: 62 to 64.
[0070] As a specific embodiment, PPO-inhibiting herbicides (also known as herbicides of PPO inhibitors) include, but are not limited to, diphenyl ethers (chloronitrofen, chlomethoxyfen, biphenox, oxyfluorfen, acifluorfen, its salts and esters, hinosafen, lactofen, fluoroglycofen ethyl, ethoxyfen ethyl, acifluorfen, biphenox, ethoxyfen, chlorintrofen, and halosafen), oxadiazolones (oxadiazon and oxadiargyl), N-phenylphthalimides (flumioxazin, flumiclorac pentyl, and cinidon-ethyl), oxazolinones (pentoxazone), phenylpyrazoles (fluazolate and pyraflufen ethyl), uracils (benzfendizone, butafenacil, and safufenacil), thiadiazoles (thidiazimin and fluthiacet), triazolinones (azafenidin, sulfentrazone, and carfentrazone), triazinones (triflumidoxazin), and others (flufenpyr ethyl and pyraclonil), and may be one or more selected from the group consisting of them.
[0071] As used herein, the articles "a" and "an" refer to one or more (i.e., at least one). For example, "an element" means one or more elements (components). Further, words such as "comprise", "comprises" or "comprising" are to be understood to mean including the stated element, integer or step, or group of elements, integers or steps, but not to exclude any other element, integer or step, or group of elements, integers or steps.
[0072] As used herein, the term "herbicide-insensitive" means the ability of protoporphyrinogen oxidase to maintain at least a portion of its enzymatic activity even in the presence of one or more PPO herbicides. The enzymatic activity of protoporphyrinogen oxidase can be measured by any means known in the art, for example, by assays that measure the production of the product of protoporphyrinogen oxidase or the consumption of the substrate of protoporphyrinogen oxidase in the presence of one or more PPO herbicides, by fluorescence, high performance liquid chromatography (HPLC), or mass spectrometry (MS). "Herbicide-insensitive" may be complete or partial insensitivity to a particular herbicide, or may be expressed as a percentage of tolerance or insensitivity to a particular PPO herbicide.
[0073] As used herein, the terms "herbicide tolerance of a plant, seed, plant tissue or cell" or "herbicide-tolerant plant, seed, plant tissue or cell" refer to the ability of a plant, seed, plant tissue or cell to resist the effects of an applied herbicide. For example, a herbicide-tolerant plant can survive or continue to grow in the presence of a herbicide. The herbicide tolerance of a plant, seed, plant tissue or cell can be evaluated by comparing the plant, seed, plant tissue, or cell with an appropriate control. For example, a herbicide is applied to a plant (test plant) containing a DNA molecule encoding a protein capable of conferring herbicide tolerance and a plant (control plant) not containing a DNA molecule encoding a protein capable of conferring herbicide tolerance, and then the damage to these two plants is compared to evaluate and determine herbicide tolerance. The herbicide tolerance of the test plant is represented by the degree of reduction in the damage rate compared to the control plant. A herbicide-tolerant plant, seed, plant tissue or cell has a reduced response to the toxic effects of a herbicide compared to a control plant, seed, plant tissue or cell. The term "herbicide tolerance trait" is a transgenic trait that confers improved herbicide tolerance to a plant compared to a wild-type plant. Examples of plants that can be produced using the herbicide tolerance trait of the present invention include any plant, including crop plants such as rye, wheat, barley, millet, corn, sorghum, carpetweed, rice, tobacco, sunflower, alfalfa, soybean, chickpea, peanut, sugar beet, cucumber, cotton, rape, potato, tomato, and Arabidopsis thaliana.
[0074] The DNA molecules of the present invention may be wholly or partially synthesized and modified by methods known in the art, particularly when it is desirable to provide sequences useful for DNA manipulation (such as restriction enzyme recognition sites or recombination-based cloning sites), sequences preferred in plants (such as plant codon usage or Kozak consensus sequences), or sequences useful for DNA construct design (such as spacer sequences or linker sequences). The present invention includes DNA molecules encoding proteins having at least 88% sequence identity, at least 90% sequence identity, at least 91% sequence identity, at least 92% sequence identity, at least 93% sequence identity, at least 94% sequence identity, at least 95% sequence identity, at least 96% sequence identity, at least 97% sequence identity, at least 98% sequence identity, and at least 99% sequence identity with the amino acid sequences selected from the group consisting of SEQ ID NOs: 1 to 14, preferably proteins are included. The term "sequence identity percentage" or "sequence identity %" refers to the percentage of identical amino acids in the protein sequence of a reference sequence or query sequence (or its complementary strand) compared to a test sequence (or its complementary strand) when the reference sequence or query sequence (or its complementary strand) is aligned with the test sequence (or its complementary strand). Methods for sequence alignment are well known in the art and can be achieved using mathematical algorithms such as the algorithm of Myers and Miller (1988) in CABIOS 4:11-17, the local alignment algorithm of Smith et al. (1981) in Adv. Appl. Math. 2:482, the global alignment algorithm of Needleman and Wunsch (1970) in J. Mol. Biol. 48:443-453, and the algorithm of Karlin and Altschul (1990) in Proc. Natl. Acad. Sci. USA 87:2264 as modified by Karlin and Altschul (1993) in Proc. Natl. Acad. Sci. USA 90:5873-5877. Computer implementations of these mathematical algorithms can be utilized for sequence comparison to determine sequence identity.Such implementations include, but are not limited to, CLUSTAL of the PC / Gene program (available from Intelligenetics, Mountain View, California); the ALIGN program (Version 2.0) of the GCG Wisconsin Genetics Software Package, Version 10 (available from Accelrys Inc, 9685 Scranton Road, San Diego, California, USA), and GAP, BESTFIT, BLAST, FASTA, and TFASTA. The sequence identity ratio is expressed as 100 times the identity ratio.
[0075] As used herein, oxyfluorfen refers to 2-chloro-1-(3-ethoxy-4-nitrophenoxy)-4-trifluoromethylbenzene, which is a colorless crystalline solid. Oxyfluorfen is a selective, pre-emergence and post-emergence contact PPO-inhibiting herbicide of the diphenyl ether class and can be applied as an emulsifiable concentrate. Weeds die mainly by absorbing the herbicide through the coleoptile and mesocotyl. Oxyfluorfen can effectively control weeds in fields of crops such as rice, soybean, corn, cotton, vegetables, grapes, fruit trees, etc. Weeds that can be controlled include, but are not limited to, monocotyledonous and broadleaf weeds such as barnyard grass (Echinochloa crus-galli), sesbania (Sesbania cannabina), cheatgrass (Bromus tectorum), green foxtail (Setaria viridis), jimsonweed (Datura stramonium), quackgrass (Agropyron repens), common ragweed (Ambrosia artemisiifolia), spiny sida (Sida spinosa), velvetleaf (Abutilon theophrasti), and wild mustard (Brassica kaber).
[0076] As used herein, an effective amount of oxyfluorfen means an amount in the range of 180 to 720 g ai / ha, for example, used in the range of 190 to 700 g ai / ha, 250 to 650 g ai / ha, 300 to 600 g ai / ha, or 400 to 500 g ai / ha.
[0077] As used herein, sulfufenacil refers to N’-[2-chloro-4-fluoro-5-(3-methyl-2,6-dioxo-4-(trifluoromethyl)-3,6-dihydro-1(2H)-pyrimidinyl)benzoyl]-N-isopropyl-N-methylsulfamide, which is a light brown extruded granular solid. Sulfufenacil belongs to the class of sterilizing PPO-inhibiting herbicides of uracils and can be made into 70% water dispersible granules. Sulfufenacil is effective against various broadleaf weeds, such as those resistant to glyphosate, acetolactate synthase (ALS), and triazine, and is characterized by a fast withering effect and fast decomposition of residues in the soil.
[0078] As used herein, an effective amount of sulfufenacil means an amount in the range of 25 to 100 g ai / ha, for example, used in the range of 30 to 95 g ai / ha, 40 to 90 g ai / ha, 50 to 85 g ai / ha, or 60 to 80 g ai / ha.
[0079] As used herein, flumioxazin refers to 2-[7-fluoro-3,4-dihydro-3-oxo-4-(2-propynyl)-2H-1,4-benzoxazin-6-yl]-4,5,6,7-tetrahydro-1H-isoindole-1,3(2H)-dione. Flumioxazin is a PPO-inhibiting herbicide of N-phenylphthalimides, is absorbed by seedlings and leaves, and is usually applied in the dosage forms of 50% wettable powder and 48% suspension concentrate (SC). Flumioxazin can effectively control annual broadleaf weeds and some gramineous weeds. Flumioxazin is easily decomposed in the environment and is safe for subsequent crops.
[0080] As used herein, the effective amount of flumioxazin means an amount in the range of 60 to 240 g ai / ha, for example, 70 to 220 g ai / ha, 85 to 200 g ai / ha, 90 to 185 g ai / ha, or 100 to 150 g ai / ha.
[0081] As used herein, sulfentrazone refers to N-(2,4-dichloro-5-(4-difluoromethyl-4,5-dihydro-3-methyl-5-oxo-1H-1,2,4-triazol-1-yl)phenyl)methanesulfonamide, which is a brown solid. Sulfentrazone is a PPO-inhibiting herbicide of triazolinones, usually in the dosage forms of 38.9% and 44.5% SC formulations. Sulfentrazone can be used for controlling, among others, annual broadleaf weeds, gramineous weeds, and Cyperaceae such as Ipomoea nil, Amaranthus retroflexus, Chenopodium album, Datura stramonium, Digitaria sanguinalis, Setaria viridis, Xanthium strumarium, Eleusine indica Gaertn, and Cyperus rotundus in fields such as corn, sorghum, soybean, and peanut.
[0082] As used herein, the effective amount of sulfentrazone means an amount in the range of 450 to 900 g ai / ha, for example, 500 to 850 g ai / ha, 550 to 700 g ai / ha, 500 to 685 g ai / ha, or 500 to 650 g ai / ha.
[0083] As used herein, the term "resistance" is hereditary and enables a plant to grow and reproduce even under circumstances where effective treatment with a conventional herbicide is carried out on a given plant. As recognized by those skilled in the art, even if a given plant treated with a herbicide has some degree of damage (such as small necrosis, lysis, or albino damage), the plant can still be considered "resistant" as long as at least the yield is not significantly impaired. In other words, a given plant has enhanced ability to resist various degrees of damage induced by a herbicide, and generally, it can cause damage to wild-type plants with the same genotype with the same dose of herbicide. The term "tolerant" or "tolerance" in the present invention is broader than the term "resistance" and includes "resistance".
[0084] As used herein, the term "biotic stress resistance protein" refers to a protein that resists stress imposed by other organisms, such as insect resistance proteins and disease resistance proteins (against viruses, bacteria, fungi, and nematodes).
[0085] As used herein, the term "abiotic stress resistance protein" refers to a protein that resists stress imposed by the external environment, such as a protein that is tolerant to herbicides, drought, heat, cold, frost, salt stress, oxidative stress, and the like.
[0086] As used herein, the term "protein that affects plant quality" refers to a protein that affects plant product traits, such as a protein that improves the quality and content of starch, oil, vitamins, etc., and a protein that improves fiber quality.
[0087] In addition, an expression cassette containing a polynucleotide sequence encoding protoporphyrinogen oxidase can also be expressed together with at least one protein encoding a herbicide resistance gene in plants. Herbicide resistance proteins include, but are not limited to, 5-enolpyruvylshikimate-3-phosphate synthase (EPSPS), glyphosate oxidoreductase (GOX), glyphosate-N-acetyltransferase (GAT), glyphosate decarboxylase, glufosinate acetyltransferase (PAT), alpha-ketoglutarate-dependent dioxygenase (AAD), dicamba monooxygenase (DMO), 4-hydroxyphenylpyruvate dioxygenase (HPPD), acetolactate synthase (ALS), and / or cytochrome-like protein (P450).
[0088] As used herein, "glyphosate" refers to N-phosphonomethylglycine and its salts, and "treatment with a glyphosate herbicide" refers to treatment with any herbicide formulation containing glyphosate. Commercially available formulations of glyphosate include, but are not limited to, ROUNDUP® (glyphosate isopropylammonium salt), ROUNDUP® WEATHERMAX® (glyphosate potassium salt); ROUNDUP® DRY and RIVAL® (glyphosate ammonium salt); ROUNDUP® GEOFORCE® (glyphosate sodium salt); and TOUCHDOWN® (glyphosate trimethylsulfonium salt).
[0089] As used herein, an effective amount of glyphosate means an amount in the range from 200 to 1600 g ae / ha, for example, from 250 to 1600 g ae / ha, from 300 to 1600 g ae / ha, from 500 to 1600 g ae / ha, from 800 to 1500 g ae / ha, from 1000 to 1500 g ae / ha, from 800 to 1500 g ae / ha, and is used in these ranges.
[0090] As used herein, "glufosinate" is also known as phosphinothricin and refers to ammonium 2-amino-4-[hydroxy(methyl)phosphoryl]butanoate, and "treatment with a glufosinate herbicide" refers to treatment with any herbicide formulation containing glufosinate.
[0091] As used herein, an effective amount of glufosinate means an amount in the range from 200 to 800 g ae / ha, for example, from 200 to 750 g ae / ha, from 250 to 700 g ae / ha, from 300 to 700 g ae / ha, from 350 to 650 g ae / ha, or from 400 to 600 g ae / ha, and is used in these ranges.
[0092] In the present invention, auxin-like herbicides mimic or act like a natural plant growth regulator called auxin. Auxin-like herbicides affect the plasticity of cell walls and nucleic acid metabolism, thereby being able to incapacitate cell division and growth. Injury symptoms caused by auxin-like herbicides include epinastic growth curvature and twisting of stems and petioles, leaf depressions and curvatures, and abnormalities in leaf shape and leaf veins. Auxin-like herbicides include, but are not limited to, phenoxycarboxylic acid compounds, benzoic acid compounds, pyridinecarboxylic acid compounds, quinolinecarboxylic acid compounds, and bentazone ethyl compounds. Usually, auxin-like herbicides are dicamba, 2,4-dichlorophenoxyacetic acid (2,4-D), (4-chloro-2-methylphenoxy)acetic acid (MCPA), and / or 4-(2,4-dichlorophenoxy)butyric acid (2,4-DB).
[0093] As used herein, "dicamba" refers to 3,6-dichloro-o-anisic acid or 3,6-dichloro-2-methoxybenzoic acid, and its acids and salts. Examples of its salts include salts of isopropylamine, diglycolamine, dimethylamine, potassium, and sodium. Commercially available formulations of dicamba include, but are not limited to, Banvel® (DMA salt), Clarity® (DGA salt, BASF), VEL-58--CS-11™, and Vanquish® (DGA salt, BASF).
[0094] In the present invention, 2,4-D is a relatively inexpensive and powerful broad-leaved herbicide with a wide spectrum, and has been used for controlling broad-spectrum broad-leaved weeds for over 65 years under agricultural and non-crop conditions. The selectivity level of 2,4-D varies among plants (for example, dicotyledonous plants are more sensitive than gramineous plants). Generally, plants metabolize 2,4-D slowly, so the difference in plant responses to 2,4-D is likely to be explained by the difference in the activity of the target site. The plant metabolism of 2,4-D is generally carried out by two-step metabolism, that is, generally after hydroxylation, it binds to an amino acid or glucose in two steps.
[0095] Pre-emergence selective herbicides in the present invention include, but are not limited to, acetanilide, acetochlor, acetolactate synthase inhibitors, and dinitroaniline.
[0096] Post-emergence selective herbicides in the present invention include, but are not limited to, nicosulfuron, rimsulfuron, and quizalofop-p-ethyl.
[0097] The application rate of the herbicide in the present invention varies depending on soil structure, pH value, organic matter content, farming system, and weed size, and is determined by checking the appropriate application rate of the herbicide described on the herbicide label.
[0098] In this specification, the term "confer" refers to providing a plant with a characteristic or trait, such as herbicide tolerance and / or other desirable traits.
[0099] In this specification, the term "heterologous" means from another source. In the context of DNA, "heterologous" refers to any foreign "non-self" DNA, including that from another plant of the same species. For example, in the present invention, the soybean HPPD gene that can be expressed in soybean plants by a gene transfer method is also regarded as "heterologous" DNA.
[0100] As used herein, the term "nucleic acid" includes deoxyribonucleotide polymers or ribonucleotide polymers in either single-stranded or double-stranded form, and unless otherwise specified, has the essential characteristics of natural nucleotides and includes known analogs (e.g., peptide nucleic acids) that hybridize to single-stranded nucleic acids in a manner similar to natural origin nucleotides.
[0101] As used herein, the terms "encoding" or "encoded" when used in the context of a particular nucleic acid mean that the nucleic acid contains the information necessary to direct the translation of a particular nucleotide sequence into a protein. The information encoded for a protein is specified by the use of codons. A nucleic acid encoding a protein may contain untranslated sequences (e.g., introns) within the translated region of the nucleic acid, or may not have such intervening untranslated sequences (e.g., as in cDNA).
[0102] The DNA sequence encoding the protoporphyrinogen oxidase of the present invention is used for providing plants, plant cells and seeds of the present invention that exhibit better tolerance to a plurality of PPO-inhibiting herbicides as compared to a plant of the same species (control plant) that does not contain the DNA sequence encoding the protoporphyrinogen oxidase of the present invention.
[0103] The gene encoding the protoporphyrinogen oxidase of the present invention is useful for the production of plants that are resistant to PPO-inhibiting herbicides. The gene encoding the protoporphyrinogen oxidase of the present invention is particularly suitable for expression in plants to confer herbicide resistance to plants.
[0104] The terms "polypeptide", "peptide", and "protein" are used interchangeably herein and refer to polymers of amino acid residues. These terms apply to amino acid polymers in which one or more amino acid residues are artificial chemical analogs of the corresponding naturally-occurring amino acids, as well as to naturally-occurring amino acid polymers. The polypeptides of the present invention can be produced from the nucleic acids disclosed herein or by standard molecular biological techniques. For example, the truncated proteins of the present invention can be produced by expression of the recombinant nucleic acids of the present invention in a suitable host cell or by a combination of ex vivo procedures such as protease digestion and purification.
[0105] The present invention also provides nucleic acid molecules comprising protoporphyrinogen oxidase. Generally, the present invention includes any polynucleotide sequence encoding a protoporphyrinogen oxidase having one or more conservative amino acid substitutions relative to protoporphyrinogen oxidase. Conservative substitutions that provide functionally similar amino acids are well known in the art. The following five groups each contain amino acids that are conservative substitutes for one another. Aliphatic: glycine (G), alanine (A), valine (V), leucine (L), isoleucine (I); Aromatic: phenylalanine (F), tyrosine (Y), tryptophan (W); Sulfur-containing: methionine (M), cysteine (C); Basic: arginine (I), lysine (K), histidine (H); Acidic: aspartic acid (D), glutamic acid (E), asparagine (N), glutamine (Q).
[0106] Accordingly, sequences that have resistance activity against protoporphyrinogen oxidase-inhibiting herbicides and hybridize under stringent conditions to the gene encoding the protoporphyrinogen oxidase of the present invention are included in the present invention. Exemplary sequences include at least about 85%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99% or more sequence identity with SEQ ID NOs: 29-42 and SEQ ID NOs: 62-64 of the present invention. The genes encoding the protoporphyrinogen oxidase of the present invention do not include SEQ ID NOs: 15-28.
[0107] The presence of the PPO gene of the present invention can be identified using any conventional nucleic acid hybridization method or nucleic acid amplification method. A nucleic acid molecule or a fragment thereof can specifically hybridize with other nucleic acid molecules under certain circumstances. In the present invention, if two nucleic acid molecules can form an antiparallel double-stranded nucleic acid structure, these two nucleic acid molecules can be considered to be able to specifically hybridize with each other. If two nucleic acid molecules show complete complementarity, one of the two nucleic acid molecules is said to be the "complement" of the other nucleic acid molecule. In the present invention, when each nucleotide of a nucleic acid molecule is complementary to the corresponding nucleotide of another nucleic acid molecule, these two nucleic acid molecules are said to show "complete complementarity". Two nucleic acid molecules are said to be "minimally complementary" if they can hybridize with each other with sufficient stability to anneal and bind to each other at least under conventional "low stringency" conditions. Similarly, two nucleic acid molecules are said to be "complementary" if they can hybridize with each other with sufficient stability to anneal and bind to each other under conventional "high stringency" conditions. Deviations from complete complementarity are tolerated as long as the deviation does not completely prevent the two molecules from forming a double-stranded structure. To enable a nucleic acid molecule to act as a primer or probe, it is only necessary to ensure that the molecule has sufficient complementarity in its sequence so that a stable double-stranded structure is formed under specific solvent and salt concentration conditions.
[0108] In the present invention, a substantially homologous sequence refers to a nucleic acid molecule that can specifically hybridize to the complementary strand of a compatible nucleic acid molecule under high stringency conditions. Appropriate stringent conditions for promoting DNA hybridization are well known to those skilled in the art. For example, appropriate stringent conditions can be achieved by treating with 6.0× sodium chloride / sodium citrate (SSC) at about 45°C and then washing with 2.0× SSC at 50°C. For example, the salt concentration in the washing step can be selected from low stringency conditions of about 2.0× SSC at 50°C to high stringency conditions of about 0.2× SSC at 50°C. Also, the temperature condition of the washing step can be raised from low stringency conditions at room temperature (about 22°C) to high stringency conditions at about 65°C. Both the temperature condition and the salt concentration can be changed, or one of them can be changed while the other remains unchanged. Preferably, the stringent conditions in the present invention can be achieved by specifically hybridizing to the gene encoding protoporphyrinogen oxidase of the present invention in a 6× SSC, 0.5% SDS solution at 65°C, and then washing the membrane once with 2× SSC, 0.1% SDS, and once with 1× SSC, 0.1% SDS.
[0109] As used herein, the terms "hybridize" or "specifically hybridize" refer to a molecule binding, duplexing, or hybridizing only to that sequence under stringent conditions when a specific polynucleotide sequence is present in the DNA or RNA of a complex mixture (e.g., whole cells).
[0110] Due to the degeneracy of the genetic codon, various different DNA sequences may encode the same amino acid sequence. Generating these alternative DNA sequences that encode the same or substantially the same protein is within the skill of the art. These different DNA sequences are included within the scope of the present invention. The term "substantially the same" sequence refers to a sequence having amino acid substitutions, deletions, additions or insertions that do not substantially affect herbicide tolerance activity, and includes fragments that retain herbicide tolerance activity.
[0111] The term "functional activity" or "activity" in the present invention means that the protein / enzyme used in the present invention has the ability to degrade a herbicide (alone or in combination with other proteins) or the ability to reduce herbicide activity. Plants that produce the protein of the present invention preferably produce an "effective amount" of the protein, and thus, when treating plants with a herbicide, the expression level of the protein is sufficient (in a general amount, unless otherwise specified) to confer complete or partial tolerance to the herbicide on the plant. The herbicide can be used in an amount that normally kills the target plant or in normal field amounts and concentrations. Preferably, the plant cells and plants of the present invention are protected from growth inhibition or damage caused by treatment with a herbicide. The transformed plants and plant cells of the present invention are preferably resistant to PPO-inhibiting herbicides, i.e., the transformed plants and plant cells can grow in the presence of an effective amount of a PPO-inhibiting herbicide.
[0112] The genes and proteins in the present invention include not only specific exemplary sequences, but also portions and / or fragments that retain the activity characteristic of the specific exemplary protein (including internal deletions and / or terminal deletions when compared to the full-length protein), variants, mutants, mutant proteins, substituents (proteins having substituted amino acids), chimeras, and fusion proteins.
[0113] The term "variant" as used in the present invention is intended to mean substantially similar sequences. In the case of polynucleotides, variants include deletions and / or additions of one or more nucleotides at one or more internal sites within the reference polynucleotide, and / or substitutions of one or more nucleotides at one or more sites of the herbicide tolerance gene. As used herein, the terms "reference polynucleotide or polypeptide" each include a polynucleotide sequence or amino acid sequence conferring herbicide tolerance. As used herein, the terms "native polynucleotide or polypeptide" each include a polynucleotide sequence or amino acid sequence of natural origin. In the case of nucleic acid molecules, conservative variants include multiple polynucleotide sequences encoding one of the protoporphyrinogen oxidases of the present invention due to the degeneracy of the genetic code. Such allelic variants of natural origin can be identified using well-known molecular biology techniques, for example, polymerase chain reaction (PCR) and hybridization techniques outlined below. Variant nucleic acid molecules also include synthetically derived nucleic acid molecules, for example, those produced using site-directed mutagenesis and still encoding the nucleotide sequence of the protoporphyrinogen oxidase of the present invention. In general, variants of a particular nucleic acid molecule of the present invention will have at least about 85%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99% or more sequence identity with that particular nucleic acid molecule as determined by sequence alignment programs and parameters.
[0114] As used herein, the term "mutant protein" is intended to mean a protein derived from a reference protein by deletion or addition of one or more amino acids at one or more internal sites of protoporphyrinogen oxidase, and / or substitution of one or more amino acids at one or more sites of protoporphyrinogen oxidase. Mutant proteins encompassed by the present invention are biologically active, i.e., they continue to possess the desired biological activity of the protoporphyrinogen oxidase of the present invention, namely the protoporphyrinogen oxidase activity and / or herbicide tolerance described herein. Such variants may occur, for example, as a result of genetic polymorphism or artificial manipulation. Biologically active variants of the protoporphyrinogen oxidase of the present invention will have at least about 88%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99% or more sequence identity with the entire amino acid sequence of protoporphyrinogen oxidase as determined by sequence alignment programs and parameters. Biologically active variants of the proteins of the present invention may differ from the proteins of the present invention by only 1 to 15 amino acid residues, only 1 to 10 amino acid residues, such as 6 to 10, only 5, only 4, 3, 2, or just 1 amino acid residue.
[0115] In one embodiment, the nucleotide sequence encoding the protoporphyrinogen oxidase of the present invention or a variant thereof that retains protoporphyrinogen oxidase activity can be stacked with any combination of nucleotide sequences of interest to produce a plant having a desired trait. The term "trait" refers to a phenotypic trait derived from a particular sequence or group of sequences. For example, the amino acid / polynucleotide encoding the protoporphyrinogen oxidase of the present invention or a variant thereof that retains protoporphyrinogen oxidase activity may be stacked with any other nucleotide encoding a polypeptide conferring a desired trait. Desirable traits include, but are not limited to, resistance to diseases, insects and herbicides, tolerance to heat and drought, shortening of the period to crop maturity, improvement of industrial processes for converting, for example, starch or biomass into fermentable sugars, and improvement of agronomic qualities such as, for example, high oil and protein contents.
[0116] In addition to PPO-tolerant crops, it is well known to those skilled in the art that the advantages of combining two or more modes of action in improving the spectrum of weeds to be controlled and / or controlling naturally more tolerant or resistant weed species can also be extended to chemicals that enable herbicide tolerance in crops by artificial methods (either transgenic or non-transgenic). In fact, the traits encoding the following resistance factors can be stacked alone or in multiple combinations to provide the ability to effectively control or prevent changes in weeds against herbicides. The above resistance factors include glyphosate resistance factors (such as EPSPS, GOX, and GAT from resistant plants or bacteria), glufosinate resistance factors (such as PAT and Bar), herbicide resistance factors against acetolactate synthase (ALS) inhibitors (such as resistance genes for chemicals such as imidazolinones, sulfonylureas, triazolopyrimidines, sulfonated anilines, pyrimidinylthio-benzoic acids, for example, AHAS, Csrl, and SurA), phenoxyauxin herbicide resistance factors (such as aryloxyalkanoate dioxygenase-12 (AAD-12)), dicamba herbicide resistance factors (such as dicamba monooxygenase (DMO)), bromoxynil resistance factors (such as Bxn), phytoene desaturase (PDS) inhibitor resistance factors, herbicide resistance factors against photosystem II inhibitors (such as psbA), herbicide resistance factors against photosystem I inhibitors, herbicide resistance factors against 4-hydroxyphenylpyruvate dioxygenase (HPPD) inhibitors (such as PPO-1), phenylurea herbicide resistance factors (such as CYP76B1), and dichloromethoxybenzoic acid degrading enzymes.
[0117] Glyphosate is widely used because it controls a very broad spectrum of broadleaf and grassy weed species. However, repeated use of glyphosate in the application to glyphosate-tolerant crops and non-crops has caused (and continues to cause) weeds to change to naturally more tolerant species or glyphosate-resistant biotypes. In most herbicide resistance management programs, it has been proposed to use effective amounts of tank-mixed herbicides as a means of delaying the emergence of resistant weeds, said herbicides being those that control the same species but have different modes of action. By stacking a gene encoding protoporphyrinogen oxidase of the present invention with a glyphosate tolerance trait (and / or other herbicide tolerance traits), selective use of glyphosate herbicides and PPO-inhibiting herbicides (such as oxyfluorfen, sulfufenacil, and flumioxazin) in the same glyphosate-tolerant crops is enabled, thereby achieving control of glyphosate-resistant weed species (broadleaf weed species controlled by one or more PPO-inhibiting herbicides). These herbicides can be applied simultaneously as a tank mixture containing two or more herbicides with different modes of action, or in a single herbicide composition by separate sequential applications (e.g., pre-planting, or pre-emergence or post-emergence) (at application intervals ranging from 2 hours to 3 months). Alternatively, the application of these herbicides can be carried out by combining any number of herbicides representative of each applicable compound category at any time (from 7 months after crop planting to the time of crop harvest (or, for a single herbicide, at the shortest interval during the pre-harvest interval)).
[0118] In the control of broadleaf weeds, flexibility is very important in terms of the application timing, the application rate of a single herbicide, and the ability to control stubborn or resistant weeds. The application range of glyphosate in crops stacked with the glyphosate resistance gene / the gene encoding the protoporphyrinogen oxidase of the present invention can be from 250 to 2500 g ae / ha. The application range of PPO-inhibiting herbicide(s) can be from 10 to 1000 g ai / ha. The optimal combination of timing for these applications depends on specific conditions, species, and the environment.
[0119] Herbicide formulations (e.g., ester, acid or salt formulations, or soluble concentrates, emulsifiable concentrates or soluble liquids), and tank mix additives (e.g., adjuvants or compatibilizers) can significantly affect the weed control of a given herbicide, or the weed control of a combination of one or more herbicides. Any chemical combination of the aforementioned herbicides is within the scope of the present invention.
[0120] Also, the gene encoding the protoporphyrinogen oxidase of the present invention, alone or stacked with other traits of herbicide-resistant crops, can be stacked with one or more other input traits (e.g., insect resistance, fungal resistance, or stress tolerance, etc.) or output traits (e.g., increased yield, improved oil content, improved fiber quality, etc.). Therefore, using the present invention, a complete agricultural solution can be provided to improve the quality of crops with the ability to flexibly and economically control any number of agricultural pests.
[0121] The stacked combinations described above can be produced by any method, including but not limited to, crossing plants by conventional or TopCross methodologies, or genetic transformation. When stacking sequences by genetically transforming a plant, the polynucleotide sequences of interest can be combined at any time and in any order. For example, a transgenic plant containing one or more desired traits can be used as a target, and additional traits can be introduced by subsequent transformation. The traits can be provided by any combination of polynucleotides of interest in any combination of transformation cassettes and introduced simultaneously with a co-transformation protocol. For example, when two sequences are introduced, they can be included in separate transformation cassettes (trans) or in the same transformation cassette (cis). Expression of these sequences can be driven by the same promoter or different promoters. In some cases, it may be desirable to introduce a transformation cassette that suppresses the expression of the polynucleotide of interest. This can be combined with any combination of other suppression or overexpression cassettes to produce the desired combination of traits in the plant. Furthermore, it has been recognized that site-specific recombination systems can be used to stack polynucleotide sequences at desired genomic locations.
[0122] The gene encoding protoporphyrinogen oxidase according to the present invention has higher tolerance to PPO-inhibiting herbicides, which is an important basis for the potential of herbicide-tolerant crops and selectable marker traits.
[0123] As used herein, the term "expression cassette" means a nucleic acid molecule capable of directing the expression of a particular polynucleotide sequence in a suitable host cell, comprising a promoter operably linked to the polynucleotide sequence of interest (i.e., a polynucleotide encoding protoporphyrinogen oxidase of the present invention or a mutant protein retaining protoporphyrinogen oxidase activity, alone or in combination with one or more additional nucleic acid molecules encoding polypeptides conferring desirable traits), wherein the polynucleotide sequence of interest is operably linked to a termination signal. The coding region usually codes for the protein of interest, but may also code for a functional RNA of interest, such as antisense RNA or non-translated RNA, in either the sense or antisense direction. The expression cassette containing the polynucleotide sequence of interest may be chimeric, meaning that at least one of its components is heterologous to at least one of the other components. The expression cassette may also be of natural origin, but is usually obtained in recombinant form useful for heterologous expression. However, usually the expression cassette is heterologous to the host, i.e., the particular DNA sequence of the expression cassette must not occur naturally in the host cell but must be introduced into the new host cell by a transformation event. The expression of the polynucleotide sequence in the expression cassette may be under the control of a constitutive promoter or an inducible promoter that initiates transcription only when the host cell is exposed to some specific external stimulus. Furthermore, the promoter may also be specific for a particular tissue or organ or developmental stage.
[0124] The present invention encompasses the transformation of plants using an expression cassette capable of expressing a polynucleotide of interest (i.e., a polynucleotide encoding the protoporphyrinogen oxidase of the present invention or encoding a mutant protein thereof that retains protoporphyrinogen oxidase activity, which is either alone or in combination with one or more additional nucleic acid molecules encoding a polypeptide conferring a desired trait). The expression cassette will include, in the 5'-3' direction of transcription, a region for initiation of transcription and translation (i.e., a promoter) and a polynucleotide open reading frame. Optionally, the expression cassette may include a region for termination of transcription and translation (i.e., a termination region) that is functional in plants. In some embodiments, the expression cassette includes a selectable marker gene that allows for the selection of stable transformants. The expression construct of the present invention may also include a leader sequence and / or a sequence that allows for inducible expression of the polynucleotide of interest.
[0125] The regulatory sequences of the expression construct are effectively linked to the polynucleotide of interest. The regulatory sequences in the present invention include, but are not limited to, regulatory sequences such as a promoter operably linked to a gene encoding protoporphyrinogen oxidase, a transit peptide, a terminator, an enhancer, a leader sequence, an intron, etc.
[0126] The promoter is a plant-expressive promoter. The "plant-expressive promoter" refers to a promoter that ensures the expression of a coding sequence linked to the promoter in plant cells. The plant-expressive promoter can be a constitutive promoter. Examples of promoters that direct constitutive expression in plants include, but are not limited to, the 35S promoter derived from cauliflower mosaic virus, the maize Ubi promoter, the rice GOS2 gene promoter, etc. Alternatively, the plant-expressive promoter can be a tissue-specific promoter. A tissue-specific promoter, that is, in some tissues such as green tissues, at a higher level (measurable by conventional RNA tests) than other tissues of the plant, is a promoter that directs the expression of the coding sequence. For example, there is the PEP carboxylase promoter. Alternatively, the plant-expressive promoter can be a wound-inducible promoter. A wound-inducible promoter, or a promoter that directs a wound-inducible expression pattern, means that when a plant is subjected to a wound caused by a mechanical factor or insect biting, the expression of the coding sequence under the regulation of the promoter is significantly improved compared to normal growth conditions. Examples of wound-inducible promoters include, but are not limited to, the promoters of the protease inhibitor genes (pin I and pin II) of potato and tomato, and the protease inhibitor gene (MPI) of maize.
[0127] The transport peptide (also known as a secretion signal sequence or targeting sequence) directs the gene transfer product to a specific organelle or cell compartment. In the case of a receptor protein, the transport peptide can be heterologous. For example, there are those that target chloroplasts using a sequence encoding a chloroplast transport peptide, or those that target the endoplasmic reticulum using the "KDEL" retention sequence, or those that target vacuoles using the CTPP of the wheat lectin gene.
[0128] The leader sequences include, but are not limited to, small RNA virus leader sequences such as the EMCV leader sequence (the 5' non-coding region of encephalomyocarditis virus), the potato virus Y group leader sequence such as the MDMV (Maize Dwarf Mosaic Virus) leader sequence, the human immunoglobulin heavy chain binding protein (BiP), the untranslated leader sequence of the coat protein mRNA of alfalfa mosaic virus (AMV RNA4), and the tobacco mosaic virus (TMV) leader sequence.
[0129] The enhancers include, but are not limited to, the cauliflower mosaic virus (CaMV) enhancer, the figwort mosaic virus (FMV) enhancer, the carnation etched ring virus (CERV) enhancer, the cassava vein mosaic virus (CsVMV) enhancer, the mirabilis mosaic virus (MMV) enhancer, the cestrum yellow leaf curling virus (CmYLCV) enhancer, the cotton leaf curl Multan virus (CLCuMV) enhancer, the commelina yellow mottle virus (CoYMV) enhancer, and the peanut chlorotic streak caulimovirus (PCLSV) enhancer.
[0130] When used in monocotyledonous plants, the intron includes, but is not limited to, the maize hsp70 intron, the maize ubiquitin intron, the Adh intron 1, the sucrose synthase intron, or the rice Act1 intron. When used in dicotyledonous plants, the intron includes, but is not limited to, the CAT-1 intron, the pKANNIBAL intron, the PIV2 intron, and the "super ubiquitin" intron.
[0131] The terminator can be an appropriate polyadenylation signal sequence that functions in plants. Appropriate polyadenylation signal sequences include, but are not limited to, the polyadenylation signal sequence derived from the nopaline synthetase (NOS) gene of Agrobacterium tumefaciens, the polyadenylation signal sequence derived from the protease inhibitor II (pinII) gene, the polyadenylation signal sequence derived from the pea ssRUBISCO E9 gene, and the polyadenylation signal sequence derived from the α-tubulin gene.
[0132] As used herein, "operatively linked" refers to the joining of nucleic acid sequences such that one nucleic acid sequence enables the provision of a necessary function to the sequence to which it is linked. By "operatively linking" in the present invention, a promoter can be linked to a target sequence, and as a result, the transcription of the target sequence is controlled and regulated by the promoter. When the target sequence encodes a protein and the expression of the protein is desired, "operatively linked" means that the promoter is linked to the sequence in such a way that the resulting transcript is effectively translated. When the linkage of the promoter to the coding sequence is a transcriptional fusion and the encoded protein is expressed, such a linkage is made such that the first translation initiation codon of the resulting transcript is the start codon of the coding sequence. Alternatively, when the linkage of the promoter to the coding sequence is a translational fusion and the encoded protein is expressed, such a linkage is made such that the first translation initiation codon contained in the 5' untranslated sequence is in-frame with the translational open reading frame encoding the resulting translation product and the desired protein. Nucleic acid sequences that can be "operatively linked" include, but are not limited to, sequences that provide gene expression functions (i.e., gene expression elements such as promoters, 5' untranslated regions, introns, protein coding regions, 3' untranslated regions, polyadenylation sites, and / or transcription terminators), sequences that provide DNA transfer and / or integration functions (i.e., T-DNA border sequences, site-specific recombinase recognition sites, and integrase recognition sites), sequences that provide selectable functions (i.e., antibiotic resistance markers and biosynthetic genes), sequences that provide marker scoring functions, sequences that assist in sequence manipulation in vitro or in vivo (i.e., polylinker sequences and site-specific recombination sequences), and sequences that provide replication functions (i.e., bacterial origins of replication, self-replicating sequences, and centromere sequences).
[0133] The genome of a plant, plant tissue or plant cell in the present invention refers to any genetic material in the plant, plant tissue or plant cell, and includes the genomes of the nucleus, plastid and mitochondrion.
[0134] As used herein, the terms "plant part" or "plant tissue" include plant cells, plant protoplasts, plant cell tissue cultures from which plants can be regenerated, plant calli, plant aggregates, and plant cells that are intact in a plant or a part of a plant. Examples of plant parts include embryos, pollen, ovules, seeds, leaves, flowers, branches, fruits, grains, ears, tubers, husks, stems, roots, root tips, anthers, etc.
[0135] The mutant PPO protein of the present invention can be applied to various types of plants. Dicotyledonous plants include, but are not limited to, alfalfa, bean, cauliflower, cabbage, carrot, celery, cotton, cucumber, eggplant, lettuce, melon, pea, pepper, zucchini, radish, rape, spinach, soybean, pumpkin, tomato, Arabidopsis thaliana, peanut, or watermelon. Preferably, the dicotyledonous plants refer to cucumber, soybean, Arabidopsis thaliana, tobacco, cotton, rape. Monocotyledonous plants include, but are not limited to, corn, rice, sorghum, wheat, barley, rye, millet, sugarcane, triticale, or Miscanthus. Preferably, the monocotyledonous plants refer to corn, rice, sorghum, wheat, barley, millet, sugarcane, or triticale.
[0136] As used herein, the term "plant transformation" means cloning a nucleic acid molecule encoding a herbicide resistance or tolerance of the protoporphyrinogen oxidase of the present invention alone or in combination with one or more additional nucleic acid molecules encoding a polypeptide conferring a desired trait into an expression system and then transforming a plant cell. The receptor and target expression cassette of the present invention can be introduced into plant cells by a plurality of techniques recognized in the art. For example, the term "introduction" in the context of a polynucleotide, which is a nucleotide construct of interest, is intended to mean the presentation of the polynucleotide to a plant in such a manner that the polynucleotide reaches inside the cell of the plant. When two or more polynucleotides are introduced, these polynucleotides can be assembled as part of a single nucleotide construct or as separate nucleotide constructs and can be placed in the same or different transformation vectors. Thus, these polynucleotides can be introduced into the target host cell in a single transformation event, in separate transformation events, or, for example, as part of a breeding protocol in a plant. The method of the present invention does not depend on a specific method for introducing one or more polynucleotides into a plant and depends only on the (one or more) polynucleotides reaching inside at least one cell of the plant. Methods for introducing one or more polynucleotides into a plant are known in the art and include, but are not limited to, transient transformation methods, stable transformation methods, and virus-mediated methods or genome editing techniques.
[0137] The term "stable transformation" means that a foreign gene is introduced into the genome of a plant and stably integrated into the genome of that plant or any subsequent generation of that plant, and as a result, the foreign gene is stably inherited.
[0138] The term "transient transformation" means that a nucleic acid molecule or protein is introduced into a plant cell and functions, but is not integrated into the genome of the plant, and as a result, the foreign gene is not stably inherited.
[0139] "Genome editing technology" refers to the technology used to modify the genome, which can accurately manipulate the genomic sequence to achieve operations such as site-directed gene mutations, insertions, and deletions. Currently, the genome editing technologies mainly include homing endonuclease (HE), zinc-finger nuclease (ZFN), transcription activator-like effector nuclease (TALEN), and CRISPR (Clustered regulatory interspaced short palindromic repeat) technology.
[0140] A number of transformation vectors available for plant transformation are known to those skilled in the art, and the genes related to the present invention can be used in combination with any such vector. The choice of vector depends on the preferred transformation technique and the target species for transformation. For some target species, different antibiotic or herbicide selection markers may be preferred. Selection markers commonly used in transformation include the nptII gene that confers resistance to kanamycin and related antibiotics or herbicides (published in Bevan et al., Nature 304:184-187 (1983)); the pat gene and bar gene that confer resistance to the herbicide glufosinate (also called phosphinothricin) (see White et al., Nucl. Acids Res 18:1062 (1990), Spencer et al., Theor. Appl. Genet. 79:625-631 (1990), and U.S. Patent Nos. 5,561,236 and 5,276,268); the hph gene that confers resistance to the antibiotic hygromycin (Blochinger & Diggelmann, Mol. Cell. Biol. 4:2929-2931); the dhfr gene that confers resistance to methotrexate (Bourouis et al., EMBO J. 2(7):1099-1104 (1983)); the EPSPS gene that confers resistance to glyphosate (U.S. Patent Nos. 4,940,935 and 5,188,642); the glyphosate N-acetyltransferase (GAT) gene that also confers resistance to glyphosate (Castle et al. (2004) Science, 304:1151-1154; U.S. Patent Application Publication Nos. 20070004912, 20050246798, and 20050060767); and the mannose-6-phosphate isomerase gene that provides the ability to metabolize mannose (U.S. Patent Nos. 5,767,378 and 5,994,629). Methods for plant regeneration are also well known in the art.For example, Ti plasmid vectors are used for the delivery of foreign DNA, as are direct DNA uptake, liposomes, electroporation, microinjection, and particle guns.
[0141] In the present invention, a weed refers to a plant that competes with a genetically modified plant cultivated in farmland.
[0142] The terms "control" and / or "prevention" in the present invention refer to minimizing the occurrence of weeds and / or stopping the growth of weeds by applying an effective amount of a PPO-inhibiting herbicide directly to the farmland at least (e.g., by spraying). At the same time, the cultivated genetically modified plants should be morphologically normal and can be cultivated by conventional methods for product consumption and / or production. And preferably, the cultivated plants have less plant damage and / or higher plant yields compared to non-genetically modified wild-type plants. Reduction of plant damage includes, but is not limited to, improvement of stem resistance and / or increase in grain weight. Protoporphyrinogen oxidase independently has an "control" and / or "prevention" effect on weeds, and the effect will not be reduced and / or disappear due to the presence of other substances that can "control" and / or "prevent" weeds. Specifically, when any tissue of a genetically modified plant (including the gene encoding the protoporphyrinogen oxidase of the present invention) has and / or produces protoporphyrinogen oxidase and / or another substance that can control weeds, simultaneously and / or separately, the "control" and / or "prevention" effect of protoporphyrinogen oxidase on weeds will not be affected by the presence of that other substance, nor will the "control" and / or "prevention" effect be completely and / or partially achieved by that other substance without regard to protoporphyrinogen oxidase.
[0143] The "plant propagules" in the present invention include, but are not limited to, plant sexual propagules and plant vegetative propagules. Examples of plant sexual propagules include, but are not limited to, plant seeds. Vegetative propagules refer to the vegetative organs or specific tissues of plants that can produce new plants under ex vivo conditions. Examples of vegetative organs or specific tissues include, but are not limited to, roots, stems, and leaves. For example, plants using roots such as strawberries and sweet potatoes as vegetative propagules; plants using stems such as sugarcane and potatoes (tubers) as vegetative propagules; and plants using leaves such as aloe and begonia as vegetative propagules.
[0144] According to the present invention, novel herbicide resistance traits can be imparted to plants, and no adverse effects on traits (such as yield) are observed. The plants in the present invention can exhibit resistance to, for example, 2×, 3×, 4×, or 5× the general application level of at least one herbicide tested. Improvements in these resistance levels are within the scope of the present invention. For example, various techniques known in the art can be subjected to predictable optimization and further development in order to increase the expression of a given gene.
[0145] The present invention provides the use of protoporphyrinogen oxidase having the following advantages.
[0146] 1. Broad resistance to herbicides. The present invention first discloses that protoporphyrinogen oxidases PPO1 to PPO14 exhibit higher resistance to PPO-inhibiting herbicides, and therefore there is a prospect of wide application in plants.
[0147] 2. Strong resistance to herbicides. Protoporphyrinogen oxidases PPO1 to PPO14 disclosed by the present invention exhibit strong resistance to PPO-inhibiting herbicides. Almost all of protoporphyrinogen oxidases PPO1 to PPO14 exhibit high resistance to oxyfluorfen, sulfufenacil, and flumioxazin at 4 times the field concentration, and sulfentrazone at 2 times the field concentration.
[0148] 3. Yield hardly affected. The tolerance of plants to herbicides is directly correlated with the yield of the plants. Highly resistant plants are not affected by herbicides, and the herbicides do not affect the yield of the plants. However, the yields of moderately resistant and low-resistant plants are much lower than those of highly resistant plants.
[0149] The technical solution of the present invention will be further described in detail with reference to the following drawings and examples.
Brief Description of the Drawings
[0150]
Figure 1
Figure 2
Figure 3
Figure 4
Modes for Carrying Out the Invention
[0151] The technical solution regarding the use of the protoporphyrinogen oxidase of the present invention will be further described with reference to the following examples.
Examples
[0152] Obtaining and verifying transgenic Arabidopsis thaliana plants 1. Obtaining the gene encoding protoporphyrinogen oxidase The amino acid sequences of the microbial protoporphyrinogen oxidases PPO1, PPO2, PPO3, PPO4, PPO5, PPO6, PPO7, PPO8, PPO9, PPO10, PPO11, PPO12, PPO13 and PPO14 are described as SEQ ID NOs: 1 to 14 in the Sequence Listing. The nucleotide sequences of PPO1 to PPO14 encode the corresponding protoporphyrinogen oxidases PPO1 to PPO14 and are described as SEQ ID NOs: 15 to 28 in the Sequence Listing. The nucleotide sequences of PPO1A to PPO14A encode the corresponding protoporphyrinogen oxidases PPO1 to PPO14 and are obtained based on the Arabidopsis thaliana / soybean common codon usage bias and are described as SEQ ID NOs: 29 to 42 in the Sequence Listing. The nucleotide sequences of PPO1B, PPO6B and PPO12B encode the corresponding protoporphyrinogen oxidases PPO1, PPO6 and PPO12 and are obtained based on the maize common codon usage bias and are described as SEQ ID NOs: 62 to 64 in the Sequence Listing.
[0153] The amino acid sequence of the Escherichia coli protoporphyrinogen oxidase PPO-EC is described as SEQ ID NO: 43 in the Sequence Listing. The PPO-EC nucleotide sequence encodes the corresponding Escherichia coli protoporphyrinogen oxidase PPO-EC and is described as SEQ ID NO: 44 in the Sequence Listing. The PPO-ECA nucleotide sequence encodes the corresponding Escherichia coli protoporphyrinogen oxidase PPO-EC and is obtained based on the Arabidopsis thaliana / soybean common codon usage bias and is described as SEQ ID NO: 45 in the Sequence Listing.
[0154] The amino acid sequence of Arabidopsis thaliana protoporphyrinogen oxidase PPO-AT is described as SEQ ID NO: 46 in the Sequence Listing. The PPO-AT nucleotide sequence encodes the corresponding Arabidopsis thaliana protoporphyrinogen oxidase PPO-AT and is described as SEQ ID NO: 47 in the Sequence Listing. The PPO-ATA nucleotide sequence encodes the corresponding Arabidopsis thaliana protoporphyrinogen oxidase PPO-AT and is obtained based on the Arabidopsis thaliana / soybean common codon usage bias, and is described as SEQ ID NO: 48 in the Sequence Listing.
[0155] The amino acid sequence of Arsenophonus protoporphyrinogen oxidase PPO-AP is described as SEQ ID NO: 65 in the Sequence Listing. The PPO-AP nucleotide sequence encodes the corresponding Arsenophonus protoporphyrinogen oxidase PPO-AP and is described as SEQ ID NO: 66 in the Sequence Listing. The PPO-APA nucleotide sequence encodes the corresponding Arsenophonus protoporphyrinogen oxidase PPO-AP and is obtained based on the Arabidopsis thaliana / soybean common codon usage bias, and is described as SEQ ID NO: 67 in the Sequence Listing. The PPO-APB nucleotide sequence encodes the corresponding Arsenophonus protoporphyrinogen oxidase PPO-AP and is obtained based on the maize common codon usage bias, and is described as SEQ ID NO: 68 in the Sequence Listing.
[0156] 2. Synthesis of the aforementioned nucleotide sequences The 5'-ends and 3'-ends of the PPO1A to PPO14A nucleotide sequences, the PPO-ECA nucleotide sequence, the PPO-ATA nucleotide sequence, and the PPO-APA nucleotide sequence (SEQ ID NOs: 29 to 42, SEQ ID NO: 45, SEQ ID NO: 48, and SEQ ID NO: 67) were each ligated to Universal Adapter Primer 1.
[0157] Universal Adapter Primer 1 for 5'-end: 5'-taagaaggagatatacatatg-3' described in SEQ ID NO: 49 of the Sequence Listing 3'-end universal adapter primer 1: 5'-gtggtggtggtgctcgag-3' as described in SEQ ID NO: 50 of the Sequence Listing 3. Construction of a recombinant expression vector containing the PPO1A to PPO14A nucleotide sequences, PPO-ECA nucleotide sequence, PPO-ATA nucleotide sequence, and PPO-APA nucleotide sequence for Arabidopsis thaliana The plant expression vector DBNBC-01 was double-digested with restriction enzymes Spe I and Asc I to linearize it. The digestion products were purified to obtain the linearized DBNBC-01 expression vector backbone (vector backbone: pCAMBIA2301 (available from CAMBIA)), and then a recombination reaction was carried out with the PP01A nucleotide sequence (SEQ ID NO: 29) ligated to the universal adapter primer 1 according to the procedure in the instruction manual of the Takara In-Fusion products seamless connection kit (Clontech, California, USA, CAT: 121416) to construct the recombinant expression vector DBN12337 having the schematic structure shown in Fig. 1 (Spec: spectinomycin gene, RB: right border, eFMV: enhancer of Figwort mosaic virus (SEQ ID NO: 51), prBrCBP: promoter of the Brassica eukaryotic elongation factor gene 1α (Tsf1) (SEQ ID NO: 52), spAtCTP2: Arabidopsis thaliana chloroplast transit peptide (SEQ ID NO: 53), EPSPS: 5-enolpyruvylshikimate-3-phosphate synthase gene (SEQ ID NO: 54), tPsE9: terminator of the pea RbcS gene (SEQ ID NO: 55), prAtUbi10: promoter of the Arabidopsis thaliana ubiquitin 10 gene (SEQ ID NO: 56), spAtCLP1: transit peptide of the white or pale green chloroplasts of Arabidopsis thaliana (SEQ ID NO: 57), PPO1A: PPO1A nucleotide sequence (SEQ ID NO: 29), tNos: terminator of a nopaline synthase gene (SEQ ID NO: 58), pr35S: cauliflower mosaic virus 35S promoter (SEQ ID NO: 59), cPAT: phosphinothricin acetyltransferase gene (SEQ ID NO: 60), t35S: cauliflower mosaic virus 35S terminator (SEQ ID NO: 61), LB: left border).
[0158] E. coli T1 competent cells were transformed with the recombinant expression vector DBN12337 by using the heat shock method under the following heat shock conditions. 50 μL of E. coli T1 competent cells and 10 μL of plasmid DNA (recombinant expression vector DBN12337) were incubated in a water bath at 42°C for 30 seconds, followed by shaking culture at 37°C for 1 hour (a shaker was used at a rotation speed of 100 rpm). Then, under the condition of a temperature of 37°C, the cells were cultured on an LB solid plate containing 50 mg / L of spectinomycin (tryptone 10 g / L, yeast extract 5 g / L, NaCl 10 g / L, and agar 15 mg / L; adjusted to pH 7.5 with NaOH) for 12 hours. White bacterial colonies were picked out and cultured overnight in an LB liquid medium (tryptone 10 g / L, yeast extract 5 g / L, NaCl 10 g / L, and spectinomycin 50 mg / L; adjusted to pH 7.5 with NaOH) at a temperature of 37°C. The plasmid in the cells was extracted by the alkaline method. The bacterial solution was centrifuged at a rotation speed of 12,000 rpm for 1 minute, the supernatant was removed, and the precipitated mycelium was suspended in 100 μL of ice-precooled Solution I (25 mM Tris-HCl, 10 mM ethylenediaminetetraacetic acid (EDTA), and 50 mM glucose, pH 8.0). 200 μL of freshly prepared Solution II (0.2 M NaOH, 1% sodium dodecyl sulfate (SDS)) was added, the tube was inverted 4 times to mix, and it was placed on ice for 3 - 5 minutes. 150 μL of ice-cold Solution III (3 M potassium acetate, 5 M acetic acid) was added, immediately mixed uniformly, and placed on ice for 5 - 10 minutes. The mixture was centrifuged at 4°C and a rotation speed of 12,000 rpm for 5 minutes, 2 volumes of absolute ethanol were added to the supernatant, mixed uniformly, and left at room temperature for 5 minutes. The mixture was centrifuged at 4°C and a rotation speed of 12,000 rpm for 5 minutes, the supernatant was discarded, the precipitate was washed with 70% (V / V) ethanol, and then air-dried. 30 μL of TE (10 mM Tris-HCl and 1 mM EDTA, pH 8.0) containing RNase (20 μg / mL) was added to dissolve the precipitate. The obtained product was incubated in a water bath at 37°C for 30 minutes to digest RNA and stored at -20°C for use.The extracted plasmid was identified by nucleotide sequencing. As a result, it was shown that the nucleotide sequence between the SpeI site and the AscI site of the recombinant expression vector DBN12337 is the one described in SEQ ID NO: 29 of the Sequence Listing, that is, the PPO1A nucleotide sequence.
[0159] According to the above method for constructing the recombinant expression vector DBN12337, the PPO2A~PPO14A nucleotide sequences, the PPO-ECA nucleotide sequence, the PPO-ATA nucleotide sequence, and the PPO-APA nucleotide sequence ligated to the Universal Adapter Primer 1 were each subjected to a recombination reaction with the linearized DBNBC-01 expression vector backbone to sequentially construct recombinant expression vectors DBN12338~DBN12353. It was confirmed by nucleotide sequencing that each of the above nucleotide sequences was correctly inserted into the recombinant expression vectors DBN12338~DBN12353.
[0160] According to the above method for constructing the recombinant expression vector DBN12337, a recombinant expression vector DBN12337N was constructed as a control, and its structure is shown in Figure 2 (Spec: spectinomycin gene, RB: right border, eFMV: 34S enhancer of sesame mosaic virus (SEQ ID NO: 51), prBrCBP: promoter of Brassica eukaryotic elongation factor gene 1α (Tsf1) (SEQ ID NO: 52), spAtCTP2: Arabidopsis thaliana chloroplast transit peptide (SEQ ID NO: 53), EPSPS: 5-enolpyruvylshikimate-3-phosphate synthase gene (SEQ ID NO: 54), tPsE9: terminator of pea RbcS gene (SEQ ID NO: 55), pr35S: cauliflower mosaic virus 35S promoter (SEQ ID NO: 59), cPAT: phosphinothricin acetyltransferase gene (SEQ ID NO: 60), t35S: cauliflower mosaic virus 35S terminator (SEQ ID NO: 61), LB: left border).
[0161] 4. Transformation of Agrobacterium using the recombinant expression vector for Arabidopsis thaliana The correctly constructed recombinant expression vectors DBN12337 - DBN12350, DBN12352, DBN12353, and the above - mentioned control recombinant expression vector DBN12337N were each transformed into Agrobacterium GV3101 using the liquid nitrogen method under the following transformation conditions. 100 μL of Agrobacterium GV3101 and 3 μL of plasmid DNA (recombinant expression vectors DBN12337 - DBN12350, DBN12352, DBN12353, and DBN12337N) were placed in liquid nitrogen for 10 minutes and then immersed in warm water at 37°C for 10 minutes. The transformed Agrobacterium GV3101 was inoculated into an LB tube and cultured for 2 hours under the conditions of a temperature of 28°C and a rotation speed of 200 rpm, spread on an LB solid plate containing 50 mg / L of rifampicin and 50 mg / L of spectinomycin to grow positive single clones, a single clone was taken out and cultured, and its plasmid was extracted. The extracted plasmid was identified by the nucleotide sequencing method. As a result, it was shown that the structures of the recombinant expression vectors DBN12337 - DBN12350, DBN12352, DBN12353, and DBN12337N were completely correct.
[0162] 5. Obtaining Transgenic Arabidopsis Plants Seeds of wild - type Arabidopsis were suspended in a 0.1% (w / v) agarose solution. To ensure synchronous seed germination, the suspended seeds were stored at 4°C for 2 days to meet the dormancy requirement. Vermiculite was mixed with horse manure compost soil, and the mixture was watered from the bottom and drained for 24 hours. The above - pretreated seeds were sown in the mixed soil and covered with a humidity - maintaining cover for 7 days. The seeds were germinated and cultivated in a greenhouse under the conditions of a constant temperature (22°C), a constant humidity (40 - 50%), and a light intensity of 120 - 150 μmol / m 2 s -1 s of long - day light conditions (16 - hour light period / 8 - hour dark period). Initially, the plants were watered with Hoagland nutrient solution and then with deionized water to keep the soil moist but not waterlogged.
[0163] Arabidopsis thaliana was transformed by the floral dip method. Colonies of Agrobacterium collected were inoculated into 15 - 30 mL of one or more precultures of LB culture medium containing spectinomycin (50 mg / L) and rifampicin (10 mg / L). The precultures were incubated at a temperature of 28°C and a rotation speed of 220 rpm with shaking at a constant speed overnight. Using each preculture, two 500 - mL cultures of YEP culture medium containing spectinomycin (50 mg / L) and rifampicin (10 mg / L) were inoculated, and the cultures were incubated at 28°C overnight with continuous shaking. Centrifugation at a rotation speed of approximately 4,000 rpm was performed for 20 minutes at room temperature to precipitate the cells, and the resulting supernatant was discarded. The cell precipitate was gently resuspended in 500 mL of an osmotic culture medium containing 1 / 2×MS salts / B5 vitamins, 10% (w / v) sucrose, 0.044 μM benzylaminopurine (10 μL / L (DMSO stock solution of 1 mg / mL)), and 300 μL / L of Silwet L - 77. Arabidopsis plants approximately 1 - month - old were dipped into the osmotic culture medium containing the resuspended cells for 15 seconds to ensure that the most recent inflorescence was immersed. Then, the Arabidopsis plants were placed horizontally and covered, and kept in a moist state in the dark for 24 hours. The Arabidopsis plants were usually cultivated at 22°C under a photoperiod of 16 - hour light period / 8 - hour dark period. Seeds were harvested after approximately 4 weeks.
[0164] The newly harvested (PPO1A - PPO14A nucleotide sequences, PPO - ATA nucleotide sequence, PPO - APA nucleotide sequence, and control vector DBN12337N) T1 seeds were dried at room temperature for 7 days. These seeds were sown on germination disks of 26.5 cm×51 cm, with 200 mg of T1 seeds (about 10,000 seeds) per disk. Here, the seeds were pre - suspended in distilled water and stored at 4°C for 2 days to meet the dormancy requirement in order to ensure synchronous seed germination.
[0165] Vermiculite was mixed with horse manure compost soil, and the mixture was watered from the bottom and drained by gravity. Using a pipette, the pretreated seeds were evenly sown in the mixed soil and covered with a moisture-retaining cover for 4 - 5 days. To select the initial transformants, the cover was removed 1 day before spraying and applying glufosinate (used for the selection of the co-transformed PAT gene) after germination.
[0166] A 0.2% solution of Liberty herbicide (glufosinate 200 g ai / L) was sprayed onto T1 plants using a Devilbiss compressed air nozzle at a spraying rate of 10 mL / disk (703 L / ha) at 7 days after planting (DAP) and 11 DAP (cotyledon stage and 2 - 4 leaf stage, respectively), providing an effective amount of 280 g ai / ha of glufosinate per application. Four to seven days after the final spraying, the surviving plants (actively growing plants) were identified and transplanted into 7 cm × 7 cm square pots made of horse manure compost soil and vermiculite (3 - 5 plants / disk). The transplanted plants were covered with a moisture-retaining cover for 3 - 4 days and placed in an incubator at 22°C or directly transferred to the above greenhouse. Then, at least 1 day before testing the ability of the PPO1A - PPO14A nucleotide sequences, PPO-ATA nucleotide sequence, PPO-APA nucleotide sequence, and control vector to confer resistance to PPO-inhibiting herbicides, the plants were planted in the greenhouse (22 ± 5°C, 50 ± 30% RH, 14-hour light period: 10-hour dark period, minimum 500 μE / m 2 s -1 of natural light + supplementary light).
[0167] 6. Detection of Herbicide Tolerance in Transgenic Arabidopsis Plants The transformed Arabidopsis T1 plants were first selected using glufosinate herbicide. Arabidopsis T1 plants (PPO1A) into which the PPO1A nucleotide sequence was introduced, Arabidopsis T1 plants (PPO2A) into which the PPO2A nucleotide sequence was introduced, Arabidopsis T1 plants (PPO3A) into which the PPO3A nucleotide sequence was introduced, Arabidopsis T1 plants (PPO4A) into which the PPO4A nucleotide sequence was introduced, Arabidopsis T1 plants (PPO5A) into which the PPO5A nucleotide sequence was introduced, Arabidopsis T1 plants (PPO6A) into which the PPO6A nucleotide sequence was introduced, Arabidopsis T1 plants (PPO7A) into which the PPO7A nucleotide sequence was introduced, Arabidopsis T1 plants (PPO8A) into which the PPO8A nucleotide sequence was introduced, Arabidopsis T1 plants (PPO9A) into which the PPO9A nucleotide sequence was introduced, Arabidopsis T1 plants (PPO10A) into which the PPO10A nucleotide sequence was introduced, Arabidopsis T1 plants (PPO11A) into which the PPO11A nucleotide sequence was introduced, Arabidopsis T1 plants (PPO12A) into which the PPO12A nucleotide sequence was introduced, Arabidopsis T1 plants (PPO13A) into which the PPO13A nucleotide sequence was introduced, Arabidopsis T1 plants (PPO14A) into which the PPO14A nucleotide sequence was introduced, Arabidopsis T1 plants (PPO-ATA) into which the PPO-ATA nucleotide sequence was introduced, Arabidopsis T1 plants (PPO-APA) into which the PPO-APA nucleotide sequence was introduced, Arabidopsis T1 plants (control vector) into which the control vector was introduced, and wild-type Arabidopsis plants (CK) (24 plants for each genotype) were treated with oxyfluorfen at three concentrations (180 g ai / ha (1-fold the field concentration, 1×), 720 g ai / ha (4-fold the field concentration, 4×), and 0 g ai / ha (water, 0×)), sulfentrazone at three concentrations (25 g ai / ha (1-fold the field concentration, 1×), 100 g ai / ha (4-fold the field concentration, 4×), and 0 g ai / ha (water, 0×)), and flumioxazin at three concentrations (60 g ai / ha (1-fold the field concentration, 1×), 240 g ai / ha (4-fold the field concentration, 4×), and 0 gai / ha (water, 0×)), and sulfentrazone was sprayed at three concentrations (450 g ai / ha (1 times the field concentration, 1×), 900 g ai / ha (2 times the field concentration, 2×), and 0 g ai / ha (water, 0×)) to determine the tolerance of Arabidopsis thaliana to the herbicide. Seven days after spraying (7 DAT), the damage level of each plant caused by the herbicide was evaluated according to the average (%) of the plant damage level (average (%) of the plant damage level = area of damaged leaves / total leaf area × 100%). That is, the grade of pesticide damage: grade 0 means that the growth state of the plant is essentially the same as that sprayed with the blank solvent (water), grade 1 means that the average of the plant damage level is less than 10%, grade 2 means that the average of the plant damage level is more than 10%, and grade 3 means that the average of the plant damage level is 100%. Plants with a growth state corresponding to grade 0 and grade 1 are classified as highly resistant plants, those corresponding to grade 2 are classified as low-resistant plants, and those corresponding to grade 3 are classified as non-resistant plants. The experimental results are shown in Tables 1 - 4.
[0168]
Table 1
[0169] In Arabidopsis thaliana, 180 g ai / ha of the oxyfluorfen herbicide is an effective amount to distinguish between sensitive plants and plants with an average level of resistance. From the results in Table 1, it can be seen that compared with the control vector and CK, all genotypes PPO1A - PPO14A showed high resistance to oxyfluorfen at different concentrations, while both genotypes PPO - APA and PPO - ATA basically showed no tolerance.
[0170]
Table 2
[0171] In Arabidopsis thaliana, 25 g ai / ha of sulfentrazone herbicide is the effective amount for discriminating between susceptible plants and plants with an average level of resistance. The following can be understood from the results in Table 2. Compared with the control vector and CK, (1) all genotypes PPO1A to PPO14A showed high resistance to sulfentrazone at a field concentration of 1-fold, but neither genotype PPO-APA nor PPO-ATA showed resistance; (2) all genotypes PPO1A to PPO7A and PPO9A to PPO14A showed high resistance to sulfentrazone at a field concentration of 4-fold (in genotype PPO8A, only 2 strains showed moderate or low resistance, and the other 22 strains all showed high resistance), but neither genotype PPO-APA nor PPO-ATA showed resistance.
[0172]
Table 3
[0173] In Arabidopsis thaliana, 60 g ai / ha of flumioxazin herbicide is the effective amount for discriminating between susceptible plants and plants with an average level of resistance. From the results in Table 3, it can be seen that compared with the control vector and CK, all genotypes PPO1A to PPO14A showed high resistance to flumioxazin at different concentrations, but neither genotype PPO-APA nor PPO-ATA basically showed resistance.
[0174]
Table 4
[0175] In Arabidopsis thaliana, 450 g ai / ha of sulfentrazone herbicide is the effective amount for discriminating between susceptible plants and plants with an average level of resistance. From the results in Table 4, it can be seen that compared with the control vector and CK, all genotypes PPO1A to PPO14A showed high resistance to sulfentrazone at different concentrations, but neither genotype PPO-APA nor PPO-ATA showed resistance.
Example
[0176] Obtaining and Verification of Transgenic Soybean Plants 1. Transformation of Agrobacterium with Recombinant Expression Vectors The recombinant expression vectors DBN12337, DBN12342, DBN12348, DBN12351, and DBN12353 (each containing the PPO1A nucleotide sequence, PPO6A nucleotide sequence, PPO12A nucleotide sequence, PPO-ECA nucleotide sequence, and PPO-APA nucleotide sequence, respectively), and the control recombinant expression vector DBN12337N described in item 3 of Example 1 were each transformed into Agrobacterium tumefaciens LBA4404 (Invitrogen, Chicago, USA, CAT: 18313-015) using the liquid nitrogen method under the following transformation conditions. 100 μL of Agrobacterium tumefaciens LBA4404 and 3 μL of plasmid DNA (recombinant expression vector) were placed in liquid nitrogen for 10 minutes and then immersed in warm water at 37°C for 10 minutes. The transformed Agrobacterium tumefaciens LBA4404 was inoculated into an LB tube and cultured for 2 hours under the conditions of a temperature of 28°C and a rotation speed of 200 rpm, and then spread on an LB plate containing 50 mg / L of rifampicin and 50 mg / L of spectinomycin to grow positive single clones. Single clones were collected and cultured, and their plasmids were extracted. The extracted plasmids were identified by nucleotide sequencing. As a result, it was shown that the structures of the recombinant expression vectors DBN12337, DBN12342, DBN12348, DBN12351, DBN12353, and the control recombinant expression vector DBN12337N were completely correct.
[0177] 2. Obtaining Transgenic Soybean Plants According to the conventional Agrobacterium infection method, the cotyledon node tissue of aseptically cultured soybean variety Zhonghuang13 was co-cultured with the Agrobacterium described in item 1 of this example to introduce the T-DNAs of recombinant expression vectors DBN12337, DBN12342, DBN12348, DBN12351, DBN12353, and the control recombinant expression vector DBN12337N into the soybean chromosome (the T-DNA contains the 34S enhancer sequence of the sesame mosaic virus, the promoter sequence of the Arabidopsis thaliana eukaryotic elongation factor gene 1α (Tsf1), the Arabidopsis thaliana chloroplast transit peptide sequence, the 5-enolpyruvylshikimate-3-phosphate synthase gene, the terminator sequence of the pea RbcS gene, the promoter sequence of the Arabidopsis thaliana ubiquitin 10 gene, the transit peptide of the white or light green chloroplast of Arabidopsis thaliana, the PPO1A nucleotide sequence, the PPO6A nucleotide sequence, the PPO12 nucleotide sequence, the PPO-ECA nucleotide sequence, the PPO-APA nucleotide sequence, the terminator sequence of the nopaline synthase gene, the 35S promoter sequence of the cauliflower mosaic virus, the phosphinothricin-N-acetyltransferase gene, and the 35S terminator sequence of the cauliflower mosaic virus). As a result, soybean plants into which the PPO1A nucleotide sequence was introduced, soybean plants into which the PPO6A nucleotide sequence was introduced, soybean plants into which the PPO12A nucleotide sequence was introduced, soybean plants into which the PPO-ECA nucleotide sequence was introduced, soybean plants into which the PPO-APA nucleotide sequence was introduced, and soybean plants into which the control vector DBN12337N was introduced were obtained respectively.
[0178] In Agrobacterium-mediated soybean transformation, briefly, soybean mature seeds were germinated in a soybean germination medium (3.1 g / L of B5 salts, B5 vitamins, 20 g / L of sucrose, and 8 g / L of agar, pH 5.6), and then cultured under the conditions of a temperature of 25 ± 1°C and a photoperiod (light period / dark period) of 16 hours / 8 hours. Four to six days after germination, aseptic soybean seedlings with swollen cotyledon nodes in light green were collected, the hypocotyls 3 to 4 millimeters below the cotyledon nodes were cut off, the hypocotyls were longitudinally cut, and the apical buds, lateral buds, and seed roots were removed. A wound was made on the cotyledon nodes using the back of a scalpel, and an Agrobacterium suspension was brought into contact with the wounded cotyledon node tissue. Here, Agrobacterium can transfer the PPO1A nucleotide sequence, PPO6A nucleotide sequence, PPO12A nucleotide sequence, PPO-ECA nucleotide sequence, or PPO-APA nucleotide sequence to the wounded cotyledon node tissue, respectively (Step 1: Infection step). In this step, preferably, the Agrobacterium suspension (OD 660= 0.5 to 0.8, the cotyledonary node tissue was immersed in an infection medium (MS salts 2.15 g / L, B5 vitamins, sucrose 20 g / L, glucose 10 g / L, acetosyringone (AS) 40 mg / L, 2-morpholine ethanesulfonic acid (MES) 4 g / L, and zeatin (ZT) 2 mg / L, pH 5.3) to initiate inoculation. The cotyledonary tissue was co-cultured with Agrobacterium for a certain period (3 days) (Step 2: Co-cultivation step). Preferably, after the infection step, the cotyledonary tissue was cultured on a solid medium (MS salts 4.3 g / L, B5 vitamins, sucrose 20 g / L, glucose 10 g / L, MES 4 g / L, ZT 2 mg / L, agar 8 g / L; pH 5.6). After this co-cultivation stage, an optional "recovery" step can be provided, in which at least one antibiotic (cephalosporin 150 - 250 mg / L) is added to inhibit the growth of Agrobacterium, and a recovery medium (B5 salts 3.1 g / L, B5 vitamins, MES 1 g / L, sucrose 30 g / L, ZT 2 mg / L, agar 8 g / L, cephalosporin 150 mg / L, glutamic acid 100 mg / L, and aspartic acid 100 mg / L, pH 5.6) without a selection agent for plant transformants is used (Step 3: Recovery step). Preferably, the tissue mass regenerated from the cotyledonary node was cultured on a solid medium containing an antibiotic but not a selection agent to eliminate Agrobacterium and provide a recovery period for infected cells. Then, the tissue mass regenerated from the cotyledonary node was cultured in a medium containing a selection agent (glyphosate) to select for growing transformed calli (Step 4: Selection step). Preferably, transformed cells were selectively grown by culturing the tissue mass regenerated from the cotyledonary node in a screening solid medium containing a selection agent (B5 salts 3.1 g / L, vitamin B5, MES 1 g / L, sucrose 30 g / L, 6-benzyladenine (6-BAP) 1 mg / L, agar 8 g / L, cephalosporin 150 mg / L, glutamic acid 100 mg / L, aspartic acid 100 mg / L, and N-(phosphonomethyl)glycine 0.25 mol / L, pH 5.6). Subsequently, plants were regenerated from the transformed cells (Step 5: Regeneration step).The tissue clumps regenerated from cotyledon nodes that had been grown in a medium containing a selection agent were cultured on a solid medium (B5 differentiation medium and B5 rooting medium) to regenerate plants.
[0179] The screened resistant tissues were transferred to B5 differentiation medium (B5 salts 3.1 g / L, B5 vitamins, MES 1 g / L, sucrose 30 g / L, ZT 1 mg / L, agar 8 g / L, cephalosporin 150 mg / L, glutamic acid 50 mg / L, aspartic acid 50 mg / L, gibberellin 1 mg / L, auxin 1 mg / L, and N-(phosphonomethyl)glycine 0.25 mol / L, pH 5.6) and cultured at 25°C for differentiation. The differentiated seedlings were transferred to B5 rooting medium (B5 salts 3.1 g / L, B5 vitamins, MES 1 g / L, sucrose 30 g / L, agar 8 g / L, cephalosporin 150 mg / L, indole-3-butyric acid (IBA) 1 mg / L), cultured in the rooting medium at 25°C until they reached a height of about 10 cm, and then transferred to a glass greenhouse for fruiting. In the greenhouse, the plants were cultured at 26°C for 16 hours and then at 20°C for 8 hours a day.
[0180] 3. Verification of Transgenic Soybean Plants Using TaqMan Leaves of approximately 100 mg were collected as samples from soybean plants into which the PPO1A nucleotide sequence had been introduced, soybean plants into which the PPO6A nucleotide sequence had been introduced, soybean plants into which the PPO12A nucleotide sequence had been introduced, soybean plants into which the PPO-ECA nucleotide sequence had been introduced, soybean plants into which the PPO-APA nucleotide sequence had been introduced, and soybean plants into which the control vector DBN12337N had been introduced. Genomic DNA of the above soybean plants was extracted using Qiagen's DNeasy Plant Maxi Kit, and the copy number of the PPO gene was determined by detecting the copy number of the EPSPS gene by Taqman probe fluorescence quantitative PCR method. At the same time, wild-type soybean plants were used as controls, and detection and analysis were performed according to the above method. The experiment was repeated 3 times, and the average value was calculated.
[0181] The specific method for detecting the copy number of the EPSPS gene is as follows.
[0182] Step 11: 100 mg of leaves were collected from soybean plants into which the PPO1A nucleotide sequence was introduced, soybean plants into which the PPO6A nucleotide sequence was introduced, soybean plants into which the PPO12A nucleotide sequence was introduced, soybean plants into which the PPO-ECA nucleotide sequence was introduced, soybean plants into which the PPO-APA nucleotide sequence was introduced, soybean plants into which the control vector DBN12337N was introduced, and wild-type soybean plants, ground in a mortar using liquid nitrogen to obtain a homogenate, and each sample was repeated 3 times.
[0183] Step 12: Using Qiagen's DNeasy Plant Mini Kit, the genomic DNA of the above samples was extracted by a specific method described in the product manual.
[0184] Step 13: The concentration of the genomic DNA of the above samples was detected using a NanoDrop 2000 (Thermo Scientific).
[0185] Step 14: The concentration of the genomic DNA of each of the above samples was adjusted to the same value in the range from 80 to 100 ng / μL.
[0186] Step 15: The copy number of the samples was determined using the Taqman probe fluorescence quantitative PCR method. Here, a sample with a known and determined copy number was used as a standard, and a sample of wild-type soybean plants was used as a control. Each sample was repeated 3 times and averaged. The sequences of the fluorescence quantitative PCR primers and probes are as follows.
[0187] For the detection of the EPSPS gene sequence, the following primers and probes were used.
[0188] Primer 1: ctggaaggcgaggacgtcatcaata described in SEQ ID NO: 69 of the Sequence Listing Primer 2: tggcggcattgccgaaatcgag as described in SEQ ID NO: 70 of the Sequence Listing Probe 1: atgcaggcgatgggcgcccgcatccgta as described in SEQ ID NO: 71 of the Sequence Listing PCR reaction system: JumpStart™ Taq ReadyMix™ (Sigma) 10 μL 50× Primer / Probe mixture 1 μL Genomic DNA 3 μL Water (ddH2O) 6 μL The 50× Primer / Probe mixture contained 45 μL of each primer at a concentration of 1 mM, 50 μL of the probe at a concentration of 100 μM, and 860 μL of 1× TE buffer, and was placed in an amber tube and stored at 4°C.
[0189] PCR reaction conditions: Step Temperature Time 21 95°C 5 minutes 22 95°C 30 seconds 23 60°C 1 minute 24 Return to step 22 and repeat 40 times The data was analyzed using the software SDS 2.3 (Applied Biosystems).
[0190] By analyzing the experimental results regarding the copy number of the EPSPS gene, it was further demonstrated that all of the PPO1A nucleotide sequence, PPO6A nucleotide sequence, PPO12A nucleotide sequence, PPO-ECA nucleotide sequence, PPO-APA nucleotide sequence, and the control vector DBN12337N were integrated into the chromosomes of the detected soybean plants, and all of the soybean plants into which the PPO1A nucleotide sequence was introduced, the soybean plants into which the PPO6A nucleotide sequence was introduced, the soybean plants into which the PPO12A nucleotide sequence was introduced, the soybean plants into which the PPO-ECA nucleotide sequence was introduced, the soybean plants into which the PPO-APA nucleotide sequence was introduced, and the soybean plants into which the control vector DBN12337N was introduced ultimately became single-copy transgenic soybean plants.
[0191] 4. Detection of Herbicide Tolerance in Transgenic Soybean Plants Soybean plants into which the PPO1A nucleotide sequence was introduced (PPO1A), soybean plants into which the PPO6A nucleotide sequence was introduced (PPO6A), soybean plants into which the PPO12A nucleotide sequence was introduced (PPO12A), soybean plants into which the PPO-ECA nucleotide sequence was introduced (PPO-ECA), soybean plants into which the PPO-APA nucleotide sequence was introduced (PPO-APA), soybean plants into which the control vector was introduced (control vector), and wild-type soybean plants (CK) (16 plants for each genotype) were collected (18 days after sowing), and sulfentrazone was applied at three concentrations (50 g ai / ha (2 times the field concentration, 2×), 100 g ai / ha (4 times the field concentration, 4×), and 0 g ai / ha (water, 0×)), oxyfluorfen was applied at three concentrations (360 g ai / ha (2 times the field concentration, 2×), 720 g ai / ha (4 times the field concentration, 4×), and 0 g ai / ha (water, 0×)), and flumioxazin was applied at three concentrations (120 g ai / ha (2 times the field concentration, 2×), 240 g ai / ha (4 times the field concentration, 4×), and 0 g ai / ha (water, 0×)) to determine the tolerance of the soybean plants to the herbicides. According to the above method in item 6 of Example 1, 7 days after application (7DAT), the damage level of each plant caused by the herbicide was evaluated according to the average (%) of the plant damage level. The experimental results are shown in Tables 5 to 7.
[0192]
Table 5
[0193] The following can be understood from the results in Table 5. (1) Compared with the control vector and CK, the genotypes PPO1A, PPO6A, PPO12A, and PPO-ECA were able to show resistance to sulfenylphenaxyl to varying degrees, but PPO-APA basically did not show resistance. (2) When treated with sulfenylphenaxyl at twice the field concentration, the damage levels of the genotypes PPO1A, PPO6A, and PPO12A were evaluated as grade 0, but for the genotype PPO-ECA, about 44% of the plants were evaluated as grade 1. (3) All of the genotypes PPO1A, PPO6A, and PPO12A showed high resistance to sulfenylphenaxyl at four times the field concentration, but for the genotype PPO-ECA, about 31% of the plants showed moderate or low resistance.
[0194]
Table 6
[0195] The following can be understood from the results in Table 6. Compared with the control vector and CK, (1) all of the genotypes PPO1A, PPO6A, PPO12A, and PPO-ECA showed high resistance to oxyfluorfen at twice the field concentration, but for the genotype PPO-APA, 50% of the plants did not show resistance. (2) All of the genotypes PPO1A, PPO6A, PPO12A, and PPO-ECA showed high resistance to oxyfluorfen at four times the field concentration, but the genotype PPO-APA did not show resistance.
[0196]
Table 7
[0197] From the results in Table 7, it can be seen that compared with the control vector and CK, all of the genotypes PPO1A, PPO6A, PPO12A, and PPO-ECA showed high resistance to flumioxazin at different concentrations, but the genotype PPO-APA did not show flumioxazin resistance.
Example
[0198] Obtaining and Verification of Transgenic Maize Plants 1. Construction of Recombinant Expression Vectors of Maize Containing PPO Genes The PPO1B nucleotide sequence, PPO6B nucleotide sequence, and PPO12B nucleotide sequence described in Item 1 of Example 1, and the 5'- and 3'-ends of the PPO-APB nucleotide sequence were each ligated to the following Universal Adapter Primer 2.
[0199] Universal Adapter Primer 2 for 5'-end: 5'-ccaagcggccaagctta-3' as described in SEQ ID NO: 72 of the Sequence Listing Universal Adapter Primer 2 for 3'-end: 5'-tgtttgaacgatcggcgcgcc-3 as described in SEQ ID NO: 73 of the Sequence Listing The plant expression vector DBNBC-02 was double digested with restriction enzymes Spe I and Asc I to linearize the plant expression vector. The digestion products were purified to obtain the linearized DBNBC-02 expression vector backbone (vector backbone: pCAMBIA2301 (available from CAMBIA)), and then, according to the procedures in the instructions of Takara In-Fusion products seamless connection kit (Clontech, California, USA, CAT: 121416), a recombination reaction was carried out with the PPO1B nucleotide sequence ligated to the Universal Adapter Primer 2 to construct a recombinant expression vector BN12354 having the vector structure shown in Figure 3 (Spec: spectinomycin gene, RB: right border, prOsAct1: rice actin 1 promoter (SEQ ID NO: 74), cPAT: phosphinothricin-N-acetyltransferase gene (SEQ ID NO: 60), t35S: cauliflower mosaic virus 35S terminator (SEQ ID NO: 61), pr35S-06: cauliflower mosaic virus 35S promoter (SEQ ID NO: 75), iZmHSP70: maize heat shock 70 kDa protein intron (SEQ ID NO: 76), spAtCLP1: Arabidopsis thaliana white or light green chloroplast transit peptide (SEQ ID NO: 57), PPO1B: PPO1B nucleotide sequence (SEQ ID NO: 62), tNos: nopaline synthase gene terminator (SEQ ID NO: 58), prZmUbi: Zea mays ubiquitin 1 gene promoter (SEQ ID NO: 77), PMI: phosphomannose isomerase gene (SEQ ID NO: 78), tNos: terminator of a nopaline synthase gene SEQ ID NO: 58), LB: left border).
[0200] According to the heat shock method described in item 3 of Example 1, Escherichia coli T1 competent cells were transformed, and the plasmid in the cells was extracted by the alkaline method. The extracted plasmid was identified by the nucleotide sequencing method. As a result, it was shown that the recombinant expression vector DBN12354 contains the nucleotide sequence described in SEQ ID NO: 62 of the Sequence Listing, that is, the PPO1B nucleotide sequence.
[0201] According to the above method for constructing the recombinant expression vector DBN12354, the PPO6B nucleotide sequence, PPO12B nucleotide sequence, and PPO-APB nucleotide sequence ligated to the Universal Adapter Primer 2 were each subjected to a recombination reaction with the linearized DBNBC-02 expression vector backbone to construct recombinant expression vectors DBN12355 to DBN12357 in sequence. By the nucleotide sequencing method, it was confirmed that the PPO6B nucleotide sequence, PPO12B nucleotide sequence, and PPO-APB nucleotide sequence were correctly inserted into the recombinant expression vectors DBN12355 to DBN12357.
[0202] According to the method for constructing the above recombinant expression vector DBN12354, a recombinant expression vector DBN12354N was constructed as a control, and its structure is shown in FIG. 4 (Spec: spectinomycin gene, RB: right border, prOsAct1: rice actin 1 promoter (SEQ ID NO: 74), cPAT: phosphinothricin-N-acetyltransferase gene (SEQ ID NO: 60), t35S: cauliflower mosaic virus 35S terminator (SEQ ID NO: 61), prZmUbi: maize ubiquitin 1 gene promoter (SEQ ID NO: 77), PMI: phosphomannose isomerase gene (SEQ ID NO: 78), tNos: terminator of nopaline synthase gene (SEQ ID NO: 58), LB: left border).
[0203] 2. Transformation of Agrobacterium using the recombinant expression vector The correctly constructed recombinant expression vectors DBN12354 to DBN12357, and the above-mentioned control recombinant expression vector DBN12354N were each transformed into Agrobacterium LBA4404 (Invitrogen, Chicago, USA, CAT: 18313-015) using the liquid nitrogen method under the following transformation conditions. 100 μL of Agrobacterium LBA4404 and 3 μL of plasmid DNA (recombinant expression vector) were placed in liquid nitrogen for 10 minutes and then immersed in warm water at 37°C for 10 minutes. The transformed Agrobacterium LBA4404 was inoculated into an LB tube and cultured for 2 hours under the conditions of a temperature of 28°C and a rotation speed of 200 rpm. Then, it was spread on an LB plate containing 50 mg / L of rifampicin and 50 mg / L of spectinomycin to grow positive single clones. The single clones were collected and cultured, and their plasmids were extracted. The extracted plasmids were identified by the nucleotide sequencing method. As a result, it was shown that the structures of the recombinant expression vectors DBN12354 to DBN12357 and the control vector DBN12354N were completely correct.
[0204] 3. Obtaining Transgenic Maize Plants According to the conventionally used Agrobacterium infection method, immature embryos of aseptically cultured maize variety Zong31 (Z31) were co-cultured with the Agrobacterium described in item 2 of this example, and the T-DNAs of the recombinant expression vectors DBN12354 to DBN12357 and the control recombinant expression vector DBN12354N constructed in item 1 of this example were introduced into the maize chromosome (the T-DNA contains rice actin 1 promoter sequence, phosphinothricin N-acetyltransferase gene, cauliflower mosaic virus 35S terminator sequence, cauliflower mosaic virus 35S promoter sequence, maize heat shock 70 kDa protein intron sequence, transport peptide of white or light green chloroplasts of Arabidopsis thaliana, PPO1B nucleotide sequence, PPO6B nucleotide sequence, PPO12B nucleotide sequence, PPO-APB nucleotide sequence, nopaline synthase gene terminator sequence, maize ubiquitin 1 gene promoter sequence, phosphomannose isomerase gene, and terminator sequence of nopaline synthase gene), maize plants into which the PPO1B nucleotide sequence was introduced, maize plants into which the PPO6B nucleotide sequence was introduced, maize plants into which the PPO12B nucleotide sequence was introduced, maize plants into which the PPO-APB nucleotide sequence was introduced, and maize plants into which the control vector DBN12354N was introduced were obtained respectively. On the other hand, wild-type maize plants were used as a control.
[0205] In Agrobacterium-mediated maize transformation, briefly, immature embryos were isolated from maize and contacted with an Agrobacterium suspension. Here, Agrobacterium can transfer the PPO1B nucleotide sequence, PPO6B nucleotide sequence, PPO12B nucleotide sequence, or PPO-APB nucleotide sequence into at least one cell of one of the immature embryos (step 1: infection step). In this step, the Agrobacterium suspension (OD 660= 0.4 - 0.6, the immature embryos were immersed in an infection medium (MS salts 4.3 g / L, N6 vitamins, casein 300 mg / L, sucrose 68.5 g / L, glucose 36 g / L, AS 40 mg / L, 2,4-D 1 mg / L; pH 5.3) to initiate inoculation. The immature embryos were co-cultured with Agrobacterium for a certain period (3 days) (Step 2: Co-cultivation step). Preferably, after the infection step, the immature embryos were cultured on a solid medium (MS salts 4.3 g / L, MS vitamins, casein 300 mg / L, sucrose 20 g / L, glucose 10 g / L, AS 100 mg / L, 2,4-D 1 mg / L, agar 8 g / L; pH 5.8). After the co-cultivation step, a "recovery" step may be provided. In this step, a recovery medium (MS salts 4.3 g / L, MS vitamins, casein 300 mg / L, sucrose 30 g / L, 2,4-D 1 mg / L, phytagel 3 g / L; pH 5.8) containing at least one antibiotic (cephamycin) to inhibit the growth of Agrobacterium and no selection agent for plant transformants was used (Step 3: Recovery step). Preferably, by culturing the immature embryos on a solid medium containing the antibiotic but no selection agent, Agrobacterium was eliminated and a recovery period for infected cells was provided. Then, the inoculated immature embryos were cultured in a medium containing a selection agent (mannose) to select the growing transformed calli (Step 4: Selection step). Preferably, by culturing the immature embryos on a solid selection medium (MS salts 4.3 g / L, MS vitamins, casein 300 mg / L, sucrose 30 g / L, mannose 12.5 g / L, 2,4-D 1 mg / L, phytagel 3 g / L; pH 5.8) containing the selection agent, the transformed cells were selectively grown. Then, the calli were regenerated into plants (Step 5: Regeneration step). Preferably, the calli growing in a medium containing the selection agent were cultured on a solid medium (MS differentiation medium and MS rooting medium) to regenerate plants.
[0206] The resistant calli obtained by screening were transferred to MS differentiation medium (MS salts 4.3 g / L, MS vitamins, casein 300 mg / L, sucrose 30 g / L, 6-benzyladenine 2 mg / L, mannose 5 mg / L, phytagel 3 g / L; pH 5.8) and cultured at 25 °C for differentiation. The differentiated plantlets were transferred to MS rooting medium (MS salts 2.15 g / L, MS vitamins, casein 300 mg / L, sucrose 30 g / L, indole-3-acetic acid 1 mg / L, phytagel 3 g / L; pH 5.8) and cultured at 25 °C. When the height of the plantlets reached about 10 cm, they were transferred to a greenhouse and cultured until fruiting. In the greenhouse, the plants were cultured at 28 °C for 16 hours and then at 20 °C for 8 hours a day.
[0207] 4. Verification of transgenic maize plants using TaqMan According to the method described in item 3 of Example 2 for verifying transgenic soybean plants using TaqMan, maize plants into which the PPO1B nucleotide sequence was introduced, maize plants into which the PPO6B nucleotide sequence was introduced, maize plants into which the PPO12B nucleotide sequence was introduced, maize plants into which the PPO-APB nucleotide sequence was introduced, and maize plants into which the control vector DBN12354N was introduced were detected and analyzed. The copy number of the PPO gene was determined by detecting the copy number of the PMI gene by Taqman probe fluorescence quantitative PCR method. On the other hand, wild-type maize plants were used as a control and detected and analyzed according to the above method. The experiment was repeated 3 times and the average value was calculated.
[0208] The following primers and probes were used for the detection of the PMI gene sequence.
[0209] Primer 3: gctgtaagagcttactgaaaaaattaaca as described in SEQ ID NO: 79 of the sequence listing Primer 4: cgatctgcaggtcgacgg as described in SEQ ID NO: 80 of the sequence listing Probe 2: tctcttgctaagctgggagctcgatcc as described in SEQ ID NO: 81 of the sequence listing By analyzing the experimental results regarding the copy number of the PMI gene, it was further confirmed that the PPO1B nucleotide sequence, PPO6B nucleotide sequence, PPO12B nucleotide sequence, PPO-APB nucleotide sequence, and the control vector DBN12354N were all integrated into the chromosomes of the detected maize plants, and that the maize plants into which the PPO1B nucleotide sequence was introduced, the maize plants into which the PPO6B nucleotide sequence was introduced, the maize plants into which the PPO12B nucleotide sequence was introduced, the maize plants into which the PPO-APB nucleotide sequence was introduced, and the maize plants into which the control vector DBN12354N was introduced all ultimately became single-copy transgenic maize plants.
[0210] 5. Detection of Herbicide Tolerance in Transgenic Maize Plants Maize plants (PPO1B) into which the PPO1B nucleotide sequence was introduced, maize plants (PPO6B) into which the PPO6B nucleotide sequence was introduced, maize plants (PPO12B) into which the PPO12B nucleotide sequence was introduced, maize plants (PPO-APB) into which the PPO-APB nucleotide sequence was introduced, maize plants into which the control vector was introduced (control vector), and wild-type maize plants (CK) (16 plants for each genotype) were collected (18 days after sowing), and sulfentrazone was applied at three concentrations (50 g ai / ha (2 times the field concentration, 2×), 100 g ai / ha (4 times the field concentration, 4×), and 0 g ai / ha (water, 0×)), oxyfluorfen was applied at three concentrations (360 g ai / ha (2 times the field concentration, 2×), 720 g ai / ha (4 times the field concentration, 4×), and 0 g ai / ha (water, 0×)), and flumioxazin was applied at three concentrations (120 g ai / ha (2 times the field concentration, 2×), 240 g ai / ha (4 times the field concentration, 4×), and 0 g ai / ha (water, 0×)) to determine the tolerance of maize plants to herbicides. According to the above method in item 6 of Example 1, 7 days after spraying (7 DAT), the damage level of each plant caused by the herbicide was evaluated as the average (%) of the plant damage level (average (%) of the plant damage level = area of damaged leaves / total leaf area × 100%). The experimental results are shown in Tables 8 to 10.
[0211]
Table 8
[0212] The following can be seen from the results in Table 8. Compared with the control vector and CK, (1) all of the genotypes PPO1B, PPO6B, and PPO12B showed high resistance to sulfentrazone at twice the field concentration, but about 56% of the plants of the genotype PPO-APB did not show tolerance; (2) all of the genotypes PPO1B, PPO6B, and PPO12B showed high resistance to sulfentrazone at four times the field concentration, but the genotype PPO-APB basically did not show tolerance.
[0213]
Table 9
[0214] From the results in Table 9, the following can be seen. Compared with the control vector and CK, (1) all of the genotypes PPO1B, PPO6B, and PPO12B showed high resistance to oxyfluorfen at twice the field concentration, but about 50% of the plants with the genotype PPO-APB did not show resistance; (2) all of the genotypes PPO1B, PPO6B, and PPO12B showed high resistance to oxyfluorfen at four times the field concentration, but the genotype PPO-APB did not show resistance.
[0215]
Table 10
[0216] From the results in Table 10, it can be seen that compared with the control vector and CK, all of the genotypes PPO1B, PPO6B, and PPO12B showed high resistance to flumioxazin at different concentrations, but the genotype PPO-APB basically did not show resistance to flumioxazin.
[0217] In summary, regarding plants, the protoporphyrinogen oxidases PPO1 to PPO14 of the present invention can confer good tolerance to PPO-inhibiting herbicides on Arabidopsis plants. In particular, PPO1, PPO6, and PPO12 can confer good tolerance to PPO-inhibiting herbicides on Arabidopsis, soybean, and corn plants. Thus, the protoporphyrinogen oxidases PPO1 to PPO14 can confer good tolerance to plants. Regarding herbicides, the present invention discloses for the first time that the protoporphyrinogen oxidases PPO1 to PPO14 can confer higher tolerance to PPO-inhibiting herbicides on plants to such an extent that the plants can tolerate oxyfluorfen, saflufenacil, or flumioxazin at least 4 times the field concentration and sulfentrazone at 2 times the field concentration. Therefore, the present invention has the prospect of wide application in plants.
[0218] Finally, it should be noted that all of the above examples are not for limiting the present invention, but are merely used for explaining the embodiments of the present invention. Although the present invention has been described in detail with reference to the preferred embodiments, those skilled in the art should understand that the embodiments of the present invention can be equivalently modified or substituted without departing from the spirit and scope of the technical solution of the present invention.
Claims
**Claim 1** A method for controlling weeds, the method for controlling weeds comprising applying a herbicide containing an effective amount of a PPO-inhibiting herbicide to a field in which at least one genetically modified plant is present, the genetically modified plant comprising in its genome a polynucleotide sequence encoding protoporphyrinogen oxidase, the genetically modified plant having less plant damage and / or more plant yield compared to other plants that do not have the polynucleotide sequence encoding protoporphyrinogen oxidase, and the protoporphyrinogen oxidase having at least 99% sequence identity with an amino acid sequence selected from the group consisting of SEQ ID NOs: 1 to 14. A method for controlling weeds, characterized in that. **Claim 2** The genetically modified plants include monocotyledonous and dicotyledonous plants, and the genetically modified plants are Triticum aestivum, Triticum aestivum, Hordeum vulgare, Setaria italica, Zea mays, Sorghum bicolor, Atriplex patula, Oryza sativa, Nicotiana tabacum, Helianthus annuus, Medicago sativa, Glycine max, Cicer arietinum, Arachis hypogaea, Beta vulgaris, Cucumis sativus, Gossypium hirsutum, Brassica rapa, Solanum tuberosum, Solanum lycopersicum, or Arabidopsis thaliana. The method for controlling weeds according to claim 1, characterized in that. **Claim 3** The PPO-inhibiting herbicide includes PPO-inhibiting herbicides of the types diphenyl ethers, oxadiazonones, N-phenylphthalimides, oxazolinones, phenylpyrazoles, uracils, thiadiazoles, triazolinones, and / or triazinones, and the PPO-inhibiting herbicide includes oxyfluorfen, sulfphenacyl, sulfentrazone, and / or flumioxazin. The method for controlling weeds according to claim 1, characterized in that. **Claim 4** The polynucleotide sequence of the protoporphyrinogen oxidase is a) a polynucleotide sequence encoding an amino acid sequence having at least 99% sequence identity with a sequence selected from SEQ ID NOs: 1 to 14 and not including SEQ ID NOs: 15 to 28, or b) a polynucleotide sequence shown in any one of SEQ ID NOs: 29 to 42 or SEQ ID NOs: 62 to 64 The method for controlling weeds according to any one of claims 1 to 3, characterized in that it comprises. **Claim 5** The method for controlling weeds according to any one of claims 1 to 4, characterized in that the genetically modified plant further comprises at least one second polynucleotide encoding a second herbicide-tolerant protein different from the polynucleotide sequence encoding the protoporphyrinogen oxidase.
6. The method for controlling weeds according to claim 5, characterized in that the second polynucleotide encodes a selectable marker protein, a protein having synthetic activity, a protein having degrading activity, a biotic stress resistance protein, an abiotic stress resistance protein, a male sterility protein, a protein affecting plant yield, and / or a protein affecting plant quality.
7. The method for controlling weeds according to claim 6, characterized in that the second polynucleotide encodes 5-enolpyruvylshikimate-3-phosphate synthase, glyphosate oxidoreductase, glyphosate-N-acetyltransferase, glyphosate decarboxylase, glufosinate acetyltransferase, alpha-ketoglutarate-dependent dioxygenase, dicamba monooxygenase, 4-hydroxyphenylpyruvate dioxygenase, acetolactate synthase, and / or a cytochrome-like protein.
8. The method for controlling weeds according to any one of claims 1 to 7, characterized in that the herbicide containing an effective amount of a PPO-inhibiting herbicide further comprises a glyphosate herbicide, a glufosinate herbicide, an auxin-like herbicide, a weed control agent, a pre-emergence selective herbicide, and / or a post-emergence selective herbicide.
9. A planting combination for suppressing weed growth, wherein the planting combination comprises a PPO-inhibiting herbicide and at least one genetically modified plant, and the herbicide containing an effective amount of the PPO-inhibiting herbicide is applied to a field where the at least one genetically modified plant is present. The genetically modified plant contains a polynucleotide sequence encoding protoporphyrinogen oxidase in its genome. Compared with other plants that do not have the polynucleotide sequence encoding protoporphyrinogen oxidase, the genetically modified plant has less plant damage and / or higher plant yield. The protoporphyrinogen oxidase has at least 99% sequence identity with an amino acid sequence selected from the group consisting of SEQ ID NOs: 1 to 14.
10. The genetically modified plants include monocotyledonous and dicotyledonous plants, and the genetically modified plants are Triticum aestivum, Triticum durum, Triticum aestivum, Setaria italica, Zea mays, Sorghum bicolor, Spartina alterniflora, Oryza sativa, Nicotiana tabacum, Helianthus annuus, Medicago sativa, Glycine max, Cicer arietinum, Arachis hypogaea, Beta vulgaris, Cucumis sativus, Gossypium hirsutum, Brassica napus, Solanum tuberosum, Solanum lycopersicum, or Arabidopsis thaliana. The planting combination for suppressing weed growth according to claim 9, characterized in that it is.
11. The PPO-inhibiting herbicide includes PPO-inhibiting herbicides of the types of diphenyl ethers, oxadiazonones, N-phenylphthalimides, oxazolinones, phenylpyrazoles, uracils, thiadiazoles, triazolinones and / or triazinones. The PPO-inhibiting herbicide includes oxyfluorfen, safufenacil, sulfentrazone, and / or flumioxazin. The planting combination for suppressing weed growth according to claim 9, characterized in that it is.
12. A planting combination for suppressing weed growth according to claim 9, wherein the polynucleotide sequence of the protoporphyrinogen oxidase is (a) a polynucleotide sequence encoding an amino acid sequence having at least 99% sequence identity with a sequence selected from SEQ ID NOs: 1 to 14 and not including SEQ ID NOs: 15 to 28, or (b) the polynucleotide sequence shown in any one of SEQ ID NOs: 29 to 42 or SEQ ID NOs: 62 to 64 A planting combination, characterized by including.
13. The transgenic plant further comprises at least one second polynucleotide encoding a second herbicide tolerance protein different from the polynucleotide sequence encoding the protoporphyrinogen oxidase, and is characterized in that it is a planting combination for suppressing weed growth according to any one of claims 9 to 12.
14. The planting combination for suppressing weed growth according to claim 13, wherein the second polynucleotide encodes a selective marker protein, a protein having synthetic activity, a protein having degrading activity, a biotic stress resistance protein, an abiotic stress resistance protein, a male sterility protein, a protein affecting plant yield, and / or a protein affecting plant quality.
15. The planting combination for suppressing weed growth according to claim 14, wherein the second polynucleotide encodes 5-enolpyruvylshikimate-3-phosphate synthase, glyphosate oxidoreductase, glyphosate-N-acetyltransferase, glyphosate decarboxylase, glufosinate acetyltransferase, alpha-ketoglutarate-dependent dioxygenase, dicamba monooxygenase, 4-hydroxyphenylpyruvate dioxygenase, acetolactate synthase, and / or a cytochrome-like protein.
16. The herbicide containing an effective amount of a PPO-inhibiting herbicide further comprises a glyphosate herbicide, a glufosinate herbicide, an auxin-like herbicide, a weed control agent, a pre-emergence selective herbicide, and / or a post-emergence selective herbicide, and is characterized in that it is a planting combination for suppressing weed growth according to any one of claims 9 to 15.
17. A method for producing a plant resistant to a PPO-inhibiting herbicide, the method comprising introducing into the genome of the plant a polynucleotide sequence encoding protoporphyrinogen oxidase, wherein when the herbicide containing an effective amount of the PPO-inhibiting herbicide is applied to at least the field where the plant is present, the plant has less plant damage and / or more plant yield compared to other plants that do not have the polynucleotide sequence encoding protoporphyrinogen oxidase, and the protoporphyrinogen oxidase has at least 99% sequence identity with an amino acid sequence selected from the group consisting of SEQ ID NOs: 1 to 14.
18. The plant includes monocotyledonous plants and dicotyledonous plants, and the plant is selected from the group consisting of Triticum turgidum, Triticum aestivum, Hordeum vulgare, Setaria italica, Zea mays, Sorghum bicolor, Chenopodium album, Oryza sativa, Nicotiana tabacum, Helianthus annuus, Medicago sativa, Glycine max, Vigna radiata, Arachis hypogaea, Beta vulgaris, Cucumis sativus, Gossypium hirsutum, Brassica rapa, Solanum tuberosum, Solanum lycopersicum, or Arabidopsis thaliana. A method for producing a plant resistant to a PPO-inhibiting herbicide according to claim 17, characterized in that.
19. The PPO-inhibiting herbicide includes PPO-inhibiting herbicides of the types of diphenyl ethers, oxadiazolones, N-phenylphthalimides, oxazolinones, phenylpyrazoles, uracils, thiadiazoles, triazolinones and / or triazinones, and the PPO-inhibiting herbicide includes oxyfluorfen, sulfentrazone, and / or flumioxazin. A method for producing a plant resistant to a PPO-inhibiting herbicide according to claim 17, characterized in that.
20. A method for cultivating a plant resistant to a PPO-inhibiting herbicide, the cultivation method comprising: Planting at least one plant propagule, the plant propagule including in its genome a polynucleotide sequence encoding protoporphyrinogen oxidase, and the protoporphyrinogen oxidase having at least 99% sequence identity with an amino acid sequence selected from the group consisting of SEQ ID NOs: 1 to 14; Growing the plant propagule into a plant; Applying the herbicide containing an effective amount of a PPO-inhibiting herbicide to a field containing at least the plant, and harvesting the plant with less plant damage and / or higher plant yield as compared to other plants that do not have the polynucleotide sequence encoding the protoporphyrinogen oxidase A cultivation method, characterized by comprising the above steps. **Claim 21** The plant includes monocotyledonous and dicotyledonous plants, and the plant is Avena fatua, Triticum aestivum, Hordeum vulgare, Setaria italica, Zea mays, Sorghum bicolor, Chenopodium album, Oryza sativa, Nicotiana tabacum, Helianthus annuus, Medicago sativa, Glycine max, Vigna radiata, Arachis hypogaea, Beta vulgaris, Cucumis sativus, Gossypium hirsutum, Brassica rapa, Solanum tuberosum, Solanum lycopersicum, or Arabidopsis thaliana. A method for cultivating a plant resistant to the PPO-inhibiting herbicide according to claim 20, characterized in that it is as described above. **Claim 22** The PPO-inhibiting herbicide includes PPO-inhibiting herbicides of the types of diphenyl ethers, oxadiazolones, N-phenylphthalimides, oxazolinones, phenylpyrazoles, uracils, thiadiazoles, triazolinones, and / or triazinones. The PPO-inhibiting herbicide includes oxyfluorfen, sulfufenacil, sulfentrazone, and / or flumioxazin. A method for cultivating a plant resistant to the PPO-inhibiting herbicide according to claim 20, characterized in that it is as described above. **Claim 23** A method for protecting a plant from damage caused by a PPO-inhibiting herbicide or conferring resistance to the PPO-inhibiting herbicide to the plant, which includes introducing a polynucleotide sequence encoding protoporphyrinogen oxidase into the genome of the plant. Compared with other plants that do not have the polynucleotide sequence encoding the protoporphyrinogen oxidase, the plant has less plant damage and / or higher plant yield. The protoporphyrinogen oxidase has at least 99% sequence identity with an amino acid sequence selected from the group consisting of SEQ ID NOs: 1-14. A method, characterized in that it is as described above. **Claim 24** The transgenic plant includes monocotyledonous plants and dicotyledonous plants, and the transgenic plant is characterized by being Triticum monococcum, Triticum aestivum, Hordeum vulgare, Panicum miliaceum, Zea mays, Sorghum bicolor, Chenopodium album, Oryza sativa, Nicotiana tabacum, Helianthus annuus, Medicago sativa, Glycine max, Arachis hypogaea, Beta vulgaris, Cucumis sativus, Gossypium hirsutum, Brassica napus, Solanum tuberosum, Solanum lycopersicum, or Arabidopsis thaliana, and is a method for protecting a plant from damage caused by the PPO-inhibiting herbicide according to claim 23 or for conferring tolerance of the plant to the PPO-inhibiting herbicide.
25. The PPO-inhibiting herbicide includes PPO-inhibiting herbicides of the types of diphenyl ethers, oxadiazolones, N-phenylphthalimides, oxazolinones, phenylpyrazoles, uracils, thiadiazoles, triazolinones and / or triazinones, and the PPO-inhibiting herbicide is characterized by including oxyfluorfen, sulfufenacil, sulfentrazone, and / or flumioxazin, and is a method for protecting a plant from damage caused by the PPO-inhibiting herbicide according to claim 23 or for conferring tolerance of the plant to the PPO-inhibiting herbicide.
26. The use of protoporphyrinogen oxidase for conferring tolerance of a plant to a PPO-inhibiting herbicide, wherein the protoporphyrinogen oxidase has at least 99% sequence identity with an amino acid sequence selected from the group consisting of SEQ ID NOs: 1 to 14.
27. The use of protoporphyrinogen oxidase for conferring tolerance of a plant to a PPO-inhibiting herbicide according to claim 26, which includes applying a herbicide containing an effective amount of a PPO-inhibiting herbicide to a field in which there is at least one transgenic plant, wherein the transgenic plant includes a polynucleotide sequence encoding protoporphyrinogen oxidase in its genome, and the transgenic plant has less plant damage and / or more plant yield compared to other plants without the polynucleotide sequence encoding protoporphyrinogen oxidase.
28. The plant includes monocotyledonous plants and dicotyledonous plants, and the plant is characterized by being Triticum turgidum, Triticum aestivum, Hordeum vulgare, Pennisetum glaucum, Zea mays, Sorghum bicolor, Spartina anglica, Oryza sativa, Nicotiana tabacum, Helianthus annuus, Medicago sativa, Glycine max, Arachis hypogaea, Beta vulgaris, Cucumis sativus, Gossypium hirsutum, Brassica napus, Solanum tuberosum, Solanum lycopersicum, or Arabidopsis thaliana. The use of protoporphyrinogen oxidase for conferring resistance to the PPO-inhibiting herbicide according to claim 26 to a plant.
29. The PPO-inhibiting herbicide includes PPO-inhibiting herbicides of the types of diphenyl ethers, oxadiazonones, N-phenylphthalimides, oxazolinones, phenylpyrazoles, uracils, thiadiazoles, triazolinones, and / or triazinones. The PPO-inhibiting herbicide is characterized by including oxyfluorfen, sulfofenacil, sulfentrazone, and / or flumioxazin. The use of protoporphyrinogen oxidase for conferring resistance to the PPO-inhibiting herbicide according to claim 26 to a plant.
30. The polynucleotide sequence of the protoporphyrinogen oxidase is (a) a polynucleotide sequence encoding an amino acid sequence having at least 99% sequence identity with a sequence selected from SEQ ID NOs: 1 to 14 and not including SEQ ID NOs: 15 to 28, or (b) a polynucleotide sequence shown in any one of SEQ ID NOs: 29 to 42 or SEQ ID NOs: 62 to 64 The use of protoporphyrinogen oxidase for conferring resistance to the PPO-inhibiting herbicide according to claim 27 to a plant, characterized by including the above.
Citation Information
Patent Citations
Method for imparting or enhancing herbicide resistance in plants and / or algae using protoporphyrinogen oxidase mutants
JP2018500909A
Methods and Compositions for Herbicide Tolerance in Plants
JP2018527911A
Protoporphyrinogen oxidase variants and compositions and methods for conferring and / or enhancing herbicide tolerance using the same
JP2019533424A