IL-15 system fusion to IL-12 and IL-18

Abstract

To provide multi-specific fusion protein complexes with one domain comprising IL-15 or a functional fragment and a binding domain specific to IL-12 or IL-18.SOLUTION: An isolated soluble fusion protein complex comprises at least two soluble proteins, wherein a first soluble protein comprises an IL-15 domain and a second soluble protein comprises a soluble IL-15 receptor alpha sushi-binding domain (IL-15 RαSu) fused to an immunoglobulin Fc domain, wherein the first or second soluble protein further comprises an IL-18 binding domain, wherein the first or second soluble protein further comprises an IL-12 binding domain, and wherein the IL-15 domain of the first soluble protein binds to the IL-15RαSu domain of the second soluble protein to form a soluble fusion protein complex.SELECTED DRAWING: None

Description

[Technical Field]

[0001] Related Applications This application claims the benefit of U.S. Provisional Patent Application No. 62 / 467,623, filed March 6, 2017, which is incorporated herein by reference in its entirety.

[0002] The present invention relates generally to the field of multimeric fusion molecules. [Background technology]

[0003] Prior to the invention described herein, there was an urgent need to develop new strategies to enhance immune responses to provide therapeutic benefit to patients with neoplastic or infectious diseases. Summary of the Invention [Means for solving the problem]

[0004] The present invention is based, at least in part, on the surprising discovery that multispecific interleukin-15 (IL-15)-based fusion protein complexes enhance the stimulation of immune cells and promote their activity against diseased cells, thereby resulting in the reduction or prevention of disease. These IL-15-based fusion protein complexes may also exhibit increased binding to disease and target antigens. Provided herein are multispecific IL-15-based fusion protein complexes comprising IL-12 and IL-18 binding domains (FIGS. 1A and 1B). Specifically, described herein are fusion protein complexes comprising an IL-15N72D:IL-15RαSu-Ig Fc scaffold fused to an IL-12 and / or IL-18 binding domain. When characterized using human immune cells, as described in detail below, these fusion protein complexes exhibit the binding and biological activities of the IL-15, IL-12, and IL-18 cytokines, respectively. Furthermore, these fusion protein complexes induce cytokine-induced memory-like (CIML) natural killer (NK) cells with elevated activation markers, increased cytotoxicity against tumor cells, and enhanced production of IFN-γ.

[0005] Thus, as a single molecule, the fusion protein complex binds to and signals through multiple cytokine receptors on NK cells to provide responses previously observed only with the combination of multiple individual cytokines. Furthermore, these fusion protein complexes provide soluble multi-polypeptide complexes, bind protein A for purification purposes, and contain the Fc region of an Ig molecule that can dimerize to interact with Fcγ receptors on NK cells and macrophages, thereby providing advantages not present in combinations of individual cytokines. Described herein are mammalian cell expression-based methods for generating these fusion protein complexes suitable for large-scale production of clinical-grade material. Additional methods for generating and using CIML NK cells induced by the fusion protein complexes of the invention are also provided.

[0006] Thus, an isolated soluble fusion protein complex is provided, comprising at least two soluble proteins. For example, the first protein comprises an IL-15 polypeptide, e.g., a mutant IL-15 polypeptide comprising an N72D mutation (IL-15N72D). The second protein comprises a soluble IL-15 receptor alpha sushi-binding domain (IL-15RαSu) fused to an immunoglobulin Fc domain (IL-15RαSu / Fc). The third component of the isolated soluble fusion protein complex comprises an IL-12 binding domain, wherein the IL-12 binding domain is fused to either the IL-15N72D or IL-15RαSu / Fc protein. The fourth component of the isolated soluble fusion protein complex comprises an IL-18 binding domain, wherein the IL-18 binding domain is fused to either the IL-15N72D or IL-15RαSu / Fc protein. In some cases, the IL-12 and / or IL-18 binding domains are fused to both the IL-15N72D and IL-15RαSu / Fc proteins. In other cases, either the IL-12 or IL-18 binding domain is fused to the IL-15N72D or IL-15RαSu / Fc protein, and the other binding domain is fused to the other protein. In other cases, the complex comprises an IL-18 binding domain fused to an IL-12-free IL-15N72D:IL-15RαSu-Ig Fc scaffold or an IL-18 binding domain fused to an IL-12-free IL-15N72D:IL-15RαSu-Ig Fc scaffold. Fusions can be made at the N-terminus or C-terminus of the protein. The IL-12 protein can comprise a heterodimer of the p40 and p35 IL-12 subunits. Alternatively, the IL-12 protein can comprise a single-chain format in which the p40 and p35 subunits are linked by a flexible polypeptide linker. The single-chain IL-12 can comprise either the C-terminus of p40 linked to the N-terminus of p35 or the C-terminus of p35 linked to the N-terminus of p40. An exemplary fusion protein complex comprises an IL-18 polypeptide covalently linked to IL-15N72D and a single-chain IL-12 polypeptide covalently linked to an IL-15RαSu / Fc fusion protein.Instead, the fusion protein complex comprises a single-chain IL-12 polypeptide covalently linked to IL-15N72D and an IL-18 polypeptide covalently linked to an IL-15RαSu / Fc fusion protein (Figures 1A, 1B).

[0007] An exemplary first protein comprises the amino acid sequence set forth in SEQ ID NO:2 and SEQ ID NO:6. An exemplary second protein comprises the amino acid sequence set forth in SEQ ID NO:4 and SEQ ID NO:8. An exemplary nucleic acid sequence encoding the first protein comprises the sequence set forth in SEQ ID NO:1 and SEQ ID NO:5. An exemplary nucleic acid sequence encoding the second protein comprises the sequence set forth in SEQ ID NO:3 and SEQ ID NO:7. In one embodiment, the nucleic acid sequence further comprises a promoter, a translation initiation signal, and a leader sequence operably linked to the sequence encoding the fusion protein. Also provided are DNA vectors comprising the nucleic acid sequences described herein. For example, the nucleic acid sequence is in a vector for replication, expression, or both.

[0008] Also provided are soluble fusion protein complexes comprising a first soluble fusion protein complex covalently linked to a second soluble fusion protein complex. For example, the soluble fusion protein complexes of the present invention are multimerized, e.g., dimerized, trimerized, or otherwise multimerized (e.g., tetrameric complexes, pentameric complexes, etc.). For example, the multimers are homomultimers or heteromultimers. The soluble fusion protein complexes are joined by covalent bonds, e.g., disulfide bonds, chemical crosslinkers. In some cases, one soluble fusion protein is covalently linked to another soluble fusion protein by a disulfide bond linking the Fc domain of the first soluble protein to the Fc domain of the second soluble protein.

[0009] The Fc domain or functional fragment thereof includes an Fc domain selected from the group consisting of an IgG Fc domain, a human IgG1 Fc domain, a human IgG2 Fc domain, a human IgG3 Fc domain, a human IgG4 Fc domain, an IgA Fc domain, an IgD Fc domain, an IgE Fc domain, and an IgM Fc domain; a mouse IgG2A domain, or any combination thereof. Optionally, the Fc domain includes amino acid changes that result in an Fc domain with altered complement or Fc receptor binding properties or altered dimerization or glycosylation profiles. Amino acid changes that result in Fc domains with altered complement or Fc receptor binding properties or altered dimerization or glycosylation profiles are known in the art. For example, substitution of the leucine residue (i.e., ...PELLG G...) at positions 234 and 235 (numbering based on the antibody consensus sequence) of IgG1 CH2 with an alanine residue (i.e., ...PEAAG G...) results in loss of Fc gamma receptor binding, while substitution of the lysine residue (i.e., ...KCKS L...) at position 322 (numbering based on the antibody consensus sequence) of IgG1 CH2 with an alanine residue (i.e., ...KCAS L...) results in loss of complement activation. In some instances, such mutations are combined.

[0010] In some aspects, the IL-12 or IL-18 binding domain is covalently linked to the IL-15 polypeptide (or a functional fragment thereof) by a polypeptide linker sequence. Similarly, the IL-12 or IL-18 binding domain is covalently linked to the IL-15Rα polypeptide (or a functional fragment thereof) by a polypeptide linker sequence. Optionally, the IL-15Rα polypeptide (or a functional fragment thereof) is covalently linked to the Fc domain (or a functional fragment thereof) by a polypeptide linker sequence. Each polypeptide linker sequence may be independently selected. Optionally, the polypeptide linker sequences are the same. Alternatively, they are different.

[0011] Optionally, soluble fusion protein complexes of the invention are provided, wherein at least one of the soluble fusion proteins comprises one or more binding domains or detectable labels. Such binding domains may comprise antibodies, soluble T cell receptors, ligands, soluble receptor domains, or functional fragments thereof. IL-15-based fusion protein complexes comprising such binding domains have been previously described in U.S. Patent No. 8,492,118, which is incorporated herein by reference. Detectable labels include, but are not limited to, biotin, streptavidin, enzymes or catalytically active fragments thereof, radionuclides, nanoparticles, paramagnetic metal ions, or fluorescent, phosphorescent, or chemiluminescent molecules, or any combination thereof.

[0012] The invention provides methods for making the soluble fusion protein complexes of the invention, comprising the steps of: a) introducing into a first host cell a DNA vector with appropriate control sequences encoding a first protein, b) culturing the first host cell in a medium under conditions sufficient to express the first protein in the cells or in the medium, c) purifying the first protein from the host cell or medium, d) introducing into a second host cell a DNA vector with appropriate control sequences encoding a second protein, e) culturing the second host cell in a medium under conditions sufficient to express the second protein in the cells or in the medium, f) purifying the second protein from the host cell or medium, and g) mixing the first and second proteins under conditions sufficient to allow binding of the IL-15 domain of the first protein to the soluble IL-15Rα domain of the second protein to form a soluble fusion protein complex.

[0013] In some cases, the method further comprises mixing the first and second proteins under conditions sufficient to allow the formation of disulfide bonds between the polypeptides expressed from the expression vectors.

[0014] Alternatively, a method for producing a soluble fusion protein complex of the present invention is carried out by: a) introducing into a host cell a DNA vector with appropriate control sequences encoding a first protein and a DNA vector with appropriate control sequences encoding a second protein; b) culturing the host cells in a medium under conditions sufficient to express the proteins in the cells or medium and allow association between the IL-15 domain of the first protein and the soluble IL-15Rα domain of the second protein to form a soluble fusion protein complex; and c) purifying the soluble fusion protein complex from the host cells or medium.

[0015] In one embodiment, the method further comprises mixing the first and second proteins under conditions sufficient to allow the formation of disulfide bonds between the polypeptides expressed from the expression vectors.

[0016] Also provided is a method for making a soluble fusion protein complex, comprising: a) introducing into a host cell a DNA vector with appropriate control sequences encoding a first and a second protein; b) culturing the host cell in a medium under conditions sufficient to express the proteins in the cells or medium and to allow association between the IL-15 domain of the first protein and the soluble IL-15Rα domain of the second protein to form a soluble fusion protein complex and to allow formation of disulfide bonds between the polypeptides; and c) purifying the soluble fusion protein complex from the host cell or medium.

[0017] Optionally, the method further comprises mixing the first and second proteins under conditions sufficient to allow the formation of disulfide bonds between the polypeptides expressed from the expression vectors.

[0018] In some cases, the methods further include purifying the fusion protein complex by Protein A affinity chromatography, size exclusion chromatography, ion exchange chromatography, and / or other standard methods (including viral inactivation and / or filtration) sufficient to produce a sufficiently pure fusion protein complex suitable for use as a clinical reagent or therapeutic.

[0019] In certain embodiments of the soluble fusion protein complexes of the invention, the IL-15 polypeptide is an IL-15 variant having an amino acid sequence that differs from that of a native IL-15 polypeptide. Human IL-15 polypeptides are referred to herein as huIL-15, hIL-15, huIL-15, hIL-15, or IL-15 wild-type (wt), and variants thereof are referred to using the native amino acid, its position in the mature sequence, and the mutated amino acid. For example, huIL-15N72D refers to human IL-15 containing an N to D substitution at position 72. In one embodiment, the IL-15 variant functions as an IL-15 agonist, e.g., as demonstrated by increased binding activity to the IL-15RβγC receptor compared to the native IL-15 polypeptide. Alternatively, the IL-15 variant functions as an IL-15 antagonist, e.g., as demonstrated by decreased binding activity to the IL-15RβγC receptor compared to the native IL-15 polypeptide.

[0020] A method for enhancing immune function is carried out by the steps of: a) contacting a plurality of cells with a soluble fusion protein complex of the present invention, wherein the plurality of cells further includes immune cells comprising an IL-15R chain recognized by the IL-15 domain, an IL-12R chain recognized by the IL-12 domain, and / or an IL-18R chain recognized by the IL-18 domain; and b) activating the immune cells through IL-15R, IL-12R, and / or IL-18R signaling. In one embodiment, the method for enhancing immune function further comprises activating immune cells through signaling of a combination of at least two or all of IL-15R, IL-12R, and IL-18R by the soluble fusion protein complex. An exemplary method for enhancing immune function comprises activating NK cells through signaling of IL-15R, IL-12R, and IL-18R by the soluble fusion protein complex. Such methods include activating NK cells resulting in increased activation markers (i.e., CD25, CD69), increased cytotoxicity of diseased cells, or increased production of IFN-γ. In some aspects, the methods include inducing CIML NK cells with a soluble fusion protein complex of the invention.

[0021] A method for killing target cells is carried out by the following steps: a) contacting a plurality of cells with a soluble fusion protein complex of the present invention, wherein the plurality of cells further includes immune cells and target disease cells comprising an IL-15R chain recognized by the IL-15 domain, an IL-12R chain recognized by the IL-12 domain, and / or an IL-18R chain recognized by the IL-18 domain; b) activating the immune cells via IL-15R, IL-12R, and / or IL-18R signaling; and c) killing the target disease cells with the activated immune cells. In one embodiment, the method comprises activating immune cells via signaling of a combination of at least two or all of IL-15R, IL-12R, and IL-18R by the soluble fusion protein complex. An exemplary method comprises activating NK cells, particularly CIML NK cells, via signaling of IL-15R, IL-12R, and IL-18R by the soluble fusion protein complex. Such methods include activation of NK cells resulting in an increase in activation markers (ie, CD25, CD69) and cytotoxicity against target cells.

[0022] The present invention also provides a method for preventing or treating a disease in a patient, the method comprising the steps of: a) mixing immune cells comprising an IL-15R chain recognized by the IL-15 domain, an IL-12R chain recognized by the IL-12 domain, and / or an IL-18R chain recognized by the IL-18 domain with a soluble fusion protein complex of the present invention; b) activating the immune cells through IL-15R, IL-12R, and / or IL-18R signaling; c) administering (or adoptively transferring) the activated immune cells to the patient; and d) damaging or killing diseased cells via the activated immune cells sufficient to prevent or treat the disease in the patient. In one embodiment, the method comprises activating immune cells through signaling of a combination of at least two or all of IL-15R, IL-12R, and IL-18R by the soluble fusion protein complex. Exemplary methods include activation of NK cells, particularly CIML NK cells, via IL-15R, IL-12R, and IL-18R signaling by soluble fusion protein complexes. Other aspects of the methods include the use of immortalized immune cells, such as NK-92, aNK, haNK, or taNK cells, which may be irradiated prior to transfer. In some embodiments of the invention, patients are pretreated or preconditioned to promote engraftment or survival of the adoptively transferred cells. Examples of preconditioning include treatment with cyclophosphamide and fludarabine. Additionally, patients may be treated with agents that promote activation, survival, or persistence of the adoptively transferred cells before and / or after cell transfer. Examples of such treatments include the use of IL-2, IL-15, ALT-803, or other immunostimulants. Other therapeutic approaches known in the field of adoptive cell therapy (i.e., allogeneic cell therapy, autologous cell therapy, haploidentical therapy, DLI therapy, stem cell therapy, CAR T therapy, NK92-based therapy, and CAR NK therapy) can also be used in the methods described herein.

[0023] Also provided is a method for preventing or treating a disease in a patient, comprising the steps of: a) administering to the patient a soluble fusion protein complex of the invention; b) activating immune cells in the patient via IL-15R, IL-12R and / or IL-18R signaling; and c) damaging or killing diseased cells via the activated immune cells sufficient to prevent or treat the disease in the patient.

[0024] Administration of the fusion protein complex of the invention induces an immune response in a patient. For example, administration of the fusion protein complex of the invention induces an immune response against cells associated with a neoplasm or infectious disease. In one embodiment, the fusion protein complex of the invention increases immune cell proliferation, activation markers, cytotoxicity against target cells, and / or production of pro-inflammatory cytokines.

[0025] The present invention provides a method for stimulating an immune response in a mammal by administering to the mammal an effective amount of a soluble fusion protein complex of the present invention. The present invention also provides a method for suppressing an immune response in a mammal by administering to the mammal an effective amount of any one of the soluble fusion protein complexes of the present invention.

[0026] A method for treating a neoplasm or infectious disease in a subject in need thereof is carried out by administering to the subject an effective amount of activated immune cells or a pharmaceutical composition comprising a soluble fusion protein complex described herein. For example, a method for treating a solid malignant tumor or a hematological malignant tumor in a subject in need thereof is carried out by administering to the subject an effective amount of CIML NK cells activated ex vivo by a soluble fusion protein complex of the present invention, thereby treating the malignant tumor. Exemplary soluble fusion protein complexes include the amino acid sequences set forth in SEQ ID NOs: 2 and 6, and SEQ ID NOs: 4 and 8.

[0027] Neoplasms suitable for treatment using the methods described herein include glioblastoma, prostate cancer, acute myeloid leukemia, B-cell neoplasms, multiple myeloma, B-cell lymphoma, B-cell non-Hodgkin's lymphoma, Hodgkin's lymphoma, chronic lymphocytic leukemia, acute myeloid leukemia, cutaneous T-cell lymphoma, T-cell lymphoma, solid tumors, urothelial / bladder cancer, melanoma, lung cancer, renal cell carcinoma, breast cancer, gastroesophageal cancer, head and neck cancer, prostate cancer, pancreatic cancer, colorectal cancer, ovarian cancer, non-small cell lung cancer, and head and neck squamous cell carcinoma.

[0028] Exemplary infectious diseases for treatment using the methods described herein include infections caused by human immunodeficiency virus (HIV) or cytomegalovirus (CMV). The methods described herein are also useful for treating bacterial infections (e.g., gram-positive or gram-negative bacteria) (see, e.g., Oleksiewicz et al. 2012. Arch Biochem Biophys. 526:124-31, incorporated herein by reference).

[0029] The cell therapy of the present invention involves the administration of an effective amount of activated immune cells. For example, an effective amount of activated NK cells is 1×10 4 cells / kg~1×10 10 cells / kg, e.g., 1 x 10 4 , 1×10 5 , 1×10 6 , 1×10 7 , 1×10 8 , 1×10 9 and 1 x 10 10 Alternatively, activated immune cells may be administered as a fixed quantity or per body surface area (i.e., 1 m). 2 Cells may be administered after ex vivo activation, or may be cryogenically stored and thawed (and optionally washed) before administration.

[0030] The pharmaceutical composition comprising the fusion protein conjugate is administered in an effective amount. For example, the effective amount of the pharmaceutical composition is about 1 μg / kg to 100 μg / kg, e.g., 1, 5, 10, 15, 20, 25, 30, 35, 40, 45, 50, 55, 60, 65, 70, 75, 80, 85, 90, 95, or 100 μg / kg. Alternatively, the fusion protein conjugate may be administered as a fixed amount or per unit area of body surface (i.e., 1 m2). 2 The dose is based on the number of doses per person.

[0031] The adoptively transferred cells or pharmaceutical composition containing the fusion protein complex are administered at least once a month, for example, twice a month, once a week, twice a week, once a day, twice a day, every 8 hours, every 4 hours, every 2 hours, or every hour. Suitable modes of administration for adoptively transferred immune cells include systemic administration, intravenous administration, or local administration. Suitable modes of administration for pharmaceutical compositions include systemic administration, intravenous administration, local administration, subcutaneous administration, intramuscular administration, intratumoral administration, inhalation, and intraperitoneal administration.

[0032] In one aspect, the present disclosure provides an isolated soluble fusion protein complex comprising at least two soluble proteins, wherein a first soluble protein comprises an interleukin-15 (IL-15) polypeptide domain and a second soluble protein comprises a soluble IL-15 receptor alpha sushi binding domain (IL-15RαSu) fused to an immunoglobulin Fc domain, wherein one of the first or second soluble proteins further comprises an IL-18 binding domain or a functional fragment thereof, and one of the first or second soluble proteins further comprises an IL-12 binding domain or a functional fragment thereof, and wherein the IL-15 domain of the first soluble protein binds to the IL-15RαSu domain of the second soluble protein to form the soluble protein complex.

[0033] In one embodiment, the IL-15 polypeptide is an IL-15 variant containing the N72D mutation (IL-15N72D).

[0034] In one embodiment, the IL-12 binding domain comprises the p40 and p35 subunits of IL-12. In one embodiment, the p40 and p35 subunits of IL-12 are linked in a single-chain format by a flexible polypeptide linker.

[0035] In one embodiment, the first soluble protein comprises the amino acid sequence set forth in one of SEQ ID NOs: 2 or 6.

[0036] In one embodiment, the second soluble protein comprises the amino acid sequence set forth in one of SEQ ID NOs: 4 or 8.

[0037] In one embodiment, the first soluble fusion protein complex may be covalently linked to a second soluble fusion protein complex.

[0038] In one embodiment, the first soluble fusion protein complex is covalently linked to the second soluble fusion protein complex by a disulfide bond linking the Fc domain of the first soluble fusion protein complex to the Fc domain of the second soluble fusion protein complex.

[0039] In one embodiment, the first or second soluble protein further comprises a binding domain that recognizes a disease antigen.

[0040] In one embodiment, the first or second soluble protein further comprises a binding domain that recognizes an immune checkpoint or signaling molecule.

[0041] In one embodiment, the disease antigen is associated with a neoplastic or infectious disease.

[0042] In one embodiment, the first soluble protein is encoded by the sequence set forth in SEQ ID NO: 1 or 5. In one embodiment, the nucleic acid sequence further comprises a promoter, translation initiation signal and leader sequence operably linked to the sequence encoding the soluble protein.

[0043] In one embodiment, the second soluble protein may be encoded by the nucleic acid sequence set forth in SEQ ID NO: 3 or 7. In one embodiment, the nucleic acid sequence further comprises a promoter, translation initiation signal, and leader sequence operably linked to the sequence encoding the soluble protein.

[0044] In one embodiment, the DNA vector may comprise any of the nucleic acid sequences listed above.

[0045] In one embodiment, a method of enhancing immune function comprises the steps of: a) contacting a plurality of cells with any of the soluble fusion protein complexes described above, wherein the plurality of cells further comprises immune cells comprising an IL-15R chain recognized by the IL-15 domain, an IL-12R chain recognized by the IL-12 domain, and / or an IL-18R chain recognized by the IL-18 domain; and b) activating the immune cells via IL-15R, IL-12R, and / or IL-18R signaling.

[0046] In one aspect, the disclosure provides a method for killing target cells, the method comprising: a) contacting a plurality of cells with any of the above-described soluble fusion protein complexes, wherein the plurality of cells further comprises immune cells and target disease cells comprising an IL-15R chain recognized by the IL-15 domain, an IL-12R chain recognized by the IL-12 domain, and / or an IL-18R chain recognized by the IL-18 domain; b) activating the immune cells via IL-15R, IL-12R, and / or IL-18R signaling; and c) killing the target disease cells with the activated immune cells.

[0047] In one embodiment, the target cell is a tumor cell or an infected cell.

[0048] In one aspect, the disclosure provides a method of enhancing an immune response in a subject, the method comprising: a) contacting a plurality of cells with any of the soluble fusion protein complexes described above, wherein the plurality of cells further comprises immune cells comprising an IL-15R chain recognized by the IL-15 domain, an IL-12R chain recognized by the IL-12 domain, and / or an IL-18R chain recognized by the IL-18 domain; b) activating the immune cells via IL-15R, IL-12R, and / or IL-18R signaling; c) administering (or adoptively transferring) the activated immune cells to the patient; and d) enhancing the immune response in the patient.

[0049] In one aspect, the disclosure provides a method of preventing or treating a disease in a patient, the method comprising: a) contacting a plurality of cells with a soluble fusion protein complex, wherein the plurality of cells further comprises immune cells comprising an IL-15R chain recognized by the IL-15 domain, an IL-12R chain recognized by the IL-12 domain, and / or an IL-18R chain recognized by the IL-18 domain; b) activating the immune cells via IL-15R, IL-12R, and / or IL-18R signaling; c) administering (or adoptively transferring) an effective amount of the activated immune cells to the patient; and d) damaging or killing the diseased cells via the activated immune cells sufficient to prevent or treat the disease in the patient.

[0050] In one embodiment, the disease is a neoplastic or infectious disease.

[0051] In one aspect, the disclosure provides a method of enhancing an immune response in a subject, comprising administering to a patient an effective amount of any of the soluble fusion protein complexes described above.

[0052] In one aspect, the present disclosure provides a method for treating a neoplasm or infectious disease in a subject in need thereof, comprising administering to said patient an effective amount of a pharmaceutical composition comprising any of the soluble fusion protein complexes described above, thereby treating said neoplasm or infectious disease.

[0053] In one embodiment, the neoplasm is selected from the group consisting of glioblastoma, prostate cancer, hematological cancer, B-cell neoplasm, multiple myeloma, B-cell lymphoma, B-cell non-Hodgkin's lymphoma, Hodgkin's lymphoma, chronic lymphocytic leukemia, acute myeloid leukemia, cutaneous T-cell lymphoma, T-cell lymphoma, solid tumor, urothelial / bladder cancer, melanoma, lung cancer, renal cell carcinoma, breast cancer, gastric and esophageal cancer, prostate cancer, pancreatic cancer, colorectal cancer, ovarian cancer, non-small cell lung cancer, and head and neck squamous cell carcinoma.

[0054] In one embodiment, the immune cells are NK cells or cytokine-induced memory-like (CIML) NK cells.

[0055] In one embodiment, the effective amount of activated immune cells is 1×10 4 cells / kg~1×10 10 cells / kg.

[0056] In one embodiment, the immune cells are administered at least once a week.

[0057] In one embodiment, the effective amount is 1 to 100 μg / kg of the effective protein complex.

[0058] In one embodiment, the fusion protein complex is administered at least once a week.

[0059] In one embodiment, the fusion protein complex increases immune cell proliferation, activation markers, cytotoxicity against target cells, and / or production of pro-inflammatory cytokines, including IFN-γ.

[0060] Preferably, the fusion protein complex increases serum levels of interferon gamma (IFN-γ) to kill diseased or tumor cells in a subject, and / or stimulates CD4 + and CD8 + Stimulates T cells and NK cells.

[0061] Unless otherwise defined, all technical and scientific terms used herein have the same meaning as commonly understood by one of ordinary skill in the art to which this invention belongs. The following references provide those of ordinary skill in the art with general definitions of many of the terms used in this invention: Singleton et al., Dictionary of Microbiology and Molecular Biology (2nd ed. 1994); The Cambridge Dictionary of Science and Technology (Walker ed., 1988); The Glossary of Genetics, 5th Ed., R. Rieger et al. (eds.), Springer Verlag (1991); and Hale & Marham, The Harper Collins Dictionary of Biology (1991). As used herein, the following terms have the meanings ascribed to them below, unless otherwise defined.

[0062] "(Drug) agent" means a peptide, a nucleic acid molecule, or a small molecule compound.

[0063] "TxM" refers to a fusion protein complex comprising an IL-15N72D:IL-15RαSu / Fc scaffold linked to a binding domain (Figures 1A and 1B). An exemplary TxM is an IL-15N72D:IL-15RαSu fusion protein complex comprising fusions to the IL-12 and IL-18 cytokines.

[0064] "Ameliorate" means to reduce, inhibit, attenuate, diminish, arrest or stabilize the onset or progression of a disease.

[0065] "Analog" refers to a molecule that has similar, but not identical, functional or structural characteristics. For example, a polypeptide analog retains the biological activity of the corresponding naturally occurring polypeptide while possessing certain biochemical modifications that enhance the function of the analog compared to the naturally occurring polypeptide. Such biochemical modifications may, for example, increase the analog's protease resistance, membrane permeability, or half-life without altering ligand binding. Analogs may also include unnatural amino acids.

[0066] The present invention includes antibodies or fragments of such antibodies as long as they exhibit the desired biological activity. Also included in the present invention are chimeric antibodies, such as humanized antibodies. Generally, a humanized antibody has one or more amino acid residues introduced into it from a non-human source. Humanization can be performed, for example, by replacing at least a portion of a rodent complementarity-determining region with the corresponding region of a human antibody using methods described in the art.

[0067] The term "antibody" or "immunoglobulin" is intended to encompass both polyclonal and monoclonal antibodies. Preferred antibodies are monoclonal antibodies reactive with an antigen. The term "antibody" is also intended to encompass a mixture of two or more antibodies reactive with an antigen (e.g., a cocktail of various types of monoclonal antibodies reactive with an antigen). The term "antibody" is also intended to encompass whole antibodies, biologically functional fragments thereof, genetically engineered antibodies such as single-chain antibodies and chimeric antibodies containing portions derived from more than one species, bifunctional antibodies, antibody conjugates, humanized antibodies, and human antibodies. Biologically functional antibody fragments that can also be used are peptide fragments derived from antibodies that are sufficiently capable of binding to the antigen. As used herein, "antibody" is intended to encompass whole antibodies and any antibody fragments (e.g., F(ab')2, Fab', Fab, Fv) capable of binding to an epitope, antigen, or antigen fragment of interest.

[0068] To "bind" to a molecule means to have a physiochemical affinity for that molecule.

[0069] The term "binding domain" is intended to include an antibody, a single chain antibody, a Fab, an Fv, a T-cell receptor binding domain, a ligand binding domain, a receptor binding domain, or other antigen-specific polypeptide known in the art.

[0070] As used herein, the term "biologically active polypeptide" or "effector molecule" refers to an amino acid sequence capable of producing a desired effect as discussed herein, e.g., a protein, polypeptide, or peptide; a sugar or polysaccharide; a lipid or glycolipid, a glycoprotein, or a lipoprotein. Effector molecules also include chemical agents. Also contemplated are effector molecule nucleic acids that encode bioactive or effector proteins, polypeptides, or peptides. Suitable molecules therefore include regulators, enzymes, antibodies, or drugs, as well as DNA, RNA, and oligonucleotides. A bioactive polypeptide or effector molecule can be naturally occurring or can be synthesized from known components, e.g., by recombinant or chemical synthesis, and can include heterologous components. Bioactive polypeptides or effector molecules generally have a molecular size of about 0.1-100 kD or more up to about 1,000 kD, preferably about 0.1, 0.2, 0.5, 1, 2, 5, 10, 20, 30-50 kD, as determined by standard molecular sizing techniques, such as centrifugation or SDS-polyacrylamide gel electrophoresis. Desired effects of the present invention include, but are not limited to, forming a fusion protein complex of the present invention with increased binding activity, killing target cells, e.g., to induce cell proliferation or cell death, initiating an immune response in preventing or treating disease, or acting as a detection molecule for diagnostic purposes. For such detection, an assay can be used, e.g., comprising the sequential steps of culturing cells to grow them, contacting the cells with a fusion protein complex of the present invention, and then assessing whether the fusion protein complex further inhibits cell development.

[0071] The process of covalently linking an effector molecule to a fusion protein complex of the invention according to the present invention offers a number of significant advantages. Fusion protein complexes of the invention can be generated containing a single effector molecule, including peptides of known structure. Furthermore, a wide variety of effector molecules can be generated within a similar DNA vector. That is, a library of different effector molecules can be linked to a fusion protein complex for the recognition of infected and diseased cells. Furthermore, for therapeutic applications, rather than administering the fusion protein complex of the invention to a subject, a DNA expression vector encoding the fusion protein complex can be administered for in vivo expression of the fusion protein complex. Such an approach avoids the costly purification steps typically associated with recombinant protein preparation and the complexities of antigen uptake and processing associated with conventional approaches.

[0072] As noted above, the components of the fusion proteins disclosed herein, e.g., effector molecules such as cytokines, chemokines, growth factors, protein toxins, immunoglobulin domains, or other biologically active molecules, and optional peptide linkers, can be organized in almost any manner, provided that the fusion protein has its intended function. In particular, each component of the fusion protein can be spaced from another component, if necessary, by at least one suitable peptide linker sequence. Additionally, the fusion protein can include tags, e.g., to facilitate modification, identification, and / or purification of the fusion protein. More specific fusion proteins are described in the Examples below.

[0073] "Detect" means to identify the presence, absence, or amount of the analyte being detected.

[0074] "Disease" means any condition or disorder that damages or interferes with the normal function of a cell, tissue, or organ. Examples of diseases include neoplasms and viral infections.

[0075] The terms "effective amount" and "therapeutically effective amount" of a formulation or a component of a formulation refer to an amount sufficient, alone or in combination, to provide the desired effect of the formulation or component. For example, an "effective amount" refers to the amount of a compound, alone or in combination, required to improve the symptoms of a disease compared to an untreated patient. The effective amount of an active compound used to practice the present invention for the therapeutic treatment of a disease will vary depending on the method of administration, the age, weight, and general health of the subject. Ultimately, the attending physician or veterinarian will determine the appropriate amount and administration regimen. Such an amount is referred to as an "effective" amount.

[0076] "Fragment" refers to a portion of a polypeptide or nucleic acid molecule. This portion preferably contains at least 10%, 20%, 30%, 40%, 50%, 60%, 70%, 80%, or 90% of the entire length of the reference nucleic acid molecule or polypeptide. For example, a fragment may contain 10, 20, 30, 40, 50, 60, 70, 80, 90, 100, 200, 300, 400, 500, 600, 700, 800, 900, or 1,000 nucleotides or amino acids. However, the present invention encompasses polypeptide and nucleic acid fragments, so long as they exhibit the desired biological activity of the full-length polypeptide and nucleic acid, respectively. Nucleic acid fragments of almost any length may be utilized. For example, exemplary polynucleotide segments having total lengths of about 10,000, about 5,000, about 3,000, about 2,000, about 1,000, about 500, about 200, about 100, or about 50 base pairs in length (including all intermediate lengths) are included in many embodiments of the invention. Similarly, polypeptide fragments of almost any length may be utilized. For example, exemplary polypeptide segments having lengths of about 10,000, about 5,000, about 3,000, about 2,000, about 1,000, about 500, about 200, about 100, or about 50 amino acids in length (including all intermediate lengths) are included in many embodiments of the invention.

[0077] The terms "isolated," "purified," or "biologically pure" refer to material that is, to various degrees, free from components that normally accompany it as found in its natural state. "Isolated" refers to a degree of separation from its original source or environment. "Purify" refers to a degree of separation that is greater than isolation.

[0078] A "purified" or "biologically pure" protein is sufficiently free from other materials so that any impurities do not materially affect the biological properties of the protein or produce other adverse effects. That is, a nucleic acid or peptide of the invention is purified if it is substantially free of cellular material, viral material, or culture medium if produced by recombinant DNA technology, or chemical precursors or other chemicals if chemically synthesized. Purity and homogeneity are typically determined using analytical chemistry techniques, such as polyacrylamide gel electrophoresis or high-performance liquid chromatography. The term "purified" can mean that the nucleic acid or protein gives rise to essentially one band in an electrophoretic gel. For proteins that can be modified, such as phosphorylation or glycosylation, different modifications can give rise to different isolated proteins that can be separately purified.

[0079] Similarly, "substantially pure" refers to a nucleotide or polypeptide that has been separated from components that naturally accompany it. Typically, nucleotides and polypeptides are substantially pure when they are at least 60%, 70%, 80%, 90%, 95%, or even 99%, by weight, free from the proteins and naturally-occurring organic molecules with which they are naturally associated.

[0080] An "isolated nucleic acid" refers to a nucleic acid that is completely free of the genes that flank it in the native genome of the organism from which it originates. This term covers, for example, (a) DNA that is part of a native genomic DNA molecule but is not flanked by both nucleic acid molecules that flank that portion of the molecule in the genome of the organism in which it naturally occurs; (b) a nucleic acid that has been incorporated into a vector or into the genomic DNA of a prokaryotic or eukaryotic organism in such a way that the resulting molecule is not identical to any native vector or genomic DNA; (c) a separate molecule, such as a cDNA, a genomic fragment, a fragment generated by polymerase chain reaction (PCR), or a restriction fragment; and (d) a recombinant nucleotide sequence that is part of a hybrid gene, i.e., a gene encoding a fusion protein. Isolated nucleic acid molecules according to the present invention further include synthetically produced molecules and any nucleic acid that has been chemically altered and / or has a modified backbone. For example, an isolated nucleic acid is a purified cDNA or RNA polynucleotide. Isolated nucleic acid molecules also include messenger ribonucleic acid (mRNA) molecules.

[0081] "Isolated polypeptide" refers to a polypeptide of the invention that has been separated from components that naturally accompany it. Typically, a polypeptide is isolated when it is at least 60%, by weight, free from the proteins and naturally-occurring organic molecules with which it is naturally associated. Preferably, the preparation is at least 75%, more preferably at least 90%, and most preferably at least 99%, by weight, a polypeptide of the invention. Isolated polypeptides of the invention can be obtained, for example, by extraction from a natural source, by expression of a recombinant nucleic acid encoding such a polypeptide, or by chemically synthesizing the protein. Purity can be measured by any appropriate method, such as column chromatography, polyacrylamide gel electrophoresis, or HPLC analysis.

[0082] "Marker" means any protein or polynucleotide having an alteration in expression level or activity that is associated with a disease or disorder.

[0083] "Neoplasm" means a disease or disorder characterized by excessive proliferation or decreased apoptosis. Exemplary neoplasms for which the present invention may be used include, but are not limited to, leukemia (e.g., acute leukemia, acute lymphocytic leukemia, acute myeloid leukemia, acute myeloblastic leukemia, acute promyelocytic leukemia, acute myelomonocytic leukemia, acute monocytic leukemia, acute erythroleukemia, chronic leukemia, chronic myelogenous leukemia, chronic lymphocytic leukemia), polycythemia vera, lymphoma (Hodgkin's disease, non-Hodgkin's disease), Waldenstrom's macroglobulinemia, heavy chain disease, and solid tumors such as sarcomas and carcinomas (e.g., fibrosarcoma, myxosarcoma, liposarcoma, chondrosarcoma, osteogenic sarcoma, chordoma, angiosarcoma, endothelial sarcoma, lymphangiosarcoma, lymphangiosarcoma, lymphangiocarcinoma ... These include endothelial cell sarcoma, synovium, mesothelioma, Ewing's tumor, leiomyosarcoma, rhabdomyosarcoma, colon cancer, pancreatic cancer, breast cancer, ovarian cancer, prostate cancer, squamous cell carcinoma, basal cell carcinoma, adenocarcinoma, sweat gland carcinoma, sebaceous gland carcinoma, papillary carcinoma, papillary adenocarcinoma, cystadenocarcinoma, medullary carcinoma, bronchogenic carcinoma, renal cell carcinoma, liver cancer, bile duct carcinoma, choriocarcinoma, seminoma, embryonal carcinoma, Wilms' tumor, cervical cancer, uterine cancer, testicular cancer, lung cancer, small cell lung carcinoma, bladder carcinoma, epithelial carcinoma, glioma, glioblastoma multiforme, astrocytoma, medulloblastoma, craniopharyngioma, ependymoma, pinealoma, hemangioblastoma, acoustic neuroma, oligodendroglioma, schwannoma, meningioma, melanoma, neuroblastoma, and retinoblastoma. In certain embodiments, the neoplasm is multiple myeloma, beta cell lymphoma, urothelial / bladder cancer, or melanoma. As used herein, "obtaining" in "obtaining an agent" includes synthesizing, purchasing, or otherwise acquiring the agent.

[0084] By "decreasing" is meant a negative change of at least 5%, 10%, 25%, 50%, 75% or 100%.

[0085] "Reference" means a standard or control condition.

[0086] A "reference sequence" is a defined sequence used as a basis for sequence comparison. A reference sequence can be a subset or the entirety of a particular sequence; for example, a segment of a full-length cDNA or gene sequence, or the complete cDNA or gene sequence. For polypeptides, the length of a reference polypeptide sequence will generally be at least about 16 amino acids, preferably at least about 20 amino acids, more preferably at least about 25 amino acids, even more preferably 35 amino acids, about 50 amino acids, or about 100 amino acids. For nucleic acids, the length of a reference nucleic acid sequence will generally be at least about 50 nucleotides, preferably at least about 60 nucleotides, more preferably at least about 75 nucleotides, even more preferably 100 nucleotides or about 300 nucleotides, or any integer number approximately therebetween.

[0087] "Specifically binds" means a compound or antibody that recognizes and binds to a polypeptide of the invention but does not substantially recognize and bind to other molecules in a sample, e.g., a biological sample that naturally contains a polypeptide of the invention.

[0088] Nucleic acid molecules useful in the methods of the present invention include any nucleic acid molecule encoding a polypeptide of the present invention or a fragment thereof. Such nucleic acid molecules need not be 100% identical to an endogenous nucleic acid sequence, but will typically exhibit substantial identity. A polynucleotide having "substantial identity" to an endogenous sequence will typically be able to hybridize with at least one strand of a double-stranded nucleic acid molecule. Nucleic acid molecules useful in the methods of the present invention include any nucleic acid molecule encoding a polypeptide of the present invention or a fragment thereof. Such nucleic acid molecules need not be 100% identical to an endogenous nucleic acid sequence, but will typically exhibit substantial identity. A polynucleotide having "substantial identity" to an endogenous sequence will typically be able to hybridize with at least one strand of a double-stranded nucleic acid molecule. "Hybridize" refers to pairs or portions thereof that form double-stranded molecules between complementary polynucleotide sequences (e.g., genes described herein) under conditions of various stringencies (see, e.g., Wahl, GM and SL Berger (1987) Methods Enzymol. 152:399; Kimmel, AR (1987) Methods Enzymol. 152:507).

[0089] For example, stringent salt concentrations will typically be less than about 750 mM NaCl and 75 mM trisodium citrate, preferably less than about 500 mM NaCl and 50 mM trisodium citrate, and more preferably less than about 250 mM NaCl and 25 mM trisodium citrate. Low stringency hybridization can be achieved in the absence of organic solvents, such as formamide, while high stringency hybridization can be achieved in the presence of at least about 35% formamide, more preferably at least about 50% formamide. Stringent temperature conditions will typically include a temperature of at least about 30°C, more preferably at least about 37°C, and most preferably at least about 42°C. Various additional parameters, such as hybridization time, concentration of detergent, e.g., sodium dodecyl sulfate (SDS), and inclusion or exclusion of carrier DNA, are well known to those skilled in the art. Various levels of stringency can be achieved by combining these various conditions as needed. In a preferred embodiment, hybridization will occur at 30° C. in 750 mM NaCl, 75 mM trisodium citrate, and 1% SDS. In a more preferred embodiment, hybridization will occur at 37° C. in 500 mM NaCl, 50 mM trisodium citrate, 1% SDS, 35% formamide, and 100 μg / mL denatured salmon sperm DNA (ssDNA). In a most preferred embodiment, hybridization will occur at 42° C. in 250 mM NaCl, 25 mM trisodium citrate, 1% SDS, 50% formamide, and 200 μg / mL ssDNA. Useful variations on these conditions will be readily apparent to those of skill in the art.

[0090] For most applications, washing steps following hybridization will also vary in stringency. Wash stringency conditions can be defined by salt concentration and temperature. As noted above, wash stringency can be increased by decreasing salt concentration or increasing temperature. For example, stringent salt concentrations for wash steps would preferably be less than about 30 mM NaCl and 3 mM trisodium citrate, most preferably less than about 15 mM NaCl and 1.5 mM trisodium citrate. Stringent temperature conditions for wash steps include temperatures of at least about 25°C, more preferably at least about 42°C, and even more preferably at least about 68°C. In a preferred embodiment, wash steps will be performed at 25°C in 30 mM NaCl, 3 mM trisodium citrate, and 0.1% SDS. In a more preferred embodiment, wash steps will be performed at 42°C in 15 mM NaCl, 1.5 mM trisodium citrate, and 0.1% SDS. In a more preferred embodiment, wash steps will be performed at 68°C in 15 mM NaCl, 1.5 mM trisodium citrate, and 0.1% SDS. Additional variations on these conditions will be readily apparent to those skilled in the art. Hybridization techniques are well known to those skilled in the art and are described, for example, in Benton and Davis (Science 196:180, 1977); Grunstein and Hogness (Proc. Natl. Acad. Sci., USA 72:3961, 1975); Ausubel et al. (Current Protocols in Molecular Biology, Wiley Interscience, New York, 2001); Berger and Kimmel (Guide to Molecular Cloning Techniques, 1987, Academic Press, New York); and Sambrook et al., Molecular Cloning: A Laboratory Manual, Cold Spring Harbor Laboratory Press, New York.

[0091] "Substantially identical" refers to a polypeptide or nucleic acid molecule that exhibits at least 50% identity to a reference amino acid sequence (e.g., any one of the amino acid sequences described herein) or nucleic acid sequence (e.g., any one of the nucleic acid sequences described herein). Preferably, such a sequence is at least 60%, more preferably 80% or 85%, more preferably 90%, 95% or even 99% identical at the amino acid or nucleic acid level to the sequence used for comparison.

[0092] Sequence identity is typically measured using sequence analysis software (e.g., Sequencher, Gene Codes Corporation, 775 Technology Drive, Ann Arbor, MI; Vector NTI, Life Technologies, 3175 Staley Rd., Grand Island, NY). Such software matches identical or similar sequences by assigning degrees of homology to various substitutions, deletions, and / or other modifications. Conservative substitutions typically include substitutions within the following groups: glycine, alanine; valine, isoleucine, leucine; aspartic acid, glutamic acid, asparagine, glutamine; serine, threonine; lysine, arginine; and phenylalanine, tyrosine. An exemplary approach for determining the degree of identity is to use the -3 ~e -100 BLAST programs can be used where a probability score of 0 indicates closely related sequences.

[0093] "Subject" means a mammal, including, but not limited to, a human or non-human mammal, such as a cow, horse, dog, sheep, or cat. The subject is preferably a mammal in need of such treatment, such as a subject diagnosed with or predisposed to B-cell lymphoma. The mammal may be any mammal, such as a human, a primate, mouse, rat, dog, cat, horse, or livestock or animal raised for food, such as cows, sheep, pigs, chickens, and goats. In one preferred embodiment, the mammal is a human.

[0094] Ranges provided herein are understood to be shorthand for all numbers within the range. For example, a range of 1 to 50 is understood to include any number, combination of numbers, or subrange from the group consisting of 1, 2, 3, 4, 5, 6, 7, 8, 9, 10, 11, 12, 13, 14, 15, 16, 17, 18, 19, 20, 21, 22, 23, 24, 25, 26, 27, 28, 29, 30, 31, 32, 33, 34, 35, 36, 37, 38, 39, 40, 41, 42, 43, 44, 45, 46, 47, 48, 49, or 50.

[0095] As used herein, the terms "treat" and "treatment" refer to the administration of an agent or preparation to a clinically symptomatic individual afflicted with an adverse condition, disorder, or disease to affect a reduction in the severity and / or frequency of symptoms, eliminate the symptoms and / or their underlying causes, and / or promote the improvement or correction of damage. It will be understood that treating a disease or condition does not require that the disorder, its associated condition, or symptoms be completely eliminated, although this is not excluded. The agent or preparation used in treatment may include cells or tissues.

[0096] Treatment for patients with neoplasms may include any of the following: adjuvant therapy (also called adjuvant or additional therapy) to destroy residual cells that may be present after a known tumor has been removed by initial therapy (e.g., surgery), thereby preventing possible cancer recurrence; neoadjuvant therapy, which is performed before a surgical procedure to shrink the cancer; induction therapy, which typically induces remission for acute leukemia; consolidation therapy (also called intensification therapy), which is performed after remission is achieved to maintain remission; maintenance therapy, which is given in lower doses or less frequently to help prolong remission; first-line therapy (also called standard therapy); second-line (or third-line, fourth-line, etc.) therapy (also called salvage therapy), which is given when the disease does not respond or recurs after first-line therapy; and palliative therapy (also called symptomatic treatment), which addresses symptom management without the hope of significantly reducing the cancer.

[0097] The terms "preventing" and "prevention" refer to the administration of an agent or composition to a clinically asymptomatic individual who is susceptible or predisposed to a particular adverse condition, disorder or disease, and thus to the prevention of the onset of symptoms and / or their underlying causes.

[0098] Unless specifically stated otherwise or clear from the context, the term "or" as used herein is understood to be inclusive. Unless specifically stated otherwise or clear from the context, the terms "a," "an," and "the" as used herein are understood to be singular or plural.

[0099] Unless specifically specified or clear from the context, the term "about" as used herein is understood to mean within a range of normal acceptance in the art, for example, within two standard deviations of the mean value. "About" may be understood to mean within 10%, 9%, 8%, 7%, 6%, 5%, 4%, 3%, 2%, 1%, 0.5%, 0.1%, 0.05%, or 0.01% of the standard value. Unless otherwise clear from the context, all numerical values provided herein are modified by the term "about."

[0100] The recitation of a listing of chemical groups in any definition of a variable herein includes definition of that variable as any single group or combination of listed groups. The recitation of an embodiment for a variable or aspect herein includes that embodiment as any single embodiment or in combination with any other embodiment or portion thereof.

[0101] Any composition or method provided herein can be combined with any of the other compositions and one or more of the methods provided herein.

[0102] The transitional term "comprising," which is synonymous with "comprising," "containing," or "characterized by," is inclusive or open-ended and does not exclude additional, unrecited elements or method steps. In contrast, the transitional phrase "consisting of" excludes any element, step, or ingredient not specified in the claim. The transitional phrase "consisting essentially of" limits the claim to the claimed materials or steps "and which do not materially affect the basic, novel characteristics" of the invention.

[0103] Other features and advantages of the present invention will be apparent from the following detailed description of the preferred embodiments of the invention and the claims. Unless otherwise specified, all technical and scientific terms used herein have the same meaning as commonly understood by one of ordinary skill in the art to which this invention belongs. Although methods and materials similar or equivalent to those described herein can be used in the practice or testing of the present invention, suitable methods and materials are described below. All published foreign patents and patent applications mentioned herein are incorporated herein by reference.

[0104] Genbank and NCBI deposits, identified by accession numbers, cited herein are incorporated by reference. All other published references, documents, manuscripts, and scientific literature cited herein are incorporated by reference. In case of conflict, the present specification, including definitions, will control. Furthermore, the materials, methods, and examples are intended to be illustrative only and not limiting. [Brief explanation of the drawings]

[0105] [Figure 1A] Schematic diagram illustrating various TxM fusion protein complexes comprising an IL-15N72D:IL-15RαSu / Fc scaffold fused to IL-12 and IL-18 binding domains. In some cases, the dimeric IL-15RαSu / Fc fusion protein complex comprises one or two IL-15N72D fusion proteins. [Figure 1B]FIG. 1 is a schematic diagram illustrating various TxM fusion protein complexes comprising an IL-15N72D:IL-15RαSu / Fc scaffold fused to an IL-18 binding domain. [Figure 2A] 1 is a line graph showing the chromatographic profile of hIL18 / IL12 / TxM protein-containing cell culture supernatant after binding on and elution from a Protein A resin. [Figure 2B] 1 is a line graph showing the chromatographic profile of Protein A purified hIL18 / IL12 / TxM protein after elution on a preparative size exclusion column. [Figure 2C] FIG. 1 is a line graph showing the chromatographic profile of Protein A / SEC purified hIL18 / IL12 / TxM protein after elution on an analytical size exclusion column demonstrating separation of the monomeric multi-protein hIL18 / IL12 / TxM fusion protein complex from protein aggregates. [Figure 3] Photograph showing sodium dodecyl sulfate polyacrylamide gel (4-12%) electrophoresis (SDS-PAGE) analysis of hIL18 / IL12 / TxM fusion protein complexes after disulfide bond reduction. Left lane: SeeBlue Plus2 marker; right lane: Protein A-purified hIL18 / IL12 / TxM. [Figure 4A] 1 is a line graph showing the binding activity of hIL18 / IL12 / TxM fusion protein complexes to antibodies specific for human IL-15 and human IgG. [Figure 4B] 1 is a line graph showing the binding activity of hIL12 / IL18 / TxM fusion protein complexes to antibodies specific for human IL-15 and human IgG. [Figure 4C] 1 is a line graph showing the binding activity of two-headed IL18 / TxM fusion protein complexes to antibodies specific for human IL-15 and human IL-18. Controls include anti-CD20 TxM (2B8T2M), ALT-803, and hIL12 / IL18 / TxM, depending on the assay format. [Figure 5]1 is a line graph illustrating IL-15-dependent 32D beta cell proliferation mediated by hIL18 / IL12 / TxM fusion protein complex compared to ALT-803. [Figure 6] 10 is a line graph further illustrating IL-15-dependent 32D beta cell proliferation mediated by hIL18 / IL12 / TxM fusion protein complex compared to ALT-803. [Figure 7] 1 is a line graph further illustrating activation of IL-18 sensitive HEK18 receptor cells mediated by hIL18 / IL12 / TxM fusion protein complexes compared to IL-18. [Figure 8] 1 is a line graph further illustrating activation of IL-12 sensitive HEK12 receptor cells mediated by hIL18 / IL12 / TxM fusion protein complex compared to IL-12. [Figure 9A-9B] 9A and 9B are line graphs showing IL-12 bioactivity of hIL18 / IL12 / TxM (FIG. 9A) or the combination of recombinant IL-12, IL-18, and ALT-803 (rIL12+rIL18+ALT-803) (FIG. 9B) (red line) compared to medium control (black line) for stimulating STAT4 phosphorylation in NK cells. [Figure 9C-9D] 1 is a line graph showing IL-18 bioactivity of hIL18 / IL12 / TxM (A) or the combination of recombinant IL-12, IL-18 and ALT-803 (rIL12+rIL18+ALT-803) (B) (red line) compared to medium control (black line) in stimulating phosphorylation of p38 MAPK in purified human NK cells. [Figure 9E-9F] 1 is a line graph showing the IL-15 bioactivity of hIL18 / IL12 / TxM (A) or the combination of recombinant IL-12, IL-18 and ALT-803 (rIL12+rIL18+ALT-803) (B) (red line) compared to medium control (black line) in stimulating STAT5 phosphorylation in aNK cells. [Figure 10A]1 is a bar graph illustrating the combined cytokine immunostimulatory activity of hIL18 / IL12 / TxM fusion protein complexes compared to cytokines alone or in combination for inducing IFN-γ production by aNK cells. [Figure 10B] 1 is a line graph illustrating the cytokine immunostimulatory activity of the double-headed IL18 / TxM fusion protein complex compared to ALT-803 or hIL18 / IL12 / TxM for inducing IFN-γ production by aNK cells. [Figures 11A-11B] 11A and 11B are line graphs showing the biological activity of hIL18 / IL12 / TxM (FIG. 11A) or the combination of recombinant IL-12, IL-18, and ALT-803 (rIL12+rIL18+ALT-803) (FIG. 11B) (red line) compared to medium control (black line) for inducing CD25 by purified human NK cells. [Figures 11C-11D] 11A and 11B are line graphs showing the biological activity of hIL18 / IL12 / TxM (FIG. 11A) or the combination of recombinant IL-12, IL-18, and ALT-803 (rIL12+rIL18+ALT-803) (FIG. 11B) (red line) compared to medium control (black line) for inducing CD69 by purified human NK cells. [Figures 11E-11F] 1 is a line graph showing the biological activity of hIL18 / IL12 / TxM (A) or the combination of recombinant IL-12, IL-18 and ALT-803 (rIL12+rIL18+ALT-803) (B) (red line) compared to medium control (black line) for inducing intracellular IFN-γ by purified human NK cells. [Figure 12A] 1 is a line graph illustrating the induction of activation marker CD25 on the surface of human NK cells mediated by hIL18 / IL12 / TxM fusion protein complexes compared to IL-18+IL-12+ALT-803. [Figure 12B] 1 is a line graph illustrating the induction of intracellular IFN-γ in human NK cells mediated by hIL18 / IL12 / TxM fusion protein complex compared to IL-18+IL-12+ALT-803. [Figure 13A]1 is a bar graph illustrating the maintenance of CD25 on the surface of human CIML NK cells induced by priming with hIL18 / IL12 / TxM fusion protein complex (compared to ALT-803) followed by resting in ALT-803. [Figure 13B] 1 is a bar graph illustrating enhanced levels of intracellular IFN-γ in human CIML NK cells primed with hIL18 / IL12 / TxM fusion protein complexes (compared to ALT-803), then rested in ALT-803, and induced by restimulation with IL-12+ALT-803 or K562 leukemia targets. [Figure 14A] FIG. 1 shows contour plots illustrating proliferation (CTV dilution) and IFN-γ expression in human CIML NK cells primed with hIL18 / IL12 / TxM fusion protein complexes, individual cytokines, or IL-18+IL-12+ALT-803, then rested in IL-15, and induced by restimulation with IL-12+ALT-803 compared to no restimulation. [Figure 14B] FIG. 11 is a contour plot illustrating proliferation (CTV dilution) and IFN-γ expression in human CIML NK cells primed with hIL18 / IL12 / TxM fusion protein complexes, individual cytokines, or IL-18+IL-12+ALT-803, then rested in ALT-803, and induced by restimulation with IL-12+ALT-803 compared to no restimulation. [Figure 15] 1 shows histogram plots illustrating proliferation (CTV dilution) in human CIML NK cells primed with hIL18 / IL12 / TxM fusion protein complexes, individual cytokines, or IL-18+IL-12+ALT-803, then rested in IL-15 or ALT-803, and induced by restimulation with IL-12+ALT-803. [Figure 16]1 is a bar graph illustrating human NK cell cytotoxicity against MDA-MB-231 human breast cancer cells induced by hIL18 / IL12 / TxM fusion protein complex or ALT-803 (IL-15N72D:IL-15Rα / Fc complex). [Figure 17A] 1 is a bar graph illustrating the induction of intracellular granzyme B in human NK cells mediated by hIL18 / IL12 / TxM fusion protein complexes compared to ALT-803 or no treatment. [Figure 17B] 1 is a bar graph illustrating the direct cytotoxicity (vehicle bars) or antibody-dependent cellular cytotoxicity (αTF antibody bars) of human NK cells against tissue factor-positive SW1990 human pancreatic adenocarcinoma cells after priming with hIL18 / IL12 / TxM fusion protein complex compared to medium alone or ALT-803. [Figure 17C] 1 is a bar graph illustrating increased expression of IFN-γ by human NK cells incubated with SW1990 human pancreatic adenocarcinoma cells with anti-TF antibody or media alone (vehicle) after priming with hIL18 / IL12 / TxM fusion protein complex compared to media alone or ALT-803. [Figure 18A] 1 is a bar graph showing the change in spleen weight after administration of hIL18 / IL12 / TxM (20 mg / kg) versus PBS in C57BL / 6 mice. [Figure 18B] 1 is a bar graph showing the changes in CD8 T cell and NK cell numbers in the spleens of C57BL / 6 mice following administration of hIL18 / IL12 / TxM (20 mg / kg) compared to PBS controls. [Figure 18C] 1 is a bar graph showing the change in the percentage of absolute CD8 T cells and NK cells in the blood of C57BL / 6 mice after administration of hIL18 / IL12 / TxM (20 mg / kg) compared to PBS control. [Figure 18D] 1 is a bar graph showing the change in the percentage of CD8 T cells and NK cells in the blood of C57BL / 6 mice after administration of hIL18 / IL12 / TxM (20 mg / kg) compared to PBS control. DETAILED DESCRIPTION OF THE INVENTION

[0106] Therapies utilizing natural killer (NK) cells and T cells have emerged as promising treatments for cancer and viral infections due to the ability of these cells to kill diseased cells and release proinflammatory cytokines (see, e.g., Fehniger TA and Cooper MA. Trends Immunol. 2016;37:877-888; and Cerwenka A and Lanier LL. Nat Rev Immunol. 2016 16:112-23). Of particular interest are cytokine-induced memory-like (CIML) natural killer (NK) cells, which exhibit sustained non-antigen-specific NK cell effector function. These cells can be induced ex vivo following overnight stimulation of purified NK cells with saturating doses of interleukin-12 (IL-12, 10 ng / mL), IL-15 (50 ng / mL), and IL-18 (50 ng / mL). These primed NK cells exhibit memory-like properties, such as 1) enhanced proliferation, 2) expression of IL-2 receptor alpha (IL-2Rα, CD25), perforin, granzymes, and other activation markers, and 3) increased interferon-gamma (IFN-γ) production after restimulation.

[0107] The initial therapeutic evaluation of CIML NK cells in a first-in-human phase 1 clinical trial utilized ex vivo IL-12 / IL-15 / IL-18 stimulation of allogeneic haploidentical NK cells followed by adoptive transfer of CIML NK cells into patients with relapsed or refractory acute myeloid leukemia (AML) who had been preconditioned with cyclophosphamide and fludarabine. After transfer, patients received low-dose IL-2 to support the cells in vivo. These transferred, primed NK cells peaked in frequency 7–14 days after infusion, with over 90% of total NK cells in the blood 7 days after transfer. Of the nine patients evaluable at the time of publication, four had complete remissions in addition to one patient with a morphologically leukemia-free status, suggesting promising therapeutic activity mediated by adoptively transferred CIML NK cells (see Romee, R, et al. Sci Transl Med. 2016;8:357ra123, incorporated herein by reference).

[0108] Prior to the invention described herein, optimal methods for generating CIML NK cells were not fully characterized. Prior to the invention described herein, strategies utilized recombinant human IL-12 (produced in insect cells), human IL-18 (produced in E. coli), and human IL-15 (produced in E. coli), which differ in glycosylation and potentially other post-translational modifications compared to mammalian cell-purified cytokines. Recombinant cytokines may also have different purity and stability and are not generally available as clinical materials. Furthermore, each cytokine is expected to have unique receptor binding, internalization, and recycling properties.

[0109] Thus, provided herein are multispecific IL-15-based fusion protein complexes containing IL-12 and IL-18 binding domains (Figures 1A and 1B). Specifically, described herein are fusion protein complexes comprising an IL-15N72D:IL-15RαSu-Ig Fc scaffold fused to IL-12 and IL-18 binding domains. When characterized using human immune cells, these fusion protein complexes exhibit the binding and biological activities of IL-15, IL-12, and IL-18 cytokines, respectively. Furthermore, these fusion protein complexes act to induce CIML NK cells with elevated activation markers, increased cytotoxicity against tumor cells, and enhanced production of IFN-γ. Thus, the fusion protein complex as a single molecule binds to and signals through multiple cytokine receptors on NK cells, providing a synergistic response previously observed only with the combination of multiple individual cytokines. Furthermore, these fusion protein complexes provide soluble multi-polypeptide complexes, bind protein A for purification purposes, and contain the Fc region of an Ig molecule that can dimerize to interact with Fcγ receptors on NK cells and macrophages, thereby providing advantages not present in combinations of individual cytokines. Mammalian cell expression-based methods for producing these fusion protein complexes suitable for large-scale production of clinical material are described herein. Additional methods for generating and using CIML NK cells induced by the fusion protein complexes of the invention are also provided.

[0110] Interleukin-15 Interleukin-15 (IL-15) stimulates effector NK cells and CD8 + IL-15 is an important cytokine for the development, proliferation, and activation of memory T cells. IL-15 binds to the IL-15 receptor α (IL-15Rα) and activates the IL-2 / IL-15 receptor β common γ chain (IL-15Rβγ) on effector cells. c ) complex. IL-15 and IL-2 are presented in trans to the IL-15Rβγ cHowever, unlike IL-2, IL-15 binds to CD4 + CD25 + FOXP3 + Supporting the maintenance of regulatory T (Treg) cells also involves activated CD8 + It also does not induce T cell death, an effect that may limit the therapeutic activity of IL-2 against multiple myeloma. Furthermore, IL-15 inhibits the effector CD8 + It is the only cytokine known to provide an anti-apoptotic signal to T cells. IL-15, administered either alone or in complex with IL-15Rα, exhibits potent anti-tumor activity against well-established solid tumors in experimental animal models and has therefore been identified as one of the most promising immunotherapeutic agents that can potentially treat cancer.

[0111] To facilitate the clinical development of IL-15-based cancer therapeutics, an IL-15 mutant (IL-15N72D) with increased biological activity compared to IL-15 was identified (Zhu et al., J Immunol, 183:3598-3607, 2009). The pharmacokinetics and biological activity of this IL-15 superagonist (IL-15N72D) were further improved by creating an IL-15N72D:IL-15Rα / Fc fusion complex (ALT-803), such that the superagonist complex possessed at least 25-fold greater activity than the native cytokine in vivo (Han et al., Cytokine, 56:804-810, 2011).

[0112] IL-15:IL-15Rα protein complex As noted above, an IL-15:IL-15Rα fusion protein complex can refer to a complex having IL-15 noncovalently bound to a soluble IL-15Rα domain of native IL-15Rα. In some cases, the soluble IL-15Rα is covalently bound to a biologically active polypeptide and / or an IgG Fc domain. The IL-15 can be either IL-15 or IL-15 covalently bound to a second biologically active polypeptide. The crystal structure of the IL-15:IL-15Rα protein complex is shown in Chirifu et al., 2007 Nat Immunol 8, 1001-1007, incorporated herein by reference.

[0113] In various embodiments of the above or any other aspect of the invention delineated herein, the IL-15Rα fusion protein comprises soluble IL-15Rα, e.g., IL-15Rα covalently linked to a biologically active polypeptide (e.g., an IgG heavy chain constant domain, an Fc domain of an IgG heavy chain constant domain, or a cytokine). In other embodiments of the above aspects of the invention, the IL-15 comprises IL-15, e.g., IL-15 covalently linked to a second biologically active polypeptide, e.g., a cytokine. In other embodiments, purifying the IL-15:IL-15Rα fusion protein complex from the host cell or culture medium comprises capturing the IL-15:IL-15Rα fusion protein complex on an affinity reagent that specifically binds to the IL-15:IL-15Rα fusion protein complex. In other embodiments, the IL-15Rα fusion protein comprises an IL-15Rα / Fc fusion protein, and the affinity reagent specifically binds to the Fc domain. In other embodiments, the affinity reagent is Protein A or Protein G. In other embodiments, the affinity reagent is an antibody. In other embodiments, purifying the IL-15:IL-15Rα fusion protein complex from the host cells or culture medium comprises ion exchange chromatography, hi other embodiments, purifying the IL-15:IL-15Rα fusion protein complex from the host cells or culture medium comprises size exclusion chromatography.

[0114] In another embodiment, the IL-15Rα comprises IL-15RαSushi (IL-15RαSu). In another embodiment, the IL-15 is a mutant IL-15 (e.g., IL-15N72D). In another embodiment, the IL-15 binding site of the IL-15:IL-15Rα fusion protein complex is fully occupied. In another embodiment, both IL-15 binding sites of the IL-15:IL-15RαSu / Fc fusion protein complex are fully occupied. In another embodiment, the IL-15:IL-15Rα fusion protein complex is purified based on the charge or size characteristics of the fusion protein complex. In another embodiment, the fully occupied IL-15N72D:IL-15RαSu / Fc fusion protein complex is purified by anion exchange chromatography based on the charge characteristics of the fusion protein complex. In another embodiment, the fully occupied IL-15N72D:IL-15RαSu / Fc fusion protein complex is purified using a quaternary amine-based resin with binding conditions using a low ionic strength neutral pH buffer and elution conditions utilizing buffers of increasing ionic strength.

[0115] In certain embodiments, the soluble fusion protein complex comprises a first and a second soluble protein, wherein the first soluble protein comprises an interleukin-15 (IL-15) polypeptide domain linked to an IL-12 or IL-18 binding domain or a functional fragment thereof, and the second soluble protein comprises a soluble IL-15 receptor alpha sushi binding domain (IL-15RαSu) fused to an immunoglobulin Fc domain, wherein the IL-15RαSu domain is linked to the IL-12 or IL-18 binding domain or a functional fragment thereof, and the IL-15 polypeptide domain of the first soluble protein binds to the IL-15RαSu domain of the second soluble protein to form the soluble fusion protein complex.

[0116] In certain embodiments, the isolated soluble fusion protein complex comprises an interleukin-15 (IL-15) polypeptide domain linked to an IL-12 and / or IL-18 binding domain or a functional fragment thereof. In certain embodiments, the IL-15 polypeptide domain is an IL-15 variant comprising an N72D mutation (IL-15N72D).

[0117] In certain embodiments, the isolated soluble fusion protein complex comprises a soluble IL-15 receptor alpha sushi binding domain (IL-15RαSu) fused to an immunoglobulin Fc domain, wherein the IL-15RαSu domain is linked to an IL-12 and / or IL-18 binding domain or a functional fragment thereof.

[0118] Isolated protein fusion complexes can be "double-headed" fusion protein complexes. These complexes can vary in their combinations of IL-15, IL-15RαSu / Fc, and interleukins, including, for example, IL-18 / IL-15RαSu / Fc and IL-15N72D fusion proteins or IL-15RαSu / Fc and IL-18 / IL-15N72D fusion proteins (FIG. 1B). Similarly, these fusion protein complexes can include IL-12 / IL-15RαSu / Fc and IL-15N72D fusion proteins or IL-15RαSu / Fc and IL-12 / IL-15N72D fusion proteins. The types of molecules, including these combinations and variants, mutants, homologs, analogs, modified molecules, etc., can vary.

[0119] Thus, in certain embodiments, the isolated soluble protein complex comprises a first and a second soluble protein, wherein the first soluble protein comprises an interleukin-15 receptor alpha sushi binding domain (IL-15RαSu) fused to an immunoglobulin Fc domain, wherein the IL-15RαSu domain is fused to an IL-18 binding domain or a functional fragment thereof, and the second soluble protein comprises an interleukin-15 (IL-15) polypeptide domain fused to an IL-18 domain, wherein the IL-15 polypeptide domain of the first soluble protein binds to the IL-15RαSu domain of the second soluble protein to form the soluble fusion protein complex.

[0120] In another embodiment, the isolated soluble fusion protein complex comprises a first and a second soluble protein, wherein the first soluble protein comprises an interleukin-15 receptor alpha sushi binding domain (IL-15RαSu) fused to an immunoglobulin Fc domain, wherein the IL-15RαSu domain is fused to an IL-12 binding domain or a functional fragment thereof, and the second soluble protein comprises an interleukin-15 (IL-15) polypeptide domain fused to an IL-12 domain, and wherein the IL-15 polypeptide domain of the first soluble protein binds to the IL-15RαSu domain of the second soluble protein to form the soluble fusion protein complex.

[0121] In certain embodiments, the isolated soluble fusion protein comprises an interleukin-15 polypeptide domain, a first soluble protein, and a second soluble protein, wherein the first soluble protein comprises an interleukin-15 receptor alpha sushi binding domain (IL-15RαSu) fused to an immunoglobulin Fc domain, the IL-15RαSu domain linked to an IL-12 and / or IL-18 binding domain or a functional fragment thereof, and a second soluble protein comprising an interleukin-15 receptor alpha sushi binding domain (IL-15RαSu) fused to an immunoglobulin Fc domain, the IL-15RαSu domain linked to an IL-12 and / or IL-18 binding domain or a functional fragment thereof, and the IL-15 polypeptide domain binds to the IL-15RαSu domain of the first and / or second soluble protein to form a soluble fusion protein complex.

[0122] In another embodiment, the isolated soluble fusion protein comprises an interleukin-15 receptor alpha sushi binding domain (IL-15RαSu) fused to an immunoglobulin Fc domain, first and second soluble proteins, wherein the first soluble protein comprises an interleukin-15 polypeptide domain linked to an IL-12 and / or IL-18 binding domain or a functional fragment thereof, and a second soluble protein comprising an interleukin-15 polypeptide domain linked to an IL-12 and / or IL-18 binding domain or a functional fragment thereof, and wherein the IL-15 polypeptide domain of the first and / or second soluble protein binds to the IL-15RαSu domain to form the soluble fusion protein complex.

[0123] In certain embodiments of the soluble fusion protein complexes of the invention, the IL-15 polypeptide is an IL-15 variant having an amino acid sequence that differs from that of a native IL-15 polypeptide. Human IL-15 polypeptides are referred to herein as huIL-15, hIL-15, huIL15, hIL15, or IL-15 wild-type (wt), and variants thereof are referred to using the native amino acid, its position in the mature sequence, and the mutated amino acid. For example, huIL15N72D refers to human IL-15 containing an N to D substitution at position 72. In certain embodiments, the IL-15 variant functions as an IL-15 agonist, e.g., as demonstrated by increased binding activity to the IL-15RβγC receptor compared to the native IL-15 polypeptide. In certain embodiments, the IL-15 variant functions as an IL-15 antagonist, e.g., as demonstrated by decreased binding activity to the IL-15RβγC receptor compared to the native IL-15 polypeptide. In some embodiments, the IL-15 variant has increased binding affinity or decreased binding activity for the IL-15RβγC receptor compared to a native IL-15 polypeptide. In some embodiments, the sequence of the IL-15 variant has at least one (i.e., 1, 2, 3, 4, 5, 6, 7, 8, 9, 10 or more) amino acid change compared to the native IL-15 sequence. The amino acid change may include one or more amino acid substitutions or deletions within the IL-15 domains that interact with IL-15Rβ and / or IL-15RγC. In some embodiments, the amino acid change is one or more amino acid substitutions or deletions at positions 8, 61, 65, 72, 92, 101, 108, or 111 of the mature human IL-15 sequence. For example, the amino acid change is a D to N or A substitution at position 8, a D to A at position 61, an N to A at position 65, an N to R at position 72, or a Q to A at position 108 of the mature human IL-15 sequence, or any combination of these substitutions. In certain embodiments, the amino acid change is an N to D substitution at position 72 of the mature human IL-15 sequence.

[0124] ALT-803 ALT-803 comprises an IL-15 mutant with an increased ability to bind to IL-2Rβγ and enhanced biological activity (see U.S. Pat. No. 8,507,222, incorporated herein by reference). This superagonist mutant of IL-15 was described in a publication (Zu et al., 2009 J Immunol, 183:3598-3607, incorporated herein by reference). This IL-15 superagonist (IL-15RαSu / Fc) combined with a soluble IL-15α receptor fusion protein generates a fusion protein complex with highly potent IL-15 activity in vitro and in vivo (Han et al., 2011, Cytokine, 56:804-810; Xu et al., 2013 Cancer Res. 73:3075-86; Wong et al., 2013 Oncolmmunology 2:e26442). The IL-15 superagonist complex contains an IL-15 mutant (IL-15N72D) fusion protein (IL-15N72D:IL-15RαSu / Fc) linked to an IL-15 receptor α / IgG1 Fc fusion protein, termed "ALT-803."

[0125] Pharmacokinetic analysis showed that the fusion protein complex had a half-life of 25 hours after iv administration in mice. ALT-803 exhibits impressive antitumor activity against advanced solid tumors and hematological tumor models in immunocompetent mice. ALT-803 can be administered as monotherapy using twice-weekly or once-weekly iv dosing regimens, or in combination therapy with antibodies. ALT-803 antitumor responses are durable. Tumor-bearing mice cured after ALT-803 treatment were highly resistant to rechallenge with the same tumor cells, indicating that ALT-803 induces an effective immunological memory response against reintroduced tumor cells.

[0126] The sequence of ALT-803 (IL-15N72D associated with a dimeric IL-15RαSu / Fc fusion protein) comprises SEQ ID NO:9. IL-15N72D protein sequence (including leader peptide) METDTLLLWVLLLWVPGSTG- [Leader peptide] [ka]

[0127] IL-15RαSu / Fc protein sequence (including leader peptide) MDRLTSSFLLLIVPAYVLS- [Leader peptide] [ka] [ka]

[0128] IL-12 IL-12 is a member of the cytokine family consisting of IL-12, IL-23, IL-27, and IL-35, which have diverse functions and play important roles in both pro- and anti-inflammatory responses. IL-12 is typically expressed by activated antigen-presenting cells (APCs). IL-12 promotes Th1 differentiation and IFN-γ production by T cells and plays an important role in inducing anti-tumor responses. As described herein, IL-12 in combination with IL-15 and IL-18 can induce CIML NK cells.

[0129] IL-12 is a disulfide-linked heterodimer consisting of an α subunit (p35) and a β subunit (p40), where the α subunit consists of a four-helix bundle of long-chain cytokines and the β subunit is homologous to non-signaling receptors of the IL-6 family. Crystal structure and mutagenesis analysis of IL-12 have defined amino acid residues at the p35 / p40 interface that are important for subunit interactions (Yoon et al., 2000, EMBO J. 9, 3530-354). For example, a key arginine residue (R189) in p35 interacts with an aspartic acid residue (D290) in p40 such that the R189 side chain is buried within a hydrophilic pocket on p40. Furthermore, structural changes in p40 may be important in optimizing these interactions. Based on this information, IL-12 mutants containing amino acid changes that exhibit improved subunit interactions can be generated. Additionally, single-chain forms of IL-12 can be generated that consist of a p35 subunit linked to a p40 subunit by a flexible linker, either through the C-terminus of p35 linked to the N-terminus of p40, or vice versa. Such variants can be incorporated into the fusion protein complexes of the invention to optimize expression, subunit interaction, and / or stability of the IL-12 binding domain. Similarly, the IL-12 gene and expression constructs can be modified (i.e., codon optimization, removal of secondary structure) to improve gene expression, translation, post-translational modification, and / or secretion.

[0130] The effects of IL-12 are mediated by binding to a transmembrane receptor composed of two subunits (IL-12Rβ1 and IL-12Rβ2). Each receptor subunit consists of an extracellular ligand-binding domain, a transmembrane domain, and a cytoplasmic domain that mediates binding of Janus family tyrosine kinases. IL-12 binding is thought to result in heterodimerization of β1 and β2 subunits and the formation of a high-affinity receptor complex that enables signal transduction. In this model, receptor dimerization leads to the juxtaposition of the cytoplasmic domains and subsequent tyrosine phosphorylation and activation of the receptor-associated Janus family kinases, Jak2 and Tyk-2. These activated kinases in turn tyrosine phosphorylate and activate several members of the signal transducer and activator of transcription (STAT) family (STAT-1, -3, and -4). STATs translocate to the nucleus and activate the transcription of multiple immune response genes, including IFN-γ. Although the crystal structure of the IL-12:IL-12R complex has yet to be determined, IL-12 variants with increased receptor binding / signaling activity can be isolated by standard screening assays (Leong et al. 2003, PNAS 100:1163-1168). Fragments of the IL-12 heterodimer containing only the p35 subunit may exhibit biological activity. IL-12 variants that modify IL-12 / IL-12R surface residence time, turnover, and / or recycling may also be isolated. Furthermore, IL-12 variants can be incorporated into the fusion protein complexes of the present invention to optimize and / or balance the combined cytokine activity in inducing immune cell responses, particularly CIML NK cell activity.

[0131] IL-18 Interleukin-18 (IL-18) is a pleiotropic IL-1 superfamily cytokine involved in the regulation of innate and adaptive immune responses. In the context of IL-12 or IL-15, IL-18 is a potent inducer of IFN-γ in NK cells and CD4 T helper (Th)I lymphocytes. However, IL-18 also regulates Th2 and Th17 cell responses and the activity of CD8 cytotoxic cells and neutrophils in a host microenvironment-dependent manner. IL-18's biological activity is mediated by its binding to the heterodimeric IL-18Rα / β complex expressed on T cells, NK cells, macrophages, neutrophils, and endothelial cells, inducing downstream signals that result in the activation of NF-κB. Furthermore, the activity of IL-18 can be regulated by the level of high-affinity, constitutively expressed circulating IL-18-binding protein (IL-18BP), which competes with cell surface receptors for IL-18 and neutralizes IL-18 activity. IL-18 mutants (e.g., with amino acid mutations / deletions) that reduce interaction with IL-18BP and / or increase binding / signaling of the IL-18Rα / β complex may be useful in enhancing IL-18 activity. Such mutants can be identified by standard screening assays (Kim et al. 2001, PNAS 98:3304-3309). Fragments of IL-18 may exhibit biological activity. IL-18 mutants that modify IL-18 / IL-18R surface residence time, turnover, and / or recycling may also be isolated. Such IL-18 variants can be incorporated into the fusion protein complexes of the invention to optimize IL-18 activity and / or balance the activity of the associated cytokines to induce immune cell responses, particularly CIML NK cell activity. Furthermore, IL-18 variants can be incorporated into the fusion protein complexes of the invention to optimize expression and / or stability of the IL-18 binding domain. Similarly, IL-18 genes and expression constructs can be modified (i.e., codon optimization, removal of secondary structure) to improve gene expression, translation, post-translational modification, and / or secretion.

[0132] Antigen-specific binding domain Antigen-specific binding domains consist of polypeptides that specifically bind to targets on diseased cells. Alternatively, these domains may bind to targets on other cells that support a disease state, such as targets on stromal cells that support tumor growth or targets on immune cells that support disease-mediated immunosuppression. Antigen-specific binding domains include antibodies, single-chain antibodies, Fabs, Fvs, T-cell receptor binding domains, ligand-binding domains, receptor-binding domains, domain antibodies, single-domain antibodies, minibodies, nanobodies, peptibodies, or various other antibody mimetics known in the art (e.g., affimers, affitins, alphabodies, atrimers, CTLA4-based molecules, adnectins, anticalins, Kunitz domain-based proteins, avimers, knottins, fynomers, darpins, affibodies, affilins, monobodies, and armadillo repeat protein-based proteins (Weidle, UH, et al. 2013. Cancer Genomics & Proteomics 10:155-168)).

[0133] In certain embodiments, the antigen for the antigen-specific binding domain comprises a cell surface receptor or ligand, hi other embodiments, the antigen comprises a CD antigen, a cytokine or chemokine receptor or ligand, a growth factor receptor or ligand, a tissue factor, a cell adhesion molecule, an MHC / MHC-like molecule, an Fc receptor, a Toll-like receptor, an NK receptor, a TCR, a BCR, a positive / negative costimulatory receptor or ligand, a death receptor or ligand, a tumor-associated antigen, or a virus encoding an antigen.

[0134] Preferably, the antigen-specific binding domain is capable of binding to an antigen on a tumor cell. The tumor-specific binding domain may be derived from an antibody approved for the treatment of patients with cancer, including rituximab, ofatumumab, and obinutuzumab (anti-CD20 antibodies); trastuzumab and pertuzumab (anti-HER2 antibodies); cetuximab and panitumumab (anti-EGFR antibodies); and alemtuzumab (anti-CD52 antibody). Similarly, CD20 ( 90 Y-labeled ibritumomab tiuxetan, 131Binding domains derived from approved antibody effector molecule conjugates specific for I-labeled tositumomab, HER2 (ado-trastuzumab emtansine), CD30 (brentuximab vedotin), and CD33 (gemtuzumab ozogamicin) can be used (Sliwkowski MX, Mellman I. 2013 Science 341:1192).

[0135] Additionally, preferred binding domains of the present invention may include various other tumor-specific antibody domains known in the art. Antibodies and their respective targets for treating cancer include nivolumab (anti-PD-1 antibody), TA99 (anti-gp75), 3F8 (anti-GD2), 8H9 (anti-B7-H3), abagovomab (CA125(mimetic)), adecatumumab (anti-EpCAM), afutuzumab (anti-CD20), alacizumab pegol (anti-VEGFR2), altumomab pentetate (anti-CEA), amatuximab (anti-mesocetane), and nivolumab (anti-PD-1 antibody). Phosphorin), AME-133 (anti-CD20), anatumomab mafenatox (anti-TAG-72), apolizumab (anti-HLA-DR), arcitumomab (anti-CEA), bavituximab (anti-phosphatidylserine), bectumomab (anti-CD22), belimumab (anti-BAFF), besilesomab (anti-CEA-related antigen), bevacizumab (anti-VEGF-A), bivatuzumab mertansine (anti-CD44 v6), blinatumomab (anti-CD19), BMS-663513 (anti-CD137), brentuximab vedotin (anti-CD30 (TNFRSF8)), cantuzumab mertansine (anti-mucin CanAg), cantuzumab ravtansine (anti-MUC1), capromab pendetide (anti-prostate cancer cells), carlumab (anti-MCP-1), catumaxomab (anti-EpCAM, CD3), cBR96-doxorubicin immunoconjugate (anti-Lewis Y antigen), CC49 (anti-TAG-72), cedelizumab (anti-CD4), Ch.14.18 (anti-GD2), ch-TNT (anti-DNA-related antigen), sitatuzumab bogatox (anti-EpCAM), cixutumumab (anti-IGF-1 receptor), Batuzumab tetraxetan (anti-MUC1), conatumumab (anti-TRAIL-R2), CP-870893 (anti-CD40), dacetuzumab (anti-CD40), daclizumab (anti-CD25), dalotuzumab (anti-insulin-like growth factor I receptor), daratumumab (anti-CD38 (cyclic ADP-ribose hydrolase)), demcizumab (anti-DLL4), detumomab (anti-B lymphoma cells), drozitumab (anti-DR5), durigotumab (anti-HER3), dusigitumab (anti-ILGF2), ecloneximab (anti-GD3 ganglioside), edrecolomab (anti-EpCAM), elotuzumab (anti-SLAMF7), elsilimomab (anti-IL-6),Enavatuzumab (anti-TWEAK receptor), enoticumab (anti-DLL4), encituximab (anti-5AC), epitumomab cituxetan (anti-episialin), epratuzumab (anti-CD22), ertumaxomab (anti-HER2 / neu, CD3), etaracizumab (anti-integrin αvβ3), faralimomab (anti-interferon receptor), farletuzumab (anti-folate receptor 1), FBTA05 (anti-CD20), ficlatuzumab (anti-HGF), figitumumab (anti-IGF-1 receptor), framvotumab (anti-TYRP1 (glycoprotein 75)), fre Solimumab (anti-TGFβ), futuximab (anti-EGFR), galiximab (anti-CD80), ganitumab (anti-IGF-I), gemtuzumab ozogamicin (anti-CD33), girentuximab (anti-carbonic anhydrase 9 (CA-IX)), glenbatumumab vedotin (anti-GPNMB), guselkumab (anti-IL13), ibalizumab (anti-CD4), ibritumomab tiuxetan (anti-CD20), icrucumab (anti-VEGFR-1), igovomab (anti-CA-125), IMAB362 (anti-CLDN18.2), IMC-CS4 (anti-CSF1R), IMC-TR1 (anti-T GFβRII), imgatuzumab (anti-EGFR), inlacumab (anti-selectin P), indatuximab ravtansine (anti-SDC1), inotuzumab ozogamicin (anti-CD22), intetumumab (anti-CD51), ipilimumab (anti-CD152), iratumumab (anti-CD30 (TNFRSF8)), KM3065 (anti-CD20), KW-0761 (anti-CD194), LY2875358 (anti-MET), labetuzumab (anti-CEA), lambrolizumab (anti-PDCD1), lexatumumab (anti-TRAIL-R2), lintuzumab (anti-CD33), Lipoprotein A (IL-1), and ribozyme inhibitors (RIB). Lumab (anti-KIR2D), lorvotuzumab mertansine (anti-CD56), lucatumumab (anti-CD40), lumiliximab (anti-CD23 (IgE receptor)), mapatumumab (anti-TRAIL-R1), margetuximab (anti-ch4D5), matuzumab (anti-EGFR), mavrilimumab (anti-GMCSF receptor α chain), milatuzumab (anti-CD74), minletumomab (anti-TAG-72), mitumomab (anti-GD3 ganglioside), mogamulizumab (anti-CCR4), moxetumomab pasudotox (anti-CD22), nacolomabutafenatox (anti-C242 antigen),Naptumomab estafenatox (anti-5T4), narunatumumab (anti-RON), necitumumab (anti-EGFR), nesbacumab (anti-angiopoietin 2), nimotuzumab (anti-EGFR), nivolumab (anti-IgG4), nofetumomab merpentane, ocrelizumab (anti-CD20), ocaratulumab (anti-CD20), olaratumab (anti-PDGF-Rα), onartuzumab (anti-c-MET), ontuxizumab (anti-TEM1), oportuzumab monatox (anti-EpCAM), oregovomab (anti-CA-125), otlertuzumab (anti-CD37), pancomab (MUC Anti-tumor specific glycosylation of 1), palsatuzumab (anti-EGFL7), pascolizumab (anti-IL-4), patritumab (anti-HER3), pemtumomab (anti-MUC1), pertuzumab (anti-HER2 / neu), pidilizumab (anti-PD-1), pinatuzumab vedotin (anti-CD22), pintumomab (anti-adenocarcinoma antigen), polatuzumab vedotin (anti-CD79B), pritumumab (anti-vimentin), PRO131921 (anti-CD20), quilizumab (anti-IGHE), racotumomab (anti-N-glycolylneuraminic acid), radletumab (anti-fibronectin extracellular matrix metalloproteinase). Main-B), ramucirumab (anti-VEGFR2), rilotumumab (anti-HGF), lobatumumab (anti-IGF-1 receptor), loredumab (anti-RHD), rovelizumab (anti-CD11 & CD18), samalizumab (anti-CD200), satumomab pendetide (anti-TAG-72), seribantumab (anti-ERBB3), SGN-CD19A (anti-CD19), SGN-CD33A (anti-CD33), sibrotuzumab (anti-FAP), siltuximab (anti-IL-6), solitomab (anti-EpCAM), sontuzumab (anti-episialin), tabalumab (anti-BAFF), tacatuzumab Traxetan (anti-alpha-fetoprotein), taplitumomab paptox (anti-CD19), terimomab alitox, tenatumomab (anti-tenascin C), teneliximab (anti-CD40), teprotumumab (anti-CD221), TGN1412 (anti-CD28), ticilimumab (anti-CTLA-4), tigatuzumab (anti-TRAIL-R2), TNX-650 (anti-IL-13), tositumomab (anti-CS20), tobetumab (anti-CD140a), TRBS07 (anti-GD2), tregalizumab (anti-CD4), tremelimumab (anti-CTLA-4), TRU-016 (anti-CD37),Tucotuzumab-celmoleukin (anti-EpCAM), ublituximab (anti-CD20), urelumab (anti-4-1BB), vanticutumab (anti-Frizzled receptor), bapaliximab (anti-AOC3 (VAP-1)), batelizumab (anti-ITGA2), veltuzumab (anti-CD20), besencumab (anti-NRP1), visilizumab (anti-CD3), volociximab (anti-integrin α5β1), borsetuzumab mafodotin (anti-CD70), votumumab (anti-tumor Examples of antibodies include, but are not limited to, anti-cancer antigen CTAA16.88, zalutumumab (anti-EGFR), zanolimumab (anti-CD4), zatuximab (anti-HER1), dillalimumab (anti-CD147 (basigin)), RG7636 (anti-ETBR), RG7458 (anti-MUC16), RG7599 (anti-NaPi2b), MPDL3280A (anti-PD-L1), RG7450 (anti-STEAP1), and GDC-0199 (anti-Bcl-2).

[0136] Other antibody domains or tumor target binding proteins (e.g., TCR domains) useful in the present invention include, but are not limited to, those that bind to the following antigens (note that the cancer indications listed represent non-limiting examples): aminopeptidase N (CD13), annexin A1, B7-H3 (CD276, various cancers), CA125 (ovarian cancer), CA15-3 (carcinoma), CA19-9 (carcinoma), L6 (carcinoma), Lewis Y (carcinoma), Lewis X (carcinoma), alpha-fetoprotein (carcinoma), CA242 (colorectal cancer), placental alkaline phosphatase ( carcinoma), prostate-specific antigen (prostate), prostatic acid phosphatase (prostate cancer), epidermal growth factor (carcinoma), CD2 (Hodgkin's disease, NHL lymphoma, multiple myeloma), CD3ε (T-cell lymphoma, lung cancer, breast cancer, gastric cancer, ovarian cancer, autoimmune diseases, malignant ascites), CD19 (B-cell malignancies), CD20 (non-Hodgkin's lymphoma, B-cell neoplasms, autoimmune diseases), CD21 (B-cell lymphoma), CD22 (leukemia, lymphoma, multiple myeloma, SLE), CD30 (Hodgkin's lymphoma), CD33 (leukemia, autoimmune diseases), CD38 (multiple myeloma), CD40 (lymphoma) tumors, multiple myeloma, leukemia (CLL)), CD51 (metastatic melanoma, sarcoma), CD52 (leukemia), CD56 (small cell lung cancer, ovarian cancer, Merkel cell carcinoma and liquid tumors, multiple myeloma), CD66e (carcinoma), CD70 (metastatic renal cell carcinoma and non-Hodgkin's lymphoma), CD74 (multiple myeloma), CD80 (lymphoma), CD98 (carcinoma), CD123 (leukemia), mucin (carcinoma), CD221 (solid tumors), CD227 (breast cancer, ovarian cancer), CD262 (NSCLC and other cancers), CD309 (ovarian cancer), CD326 (solid tumors), CEACAM3 (colorectal cancer, gastric cancer), CEACAM5 (CEA, CD66e) (breast, colorectal and lung cancer), DLL4 (A-like-4), EGFR (various cancers), CTLA4 (melanoma), CXCR4 (CD184, hematology-oncology, solid tumors), endoglin (CD105, solid tumors), EPCAM (epithelial cell adhesion molecule, bladder cancer, head and neck cancer, colon cancer, NHL, prostate cancer and ovarian cancer), ERBB2 (lung cancer, breast cancer, prostate cancer), FCGR1 (autoimmune diseases), FOLR (folate receptor, ovarian cancer), FGFR (carcinoma), GD2 ganglioside (carcinoma), G-28 (cell surface antigen glycolipid,melanoma), GD3 idiotype (carcinoma), heat shock protein (carcinoma), HER1 (lung cancer, gastric cancer), HER2 (breast cancer, lung cancer and ovarian cancer), HLA-DR10 (NHL), HLA-DRB (NHL, B-cell leukemia), human chorionic gonadotropin (carcinoma), IGF1R (solid tumors, blood cancer), IL-2 receptor (T-cell leukemia and lymphoma), IL-6R (multiple myeloma, RA, Castremann's disease, IL-6-dependent tumors), integrins (ανβ3, α5β1, α6β4, α11β3, α5β5, ανβ 5, for various cancers), MAGE-1 (carcinoma), MAGE-2 (carcinoma), MAGE-3 (carcinoma), MAGE4 (carcinoma), anti-transferrin receptor (carcinoma), p97 (melanoma), MS4A1 (transmembrane 4-domain subfamily A member 1, non-Hodgkin's B-cell lymphoma, leukemia), MUC1 (breast cancer, ovarian cancer, cervical cancer, bronchial cancer and gastrointestinal cancer), MUC16 (CA125) (ovarian cancer), CEA (colorectal cancer), gp100 (melanoma), MARTI (melanoma), MPG (melanoma), MS4A1 ( Transmembrane 4-domain subfamily A, small cell lung cancer, NHL), nucleolin, Neu oncogene product (carcinoma), P21 (carcinoma), nectin-4 (carcinoma), antigen binding site of anti-(N-glycolylneuraminic acid, breast cancer, melanoma cancer), PLAP-like testicular alkaline phosphatase (ovarian cancer, testicular cancer), PSMA (prostate tumor), PSA (prostate), ROB04, TAG72 (tumor-associated glycoprotein 72, AML, gastric cancer, colorectal cancer, ovarian cancer), T cell transmembrane protein (cancer), Tie (CD202b), Tumor necrosis factor receptor superfamily member 10B, carcinoma), TNFRSF13B (tumor necrosis factor receptor superfamily member 13B, multiple myeloma, NHL, other cancers, RA and SLE), TPBG (trophoblast glycoprotein, renal cell carcinoma), TRAIL-R1 (tumor necrosis-inducing ligand receptor 1, lymphoma, NHL, colorectal cancer, lung cancer), VCAM-1 (CD106, melanoma), VEGF, VEGF-A, VEGF-2 (CD309) (various cancers). Some other tumor-associated antigen targets include:Reviewed (Gerber, et al,mAbs 2009 1:247-253;Novellino et al,Cancer Immunol Immunother.2005 54:187-207,Franke,et al,Cancer Biother Radiopharm.2000,15:459-76,Guo,et al.,Adv Cancer Res.2013;119:421-475,Parmiani et al.J Immunol.2007 178:1975-9). Examples of these antigens include the cluster of differentiation (CD4, CD5, CD6, CD7, CD8, CD9, CD10, CD11a, CD11b, CD11c, CD12w, CD14, CD15, CD16, CDw17, CD18, CD21, CD23, CD24, CD25, CD26, CD27, CD28, CD29, CD31, CD32, CD34, CD35, CD36, CD3 7, CD41, CD42, CD43, CD44, CD45, CD46, CD47, CD48, CD49b, CD49c, CD53, CD54, CD55, CD58, CD59, CD61, CD 62E, CD62L, CD62P, CD63, CD68, CD69, CD71, CD72, CD79, CD81, CD82, CD83, CD86, CD87, CD88, CD89, CD90, CD91, CD95, CD96, CD100, CD103, CD105, CD106, CD109, CD117, CD120, CD127, CD133, CD134, CD135, CD13 8, CD141, CD142, CD143, CD144, CD147, CD151, CD152, CD154, CD156, CD158, CD163, CD166, CD168, CD184, CDwl86, CD195, CD202(a,b), CD209, CD235a, CD271, CD303, CD304), Annexin A1, Nucleolin, Endoglin (CD105), ROB04, Aminopeptidase N,-like-4 (DLL4), VEGFR-2 (CD309), CXCR4 (CD184), Tie2, B7-H3, WT1, MUC1, LMP2, HPV E6E7, EGFRvIII, HER-2 / neu, Idiotype, MAGE A3, p53 non-mutant, NY-ESO-1, GD2, CEA,MelanA / MARTl, Ras mutants, gp100, p53 mutants, proteinase 3 (PR1), bcr-abl, tyrosinase, survivin, hTERT, sarcoma translocation breakpoints, EphA2, PAP, ML-IAP, AFP, EpCAM, ERG (TMPRSS2 ETS fusion gene), NA17, PAX3, ALK, androgen receptor, cyclin B1, polysialic acid, MYCN, RhoC, TRP-2, GD3, fucosyl GM1, mesothelin, PSCA, MAGE Al, sLe(a), CYPIB I, PLACl, GM3, BORIS, Tn, GloboH, ETV6-AML, NY-BR-1, RGS5, SART3, STn, carbonic anhydrase IX, PAX5, OY-TES1, sperm protein 17, LCK, HMWMAA, AKAP-4, SSX2, XAGE1, B7H3, legumain, Tie 2, Page4, VEGFR2, MAD-CT-1, FAP, PDGFR-β, MAD-CT-2, and Fos-related antigen 1.

[0137] Additionally, preferred binding domains of the present invention include binding domains that are specific for antigenic and epitope targets associated with infected cells, as are known in the art. Such targets include, but are not limited to, those derived from the following infectious agents, of which the following are of interest: HIV virus (particularly antigens derived from the HIV envelope spike and / or epitopes of gp120 and gp41), human papillomavirus (HPV), Mycobacterium tuberculosis, Streptococcus agalactiae, methicillin-resistant Staphylococcus aureus, Legionella pneumophilia, Streptococcus pyogenes, Escherichia coli, Neisseria gonorrhoeae, Neisseria meningitidis, Streptococcus pneumoniae, and Cryptococcus neoformans. Neoformans, Histoplasma capsulatum, Haemophilus influenzae type B, Treponema pallidum, Lyme disease spirochetes, Pseudomonas aeruginosa, Mycobacterium leprae, Brucella abortus, rabies virus, influenza virus, cytomegalovirus, herpes simplex virus type I, herpes simplex virus type II, human serum parvo-like virus, respiratory syncytial virus, varicella-zoster virus, hepatitis B virus, hepatitis C virus, measles virus, adenovirus, human T-cell leukemia virus, Epstein-Barr virusvirus, murine leukemia virus, mumps virus, vesicular stomatitis virus, Sindbis virus, lymphocytic choriomeningitis virus, wart virus, bluetongue virus, Sendai virus, feline leukemia virus, reovirus, poliovirus, Simian virus 40, mouse mammary tumor virus, dengue virus, rubella virus, West Nile virus, Plasmodium falciparum, Plasmodium vivax, Toxoplasma gondii, Trypanosoma rangeli, Trypanosoma cruzi, Trypanosoma rhodesiensei, Trypanosoma brucei, Schistosoma mansoni mansoni, Schistosoma japonicum, Babesia bovis, Elmeria tenella, Onchocerca volvulus, Leishmania tropica, Trichinella spiralis, Theileria parva, Taenia hydatigena, Taenia ovis, Taenia saginata, Echinococcus granulosus, Mesocestoides corti, Mycoplasma arthritidis arthritidis, M. hyorhinis, M. orale, M. arginini, Acholeplasma laidlawii, M. salivarium, and Mycoplasma pneumoniae.

[0138] Immune checkpoint inhibitors and immune agonist domains In other embodiments, the binding domain is specific for an immune checkpoint or signaling molecule or its ligand and acts as an inhibitor of immune checkpoint suppressive activity or an agonist of immunostimulatory activity. Such immune checkpoint and signaling molecules and ligands include PD-1, PD-L1, PD-L2, CTLA-4, CD28, CD80, CD86, B7-H3, B7-H4, B7-H5, ICOS-L, ICOS, BTLA, CD137L, CD137, HVEM, KIR, 4-1BB, OX40L, CD70, CD27, CD47, CIS, OX40, GITR, IDO, TIM3, GAL9, VISTA, CD155, TIGIT, LIGHT, LAIR-1, Siglec, and A2aR (Pardoll DM. 2012. Nature Rev Cancer 12:252-264, Thaventhiran T, et al. 2012. J Clin Cell Immunol S12:004). Furthermore, preferred antibody domains of the invention may include ipilimumab and / or tremelimumab (anti-CTLA4), nivolumab, pembrolizumab, pidilizumab, TSR-042, ANB011, AMP-514 and AMP-224 (ligand Fc fusion) (anti-PD1), atezolizumab (MPDL3280A), avelumab (MSB0010718C), durvalumab (MEDI4736), MEDI0680, as well as BMS-9365569 (anti-PDL1), MEDI6469 (anti-OX40 agonist), BMS-986016, IMP701, IMP731, IMP321 (anti-LAG3) and GITR ligands.

[0139] T cell receptor (TCR) T cells are a subgroup of cells that, together with other immune cell types (polymorphonuclear cells, eosinophils, basophils, mast cells, B cells, and NK cells), constitute the cellular component of the immune system. Under physiological conditions, T cells function in immune surveillance and the elimination of foreign antigens. However, under pathological conditions, there is compelling evidence that T cells play a major role in the pathogenesis and propagation of disease. In these diseases, the breakdown of either central or peripheral T cell immune tolerance is a fundamental process in the causation of autoimmune diseases.

[0140] The TCR complex is composed of at least seven transmembrane proteins. Disulfide-bonded (αβ or γδ) heterodimers form a single antigen-recognition unit, while the invariant chain of CD3, consisting of the ε, γ, δ, ζ, and η chains, is responsible for coupling ligands to signaling pathways that lead to T cell activation and the generation of a cellular immune response. Despite the genetic diversity of TCR chains, two structural features are common to all known subunits. First, they are transmembrane proteins with a single, presumably α-helical, transmembrane-spanning domain. Second, all TCR chains have the unusual feature of containing charged amino acids within the predicted transmembrane domain. The invariant chain has a single negative charge conserved between mice and humans, while the variable chains have one (TCR-β) or two (TCR-α) positive charges. The transmembrane sequence of TCR-α is highly conserved across multiple species and may therefore play an important phylogenetic functional role. The octapeptide sequence, which contains the hydrophilic amino acids arginine and lysine, is identical between these species.

[0141] T cell responses are regulated by antigen binding to the TCR. One type of TCR is a membrane-bound heterodimer consisting of an α chain and a β chain, similar to the variable (V) and constant (C) regions of immunoglobulins. The TCR α chain comprises a covalently linked V-α chain and a C-α chain, while the β chain comprises a V-β chain covalently linked to a C-β chain. The V-α and V-β chains form a pocket or cleft that can bind superantigens or antigens in association with the major histocompatibility complex (MHC) (known in humans as the HLA complex). See Davis Ann. Rev. of Immunology 3:537 (1985); Fundamental Immunology 3rd Ed., W. Paul Ed. Rsen Press LTD. New York (1993).

[0142] The extracellular domains of the TCR chains (αβ or γδ) can also be engineered to be fused to heterologous transmembrane regions for cell surface expression. Such TCRs can include fusions to CD3, CD28, CD8, 4-1BB, and / or chimeric activating receptor (CAR) transmembrane or activation domains. TCRs can also be soluble proteins comprising one or more antigen-binding domains of the αβ or γδ chains. Such TCRs can comprise TCR variable domains or functional fragments thereof, with or without TCR constant domains. Soluble TCRs can be heterodimeric or single-chain molecules.

[0143] Fc domain The fusion protein complexes of the present invention may contain an Fc domain. For example, hIL-18 / IL12 / TxM comprises an IL-18 / IL-15N72D:IL-12 / IL-15RαSu / Fc fusion protein complex. Fusion proteins linking the Fc region of IgG to domains of other proteins, such as various cytokines and soluble receptors, have been reported (see, e.g., Capon et al., Nature, 337:525-531, 1989; Chamow et al., Trends Biotechnol., 14:52-60, 1996; U.S. Patent Nos. 5,116,964 and 5,541,087). Prototype fusion proteins comprise a heavy chain variable domain and a C H IL-15 is a homodimeric protein linked through cysteine residues in the hinge region of IgG Fc, resulting in a molecule similar to an IgG molecule lacking the I domain and light chain. The dimeric nature of fusion proteins containing an Fc domain can be advantageous in providing higher-order interactions (i.e., bivalent or bispecific binding) with other molecules. Due to structural homology, Fc fusion proteins exhibit in vivo pharmacokinetic profiles comparable to those of human IgG, which has a similar isotype. Immunoglobulins of the IgG class are among the most abundant proteins in human blood, and their circulating half-lives can reach as long as 21 days. Described herein are fusion protein complexes containing an IL-15 domain noncovalently linked to IL-15Rα, which is covalently linked to the Fc portion of a human IgG heavy chain protein, to extend the circulating half-life of IL-15 or an IL-15 fusion protein and / or increase its biological activity.

[0144] The term "Fc" refers to the fragment crystallizable region, which is the constant region of an antibody that interacts with cell surface receptors called Fc receptors and with several proteins of the complement system. Such an "Fc" is in a dimeric form. The original immunoglobulin origin of native Fc is preferably human and can be any immunoglobulin, with IgG1 and IgG2 being preferred. Native Fc' is composed of monomeric polypeptides that can be linked into dimeric or multimeric forms by covalent (i.e., disulfide bond) and non-covalent associations. The number of intermolecular disulfide bonds between the monomeric subunits of native Fc molecules ranges from 1 to 4, depending on the class (e.g., IgG, IgA, IgE) or subclass (e.g., IgG1, IgG2, IgG3, IgA1, IgGA2). One example of a native Fc is the disulfide-bonded dimer resulting from papain digestion of IgG (see Ellison et al. (1982), Nucleic Acids Res. 10:4071-9). As used herein, the term "native Fc" refers collectively to monomeric, dimeric, and multimeric forms. It is an Fc domain that contains binding sites for Protein A, Protein G, various Fc receptors, and complement proteins. In some embodiments, the Fc domain of the fusion protein complex can interact with an Fc receptor to mediate antibody-dependent cell-mediated cytotoxicity (ADCC) and / or antibody-dependent cellular phagocytosis (ADCP). In other applications, the fusion protein complex contains an Fc domain (e.g., IgG4 Fc) that cannot effectively mediate ADCC or ADCP.

[0145] In some embodiments, the term "Fc variant" refers to a molecule or sequence that has been modified from a native Fc but still contains a binding site for the salvage receptor, FcRn. WO 97 / 34631 and WO 96 / 32478 describe exemplary Fc variants and their interactions with the salvage receptor and are incorporated herein by reference. Thus, the term "Fc variant" includes a molecule or sequence that has been humanized from a non-human native Fc. Additionally, the native Fc contains sites that can be removed to provide structural features or biological activity not required for the fusion molecules of the invention. Thus, in certain embodiments, the term "Fc variant" includes molecules or sequences that alter one or more native Fc sites or residues that affect or are involved in (1) disulfide bond formation, (2) incompatibility with a selected host cell, (3) N-terminal heterogeneity due to expression in a selected host cell, (4) glycosylation, (5) interaction with complement, (6) binding to Fc receptors other than salvage receptors, (7) antibody-dependent cellular cytotoxicity (ADCC), or (8) antibody-dependent cellular phagocytosis (ADCP). Such alterations may increase or decrease any one or more of these Fc properties. Fc variants are described in more detail below.

[0146] The term "Fc domain" encompasses native Fc and Fc variant molecules and sequences as defined above. As with Fc variants and native Fcs, the term "Fc domain" includes molecules in monomeric or multimeric form, whether derived from whole antibodies or produced by recombinant gene expression or other means.

[0147] Linker In some cases, the fusion protein complexes of the invention also include a flexible linker sequence inserted between the IL-15 or IL-15Rα domain and the IL-12 and / or IL-18 binding domain or IL-12 subunit. The linker sequence must allow for effective positioning of the polypeptide relative to the IL-15 or IL-15Rα domain to allow functional activity of both. In turn, the linker must allow for the formation of a functional IL-12 binding domain.

[0148] In certain cases, the soluble fusion protein complex comprises a linker, wherein the first polypeptide is covalently linked to the IL-15 (or functional fragment thereof) by a polypeptide linker sequence. In other aspects, the soluble fusion protein complexes described herein comprise a linker, wherein the second polypeptide is covalently linked to the IL-15Rα polypeptide (or functional fragment thereof) by a polypeptide linker sequence.

[0149] The linker sequence is preferably encoded by a nucleotide sequence that generates a peptide that can effectively position the binding groove of a TCR molecule to recognize a presented antigen or the binding domain of an antibody molecule to recognize an antigen. As used herein, the phrase "effectively positioning a biologically active polypeptide relative to an IL-15 or IL-15Rα domain" or other similar phrases is intended to mean that the biologically active polypeptide linked to the IL-15 or IL-15Rα domain is positioned so that the IL-15 or IL-15Rα domain can interact with each other to form a protein complex. For example, the IL-15 or IL-15Rα domain is effectively positioned to allow interaction with immune cells to initiate or inhibit an immune response or to inhibit or stimulate cell development.

[0150] The fusion protein complexes of the present invention preferably also include a flexible linker sequence inserted between the IL-15 or IL-15Rα domain and the immunoglobulin Fc domain. The linker sequence must allow for effective positioning of the Fc domain, biologically active polypeptide, and IL-15 or IL-15Rα domain to enable the functional activity of each domain. For example, the Fc domain is effectively positioned to allow proper fusion protein complex formation and / or interaction with Fc receptors on immune cells or proteins of the complement system to stimulate Fc-mediated effects, including opsonization, cell lysis, degranulation of mast cells, basophils, and eosinophils, and other Fc receptor-dependent processes; activation of the complement pathway; and enhanced in vivo half-life of the fusion protein complex.

[0151] Linker sequences can also be used to link two or more polypeptides of a biologically active polypeptide to generate a single chain molecule having a desired functional activity.

[0152] Preferably, the linker sequence contains about 7 to 20 amino acids, more preferably about 10 to 20 amino acids. The linker sequence is preferably flexible so as not to hold the biologically active polypeptide or effector molecule in a single, undesired conformation. The linker sequence can be used, for example, to space the recognition site from the fusion molecule. Specifically, a peptide linker sequence can be placed between the biologically active polypeptide and the effector molecule, for example, to chemically crosslink the same and to provide molecular flexibility. The linker preferably contains primarily amino acids with short side chains, such as glycine, alanine, and serine, to provide flexibility. Preferably, at least about 80 or 90% of the linker sequence contains glycine, alanine, or serine residues, particularly glycine and serine residues.

[0153] A variety of linker sequences may be used, including any of the numerous flexible linker designs that have been successfully used to join antibody variable regions together (see, e.g., Whitlow, M. et al., (1991) Methods: A Companion to Methods in Enzymology, 2:97-105).

[0154] Adoptive Cell Therapy Adoptive cell therapy (ACT) (allogeneic and autologous hematopoietic stem cell transplantation (HSCT) and engineered cell (i.e., CAR T) therapy) is the therapy of choice for many malignant disorders (for reviews of HSCT and adoptive cell therapy approaches, see Rager & Porter, Ther Adv Hematol (2011) 2(6) 409-428; Roddie & Peggs, Expert Opin. Biol. Ther. (2011) 11(4):473-487; Wang et al. Int. J. Cancer: (2015) 136, 1751-1768; and Chang, YJ and XJ Huang, Blood Rev, 2013. 27(1):55-62). Such adoptive cell therapies include, but are not limited to, allogeneic and autologous hematopoietic stem cell transplantation, donor leukocyte (or lymphocyte) infusion (DLI), adoptive transfer of tumor-infiltrating lymphocytes, or adoptive transfer of T cells or NK cells (including engineered cells, i.e., CAR T, CAR, NK, gene-edited T cells or NK cells; see Hu et al. Acta Pharmacologica Sinica (2018) 39:167-176, Irving et al. Front Immunol. (2017) 8:267). Beyond donor-derived cells being necessary for hematopoietic reconstitution after radiation therapy and chemotherapy, immunological reconstitution from metastatic cells is crucial for eliminating residual tumor cells. The effectiveness of ACT as a treatment option for malignancies is influenced by numerous factors, including the origin, composition, and phenotype (lymphocyte subsets, activation state) of donor cells, the underlying disease, the pre-transplant conditioning regimen and post-transplant immune support (i.e., IL-2 therapy), and the graft-versus-tumor (GVT) effect mediated by donor cells within the graft. Furthermore, these factors must be balanced against transplant-associated mortality, which typically results from the conditioning regimen and / or excessive immune activity of donor cells within the host (i.e., graft-versus-host disease, cytokine release syndrome, etc.).

[0155] There has been significant interest in approaches utilizing adoptive NK cell therapy. In patients receiving autologous HSCT, circulating NK cell counts recover very quickly after transplantation, and NK cell levels correlate with positive outcomes (Rueff et al., 2014, Biol. Blood Marrow Transplant. 20, 896-899). While therapeutic strategies using autologous NK cell transfer have met with limited success due to a number of factors, adoptive transfer of ex vivo-activated allogeneic (or haploidentical) NK cells has emerged as a promising immunotherapy strategy for cancer (Guillerey et al., 2016, Nature Immunol. 17:1025-1036). The activity of these cells is less likely to be suppressed by self-MHC molecules compared with autologous NK cells. Numerous studies have demonstrated that adoptive therapy using haploidentical NK cells that exert alloreactivity against tumor cells is safe and can mediate significant clinical activity in patients with AML. Further incorporating these findings, recent research has focused on optimizing ex vivo activation / expansion methods for NK cells or NK precursors (i.e., stem cells), pre-transplant conditioning, and post-transplant immune support strategies; the use of NK cell lines or recombinant tumor-targeted NK cells; and the evaluation of combination therapies with other agents, such as therapeutic antibodies, immunomodulators (lenalidomide), and anti-KIR and checkpoint antibodies. In each case, these strategies can be complemented by the fusion protein complexes of the present invention, which have the ability to enhance NK cell expansion and activation. As demonstrated herein, ex vivo incubation of NK cells with the fusion protein complexes of the present invention results in the induction of CIML NK cells that exhibit elevated activation markers, increased cytotoxicity against tumor cells, and enhanced production of IFN-γ. Furthermore, the fusion protein complexes of the present invention can activate human NK cell lines. Furthermore, methods are provided for enhancing immune responses to treat neoplasms and infectious diseases by direct administration of the fusion protein complexes of the present invention or administration of immune cells activated by the fusion protein complexes of the present invention.

[0156] Pharmaceutical treatment drugs The present invention provides pharmaceutical compositions comprising fusion protein conjugates for use as therapeutic agents. In one embodiment, the fusion protein conjugates of the present invention are formulated in a pharmaceutically acceptable buffer, such as physiological saline, and administered systemically. Preferred routes of administration include, for example, intravesical instillation, subcutaneous, intravenous, intraperitoneal, intramuscular, intratumoral, or intradermal injection, which provide continuous, sustained, or effective levels of the composition in the patient. Treatment of human patients or other animals is carried out using a therapeutically effective amount of the therapeutic agents identified herein in a physiologically acceptable carrier. Suitable carriers and their formulations are described, for example, in Remington's Pharmaceutical Sciences by E.W. Martin. The amount of therapeutic agent to be administered will vary depending on the method of administration, the age and weight of the patient, and with the clinical symptoms of the neoplasm. Generally, amounts will fall within the range of amounts used for other agents used in the treatment of other diseases related to neoplasms or infectious diseases, although in certain cases, smaller amounts will be required due to the increased specificity of the compound. The compounds are administered at a dose that enhances the subject's immune response or reduces the growth, survival or invasiveness of neoplastic or infected cells, as determined by methods known to those of skill in the art.

[0157] Formulation of pharmaceutical compositions Administration of the fusion protein complex of the present invention to treat a neoplasm or infectious disease is carried out by any suitable means that results in a concentration of therapeutic agent, in combination with other ingredients, that is effective to ameliorate, reduce, or stabilize the neoplasm or infectious disease. The fusion protein complex of the present invention can be contained in any suitable amount in any suitable carrier substance, and is generally present in an amount of 1 to 95% by weight of the total weight of the composition. The composition can be provided in a dosage form suitable for parenteral (e.g., subcutaneous, intravenous, intramuscular, intravesical, intratumoral, or intraperitoneal) administration. For example, pharmaceutical compositions are formulated according to conventional pharmaceutical practice (see, e.g., Remington: The Science and Practice of Pharmacy (20th ed.), ed. A. R. Gennaro, Lippincott Williams & Wilkins, 2000 and Encyclopedia of Pharmaceutical Technology, eds. J. Swarbrick and J.C. Boylan, 1988-1999, Marcel Dekker, New York).

[0158] The human dosage is initially determined by extrapolating the amount of compound used in mice or non-human primates, as those skilled in the art recognize that adjusting dosages for humans compared to animal models is routine in the art. For example, the dosage may vary from about 1 μg (compound) / kg (body weight) to about 5,000 mg (compound) / kg (body weight); or from about 5 mg / kg (body weight) to about 4,000 mg / kg (body weight); or from about 10 mg / kg (body weight) to about 3,000 mg / kg (body weight); or from about 50 mg / kg (body weight) to about 2,000 mg / kg (body weight); or from about 100 mg / kg (body weight) to about 1,000 mg / kg (body weight); or from about 150 mg / kg (body weight) to about 500 mg / kg (body weight). For example, the dose is about 1, 5, 10, 25, 50, 75, 100, 150, 200, 250, 300, 350, 400, 450, 500, 550, 600, 650, 700, 750, 800, 850, 900, 950, 1,000, 1,050, 1,100, 1,150, 1,200, 1,250, 1,300, 1,350, 1,400, 1,450, 1,500, 1,600, 1,700, 1,800, 1,900, 2,000, 2,500, 3,000, 3,500, 4,000, 4,500, or 5,000 mg / kg of body weight. Alternatively, the dosage is within the range of about 5 mg of compound / kg body weight to about 20 mg of compound / kg body weight. In another embodiment, the dosage is about 8, 10, 12, 14, 16, or 18 mg / kg body weight. Preferably, the fusion protein complex is administered at 0.5 mg / kg to about 10 mg / kg (e.g., 0.5, 1, 3, 5, 10 mg / kg). Of course, this dosage can be adjusted upward or downward, as is routinely done in such treatment protocols, depending on the results of initial clinical trials and the needs of a particular patient.

[0159] The pharmaceutical composition is formulated using suitable excipients that release the therapeutic agent in a controlled manner after administration into the pharmaceutical composition. Examples include single or multiple unit tablet or capsule compositions, oil solutions, suspensions, emulsions, microcapsules, microspheres, molecular complexes, nanoparticles, patches, and liposomes. Preferably, the fusion protein conjugate is formulated in an excipient suitable for parenteral administration.

[0160] Parenteral Compositions Pharmaceutical compositions containing the fusion protein conjugates of the present invention are administered parenterally by injection, infusion, or implantation (subcutaneous, intravenous, intramuscular, intratumoral, intravesical, intraperitoneal) in dosage forms, formulations, or via suitable delivery devices or implants containing conventional non-toxic pharmaceutically acceptable carriers and adjuvants. The formulation and preparation of such compositions are well known to those skilled in the art of pharmaceutical formulation. Formulations can be found in Remington: The Science and Practice of Pharmacy, supra.

[0161] Compositions containing the fusion protein complexes of the present invention for parenteral use are provided in unit dosage form (e.g., in single-dose ampoules). Alternatively, the compositions are provided in vials containing several doses, to which suitable preservatives may be added (see below). The compositions may be in the form of a solution, suspension, emulsion, injection device, or delivery device for implantation, or presented as a dry powder to be reconstituted with water or another suitable vehicle before use. Apart from the active substance that reduces or ameliorates neoplasia or infectious disease, the compositions include suitable parenterally acceptable carriers and / or excipients. The active therapeutic agent can be incorporated into microspheres, microcapsules, nanoparticles, or liposomes for controlled release. Furthermore, the compositions may include suspending agents, solubilizers, stabilizers, pH adjusters, tonicity adjusters, and / or dispersing agents.

[0162] As noted above, pharmaceutical compositions containing the fusion protein conjugates of the present invention may be in a form suitable for sterile injection. To prepare such compositions, a suitable active therapeutic agent is dissolved or suspended in a parenterally acceptable liquid vehicle. Particularly acceptable vehicles and solvents that may be used are water, water adjusted to a suitable pH by the addition of an appropriate amount of hydrochloric acid, sodium hydroxide or a suitable buffer, 1,3-butanediol, Ringer's solution, isotonic sodium chloride solution, and dextrose solution. Aqueous preparations may contain one or more preservatives (e.g., methyl, ethyl, or n-propyl p-hydroxybenzoate). If one of these compounds is sparingly or only slightly soluble in water, a solubility enhancer or solubilizer may be added, or the solvent may contain 10-60% w / w propylene glycol.

[0163] The present invention provides a method of treating a neoplastic or infectious disease or a symptom thereof, comprising administering to a subject (e.g., a mammal, e.g., a human) a pharmaceutical composition comprising a therapeutically effective amount of a compound of the formulae described herein. Accordingly, one embodiment is a method of treating a subject suffering from or susceptible to a neoplastic or infectious disease or a symptom thereof. The method comprises administering to the mammal a therapeutic amount of an amount of a compound described herein sufficient to treat the disease or disorder or a symptom thereof under conditions such that the disease or disorder is treated.

[0164] The methods described herein include administering to a subject (including a subject identified as being in need of such treatment) an effective amount of a compound described herein or a composition described herein to produce such an effect. Identifying a subject in need of such treatment may be the judgment of the subject or a health care professional and may be subjective (e.g., opinion) or objective (e.g., measurable by a test or diagnostic method).

[0165] Therapeutic methods (including prophylactic treatments) of the present invention generally involve administration of a therapeutically effective amount of a compound described herein, e.g., a compound of a formula described herein, to a subject (e.g., animal, human) in need thereof, including mammals, particularly humans. Such treatments would be suitably administered to subjects, particularly humans, who are suffering from, have, are susceptible to, or are at risk for a neoplasm, infectious disease, disorder, or symptom thereof. Those subjects who are "at risk" can be determined by any objective or subjective determination, such as by diagnostic testing or opinion of the subject or a health care provider (e.g., genetic testing, enzyme or protein markers, markers (as defined herein), family history, etc.). The fusion protein complexes of the present invention can be used in the treatment of any other disorder in which an increased immune response is desired.

[0166] The present invention also provides methods for monitoring the progress of a treatment. The methods involve determining the level or diagnostic measurement (e.g., a screen, assay) of a diagnostic marker (e.g., any target delineated herein that is modulated by a compound, protein, or indicator thereof described herein, etc.) in a subject suffering from or susceptible to a neoplasia-related disorder or symptom thereof, to which the subject has been administered a therapeutic amount of a compound described herein sufficient to treat the disease or symptom thereof. The level of the marker determined by this method can be compared to known levels of the marker in either healthy normal controls or other affected patients to determine the subject's disease status. In some cases, a second level of the marker in the subject is determined at a time later than the determination of the first level, and the two levels are compared to monitor the course of the disease or the effectiveness of the therapy. In certain embodiments, a pre-treatment level of the marker in the subject is determined before initiating treatment according to the present invention. This pre-treatment level of the marker can be compared to the level of the marker in the subject after initiation of treatment to determine the effectiveness of the treatment.

[0167] Combination therapy Optionally, the fusion protein complex of the present invention or immune cells treated with the fusion protein complex of the present invention are administered in combination with any other standard therapy. Such methods are known to those skilled in the art and are described in Remington's Pharmaceutical Sciences by E.W. Martin. Optionally, the fusion protein complex of the present invention or immune cells treated with the fusion protein complex of the present invention are administered in combination with any conventional anti-neoplastic therapy, including, but not limited to, immunotherapy, adoptive cell therapy, vaccines, therapeutic antibodies and checkpoint inhibitor antibodies, targeted therapy, surgery, radiation therapy, or chemotherapy.

[0168] Kit or formulation Pharmaceutical compositions comprising the fusion protein complexes of the invention or immune cells treated with the fusion protein complexes of the invention can be assembled into kits or formulations for use in ameliorating neoplasia or infectious disease. A kit or formulation according to this aspect of the invention comprises a shipping means, e.g., a box, carton, tube, having one or more container means, e.g., vials, tubes, ampoules, bottles, etc., securely enclosed therein. A kit or formulation may also include associated instructions for using the fusion protein complexes of the invention. In one embodiment, the kit includes suitable containers, e.g., bags, bottles, tubes, to enable ex vivo treatment of immune cells using the fusion protein complexes of the invention and / or administration of such cells to a patient. The kit may also include a medical device comprising the fusion protein complexes of the invention.

[0169] Recombinant protein expression In general, preparation of the fusion protein complexes of the invention (eg, components of TxM complexes) can be carried out by procedures disclosed herein and by recognized recombinant DNA techniques.

[0170] Generally, recombinant polypeptides are produced by transformation of a suitable host cell with a nucleic acid molecule or fragment thereof encoding all or part of the polypeptide in a suitable expression vehicle. Those skilled in the art of molecular biology will appreciate that any of a wide variety of expression systems can be used to provide recombinant proteins. The precise host cell used is not critical to the present invention. Recombinant polypeptides can be produced in virtually any eukaryotic host (e.g., Saccharomyces cerevisiae, insect cells such as Sf21 cells, or mammalian cells such as NIH 3T3, HeLa, or preferably COS cells). Such cells are available from a wide range of sources (e.g., American Type Culture Collection, Rockland, MD; see also, e.g., Ausubel et al., Current Protocols in Molecular Biology, New York: John Wiley and Sons, 1997). The method of transfection and choice of expression vehicle will depend on the host system selected. Transformation methods are described, for example, in Ausubel et al. (see above). Expression vehicles can be selected, for example, from among those provided in Cloning Vectors: A Laboratory Manual (P.F. Douwels et al., 1985, Supp. 1987).

[0171] A variety of expression systems exist for producing recombinant polypeptides. Expression vectors useful for producing such polypeptides include, without limitation, chromosomal, episomal, and virus-derived vectors, such as those derived from bacterial plasmids, bacteriophages, transposons, yeast episomes, insertion elements, yeast chromosomal elements, viruses such as baculoviruses, papovaviruses, e.g., SV40, vaccinia viruses, adenoviruses, fowlpox viruses, pseudorabies viruses, and retroviruses, and combinations thereof.

[0172] Once the recombinant polypeptide is expressed, it can be isolated, for example, using affinity chromatography. In one example, an antibody raised against the polypeptide (e.g., generated as described herein) can be attached to a column and used to isolate the recombinant polypeptide. Lysis and fractionation of cells bearing the polypeptide prior to affinity chromatography can be performed by standard methods (see, e.g., Ausubel et al., supra). Once isolated, the recombinant protein can be further purified, if desired, by, for example, high performance liquid chromatography (see, e.g., Fisher, Laboratory Techniques in Biochemistry and Molecular Biology, eds., Work and Burdon, Elsevier, 1980).

[0173] As used herein, biologically active polypeptides or effector molecules of the invention can include, for example, factors such as cytokines, chemokines, growth factors, protein toxins, immunoglobulin domains, or other biologically active proteins such as enzymes. Biologically active polypeptides can also include conjugates to other compounds such as, for example, non-protein toxins, cytotoxic agents, chemotherapeutic agents, detectable labels, radioactive materials, etc.

[0174] A cytokine of the present invention is defined as any factor produced by a cell that affects other cells and is responsible for any of the many multiple effects of cellular immunity. Examples of cytokines include, but are not limited to, the IL-2 family, interferons (IFNs), IL-10, IL-12, IL-18, IL-1, IL-17, the TGF and TNF cytokine families and IL-1 through IL-35, IFN-α, IFN-β, IFNγ, TGF-β, TNF-α, and TNF-β.

[0175] In one embodiment of the present invention, the first protein comprises a first biologically active polypeptide covalently linked to an interleukin-15 (IL-15) domain or a functional fragment thereof. IL-15 is a cytokine that influences T cell activation and proliferation. IL-15 activity in influencing immune cell activation and proliferation is similar in some respects to IL-2, although fundamental differences have been clearly characterized (Waldmann, TA, 2006, Nature Rev. Immunol. 6:595-601).

[0176] In another aspect of the present invention, the first protein comprises an interleukin-15 (IL-15) domain that is an IL-15 variant (also referred to herein as an IL-15 mutant). The IL-15 variant preferably comprises an amino acid sequence that differs from that of the native (or wild-type) IL-15 protein. The IL-15 variant preferably binds to an IL-15Rα polypeptide and functions as an IL-15 agonist or antagonist. Preferably, an IL-15 variant with agonist activity has superagonist activity. An IL-15 variant can function as an IL-15 agonist or antagonist independently of its association with IL-15Rα. An IL-15 agonist is exemplified by comparable or increased biological activity compared to wild-type IL-15. An IL-15 antagonist is exemplified by decreased biological activity compared to wild-type IL-15 or the ability to inhibit an IL-15-mediated response. In some examples, IL-15 variants bind to the IL-15RβγC receptor with increased or decreased activity. In some cases, the sequence of an IL-15 variant has at least one amino acid change, e.g., a substitution or deletion, compared to the native IL-15 sequence, which confers IL-15 agonist or antagonist activity. Preferably, the amino acid substitution / deletion is within the domain of IL-15 that interacts with IL-15Rβ and / or γC. More preferably, the amino acid substitution / deletion does not affect the ability to bind to an IL-15Rα polypeptide or generate an IL-15 variant. Suitable amino acid substitutions / deletions for generating IL-15 variants can be identified through rational or random mutagenesis and functional assays or other empirical methods provided herein, based on predicted or known IL-15 structure, comparison of IL-15 with a cognate molecule, such as IL-2, which has a known structure. Furthermore, suitable amino acid substitutions can be conservative or non-conservative changes and insertions of additional amino acids. Preferably, the IL-15 variants of the present invention contain one or more amino acid substitutions / deletions at positions 6, 8, 10, 61, 65, 72, 92, 101, 104, 105, 108, 109, 111 or 112 of the mature human IL-15 sequence.In particular, D8N (where "D8" refers to the amino acid and residue position within the native mature human IL-15 sequence and "N" refers to the amino acid residue substituted at that position in the IL-15 variant), I6S, D8A, D61A, N65A, N72R, V104P or Q108A substitutions result in IL-15 variants with antagonist activity, and N72D substitutions result in IL-15 variants with agonist activity.

[0177] A chemokine is defined as any chemical factor or molecule that, similar to cytokines, is responsible for any of the many multiple effects of cellular immunity when exposed to other cells. Suitable chemokines may include, but are not limited to, the CXC, CC, C, and CX3C chemokine families, as well as CCL-1 through CCL-28, CXC-1 through CXC-17, XCL-1, XCL-2, CX3CL1, MIP-1b, IL-8, MCP-1, and Rantes.

[0178] Growth factors include any molecule that, when exposed to a particular cell, induces proliferation and / or differentiation of diseased cells. Growth factors include proteins and chemical molecules, some of which include GM-CSF, G-CSF, human growth factor, and stem cell growth factor. Additional growth factors may also be suitable for the uses described herein.

[0179] Toxins or cytotoxic agents include any substance that has a lethal or growth-inhibitory effect on cells upon exposure. More specifically, the effector molecule can be, for example, a cytotoxin of plant or bacterial origin, such as diphtheria toxin (DT), Shiga toxin, abrin, cholera toxin, ricin, saporin, Pseudomonas exotoxin (PE), pokeweed antiviral protein, or gelonin. Biologically active fragments of such toxins are well known in the art and include, for example, DT A chain and ricin A chain. Furthermore, the toxin can be a substance active on the cell surface, such as a phospholipase enzyme (e.g., phospholipase C).

[0180] Additionally, the effector molecule may be a chemotherapeutic drug such as vindesine, vincristine, vinblastine, methotrexate, adriamycin, bleomycin, or cisplatin.

[0181] Furthermore, the effector molecule may be a detectably labeled molecule suitable for diagnostic or imaging studies. Such labels include biotin or streptavidin / avidin, detectable nanoparticles or crystals, enzymes or catalytically active fragments thereof, fluorescent labels such as green fluorescent protein, FITC, phycoerythrin, cychome, Texas Red or quantum dots; radionuclides such as iodine-131, yttrium-90, rhenium-188 or bismuth-212; phosphorescent or chemiluminescent molecules, or labels detectable by PET, ultrasound or MRI, such as contrast agents based on Gd or paramagnetic metal ions. For disclosures regarding the production and use of proteins containing effectors or tags, see, e.g., Moskaug, et al. J. Biol. Chem. 264, 15709 (1989); Pastan, I. et al. Cell 47, 641, 1986; Pastan et al., Recombinant Toxins as Novel Therapeutic Agents, Ann. Rev. Biochem. 61, 331, (1992); "Chimeric Toxins" Olsnes and Phil, Pharmac. Ther., 25, 355 (1982); published PCT applications WO 94 / 29350; WO 94 / 04689; WO 2005046449; and U.S. Pat. No. 5,620,939.

[0182] The IL-15 and IL-15Rα polypeptides of the present invention preferably correspond in amino acid sequence to naturally occurring IL-15 and IL-15Rα molecules, e.g., human, mouse, or other rodent or other mammalian IL-15 and IL-15Rα molecules. The sequences of these polypeptides and encoding nucleic acids are known in the literature, including human interleukin (IL15) mRNA—GenBank: U14407.1 (incorporated herein by reference), murine interleukin 15 (IL15) mRNA—GenBank: U14332.1 (incorporated herein by reference), human interleukin-15 receptor alpha chain precursor (IL15RA) mRNA—GenBank: U31628.1 (incorporated herein by reference), and murine interleukin-15 receptor, alpha chain—GenBank: BC095982.1 (incorporated herein by reference).

[0183] In some situations, it may be useful to make the protein fusion complexes or conjugate complexes of the present invention multivalent, for example, to increase the valency of sc antibodies. In particular, the interaction between the IL-15 and IL-15Rα domains of the fusion protein complex provides a means for generating multivalent complexes. Furthermore, multivalent fusion proteins can be created by covalently or noncovalently linking one protein to four proteins (the same or different), for example, by using standard biotin-streptavidin labeling techniques or by conjugation to a suitable solid support such as latex beads. Chemically crosslinked proteins (e.g., crosslinked to dendrimers) are also suitable multivalent species. For example, proteins can be modified by including a modifiable tag sequence, such as a biotinylated BirA tag, or a sequence encoding an amino acid residue with a chemically reactive side chain, such as Cys or His. Such amino acid tags or chemically reactive amino acids can be placed at various positions in the fusion protein, preferably distal to the active site of the biologically active polypeptide or effector molecule. For example, the C-terminus of a soluble fusion protein can be covalently linked to a tag or other fusion protein containing such reactive amino acids. Two or more fusion proteins can be chemically linked to suitable dendrimers or other nanoparticles containing suitable side chains to obtain multivalent molecules. Dendrimers are synthetic chemical polymers that can have any one of a number of different functional groups on their surface (D. Tomalia, Aldrichimica Acta, 26:91:101 (1993)). Exemplary dendrimers for use in accordance with the present invention include, for example, E9 starburst polyamine dendrimers and E9 combust polyamine dendrimers, which can conjugate cysteine residues. Exemplary nanoparticles include liposomes, core-shell particles, or PLGA-based particles.

[0184] In another embodiment, one or both polypeptides of the fusion protein complex comprise an immunoglobulin domain. Alternatively, the protein binding domain-IL-15 fusion protein can be linked to an immunoglobulin domain. Preferred immunoglobulin domains include regions that interact with other immunoglobulin domains to form multi-chain proteins as provided above. For example, an immunoglobulin heavy chain region, such as an IgG1 C H 2-C H 3 can stably interact to create an Fc region. Preferred immunoglobulin domains containing an Fc domain also contain regions with effector functions, including Fc receptor or complement protein binding activity, and / or glycosylation sites. In some embodiments, the immunoglobulin domain of the fusion protein complex contains mutations that reduce or enhance Fc receptor or complement binding activity, or glycosylation or dimerization, thereby affecting the biological activity of the resulting protein. For example, immunoglobulin domains containing mutations that reduce binding to Fc receptors can be used to generate fusion proteins of the invention that have lower binding activity to cells that have Fc receptors, which may be advantageous for reagents designed to recognize or detect specific antigens.

[0185] Nucleic acids and vectors The present invention further provides nucleic acid sequences, and particularly DNA sequences, encoding the fusion proteins (e.g., components of TxM) of the present invention. Preferably, the DNA sequences are carried by a vector suitable for extrachromosomal replication, such as, for example, a phage, virus, plasmid, phagemid, cosmid, YAC, or episome. In particular, the use of a DNA vector encoding the desired fusion protein facilitates the preparation methods described herein and allows for the production of significant quantities of the fusion protein. The DNA sequence can be inserted into an appropriate expression vector, i.e., a vector containing the necessary elements for the transcription and translation of the inserted protein-coding sequence. A variety of host-vector systems can be used to express the protein-coding sequence. These include mammalian cell systems infected with viruses (e.g., vaccinia virus, adenovirus, etc.); insect cell systems infected with viruses (e.g., baculovirus); microorganisms such as yeast containing yeast vectors or bacteria transformed with bacteriophage DNA, plasmid DNA, or cosmid DNA. Depending on the host-vector system utilized, any one of a number of suitable transcription and translation elements can be used. See Sambrook et al., supra, and Ausubel et al.

[0186] Included in the present invention is a method for making a soluble fusion protein complex, comprising introducing into a host cell a DNA vector described herein encoding a first protein and a second protein; culturing the host cell in a medium under conditions sufficient to express the fusion proteins in the cells or medium and to allow association between the IL-15 domain of the first protein and the soluble IL-15Rα domain of the second protein to form a soluble fusion protein complex; and purifying the soluble fusion protein complex from the host cell or medium.

[0187] In general, preferred DNA vectors according to the present invention comprise nucleotide sequences linked by phosphodiester bonds, which in a 5' to 3' direction comprise a first cloning site for introducing a first nucleotide sequence encoding a biologically active polypeptide operably linked to a sequence encoding an effector molecule.

[0188] The fusion protein components encoded by the DNA vector can be provided in a cassette format. The term "cassette" means that each component can be easily replaced by another component using standard recombinant methods. In particular, DNA vectors configured in a cassette format are particularly desirable when the encoded fusion protein complex must be used against a pathogen that may or has the ability to generate serotypes.

[0189] To create a vector encoding a fusion protein complex, a sequence encoding a biologically active polypeptide is ligated to a sequence encoding an effector peptide using a suitable ligase. DNA encoding the display peptide can be isolated from natural sources, such as suitable cell lines, or synthesized by known methods, such as the phosphotriester method. See, for example, Oligonucleotide Synthesis, IRL Press (M.J. Gait, ed., 1984). Synthetic oligonucleotides can also be prepared using commercially available automated oligonucleotide synthesizers. Once isolated, the gene encoding the biologically active polypeptide can be amplified by polymerase chain reaction (PCR) or other means known in the art. PCR primers suitable for amplifying the biologically active polypeptide gene can add restriction enzyme recognition sites to the PCR product. The PCR product preferably contains splice sites for the effector peptide and a leader sequence necessary for proper expression and secretion of the biologically active polypeptide-effector fusion protein. The PCR product also preferably contains a sequence encoding a linker sequence or a restriction enzyme site for ligating such a sequence.

[0190] The fusion proteins described herein are preferably produced by standard recombinant DNA techniques. For example, once a DNA molecule encoding a biologically active polypeptide is isolated, the sequence can be ligated to another DNA molecule encoding an effector polypeptide. The nucleotide sequence encoding the biologically active polypeptide can be directly spliced to the DNA sequence encoding the effector peptide, or more typically, a DNA sequence encoding a linker sequence as discussed herein can be inserted between the sequence encoding the biologically active polypeptide and the sequence encoding the effector peptide and then joined using a suitable ligase. The resulting hybrid DNA molecule can be expressed in a suitable host cell to produce a fusion protein complex. The DNA molecules are ligated to each other in the 5' to 3' direction (i.e., the DNA molecules are ligated in-frame to each other) so that the translation frame of the encoded polypeptide is not altered after ligation. The resulting DNA molecule encodes an in-frame fusion protein.

[0191] Other nucleotide sequences can also be included in the genetic construct. For example, a promoter sequence controlling expression of a sequence encoding a biologically active polypeptide fused to an effector peptide, or a leader sequence directing the fusion protein to the cell surface or culture medium, can be included in the construct or present in the expression vector into which the construct is inserted. Immunoglobulin or CMV promoters are particularly preferred.

[0192] Upon obtaining the coding sequence of a variant biologically active polypeptide, IL-15, IL-15Rα, or Fc domain, one skilled in the art will recognize that the polypeptide can be modified by certain amino acid substitutions, additions, deletions, and post-translational modifications without abolishing or reducing biological activity. In particular, it is well known that conservative amino acid substitutions, i.e., the replacement of one amino acid with another amino acid with similar size, charge, polarity, and conformation, are unlikely to significantly alter protein function. The 20 standard amino acids that are the building blocks of proteins are roughly classified into the following four groups of conservative amino acids: Nonpolar (hydrophobic) groups include alanine, isoleucine, leucine, methionine, phenylalanine, proline, tryptophan, and valine; polar (uncharged, neutral) groups include asparagine, cysteine, glutamine, glycine, serine, threonine, and tyrosine; positively charged (basic) groups include arginine, histidine, and lysine; and negatively charged (acidic) groups include aspartic acid and glutamic acid. Substitution of a single amino acid in a protein with another amino acid in the same group is unlikely to have a deleterious effect on the biological activity of that protein. In other examples, modifications to amino acid positions can decrease or increase the biological activity of a protein. Such changes can be introduced randomly or by site-directed mutagenesis based on known or predicted structural or functional properties of the targeted residue. Following expression of the mutant protein, binding or functional assays can be used to readily assess changes in biological activity resulting from the modification.

[0193] Homology between nucleotide sequences can be determined by DNA hybridization analysis, where the stability of double-stranded DNA hybrids depends on the degree of base pairing that occurs. High temperature and / or low salt conditions can be used to reduce hybrid stability and prevent annealing of sequences with lower homology than a selected level. For example, for a sequence with approximately 55% GC content, hybridization and washing conditions of 40°C to 50°C, 6x SSC (sodium chloride / sodium citrate buffer), and 0.1% SDS (sodium dodecyl sulfate) indicate approximately 60% to 70% homology; hybridization and washing conditions of 50°C to 65°C, 1x SSC, and 0.1% SDS indicate approximately 82% to 97% homology; and hybridization and washing conditions of 52°C, 0.1x SSC, and 0.1% SDS indicate approximately 99% to 100% homology. A wide range of computer programs are available for comparing nucleotide and amino acid sequences (and for measuring the degree of homology); a list providing sources of both commercially available and free software can be found in Ausubel et al. (1999). Readily available sequence comparison and multiple sequence alignment algorithms are the Basic Local Alignment Search Tool (BLAST) (Altschul et al., 1997) and ClustalW programs, respectively. BLAST is available on the World Wide Web at ncbi.nlm.nih.gov, and ClustalW is available at 2.ebi.ac.uk.

[0194] The components of the fusion protein can be arranged in almost any order so long as each is capable of performing its intended function. For example, in one embodiment, the biologically active polypeptide is placed at the C-terminus or N-terminus of the effector molecule.

[0195] Preferred effector molecules of the present invention will have a size conducive to the domain's intended function. Effector molecules of the present invention can be generated and fused to biologically active polypeptides by a variety of methods, including well-known chemical cross-linking methods. See, e.g., Means, GE and Feeney, RE (1974) in Chemical Modification of Proteins, Holden-Day. See also, S.S.W. Song (1991) in Chemistry of Protein Conjugation and Cross-Linking, CRC Press. However, it is generally preferred to generate in-frame fusion proteins using recombinant techniques.

[0196] As discussed above, fusion or conjugate molecules can be constructed in several ways according to the present invention. In an exemplary configuration, the C-terminus of the biologically active polypeptide is operably linked to the N-terminus of the effector molecule. This linkage can be achieved by recombinant methods, if desired. However, in another configuration, the N-terminus of the biologically active polypeptide is linked to the C-terminus of the effector molecule.

[0197] Alternatively or additionally, one or more additional effector molecules can be inserted into the bioactive polypeptide or conjugate complex as desired.

[0198] Vectors and Expression Numerous strategies can be used to express components of the fusion protein complexes (e.g., TxM) of the present invention. For example, constructs encoding one or more components of the fusion protein complexes of the present invention can be incorporated into an appropriate vector by using a restriction enzyme to create a cut in the vector for insertion of the construct, followed by ligation. The vector containing the gene construct is then introduced into a suitable host for expression of the fusion protein. See generally, Sambrook et al., supra. Suitable vectors can be selected empirically based on factors related to the cloning protocol. For example, the vector must be compatible with the host being used and have the appropriate replicon. The vector must be able to accommodate the DNA sequence encoding the fusion protein complex to be expressed. Suitable host cells include eukaryotic and prokaryotic cells, preferably cells that are easily transformed and exhibit rapid growth in culture medium. In particular, preferred host cells include prokaryotes such as E. coli and Bacillus subtilis, and eukaryotic cells such as animal cells and yeast strains (e.g., S. cerevisiae). Mammalian cells, particularly J558, NSO, SP2-O, or CHO, are generally preferred. Other suitable hosts include insect cells, such as Sf9. Conventional culture conditions are used. See Sambrook, supra. Stably transformed or transfected cell lines can then be selected. Cells expressing the fusion protein complex of the invention can be determined by known procedures. For example, expression of the fusion protein complex linked to an immunoglobulin can be determined by ELISA and / or immunoblotting specific for the linked immunoglobulin. Other methods for detecting expression of fusion proteins comprising a biologically active polypeptide linked to an IL-15 or IL-15Rα domain are disclosed in the Examples.

[0199] As generally mentioned above, host cells can be used for preparative purposes to propagate nucleic acids encoding the desired fusion proteins. Host cells can therefore include prokaryotic or eukaryotic cells in which production of the fusion protein is specifically intended. Host cells therefore particularly include yeast, fly, worm, plant, frog, and mammalian cells and organs capable of propagating fusion-encoding nucleic acids. Non-limiting examples of mammalian cell lines that can be used include CHO dhfr cells (Urlaub and Chasm, Proc. Natl. Acad. Sci. USA, 77:4216 (1980)), 293 cells (Graham et al., J. Gen. Virol., 36:59 (1977)), or myeloma cells such as SP2 or NSO (Galfre and Milstein, Meth. Enzymol., 73(B):3 (1981)).

[0200] Host cells in which nucleic acids encoding the desired fusion protein complexes can be propagated similarly include non-mammalian eukaryotic cells, including insects (e.g., Frugiperda spp.), yeast (e.g., S. cerevisiae, S. pombe, P. pastoris, K. lactis, H. polymorpha, as reviewed by Fleer, R., Current Opinion in Biotechnology, 3(5):486-496 (1992)), fungal cells, and plant cells. Certain prokaryotes, such as E. coli and Bacillus, are also contemplated.

[0201] Nucleic acids encoding the desired fusion proteins can be introduced into host cells by standard techniques for transfecting cells. The terms "transfect" or "transfection" are intended to encompass all conventional techniques for introducing nucleic acids into host cells, including calcium phosphate co-precipitation, DEAE-dextran-mediated transfection, lipofection, electroporation, microinjection, viral transduction, and / or viral integration. Suitable methods for transfecting host cells can be found in Sambrook et al., supra, and other laboratory textbooks.

[0202] Various promoters (transcription initiation regulatory regions) can be used according to the present invention. The selection of an appropriate promoter depends on the proposed expression host. Promoters from heterologous sources can be used as long as they are functional in the selected host.

[0203] The choice of promoter also depends on the desired efficiency and level of peptide or protein production. For example, inducible promoters such as tac are often used to dramatically increase the level of protein expression in E. coli. Overexpression of proteins can be harmful to the host cell. As a result, host cell growth can be limited. The use of an inducible promoter system allows the host cell to be cultured at an acceptable density prior to induction of gene expression, thereby facilitating higher yields of product.

[0204] A variety of signal sequences can be used in accordance with the present invention. Signal sequences homologous to the biologically active polypeptide coding sequence can be used. Alternatively, signal sequences selected or designed for efficient secretion and processing in the expression host can be used. For example, suitable signal sequence / host cell pairs include the B. subtilis sacB signal sequence for secretion in B. subtilis and the Saccharomyces cerevisiae α-mating factor or the P. pastoris acid phosphatase pohI signal sequence for secretion in P. pastoris. The signal sequence can be joined directly to the protein-coding sequence through a sequence encoding a signal peptidase cleavage site or by a short nucleotide bridge, usually consisting of fewer than 10 codons, where the bridge ensures the correct reading frame of the downstream TCR sequence.

[0205] Elements that enhance transcription and translation have been identified in eukaryotic protein expression systems. For example, placing 1,000 bp of the cauliflower mosaic virus (CaMV) promoter on either side of a heterologous promoter can increase transcription levels in plant cells by 10- to 400-fold. Expression constructs should also contain appropriate translation initiation sequences. Modifying expression constructs to include a Kozak consensus sequence for accurate translation initiation can increase translation levels by 10-fold.

[0206] Selectable markers are often used that can be part of the expression construct or separate from it (e.g., carried by an expression vector) so that the marker can be integrated at a site different from the gene of interest. Examples include those that confer resistance to antibiotics (e.g., bla, which confers ampicillin resistance to E. coli host cells, nptII, which confers kanamycin resistance to a wide range of prokaryotic and eukaryotic cells) or that allow the host to grow on minimal media (e.g., HIS4 in P. pastoris or His -Selectable markers include those that allow S. cerevisiae to grow in the absence of histidine. Selectable markers have their own transcriptional and translational initiation and termination regulatory regions to allow independent expression of the marker. When antibiotic resistance is used as a marker, the concentration of antibiotic for selection varies depending on the antibiotic, but is generally in the range of 10 μg to 600 μg of antibiotic per mL of medium.

[0207] Expression constructs are constructed using known recombinant DNA techniques (Sambrook et al., 1989; Ausubel et al., 1999). Restriction enzyme digestion and ligation are the basic steps used to join two pieces of DNA. The ends of the DNA fragments may require modification prior to ligation; this can be accomplished by filling in overhangs, deleting the ends of the fragments using a nuclease (e.g., ExoIII), or adding new base pairs by site-directed mutagenesis or PCR. Polylinkers and adapters can be used to facilitate joining of selected fragments. Expression constructs are typically assembled in stages using repeated restriction, ligation, and transformation of E. coli. Numerous cloning vectors suitable for constructing expression constructs are known in the art (λZAP and pBLUESCRIPT SK-1, Stratagene, La Jolla, CA, mentioned in Ausubel et al., 1999; pET, Novagen Inc., Madison, WI), and the particular choice is not critical to the present invention. The choice of cloning vector will be influenced by the gene transfer system chosen for introduction of the expression construct into the host cell. At the end of each step, the resulting constructs can be analyzed by restriction, DNA sequence, hybridization, and PCR analysis.

[0208] Expression constructs can be transformed into hosts as either linear or circular cloning vector constructs, or can be removed from the cloning vector and used as is or introduced onto a delivery vector. The delivery vector facilitates the introduction and maintenance of the expression construct in a selected host cell type. Expression constructs are introduced into host cells by a number of known gene transfer systems (e.g., natural competence, chemically mediated transformation, protoplast transformation, electroporation, biolistic transformation, transfection, or conjugation) (Ausubel et al., 1999; Sambrook et al., 1989). The gene transfer system selected depends on the host cell and vector system used.

[0209] For example, expression constructs can be introduced into S. cerevisiae cells by protoplast transformation or electroporation. Electroporation of S. cerevisiae is easily accomplished and results in transformation efficiencies comparable to spheroplast transformation.

[0210] The present invention further provides a production method for isolating a fusion protein of interest. In this method, host cells (e.g., yeast, fungal, insect, bacterial, or animal cells) into which a nucleic acid encoding a protein of interest operably linked to a regulatory sequence has been introduced are grown at a production scale in a culture medium to stimulate transcription of the nucleotide sequence encoding the fusion protein of interest. The fusion protein of interest is then isolated from the harvested host cells or culture medium. Standard protein purification techniques can be used to isolate the protein of interest from the medium or harvested cells. In particular, purification techniques can be used to express and purify the desired fusion protein on a large scale (i.e., at least milligram quantities) from a variety of platforms, including roller bottles, spinner flasks, tissue culture plates, bioreactors, or fermenters.

[0211] The expressed protein fusion complex can be isolated and purified by known methods. Typically, the culture medium is centrifuged or filtered, and the supernatant is then purified by affinity or immunoaffinity chromatography, e.g., protein A or protein G affinity chromatography, or immunoaffinity protocols involving the use of monoclonal antibodies that bind the expressed fusion complex. The fusion proteins of the present invention can be isolated and purified by an appropriate combination of known techniques. These methods include, for example, solubility-based methods such as salt precipitation and solvent precipitation; molecular weight-based methods such as dialysis, ultrafiltration, gel filtration, and SDS-polyacrylamide gel electrophoresis; charge-based methods such as ion-exchange column chromatography; specific affinity-based methods such as affinity chromatography; hydrophobicity-based methods such as reverse-phase high-performance liquid chromatography; and isoelectric focusing, which utilizes differences in isoelectric points on metal affinity columns such as Ni-NTA. For disclosures related to these methods, see generally Sambrook et al. and Ausubel et al., supra.

[0212] The fusion proteins of the present invention are preferably substantially pure. That is, the fusion protein has been isolated from the cellular substitutes with which it is naturally associated, such that the fusion protein is preferably present in at least 80% or 90%-95% homogeneity (weight / weight). Fusion proteins having at least 98%-99% homogeneity (weight / weight) are most preferred for many pharmaceutical, clinical, and research applications. When substantially purified, the fusion protein should be substantially free of contaminants for therapeutic applications. When purified to partial or substantial purity, the soluble protein can be used therapeutically or in performing the in vitro or in vivo assays disclosed herein. Substantial purity can be determined by a variety of standard techniques, such as chromatography and gel electrophoresis.

[0213] The fusion protein complexes of the present invention are suitable for use in vitro or in vivo with a variety of cells that are cancerous or infected or susceptible to infection by one or more diseases.

[0214] Human interleukin-15 (huIL-15) is trans-presented to immune effector cells by the human IL-15 receptor α chain (huIL-15Rα) expressed on antigen-presenting cells. IL-15Rα binds to huIL-15 with high affinity (38 pM) primarily through its extracellular sushi domain (huIL-15RαSu). As described herein, the huIL-15 and huIL-15RαSu domains can be used as scaffolds to construct multidomain fusion complexes.

[0215] IgG domains, particularly Fc fragments, have been successfully used as dimer scaffolds for numerous therapeutic molecules, including approved biologic drugs. For example, etanercept is a dimer of the soluble human p75 tumor necrosis factor (TNF-α) receptor (sTNFR) linked to the Fc domain of human IgG1. This dimerization allows etanercept to be up to 1,000-fold more potent at inhibiting TNF-α activity than the monomeric sTNFR and provides a fusion with a serum half-life five times longer than the monomeric form. Consequently, etanercept is effective in neutralizing the pro-inflammatory activity of TNF-α in vivo and improves patient outcomes for a number of different autoimmune indications.

[0216] In addition to its dimerization activity, the Fc fragment also provides cytotoxic effector function through complement activation and interaction with Fcγ receptors displayed on natural killer (NK) cells, neutrophils, phagocytes, and dendritic cells. In the context of anti-cancer therapeutic antibodies and other antibody domain-Fc fusion proteins, these activities likely play an important role in the efficacy observed in animal tumor models and cancer patients. However, these cytotoxic effector responses may not be sufficient for many therapeutic applications. Therefore, there has been considerable interest in improving and expanding the effector activity of the Fc domain and developing other means to mobilize cytolytic immune responses, including T cell activity, to disease sites by targeting therapeutic molecules. IgG domains have been used as scaffolds to form bispecific antibodies to improve the quality and quantity of products generated by traditional hybridoma fusion technology. While these methods avoid the shortcomings of other scaffolds, producing bispecific antibodies in mammalian cells at levels sufficient to support clinical development and use has been challenging.

[0217] In an attempt to develop a human-derived immunostimulatory multimeric scaffold, human IL-15 (huIL-15) and the IL-15 receptor domain were used. huIL-15 has a high binding affinity (equilibrium dissociation constant (KD) of approximately 10 -11huIL-15 is a member of the small four-alpha-helical bundle family of cytokines that associates with the human IL-2 / IL-15 receptor α chain (huIL-15Rα) at the IL-15 receptor β / common γ chain (huIL-15RβγC) complex displayed on the surface of T cells and NK cells. This cytokine / receptor interaction leads to the proliferation and activation of effector and NK cells, which play a key role in eradicating virally infected and malignant cells. Normally, huIL-15 and huIL-15Rα are co-produced within dendritic cells to form a complex that is subsequently secreted and displayed as a heterodimeric molecule on the cell surface. Therefore, the characterization of the interaction between huIL-15 and huIL-15Rα suggests that their interchain binding domains could function as a human-derived immunostimulatory scaffold, generating a soluble dimeric molecule capable of target-specific binding.

[0218] The practice of the present invention employs, unless otherwise indicated, conventional techniques of molecular biology (including recombinant techniques), microbiology, cell biology, biochemistry, and immunology, which are well within the knowledge of those skilled in the art. Such techniques are fully explained in such references as "Molecular Cloning: A Laboratory Manual," second edition (Sambrook, 1989); "Oligonucleotide Synthesis" (Gait, 1984); "Animal Cell Culture" (Freshney, 1987); "Methods in Enzymology," "Handbook of Experimental Immunology" (Weir, 1996); "Gene Transfer Vectors for Mammalian Cells" (Miller and Calos, 1987); "Current Protocols in Molecular Biology" (Ausubel, 1987); "PCR: The Polymerase Chain Reaction" (Mullis, 1994); and "Current Protocols in Immunology" (Coligan, 1991). These techniques can be applied to the production of the polynucleotides and polypeptides of the invention and therefore can be taken into consideration when making and practicing the invention. The following sections discuss techniques that are particularly useful for particular embodiments.

[0219] The following examples are put forward so as to provide those of ordinary skill in the art with a detailed disclosure and description of how to make and use the assay, screening and treatment methods of the present invention, and are not intended to limit the scope of what the inventors regard as their invention. [Example]

[0220] Example 1: Generation and characterization of fusion protein complexes containing IL-15, IL-12, and IL-18 domains An important therapeutic approach for treating cancer or infectious diseases relies on enhancing immune cell activity against diseased cells. This strategy involves stimulating immune cells ex vivo, followed by adoptive transfer and / or increasing the levels or activity of immune cells in vivo in the patient. The immune cells involved in these approaches can be cells of the innate (i.e., NK cells) or adaptive (i.e., T cell) immune system.

[0221] One approach to enhancing immune activity is to provide immune cells with immunostimulatory cytokines. Such cytokines are known in the art and can be used alone or in combination with other cytokines or drugs. As described in detail below, we generated fusion protein complexes containing the IL-15N72D:IL-15RαSu / Fc scaffold fused to IL-12 and / or IL-18 binding domains (Figures 1A and 1B). These fusion protein complexes have advantages in binding to NK cells and signaling cellular responses through each of the cytokine receptors. The Fc region of Ig molecules can dimerize to provide a soluble multipolypeptide complex, bind protein A for purification purposes, and interact with Fcγ receptors on NK cells and macrophages, thereby providing the fusion protein complex with advantages not present in combinations of individual cytokines. Furthermore, the interaction between the IL-15N72D domain and the IL-15RαSu domain provides a means to link IL-15N72D, IL-12, and IL-18 (and optionally other protein domains or agents) into a single immunostimulatory fusion protein complex.

[0222] Specifically, constructs were generated linking IL-12 and / or IL-18 domains to IL-15N72D and the IL-15RαSu / Fc chain. In the case of IL-12, the mature cytokine consists of two polypeptide subunits (p40 and p35) that can be linked via a flexible linker to generate an active single-chain form. In some cases, either the IL-12 or IL-18 polypeptide is linked to the N-terminus of the IL-15N72D and / or IL-15RαSu / Fc chain. In other cases, the IL-12 or IL-18 polypeptide is linked to the N-terminus of the IL-15N72D and / or IL-15RαSu / Fc chain. Specific fusion protein complexes comprising the IL-15N72D:IL-15RαSu / Fc scaffold fused to an IL-12 and / or IL-18 binding domain are described below.

[0223] 1) Fusion protein complexes containing IL-12 / IL-15RαSu / Fc and IL-18 / IL-15N72D fusion proteins were generated. The human IL-12 subunit and human IL-18 sequences were obtained from the UniProt website, and DNA for these sequences was synthesized by Genewiz. Specifically, to generate a single-chain version of IL-12, IL-12 subunit β (p40) was linked to IL-12 subunit α (p35), and then a construct was created in which the IL-12 sequence was directly linked to the IL-15RαSu / Fc chain. The synthesized IL-12 sequence was ligated to the N-terminal coding region of IL-15RαSu / Fc by overlapping PCR. The nucleic acid and protein sequences of the construct containing IL-12 linked to the N-terminus of IL-15RαSu / Fc are shown below.

[0224] The nucleic acid sequence of the IL-12 / IL-15RαSu / Fc construct (including the signal peptide sequence) is as follows (SEQ ID NO: 1): (signal peptide) atgaagtgggtgaccttcatcagcctgctgttcctgttctccagcgcctactcc (Human IL-12 subunit β(p40)) [ka] (Linker) ggaggtggcggatccggaggtggaggttctggtggaggtgggagt (Human IL-12 subunit α (p35)) [ka] (human IL-15Rα sushi domain) [ka] (Human IgG1 CH2-CH3 (Fc) domain) [ka]

[0225] The amino acid sequence of the IL-12 / IL-15RαSu / Fc fusion protein (including the signal peptide sequence) is as follows (SEQ ID NO: 2): (signal peptide) MKWVTFISLLFLFSSAYS (Human IL-12 subunit β(p40)) [ka] (Linker) GGGGSGGGGSGGGGS (Human IL-12 subunit α (p35)) [ka] (human IL-15Rα sushi domain) [ka] (Human IgG1 CH2-CH3 (Fc) domain) [ka]

[0226] In some cases, the leader peptide is cleaved from the intact polypeptide to produce a mature form that is soluble or capable of being secreted.

[0227] A construct was also generated by overlapping PCR in which the synthetic IL-18 sequence was linked to the N-terminal coding region of IL-15N72D. The nucleic acid and protein sequences of the construct containing IL-18 linked to the N-terminus of IL-15N72D are shown below.

[0228] The nucleic acid sequence of the IL-18 / IL-15N72D construct (including the leader sequence) is as follows (SEQ ID NO:3): (signal peptide) atgaagtgggtgaccttcatcagcctgctgttcctgttctccagcgcctactcc (human IL-18) [ka] (human IL-15N72D) [ka]

[0229] The amino acid sequence of the IL-18 / IL-15N72D fusion protein (including the leader sequence) is as follows (SEQ ID NO: 4): (signal peptide) MKWVTFISLLFLFSSAYS (human IL-18) [ka] (human IL-15N72D) [ka]

[0230] In some cases, the leader peptide is cleaved from the intact polypeptide to produce a mature form that is soluble or capable of being secreted.

[0231] The IL-12 / IL-15RαSu / Fc and IL-18 / IL-15N72D constructs were cloned into expression vectors as previously described ( U.S. Pat. No. 8,507,222 , Example 1, incorporated herein by reference), and the expression vectors were transfected into CHO cells. Coexpression of the two constructs in CHO cells allowed the formation and secretion of a soluble IL-18 / IL-15N72D:IL-12 / IL-15RαSu / Fc fusion protein complex (termed hIL18 / IL12 / TxM). The hIL18 / IL12 / TxM protein was purified from CHO cell culture supernatants by protein A affinity chromatography and size-exclusion chromatography, resulting in a soluble (non-aggregated) fusion protein complex consisting of the IL-12 / IL-15RαSu / Fc dimer and the IL-18 / IL-15N72D fusion protein ( Figures 2A–2C ).

[0232] SDS-PAGE analysis of the protein A-purified IL-18 / IL-15N72D:IL-12 / IL-15RαSu / Fc fusion protein complex under reducing conditions is shown in Figure 3. Bands corresponding to the soluble IL-12 / IL-15RαSu / Fc and IL-18 / IL-15N72D proteins at approximately 90 kDa and 30 kDa, respectively, were observed (Figure 3).

[0233] 2) For the second approach, a similar fusion protein complex was generated containing the IL-18 / IL-15RαSu / Fc and IL-12 / IL-15N72D fusion proteins. Specifically, the construct was created by directly linking IL-18 to the IL-15RαSu / Fc chain. The synthesized IL-18 sequence was linked to the N-terminal coding region of IL-15RαSu / Fc by overlapping PCR. The nucleic acid and protein sequences of the construct containing IL-18 linked to the N-terminus of IL-15RαSu / Fc are shown below.

[0234] The nucleic acid sequence of the IL-18 / IL-15RαSu / Fc construct (including the signal peptide sequence) is as follows (SEQ ID NO: 5): (signal peptide) atgaagtgggtgaccttcatcagcctgctgttcctgttctccagcgcctactcc (human IL-18) [ka] (human IL-15Rα sushi domain) [ka] (Human IgG1 CH2-CH3 (Fc) domain) [ka]

[0235] The amino acid sequence of the IL-18 / IL-15RαSu / Fc fusion protein (including the signal peptide sequence) is as follows (SEQ ID NO: 6): (signal peptide) MKWVTFISLLFLFSSAYS (human IL-18) [ka] (human IL-15Rα sushi domain) [ka] (Human IgG1 CH2-CH3 (Fc) domain) [ka]

[0236] In some cases, the leader peptide is cleaved from the intact polypeptide to produce a mature form that is soluble or capable of being secreted.

[0237] A construct was also generated by overlapping PCR in which the synthesized IL-12 sequence was linked to the N-terminal coding region of IL-15N72D. As described above, a single-chain version of IL-12 (p40-linker-p35) was used. The nucleic acid sequence of the IL-12 / IL-15N72D construct (including the leader sequence) is as follows (SEQ ID NO: 7): (signal peptide) atgaagtgggtgaccttcatcagcctgctgttcctgttctccagcgcctactcc (Human IL-12 subunit β(p40)) [ka] (Linker) ggaggtggcggatccggaggtggaggttctggtggaggtgggagt (Human IL-12 subunit α (p35)) [ka] (human IL-15N72D) [ka]

[0238] The amino acid sequence of the IL-12 / IL-15N72D fusion protein (including the leader sequence) is as follows (SEQ ID NO: 8): (signal peptide) MKWVTFISLLFLFSSAYS (Human IL-12 subunit β(p40)) [ka] (Linker) GGGGSGGGGSGGGGS (Human IL-12 subunit α (p35)) [ka] (human IL-15N72D) [ka]

[0239] In some cases, the leader peptide is cleaved from the intact polypeptide to produce a mature form that is soluble or capable of being secreted.

[0240] The IL-18 / IL-15RαSu / Fc and IL-12 / IL-15N72D constructs were cloned into expression vectors as previously described (U.S. Pat. No. 8,507,222, Example 1, incorporated herein by reference), and the expression vectors were transfected into CHO cells. Coexpression of the two constructs in CHO cells allowed the formation and secretion of a soluble IL-12 / IL-15N72D:IL-18 / IL-15RαSu / Fc fusion protein complex (termed hIL12 / IL18 / TxM), which could be purified by Protein A affinity chromatography and other chromatographic methods.

[0241] 3) Similar fusion protein complexes can be generated containing IL-18 / IL-15RαSu / Fc and IL-18 / IL-15N72D fusion proteins, or containing IL-12 / IL-15RαSu / Fc and IL-12 / IL-15N72D fusion proteins. "Double-headed" fusion protein complexes can be generated containing IL-18 / IL-15RαSu / Fc and IL-15N72D fusion proteins or IL-15RαSu / Fc and IL-18 / IL-15N72D fusion proteins (FIG. 1B). Similarly, "double-headed" fusion protein complexes can be generated containing IL-12 / IL-15RαSu / Fc and IL-15N72D fusion proteins or IL-15RαSu / Fc and IL-12 / IL-15N72D fusion proteins. Such complexes were generated as described above.

[0242] Example 2: In vitro characterization of the activity of hIL18 / IL12 / TxM and hIL12 / IL18 / TxM fusion protein complexes An ELISA-based method confirmed the formation of hIL18 / IL12 / TxM and hIL12 / IL18 / TxM fusion protein complexes. In Figure 4A, the IL-18 / IL-15N72D:IL-12 / IL-15RαSu / Fc fusion protein complex in the culture supernatant from transfected CHO cells was detected using a huIgG1 / IL15-specific ELISA with a capture antibody, anti-human IL-15 (MAB647, R&D Systems), and a detection antibody conjugated to horseradish peroxidase. This was compared with a similar antibody-TxM fusion protein complex (2B8T2M) of known concentration. Comparing the signal from the hIL18 / IL12 / TxM fusion protein complex to that of the 2B8 T2M control allowed estimation of fusion protein concentration. Similar results were obtained with the hIL12 / IL18 / TxM fusion protein complex (Figure 4B). For the purified "double-headed" IL-18 / TxM complex, ELISA using an anti-IL-18 capture antibody and an anti-IL-15 detection antibody confirmed the formation of fusion protein complexes (Fig. 4C). Results from these assays demonstrate that soluble IL-18 / IL-15N72D, IL-12 / IL-15RαSu / Fc, IL-12 / IL-15N72D, and IL-18 / IL-15RαSu / Fc proteins can be produced in CHO cells and that hIL18 / IL12 / TxM and hIL12 / IL18 / TxM fusion protein complexes can be formed and secreted into the culture medium.

[0243] To evaluate the IL-15 immunostimulatory activity of the hIL18 / IL12 / TxM fusion protein complex, we assessed the proliferation of IL-15-dependent 32Dβ cells, a murine hematopoietic cell line. 32Dβ cells (100 μL) were cultured in 200 μL of RPMI:10% FBS medium with increasing levels of hIL18 / IL12 / TxM. 4The cells were incubated at 37°C for 2 days. Next, WST-1 proliferation reagent (10 μL / well) was added. After 4 hours, absorbance was measured at 450 nm to determine cell proliferation based on the cleavage of WST-1 into a soluble formazan dye by metabolically active cells. The biological activity of the IL-15N72D:IL-15Rα Su / Fc complex (ALT-803) was assessed as a positive control. As shown in Figure 5, hIL18 / IL12 / TxM was able to promote cell proliferation of 32D β cells, demonstrating its IL-15 activity. The activity of hIL18 / IL12 / TxM was reduced compared to that of ALT-803, likely due to IL-18 ligation to the IL-15N72D domain.

[0244] To further evaluate the IL-15 activity of hIL18 / IL12 / TxM, increasing concentrations of hIL18 / IL12 / TxM were added to 32D beta cells in 200 μL of IMDM:10% FBS medium and incubated at 37°C for 3 days. PrestoBlue cell viability reagent (20 μL / well) was then added. After 4 hours, absorbance was measured at 570 nm (using a reference wavelength of 600 nm for normalization), and cell proliferation was determined based on the reduction of PrestoBlue, a resazurin-based solution, by metabolically active cells. Based on the relationship between absorbance and protein concentration, the 50% effective concentration (EC ) for IL-15 bioactivity for hIL18 / IL12 / TxM was then determined. 50 ) was determined. The biological activity of ALT-803 was evaluated as a positive control. As shown in Figure 6, hIL18 / IL12 / TxM was able to promote cell proliferation of 32D β cells, demonstrating IL-15 activity. The activity of hIL18 / IL12 / TxM was reduced compared to that of ALT-803, likely due to IL-18 ligation to IL-15N72D.

[0245] To assess the IL-18 activity of hIL18 / IL12 / TxM, activation of the IL-18 reporter HEK-Blue IL-18 (HEK18) cells was assessed. Increasing concentrations of hIL18 / IL12 / TxM were added to HEK18 cells (5 x 10) in 200 µL of IMDM:10% FBS HEK-Blue medium. 4 The supernatant was then added to the cells (180 μL / well) and incubated at 37°C for 20–22 hours. The culture supernatant (20 μL / well) was then added to QUANTI-Blue reagent (180 μL / well). After 20 hours, absorbance was measured at 650 nm, and cell activation was determined based on the reduction of QUANTI-Blue, a secreted placental alkaline phosphatase (SEAP) detection reagent. The 50% effective concentration (EC ) of hIL18 / IL12 / TxM for IL-18 bioactivity was then calculated based on the relationship between absorbance and protein concentration. 50 ) was determined. The biological activity of recombinant IL-18 was evaluated as a positive control. As shown in Figure 7, hIL18 / IL12 / TxM was able to activate HEK18 cells, demonstrating IL-18 activity. The activity of hIL18 / IL12 / TxM was reduced compared to that of recombinant IL-18, likely due to the ligation of IL-18 to IL-15N72D.

[0246] To evaluate the IL-12 activity of hIL18 / IL12 / TxM, activation of the IL-12 reporter HEK-Blue IL-12 (HEK12) cells was assessed. Increasing concentrations of hIL18 / IL12 / TxM were added to HEK12 cells (5 x 10) in 200 µL of IMDM:10% FBS HEK-Blue medium. 4 The culture supernatant (20 μL / well) was then added to QUANTI-Blue reagent (180 μL / well) and incubated at 37°C for 20–22 hours. After 20 hours, absorbance was measured at 650 nm, and cell activation was determined based on the reduction of QUANTI-Blue, a secreted placental alkaline phosphatase (SEAP) detection reagent. The 50% effective concentration (EC ) of hIL18 / IL12 / TxM for IL-12 bioactivity was then calculated based on the relationship between absorbance and protein concentration. 50) was determined. The biological activity of recombinant IL-12 was evaluated as a positive control. As shown in Figure 8, hIL18 / IL12 / TxM was able to activate HEK12 cells similarly to recombinant IL-12, thereby demonstrating IL-12 activity.

[0247] To further demonstrate the individual activity of each cytokine (IL-12, IL-18, and IL-15), a flow cytometry-based intracellular phosphoprotein assay was developed utilizing proteins that are uniquely phosphorylated in response to receptor signaling by each cytokine (IL-12: STAT4, IL-18: p38 MAPK, and IL-15: STAT5). NK92 (aNK) cells or purified human NK cells (>95% CD56 + After brief (5-15 min) stimulation with 1 μg / mL of hIL18 / IL12 / TxM, responses similar to those seen with the optional combination of recombinant IL-12 (10 ng / mL), IL-18 (50 ng / mL), and ALT-803 (50 ng / mL of IL-15 activity) were generated (Figure 9A-F). These results demonstrate that each of the cytokine domains of the hIL18 / IL12 / TxM fusion protein complexes maintains its specific immunostimulatory biological activity.

[0248] It is known that the combined activity of IL-12, IL-18, and IL-15 is more effective in inducing IFN-γ production by NK cells than any of these cytokines alone. To evaluate the combined cytokine activity of the hIL18 / IL12 / TxM complex, aNK cells were incubated with the hIL18 / IL12 / TxM complex (50 nM), IL-12 (0.5 nM), IL-18 (3 nM), and ALT-803 (10 nM), or each cytokine alone. After 2 days, IFN-γ levels in the culture supernatants were determined using ELISA. As shown in Figure 10A, IL-12, IL-18, and ALT-803 alone had little effect on aNK cells, whereas the combinations of IL-12 + ALT-803 and IL-18 + ALT-803 induced low levels of IFN-γ production by aNK cells. However, the hIL18 / IL12 / TxM fusion protein complex alone, as well as the combinations of IL-12 + IL-18 and IL-12 + IL-18 + ALT-803, demonstrated high levels of IFN-γ production by aNK cells. These results demonstrate that the hIL18 / IL12 / TxM fusion protein complex exhibits the expected immunostimulatory activity of combined IL-12, IL-18, and IL-15 cytokines. Similar studies using two "double-headed" IL-18 / TxM complexes demonstrated the ability of these complexes to induce IFN-γ by aNK cells, although to a lesser extent than the hIL18 / IL12 / TxM fusion protein complex (Figure 10B).

[0249] Example 3: Induction of NK cell-like cytokine-induced memory by hIL18 / IL12 / TxM fusion protein complex Previous studies have demonstrated that cytokine-induced memory-like NK cells can be induced ex vivo after overnight stimulation of purified NK cells with saturating doses of IL-12 (10 ng / mL), IL-15 (50 ng / mL), and IL-18 (50 ng / mL). These cells exhibit memory-like properties, such as 1) enhanced proliferation, 2) expression of IL-2 receptor alpha (IL-2Rα, CD25) and other activation markers, and 3) increased IFN-γ production. To assess the ability of hIL18 / IL12 / TxM to promote the generation of cytokine-induced memory-like NK cells, purified human NK cells (>95% CD56 + )(5×10 6 Human NK cells (1000 cells / mL) were stimulated with 1 μg / mL hIL18 / IL12 / TxM or the optimal combination of recombinant IL-12 (10 ng / mL), IL-18 (50 ng / mL), and ALT-803 (50 ng / mL IL-15 activity) for 18 hours. The induction of cytokine-induced memory-like cells was assessed by increased cell surface CD25 and CD69 (stimulatory markers) expression and intracellular IFN-γ levels, as determined by antibody staining and flow cytometry. The results showed that the hIL18 / IL12 / TxM fusion protein complex could induce CD25, CD69, and intracellular IFN-γ levels after overnight incubation with human NK cells to a degree similar to that of the optimal combination of IL-12, IL-18, and IL-15 (Figures 11A-11F). Thus, overnight incubation with the hIL18 / IL12 / TxM fusion protein complex can generate cytokine-induced memory-like NK cells.

[0250] Previous studies have demonstrated that cytokine-induced memory-like NK cells can be induced ex vivo after overnight stimulation of purified NK cells with saturating doses of IL-12 (10 ng / mL), IL-15 (50 ng / mL), and IL-18 (50 ng / mL). These cells exhibit memory-like properties, such as 1) enhanced proliferation, 2) IL-2 receptor alpha (IL-2Rα, CD25) expression, 3) increased IFN-γ production, and 4) enhanced perforin- and granzyme-mediated cytotoxicity. To assess the ability of hIL18 / IL12 / TxM to promote the generation of cytokine-induced memory-like NK cells, purified human NK cells (>95% CD56) were cultured for 12–18 h with increasing concentrations of hIL18 / IL12 / TxM or an optimized combination of recombinant IL-12 (10 ng / mL), IL-18 (50 ng / mL), and ALT-803 (50 ng / mL IL-15, 3.88 nM). + )(5×10 6 NK cells (1000 cells / mL) were stimulated with hIL18 / IL12 / TxM. The induction of a pre-activation cytokine-induced memory-like cell phenotype was assessed as increased cell surface CD25 expression and intracellular IFN-γ levels, as determined by antibody staining and flow cytometry. As shown in Figures 12A and 12B, hIL18 / IL12 / TxM was able to induce CD25 and intracellular IFN-γ to a degree similar to that of the optimal combination of IL-12, IL-18, and ALT-803 after overnight incubation with human NK cells.

[0251] To demonstrate the generation of cytokine-induced memory-like NK cells by hIL18 / IL12 / TxM, primary human NK cells (2 × 10 6NK cells (10 ng / mL) were primed with hIL18 / IL12 / TxM (38.8 nM) as described above for 16 hours, washed, and rested in low-dose ALT-803 (77.6 pM, equivalent to 1 ng / mL IL-15) to allow the primed NK cells to differentiate into cytokine-induced memory-like NK cells. Maintenance of CD25 expression and enhanced IFN-γ production after 6 hours of restimulation with cytokines (IL-12 (10 ng / mL) and ALT-803 (50 ng / mL, equivalent to IL-15)) or leukemia targets (K562 cells, 5:1 ratio) in the presence of brefeldin A and monensin were assessed as correlates of generating cytokine-induced memory-like NK cells. In all cases, priming with hIL18 / IL12 / TxM resulted in enhanced levels of CD25 after restimulation with cytokines and leukemia targets compared to low-dose IL-15 (77.6 pM ALT-803) as a control (Figure 13B).

[0252] Similar studies were performed to further compare the effects of brief priming with hIL18 / IL12 / TxM or different cytokine combinations on human NK cells when they were subsequently rested in low-dose ALT-803 or IL-15 and restimulated with IL-12 and IL-15. For these studies, proliferation and IFN-γ production of CIML NK cells were assessed as measures of immune activation. As shown in Figure 14A and B, human NK cells were labeled with CellTrace Violet and primed with medium alone, IL-12 (0.5 nM), IL-18 (3 nM), ALT-803 (10 nM), ALT-803 (10 nM) + IL-18 (3 nM), ALT-803 (10 nM) + IL-18 (3 nM) + IL-12 (0.5 nM), or hIL18 / IL12 / TxM (10 nM) as described above. After priming, cells were washed and maintained in medium containing 1 ng / mL IL-15 (Figure 14A) or 75 pM ALT-803 (Figure 14B) and either left unstimulated or restimulated with 10 ng / mL IL-12 + 50 ng / mL IL-15. CIML NK cell proliferation was determined by dilution of CellTrace Violet label, and intracellular IFN-γ expression was determined by intracellular staining and flow cytometry. Compared with no priming or priming with individual cytokines, ALT-803 + IL-18, or ALT-803 + IL-18 + IL-12, NK cells expressed higher levels of IFN-γ after priming with hIL18 / IL12 / TxM followed by resting in IL-15 or ALT-803 followed by restimulation with IL-12 + IL-15. Specifically, >83% of CIML NK cells generated by priming with hIL18 / IL12 / TxM were found to express IFN-γ, compared with approximately 74% of NK cells primed with the standard hIL18+IL12+ALT-803 combination and 50-60% of NK cells primed with individual cytokines.CIML NK cells primed with hIL18 / IL12 / TxM also showed greater proliferation than NK cells primed with hIL18+IL12+ALT-803 or individual cytokines, as measured by CellTrace Violet dilution (Figure 15). These results confirm that short-term priming of human NK cells with hIL18 / IL12 / TxM can generate CIML NK cells (i.e., increased proliferation and immune activation (CD25, IFN-γ expression)) that are comparable to or better than priming with hIL18+IL12+IL-15.

[0253] Furthermore, we investigated the effect of the hIL18 / IL12 / TxM fusion protein complex on the cytotoxicity of human NK cells against human tumor cells. Human breast cancer cells (MDA-MB-231) (Celltrace violet-labeled) were incubated with purified human NK cells (NK1 and NK2 cells from two independent donors) (E:T ratio: 1:1) in the presence of hIL18 / IL12 / TxM complex (10 nM) as a control or ALT-803 (10 nM). After 2 days, the cytotoxicity of the killed tumor cells (Violet + PI + The percentage of NK cells was assessed by flow cytometry after staining with propidium iodide (PI). As shown in Figure 16, hIL18 / IL12 / TxM significantly induced more effective human NK cell cytotoxicity against breast cancer cells compared with ALT-803. These results are consistent with the ability of combined treatment with IL-12, IL-18, and IL-15 to enhance antitumor NK cell activity.

[0254] The hIL18 / IL12 / TxM fusion protein complex was also able to enhance granzyme B expression in human NK cells compared with ALT-803 or no treatment (Figure 17A). Furthermore, these hIL18 / IL12 / TxM-activated NK cells were more effective in direct or antibody-mediated cytotoxicity assays against human tumor targets (Figure 17B), including enhanced production of IFNγ (Figure 17C). Thus, overnight incubation with hIL18 / IL12 / TxM can generate a phenotype associated with cytokine-induced memory-like NK cells.

[0255] Example 4: Antitumor activity of immune cells stimulated by hIL18 / IL12 / TxM fusion protein complex The ability of hIL18 / IL12 / TxM fusion protein complexes to induce cytokine-induced memory-like NK cells with in vivo antitumor activity was also evaluated. Splenic NK cells were isolated from mice by standard methods and inoculated with 5x10 cells / mL of 1 μg / mL hIL18 / IL12 / TxM, a combination of recombinant IL-12 (10 ng / mL), IL-18 (50 ng / mL), and ALT-803 (50 ng / mL IL-15 activity), or ALT-803 alone (50 ng / mL IL-15 activity) for 18 hours. 6 Cells are then washed and adoptively transferred iv into C57BL / 6 mice bearing subcutaneous RMA-S lymphoma and receiving 5 Gy of total body irradiation 3 hours prior to cell transfer (1 × 10 6 cells / mouse). Survival of the mice is monitored. Tumor-bearing mice treated with IL-12+IL-18+ALT-803-activated NK cells (CIML NK cells) are expected to survive longer than mice treated with ALT-803-activated NK cells (Ni, J, et al. J. Exp. Med. 2012 209:2351-2365). The long-term survival of tumor-bearing mice receiving hIL18 / IL12 / TxM-activated NK cells would provide evidence that hIL18 / IL12 / TxM can function as an ex vivo agent to enhance the in vivo antitumor activity of immune cells.

[0256] Similarly, purified human NK cells were cultured at 5 × 10 cells for 18 hours with 1 μg / mL of hIL18 / IL12 / TxM, a combination of recombinant IL-12 (10 ng / mL), IL-18 (50 ng / mL) and ALT-803 (50 ng / mL IL-15 activity), or ALT-803 alone (50 ng / mL IL-15 activity). 6 Cells are then washed and adoptively transferred iv into NSG mice carrying K562 leukemia cells (1 × 10) and receiving low-dose rhIL-2 after cell transfer. 6 cells / mouse). Survival of the mice is monitored. Tumor-bearing mice treated with IL-12+IL-18+ALT-803-activated NK cells (CIML NK cells) are expected to survive longer than mice treated with ALT-803-activated NK cells (Romee, R, et al. Sci Transl Med. 2016;8:357ra123). The long-term survival of tumor-bearing mice receiving hIL18 / IL12 / TxM-activated human NK cells would provide evidence that hIL18 / IL12 / TxM can function as an ex vivo agent to enhance the in vivo antitumor activity of immune cells.

[0257] For example, to treat patients with malignant tumors such as relapsed or refractory acute myeloid leukemia (AML) (Romee, R, et al. Sci Transl Med. 2016;8:357ra123), patients are preconditioned with cyclophosphamide and fludarabine, followed by treatment with CIML NK cells purified from allogeneic half-identical NK cells incubated ex vivo with hIL18 / IL12 / TxM or hIL12 / IL18 / TxM for 16-24 hours. After cell transfer, patients can receive low-dose IL-2 to support the cells in vivo. Antitumor responses (objective response, disease-free survival, overall survival, time to relapse, etc.) are evaluated, providing evidence that hIL18 / IL12 / TxM or hIL12 / IL18 / TxM can function as ex vivo agents to enhance the antitumor activity of human immune cells in patients with malignant tumors. Similar studies will be conducted in patients with other hematological or solid tumors or infectious diseases.

[0258] In each of these studies, NK cell survival and functionality can be assessed post-transfer. For example, PBMCs can be isolated from patients 7–14 days after transfer, and the percentage of Ki67-positive (proliferation marker) donor NK cells can be determined by flow cytometry. NK cells can also be restimulated with tumor cells, and the level of IFN-γ production can be assessed by flow cytometry. Results of these studies will indicate whether ex vivo pre-transfer treatment with hIL18 / IL12 / TxM or hIL12 / IL18 / TxM enhances their subsequent immune responses in vivo.

[0259] Example 5: Immunostimulatory effect of hIL18 / IL12 / TxM fusion protein complex after administration to mice As shown above, hIL18 / IL12 / TxM fusion protein complexes were highly effective in stimulating immune cell proliferation and responses in vitro. To evaluate the in vivo activity of these complexes, female C57BL / 6 mice were intraperitoneally injected with 20 mg / kg hIL18 / IL12 / TxM or PBS as a control. Three days later, the mice were sacrificed, and blood and spleen samples were collected to determine changes in immune cell subsets as measured by flow cytometry after staining with antibodies against CD8 T cells (CD8), CD4 T cells (CD4), B cells (CD19), and NK cells (NKp46). As shown in Figure 18A, hIL18 / IL12 / TxM treatment resulted in a 2.5-fold increase in spleen weight compared to PBS control-treated mice. However, no signs of clinical toxicity were observed with 20 mg / kg hIL18 / IL12 / TxM treatment. Administration of hIL18 / IL12 / TxM also resulted in a more than two-fold increase in the percentage of CD8 T cells and a 5.5-fold increase in the percentage of NK cells in the spleens of treated mice compared with PBS controls (Figure 18B). Furthermore, after treatment of mice with hIL18 / IL12 / TxM, compared with PBS, absolute cell counts in the blood increased 6.4-fold for CD8 T cells and 23-fold for NK cells, and blood cell percentages increased 3.9-fold for CD8 T cells and 13-fold for NK cells (Figures 18C and 18D). The results of this study clearly demonstrate that administration of hIL18 / IL12 / TxM provides immunostimulatory effects on immune cells, particularly CD8 T cells and NK cells, without inducing excessive toxicity in mice.

[0260] Other embodiments While the present invention has been described in conjunction with its detailed description, the above description is intended to be illustrative, not limiting, of the scope of the invention, which is defined by the appended claims. Other aspects, advantages, and modifications are within the scope of the following claims.

[0261] The patent and scientific literature referred to herein establishes knowledge that is available to those skilled in the art. All U.S. patents and published or unpublished U.S. patent applications cited herein are incorporated herein by reference. All published foreign patents and foreign patent applications cited herein are incorporated herein by reference. Genbank and NCBI deposits identified by accession numbers cited herein are incorporated herein by reference. All other published literature, documents, manuscripts, and scientific literature cited herein are incorporated herein by reference.

[0262] While the present invention has been particularly shown and described with reference to preferred embodiments thereof, it will be understood by those skilled in the art that various changes in form and details can be made therein without departing from the scope of the invention as encompassed by the appended claims. The present invention includes the following embodiments. [1] 1. An isolated soluble fusion protein complex comprising at least two soluble proteins, the first soluble protein comprises an interleukin-15 (IL-15) polypeptide domain, and the second soluble protein comprises a soluble IL-15 receptor alpha sushi binding domain (IL-15RαSu) fused to an immunoglobulin Fc domain; the first or second soluble protein further comprises an IL-18 binding domain or a functional fragment thereof; the first or second soluble protein further comprises an IL-12 binding domain or a functional fragment thereof; An isolated soluble fusion protein complex, wherein the IL-15 polypeptide domain of the first soluble protein binds to the IL-15RαSu domain of the second soluble protein to form a soluble fusion protein complex. [2] The soluble fusion protein complex according to [1], wherein the IL-15 polypeptide is an IL-15 mutant containing an N72D mutation (IL-15N72D). [3] The soluble fusion protein complex according to [1], wherein the IL-12 binding domain comprises the p40 and p35 subunits of IL-12. [4] The soluble fusion protein complex of [3], wherein the p40 and p35 subunits of IL-12 are linked in a single-chain format by a flexible polypeptide linker. [5] The soluble fusion protein complex according to any one of [2] to [4], wherein the first soluble protein comprises an amino acid sequence set forth in one of SEQ ID NOs: 2 and 6. [6] The soluble fusion protein complex according to any one of [2] to [4], wherein the second soluble protein comprises an amino acid sequence set forth in one of SEQ ID NOs: 4 and 8. [7] A soluble fusion protein complex comprising the first soluble fusion protein complex of [1] covalently bound to the second soluble fusion protein complex of [1]. [8] 8. The soluble fusion protein complex of claim 7, wherein the first soluble fusion protein complex is covalently bound to the second soluble fusion protein complex by a disulfide bond linking the Fc domain of the first soluble fusion protein complex to the Fc domain of the second soluble fusion protein complex. [9] The soluble fusion protein complex described in [1], wherein the first or second soluble protein further comprises a binding domain that binds to a disease antigen and / or an immune checkpoint or signaling molecule.

[10] The soluble fusion protein complex according to [9], wherein the disease antigen is associated with a neoplasm or an infectious disease.

[11] A nucleic acid sequence encoding the first soluble protein according to [5], comprising a sequence defined in one of SEQ ID NOs: 1 and 5.

[12] The nucleic acid sequence according to

[11] , further comprising a promoter, a translation initiation signal and a leader sequence operably linked to the sequence encoding the soluble protein.

[13] A nucleic acid sequence encoding the second soluble protein according to [6], comprising a sequence as set forth in one of SEQ ID NOs: 3 and 7.

[14] The nucleic acid sequence according to

[13] , further comprising a promoter, a translation initiation signal and a leader sequence operably linked to the sequence encoding the soluble protein.

[15] A DNA vector comprising the nucleic acid sequence according to

[11] and / or

[13] .

[16] 1. A method for enhancing immune function, comprising: a) contacting a plurality of cells with the soluble fusion protein complex according to any one of [1] to

[10] , wherein the plurality of cells further comprises immune cells comprising an IL-15R chain that binds to the IL-15 polypeptide domain, an IL-12R chain that binds to the IL-12 domain, and / or an IL-18R chain that binds to the IL-18 domain; b) activating said immune cells via said IL-15R, IL-12R and / or IL-18R signaling; A method comprising:

[17] 1. A method for killing a target cell, comprising: a) contacting a plurality of cells with the soluble fusion protein complex according to any one of [1] to

[10] , wherein the plurality of cells further comprises immune cells comprising an IL-15R chain that binds to the IL-15 polypeptide domain, an IL-12R chain that binds to the IL-12 domain, and / or an IL-18R chain that binds to the IL-18 domain, and target disease cells; b) activating the immune cells via the IL-15R, IL-12R and / or IL-18R signaling; c) killing the target disease cells with the activated immune cells; A method comprising:

[18] The method according to

[17] , wherein the target cells are tumor cells or infected cells.

[19] 1. A method of enhancing an immune response in a subject, comprising: a) contacting a plurality of cells with the soluble fusion protein complex according to any one of [1] to

[10] , wherein the plurality of cells further comprises immune cells comprising an IL-15R chain that binds to the IL-15 polypeptide domain, an IL-12R chain that binds to the IL-12 domain, and / or an IL-18R chain that binds to the IL-18 domain; b) activating the immune cells via the IL-15R, IL-12R and / or IL-18R signaling; c) administering (or adoptively transferring) the activated immune cells to a patient; d) enhancing the immune response in said patient; A method comprising:

[20] 1. A method of preventing or treating a disease in a patient, comprising: a) contacting a plurality of cells with the soluble fusion protein complex according to any one of [1] to

[10] , wherein the plurality of cells further comprises immune cells comprising an IL-15R chain that binds to the IL-15 domain, an IL-12R chain that binds to the IL-12 domain, and / or an IL-18R chain that is recognized by the IL-18 domain; and b) activating the immune cells via signal transduction of the IL-15R, IL-12R, and / or IL-18R. c) administering (or adoptively transferring) an effective amount of said activated immune cells to said patient; and d) damaging or killing diseased cells via said activated immune cells sufficient to prevent or treat said disease in said patient. A method comprising: [twenty one] The method according to

[20] , wherein the disease is a neoplasm or an infectious disease. [twenty two] A method for enhancing an immune response in a subject, the method comprising the step of administering to the subject an effective amount of the soluble fusion protein complex according to any one of [1] to

[10] . [twenty three] A method for treating a neoplasm or an infectious disease in a subject in need thereof, comprising the step of administering to the subject an effective amount of a pharmaceutical composition comprising the soluble fusion protein complex described in any one of [1] to

[10] , thereby treating the neoplasm or infectious disease. [twenty four] The method according to

[21] or

[23] , wherein the neoplasm is selected from the group consisting of glioblastoma, prostate cancer, hematological cancer, B-cell neoplasm, multiple myeloma, B-cell lymphoma, B-cell non-Hodgkin's lymphoma, Hodgkin's lymphoma, chronic lymphocytic leukemia, acute myeloid leukemia, cutaneous T-cell lymphoma, T-cell lymphoma, solid tumor, urothelial / bladder cancer, melanoma, lung cancer, renal cell carcinoma, breast cancer, gastroesophageal cancer, prostate cancer, pancreatic cancer, colorectal cancer, ovarian cancer, non-small cell lung cancer, and squamous cell head and neck cancer. [twenty five] The method according to any one of

[16] to

[21] , wherein the immune cells are NK cells or cytokine-induced memory-like (CIML) NK cells.

[26] The effective amount of the activated immune cells is 1×10 4 cells / kg~1×10 10 The method according to

[20] , in which the cell density is 1000 cells / kg.

[27] The method according to

[20] , wherein the immune cells are administered at least once a week.

[28] The method according to

[22] or

[23] , wherein the effective amount is about 1 to 100 μg / kg of the fusion protein complex.

[29] The method according to

[22] or

[23] , wherein the fusion protein complex is administered at least once a week.

[30] The method according to any one of

[16] to

[29] , wherein the fusion protein complex increases immune cell proliferation, activation markers, cytotoxicity against target cells, and / or production of pro-inflammatory cytokines, including IFN-γ.

[31] An isolated soluble fusion protein complex comprising a first and a second soluble protein, wherein the first soluble protein comprises an interleukin-15 (IL-15) polypeptide domain linked to an IL-12 or IL-18 binding domain or a functional fragment thereof; the second soluble protein comprises a soluble IL-15 receptor alpha sushi binding domain (IL-15RαSu) fused to an immunoglobulin Fc domain, the IL-15RαSu domain being linked to an IL-12 or IL-18 binding domain or a functional fragment thereof; and An isolated soluble fusion protein complex, wherein the IL-15 polypeptide domain of the first soluble protein binds to the IL-15RαSu domain of the second soluble protein to form a soluble fusion protein complex.

[32] An isolated soluble fusion protein complex comprising an interleukin-15 (IL-15) polypeptide domain linked to an IL-12 and / or IL-18 binding domain or functional fragment thereof.

[33] The isolated soluble fusion protein complex according to

[32] , wherein the IL-15 polypeptide domain is an IL-15 variant containing an N72D mutation (IL-15N72D).

[34] An isolated soluble fusion protein complex comprising a soluble IL-15 receptor alpha sushi binding domain (IL-15RαSu) fused to an immunoglobulin Fc domain, wherein the IL-15RαSu domain is linked to an IL-12 and / or IL-18 binding domain or a functional fragment thereof.

[35] An isolated soluble fusion protein complex comprising a first and a second soluble protein, wherein the first soluble protein comprises an interleukin-15 receptor alpha sushi binding domain (IL-15RαSu) fused to an immunoglobulin Fc domain, and the IL-15RαSu domain is fused to an IL-18 binding domain or a functional fragment thereof; the second soluble protein comprises an interleukin-15 (IL-15) polypeptide domain fused to an IL-18 domain; An isolated soluble fusion protein complex, wherein the IL-15 polypeptide domain of the first soluble protein binds to the IL-15RαSu domain of the second soluble protein to form a soluble fusion protein complex.

[36] An isolated soluble fusion protein complex comprising a first and a second soluble protein, the first soluble protein comprises an interleukin-15 receptor alpha sushi binding domain (IL-15RαSu) fused to an immunoglobulin Fc domain, the IL-15RαSu domain being fused to an IL-12 binding domain or a functional fragment thereof; the second soluble protein comprises an interleukin-15 (IL-15) polypeptide domain fused to an IL-12 domain; An isolated soluble fusion protein complex, wherein the IL-15 polypeptide domain of the first soluble protein binds to the IL-15RαSu domain of the second soluble protein to form a soluble fusion protein complex.

[37] The isolated soluble fusion protein complex according to

[35] or

[36] , wherein the IL-15 polypeptide domain is an IL-15 variant comprising an N72D mutation (IL-15N72D).

[38] 1. An isolated soluble fusion protein complex comprising an interleukin-15 polypeptide domain, a first and a second soluble protein, the first soluble protein comprises an interleukin-15 receptor alpha sushi binding domain (IL-15RαSu) fused to an immunoglobulin Fc domain, the IL-15RαSu domain being linked to an IL-12 and / or IL-18 binding domain or a functional fragment thereof; the second soluble protein comprises an interleukin-15 receptor alpha sushi binding domain (IL-15RαSu) fused to an immunoglobulin Fc domain, said IL-15RαSu domain being linked to an IL-12 and / or IL-18 binding domain or a functional fragment thereof; An isolated soluble fusion protein, wherein the IL-15 polypeptide domain binds to the IL-15RαSu domain of the first and / or second soluble protein to form a soluble fusion protein complex.

[39] 1. An isolated soluble fusion protein comprising an interleukin-15 receptor alpha sushi binding domain (IL-15RαSu) fused to an immunoglobulin Fc domain, a first soluble protein, and a second soluble protein, the first soluble protein comprises an interleukin-15 polypeptide domain linked to an IL-12 and / or IL-18 binding domain or a functional fragment thereof, and the second soluble protein comprises an interleukin-15 polypeptide domain linked to an IL-12 and / or IL-18 binding domain or a functional fragment thereof; An isolated soluble fusion protein, wherein the IL-15 polypeptide domain of the first and / or second soluble protein binds to the IL-15RαSu domain to form a soluble fusion protein complex.

[40] The isolated soluble fusion protein complex according to

[38] or

[39] , wherein the IL-15 polypeptide domain is an IL-15 variant comprising an N72D mutation (IL-15N72D).

Claims

1. A method for activating immune cells in vitro, said method comprising the step of exposing isolated immune cells to an isolated soluble fusion protein complex comprising at least two soluble proteins, thereby activating said immune cells, wherein: 1) a first soluble protein comprises an IL-15 domain fused to the C-terminus of an IL-12 domain and a second soluble protein comprises an IL-18 domain fused to the N-terminus of an IL-15RαSu / Fc domain, wherein said IL-15RαSu / Fc domain comprises an IL-15Rαsu domain fused to the N-terminus of an immunoglobulin Fc domain; or 2) the first soluble protein comprises an IL-15 domain fused to the C-terminus of an IL-18 domain, and the second soluble protein comprises an IL-12 domain fused to the N-terminus of an IL-15RαSu / Fc domain; the IL-15 domain of the first soluble protein binds to the IL-15RαSu / Fc domain of the second soluble protein to form a soluble fusion protein complex; method.

2. 2. The method of claim 1, wherein the first soluble protein comprises an IL-12 domain fused to the N-terminus of the IL-15 domain and the second soluble protein comprises an IL-18 domain fused to the N-terminus of the IL-15RαSu / Fc domain.

3. 2. The method of claim 1, wherein the first soluble protein comprises the amino acid sequence set forth in SEQ ID NO:8 and the second soluble protein comprises the amino acid sequence set forth in SEQ ID NO:

6.

4. 2. The method of claim 1, wherein the first soluble protein comprises an IL-18 domain fused to the N-terminus of the IL-15 domain, and the second soluble protein comprises an IL-12 domain fused to the N-terminus of the IL-15RαSu / Fc domain.

5. 2. The method of claim 1, wherein the first soluble protein comprises the amino acid sequence set forth in SEQ ID NO:4 and the second soluble protein comprises the amino acid sequence set forth in SEQ ID NO:

2.

6. 2. The method of claim 1, wherein the immune cells are natural killer (NK) cells and the NK cells are activated.

7. 7. The method of claim 6, wherein the activated NK cells have increased expression of one or more activation markers, wherein the activation markers include CD25 and / or C69.

8. The method of claim 6, wherein the activated NK cells have increased cytotoxicity against cancerous cells or virus-infected cells.

9. 7. The method of claim 6, wherein the activated NK cells have increased production of interferon gamma (IFNγ).

10. The method of claim 6, wherein the activated NK cells have increased production of granzyme B.

11. The method of claim 6, wherein the activated NK cells are activated primary NK cells.

12. 12. The method of claim 11, wherein the primary NK cells are comprised of cytokine-induced memory-like (CIML) NK cells.

13. The method of claim 6 , wherein the activated NK cells comprise an NK cell line.

14. The method of claim 13, wherein the NK cell line is the NK-92 cell line.

15. 2. The isolated soluble fusion protein complex of claim 1, wherein a first soluble fusion protein complex is covalently bound to a second soluble fusion protein complex by a disulfide bond linking the Fc domain of the first soluble fusion protein complex to the Fc domain of the second soluble fusion protein complex.

Images