Interleukin-4-induced gene 1 (IL4I1) as a biomarker and its use

IL4I1 is utilized as a biomarker to detect and modulate AHR activation, addressing the lack of effective biomarkers in current technologies and enhancing treatment efficacy for AHR-related conditions like cancer and autoimmune diseases.

JP7712874B2Active Publication Date: 2025-07-24DEUTES KREBSFORSCHUNGSZENT STIFTUNG DES OFFENTLICHEN RECHTS
View PDF 2 Cites 0 Cited by

Patent Information

Application Number
JP2021560638
Authority / Receiving Office
JP · JP
Patent Type
Patents
Current Assignee / Owner
Priority Date
2019-04-10
Filing Date
2020-04-09
Publication Date
2025-07-24
Estimated Expiration
2040-04-09

AI Technical Summary

Technical Problem

Current methods lack effective biomarkers for detecting AHR activation across various cells and tissues, and there is a need for understanding the therapeutic significance of IL4I1-related conditions, particularly in cancer and immune regulation.

Method used

The use of IL4I1 as a biomarker to detect and modulate AHR activation by monitoring changes in its biological state, including expression and activity, through screening and diagnostic methods, and applying modulators to treat AHR-related diseases.

Benefits of technology

IL4I1 serves as a reliable biomarker for AHR activation, enabling effective screening and treatment of conditions such as cancer and autoimmune diseases by identifying modulators that can activate or inhibit AHR, thereby improving treatment outcomes.

✦ Generated by Eureka AI based on patent content.

Smart Images

  • Figure 0007712874000003
    Figure 0007712874000003
  • Figure 0007712874000004
    Figure 0007712874000004
  • Figure 0007712874000005
    Figure 0007712874000005
Patent Text Reader

Abstract

The present invention relates to a newly identified AHR-activating enzyme and its use as a diagnostic and therapeutic marker, for example, for selecting patients for treatment with IL4I1-modulating intervention and monitoring therapeutic response.
Need to check novelty before this filing date? Find Prior Art

Description

Technical Field

[0001] The present invention relates to a newly identified AHR-activating enzyme and its use as a marker in diagnosis and treatment for patient selection and monitoring of treatment response, for example, by IL4I1 modulation intervention.

Background Art

[0002] IL4I1 is an L-amino acid oxidase that catalyzes the oxidative deamination of L-amino acids to alpha-keto acids while generating hydrogen peroxide and ammonia (1). IL4I1 was first discovered as a pre-early IL4-inducible gene in B cells (2, 3) and was later also identified in macrophages and dendritic cells (4). Furthermore, IL4I1 is expressed in human malignancies, either in the tumor cells themselves or in tumor-associated macrophages (5). IL4I1 inhibits T cell proliferation (4, 6), which is mainly due to the production of H2O2. Furthermore, IL4I1 is involved in the differentiation of Th17 cells (7) and regulatory T cells (8) and is known to be regulated by the activation of AHR (9-11).

[0003] Currently, little is known about the therapeutic significance of IL4I1-related conditions. This can be exemplified by the existence of the only international publication WO2016 / 040488, which discloses a method for promoting myelination in the central nervous system (CNS) tissue of a subject in need thereof, the method comprising administering a therapeutically effective amount of IL4I1 protein to the subject.

[0004] The aryl hydrocarbon receptor (AHR) is a ligand-activated transcription factor involved in the regulation of diverse processes such as embryonic development, angiogenesis, metabolism, immunity, and cancer. In preclinical studies, AHR activation by tryptophan metabolites generated via indoleamine-2,3-dioxygenase (IDO1) and / or tryptophan-2,3-dioxygenase (TDO2) promoted tumor progression by enhancing tumor cell motility, anoikis resistance, and clonogenic survival, and by suppressing the antitumor immune response (12). The expression of AHR target genes is context-specific (13), and there is a need for the introduction of new biomarkers of AHR activation that can efficiently detect AHR activation in response to diverse AHR ligands across various cells / tissues. Furthermore, the functional implications of IL4I1 regulation and AHR regulation share many common pathways and crosstalk, with implications for the importance of considering IL4I1 as a potential biomarker of the state of AHR regulation.

Summary of the Invention

Means for Solving the Problems

[0005] According to its first aspect, the present invention relates to a method for detecting the regulation of AHR in a cell or a subject, comprising detecting a change in the biological state of IL4I1 in a biological sample derived from the cell or the subject, wherein the change in the biological state of IL4I1 in the cell or the sample indicates IL4I1-related regulation of AHR in the cell or the subject when compared to a control cell or sample, e.g., a sample derived from a healthy subject, a patient, or a patient group.

[0006] According to this second aspect, the present invention provides an in vitro method for screening for at least one potential modulator of the expression and / or biological activity of IL4I1, comprising contacting a sample comprising IL4I1 or cells expressing IL4I1 with at least one candidate modulator compound and detecting the modulation of said IL4I1, wherein said modulation identifies a potential modulator of the expression and / or biological activity of IL4I1.

[0007] Preferably, the method is a method for screening for at least one modulator of the biological state of IL4I1, comprising contacting at least one candidate modulator compound with a biological sample and detecting a change in the biological state of IL4I1 in the biological sample, wherein a change in the biological state of IL4I1 in the presence of said at least one modulator, as compared to the absence of said at least one modulator, identifies the modulator.

[0008] According to this third aspect, the present invention relates to a method for monitoring the modulation of the biological state of IL4I1 in response to at least one compound, comprising performing the method according to the invention on a biological sample contacted with the at least one compound, wherein said biological sample is compared to a control sample not contacted with said compound.

[0009] According to a sub-aspect of this method, the present invention relates to a method for monitoring the biological state of AHR in a cell, comprising providing at least one compound to the cell and detecting a change in the biological state, such as the expression and / or biological function of IL4I1 in the cell, in response to said at least one compound, wherein a change in the biological state, such as expression or biological function, in the presence of said at least one compound, as compared to the absence of said at least one compound, indicates the effect of said at least one compound on the biological state of AHR in the cell.

[0010] Next, according to another preferred aspect of the present invention, the present invention relates to a method for treating and / or preventing AHR-related diseases or conditions in a patient in need thereof, comprising practicing the present invention and providing the patient with appropriate treatment at least partially based on the results of the method according to the present invention, for example, providing the identified compound as described herein, or monitoring a treatment comprising said method.

[0011] Another important aspect of the present invention relates to a diagnostic kit for practicing the method of the present invention, comprising materials for practicing the method, optionally in one or separate containers, together with adjuvants and / or instructions for carrying out the method. Next, another important aspect of the present invention relates to the use of said diagnostic kit in the method according to the present invention.

[0012] Finally, the present invention relates to the use of the biomarker IL4I1 for screening modulators according to the present invention or for monitoring according to the present invention. BRIEF DESCRIPTION OF THE DRAWINGS

[0013]

Figure 1

[0014]

Figure 2-1

[0015]

Figure 2-2

[0016]

Figure 2-3

[0017]

Figure 2-4

[0018]

Figure 3-1

[0019]

Figure 3-2

[0020]

Figure 3-3

[0021]

Figure 3-4

[0022]

Figure 4-1

[0023]

Figure 4-2

[0024]

Figure 5

[0025]

Figure 6

[0026]

Figure 7

[0027] Generally preferred are human variants of the biomarker IL4I1, or closely related species such as those from other primates or mammals.

[0028] Other aspects and advantages can be readily derived from the following description and non-limiting examples.

[0029] While investigating the role of tryptophan-degrading enzymes in the regulation of AHR activity, the inventors discovered that the expression of IL4I1, a tryptophan-degrading enzyme expressed in human cancers (Figure 1) and not involved in AHR activation, significantly correlates with the expression of AHR target genes. Through gene expression analysis (Figure 2a) and AHR nuclear translocation (Figure 2b), IL4I1, which activates AHR through the production of tryptophan metabolites containing kynurenic acid, was established (Figures 2g-i, 3-4).

[0030] As described above, in the experiments conducted in the context of the present invention, the new biomarker IL4I1 was identified as a new component upstream of AHR. This enables an in vitro method for screening for at least one modulator of the biological state of IL4I1, comprising contacting at least one candidate modulator compound with a biological sample and detecting a change in the biological state of IL4I1 in the biological sample, where a change in the biological state of IL4I1 in the presence of the at least one modulator, compared to the absence of the at least one modulator, identifies the modulator. The modulator can be an activator (inducer) or inhibitor of the biological state of IL4I1.

[0031] In one alternative, a method for screening for potential modulators of the expression and / or biological activity of IL4I1 comprises contacting a sample comprising IL4I1 or cells expressing IL4I1 with at least one candidate modulator compound and detecting binding of the modulator to IL4I1, where the binding identifies a potential modulator of the expression and / or biological activity of IL4I1. This method preferably further comprises detecting the expression and / or biological activity of IL4I1 in the cells, or the biological activity of IL4I1 in the sample, where a change in the expression or biological activity of IL4I1 in the presence of the at least one compound, compared to its absence, identifies the modulator.

[0032] Such a method of the present invention is preferred where the modulator is selected from inhibitors or inducers of the expression or biological activity.

[0033] Next, another important aspect of the present invention relates to a method for diagnosing AHR-related diseases or conditions in cells and / or subjects, including detecting changes in the biological state of IL4I1 in a biological sample derived from the cells, wherein the change in the biological state of IL4I1 in the sample indicates an AHR-related physiological or pathological state in the cells and / or subject when compared to a control sample.

[0034] According to one aspect, the method includes detecting the expression or biological function of IL4I1 in a cell / tissue / biological fluid, wherein a change in the expression or biological function, particularly an upregulation or downregulation of expression or activation, in the compartment indicates an AHR-related disease or condition when compared to a healthy or other appropriate control. Such a change can be at least about 20%, at least about 30%, at least about 40%, at least about 50%, at least about 60%, at least about 70%, at least about 80%, or at least about 90% or more upregulation or downregulation of expression or biological function when compared to an appropriate control such as a value from a sample derived from healthy cells or a group of healthy humans or individuals, or when compared to an internal standard such as a housekeeping gene. In the context of the present invention, the term "about" means + / - 10% of a given value unless otherwise indicated.

[0035] In the context of the present invention, the regulation of AHR in a cell or subject as detected by detecting a change in the biological state of IL4I1 has been found to indicate an AHR-related physiological or pathological state in the cell or subject. Preferably, the AHR-related physiological or pathological state to be stratified and / or diagnosed is selected from poisoning, cancer, autoimmune diseases, degeneration, inflammation, infectious diseases, metabolic diseases and conditions, angiogenesis, drug metabolism, hematopoiesis, lipid metabolism, cell motility, immune regulation, and stress states, such as biological, mechanical, and environmental stress.

[0036] The method of the present invention is preferred, and the biological state detected herein is selected from mutation, nucleic acid methylation, copy number, expression, protein amount, protein modification, subcellular localization, metabolites, in particular metabolites produced by IL4I1 such as tryptophan degradation products, tryptophan metabolites including kynurenic acid, and the biological activity of IL4I1.

[0037] According to a preferred embodiment, in the method according to the invention, the biological state of IL4I1 is detected indirectly via a change in the abundance or biological activity of at least one metabolite biomarker according to Table 1 below, wherein the change in the expression or biological activity of said at least one biomarker when compared to a control sample indicates a change in the biological state of IL4I1 in said sample.

[0038] In the method of the present invention, the biological sample is selected from a suitable sample including body fluids, mammals such as humans, cells, tissues, whole blood, cell lines, cell supernatants, primary cells, iPSCs, hybridomas, recombinant cells, stem cells, and cancer cells, osteocytes, chondrocytes, neurons, glial cells, epithelial cells, skin cells, scalp cells, lung cells, mucosal cells, muscle cells, skeletal muscle cells, striated muscle cells, smooth muscle cells, heart cells, secretory cells, adipocytes, blood cells, erythrocytes, basophils, eosinophils, monocytes, lymphocytes, T cells, B cells, neutrophils, NK cells, regulatory T-cells, dendritic cells, Th17 cells, Th1 cells, Th2 cells, myeloid cells, macrophages, monocyte-derived stromal cells, bone marrow cells, spleen cells, thymocytes, pancreatic cells, egg cells, sperm, kidney cells, fibroblasts, intestinal cells, cells of the female or male reproductive tract, prostate cells, bladder cells, eye cells, corneal cells, retinal cells, sensory cells, keratinocytes, hepatocytes, brain cells, kidney cells, and colon cells, and transformed counterparts of said cells or tissues.

[0039] Preferred is the method according to the invention, wherein the subject is selected from mammalian subjects, in particular human subjects, in particular human patients suffering from an AHR-related physiological or pathological condition. The control sample can be selected from the samples described above.

[0040] Next, another aspect of the present invention relates to a method for monitoring the regulation of the biological state of IL4I1 in response to at least one compound, comprising performing the method according to the present invention on a biological sample contacted with an amount of at least one compound, wherein the biological sample is compared with a control sample not contacted with the amount of the compound.

[0041] Such a method for monitoring an AHR-related disease or condition in a cell is preferred, comprising providing at least one compound to the cell and detecting a change in the expression or biological function of IL4I1 in the cell in response to the at least one compound, wherein a change in expression or biological function in the presence of the at least one compound, compared to the absence of the at least one compound, indicates the effect of the at least one compound on the IL4I1-related disease or condition.

[0042] In the context of the present invention, an AHR-related disease or condition can be selected from at least one of intoxication, cancer, autoimmune disorders, degeneration, inflammation, infection, metabolic diseases and conditions, angiogenesis, drug metabolism, hematopoiesis, lipid metabolism, cell motility, aging, immune regulation, stress conditions, such as biological, mechanical and environmental stress, and AHR regulation.

[0043] According to some embodiments, the condition is cancer. According to some embodiments, the cancer is selected from the following: adrenocortical carcinoma (ACC), bladder urothelial carcinoma (BLCA), breast invasive carcinoma (BRCA), cervical squamous cell carcinoma and adenocarcinoma of the uterine cervix (CESC), cholangiocarcinoma (CHOL), colon adenocarcinoma (COAD), diffuse large B-cell lymphoma (DLBC), esophageal carcinoma (ESCA), glioblastoma multiforme (GBM), head and neck squamous cell carcinoma (HNSC), pheochromocytoma (KICH), kidney renal clear cell carcinoma (KIRC), kidney renal papillary cell carcinoma (KIRP), brain low-grade glioma (LGG), liver hepatocellular carcinoma (LIHC), lung adenocarcinoma (LUAD), lung squamous cell carcinoma (LUSC), mesothelioma (MESO), ovarian serous cystadenocarcinoma (OV), pancreatic adenocarcinoma (PAAD), pheochromocytoma and paraganglioma (PCPG), prostate adenocarcinoma (PRAD), rectal adenocarcinoma (READ), sarcoma (SARC), skin cutaneous melanoma (SKCM), stomach adenocarcinoma (STAD), testicular germ cell tumor (TGCT), thyroid carcinoma (THCA), thymoma (THYM), uterine corpus endometrial carcinoma (UCEC), uterine carcinosarcoma (UCS), and uveal melanoma (UVM).

[0044] According to one aspect, the method according to the present invention is provided to search for a modulator and elucidate its effect on the identified biomarker IL4I1. Examples of such compounds to be identified can be selected from small molecules, peptides, and libraries of said compounds. The identified (screened) compounds are selected from low molecular weight chemical molecules, peptides, antibodies, and short interfering RNAs. Preferably, the compounds are selected from the following: protein domains, small molecules, peptides, environmental substances, probiotics, toxins, aerosols, drugs, nutrients, herbal compositions, plant extracts, volatile compounds, homeopathic substances, fragrances, pharmaceuticals, vaccines, organisms such as compounds or mixtures of compounds derived from animals, plants, fungi, bacteria, archaea, compounds used in the food or cosmetic industry, and libraries of said compounds.

[0045] The identification and screening using the biomarkers disclosed in this specification can be carried out using respective methods known in the art, preferably using recombinant production proteins and / or recombinant cell models of the biomarkers. For this purpose, the biomarkers can be labeled, for example, using chemical dyes or fluorescent markers. Furthermore, the enzyme can optionally be used in the form of a fusion with the biomarker to be screened. Preferably, the method is also compliant with automation, and the screening is preferably evaluated in an automated and / or high-throughput format.

[0046] Next, another aspect relates to the use of at least one biomarker of IL4I1 for screening of a modulator according to the invention, or monitoring according to the invention, or testing of biological safety according to the invention, or diagnosis according to the invention.

[0047] Next, according to another preferred aspect of the present invention, the present invention relates to a method for treating and / or preventing an AHR-related disease or condition in cells of a patient in need of such treatment, comprising carrying out the method according to the present invention and providing appropriate treatment to the patient, wherein the treatment is at least partially based on the results of the method according to the present invention, such as providing the identified compound or monitoring the treatment.

[0048] In the context of the present invention, any biological sample containing the marker protein IL4I1 (or a functionally related part thereof), or a sample containing cells, for example obtained from a cancer patient, containing the marker protein IL4I1 (or a functionally related part thereof), or a sample containing at least one metabolite produced downstream of IL4I1, as shown for example in Table 1, can be used as long as it contains (or is presumed to contain) at least one biomarker for use in analysis and / or screening. Preferably, the biological sample is selected from samples including: biomarkers, samples containing body fluids containing cells, biological fluids, human cells, tissues, whole blood, cell lines, cell supernatants, primary cells, iPSCs, hybridomas, recombinant cells, stem cells, cancer cells, bone cells, chondrocytes, nerve cells, glial cells, epithelial cells, skin cells, scalp cells, lung cells, mucosal cells, muscle cells, skeletal muscle cells, striated muscle cells, smooth muscle cells, heart cells, secretory cells, adipocytes, blood cells, erythrocytes, basophils, eosinophils, monocytes, lymphocytes, T cells, B cells, neutrophils, NK cells, regulatory T cells, dendritic cells, Th17 cells, Th1 cells, Th2 cells, myeloid cells, macrophages, monocyte-derived stromal cells, bone marrow cells, spleen cells, thymocytes, pancreatic cells, oocytes, sperm, kidney cells, fibroblasts, intestinal cells, cells of the female or male reproductive tract, prostate cells, bladder cells, eye cells, corneal cells, retinal cells, sensory cells, keratinocytes, hepatocytes, brain cells, kidney cells, and colon cells, and suitable samples containing transformed counterparts of said cells or tissues. The sample can also be selected from: tumor tissue (tumor or metastasis), biopsy, whole blood, peripheral blood, or fractions thereof, serum, buffy coat, lymph fluid, urine, bone marrow, heparinized whole blood, and frozen samples thereof, such as frozen heparinized whole blood. The cells used in the method according to the present invention can be recombinant or non-recombinant and can express heterologous proteins depending on the desired purpose and situation. Optionally, totipotent human embryonic stem cells can be excluded. The sample can also be a combined sample from a group of subjects, for example a patient group.

[0049] Next, another aspect of the present invention relates to a method of manufacturing a pharmaceutical preparation, wherein the identified (screened) compound / modulator is further formulated into a pharmaceutical preparation by mixing the identified (at least one) compound with a pharmaceutically acceptable carrier. The pharmaceutical preparation can preferably be in the form of an injection, tablet, capsule, syrup, elixir, ointment, cream, patch, implant, aerosol, spray and suppository (rectal, vaginal and urethral). Next, another aspect of the present invention relates to a pharmaceutical preparation prepared according to the present invention.

[0050] According to another aspect of the present invention, next, the present invention relates to a diagnostic kit for carrying out the method according to the present invention in one or separate containers, optionally containing adjuvants and / or materials for carrying out the method according to the present invention together with instructions.

[0051] "Treatment" means the alleviation and / or improvement of the symptoms of a disease. Effective treatment achieves, for example, a reduction in the mass of a tumor and the number of cancer cells. Treatment can also avoid (prevent) and reduce the spread of cancer, for example, by affecting metastasis and / or its formation. Treatment can be naive treatment (before other treatment of the disease is initiated), or treatment after the first treatment round (for example, after surgery or recurrence). Treatment can also be a combination treatment including, for example, chemotherapy, surgery, and / or radiotherapy.

[0052] In the method of the present invention, generally, biomarkers can be detected and / or determined using any suitable assay. Detection usually aims at qualitative information ("marker yes - no"), while determination includes analysis of the amount of the marker (e.g., expression level and / or activity). Detection is also directed at, for example, identifying mutations that cause changes in the function of individual markers. The choice of assay depends on the parameters of the marker to be determined and / or the detection process. Thus, determination and / or detection can preferably include a method selected from the following: subtractive hybridization, microarray analysis, DNA sequencing, RNA sequencing, qPCR, ELISA, IP, PLA, BiFC, HPLC, WB, enzyme activity test, fluorescence detection, cell viability assay, such as MTT assay, phospho - receptor tyrosine kinase assay, phospho - MAPK array and proliferation assay, such as BrdU assay, proteomics, cytokine array, and mass spectrometry.

[0053] Preferably, the method is also suitable for automation, and the activity and / or expression are preferably evaluated in an automated and / or high - throughput format. Usually, this includes the use of respective machines such as chips and robots.

[0054] Another aspect of the present disclosure is directed to a method for determining the AHR activation state of a biological sample. According to some embodiments, the biological sample is taken from a subject. According to some embodiments, the biological state is determined / measured for interleukin 4 - inducible gene 1 (IL4I1).

[0055] According to some embodiments, a method for determining the AHR activation signature of a state includes the following: (a) obtaining a biological sample from a subject; (b) determining the biological state of IL4I1 in the biological sample; (c) determining the biological state of IL4I1 in control cells; (d) comparing the biological state of step (b) with the biological state of step (c); and (e) determining the AHR activation state of the biological sample based on the comparison.

[0056] According to some embodiments, the biological state detected in step (b) is RNA expression. According to some embodiments, the detection of the biological state includes measuring the level of the biological state. According to some embodiments, the RNA expression of the biomarker is detected by methods known in the art, such as qPCR, RT-qPCR, RNA-Seq, and in situ hybridization, but is not limited thereto.

[0057] According to some embodiments, the method further includes treating the subject with an AHR signaling modulator (also an "AHR modulator"). According to some embodiments, the AHR signaling modulator is administered daily, every other day, twice a week, once a week, once a month, or twice a month. According to some embodiments, the AHR signaling modulator is administered together with other agents as part of a combination therapy.

[0058] As used herein, "AHR signaling modulator" or "AHR modulator" refers to a modulator that affects AHR signaling within a cell. According to some embodiments, the AHR signaling modulator directly affects AHR signaling. According to some embodiments, the direct effect on AHR is mediated through direct binding to AHR. According to some embodiments, the direct modulator exhibits a full or partial agonist and / or antagonist effect on AHR. According to some embodiments, the AHR modulator is an indirect modulator.

[0059] According to some embodiments, the AHR signaling modulator is a small molecule compound. As used herein, the term "small molecule compound" generally refers to a small organic compound having a molecular weight of less than 2000 Daltons, 1500 Daltons, 1000 Daltons, 800 Daltons, or 600 Daltons.

[0060] According to some embodiments, the AHR modulator includes: 2-phenylpyrimidine-4-carboxamide compounds, sulfur-substituted 3-oxo-2,3-dihydropyridazine-4-carboxamide compounds, 3-oxo-6-heteroaryl-2-phenyl-2,3-dihydropyridazine-4-carboxamide compounds, 2-heteroarylpyrimidine-4-carboxamide compounds, 3-oxo-2,6-diphenyl-2,3-dihydropyridazine-4-carboxamide compounds, 2-heteroaryl-3-oxo-2,3-dihydro-4-carboxamide compounds, PDM 2, 1,3-dichloro-5-[(1E)-2-(4-methoxyphenyl)ethenyl]-benzene, α-naphthoflavone, 6,2‘,4’-trimethoxyflavone, CH223191, tetrahydropyridopyrimidine derivatives, StemRegenin-1, CH223191, GNF351, CB7993113 HP163, PX-A590, PX-A548, PX-A275, PX-A758, PX-A446, PX-A24590, PX-A25548, PX-A25275, PX-A25758, PX-A26446, indole AHR inhibitors, and oxazole-containing (OxC) compounds.

[0061] According to some embodiments, the direct AHR modulator includes: (a) Drugs: for example, omeprazole, sulindac, leflunomide, tranilast, lacosamide, flutamide, nimodipine, mexiletine, 4-hydroxy-tamoxifen, vemurafenib, etc., (b) Synthetic compounds: for example, 10-chloro-7H-benzoimidazo[2,1-a]benz[de]isoquinolin-7-one (10-Cl-BBQ), pifithrin-α hydrobromide, (c) Natural compounds: for example, kynurenine, kynurenic acid, cinnabarinic acid, ITE, FICZ, indole-3-carbinol, indole-3-pyruvic acid, indole-aldehyde, microbial metabolites, dietary components, quercetin, resveratrol, indoles including curcumin, or (d) Toxic compounds: for example, TCDD, tobacco smoke, 3-methylcholanthrene, benzo(a)pyrene, 2,3,7,8-tetrachlorodibenzofuran, fuel emissions, halogenated and non-halogenated aromatic hydrocarbons, pesticides.

[0062] According to some embodiments, the indirect AHR modulator affects the activation of AHR through the regulation of the levels of AHR agonists or antagonists.

[0063] According to some embodiments, the regulation of the levels of AHR agonists or antagonists is mediated through one or more of the following: (a) Regulation of cytochrome p450 enzymes by cytochrome p450 enzyme inhibitors that modify AHR ligands, such as 3'methoxy-4'nitroflavone (MNF), alpha-naphthoflavone (α-NF), fluoranthene (FL), phenanthrene (Phe), pyrene (PY), etc. (b) Direct and indirect inhibitors / activators / inducers of tryptophan-degrading enzymes, such as IDO1 pathway modulators (indoximod, NLG802), IDO1 inhibitors (1-methyl-L-tryptophan, epacadostat, PX-D26116, navoximod, PF-06840003, NLG-919A, BMS-986205, INCB024360A, KHK2455, LY3381916, MK-7162), IDO2 inhibitors (680C91, LM10, 4-(4-fluoropyrazol-1-yl)-1,2-oxazole-5-amine, fused imidazo-indole, indazole), dual IDO / TDO inhibitors (HTI-1090 / SHR9146, DN1406131, RG70099, EPL-1410), immunotherapy including immune checkpoint inhibition, vaccination, cell therapy, chemotherapy, immunostimulants, radiotherapy, exposure to UV light, and targeted therapy, such as imatinib, etc., regulation of enzymes producing AHR ligands.

[0064] According to some embodiments, the indirect AHR modulator affects the activation of AHR through the regulation of the expression of AHR, including HSP90 inhibitors such as 17-allylamino-demethoxygeldanamycin (17-AAG), cerastrol.

[0065] According to some embodiments, the indirect AHR modulator affects the activation of AHR by affecting binding partners / cofactors that regulate the effects of AHR, including, for example, estrogen receptor α (ESR1).

[0066] Examples of AHR modulators are shown below: US9175266, US2019 / 225683, WO2019101647A1, WO2019101642A1, WO2019101643A1, WO2019101641A1, WO2018146010A1, AU2019280023A1, WO2020039093A1, WO2020021024A1, WO2019206800A1, WO2019185870A1, WO2019115586A1, EP3535259A1, WO2020043880A1 and EP3464248A1, all of which are hereby incorporated by reference in their entirety.

[0067] According to some embodiments, the effective amount of the AHR signaling modulator is from about 0.01 mg / kg to 100 mg / kg. According to some embodiments, the effective amount of the AHR signaling modulator is an AHR signaling modulator of about 0.01 mg / kg, 0.05 mg / kg, 0.1 mg / kg, 0.2 mg / kg, 0.5 mg / kg, 1 mg / kg, 5 mg / kg, 8 mg / kg, 10 mg / kg, 15 mg / kg, 20 mg / kg, 30 mg / kg, 40 mg / kg, 50 mg / kg, 60 m / kg, 70 mg / kg, 80 mg / kg, 90 mg / kg, 100 mg / kg, 150 mg / kg, 175 mg / kg or 200 mg / kg.

[0068] Another aspect of the present disclosure relates to a method of treating and / or preventing an AHR-related disease or condition in a cell of a patient in need of such treatment, comprising performing the method according to the invention and providing appropriate treatment to the patient, wherein the treatment is at least partially based on the results of the method according to the invention, for example, by providing an identified compound or monitoring a treatment comprising the method described herein.

[0069] Another aspect of the present disclosure relates to a diagnostic kit comprising materials for performing the method according to the invention, optionally with adjuvants and / or instructions for performing the method, in one or separate containers.

[0070] Another aspect of the present disclosure is directed to screening or identifying compounds that modulate AHR activity. Another aspect of the present disclosure is directed to methods for determining the effect of a compound on the AHR activation state of a cell.

[0071] According to some embodiments, the cells are treated with a candidate compound, and the biological state of IL4I1 is determined / measured in the cells. According to some embodiments, the biological state of IL4I1 in a biological sample is compared to the biological state of IL4I1 in a control sample. According to some embodiments, the biological state is IL4I1 RNA expression.

[0072] According to some embodiments, if the biological state of IL4I1 from a sample treated with a candidate compound is less than the biological state of IL4I1 from a control sample, the candidate compound is classified as an inhibitor of AHR signaling, and the candidate compound is, if the biological state of IL4I1 from a sample treated with the candidate compound is greater than the biological state of IL4I1 from a control sample, classified as an activator of AHR signaling.

[0073] According to some embodiments, a candidate compound is characterized as an AHR activator if it results in at least a 1.5-fold absolute upregulation in the biological state of IL4I1. According to some embodiments, a candidate compound is characterized as an AHR activator if it results in an upregulation of at least a 2-fold absolute, at least a 2.5-fold absolute, at least a 3-fold absolute, at least a 3.5-fold absolute, at least a 4-fold absolute, at least a 4.5-fold absolute, or at least a 5-fold absolute in the biological state of IL4I1.

[0074] According to some embodiments, a candidate compound is characterized as an AHR inhibitor if it results in a downregulation with an absolute fold of at least 0.67 in a biological state. According to some embodiments, a candidate compound is characterized as an AHR inhibitor if it results in a downregulation in a biological state of at least 1 absolute fold, 2 absolute folds, at least 2.5 absolute folds, at least 3 absolute folds, at least 3.5 absolute folds, at least 4 absolute folds, at least 4.5 absolute folds, or at least 5 absolute folds.

[0075] The phrase "fold change" refers to the ratio between the values of a particular biomarker under two different conditions. According to some embodiments, one of the two conditions may be a control. The phrase "absolute fold change" (including "absolute fold upregulation" and "absolute fold downregulation") is used when comparing the log-transformed values of a particular biomarker between two conditions. The absolute fold change is calculated by raising the logarithm to the exponent of the fold change value and then reporting the numerical coefficient.

[0076] Various aspects of the present disclosure may be embodied or stored as a program, software, or computer instructions embodied in a group of media that, when executed on a computer or machine-usable or readable medium, or on a computer, processor, and / or machine, cause the computer or machine to execute the steps of a method. A machine-readable program storage device, such as a computer-readable medium, that specifically embodies a program of executable instructions for a machine to execute the various functionalities and methods described in the present disclosure is also provided.

[0077] According to some embodiments, the present disclosure includes a system including a CPU, a display, a network interface, a user interface, a memory, a program memory, and a working memory (FIG. 6), wherein the system is programmed to execute a program, software, or an instruction computer directed to the method or process of the present disclosure. Exemplary embodiments are shown in FIG. 7.

[0078] The term "processor" can include a single-core processor, a multi-core processor, a plurality of processors disposed on a single device, or a plurality of processors distributed via a wired or wireless communication network of devices, the Internet, or the cloud. Thus, as used herein, functions, features, or instructions executed or configured to be executed by a "processor" can include the execution of functions, features, or instructions by a single-core processor, can include the collective or cooperative performance of functions, features, or instructions by a plurality of cores of a multi-core processor, or can include the collective or cooperative performance of functions, features, or instructions by a plurality of processors, where each processor or core need not execute all functions, features, or instructions individually. The processor can be a CPU (Central Processing Unit). The processor can include other types of processors such as a GPU (Graphics Processing Unit). According to other aspects of the present disclosure, instead of or in addition to CPU execution instructions programmed in the program memory, the processor can be other functional logic such as an ASIC (Application Specific Integrated Circuit), an analog circuit, or an FPGA (Field Programmable Gate Array), a PAL (Phase Alternate Line), or a PLA (Programmable Logic Array).

[0079] The CPU is configured to execute a program (also described herein as a module or instruction) stored in a program memory to perform the functions described herein. The memory can be, but is not limited to, RAM (Random Access Memory), ROM (Read-Only Memory), and persistent storage. The memory is any hardware that can temporarily and / or permanently store information such as, for example, data, programs, instructions, program code, and / or other suitable information.

[0080] According to some embodiments, the disclosure is directed to a processor programmed to perform the following: (a) comparing the biological state of interleukin 4-induced gene 1 (IL4I1) from a sample with the biological state of IL4I1 from a control sample; and (e) determining the AHR activation state of a biological sample based on the comparing step.

[0081] According to some embodiments, the present disclosure is directed to a computer-readable storage device containing instructions for performing the following: (a) comparing the biological state of interleukin 4-induced gene 1 (IL4I1) from a sample with the biological state of IL4I1 from a control sample; and (e) determining the AHR activation state of a biological sample based on the comparing step.

[0082] Accordingly, the present invention relates to the following items: Item 1: A method for detecting regulation of an aryl hydrocarbon receptor (AHR) in a cell or subject, comprising detecting a change in the biological state of interleukin 4-induced gene 1 (IL4I1) in a biological sample derived from the cell or subject, wherein the change in the biological state of IL4I1 in the sample indicates IL4I1-related regulation of AHR in the cell or subject as compared to a control sample.

[0083] Item 2: The method according to item 1, wherein the regulation is selected from activation or suppression of AHR.

[0084] Item 3: The method according to item 1 or 2, wherein the modulation indicates an AHR-related biological or pathological state in the cell or subject.

[0085] Item 4: The method according to item 3, wherein the physiological or pathological state is selected from poisoning, cancer, autoimmune diseases, degeneration, inflammation, infectious diseases, metabolic diseases and conditions, angiogenesis, drug metabolism, hematopoiesis, lipid metabolism, cell motility, immune regulation, stress states, such as biological, mechanical and environmental stress.

[0086] Item 5: The method according to any one of items 1 to 4, wherein the detected biological state is selected from mutation, nucleic acid methylation, copy number, expression, protein amount, protein modification, subcellular localization, metabolites, in particular metabolites produced by IL4I1 such as tryptophan catabolites, and the biological activity of IL4I1.

[0087] Item 6: The method according to any one of items 1 to 5, wherein the biological sample is selected from a suitable sample containing body fluids, mammals, such as humans, cells, tissues, whole blood, cell lines, cell supernatants, primary cells, iPSCs, hybridomas, recombinant cells, stem cells, and cancer cells, bone cells, chondrocytes, neurons, glial cells, epithelial cells, skin cells, scalp cells, lung cells, mucosal cells, muscle cells, skeletal muscle cells, striated muscle cells, smooth muscle cells, heart cells, secretory cells, adipocytes, blood cells, erythrocytes, basophils, eosinophils, monocytes, lymphocytes, T cells, B cells, neutrophils, NK cells, regulatory T-cells, dendritic cells, Th17 cells, Th1 cells, Th2 cells, bone marrow cells, macrophages, monocyte-derived stromal cells, bone marrow cells, spleen cells, thymocytes, pancreatic cells, egg cells, sperm, kidney cells, fibroblasts, intestinal cells, cells of the female or male reproductive tract, prostate cells, bladder cells, eye cells, corneal cells, retinal cells, sensory cells, keratinocytes, hepatocytes, brain cells, kidney cells, and colon cells, and transformed counterparts of said cells or tissues.

[0088] Item 7: The method according to any one of Items 1 to 6, wherein the subject is selected from mammalian subjects, such as human subjects, such as human patients suffering from an AHR-related physiological or pathological condition.

[0089] Item 8: The method according to any one of Items 1 to 7, wherein the subject sample is selected from samples from, for example, healthy subjects or a group of subjects.

[0090] Item 9: A method for screening for at least one modulator of the biological state of IL4I1, comprising contacting at least one candidate modulator compound with a biological sample and detecting the biological regulation of IL4I1 or the gene encoding IL4I1, wherein the regulation or activity identifies a modulator of the biological state.

[0091] Item 10: The method according to Item 9, wherein the method preferably further comprises detecting a change in the biological state of IL4I1 in the biological sample, wherein the change in the biological state of IL4I1 in the presence of the at least one modulator as compared to in the absence of the at least one modulator identifies the modulator.

[0092] Item 11: The method according to Item 9 or 10, wherein the detected biological state is selected from mutation, nucleic acid methylation, copy number, expression, protein amount, protein modification, subcellular localization, metabolite, in particular, metabolites produced by IL4I1 such as tryptophan breakdown products, and the biological activity of IL4I1.

[0093] Item 12: The method according to any one of Items 9 to 11, wherein the modulator is selected from inhibitors or inducers of the biological state of IL4I1.

[0094] Item 13: The method according to any one of Items 9 to 12, further comprising detecting the regulation of AHR.

[0095] Item 14: The method according to any one of Items 9 to 13, wherein the compound is selected from a protein domain, a small molecule, a peptide, an antibody, for example, a monoclonal antibody that binds to IL4I1, an environmental substance, a probiotic, a toxin, an aerosol, a drug, a nutrient, a crude drug composition, a plant extract, a volatile compound, a homeopathic substance, a fragrance, a pharmaceutical, a vaccine, a biological, for example, a compound or a mixture of compounds derived from an animal, a plant, a fungus, a bacterium, an archaea, a compound used in the food or cosmetic industry, and a library of said compounds.

[0096] Item 15: A method for monitoring the regulation of the biological state of AHR in response to at least one compound, comprising performing the method according to any one of Items 1 to 8 on a biological sample contacted with an amount of at least one compound, wherein the biological sample is compared with a control sample that has not been contacted with the amount of the compound.

[0097] Item 16: The method according to Item 15, wherein the biological sample is obtained through the course of treatment and / or is compared with a sample derived from an appropriate control sample or a group of subjects or patients as described herein.

[0098] Item 17: The method according to any one of Items 1 to 16, further comprising the step of using said comparison for clustering without monitoring the sample into subgroups of IL4I1 regulation or classification with monitoring, and optionally for clustering without monitoring the sample into different subgroups of AHR regulation or classification with monitoring.

[0099] Item 18: The method according to any one of Items 1 to 16, further comprising classifying the subject into a specific group of subjects or a group of patients.

[0100] Item 19: The method according to any one of Items 1 to 18, wherein the method comprises using a high-throughput method.

[0101] Item 20: A diagnostic kit comprising materials for carrying out the method according to any one of Items 1 to 19 in one or separate containers, optionally together with adjuvants and / or instructions for carrying out said method.

[0102] Item 21: Use of the method according to any one of Items 1 to 19 for the diagnostic kit according to Item 20.

[0103] Item 22: A method for treating and / or preventing AHR-related diseases or conditions in a patient in need thereof, comprising performing the method according to any one of Items 1 to 19 and providing the patient with appropriate treatment based at least in part on the results of the method according to the present invention.

[0104] [Table 1]

[0105] Next, the present invention will be further described with reference to the accompanying drawings and, without limitation thereto, in the following examples. For the purposes of the present invention, all references cited herein are incorporated by reference in their entirety.

[0106] SEQ ID NOs: 1 to 26 show the sequences of oligomers as used in the present invention. Examples

[0107] Materials and Methods Microarray and RNA-seq Data Analysis Array dataset - The Affymetrix microarray chip "Human Gene 2.0 ST" was analyzed using the oligo package and annotated using NetAffx (14). The raw CEL files were normalized with RMA and summarized. Differential gene expression was performed using the limma pipeline for microarrays (15).

[0108] RNA-seq dataset-The harmonized FPKM data of The Cancer Genome Atlas (TCGA) tumor dataset was downloaded using TCGAbiolinks(16) of GDC( https: / / gdc.cancer.gov ), and only patients with the identifier "primary solid tumor" were retained. The FPKM values were converted to Transcripts per Million (TPM)(17), and the TPM data of normal tissues was downloaded from the Genotype-Tissue Expression dataset (GTEX - https: / / gtexportal.org / home / ). All TPM values were log2-transformed.

[0109] Cell culture HEK293T, LN-229, Tao BpRc1, and U-87MG were obtained from ATCC. CAS-1 and U-251MG were from ICLC and ECACC, respectively. CAS-1, HEK293T, LN-229, U-87MG, and U-251MG were cultured in phenol red-free high glucose DMEM medium (Gibco, 31053028) (hereinafter referred to as complete DMEM) supplemented with 10% FBS (Gibco, 10270106), 2 mM L-glutamine (Gibco, 25030-024), 1 mM sodium pyruvate (Gibco, 11360-039), 100 U / mL penicillin, and 100 μg / mL streptomycin (Gibco, 15140-122). TAO BpRc1 cells were cultured as above, but complete phenol red-free DMEM and 5 μg / mL tetracycline (Sigma-Aldrich, T3383) were used. For the translocation assay, medium containing 10% Tet System Approved FBS (Clontech, 631107) was used. The cells were cultured at 37 °C and 5% CO2.

[0110] Generation of transgenic cell lines The human IL4I1 cDNA clone adjacent to the Gateway compatibility recombination site was purchased from MyBiosource (MBS1270935). The cDNA clone was recombined into the lentivirus-compatible Gateway expression vector pLX301 (a gift from D. Root, Addgene plasmid 25895) (18). Lentivirus production was achieved by transfecting HEK293T with pMD2.G (a gift from D. Trono, Addgene plasmid 12259), psPAX2 (a gift from D. Trono, Addgene plasmid 12260), and the lentivirus plasmid according to the manufacturer's protocol using FuGENE HD (Promega, E2311). The virus supernatant was collected at 48 hours and 72 hours, pooled, and filtered through a 0.45 μm pore filter. Stable IL4I1 overexpressing (pLX301-IL4I1) and control (pLX301) cell lines were generated by infecting U-87MG and U-251MG cells with their respective virus supernatants for 24 hours in the presence of 8 μg / mL polybrene (Merck Millipore, TR-1003-G), followed by selection in medium containing 1 μg / mL puromycin (AppliChem, A2856). Stable overexpression of IL4I1 was confirmed by qRT-PCR, Western blot, and IL4I1 enzyme activity.

[0111] Stable knockdown of AHR in U-87MG cells was achieved using the shERWOOD UltramiR lentiviral shRNA targeting AHR (transOMIC Technologies, TLHSU1400-196-GVO-TRI). Glioma cells were infected with viral supernatants containing either the shAHR or shControl (shC) sequence to generate stable cell lines. The hERWOOD UltramiR shRNA sequences are as follows: shAHR (ULTRA-3234821): 5’-TGCTGTTGACAGTGAGCGCAGGAAGAATTGTTT TAGGATATAGTGAAGCCACAGATGTATATCCTAAAACAATTCTTCCTTTGCCTACTGCCTCGGA-3’ (SEQ ID NO: 1); shC (ULTRA-NT#4): 5’- TGCTGTTGACAGTGA GCG AAGGCAGAAGTATGCAAAGCATTAGTGAAGCCACAGATGTAATGCTTTGCATACTTCTGCCTGTGCCTACTGCCTCGG A-3 (SEQ ID NO: 2)’. Gene knockdown via siRNA of IL4I1 was performed using the ON-TARGETplus Human SMARTpool siRNA reagent (Dharmacon, L-008109-00-0005). Gene knockdown via siRNA of AHR was performed using the ON-TARGETplus Human SMARTpool siRNA reagent (Dharmacon, L-004990-00-0005). siRNA transfection was performed using Lipofectamine RNAiMAX (Thermo Fisher Scientific, 13778100) according to the manufacturer's protocol. ON-TARGETplus nontargeting pool siRNA (Dharmacon, D-001810-10-05) was used as a control.

[0112] The nuclear translocation of Ahr was visualized using stably transfected tao BpRc1c cells expressing GFP-tagged Ahr under the control of tetracycline. Mouse Ahr was cloned into the pEGFP-C1 vector (CLONTECH, Palo Alto, CA) containing the tet-off expression system (pRevTRE, CLONTECH). The Phoenix packaging line was used for retroviral transfection of mouse hepatocellular carcinoma BpRc1 cells lacking endogenous Ahr expression.

[0113] Cell culture treatment conditions To treat adherent cells with the established virtual AHR ligand, 4 x 10 5 cells per well were seeded in 6-well plates and incubated for 24 hours before treatment. Non-adherent cells were seeded at 5 x 10 5Cells were seeded and immediately treated. To verify the generated AHR signature, cells were treated with the established AHR agonist Kyn (50 μM, Sigma Aldrich, K8625) for 24 h. To investigate the possibility that direct and downstream IL4I1 metabolites activate AHR, cells were treated for 24 h with I3P (3.125 μM - 100 μM, Sigma-Aldrich, I7017), HPP (8 μM - 1000 μM, Sigma-Aldrich, 114286), PP (8 μM - 1000 μM, Alfa Aesar, L11934), kynurenic acid (50 μM, Sigma-Aldrich, K3375), indole-3-lactic acid (25 μM - 100 μM, Sigma-Aldrich, I5508), 3-indoleacetic acid (25 μM - 100 μM, Sigma-Aldrich, I2886), indole-3-carboxaldehyde (6.25 μM - 100 μM, Sigma-Aldrich, 129445) and the supernatants of U-87MG or U-251MG controls and il4I1-expressing cells. When using the AHR antagonist SR1 (1 μM, Merck Millipore, 182706), cells were treated for 24 h alone or in combination with an AHR ligand. DMSO was used to dissolve all compounds so that the final concentration in the medium did not exceed 0.2%.

[0114] In gene and protein expression experiments involving U-87MG and U-251MG controls and IL4I1-expressing cells, 4 x 10 5 Cells were seeded into 2 mL in 6-well plates and incubated for 72 h or 120 h. In metabolomics experiments, 4x10 5 Cells were seeded at the density of cells per well and incubated for 24 h. When more cells and supernatant were required, 2.6x10 6Cells were seeded into 13.3 mL of complete DMEM in a 10-cm dish and incubated for 24 hours. After 4 hours, the cells were washed once with PBS, and 2 or 13.3 mL of fresh FBS-free DMEM was added (depending on the well size and cell density used), and the cells were incubated for 120 hours. Sample preparation was adapted from previous studies (19, 20). Briefly, the supernatant was snap-frozen in liquid nitrogen and stored at -80 °C until metabolite measurement. The plate containing the cells was quickly washed once with cell culture-grade water preheated to 37 °C, quenched in liquid nitrogen, and stored at -80 °C until metabolite measurement.

[0115] In the experiment of knocking down IL4I1 in CAS-1 cells, 4x10 5 cells were seeded per well in a 6-well plate and incubated for 24 hours. The cells were transfected with each control or target siRNA. Twenty-four hours after transfection, complete DMEM was replaced with 1.5 mL of FBS-free DMEM, and the cells were incubated for 72 hours.

[0116] RNA Isolation and Real-Time PCR Total RNA was recovered from cultured cells using the RNeasy Mini Kit (Qiagen, 80204), and then cDNA was synthesized using the High Capacity cDNA Reverse Transcriptase Kit (Applied Biosystems, 4368813). Real-time PCR of the cDNA samples was performed using SYBR Select Master Mix (Thermo Scientific, 4309155) on a StepOne Plus Real-Time PCR System (Applied Biosystems). The data were processed and analyzed using StepOne Software v2.3. Relative quantification of the target gene was performed relative to RNA18S as a reference gene using the 2 ΔΔCt -method. Human primer sequences are shown in Table 2 as follows.

[0117]

Table 2

[0118] Isolation of Proteins and Western Blot In the HR translocation assay, the protein contents of the nuclear and cytoplasmic fractions of LN-229 glioma cells were compared by immunoblotting. LN-229 cells were treated with the supernatant of U-251MG control or IL4I1-expressing cells for 4 hours (120 hours). The lysates were snap-frozen in liquid nitrogen and sonicated for 10 cycles after each freeze-thaw cycle and then thawed three times. To isolate proteins from two different cell fractions, NE-PER® Nuclear and Cytoplasmic Extraction Reagents (Thermo Fisher Scientific Inc.) were used. The extraction was performed according to the manufacturer's instructions. Nuclear-specific lamin A served as a control for the appropriate fraction and was detected using polyclonal rabbit anti-lamin A (1:500, BioLegend), respectively. AHR was detected using the primary mouse monoclonal anti-AHR antibody clone RPT1 (Abcam, Berlin, Germany).

[0119] AHR Nuclear Translocation Assay For induction of GFP-Ahr expression in transgenic tao BpRc1c cells, cells were removed from tetracycline 24 hours prior to the translocation assay. The assay was performed in a black clear-bottom 96-well plate (BD, #353219) with 7500 cells / well at 150 μl / well. Metabolites were added to the induction medium at 50 μL / well. Cells were exposed to 25 μM of PP, HPP, and I3P for 4 hours each. The medium was discarded, and the cells were fixed with pre-warmed 3.7% formaldehyde in PBS (10 minutes at RT). After fixation, the cells were washed with a surfactant buffer (DB, 0.01% Tween20 in PBS, Sigma Aldrich), followed by permeabilization with 0.1% Triton X-100 (Sigma Aldrich) in PBS for 15 minutes at RT. The cells were washed twice with DB and incubated with 0.4 ng / ml of Hoechst 33342 (Sigma Aldrich) for 30 minutes at RT, protected from light. After washing with DB and PBS, the cells were stored in PBS at 4 °C until translocation analysis. Translocation by KynA was monitored by live cell imaging after a 3-hour exposure including appropriate negative media controls. Translocation of Ahr by different metabolites was monitored with a BD Pathway Imager855.

[0120] Metabolomics analysis Consumption of phenylalanine, tyrosine, and Trp by U-87MG and U-251MG cells expressing and not expressing IL4I1 was evaluated by quantification of amino acids in the cell culture supernatant after 120 h of incubation. To detect phenylalanine and tyrosine, amino acids were labeled with the fluorescent dye AccQ-Tag® (Waters) according to the manufacturer's protocol. Derivatized products were separated at 42 °C on an Acquity BEH C18 column (Waters) using an Acquity H-class UPLC system (Waters) connected to an Acquity fluorescence detector (FLR) (Waters). Samples were analyzed by UPLC as previously described by Yang et. al., 2015 (21). For analysis of Trp consumption, the supernatant was mixed with an equal volume of 12% perchloric acid and incubated on ice for 10 min. Prior to analysis, samples were centrifuged at 4 °C, 16,400 g for 10 min to precipitate proteins and remove remaining cell debris. Metabolites were then separated by reverse-phase chromatography on an Acquity HSS T3 column (100 mm x 2.1 mm, 1.7 μm, Waters) connected to an Acquity H-class UPLC system (Waters). The column was heated to 37 °C and equilibrated at a flow rate of 0.55 mL / min with 5 column volumes of 100% solvent A (20 mM sodium acetate, 3 mM zinc acetate, pH 6). Clear separation of Trp was achieved by increasing the concentration of solvent B (acetonitrile) in solvent A as follows: 0% B for 4 min, 5% B for 10 min, 15% B for 13 min, 25% B for 15 min, and back to 0% B in 3 min. Trp was detected by fluorescence (Acquity FLR detector, Waters, excitation: 254 nm, emission: 401 nm). Standards (Sigma) were used for quantification. Data acquisition and processing were performed using the Empower3 software suite (Waters). An untargeted metabolomics approach was employed to identify differentially abundant metabolites in the supernatants of IL4I1-expressing and non-expressing U-87MG and U-251MG cells cultured for 120 h.For this purpose, 50 μl of cell culture supernatant was mixed with 200 μl of ice-cold acetonitrile by vortexing and then incubated at -20 °C for 1 hour. The samples were centrifuged at 4 °C for 15 minutes and transferred to TruView UPLC-MS vials (Waters). Pooled samples were prepared by mixing equal amounts of all samples. Samples were measured using an I-Class UPLC system connected to a Vion IMS QTof MS (Waters). Metabolites were separated using either a Cogent Diamond Hydride 2.0 column (150x2.1 mm, 2.2 μm; MicroSolv USA) or an HSS T3 column (100x2.1 mm, 1.8 μm; Waters). UNIFI 1.8.2 (Waters) was used for instrument control and MS data acquisition. Follow-up data analysis was performed using Progenesis QI (Waters). ILA was detected at 204.0662 Da (negative mode; expected monoisotopic mass: 205.0739 Da; deviation -2 ppm) and identified by the expected fragment ions at 116.0495, 128.0495, 130.0652, and 204.0655 Da. Selected differentially abundant metabolites derived from Trp, phenylalanine, and tyrosine (IAA, I3CA, KynA, PP, HPP, HBA) and further downstream conversion products (Kyn, PAA, HPAA) were identified by comparing the fragmentation patterns obtained from suspect LC-MS measurements using triple quadrupole MS (Agilent 6460) in combination with HPLC (Agilent 1290) with an external standard.

[0121] For the targeted quantification of metabolites, the MRM mode was used. For all test compounds, the required amount was added by gravimetric analysis into 1.5 mL Eppendorf Safe-Lock tubes, and a 10 mM stock solution was prepared by dissolving the test compound in 1 mL of DMSO. For each compound, the stock solution covered a concentration range from 10 mM to 0.039 mM. For metabolite quantification, 300 μL of each bioassay supernatant was added into Eppendorf Safe-Lock tubes. The relevant calibration samples were prepared by adding 300 μL of cell culture medium and 1 μL of the test compound stock solution into Eppendorf Safe-Lock tubes. Subsequently, 300 μL of acetonitrile was added to cause precipitation of the medium components. All samples were centrifuged at 8000 rpm for 4 minutes, and 150 μL of the supernatant was transferred into 1.5 mL glass vials equipped with 200 μL glass inserts for HPLC analysis. 5 μl of the sample was injected for analysis. Acetonitrile containing water and 0.1% formic acid was used as mobile phase A and B, respectively, and HPLC separation was performed at a flow rate of 0.5 mL / min for 5 minutes. The separation was carried out using a Poroshell120 EC-C18 2.7 micron column (Agilent) with a length of 50 mm. The Agilent Jetstream ESI source was set at a gas and gas sheath temperature of 300 °C, a gas flow rate of 10 L / min, and a sheath gas flow rate of 11 L / min. The nebulizer pressure was set at 55 psi, and the capillary voltage was set at 2000 V during operation. The MassHunter software suite (Agilent) was used for instrument control and data acquisition.

[0122] IL4I1 Activity Assay U-87MG and U-251MG cells stably expressing IL4I1 and control transfectants were lysed with 0.1% Triton X-100 / PBS. Human tissues obtained from the resection of metastatic melanoma were lysed with 1% Triton X-100 / PBS by shaking for 2 cycles of 1 minute at 40 Hz with stainless steel beads in a mixer mill MM301. IL4I1 activity was determined by measuring H2O2 production every 60 minutes via Amplex® Red fluorescence (excitation at 530 nm and emission at 590 nm) in black 96-well plates using a CLARIOstar® (BMG LABTECH) plate reader. The reaction was prepared in PBS and contained 50 μM Amplex® Red (Cayman Chemicals, #Cay10010469), 0.1 U / mL HRP (Merck Millipore, #516531), and amino acids as the IL4I1 substrate, as shown in the figure legend. IL4I1-independent H2O2 production was evaluated in the absence of amino acids and subtracted from the activity obtained in the presence of the substrate. H2O2 generation via IL4I1 was calculated using an H2O2 calibration curve (final 0 - 10 μM) and normalized to the sample protein content quantified by the Bradford assay.

[0123] Software and Statistics GraphPad Prism software versions 6.0 and 8.0 were used for the graphical and statistical analysis of gene (real-time PCR) and protein expression data, as well as metabolite data. Unless otherwise specified, the data represent the mean ± S.E.M of at least 3 independent experiments. When the data were represented as fold change, these values were Log10-transformed and the resulting values were used for statistical analysis. Depending on the data, the following statistical analyses were applied: two-sided Student's t-test (paired or unpaired), one-way ANOVA using Tukey's multiple comparison test, and repeated measures ANOVA using Dunnett's multiple comparison test. A significant difference was considered when * p < 0.05, ** p < 0.01, *** p < 0.001,**** It was reported that p < 0.0001. n.s. indicates no significant difference.

[0124] When comparing the expression levels of tryptophan-degrading enzymes in normal (GTEX) and tumor tissues, the inventors found that, similar to IDO1 and TDO2, and other tryptophan-degrading enzymes involved in the activation of AHR, IL4I1 expression was enhanced in cancer tissues compared to normal tissues (Figure 1a, b). The inventors have shown that qRT-PCR of AHR target genes confirmed AHR activation mediated by IL4I1 (Figure 2a). Further confirmation of AHR activation via IL4I1 showed an increase in the nuclear / cytoplasmic localization of AHR in glioblastoma cells treated with the supernatant of IL4I1-expressing cells (Figure 2b). Conversely, knockdown of IL4I1 in glioblastoma cells constitutively expressing IL4I1 decreased the expression of the AHR target gene TIPARP (Figure 2c). Collectively, the inventors' results demonstrate that IL4I1 actually activates AHR.

[0125] Next, the inventors set out to investigate how IL4I1 activates AHR. Consistent with previous reports, the expression of il4I1 decreased the levels of phenylalanine, tyrosine, and tryptophan (Figure 2d), with phenylalanine being the most efficiently catabolized (Figure 2e, f). IL4I1 converts phenylalanine, tyrosine, and tryptophan to phenylpyruvic acid (PP), hydroxyphenylpyruvic acid (HPP), and indole-3-pyruvic acid (I3P), respectively (1). Therefore, the inventors exposed AHR-proficient glioblastoma cells to these metabolites and investigated whether they activated AHR. PP and HPP did not induce the relevant regulation of AHR target genes, but gene expression analysis revealed significant regulation of AHR-activated signature genes in response to I3P, which is AHR-dependent (Figure 2g, h). Concomitantly, nuclear translocation of AHR was observed only in response to I3P (Figure 2i). In summary, the inventors' results indicate that IL4I1 activates AHR mainly through the production of I3P, which is consistent with the findings from microbiota-derived I3P and I3P produced by D-amino acid oxidase and aspartate aminotransferase (22-25).

[0126] IL4I1-expressing cells showed high levels of PP and HPP and their downstream metabolites phenylacetic acid (PAA), 4-hydroxybenzaldehyde (HBA), and hydroxyphenylacetic acid (HPAA) (Figs. 3a, b). Surprisingly, the inventors were unable to detect I3P (Figs. 3c, d). However, the inventors detected an increase in the levels of compounds derived from I3P, including indole acetic acid (IAA), indole-3-carboxaldehyde (I3CA), and indole-3-lactic acid (ILA) (Figs. 3c, d), suggesting that the metabolic flux through I3P is very fast. Furthermore, the level of kynurenic acid was increased in the supernatant of IL4I1-expressing cells (Figs. 3c, d). Treatment of glioblastoma cells with increasing concentrations of I3P led to a dose-dependent increase in IAA, I3CA, and kynurenic acid in the cell supernatant (Fig. 4a). One reaction by which IL4I1 can increase the level of kynurenic acid is through the aminotransfer of the amino group of kynurenine (produced by IDO1 and / or TDO2) because kynurenine aminotransferase can use I3P, PP, or HPP as an amino group acceptor (26). However, the kynurenine concentration did not decrease in IL4I1-expressing cells, and this hypothesis seemed unlikely (Figs. 3c, d). Kynurenic acid is spontaneously formed from I3P and enhanced in the presence of H2O2 (Fig. 4b), suggesting that H2O2, which is produced simultaneously with I3P by IL4I1, promotes the conversion to kynurenic acid. Indeed, the generation of kynurenic acid from I3P via tryptophan aminotransfer in rat tissues has been previously described (27). The inventors did not observe the associated induction of the AHR target gene TIPARP in response to IAA or I3L (Figs. 4c, d), but I3CA (Fig. 4e) and kynurenic acid (Fig. 4f) induced the TIPARP transcript. Activation of AHR mediated by kynurenic acid was confirmed by nuclear translocation of AHR (Fig. 4g). In summary, the inventors' data suggest that IL4I1 activates AHR via downstream products of I3P, including kynurenic acid and I3CA, to produce a mixture of AHR-activating compounds.

[0127] References 1 Mason, J. M. et al. IL-4-induced gene-1 is a leukocyte L-amino acid oxidase with an unusual acidic pH preference and lysosomal localization. J Immunol 173, 4561-4567 (2004). 2 Chavan, S. S. et al. Characterization of the human homolog of the IL-4 induced gene-1 (Fig1). Biochim Biophys Acta 1576, 70-80 (2002). 3 Chu, C. C. & Paul, W. E. Fig1, an interleukin 4-induced mouse B cell gene isolated by cDNA representational difference analysis. Proc Natl Acad Sci U S A 94, 2507-2512 (1997). 4 Boulland, M. L. et al. Human IL4I1 is a secreted L-phenylalanine oxidase expressed by mature dendritic cells that inhibits T-lymphocyte proliferation. Blood 110, 220-227, doi:10.1182 / blood-2006-07-036210 (2007). 5 Carbonnelle-Puscian, A. et al. The novel immunosuppressive enzyme IL4I1 is expressed by neoplastic cells of several B-cell lymphomas and by tumor-associated macrophages. Leukemia 23, 952-960, doi:10.1038 / leu.2008.380 (2009). 6 Lasoudris, F. et al. IL4I1: an inhibitor of the CD8(+) antitumor T-cell response in vivo. Eur J Immunol 41, 1629-1638, doi:10.1002 / eji.201041119 (2011). 7 Santarlasci, V. et al. Rarity of human T helper 17 cells is due to retinoic acid orphan receptor-dependent mechanisms that limit their expansion. Immunity 36, 201-214, doi:10.1016 / j.immuni.2011.12.013 (2012). 8 Cousin, C. et al. The immunosuppressive enzyme IL4I1 promotes FoxP3(+) regulatory T lymphocyte differentiation. Eur J Immunol 45, 1772-1782, doi:10.1002 / eji.201445000 (2015). 9 Esser, C., Rannug, A. & Stockinger, B. The aryl hydrocarbon receptor in immunity. Trends Immunol 30, 447-454, doi:S1471-4906(09)00131-8 [pii]10.1016 / j.it.2009.06.005 (2009). 10 Marshall, N. B. & Kerkvliet, N. I. Dioxin and immune regulation: emerging role of aryl hydrocarbon receptor in the generation of regulatory T cells. Annals of the New York Academy of Sciences 1183, 25-37, doi:10.1111 / j.1749-6632.2009.05125.x (2010). 11 Veldhoen, M. et al. The aryl hydrocarbon receptor links TH17-cell-mediated autoimmunity to environmental toxins. Nature 453, 106-109, doi:nature06881 [pii] 10.1038 / nature06881 (2008). 12 Platten, M., Nollen, E. A. A., Rohrig, U. F., Fallarino, F. & Opitz, C. A. Tryptophan metabolism as a common therapeutic target in cancer, neurodegeneration and beyond. Nature reviews. Drug discovery, doi:10.1038 / s41573-019-0016-5 (2019). 13 Rothhammer, V. & Quintana, F. J. The aryl hydrocarbon receptor: an environmental sensor integrating immune responses in health and disease. Nat Rev Immunol, doi:10.1038 / s41577-019-0125-8 (2019). 14 Carvalho, B., Bengtsson, H., Speed, T. P. & Irizarry, R. A. Exploration, normalization, and genotype calls of high-density oligonucleotide SNP array data. Biostatistics 8, 485-499, doi:10.1093 / biostatistics / kxl042 (2007). 15 Ritchie, M. E. et al. limma powers differential expression analyses for RNA-sequencing and microarray studies. Nucleic Acids Res 43, e47, doi:10.1093 / nar / gkv007 (2015). 16 Colaprico, A. et al. TCGAbiolinks: an R / Bioconductor package for integrative analysis of TCGA data. Nucleic Acids Res 44, e71, doi:10.1093 / nar / gkv1507 (2016). 17 Li, B. & Dewey, C. N. RSEM: accurate transcript quantification from RNA-Seq data with or without a reference genome. BMC bioinformatics 12, 323, doi:10.1186 / 1471-2105-12-323 (2011). 18 Yang, X. et al. A public genome-scale lentiviral expression library of human ORFs. Nat Methods 8, 659-661, doi:10.1038 / nmeth.1638 (2011). 19 Lorenz, M. A., Burant, C. F. & Kennedy, R. T. Reducing time and increasing sensitivity in sample preparation for adherent mammalian cell metabolomics. Anal Chem 83, 3406-3414, doi:10.1021 / ac103313x (2011). 20 Ivanisevic, J. et al. Toward 'omic scale metabolite profiling: a dual separation-mass spectrometry approach for coverage of lipid and central carbon metabolism. Anal Chem 85, 6876-6884, doi:10.1021 / ac401140h (2013). 21 Yang, Y. et al. Relation between chemotaxis and consumption of amino acids in bacteria. Mol Microbiol 96, 1272-1282, doi:10.1111 / mmi.13006 (2015). 22 Aoki, R., Aoki-Yoshida, A., Suzuki, C. & Takayama, Y. Indole-3-Pyruvic Acid, an Aryl Hydrocarbon Receptor Activator, Suppresses Experimental Colitis in Mice. J Immunol 201, 3683-3693, doi:10.4049 / jimmunol.1701734 (2018). 23 Bittinger, M. A., Nguyen, L. P. & Bradfield, C. A. Aspartate aminotransferase generates proagonists of the aryl hydrocarbon receptor. Mol Pharmacol 64, 550-556, doi:10.1124 / mol.64.3.550 (2003). 24 Chowdhury, G. et al. Structural identification of Diindole agonists of the aryl hydrocarbon receptor derived from degradation of indole-3-pyruvic acid. Chem Res Toxicol 22, 1905-1912, doi:10.1021 / tx9000418 (2009). 25 Nguyen, L. P. et al. D-amino acid oxidase generates agonists of the aryl hydrocarbon receptor from D-tryptophan. Chem Res Toxicol 22, 1897-1904, doi:10.1021 / tx900043s (2009). 26 Han, Q., Li, J. & Li, J. pH dependence, substrate specificity and inhibition of human kynurenine aminotransferase I. Eur J Biochem 271, 4804-4814, doi:10.1111 / j.1432-1033.2004.04446.x (2004). 27 Russi, P., Carla, V. & Moroni, F. Indolpyruvic acid administration increases the brain content of kynurenic acid. Is this a new avenue to modulate excitatory amino acid receptors in vivo? Biochem Pharmacol 38, 2405-2409 (1989).

Claims

**Claim 1** A method for detecting the regulation of the aryl hydrocarbon receptor (AHR) in a cell or a subject, comprising detecting a change in the biological state of interleukin 4-induced gene 1 (IL4I1) in a biological sample derived from the cell or the subject, wherein the change when compared to a healthy control sample or an internal standard of the biological state of IL4I1 in the biological sample indicates the regulation of AHR related to IL4I1 in the cell or the subject. **Claim 2** The method according to claim 1, wherein the regulation is selected from activation or suppression of AHR. **Claim 3** The regulation indicates the physiological or pathological state related to AHR in the cell or the subject, and the physiological or pathological state is selected from poisoning, cancer, autoimmune diseases, degeneration, inflammation, infectious diseases, metabolic diseases and conditions, angiogenesis, drug metabolism, hematopoiesis, lipid metabolism, cell motility, immune regulation, and stress states selected from biological, mechanical and environmental stresses, the method according to any one of claims 1 or 2. **Claim 4** The detected biological state is selected from mutation, nucleic acid methylation, copy number, expression, protein amount, protein modification, subcellular localization, metabolites produced by IL4I1, and biological activity of IL4I1 of IL4I1, the method according to any one of claims 1 to 3. **Claim 5** The method according to claim 4, wherein the metabolite produced by IL4I1 is a tryptophan degradation product. **Claim 6** The method according to any one of claims 1 to 5, wherein the biological sample is selected from a sample containing body fluid, mammalian cells, tissues, whole blood, cell lines, cell supernatants, primary cells, iPSCs, hybridomas, recombinant cells, stem cells, and cancer cells, bone cells, chondrocytes, nerve cells, glial cells, epithelial cells, skin cells, scalp cells, lung cells, mucosal cells, muscle cells, skeletal muscle cells, striated muscle cells, smooth muscle cells, heart cells, secretory cells, adipocytes, blood cells, red blood cells, basophils, eosinophils, monocytes, lymphocytes, T cells, B cells, neutrophils, NK cells, regulatory T-cells, dendritic cells, Th17 cells, Th1 cells, Th2 cells, bone marrow cells, macrophages, monocyte-derived stromal cells, bone marrow cells, spleen cells, thymocytes, pancreatic cells, egg cells, sperm, kidney cells, fibroblasts, intestinal cells, cells of the female or male reproductive tract, prostate cells, bladder cells, eye cells, corneal cells, retinal cells, sensory cells, keratinocytes, hepatocytes, brain cells, kidney cells, and colon cells, and transformed ones of the cells or tissues.

7. The method according to any one of claims 1 to 6, wherein the subject is a human subject.

8. The method according to any one of claims 1 to 5, wherein the biological state of IL4I1 in the biological sample is compared with a healthy control sample selected from a sample from a healthy subject or a group of subjects.

9. A method for screening for at least one modulator of the biological state of IL4I1, comprising contacting at least one candidate modulator compound with a biological sample and detecting the biological regulation of IL4I1 or the gene encoding IL4I1, wherein the regulation or activity identifies a modulator of the biological state, the method further comprising detecting a change in the biological state of IL4I1 in the biological sample, wherein the change in the biological state of IL4I1 in the presence of the at least one modulator as compared to in the absence of the at least one modulator identifies the modulator, and the method further comprising detecting the regulation of AHR.

10. The method according to claim 9, wherein the detected biological state of IL4I1 is selected from the group consisting of mutation, nucleic acid methylation, copy number, expression, protein amount, protein modification, cellular localization, metabolites produced by IL4I1, and biological activity of IL4I1.

11. The method according to claim 10, wherein the metabolite produced by IL4I1 is a tryptophan degradation product.

12. The method according to any one of claims 9 to 11, wherein the modulator is selected from inhibitors or inducers of the biological state of IL4I1.

13. The method according to any one of claims 9 to 12, wherein the compound is selected from protein domains, small molecule compounds, peptides, antibodies, probiotics, nutrients, herbal compositions, plant extracts, volatile compounds, homeopathic substances, fragrances, pharmaceuticals, vaccines, compounds or compound mixtures derived from organisms, compounds used in the food or cosmetic industries, and libraries of said compounds.

14. The method according to claim 13, wherein the antibody is selected from monoclonal antibodies that bind to IL4I1, and / or the organism is selected from the group consisting of animals, plants, fungi, bacteria, and archaea.

15. A method for monitoring the regulation of the biological state of AHR in response to at least one compound, comprising performing the method according to any one of claims 1 to 8 on a biological sample contacted with an amount of at least one compound, wherein the biological sample is compared with a control sample that has not been contacted with the amount of the compound.

16. The method according to claim 15, wherein the biological sample is obtained through a treatment process and / or is compared with a suitable control sample or a sample derived from a group of subjects or patients.

17. The method according to any one of claims 1 to 16, wherein the comparison is used for clustering without monitoring the biological sample into subgroups of IL4I1 regulation or classification with monitoring.

18. The method according to claim 17, wherein the comparison is used for clustering without monitoring the biological sample into subgroups of IL4I1 regulation or classification with monitoring, and for clustering without monitoring the biological sample into different subgroups of AHR regulation or classification with monitoring. The method according to any one of claims 17 or 18, further comprising the step of classifying the subject into a specific group or patient group of interest.

20. A diagnostic kit comprising materials for performing the method according to any one of claims 1 to 19 in one or separate containers.

21. The diagnostic kit according to claim 20, wherein the materials are for performing the method according to any one of claims 1 to 19 in one or separate containers together with adjuvants and / or instructions for performing the method.

22. Use of the method according to any one of claims 1 to 19 in a diagnostic kit according to any one of claims 20 or 21.

Citation Information

Patent Citations

  • Methods for the treatment and the prognosis of cancer

    WO2010066858A1

  • Treating respiratory diseases by targeting interleukin 4 induced 1 (IL4I1)

    WO2017189353A1