siRNA expression vector
A nucleic acid construct with a 5' LTR, packaging signal, desired gene, post-transcriptional regulatory element, and siRNA generation sequence forms a retroviral vector to express a gene and suppress endogenous genes, addressing inefficiencies in existing vectors and enhancing gene expression and knockdown efficacy.
Patent Information
- Application Number
- JP2021551732
- Authority / Receiving Office
- JP · JP
- Patent Type
- Patents
- Current Assignee / Owner
- Priority Date
- 2019-10-11
- Filing Date
- 2020-10-09
- Publication Date
- 2025-08-04
- Estimated Expiration
- 2040-10-09
AI Technical Summary
Existing retroviral vectors are inefficient in expressing a desired gene and suppressing the expression of specific endogenous genes using RNA interference.
A nucleic acid construct comprising a 5' LTR, packaging signal, desired gene, post-transcriptional regulatory element, siRNA generation sequence forming a stem-loop structure, and 3' LTR, which integrates into retroviral vectors to express a gene and induce RNA interference, specifically targeting endogenous genes for suppression.
The construct efficiently expresses a desired gene and suppresses the expression of specific endogenous genes, facilitating protein production, disease treatment, and research through enhanced gene knockdown.
Smart Images

Figure 0007717611000002 
Figure 0007717611000003 
Figure 0007717611000004
Abstract
Description
Technical Field
[0001] The present invention relates to a nucleic acid construct that generates siRNA inducing RNA interference in mammalian cells and expresses a desired gene, a retroviral vector for introducing the nucleic acid construct into cells, a nucleic acid construct for producing the vector, a method for producing gene-introduced cells using the vector, and cells containing the nucleic acid construct.
Background Art
[0002] RNA interference (RNAi) is a phenomenon in which double-stranded RNA (hereinafter referred to as "dsRNA") consisting of a sense RNA composed of a sequence homologous to the mRNA of a target gene and an antisense RNA composed of a sequence complementary thereto is introduced into cells or the like, inducing the destruction of the mRNA of the target gene and suppressing the expression of the target gene. RNA interference has attracted attention as a simple method for inhibiting gene function or as a method applicable to gene therapy. RNA interference was originally discovered in Caenorhabditis elegans (see Non-Patent Document 1), and is now observed in various organisms such as plants, protozoa, insects, and mammals. The suppression of gene expression by RNA interference is called gene knockdown.
[0003] Subsequent studies have shown that dsRNA is cleaved by RNase III known as Dicer to generate siRNA (short interfering RNA) of around 20 bases, and that siRNA is involved in the cleavage of the target RNA. It has also been clarified that it is important for efficient cleavage of the target RNA that the 3' end of the siRNA protrudes by 2 or 3 bases in the state where the siRNA forms a double strand (see Non-Patent Document 2). These siRNAs bind to a protein complex called RISC (RNA induced silencing complex), and the RISC bound with the siRNA cleaves the mRNA of the target gene in a sequence-specific manner. siRNA is considered to suppress the expression of the target gene by such a process.
[0004] In addition, it has been reported that siRNA is generated from a single-stranded short hairpin (hereinafter referred to as "sh") RNA that forms a stem-loop structure and is effective in inducing RNA interference (Non-Patent Document 3). From this result, currently, vectors expressing shRNA have become important tools for the analysis and utilization of RNA interference.
[0005] Retroviral vectors that generate siRNA and express a desired gene have been reported in Patent Document 1. However, the development of more efficient vectors is desired.
Prior Art Documents
Non-Patent Documents
[0006]
Non-Patent Document 1
Non-Patent Document 2
Non-Patent Document 3
Patent Documents
[0007]
Patent Document 1
Summary of the Invention
Problems to be Solved by the Invention
[0008] An object of the present invention is to provide a retroviral vector for introducing and expressing a foreign gene into a cell and further transcribing an RNA that induces RNA interference in the cell to suppress the expression of a specific endogenous gene.
Means for Solving the Problems
[0009] As a result of intensive efforts to solve the above problems, the present inventors have found a retroviral vector capable of achieving both the expression of an introduced gene and the suppression of the expression of an endogenous gene by RNA interference, and completed the present invention.
[0010] That is, to outline the present invention, [1] A nucleic acid construct for expressing a desired gene, which in order from the 5'-end, (a) A 5' LTR (Long Terminal Repeat) sequence derived from a retrovirus, (b) A packaging signal sequence (ψ) derived from a retrovirus, (c) A sequence of a desired gene or a multiple cloning site, (d) A post-transcriptional regulatory element (PRE), (e) An siRNA generation sequence that forms at least one stem-loop structure and transcribes an RNA that induces RNA interference in mammalian cells, and (f) A 3' LTR sequence derived from a retrovirus, and a nucleic acid construct containing each sequence. [2] The nucleic acid construct according to [1], wherein the PRE is a PRE (WPRE) derived from woodchuck hepatitis virus. [3] The nucleic acid construct according to [1], which contains a sequence of an exogenous promoter on the 5'-side of the sequence of a desired gene. [4] The nucleic acid construct according to [1], wherein the desired gene is a gene encoding a T cell receptor (TCR) or a chimeric antigen receptor (CAR). [5] The nucleic acid construct according to [4], wherein the desired gene is a gene encoding a TCRα chain and a TCRβ chain linked by a 2A peptide. [6] The nucleic acid construct according to [1], wherein the siRNA generation sequence is a sequence that acts on the mRNA encoding the constant region of the wild-type TCR to generate an siRNA that suppresses the expression. [7] The gene encoding a TCR in which a mutation has been introduced into the nucleotide sequence of the constant region of the desired gene, and the gene encoding the TCR into which the mutation has been introduced is not suppressed in expression by the siRNA, the nucleic acid construct according to [6]. [8] The nucleic acid construct according to [1], wherein the siRNA generating sequence is a sequence that generates an siRNA that acts on the mRNA encoding a molecule that suppresses the activity of immune cells and suppresses the expression. [9] A retroviral vector containing a transcript from the nucleic acid construct according to any one of [1] to [8].
[10] The retroviral vector according to [9], comprising a 5'LTR, a packaging signal sequence, and a 3'LTR derived from an oncoretrovirus or a lentivirus.
[11] A method for producing a retroviral vector, comprising the step of introducing the nucleic acid construct according to any one of [1] to [8] into a cell having the ability to produce retroviral particles.
[12] A method for producing a gene-introduced cell, comprising the step of introducing the retroviral vector according to [9] or
[10] into a cell.
[13] The method for producing a gene-introduced cell according to
[12] , wherein the cell is a T cell, a cell capable of differentiating into a T cell, or a cell population containing them.
[14] A cell containing the nucleic acid construct according to any one of [1] to [8].
[15] The gene-introduced cell according to
[14] , wherein the cell is a T cell, a cell capable of differentiating into a T cell, or a cell population containing them. [Effect of the Invention]
[0011] According to the present invention, there are provided a nucleic acid construct having the ability to efficiently express a desired gene and efficiently suppress the expression of a specific endogenous gene, a retroviral vector for introducing the nucleic acid construct into a cell, a nucleic acid construct for producing the vector, a method for producing a gene-introduced cell using the vector, and a cell containing the nucleic acid construct. These nucleic acid constructs, retroviral vectors, and cells are extremely useful for protein production, treatment of diseases by cell therapy, and research and testing therefor. [Brief Explanation of Drawings]
[0012]
Figure 1
Figure 2
Figure 3
Figure 4
Figure 5
Figure 6
Mode for Carrying Out the Invention
[0013] As used herein, the term "nucleic acid construct" means a nucleic acid comprising a sequence constructed to contain one or more functional units not found in nature. The nucleic acid may be DNA and / or RNA, and may also include modified nucleic acids. Examples of the shape include circular, linear, double-stranded, single-stranded, extrachromosomal DNA molecules (plasmids), cosmids, and the like. In addition, the nucleic acid construct may include a nucleic acid sequence containing a control sequence (e.g., a promoter) operably linked (i.e., capable of controlling transcription and translation) as necessary in addition to the nucleic acid sequence encoding the gene. This nucleic acid construct may include other regulatory elements, functional sequences, linkers, etc. as necessary.
[0014] As used herein, "LTR (Long Terminal Repeat)" refers to a sequence consisting of 100 to 1000 base pairs repeated at both ends of proviral DNA such as retroviruses and retrotransposons. The LTR is composed of regions U3, R, and U5 involved in transcription of viral genes, reverse transcription from the viral genome, and integration of the double-stranded DNA synthesized through reverse transcription into the host DNA. The IR sequences (inverted repeat region) at the 5' and 3' ends of the provirus are 4 to 20 base pairs in length. U3 contains enhancer sequences and promoter sequences for transcription.
[0015] As used herein, the "packaging signal sequence" is also referred to as the "psi sequence" or "ψ sequence", and means a non-coding cis-acting sequence necessary for capsid formation of the retroviral RNA strand and packaging into viral particles in the formation of viral particles. For example, it is a region from the 3' side of the major splice donor (SD) site to the gag start codon, or a region containing a part of gag from the 3' side of the SD site.
[0016] As used herein, the "splice acceptor (SA) sequence" means the splice site at the 3'-terminal side of the intron among the splice sites at the boundary between the intron and exon in an RNA processing reaction that removes the intron present in the RNA and rejoins the exons before and after it. For example, a consensus sequence of AG exists at the 3'-terminal of the intron of the RNA precursor present in the nucleus, and the 3'-terminal side of the AG sequence is the SA sequence. Conversely, the "splice donor (SD) sequence" means the splice site present at the 5'-terminal of the intron. For example, a consensus sequence of GU exists at the 5'-terminal of the intron of the RNA precursor present in the nucleus, and the 5'-terminal side of the GU sequence is the SD sequence. The characteristics of the consensus sequences of the SA sequence and SD sequence of the intron contained in the eukaryotic mRNA precursor are called the GU-AG rule. An SA sequence or SD sequence with a mutation introduced into the consensus sequence is also included in the SA sequence or SD sequence of this specification if it functions in the RNA processing reaction.
[0017] As used herein, the "gene of interest" means a foreign gene that is desired to be artificially (by artificial manipulation) inserted either transiently or permanently into a cell (e.g., the cell nucleus genome or cytoplasm). Such genes include genes that are completely or partially heterologous to the cell to be introduced, and also include genes having any mutations. It can also be the same gene as the endogenous gene naturally possessed by the cell. Here, "naturally" means a natural state without artificial manipulation.
[0018] As used herein, the "posttranscriptional regulatory element (PRE)" refers to a sequence that contributes to the promotion of polyadenylation of mRNA transcribed from a gene in a cell, the promotion of nuclear export of mRNA, or the activation of translation of mRNA. By inserting it into the untranslated region of the gene of interest contained in the nucleic acid construct of the present invention, the protein-level expression of the gene of interest is improved.
[0019] As used herein, "wild type" means the one most frequently observed in a population among the gene or gene product isolated from a naturally occurring source. This can be isolated from nature or artificially produced. On the other hand, "mutant type" refers to a gene or gene product whose sequence and / or functional characteristics have been modified when compared with the wild-type gene or gene product. Mutant genes are produced by natural mutations or by artificially modifying the gene to mutate the sequence.
[0020] As used herein, the term "T cell", also referred to as T lymphocyte, means a cell derived from the thymus among lymphocytes involved in the immune response. T cells include helper T cells, suppressor T cells, regulatory T cells, CTLs, naive T cells, memory T cells, αβ T cells expressing TCR of α and β chains, and γδ T cells expressing TCR of γ and δ chains. The "cells capable of differentiating into T cells" are not particularly limited as long as they can differentiate into T cells in vivo or by artificial stimulation. Examples include hematopoietic stem cells, pluripotent progenitor cells, lymphoid common progenitor cells, T cell progenitor cells, etc. Examples of the "cell population containing T cells or cells capable of differentiating into T cells" include cell populations containing blood (peripheral blood, cord blood, etc.), bone marrow fluid, and peripheral blood mononuclear cells (PBMC), blood cell lineage cells, hematopoietic stem cells, cord blood monocytes, etc., which are collected, isolated, purified, or induced from these. In addition, various cell populations derived from blood cell lineage cells containing T cells can be used in the present invention. These cells may be activated in vivo (in vivo) or in vitro (ex vivo) by cytokines such as anti-CD3 antibody and IL-2. These cells can be either those collected from a living body or those obtained through in vitro culture. For example, a T cell population obtained from a living body can be used as it is or after cryopreservation.
[0021] As used herein, the term "suppression of expression" means suppressing the production of the final polypeptide by preventing transcription and / or translation from the gene encoding the polypeptide, that is, the amount of the polypeptide as a product decreases. Therefore, even if the transcription reaction from the gene encoding the polypeptide is not suppressed, if the transcript (mRNA) is rapidly degraded and protein production is suppressed, it is included in the "suppression of expression". The state where expression is suppressed is a state where the expression level is reduced by 20% or more, 40% or more, 60% or more, or 80% or more, or 100% reduction, that is, a completely suppressed state, compared with the case where it is not suppressed.
[0022] Hereinafter, the present invention will be specifically described. (1) The nucleic acid construct of the present invention The nucleic acid construct of the present invention is a nucleic acid construct for expressing a desired gene, which, in order from the 5'-end, (a) a 5' LTR (Long Terminal Repeat) sequence derived from a retrovirus, (b) a packaging signal sequence (ψ) derived from a retrovirus, (c) the sequence of a desired gene or a multiple cloning site, (d) a post-transcriptional regulatory element (PRE), (e) an siRNA generation sequence that forms at least one stem-loop structure and transcribes an RNA that induces RNA interference in mammalian cells, (f) a 3' LTR sequence derived from a retrovirus. The nucleic acid construct of the present invention enables suppression of the expression of a specific endogenous gene and expression of the introduced desired gene in a cell by introducing at least one nucleic acid construct into the cell. The nucleic acid construct of the present invention has a high siRNA generation efficiency and / or a high expression efficiency of the desired gene. Therefore, it can be used for the purpose of suppressing the expression of an endogenous mutant gene and replacing it with another gene that newly introduces a function of a gene expressed in a cell, such as expressing the introduced wild-type gene.
[0023] The nucleic acid construct of the present invention can be used for producing retroviral vectors. By introducing the nucleic acid construct of the present invention into cells having the ability to generate retroviral particles, retroviral vectors of the present invention containing transcripts from the nucleic acid construct can be produced. Retroviruses are single-stranded RNA viruses, and the viral genome contains, as major elements, a 5' LTR sequence, an SD sequence, a packaging signal sequence, a gag gene, a pol gene, an SA sequence, an env gene, and a 3' LTR sequence from its 5' end. In the case of lentiviruses described later, a plurality of accessory genes are included in addition to these elements. Among these, in the gene transfer system using retroviral vectors, the 5' LTR sequence, the packaging signal sequence, and the 3' LTR sequence are essential for retroviral vectors, and the nucleic acid of the present invention has all of these. Other gene products such as gag, pol, and env can be supplied from packaging cells retaining these genes. Usually, a desired gene is placed on the 3' side of the packaging signal sequence of the retroviral vector, or on the 3' side of the packaging signal sequence and the SA sequence when it has an SA sequence.
[0024] The (a) 5' LTR sequence, (f) 3' LTR sequence, and (b) packaging signal sequence contained in the nucleic acid construct of the present invention are sequences derived from retroviruses, and any sequences can be used as long as they are sequences capable of producing retroviruses containing RNA having these sequences as a genome. Retroviruses include subclasses of oncoretroviruses and lentiviruses, and sequences derived from viruses of any class can be used in the present invention. These sequences may be derived from the same virus, but they may also be used in combination with sequences derived from different viruses within the range that allows the formation of virus particles and integration into the genome of the introduced cells by an appropriate combination with packaging cells.
[0025] For the LTR sequence and packaging signal sequence used in the present invention, for example, sequences derived from Moloney murine leukemia virus (MMLV), murine embryonic stem cell virus (MESV), murine stem cell virus (MSCV), myeloproliferative sarcoma virus (MPSV), and spleen focus-forming virus (SFFV), which belong to oncoretroviruses, can be used. Although oncoretrovirus-derived viral vectors can introduce genes with high efficiency, cells need to be actively undergoing cell division during the introduction of the vectors. These oncoretroviral vectors have been described in numerous documents [e.g., U.S. Patent No. 5,219,740, U.S. Patent No. 6,207,453, U.S. Patent No. 5,219,740, BioTechniques, Vol. 7, pp. 980-990 (1989), Human Gene Therapy, Vol. 1, pp. 5-14 (1990), Virology, Vol. 180, pp. 849-852 (1991), Proc. Natl. Acad. Sci. USA, Vol. 90, pp. 8033-8037 (1993), and Cur. Opin. Genet. Develop., Vol. 3, pp. 102-109 (1993)].
[0026] In addition, for the LTR sequence and packaging signal sequence used in the present invention, for example, sequences derived from human immunodeficiency virus (HIV-1, HIV-2), simian immunodeficiency virus (SIV), feline immunodeficiency virus (FIV), equine infectious anemia virus (EIAV), and caprine arthritis encephalitis virus (CAEV), which belong to lentiviruses, can be used. Lentiviral vectors can introduce genes into the genome in the nucleus regardless of the mitosis of the cells into which the genes are introduced. Lentiviral vectors have also been described in numerous documents [e.g., J. Virology, Vol. 72, pp. 8463-8471 (1998)]. Other groups of retroviruses, such as the spumavirus genus (e.g., foamy virus), can also efficiently transduce non-dividing cells.
[0027] For the LTR sequences used in the present invention, LTR sequences with mutated sequences can also be used. Functionally, LTRs are divided into three regions: U3, R, and U5 from the 5'-end. The U3 region has enhancer / promoter activity, and the viral genome is transcribed from the R region of the 5'-LTR sequence to the R region of the 3'-LTR sequence by the host cell RNA polymerase II. LTR sequences in which the U3 region of the 3'-LTR sequence and / or the 5'-LTR sequence is replaced with an enhancer / promoter derived from a virus other than the virus from which the LTR sequence is derived can also be used in the present invention. As the exogenous enhancer / promoter to be replaced, sequences derived from viruses or mammals can be used, and constitutive, inducible or tissue-specific enhancer / promoters can be used. For example, enhancer / promoters derived from viruses such as human cytomegalovirus (HCMV) immediate early, Moloney murine sarcoma virus (MMSV), mouse stem cell virus (MSCV), Rous sarcoma virus (RSV), spleen focus-forming virus (SFFV), and enhancer / promoters derived from mammals such as β-actin, globin, elastase, albumin, α-fetoprotein, and insulin genes can be used.
[0028] The LTR sequences used in the present invention can use a 5' LTR sequence and / or a 3' LTR sequence in which a mutation is introduced into the U3 region to delete enhancer / promoter activity. By introducing a mutation into the U3 region of the 3' LTR sequence contained in a nucleic acid construct for producing a retroviral vector to delete enhancer / promoter activity, transcription from the R region in the provirus formed by integration of the viral genome containing the transcript from this nucleic acid construct into the chromosome is suppressed. A retroviral vector with the U3 region of the 3' LTR sequence thus mutated is called a self-inactivating (SIN) vector. Introduction of a mutation into the 3' LTR sequence is carried out by base substitution or deletion. Since transcription from the R region of the LTR in the provirus is suppressed in the SIN vector, a promoter sequence for expressing a desired gene needs to be arranged separately from the LTR. Further, even when expressing a plurality of desired genes, a promoter sequence different from the LTR is arranged. Such a promoter sequence existing between the 5' LTR and the 3' LTR may be referred to as an internal promoter sequence. As the internal promoter sequence, a promoter sequence derived from a virus or a mammalian gene can be used. When using a promoter sequence derived from a virus, a sequence derived from the same virus as the virus from which the 5' LTR, 3' LTR or packaging signal sequence is derived or a sequence derived from a different virus can be used. For example, a promoter sequence derived from the U3 region of the LTR of a retrovirus, for example, a promoter sequence derived from the U3 region of the LTR of murine stem cell virus (MSCV), etc. can be used. Also, as the internal promoter sequence, a sequence exemplified as an exogenous promoter that replaces the U3 region of the 5' LTR sequence in the previous paragraph can be used. As the promoter sequence derived from a virus, in addition to the above, sequences such as the SV40 promoter, the CMV promoter, etc. can be used. Further, sequences such as the PGK promoter, the EF1-α promoter, the β-actin promoter, the CAG promoter, etc., which are promoters functioning in mammalian cells, can also be used. Note that the internal promoter may be arranged upstream of (c), and can be arranged between (a) and (c), preferably between (b) and (c).
[0029] The nucleic acid construct of the present invention may contain an SD sequence and / or an SA sequence, and the SD sequence and / or the SA sequence contained in the mRNA transcribed from the promoter sequence that can be used can be used. In addition, an SD sequence and / or an SA sequence that is exogenous to the promoter sequence to be used, that is, an SD sequence and / or an SA sequence derived from a gene different from the promoter sequence to be used, can be used. "Derived from a different gene" means that each of the above elements is derived from different genes of the same species of virus or mammal, or is derived from different viruses or mammals. Furthermore, an SD sequence and / or an SA sequence derived from the same virus, a different virus, or a mammalian gene from which the 5'LTR, 3'LTR, or packaging signal sequence is derived can be used. Also, the SD sequence and the SA sequence may be sequences derived from different genes. For example, the SD sequence and the SA sequence derived from 16S RNA of simian virus (SV) 40, immediate early RNA of HCMV, and the human hEF1α gene can be used [Proceedings of the National Academy of Sciences of the United States of America, Vol. 95, No. 1, pp. 219-223 (1998)]. In addition, an SD sequence or an SA sequence in which a mutation is introduced into the consensus sequence and the splicing activity is enhanced or suppressed can also be used in the nucleic acid construct of the present invention.
[0030] The siRNA generation sequence in (e) contained in the nucleic acid construct of the present invention forms at least one stem-loop structure and is a sequence from which RNA capable of inducing RNA interference in mammalian cells is transcribed. RNA interference in the present invention aims to selectively suppress the expression of a specific endogenous gene naturally expressed in the cells into which the vector is introduced. RNA interference is induced by siRNA in which an RNA molecule homologous and a complementary RNA molecule to the base sequence of mRNA transcribed from a gene whose expression is desired to be suppressed (hereinafter referred to as a target gene) are annealed.
[0031] The siRNA generation sequence used in the present invention has a sequence (sense sequence) homologous to a certain region of the base sequence of mRNA transcribed from the target gene and a sequence (antisense sequence) complementary thereto arranged in series. A single RNA strand transcribed from the siRNA generation sequence forms a double-stranded structure by annealing the sense sequence and the antisense sequence within the molecule, and forms a stem-loop structure having the formed double-stranded RNA portion as the stem region and an arbitrary sequence arranged between the sense sequence and the antisense sequence as the loop region. In cells, siRNA is generated from this stem region by the action of RNaseIII (Dicer). The strand length of the portion corresponding to the stem region in the siRNA generation sequence is, from the viewpoint of suppressing the interferon response in mammalian cells, for example, 13 to 29 bases, preferably 15 to 25 bases, and more preferably 19 to 25 bases. The loop region may be an arbitrary sequence, and examples of the sequence having a strand length of 1 to 30 bases are given, but preferably a sequence of 1 to 25 bases, and more preferably 5 to 22 bases is used.
[0032] Here, the siRNA generated in cells according to the present invention is composed of RNA having a sequence complementary to RNA having a sequence homologous to a specific base sequence of mRNA transcribed from the target gene, but each RNA does not have to be completely homologous or complementary to the specific base sequence of the above-mentioned mRNA. A siRNA generation sequence composed of RNA that is substantially homologous and RNA having a substantially complementary sequence may be used as long as the function of suppressing the expression of the target gene is exhibited. In addition to the siRNA generation sequence that transcribes one type of siRNA targeting one gene, the siRNA generation sequence used in the present invention may also be one that transcribes a plurality of siRNAs corresponding to the base sequences of different regions of one target gene, or one that transcribes a plurality of siRNAs corresponding to a plurality of target genes. For example, the number of siRNAs generated from the siRNA generation sequence used in the present invention is 1 to 10, 1 to 6, 1 to 4, a plurality, or several.
[0033] As one aspect of the present invention, the transcription of siRNA from the siRNA generation sequence of (e) is achieved by a promoter sequence that controls the expression of the desired gene sequence of (c). That is, no promoter sequence is included between (c) and (e), and the RNA transcribed from the desired gene sequence and the siRNA are transcribed as a series of RNA molecules. As one aspect of the present invention, a new promoter sequence can also be placed between (c) and (e) according to the nature of the promoter sequence and the required siRNA transcription amount.
[0034] The desired gene sequence of (c) contained in the vector of the present invention is the gene sequence to be expressed in the cell into which the vector is introduced. Such gene sequences include, for example, sequences encoding proteins, and sequences encoding RNAs that function in cells such as tRNA and miRNA. The vector of the present invention can be manufactured as a vector in which a sequence (multiple cloning site) in which a plurality of restriction enzyme recognition sequences for ligating the sequence of the desired gene are arranged is placed as sequence (c) in the vector, and then the sequence of the desired gene is inserted using the multiple cloning site. A vector having a multiple cloning site instead of the sequence of the desired gene is also included in the vector of the present invention.
[0035] The siRNA generated from the nucleic acid sequence (e) contained in the vector of the present invention may suppress the gene expression from the sequence (c) by targeting the gene sequence of the sequence (c). When such a phenomenon is expected, in order to prevent this, a mutation can be introduced into the gene sequence of the sequence (c) and modified into a sequence that is not affected by the action of siRNA.
[0036] It is known that there are 1 to 6 codons (combinations of three bases) that specify an amino acid on a gene for each type of amino acid. By selecting an appropriate codon, the bases can be converted (referred to as silent mutation) without changing the encoded amino acid sequence. Silent mutations often occur by converting the third base of the codon. If the desired gene has the same base sequence as the region on the target gene corresponding to the siRNA generated from sequence (e), the siRNA suppresses the expression of both its original target gene and the introduced desired gene. When this silent mutation is introduced into the desired gene to eliminate homology / complementarity with the siRNA sequence, the siRNA does not act on the RNA transcribed from the desired gene, and the suppression of its expression is reduced. As a result, in the region where the siRNA acts, although the amino acid sequences of the polypeptides encoded by the desired gene and the endogenous gene that is the target of the siRNA are the same, the expression of the endogenous gene can be selectively suppressed.
[0037] Furthermore, as another aspect of mutating the nucleotide sequence of a desired gene, with respect to the amino acid sequence encoded by the RNA on which the siRNA acts, within a range that does not impair the function of the polypeptide encoded by the desired gene, the amino acid sequence may be changed by substitution with other amino acids, for example, substitution with similar amino acids. Similar amino acids mean amino acids that are similar in physicochemical properties. For example, aromatic amino acids (Phe, Trp, Tyr), aliphatic amino acids (Ala, Leu, Ile, Val), polar amino acids (Gln, Asn), basic amino acids (Lys, Arg, His), acidic amino acids (Glu, Asp), amino acids having a hydroxyl group (Ser, Thr), amino acids with small side chains (Gly, Ala, Ser, Thr, Met), etc. Amino acids classified into the same group are exemplified. Substitution with such similar amino acids is predicted not to bring about a change in the phenotype of the polypeptide (i.e., it is a conservative amino acid substitution). Specific examples of conservative amino acid substitutions are well known in the art and are described in various documents (see, for example, Bowie et al., Science, Vol. 247, pp. 1306 - 1310 (1990)). When this conservative amino acid substitution mutation is introduced into the desired gene, the siRNA generated from sequence (e) does not act on the RNA transcribed from the desired gene, and the suppression of expression is reduced. Thereby, in the region where the siRNA acts, even though the amino acid sequences of the desired gene and the endogenous polypeptide are similar, the expression of the endogenous polypeptide can be selectively suppressed.
[0038] Hereinafter, in this specification, the gene into which the silent mutation or conservative amino acid substitution mutation has been introduced as described above may be referred to as a "codon - converted type" gene. When converting the above - mentioned nucleotide sequence, although not particularly limiting the present invention, by selecting codons with high usage frequency in the host to be used or sequences that increase translation efficiency and converting the nucleotide sequence, an improvement in the expression efficiency of the desired gene is expected.
[0039] As one aspect of the present invention, the sequence of the desired gene contained in the vector of the present invention is a sequence encoding an oligomeric protein. Oligomeric proteins include structural proteins, enzymes, transcription factors, receptors, and antibodies. In the present invention, the oligomeric protein may be a cell surface protein (membrane protein), and a sequence encoding an antigen recognition receptor exemplified in the examples, for example, a T cell receptor (T cell receptor: TCR), is suitable as the desired gene.
[0040] There are two types of TCRs, a heterodimer (heterodimer) composed of an α chain and a β chain, and a heterodimer composed of a γ chain and a δ chain. Each chain of the TCR consists of a variable (V) region, a joining (J) region, a constant (C) region, and the like. The diversity of the V region of the TCR is caused by the combination and rearrangement of gene segments encoding the V region by DNA rearrangement, the shift of the rearrangement junction site, and the insertion of N sequences into the junction site. In the V regions of the α and β chains, hypervariable regions (CDRs) with particularly high amino acid sequence mutations are observed. As one aspect of the present invention, a sequence in which genes encoding two polypeptides constituting the TCR heterodimer are linked polycistronically can be used as the desired gene. The two genes can be connected to each other via a sequence selected from a sequence encoding a self-cleaving peptide and an IRES (internal ribosomal entry site) sequence. The order of the two genes can be either, and for example, a polycistronic sequence in the order of TCRα chain - TCRβ chain or TCRβ chain - TCRα chain from the 5' end can be used.
[0041] The self-cleaving peptide can be obtained from the 2A peptide of a virus or a 2A-like peptide having an equivalent function thereto. For example, it can be selected from the group consisting of the 2A peptide (F2A) derived from foot-and-mouth disease virus (FMDV), the 2A peptide (E2A) derived from equine rhinitis A virus (ERAV), the 2A peptide (P2A) derived from Porcine teschovirus (PTV-1), and the 2A peptide (T2A) derived from Thosea asigna virus (TaV). For example, P2A having the amino acid sequence encoded by the nucleotide sequence shown in SEQ ID NO: 17 can be used. The 2A peptide is reviewed in Expert Opin Biol Ther, Vol. 5, pp. 627-638 (2005).
[0042] The IRES sequence refers to an element that promotes the ribosome to directly enter the start codon of a cistron (protein-coding region), for example, AUG, thereby initiating cap-independent translation of a gene [Trends Biochem Sci, Vol. 15, No. 12, pp. 477-483 (1990)]. Multiple polypeptides are translated from a single mRNA having multiple cistrons linked by the IRES sequence.
[0043] For example, when introducing an exogenous TCR that recognizes a desired antigen into T cells, the endogenous TCR naturally expressed by the T cells may compete with the exogenous TCR, resulting in a decrease in the expression of the exogenous TCR. Furthermore, side effects such as graft-versus-host disease (GVHD) may occur due to TCRs with mispaired endogenous and exogenous TCRs. Therefore, it is important to suppress the expression of the endogenous TCR. The V region of the endogenous TCR varies among individual TCRs, while the C region is encoded by genes with the same base sequence, which is common to individual TCRs. Therefore, the siRNA generated by sequence (e) is suitable for the target sequence. Furthermore, in order to prevent the suppression of the expression of the exogenous TCR gene into which this siRNA has been introduced, a silent mutation can be introduced into the base sequence encoding the C region in the gene. In this way, the expression of the exogenous TCR can be efficiently carried out.
[0044] For example, when suppressing the expression of the endogenous TCR, although not particularly limited, among the C regions of the genes encoding the TCR, the base sequence AGTAAGGATTCTGATGTGTAT (SEQ ID NO: 1) of the endogenous TCR α chain may be codon-converted to the base sequence AGCAAGGACAGCGACGTGTAC (SEQ ID NO: 2) in the exogenous TCR α chain. The amino acid sequences encoded by the above two base sequences are common as SKDSDVY (SEQ ID NO: 3), but the α chain of the endogenous TCR is selectively suppressed by the siRNA generated by transcription of the artificial gene described in SEQ ID NO: 13. The codon conversion is exemplified in Table 1 described in the examples.
[0045] The sequence for generating siRNA that suppresses the expression of the endogenous TCR can also be combined with the "sequence encoding a chimeric antigen receptor as a desired gene" described later. Such a nucleic acid construct is useful for the preparation of T cells that have lost the cytotoxic activity derived from the TCR and exhibit an action faithful to the specificity of the CAR.
[0046] As one aspect of the present invention, the sequence of the desired gene contained in the nucleic acid construct of the present invention is a sequence encoding a chimeric antigen receptor (CAR). A typical CAR structure is composed of a single-chain antibody (single chain variable fragment: scFv) that recognizes a surface antigen of a tumor cell, a transmembrane domain, and an intracellular domain that activates T cells. As the intracellular domain, the intracellular domain of the TCR complex CD3ζ is preferably used. A CAR having such a configuration is called a first-generation CAR. The gene of the single-chain antibody portion is isolated, for example, from a hybridoma that produces a monoclonal antibody that recognizes a target antigen. T cells expressing CAR can directly recognize the surface antigen of tumor cells regardless of the expression of major histocompatibility antigen class I on the tumor cells, and at the same time activate T cells, thereby efficiently killing tumor cells.
[0047] For the purpose of enhancing the T cell activation ability of the first-generation CAR, a second-generation CAR in which the intracellular domain of a T cell costimulatory molecule is linked has been developed. As the T cell costimulatory molecule, the intracellular domain of CD28, CD137 (4-1BB) or CD134 (OX40) which is a tumor necrosis factor (TNF) receptor superfamily is preferably used. As a further improved type, a third-generation CAR in which the intracellular domains of these costimulatory molecules are tandemly linked has also been developed, and many CAR molecules targeting various tumor antigens have been reported. The nucleic acid construct of the present invention may contain, as the sequence of the desired gene, a sequence encoding any CAR.
[0048] As one aspect of the present invention, the siRNA produced by the nucleic acid contained in the nucleic acid construct of the present invention acts on the mRNA encoding a molecule that suppresses the activity of immune cells (particularly T cells) to suppress its expression. That is, the siRNA targets the gene sequence encoding a molecule that suppresses the activity of immune cells. Known molecules that suppress the activity of immune cells include, in addition to immune checkpoint molecules, NR4A1, NR4A3, TGFBR2, and TET2. Immune checkpoint molecules include, but are not limited to, the following: PD-1 (CD279, GenBank accession number: M_005018), CTLA-4 (CD152, GenBank accession number AF414120.1), LAG 3 (CD223, GenBank accession number: NM_002286.5), Tim3 (HAVCR2, GenBank accession number: JX049979.1), BTLA (CD272, GenBank accession number: NM_181780.3), BY55 (CD160, GenBank accession number: CR541888.1), TIGIT (VSTM3, GenBank accession number: NM_173799), B7H5 (C10orf54, GenBank accession number: NM_022153.1), LAIR1 (CD305, GenBank accession number: CR542051.1), SIGLEC10 (GeneBank accession number: AY358337.1), 2B4 (CD244, GeneBank accession number: NM_001166664.1). For example, CTLA-4 is a cell surface protein expressed on specific CD4 and CD8 T cells. When its ligands (B7-1 and B7-2) on antigen-presenting cells bind to CTLA-4, T cell activation and effector functions are inhibited. Therefore, the vector of the present invention can suppress the suppression of T cell activity, that is, activate T cells. As one aspect of the present invention, the cell into which the nucleic acid construct is introduced is an immune cell containing T cells, and when the sequence of the desired gene is a sequence encoding a CAR, it is preferable to suppress the expression of a molecule that suppresses the activity of immune cells.
[0049] The sequence that generates siRNA which suppresses the expression of a molecule that suppresses T cell activity can also be combined with the aforementioned "sequence encoding TCR as a desired gene". Such a nucleic acid construct is useful for the preparation of TCR-expressing T cells that recognize a specific antigen and can maintain its activity in vivo over a long period of time.
[0050] The (d) post-transcriptional regulatory sequence (PRE) contained in the nucleic acid construct of the present invention is useful for enhancing the expression of a desired gene. PRE is located within the intron of the transcript from the nucleic acid construct and can be removed by splicing in the life cycle of retroviruses. Examples of PREs that are not removed by splicing are the post-transcriptional processing element of herpes simplex virus, the post-transcriptional regulatory sequences of hepatitis B virus (HPRE) and woodchuck hepatitis virus (WPRE). Furthermore, mutants of PRE, for example, mutants in which the expression of X protein is suppressed can also be used in the present invention. WPRE is preferred in the present invention. Reference can be made to U.S. Patent No. 6,136,597 or U.S. Patent No. 7,419,829 for WPRE.
[0051] The nucleic acid construct of the present invention may contain a Rev response element (RRE) sequence and / or a central polypurine tract (cPPT) sequence. Examples of RRE include RRE located at positions 7622 to 8459 of the HIV NL4-3 genome (GenBank accession number: AF003887), RRE derived from other strains of HIV or other retroviruses, but are not limited thereto. In addition, cPPT means a sequence of about 15 bases present approximately in the center of the lentivirus genome, which is a sequence that functions as a primer binding site for plus-strand DNA synthesis during the process of double-stranded DNA synthesis from lentivirus genomic RNA. When the RNA genome of a lentivirus is reverse transcribed, it functions together with the central termination sequence (CTS) to form a three-stranded structure called a DNA flap. In the nucleic acid construct of the present invention, either the arrangement of cPPT and RRE in this order or RRE and cPPT in this order from the 5'-end may be used.
[0052] As one aspect of the present invention, the nucleic acid contained in the vector of the present invention preferably contains, in order from the 5'-end, a 5'LTR sequence, a packaging signal sequence, a cPPT sequence, an RRE sequence, an internal promoter sequence, an SD sequence, an SA sequence, a sequence of a desired gene, a PRE sequence, an siRNA generation sequence, and a 3'LTR sequence.
[0053] In the method of the present invention, as the cell having the ability to generate retroviral particles, an appropriate packaging cell is selected based on the LTR sequence and the packaging signal sequence possessed by the nucleic acid construct, and this is used to prepare retroviral vector particles. These retroviral vector particles contain transcripts from the nucleic acid construct of the present invention. Examples of the packaging cell include PG13 (ATCC CRL-10686), PA317 (ATCC CRL-9078), and the like. In addition, components necessary for retroviral particle production in 293 cells or 293T cells with high transfection efficiency (gag gene, pol gene, env gene, and other accessory genes) are introduced, and these are used as a host (as a cell having the ability to generate retroviral particles) to produce retroviral particles. Packaging cells that can be used for packaging retroviral vectors and plasmid kits for producing retroviruses are widely commercially available from various companies, and these can be used in the method of the present invention.
[0054] The present invention can also use a retrovirus produced by pseudotyped packaging that has an envelope derived from a virus heterologous to the genome of the retroviral vector. For example, a pseudotype retrovirus having an envelope derived from MMLV, gibbon ape leukemia virus (GaLV), vesicular stomatitis virus (VSV), feline endogenous virus, or a protein that can function as an envelope can be used. Furthermore, packaging cells into which an enzyme gene involved in sugar chain synthesis or the like has been introduced can be used to prepare retroviral vector particles having a glycoprotein-modified protein on their surface.
[0055] After culturing the retrovirus-producing cells created by the above operations, the cell culture is centrifuged to recover the supernatant, and contaminants are removed by appropriate filtration operations to obtain retroviral particles. Although these crudely purified retroviral particles can be directly contacted with cells for gene transfer, retroviral particles with higher purity can be prepared through known purification operations and used for gene transfer operations.
[0056] The present invention provides a composition comprising the retroviral vector of the present invention as an active ingredient together with a pharmaceutically acceptable excipient. Suitable pharmaceutically acceptable excipients are well known to those skilled in the art and include, for example, phosphate buffered saline (e.g., 0.01 M phosphate, 0.138 M NaCl, 0.0027 M KCl, pH 7.4), aqueous solutions containing mineral salts such as hydrochloride, hydrobromide, phosphate, sulfate, physiological saline, solutions such as glycol or ethanol, and salts of organic acids such as acetate, propionate, malonate, benzoate. Auxiliary agents such as wetting agents or emulsifiers, and pH buffering agents can also be used. As the pharmaceutically acceptable excipient, those described in Remington’s Pharmaceutical Sciences (Mack Pub. Co., N.J. 1991) (incorporated herein by reference) can be appropriately used. The composition can be in a known form suitable for parenteral administration, for example, injection or infusion. Further, formulation aids such as suspending agents, preservatives, stabilizers and / or dispersing agents can be used, and preservatives can be used to extend the shelf life during storage. The composition may be in a dry form for reconstitution with a suitable sterile liquid prior to use.
[0057] In one aspect of the present invention, the nucleic acid construct of the present invention is a nucleic acid construct for expressing a desired gene, which, in order from the 5'-end, (c) the sequence of the desired gene, (d) a post-transcriptional regulatory sequence (PRE), (e) a siRNA generating sequence in which an RNA that forms at least one stem-loop structure and induces RNA interference in mammalian cells is transcribed, It is a nucleic acid construct containing each of the arrays. Cells containing this nucleic acid construct are also included in the present invention. In these cells, the expression of a specific endogenous gene is suppressed, and a desired gene is expressed. This nucleic acid construct can be introduced into cells using an appropriate vector, such as a plasmid vector, a viral vector other than a retrovirus, or a transposon vector, so as to stably exert an effect intracellularly. Furthermore, it can be integrated onto the chromosomal DNA of cells using genome editing techniques. Also, this nucleic acid construct can be directly introduced into cells. To introduce the nucleic acid construct directly or via a plasmid vector into cells, methods using carriers such as liposomes and ligand-polylysine, the calcium phosphate method, the electroporation method, the particle gun method, etc. can be used. There is no particular limitation on the viral vector, and usually, known viral vectors used in gene transfer methods, such as adenovirus vectors, adeno-associated virus vectors, simian virus vectors, vaccinia virus vectors, measles virus vectors, or Sendai virus vectors, etc. are used.
[0058] (2) Method for producing gene-introduced cells of the present invention The method for producing gene cells of the present invention is characterized by including the step of introducing into cells a retroviral vector containing the nucleic acid construct of the present invention described in (1) above or a transcript from the nucleic acid construct. As one aspect of the present invention, this step is carried out in vitro.
[0059] In the method of the present invention, cells derived from mammals, such as cells derived from humans or non-human mammals such as monkeys, mice, rats, pigs, cows, dogs, etc. can be used. There is no particular limitation on the cells used in the method of the present invention, and any cells can be used. For example, cells collected, isolated, purified, or induced from body fluids, tissues, or organs such as blood (peripheral blood, umbilical cord blood, etc.), bone marrow can be used. Peripheral blood mononuclear cells (PBMC), immune cells [T cells, dendritic cells, B cells, hematopoietic stem cells, macrophages, monocytes, NK cells or blood cell lineage cells (neutrophils, basophils)], umbilical cord blood mononuclear cells, fibroblasts, preadipocytes, hepatocytes, epidermal keratinocytes, mesenchymal stem cells, adipose stem cells, various cancer cell lines or neural stem cells can be used. In the present invention, the use of T cells, progenitor cells of T cells (such as hematopoietic stem cells, lymphocyte progenitor cells, etc.) or cell populations containing them is particularly preferred. T cells include αβ T cells, γδ T cells, CD8-positive T cells, CD4-positive T cells, regulatory T cells, cytotoxic T cells, or tumor-infiltrating lymphocytes. The cell population containing T cells and progenitor cells of T cells includes PBMC. The above-mentioned cells may be those collected from a living body, those obtained by expanding and culturing them, or those established as a cell line. When it is desired to transplant the produced cells or cells differentiated from the cells into a living body, cells collected from the living body itself or the same species are preferred.
[0060] In the step of introducing the retroviral vector of the present invention into cells, a functional substance that improves the introduction efficiency can also be used (for example, WO 95 / 26200 pamphlet, WO 00 / 01836 pamphlet). Examples of substances that improve the introduction efficiency include substances having an activity to bind to the viral vector, such as substances such as fibronectin or fibronectin fragments. Preferably, a fibronectin fragment having a heparin-binding site, for example, a fragment commercially available as RetroNectin (registered trademark, CH-296, manufactured by Takara Bio Inc.) can be used.
[0061] In a preferred embodiment of the present invention, the functional substance can be used in a state fixed to a suitable solid phase, such as a container used for cell culture (plates, petri dishes, flasks, bags, etc.) or a carrier (microbeads, etc.).
[0062] (3) Cells of the present invention The cells of the present invention are cells containing the nucleic acid construct of (1) above. For example, by the production method of (2) above, cells into which the nucleic acid construct of (1) above has been introduced can be prepared. The cells of the present invention express a foreign desired gene and the expression of a specific endogenous gene is suppressed.
[0063] As one aspect of the present invention, the cells of the present invention can be used as a therapeutic agent for diseases. The therapeutic agent contains, as an active ingredient, the cells of the present invention capable of expressing a desired gene useful for the treatment of the disease, and may further contain a suitable excipient. The excipient is not particularly limited as long as it is pharmaceutically acceptable, and examples include stabilizers, buffers, tonicity agents, and the like. The diseases to which the cells of the present invention are administered are not particularly limited as long as they are diseases sensitive to the cells, and examples include cancer [blood cancer (leukemia), solid tumors, etc.], inflammatory diseases / autoimmune diseases (asthma, eczema, etc.), hepatitis, and infectious diseases caused by viruses, bacteria, and fungi (influenza, AIDS, tuberculosis, MRSA infection, VRE infection, deep mycosis are exemplified). Cells expressing TCR or CAR that recognize antigens possessed by cells, i.e., tumor antigens, viral antigens, bacterial antigens, etc., whose decrease or disappearance is desired in the above diseases, are administered for the treatment of these diseases. In addition, the cells of the present invention can also be used for bone marrow transplantation, prevention of infections after radiation, donor lymphocyte infusion for the purpose of remission of relapsed leukemia, etc. The therapeutic agent containing the cells of the present invention as an active ingredient can be administered, but is not limited to, parenterally, for example, by injection or infusion, intradermally, intramuscularly, subcutaneously, intraperitoneally, intranasally, intraarterially, intravenously, intratumorally, or into the afferent lymphatic vessel.
Examples
[0064] The present invention will be described in more detail with reference to the following examples, but the present invention is not limited to the following examples only. Among the operations described in this specification, for basic operations, the methods described in Molecular Cloning: A Laboratory Manual 3rd ed., edited by T. Maniatis et al. and published by Cold Spring Harbor Laboratory in 2001 were used.
[0065] Example 1 Preparation of Codon-Converted Human T Cell Receptor α and β Genes According to the description in An J et al., International Journal of Hematology (Int. J. Hematol.), Vol. 93, pp. 176 - 185 (2011), nucleic acid fragments containing the α-chain gene and TCRβ-chain gene of TCR that recognize the peptide of 235 - 243 of tumor antigen WT1 were prepared respectively. Next, the base sequences encoding the amino acid sequences of the C regions shown by SEQ ID NO: 3 and 6 of the thus obtained TCRα-chain gene (SEQ ID NO: 1 and 4 respectively) were each converted into the base sequences of SEQ ID NO: 2 and 5 which are codon-converted base sequences. Similarly, the base sequences encoding the amino acid sequences of the C regions shown by SEQ ID NO: 9 and 12 of the TCRβ-chain gene (SEQ ID NO: 7 and 10 respectively) were each converted into the base sequences of SEQ ID NO: 8 and 11 which are codon-converted base sequences. The details of the above base sequence conversion are shown in Table 1. Also, an artificial gene shown by SEQ ID NO: 13 was synthesized. This artificial gene transcribes four types of single-stranded RNAs that form a stem-loop structure. These single-stranded RNAs generate siRNAs that target the base sequences of SEQ ID NO: 1, 4, 7, and 10 respectively in cells and suppress the expression of wild-type TCRα-chain and wild-type TCRβ-chain genes. Although the amino acid sequences encoded by the base sequences of wild-type and codon-converted types are common, since mutations have been introduced into the base sequence of the codon-converted TCR, the expression of the codon-converted TCR is not suppressed by the double-stranded siRNA transcribed from the DNA described in SEQ ID NO: 13.
[0066]
Table 1
[0067] Example 2 Preparation of Codon-Converted TCR-Expressing Retroviral Vector DNA First, PCR was performed using pMSCVneo (manufactured by Clontech) as a template to amplify a DNA fragment of the MSCV U3 promoter region shown in SEQ ID NO: 14. Also, genomic DNA was extracted from peripheral blood mononuclear cells (PBMCs) separated from human peripheral blood from which informed consent was obtained using NucleoSpin (registered trademark) Tissue (manufactured by Macherey-Nagel), and PCR was performed using this genomic DNA as a template with the primers shown in SEQ ID NO: 15 and SEQ ID NO: 16 to amplify a DNA fragment of the region containing the SD and SA sequences derived from the human EF1α gene. Furthermore, a synthetic gene containing the P2A peptide sequence shown in SEQ ID NO: 17 was prepared. As shown in Fig. 1(A), each of the nucleic acid fragment containing the MSCV U3 promoter sequence, the region containing the SD and SA sequences derived from the human EF1α gene, and the codon-converted human anti-WT1 TCRα chain gene and TCRβ chain gene prepared in Example 1, and the artificial gene encoding the P2A peptide sequence was inserted into the ClaI-MluI digestion product of the lentiviral vector DNA, pLVSIN-CMV Neo (manufactured by Takara Bio Inc.). In addition, the order of the RRE sequence and the cPPT sequence was separately swapped so that the cPPT sequence and the RRE sequence were in that order from the 5'-end, and vector A was created. That is, vector A contains, in order from the 5'-end, 5'LTR, packaging signal sequence, cPPT sequence, RRE sequence, MSCV LTR U3 promoter sequence, SD and SA sequences derived from the human EF1α gene, codon-converted WT1-specific TCRα chain and β chain gene sequences polycistronically linked by 2A peptide, and WPRE sequence.
[0068] Next, artificial genes that generate the four types of siRNAs synthesized in Example 1 were inserted between the SD and SA sequences of vector A, between the codon-converted WT1-specific TCR gene sequence and the WPRE sequence, and between the WPRE and the 3'LTR as shown in Fig. 1 to create vectors B, C, and D, respectively.
[0069] Example 3 Preparation of Retrovirus Solution E. coli JM109 was transformed with each of vectors A to D prepared in Example 2 to obtain transformants. The plasmid DNAs retained by these transformants were each purified using NucleoSpin (registered trademark) Plasmid Midi (manufactured by Macherey-Nagel) and used as DNA for transfection in the following operations. Using each of the prepared plasmids of vectors A to D, Lentiviral High Titer Packaging Mix (manufactured by Takara Bio Inc.) and Lenti-X 293T cells (manufactured by Clontech), four kinds of supernatant liquids containing lentivirus having a VSVG envelope were obtained. The supernatant liquids were filtered through a 0.45 μm filter (Milex HV, manufactured by Millipore) to prepare virus solutions A to D, respectively.
[0070] Example 4 Infection of Codon-Converted TCR and Codon-Converted TCR-siRNA Co-Expression Retroviral Vector into Human PBMC 1 Peripheral blood mononuclear cells (PBMCs) isolated from informed-consent obtained human peripheral blood were stained with an FITC-labeled anti-Human CD8 antibody (manufactured by Becton Dickinson), and CD8-positive cells were separated using anti-FITC microbeads (manufactured by Miltenyi Biotec). Virus solutions A to D prepared in Example 3 were each diluted 2-fold, 6-fold, 18-fold, and 54-fold, and infected using RetroNectin (manufactured by Takara Bio). Cells were collected 7 days after virus infection, and total RNA was extracted and treated with DNaseI using NucleoSpin RNA Plus (manufactured by Macherey-Nagel). Using the obtained total RNA as a template, cDNA synthesis was performed using the PrimeScript RT reagent Kit (Perfect Real Time) (manufactured by Takara Bio). Furthermore, using this cDNA as a template, real-time PCR was performed using TB Green Premix Ex Taq II (manufactured by Takara Bio), primers for amplifying the wild-type TCRα chain gene of SEQ ID NOs: 18 and 19, primers for amplifying the wild-type TCRβ chain gene of SEQ ID NOs: 20 and 21, primers for amplifying the codon-converted TCRα chain gene of SEQ ID NOs: 22 and 23, and primers for amplifying the codon-converted TCRβ chain gene of SEQ ID NOs: 24 and 25, and the expression level of each gene was measured and its relative value was calculated. Correction of the total RNA amount was performed based on the measured value of the GAPDH gene using primers for amplifying the GAPDH gene of SEQ ID NOs: 26 and 27. Also, cells were collected 7 days after virus infection, plasmid DNA and the like mixed in the virus were decomposed using Recombinant DNaseI (RNAse-free) (manufactured by Takara Bio), genomic DNA was extracted using NucleoSpin (registered trademark) Tissue (manufactured by Macherey-Nagel), and the measurement of the virus copy number integrated into the genome was performed using the Provirus Copy Number Detection Primer Set, Human (manufactured by Takara Bio), CycleavePCR Core Kit (manufactured by Takara Bio), and Lenti-X Provirus Quaqntitation Kit (manufactured by Clontech).
[0071] Based on the relative values of the gene expressions of the wild-type TCRα chain and the wild-type TCRβ chain in virus-noninfected control cells, the suppression effect of the wild-type TCR gene was evaluated by calculating the ratio of the relative values of gene expressions in each experimental group. The results are shown in Figure 2. In the figure, the vertical axis indicates the relative value of the gene expression level when the expression level of the control vector is set to 100. The horizontal axis indicates the virus copy number. As shown in Figure 2, vector A did not suppress the expressions of the wild-type TCRα chain and β chain genes, vector B had a weak suppression of expression, while vectors C and D efficiently suppressed the expression. That is, it was shown that vectors C and D were excellent in suppressing the expression of the endogenous TCR.
[0072] Also, based on the relative values of the gene expressions of the codon-converted TCRα chain and the codon-converted TCRβ chain in cells infected with the two-fold diluted virus solution of vector A, the expression level of the codon-converted TCR gene was evaluated by calculating the ratio of the relative values of gene expressions in each experimental group. The results are shown in Figure 3. In the figure, the vertical axis indicates the relative value of the gene expression level when the expression level of the reference (cells infected with the two-fold diluted virus solution of vector A) is set to 100. The horizontal axis indicates the virus copy number. As shown in Figure 3, the cells prepared using vector D showed a higher expression of the codon-converted human anti-WT1 TCR gene at a lower virus copy number compared to vector C. That is, it was shown that when the configuration of vector D was adopted, the expression of the exogenous TCR was high.
[0073] Example 5 Use of the Promoter for siRNA Expression An artificial gene shown in SEQ ID NO: 28 was synthesized. This artificial gene transcribes two types of single-stranded RNAs that form a stem-loop structure. These single-stranded RNAs generate siRNAs that suppress the expression of the wild-type TCRα chain and wild-type TCRβ chain genes, targeting the nucleotide sequences of SEQ ID NOs: 1 and 7, respectively, in cells. Furthermore, an artificial gene shown in SEQ ID NO: 29 was synthesized. This artificial gene contains a human U6 promoter and a human H1 promoter upstream of each siRNA in order to transcribe the siRNAs. Next, these artificial genes were inserted between WPRE and 3'LTR as shown in Figure 4 to prepare vector E and vector F. In the same manner as in Example 3, virus solutions E and F were prepared.
[0074] In the same manner as in Example 4, PBMCs from which informed consent had been obtained were infected with virus solutions A, C, D, E, and F, and the number of virus copies integrated into the genome was measured. Also, the expression levels of the wild-type TCR chain gene and codon-converted TCR chain gene were measured, and their relative values were calculated. The number of virus copies integrated into the genome is shown in Figure 5. As shown in Figure 5, it was shown that vector F had a low copy number, and that a vector containing a promoter sequence between WPRE and 3'LTR had a low number of virus copies integrated into the genome.
[0075] Also, based on the relative values of the gene expression of the wild-type TCRα chain and wild-type TCRβ chain in virus-uninfected control cells, the ratio of the relative values of gene expression in each experimental group was calculated to evaluate the inhibitory effect on the wild-type TCR gene. The results are shown in Figure 6. In the figure, the vertical axis indicates the relative value of the gene expression level when the expression level of the control vector is set to 100. The horizontal axis indicates the number of virus copies. As shown in Figure 6, vector F did not suppress the expression of the wild-type β chain gene. That is, it was shown that a vector containing a promoter sequence between WPRE and 3'LTR has unstable gene expression suppression.
Industrial Applicability
[0076] According to the present invention, there are provided a nucleic acid construct in which a desired gene is efficiently expressed, a retroviral vector for introducing the nucleic acid construct into a cell, a method for producing a gene-introduced cell using the vector, and a cell into which the vector has been introduced. These nucleic acid constructs, retroviral vectors, methods for producing gene-introduced cells, and gene-introduced cells are extremely useful for protein production, treatment of diseases by cell therapy, and research and testing therefor.
Sequence Listing Free-Text
[0077] SEQ ID NO:1: A part of wild type TCR alpha chain coding sequence SEQ ID NO:2: A part of codon modified TCR alpha chain coding sequence SEQ ID NO:3: A part of TCR alpha chain amino acid sequence SEQ ID NO:4: A part of wild type TCR alpha chain coding sequence SEQ ID NO:5: A part of codon modified TCR alpha chain coding sequence SEQ ID NO:6: A part of TCR alpha chain amino acid sequence SEQ ID NO:7: A part of wild type TCR beta chain coding sequence SEQ ID NO:8: A part of codon modified TCR beta chain coding sequence SEQ ID NO:9: A part of TCR beta chain amino acid sequence SEQ ID NO:10: A part of wild type TCR beta chain coding sequence SEQ ID NO:11: A part of codon modified TCR beta chain coding sequence SEQ ID NO:12: A part of TCR beta chain amino acid sequence SEQ ID NO:13: siRNA generating sequence for wild type TCR genes SEQ ID NO:14: MSCV U3 promoter region. SEQ ID NO:15: EF1 alpha SD / SA amplification primer SEQ ID NO:16: EF1 alpha SD / SA amplification primer SEQ ID NO:17: P2A peptide coding sequence SEQ ID NO:18: wild type TCR alpha chain amplification primer F SEQ ID NO:19: wild type TCR alpha chain amplification primer R SEQ ID NO:20: wild type TCR beta chain amplification primer F SEQ ID NO:21: wild type TCR beta chain amplification primer R SEQ ID NO:22: codon modified TCR alpha chain amplification primer F SEQ ID NO:23: codon modified TCR alpha chain amplification primer R SEQ ID NO:24: Codon-modified TCR beta chain amplification primer F SEQ ID NO:25: Codon-modified TCR beta chain amplification primer R SEQ ID NO:26: GAPDH amplification primer F SEQ ID NO:27: GAPDH amplification primer R SEQ ID NO:28: siRNA generating sequence for wild type TCR genes SEQ ID NO:29: siRNA generating sequence for wild type TCR genes
Claims
1. A nucleic acid construct for expressing a desired gene, comprising, in order from the 5'-end, (a) a 5' long terminal repeat (LTR) sequence derived from a lentivirus, (b) a packaging signal sequence (ψ) derived from a lentivirus, (c) a sequence of a desired gene or a multiple cloning site, (d) a post-transcriptional regulatory element (PRE), (e) an siRNA generating sequence that forms at least one stem-loop structure and transcribes an RNA that induces RNA interference in mammalian cells, and (f) a 3' LTR sequence derived from a lentivirus, wherein the nucleic acid construct does not contain a promoter sequence between (c) and (e).
2. The nucleic acid construct according to claim 1, wherein the PRE is a PRE (WPRE) derived from woodchuck hepatitis virus.
3. The nucleic acid construct according to claim 1, comprising a sequence of a foreign promoter on the 5'-side of the sequence of the desired gene.
4. The nucleic acid construct according to claim 1, wherein the desired gene is a gene encoding a T cell receptor (TCR) or a chimeric antigen receptor (CAR).
5. The nucleic acid construct according to claim 4, wherein the desired gene is a gene encoding a TCRα chain and a TCRβ chain linked by a 2A peptide.
6. The nucleic acid construct according to claim 1, wherein the siRNA generating sequence is a sequence that generates an siRNA that acts on the mRNA encoding the constant region of the wild-type TCR to suppress expression.
7. The nucleic acid construct according to claim 6, wherein the desired gene is a gene encoding a TCR in which a mutation is introduced into the nucleotide sequence of the constant region, and the gene encoding the TCR into which the mutation is introduced is not suppressed in expression by the siRNA.
8. The nucleic acid construct according to claim 1, wherein the siRNA generating sequence is a sequence that generates an siRNA that acts on the mRNA encoding a molecule that suppresses the activity of immune cells to suppress expression.
9. A retroviral vector comprising a transcript from the nucleic acid construct according to any one of claims 1 to 8.
10. A method for producing a retroviral vector, comprising the step of introducing the nucleic acid construct according to any one of claims 1 to 8 into a cell having the ability to produce retroviral particles, provided that the method is not carried out in the human body.
11. A method for producing a gene-introduced cell, comprising the step of introducing the retroviral vector according to claim 9 into a cell, provided that the method is not carried out in the human body.
12. The method for producing a genetically modified cell according to claim 11, wherein the cell is a T cell, a cell capable of differentiating into a T cell, or a cell population containing them.
13. A cell comprising the nucleic acid construct according to any one of claims 1 to 8.
14. The cell according to claim 13, wherein the cell is a T cell, a cell capable of differentiating into a T cell, or a cell population containing them.
Citation Information
Patent Citations
siRNA EXPRESSION RETROVIRAL VECTOR
WO2012157742A1
High-titer retrovirus vector
WO2015053398A1