Antisense nucleic acids inducing exon skipping of the angiotensin-converting enzyme 2 gene.

Abstract

Provided is an antisense nucleic acid that induces exon skipping of angiotensin converting enzyme 2 (ACE2) gene. An antisense oligonucleotide consisting of 15-30 bases, said antisense oligonucleotide having a base sequence complementary to the target site of exon 18 of ACE2 gene and being capable of inducing exon skipping of ACE2 gene, a salt of the antisense oligonucleotide or a solvate of the same. A pharmaceutical and an agent for inhibiting expression of ACE2 protein and / or for promoting expression of soluble ACE2, each comprising the aforesaid antisense oligonucleotide, a salt thereof or a solvate of the same.

Description

[Technical Field]

[0001] The present invention relates to antisense nucleic acids that induce exon skipping in the angiotensin-converting enzyme 2 gene. [Background technology]

[0002] Angiotensin converting enzyme 2 (ACE2) is a type I transmembrane protein of approximately 92 kDa consisting of 805 amino acids, and is encoded by the 107 kb ACE2 gene located on the X chromosome, Xp22. The cDNA is approximately 3 kb in size and consists of 19 exons (NM_021804.3). ACE2 hydrolyzes the C'-terminal amino acid of peptides and converts angiotensin II to angiotensin (1-7) (Ang(1-7)) as a carboxypeptidase. Meanwhile, during the severe acute respiratory syndrome (SARS) epidemic of 2002-2003, it was revealed that ACE2 was a receptor for the coronavirus SARS-CoV when it entered the body, and it attracted attention as a key molecule in the establishment of viral infection. It was also revealed that the SARS-CoV-2 virus, which is currently spreading worldwide as COVID-19, also uses ACE2 as a receptor (Non-Patent Document 1). ACE2 is a transmembrane protein consisting of three domains: extracellular, transmembrane, and intracellular. The extracellular domain contains a virus-binding domain. This virus-binding domain binds with high affinity to the SARS-CoV-2 virus and functions as a viral receptor. ACE2 has therefore become one of the therapeutic targets for SARS-CoV-2, and methods to block ACE2 expression or to use soluble ACE2, consisting only of the extracellular domain, as a decoy receptor are being actively researched (Non-Patent Document 2). Splicing is a reaction in which introns are excised from pre-mRNA transcribed from a gene to produce mature mRNA composed only of exons. Splicing sites are determined by GT-AG sequences present at both ends of the intron, known as splicing consensus sequences. In addition, splicing promoter sequences act as cis-factors to ensure accurate splicing. Antisense oligonucleotides (ASOs) against these splicing promoter sequences inhibit the splicing promoter function, resulting in exon skipping. Active efforts are being made to develop ASOs that induce exon skipping in order to treat genetic diseases (Non-Patent Document 3). [Prior art documents] [Non-patent literature]

[0003] [Non-Patent Document 1] Hoffmann M, Kleine Weber H, Schroeder S, Kruger N, Herrler T, Erichsen S, et al. Hoffmann M, Kleine Weber H, Schroeder S, Kruger N, Herrler T, Erichsen S, et al. SARS-CoV-2 Cell Entry Depends on ACE2 and TMPRSS2 and Is Blocked by a Clinically Proven Protease Inhibitor. Cell. 2020;181(2):271-80.e8. [Non-patent document 2] Hodgson J. The pandemic pipeline. Nat Biotechnol. 2020;38(5):523-32. [Non-patent document 3] Masafumi Matsuo. Prospects for exon skipping therapy using antisense nucleic acids. Journal of the Japanese Society for Nucleic Acid Medicine 5, 4-13 (2020) Summary of the Invention [Problem to be solved by the invention]

[0004] In this study, we conceived the idea of applying this exon skipping to the ACE2 gene. The ACE2 gene consists of 19 exons, with exon 18 encoding the transmembrane domain. Skipping exon 18 results in the loss of 195 bases from the mRNA, shortening the ACE2 protein by 65 amino acids. This protein is a novel soluble form of ACE2 lacking the transmembrane domain and is expected to serve as a decoy receptor for the virus. Therefore, skipping exon 18 reduces the number of SARS-CoV-2 receptors and increases the number of decoy receptors, and is highly anticipated as a powerful and groundbreaking treatment for preventing viral infection. After initiating this antisense nucleic acid development research, Rehman et al. demonstrated exon skipping of the ACE2 gene using ASOs in in silico studies (Rehman S, and Tabish M. Alternative splicing of ACE2 possibly generates variants that may limit the entry of SARS-CoV-2: a potential therapeutic approach using SSOs. Clin Sci (Lond). 2020;134(10):1143-5). The present invention aims to provide an antisense nucleic acid (ASO) that induces exon skipping of the ACE2 gene in order to suppress the expression of ACE2 protein and promote the expression of soluble ACE2. [Means for solving the problem]

[0005] The present inventors have identified an antisense nucleic acid (ASO) that induces skipping of exon 18 of the ACE2 gene.

[0006] The gist of the present invention is as follows. (1) An antisense oligonucleotide having 15 to 30 bases and having a base sequence complementary to a target site in exon 18 of the angiotensin-converting enzyme 2 gene, which can induce exon skipping in the angiotensin-converting enzyme 2 gene, or a salt or solvate thereof. (2) The antisense oligonucleotide, its salt, or solvate according to (1), wherein the base sequence of exon 18 of the angiotensin-converting enzyme 2 gene is the base sequence of SEQ ID NO: 1, and the target site of exon 18 of the angiotensin-converting enzyme 2 gene is located within the region of base numbers 1 to 195 of the base sequence of SEQ ID NO: 1. (3) The antisense oligonucleotide, its salt, or solvate according to (1) or (2), wherein the base sequence of the antisense oligonucleotide comprises a sequence consisting of at least 15 consecutive bases in any of the base sequences of SEQ ID NOs: 2 to 17 (wherein t may be u, and u may be t). (4) The antisense oligonucleotide, its salt, or solvate according to any one of (1) to (3), wherein the antisense oligonucleotide has a base length of 18. (5) The antisense oligonucleotide, its salt or solvate according to (4), wherein the base sequence of the antisense oligonucleotide is any of the base sequences of SEQ ID NOs: 2 to 17 (wherein t may be u, and u may be t). (6) The antisense oligonucleotide, salt or solvate thereof according to any one of (1) to (5), wherein at least one nucleotide is modified. (7) The antisense oligonucleotide, salt or solvate thereof according to (6), wherein the sugar constituting the modified nucleotide is D-ribofuranose and the hydroxyl group at the 2'-position of D-ribofuranose is modified. (8) The antisense oligonucleotide, salt or solvate thereof according to (7), wherein the D-ribofuranose is 2'-O-alkylated and / or 2'-O,4'-C-alkylenated. (9) A medicine comprising the antisense oligonucleotide according to any one of (1) to (8), or a pharmaceutically acceptable salt or solvate thereof. (10) The pharmaceutical composition according to (9) for suppressing the infectivity of SARS-CoV-2 virus. (11) The pharmaceutical according to (10), which has the effect of inhibiting viral uptake into cells by reducing receptor-type angiotensin converting enzyme 2 and / or capturing viruses outside cells by increasing soluble angiotensin converting enzyme 2 that can bind to viruses. (12) The pharmaceutical composition according to any one of (8) to (11) for preventing and / or treating SARS-CoV-2 infection. (13) A drug for inhibiting the expression of angiotensin-converting enzyme 2 protein and / or promoting the expression of soluble angiotensin-converting enzyme 2, comprising the antisense oligonucleotide, its salt, or solvate according to any one of (1) to (8). (14) A soluble angiotensin-converting enzyme 2 lacking a transmembrane domain, which is produced by exon skipping of the angiotensin-converting enzyme 2 gene, induced by the antisense oligonucleotide, its salt, or solvate according to any one of (1) to (8). (15) A polynucleotide comprising a nucleotide sequence encoding the soluble angiotensin-converting enzyme 2 according to (14) and / or a sequence complementary thereto. (16) A method for suppressing the infectivity of SARS-CoV-2 virus, comprising administering to a subject an effective amount of the antisense oligonucleotide according to any one of (1) to (8), or a pharmaceutically acceptable salt or solvate thereof. (17) A method for preventing and / or treating SARS-CoV-2 infection, comprising administering to a subject an effective amount of the antisense oligonucleotide according to any one of (1) to (8), or a pharmaceutically acceptable salt or solvate thereof. (18) A method for inhibiting the expression of angiotensin-converting enzyme 2 protein and / or promoting the expression of soluble angiotensin-converting enzyme 2, comprising administering to a subject an effective amount of the antisense oligonucleotide described in any one of (1) to (8), or a pharmaceutically acceptable salt or solvate thereof. (19) The antisense oligonucleotide according to any one of (1) to (8), or a pharmaceutically acceptable salt or solvate thereof, for use in a method for suppressing the infectivity of the SARS-CoV-2 virus. (20) The antisense oligonucleotide according to any one of (1) to (8), its pharmaceutically acceptable salt, or solvate for use in a method for preventing and / or treating SARS-CoV-2 infection. (21) An antisense oligonucleotide according to any one of (1) to (8), or a pharmaceutically acceptable salt or solvate thereof, for use in a method for inhibiting the expression of angiotensin-converting enzyme 2 protein and / or promoting the expression of soluble angiotensin-converting enzyme 2. (22) Use of the antisense oligonucleotide according to any one of (1) to (8), its pharmaceutically acceptable salt or solvate in the manufacture of a medicament for suppressing the infectivity of the SARS-CoV-2 virus. (23) Use of the antisense oligonucleotide according to any one of (1) to (8), its pharmaceutically acceptable salt or solvate in the manufacture of a medicament for preventing and / or treating SARS-CoV-2 infection. (24) Use of an antisense oligonucleotide, a pharmaceutically acceptable salt or solvate thereof according to any one of (1) to (8) in the manufacture of a drug for inhibiting the expression of angiotensin-converting enzyme 2 protein and / or promoting the expression of soluble angiotensin-converting enzyme 2. [Effects of the Invention]

[0007] Skipping exon 18 of the ACE2 gene produces mRNA that is 195 bases shorter than the mRNA encoded by exon 18. This results in an ACE2 protein that is 65 amino acids shorter. Furthermore, these 65 amino acids contain the entire amino acid sequence that constitutes the transmembrane domain, producing a soluble ACE2 that lacks the transmembrane domain. This results in the suppression of receptor expression for SARS-CoV-2 infection, the expression of decoy receptors, and the expression of peptidases. This is expected to provide a significant preventive effect against SARS-CoV-2 infection. This specification includes the contents disclosed in the specification and / or drawings of Japanese Patent Application No. 2020-127142, which is a priority document of this application. [Brief explanation of the drawings]

[0008] [Figure 1] ACE2 pre-mRNA and ASO target site. ACE2 pre-mRNA, which is produced by transcription from the ACE2 gene, consists of 19 exons. To skip exon 18, we created ASO1, 2, and 3, which are complementary to the sequence within exon 18 of ACE2. [Figure 2] Comparison of ASO efficacy. ASO1, 2, and 3 were each introduced into human hepatoma cells (HepG2), and the results of RT-PCR for ACE2 mRNA are shown. a) RT-PCR results for ACE2 mRNA and GAPDH mRNA in human hepatoma cells (HepG2) are shown. w / o indicates no ASO treatment. White arrowheads indicate ACE2, and black arrowheads indicate ACE2 with exon 18 skipping. b) ACE2 exon 18 skipping mRNA / total ACE2 mRNA was calculated from the RT-PCR results. Results of three independent experiments are pooled. *P<0.05. [Figure 3] ACE2 pre-mRNA and ASO target sites. Furthermore, to explore ASOs effective in exon 18 skipping, we constructed ASOs 4, 5, 6, 7, and 8, which are complementary to sequences within exon 18 of ACE2. [Figure 4] Comparison of ASO efficacy. ASOs 4, 5, 6, 7, and 8 were introduced into human hepatoma cells (HepG2), and the results of RT-PCR for ACE2 mRNA are shown. a) RT-PCR results for ACE2 mRNA and GAPDH mRNA in human hepatoma cells (HepG2) are shown. w / o indicates no ASO treatment. White arrowheads indicate ACE2, and black arrowheads indicate ACE2 with exon 18 skipping. b) RT-PCR results show ACE2 exon 18 skipped mRNA / total ACE2 mRNA. Results of three independent experiments are pooled. **P<0.01. ***P<0.001 [Figure 5]ACE2 pre-mRNA and ASO target site. Furthermore, to search for ASOs that are effective in skipping exon 18, we constructed ASO9, In16Ex17, and Ex17In17, which are complementary to ACE2 exon 18 and the intron sequences on both sides. [Figure 6] Comparison of ASO efficacy. ASO9, In16Ex17, and Ex17In17 were each transfected into human hepatoma cells (HepG2), and the results of RT-PCR of ACE2 mRNA are shown. a) RT-PCR results of ACE2 mRNA and GAPDH mRNA in human hepatoma cells (HepG2) are shown. w / o indicates no ASO treatment. White arrowheads indicate ACE2, and black arrowheads indicate ACE2 with exon 18 skipping. b) ACE2 exon 18 skipped mRNA / total ACE2 mRNA. Results of three independent experiments are summarized. [Figure 7] ACE2 pre-mRNA and ASO target sites. Furthermore, to explore ASOs effective in exon 18 skipping, we constructed ASOs 4+5, 4-13, 5-5, 6+7, and 6-11, which are complementary to the sequences of ACE2 exon 18 and intron 17. [Figure 8] Comparison of ASO efficacy. ASO4+5, 4-13, 5-5, 6+7, and 6-11 were each introduced into human hepatoma cells (HepG2), and the results of RT-PCR for ACE2 mRNA are shown. a) RT-PCR results for ACE2 mRNA and GAPDH mRNA in human hepatoma cells (HepG2) are shown. w / o indicates no ASO treatment. White arrowheads indicate ACE2, and black arrowheads indicate ACE2 with exon 18 skipping. b) ACE2 exon 18 skipped mRNA / total ACE2 mRNA. Results of three independent experiments are summarized. *P<0.05, ***P<0.001 [Figure 9] ACE2 pre-mRNA and ASO target site. Based on the results of the four ASO efficacy studies, five types with high exon skipping efficacy for exon 18 were selected and the effects of these ASOs were compared. [Figure 10]Comparison of ASO efficacy. Five types of ASO were each introduced into human hepatoma cells (HepG2), and the results of RT-PCR of ACE2 mRNA are shown. a) Results of RT-PCR of ACE2 mRNA and GAPDH mRNA in human hepatoma cells (HepG2). w / o indicates no ASO treatment. White arrowheads indicate ACE2, and black arrowheads indicate ACE2 with exon 18 skipping. b) ACE2 exon 18 skipped mRNA / total ACE2 mRNA. Results of three independent experiments are summarized. *P<0.05, ***P<0.001 [Figure 11] ACE2 pre-mRNA and ASO target site. Furthermore, to explore ASOs that are effective in exon 18 skipping, we created ASOs 5+5, 5+6, 5+7, 5+8, 5+10, and 5+12 that are complementary to sequences within exon 18 of ACE2. [Figure 12] Comparison of ASO efficacy. ASOs 5+5, 5+6, 5+7, 5+8, 5+10, and 5+12 were introduced into human hepatoma cells (HepG2), and the results of RT-PCR for ACE2 mRNA are shown. a) RT-PCR results for ACE2 mRNA and GAPDH mRNA in human hepatoma cells (HepG2) are shown. w / o indicates no ASO treatment. White arrowheads indicate ACE2, and black arrowheads indicate ACE2 with exon 18 skipping. b) ACE2 exon 18 skipped mRNA / total ACE2 mRNA. Results of three independent experiments are summarized. ***P<0.001 [Figure 13] ACE2 pre-mRNA and ASO target site. To identify the most effective ASO for exon 18 skipping, we created ASO5+7 and 5c, which are complementary to sequences within ACE2 exon 18. The target sequence of ASO5c is the same as ASO5, but the positions of ENA and 2'OMe in the ASO differ from ASO5. [Figure 14]Comparison of ASO efficacy. ASO5+7 and 5c were each introduced into human hepatoma cells (HepG2), and the results of RT-PCR of ACE2 mRNA are shown. a) RT-PCR results of ACE2 mRNA and GAPDH mRNA in human hepatoma cells (HepG2) are shown. w / o indicates no ASO treatment. White arrowheads indicate ACE2, and black arrowheads indicate ACE2 with exon 18 skipping. b) ACE2 exon 18 skipped mRNA / total ACE2 mRNA. Results of two independent experiments are summarized. ASO5+7 was shown to be the most effective in skipping ACE2 exon 18 in HepG2 cells. DETAILED DESCRIPTION OF THE INVENTION

[0009] Hereinafter, embodiments of the present invention will be described in more detail.

[0010] The present invention provides an antisense oligonucleotide having 15 to 30 bases and having a base sequence complementary to a target site in exon 18 of the angiotensin-converting enzyme 2 gene, which is capable of inducing exon skipping of the angiotensin-converting enzyme 2 gene, as well as a salt or solvate thereof.

[0011] The nucleotide sequence of exon 18 of the human angiotensin-converting enzyme 2 gene is shown in SEQ ID NO: 1. In the present invention, when the nucleotide sequence of exon 18 of the angiotensin-converting enzyme 2 gene is the nucleotide sequence of SEQ ID NO: 1, the target site of exon 18 of the angiotensin-converting enzyme 2 gene may be located within the region of nucleotides 1 to 195 of the nucleotide sequence of SEQ ID NO: 1.

[0012] Furthermore, in the present invention, the base sequence of the antisense oligonucleotide preferably comprises a sequence consisting of at least 15 consecutive bases from any of the base sequences of SEQ ID NOs: 2 to 17 (however, t in the sequence may be u, and u may be t).

[0013] The antisense oligonucleotide may have a base length of 18, and the base sequence of the antisense oligonucleotide may be any of the base sequences of SEQ ID NOs: 2 to 17 (however, t in the sequence may be u, and u may be t).

[0014] The nucleotides constituting the antisense oligonucleotide may be natural DNA, natural RNA, or modified versions thereof, but it is preferable that at least one of them is a modified nucleotide.

[0015] Examples of modified nucleotides include those in which the sugar is modified (for example, those in which the hydroxyl group at the 2' position of D-ribofuranose is modified, such as those in which D-ribofuranose is 2'-O-alkylated or D-ribofuranose is 2'-O,4'-C-alkylenated), those in which the phosphodiester bond is modified (for example, thioated), those in which the base is modified, and combinations thereof. At least one D-ribofuranose constituting the antisense oligonucleotide is 2'-O-alkylated or 2'-O,4'-C-alkylenated. 4'-C-Alkylenated oligonucleotides have high binding strength to RNA and high resistance to nucleases, and are therefore expected to have a higher therapeutic effect than natural nucleotides (i.e., oligo-DNA, oligo-RNA). Furthermore, oligonucleotides in which at least one phosphodiester bond is thioated are also highly resistant to nucleases, and are therefore expected to have a higher therapeutic effect than natural nucleotides (i.e., oligo-DNA, oligo-RNA). Oligonucleotides containing both the modified sugar and modified phosphate as described above are more resistant to nucleases, and are therefore expected to have an even higher therapeutic effect.

[0016] For antisense oligonucleotides, examples of sugar modifications include 2'-O-alkylation of D-ribofuranose (e.g., 2'-O-methylation, 2'-O-aminoethylation, 2'-O-propylation, 2'-O-allylation, 2'-O-methoxyethylation, 2'-O-butylation, 2'-O-pentylation, 2'-O-propargylation, etc.), 2'-O,4'-C-alkylenation of D-ribofuranose (e.g., Examples include 2'-O,4'-C-ethylenated, 2'-O,4'-C-methylenated, 2'-O,4'-C-propylenated, 2'-O,4'-C-tetramethylenated, 2'-O,4'-C-pentamethyleneated, etc.), 3'-deoxy-3'-amino-2'-deoxy-D-ribofuranose, 3'-deoxy-3'-amino-2'-deoxy-2'-fluoro-D-ribofuranose, etc.

[0017] For antisense oligonucleotides, examples of modifications of phosphodiester bonds include phosphorothioate bonds, methylphosphonate bonds, methylthiophosphonate bonds, phosphorodithioate bonds, phosphoramidate bonds, and the like.

[0018] For antisense oligonucleotides, examples of base modifications include 5-methylation, 5-fluoronation, 5-bromination, 5-iodination, and N4-methylation of cytosine; 5-demethylation (uracil), 5-fluoronation, 5-bromination, and 5-iodination of thymidine; N6-methylation and 8-bromination of adenine; N2-methylation and 8-bromination of guanine; pseudouridylation of uridine; and 1-methylpseudourylation.

[0019] The antisense oligonucleotide of the present invention can be in the form of salt.When the antisense oligonucleotide of the present invention is used in medicine, the salt can be pharmaceutically acceptable salt, and such salt can be metal salt such as sodium salt, potassium salt, lithium salt, alkaline earth metal salt such as calcium salt, magnesium salt, aluminum salt, iron salt, zinc salt, copper salt, nickel salt, cobalt salt; inorganic salt such as ammonium salt, t-octylamine salt, dibenzylamine salt, morpholine salt, glucosamine salt, phenylglycine alkyl ester salt, ethylenediamine salt, N-methylglucamine salt, guanidine salt, diethylamine salt, triethylamine salt, dicyclohexylamine salt, N,N'-dibenzylethylenediamine salt, chloroprocaine salt, procaine salt, diethanolamine salt, N-benzylamine salt, Examples of suitable salts include amine salts, such as organic salts like 1-phenethylamine salt, piperazine salt, tetramethylammonium salt, and tris(hydroxymethyl)aminomethane salt; inorganic salts like hydrohalogen salts like hydrofluoride, hydrochloride, hydrobromide, and hydroiodide; nitrate, perchlorate, sulfate, and phosphate; lower alkane sulfonates like methanesulfonate, trifluoromethanesulfonate, and ethanesulfonate; aryl sulfonates like benzenesulfonate and p-toluenesulfonate; organic salts like acetate, malate, fumarate, succinate, citrate, tartrate, oxalate, and maleate; and amino acid salts like glycine salt, lysine salt, arginine salt, ornithine salt, glutamate, and aspartate. These salts can be prepared by known methods.

[0020] Furthermore, the antisense oligonucleotide may exist as a solvate (for example, a hydrate), and may be such a solvate.

[0021] Furthermore, antisense oligonucleotides may be administered in the form of prodrugs, and examples of the prodrugs include amides, esters, carbamates, carbonates, ureides, phosphates, etc. These prodrugs can be produced by known methods.

[0022] The method for synthesizing antisense oligonucleotides is not particularly limited, and conventionally known methods can be used. Examples of the synthesis method include synthesis by genetic engineering techniques and chemical synthesis. Examples of genetic engineering techniques include in vitro transcription synthesis, methods using vectors, and methods using PCR cassettes. Examples of the vector include non-viral vectors such as plasmids and viral vectors. Examples of the chemical synthesis method include the phosphoramidite method and the H-phosphonate method. For example, a commercially available automated nucleic acid synthesizer can be used for the chemical synthesis method. Amidites are generally used in the chemical synthesis method. The amidites are not particularly limited, and in the examples described below, antisense oligonucleotides were synthesized by the phosphoramidite method using ENA-2CE phosphoramidite and 2'OMe-2CE phosphoramidite.

[0023] Commercially available phosphoramidite reagents can be used for natural nucleosides and 2'-O-methylnucleosides (i.e., 2'-O-methylguanosine, 2'-O-methyladenosine, 2'-O-methylcytosine, and 2'-O-methyluridine). The following are the phosphoramidite reagents for 2'-O-alkylguanosine, adenosine, cytosine, and uridine, each of which has an alkyl group with 2 to 6 carbon atoms.

[0024] 2'-O-aminoethylguanosine, adenosine, cytosine, and uridine can be synthesized according to the literature (Blommers et al., Biochemistry (1998), 37, 17714-17725).

[0025] 2'-O-propylguanosine, adenosine, cytosine, and uridine can be synthesized according to the literature (Lesnik, EA et al., Biochemistry (1993), 32, 7832-7838).

[0026] Commercially available reagents can be used for 2'-O-allylguanosine, adenosine, cytosine, and uridine.

[0027] 2'-O-Methoxyethylguanosine, adenosine, cytosine, and uridine can be synthesized according to the patent (US6261840) or the literature (Martin, P. Helv. Chim. Acta. (1995) 78, 486-504).

[0028] 2'-O-butylguanosine, adenosine, cytosine, and uridine can be synthesized according to the literature (Lesnik, EA et al., Biochemistry (1993), 32, 7832-7838).

[0029] 2'-O-pentylguanosine, adenosine, cytosine, and uridine can be synthesized according to the literature (Lesnik, EA et al., Biochemistry (1993), 32, 7832-7838).

[0030] Commercially available reagents can be used for 2'-O-propargylguanosine, adenosine, cytosine, and uridine.

[0031] 2'-O,4'-C-methyleneguanosine, adenosine, 5-methylcytosine, and thymidine can be produced according to the method described in WO99 / 14226, and 2'-O,4'-C-alkyleneguanosine, adenosine, 5-methylcytosine, and thymidine having an alkylene group with 2 to 5 carbon atoms can be produced according to the method described in WO00 / 47599.

[0032] After coupling with a phosphoramidite reagent, antisense oligonucleotides having phosphorothioate bonds can be synthesized by reacting with a reagent such as sulfur, tetraethylthiuram disulfide (TETD, Applied Biosystems), Beaucage reagent (Glen Research), or xanthan hydride (Tetrahedron Letters, 32, 3005 (1991), J. Am. Chem. Soc. 112, 1253 (1990), PCT / WO98 / 54198).

[0033] The controlled pore glass (CPG) used in the synthesizer can be commercially available, with 2'-O-methylnucleosides attached. For 2'-O,4'-C-methyleneguanosine, adenosine, 5-methylcytosine, and thymidine, nucleosides with alkylene groups of 2 to 5 carbon atoms can be attached to CPG according to the method described in WO 99 / 14226. For 2'-O,4'-C-alkyleneguanosine, adenosine, 5-methylcytosine, and thymidine, nucleosides prepared according to the method described in WO 00 / 47599 can be attached to CPG according to the literature (Oligonucleotide Synthesis, Edited by MJ Gait, Oxford University Press, 1984). Using modified CPG (described in Example 12b of JP-A-7-87982), oligonucleotides with a 2-hydroxyethyl phosphate group attached to the 3' end can be synthesized. In addition, 3'-amino-Modifier C3 CPG, 3'-amino-Modifier C7 CPG, Glyceryl CPG (Glen Research), 3'-specer C3 SynBase CPG 1000, and 3'-specer C9 SynBase CPG 1000 (link technologies) can be used to synthesize oligonucleotides with a hydroxyalkyl phosphate group or an aminoalkyl phosphate group attached to the 3' end.

[0034] The antisense oligonucleotides of the present invention can be used in pharmaceuticals. When used as pharmaceuticals, the antisense oligonucleotides may be in the form of pharmaceutically acceptable salts, solvates, or prodrugs thereof. Therefore, the present invention provides pharmaceuticals comprising an antisense oligonucleotide having 15 to 30 bases and a base sequence complementary to a target site in exon 18 of the angiotensin-converting enzyme 2 gene, capable of inducing exon skipping in the angiotensin-converting enzyme 2 gene, or a pharmaceutically acceptable salt or solvate thereof. The pharmaceuticals may be used to suppress the infectivity of the SARS-CoV-2 virus, but are not limited thereto. The pharmaceuticals of the present invention may have the effect of inhibiting viral uptake into cells by reducing receptor-type angiotensin-converting enzyme 2 and / or capturing the virus extracellularly by increasing soluble angiotensin-converting enzyme 2 that can bind to the virus. The pharmaceuticals of the present invention may be used to prevent and / or treat SARS-CoV-2 infection. The present invention also provides a method for suppressing SARS-CoV-2 virus infectivity, comprising administering to a subject an effective amount of the above-described antisense oligonucleotide, a pharmaceutically acceptable salt, or a solvate thereof. The present invention also provides a method for preventing and / or treating SARS-CoV-2 infection, comprising administering to a subject an effective amount of the above-described antisense oligonucleotide, a pharmaceutically acceptable salt, or a solvate thereof. The subject may be a human or an animal. Examples of animals include mammals such as dogs, cats, mink, tigers, lions, mice, rats, rabbits, sheep, pigs, cows, and horses. As used herein, "prevention of infection" includes prevention of viral infection, prevention of the onset of undesirable symptoms due to viral infection (viral infection), and prevention of viral infection from becoming severe, and "prevention" also includes reducing the rate of viral infection, reducing the rate of onset of undesirable symptoms due to viral infection, reducing the rate of viral infection becoming severe, and reducing the degree of severity of viral infection. In addition, in this specification, "treatment of infection" includes curing a viral infection, alleviating undesirable symptoms caused by a viral infection, and preventing or delaying the aggravation of a viral infection.

[0035] The antisense oligonucleotides of the present invention, or pharmaceutically acceptable salts, solvates, or prodrugs thereof (hereinafter referred to as "active ingredients"), can be administered orally or parenterally to mammals (e.g., humans, rabbits, dogs, cats, rats, and mice) alone or in appropriate dosage forms together with pharmacologically acceptable carriers, diluents, or excipients. The dosage varies depending on the subject, symptoms, and route of administration. For example, a single dose of the active ingredient is typically about 0.1 to 50 mg / kg body weight, preferably about 0.5 mg / kg body weight, administered intranasally or intravenously (preferably continuously or every other day) about 1 to 3 times daily, preferably about once daily. Similar amounts can also be administered for other parenteral and oral administrations. In particularly severe cases, the dosage may be increased depending on the symptoms.

[0036] Preparations for oral administration include solid or liquid dosage forms, specifically tablets (including sugar-coated tablets and film-coated tablets), pills, granules, powders, capsules (including soft capsules), syrups, emulsions, suspensions, etc. Such preparations can be manufactured by conventional methods and may contain carriers, diluents, or excipients commonly used in the pharmaceutical field. For example, carriers and excipients for tablets include lactose, starch, sucrose, magnesium stearate, etc.

[0037] Examples of formulations for parenteral administration include nasal drops, injections, suppositories, etc. Nasal drops may be in the form of nasal powders or nasal liquids, while injections may be in the form of intravenous, subcutaneous, intradermal, intramuscular, or drip infusions. For nasal powders, the active ingredient is prepared by dissolving or suspending it in moderately fine particles, optionally with additives. For nasal liquids, the active ingredient is dissolved or suspended in a solvent and additives, and then filtered as needed. Tonicity agents, pH adjusters, etc. may also be used. Examples of additives include preservatives such as benzalkonium chloride, binders such as hydroxypropyl cellulose, and excipients such as lactose. Physiological saline is typically used as the solvent, but solubilizers such as alcohols (e.g., ethanol, isopropyl alcohol, etc.), glycols (e.g., propylene glycol, polyethylene glycol, polypropylene glycol, glycol ethers, glycerol, etc.), and polyoxyethylene alcohols may also be added. Injectable preparations are prepared by conventional methods, i.e., by dissolving, suspending, or emulsifying the active ingredient in a sterile aqueous or oily liquid typically used for injections. Aqueous solutions for injection include physiological saline and isotonic solutions containing glucose or other adjuvants. These solutions may be used in combination with appropriate solubilizers, such as alcohols (e.g., ethanol), polyalcohols (e.g., propylene glycol, polyethylene glycol), and nonionic surfactants (e.g., polysorbate 80, HCO-50 (polyoxyethylene (50 mol) adduct of hydrogenated castor oil)). Oily solutions include sesame oil and soybean oil, and may be used in combination with solubilizers such as benzyl benzoate and benzyl alcohol. The prepared injectable solutions are usually filled into appropriate ampoules. Suppositories for rectal administration can be prepared by mixing the active ingredient with a conventional suppository base.

[0038] The oral or parenteral pharmaceutical preparations may be prepared in dosage unit forms that correspond to the dosage of the active ingredient. Examples of dosage unit forms include tablets, pills, capsules, preparations for nasal administration filled in nasal drop containers, injections (ampoules), suppositories, etc., and each dosage unit preferably contains 0.1 to 1,000 mg of the active ingredient.

[0039] The antisense oligonucleotide of the present invention can suppress the expression of angiotensin-converting enzyme 2 protein and / or promote the expression of soluble angiotensin-converting enzyme 2. Accordingly, the present invention provides a pharmaceutical agent for suppressing the expression of angiotensin-converting enzyme 2 protein and / or promoting the expression of soluble angiotensin-converting enzyme 2, comprising an antisense oligonucleotide of 15 to 30 bases having a base sequence complementary to a target site in exon 18 of the angiotensin-converting enzyme 2 gene, capable of inducing exon skipping in the angiotensin-converting enzyme 2 gene, or a salt or solvate thereof. The pharmaceutical agent of the present invention can be used as a pharmaceutical or an experimental reagent. The present invention also provides a method for suppressing the expression of angiotensin-converting enzyme 2 protein and / or promoting the expression of soluble angiotensin-converting enzyme 2, comprising administering an effective amount of the antisense oligonucleotide, a pharmaceutically acceptable salt, or a solvate thereof to a subject. The subject may be a human or an animal. Examples of animals include mammals such as dogs, cats, minks, tigers, lions, mice, rats, rabbits, sheep, pigs, cows, and horses. The antisense oligonucleotide may be in the form of a salt, solvate, or prodrug. Examples of salts, solvates, or prodrugs include pharmaceutically acceptable salts, solvates, or prodrugs, which are described above.

[0040] When used as an experimental reagent, treatment of cells, tissues, or organs expressing angiotensin-converting enzyme 2 with the antisense oligonucleotide, salt, or solvate of the present invention can suppress the expression of angiotensin-converting enzyme 2 protein or promote the expression of soluble angiotensin-converting enzyme 2. The antisense oligonucleotide, salt, and solvate of the present invention can be used in an amount effective for suppressing the expression of angiotensin-converting enzyme 2 protein or promoting the expression of soluble angiotensin-converting enzyme 2. Examples of cells expressing angiotensin-converting enzyme 2 include nasal mucosal epithelial goblet cells, type II alveolar epithelial cells, absorptive intestinal epithelial cells, hepatoma cells, vascular endothelial cells, and renal tubular epithelial cells. In addition to naturally occurring cells, recombinant cells into which the angiotensin-converting enzyme 2 gene has been introduced can also be used. Examples of tissues and organs expressing angiotensin-converting enzyme 2 include the heart, kidney, testis, lung, testis, small intestine, kidney, and prostate. The expression of angiotensin-converting enzyme 2 can be analyzed by analyzing angiotensin-converting enzyme 2 mRNA in a sample by RT-PCR, or by detecting angiotensin-converting enzyme 2 protein in a sample by Western blotting or mass spectrometry.

[0041] Exon skipping of the angiotensin-converting enzyme 2 gene induced by the antisense oligonucleotide, salt or solvate thereof of the present invention produces soluble angiotensin-converting enzyme 2 lacking the transmembrane domain. The present invention also provides this soluble angiotensin-converting enzyme 2.

[0042] The present invention also provides a polynucleotide comprising a nucleotide sequence encoding soluble angiotensin-converting enzyme 2 and / or a sequence complementary thereto.

[0043] The soluble angiotensin-converting enzyme 2 of the present invention and a polynucleotide comprising a nucleotide sequence encoding it are produced by inducing exon skipping of the angiotensin-converting enzyme 2 gene with the antisense oligonucleotide of the present invention in cells expressing angiotensin-converting enzyme 2. The soluble angiotensin-converting enzyme 2 of the present invention can also be produced by extracting RNA from cells in which exon skipping of the angiotensin-converting enzyme 2 gene has been induced, synthesizing cDNA using reverse transcriptase and random primers, amplifying it by PCR, and then performing sequence analysis to determine the sequence. After that, restriction enzyme recognition sequences are added to the 5' and 3' ends of the sequence in which the codon usage of the open reading frame has been optimized, and then incorporating it into an appropriate vector, which is then introduced into an appropriate host cell for production as a recombinant protein.

[0044] Examples of vectors that can be used include plasmids derived from Escherichia coli (e.g., pBR322, pBR325, pUC12, pUC13, pUC19, pET-44, pBlueScriptII), plasmids derived from Bacillus subtilis (e.g., YEp13, pYES2, YRp7, YIp5, pYAC2, pUB110, pTP5, pC194), yeast-derived plasmids (e.g., pSH19, pSH15), bacteriophages such as λ phage, retroviruses, adenoviruses, lentiviruses, adeno-associated viruses, animal viruses such as vaccinia virus, and insect pathogenic viruses such as baculovirus.

[0045] The expression vector may contain a promoter, enhancer, terminator, splicing signal, poly A addition signal, selection marker, SV40 replication origin, and the like.

[0046] Examples of hosts include bacterial cells (e.g., Escherichia, Bacillus, Bacillus subtilis, etc.), fungal cells (e.g., yeast, Aspergillus, etc.), insect cells (e.g., S2 cells, Sf cells, etc.), animal cells (e.g., CHO cells, COS cells, HeLa cells, C127 cells, 3T3 cells, BHK cells, HEK293 cells, etc.), and plant cells.

[0047] The recombinant vector can be introduced into a host by the methods described in Molecular Cloning 2nd Edition, J. Sambrook et al., Cold Spring Harbor Lab. Press, 1989 (e.g., calcium phosphate method, DEAE-dextran method, transvection method, microinjection method, lipofection method, electroporation method, transduction method, scrape-loading method, shotgun method, etc.) or by infection.

[0048] The transformed cells can be cultured in a medium, and soluble angiotensin-converting enzyme 2 can be collected from the culture. When soluble angiotensin-converting enzyme 2 is secreted into the medium, the medium can be collected, and soluble angiotensin-converting enzyme 2 can be separated from the medium and purified. When soluble angiotensin-converting enzyme 2 is produced within the transformed cells, the cells can be lysed, and soluble angiotensin-converting enzyme 2 can be separated from the lysate and purified.

[0049] Soluble angiotensin-converting enzyme 2 can be separated and purified by known methods, including methods that utilize solubility, such as salting out and solvent precipitation, methods that utilize differences in molecular weight, such as dialysis, ultrafiltration, gel filtration, and SDS-polyacrylamide gel electrophoresis, methods that utilize differences in charge, such as ion exchange chromatography, methods that utilize specific affinity, such as affinity chromatography, methods that utilize differences in hydrophobicity, such as reversed-phase high-performance liquid chromatography, and methods that utilize differences in isoelectric point, such as isoelectric focusing. [Example]

[0050] The present invention will be described in detail below based on examples. [Examples 1 to 8] Synthesis of antisense oligonucleotides (ASO) The antisense oligonucleotides (ASOs) shown in Table 1 were synthesized. The sequence locations of the ASOs complementary to ACE2 pre-mRNA are shown in Figures 1 and 3. The modified nucleic acid ENA® (2'-O,4'-C-Ethylene-bridged Nucleic Acids) was introduced into the A (adenine), G (guanine), C (cytosine), and T (thymine) residues in the ASO sequence to improve affinity and stability. Synthesis of gCTgTaTCCCCagaaaCT (ACE2ASO1) (Example 1) The synthesis was carried out on a 1 μmol scale using an automated nucleic acid synthesizer (NTS H-6 DNA / RNA synthesizer, manufactured by Nippon Techno Service Co., Ltd.). The concentrations of solvents, reagents, and phosphoramidites in each synthesis cycle were the same as those used in natural oligonucleotide synthesis. Reagents and 2'-O-methylnucleoside phosphoramidites (adenosine product No. 10-3100-10, guanosine product No. 10-3121-10) were from Glen Research. Solvents were from Wako Pure Chemical Industries, Ltd. The unnatural phosphoramidites used were those described in Example 22 (5'-O-dimethoxytrityl-2'-O,4'-C-ethylene-4-N-benzoyl-5-methylcytidine-3'-O-(2-cyanoethyl-N,N-diisopropyl)phosphoramidite) and Example 9 (5'-O-dimethoxytrityl-2'-O,4'-C-ethylene-5-methyluridine-3'-O-(2-cyanoethyl-N,N-diisopropyl)phosphoramidite) of JP 2000-297097 A. The compounds shown were synthesized using Universal Control Pore Glass (CPG) (Glen Research, product No. 25-5040) as the solid support. The time required for condensation of the amidites was 15 minutes. The protected oligonucleotide analogs containing the target sequence were cleaved from the support by heat treatment with concentrated aqueous ammonia (55°C for 8 hours), which removed the cyanoethyl protecting groups on the phosphorus atom and the nucleobases. The resulting ammonia solution was used in a Glen-Pak DNA Purification Cartridge (Glen Research, product no. 60-5100) to remove DMT in the cartridge according to the protocol recommended by Glen Research. The collected solution was evaporated under reduced pressure, and the residue was purified by reverse-phase HPLC (Shimadzu LC-2a, column (YMC Triart C18, 10 x 150 mm)) using a mixture of 0.1 M triethylamine acetate (TEAA), pH 7.0, and acetonitrile (B), with a linear gradient of 10% to 25% B (30 min, 50°C, 4.7 mL / min, 280 nm). After distilling off the solvent, the residue was dissolved in 10 mM NaOH solution, and the solution was replaced with pure water by ultrafiltration using a Microsep centrifugal filtration device (product No. MAP003C, manufactured by Nippon Pall Corporation), and the target compound was obtained after lyophilization. This compound was identified by negative ion MALDI-TOFMS (calculated value: 6461, measured value: 6461). The base sequence of this compound is complementary to nucleotides 36796-36813 of Homo sapiens angiotensin I converting enzyme 2 (ACE2), RefSeqGene on chromosome X (Gene Bank accession no. NG_012575.1). Synthesis of gaTCCCagTgaagaTCag (ACE2ASO2) (Example 2) The compound of Example 2 having the target sequence similar to that of the compound of Example 1 was synthesized. This compound was identified by negative ion MALDI-TOFMS (calculated value: 6486, measured value: 6487). The base sequence of this compound is complementary to nucleotides 36906-36923 of Homo sapiens angiotensin I converting enzyme 2 (ACE2), RefSeqGene on chromosome X (Gene Bank accession no. NG_012575.1). Synthesis of TCTTCCgaTCTCTgaTCC (ACE2ASO3) (Example 3) The compound of Example 3 having the target sequence similar to that of the compound of Example 1 was synthesized. This compound was identified by negative ion MALDI-TOFMS (calculated value: 6456, measured value: 6456). The base sequence of this compound is complementary to nucleotides 36919-36936 of Homo sapiens angiotensin I converting enzyme 2 (ACE2), RefSeqGene on chromosome X (Gene Bank accession no. NG_012575.1). Synthesis of TgaTaCggCTCCgggaCa (ACE2ASO4) (Example 4) The compound of Example 4 having the target sequence similar to that of the compound of Example 1 was synthesized. This compound was identified by negative ion MALDI-TOFMS (calculated value: 6504, measured value: 6504). The base sequence of this compound is complementary to nucleotides 36745-36762 of Homo sapiens angiotensin I converting enzyme 2 (ACE2), RefSeqGene on chromosome X (Gene Bank accession no. NG_012575.1). Synthesis of ggCTgTTgTCaTTCagaC (ACE2ASO5) (Example 5) The compound of Example 5 having the target sequence similar to that of the compound of Example 1 was synthesized. This compound was identified by negative ion MALDI-TOFMS (calculated value: 6495, measured value: 6495). The base sequence of this compound is complementary to nucleotides 36775-36792 of Homo sapiens angiotensin I converting enzyme 2 (ACE2), RefSeqGene on chromosome X (Gene Bank accession no. NG_012575.1). Synthesis of TaggaggTCCaagTgTTg (ACE2ASO6) (Example 6) The compound of Example 6 having the target sequence similar to that of the compound of Example 1 was synthesized. This compound was identified by negative ion MALDI-TOFMS (calculated value: 6520, measured value: 6521). The base sequence of this compound is complementary to nucleotides 36814-36831 of Homo sapiens angiotensin I converting enzyme 2 (ACE2), RefSeqGene on chromosome X (Gene Bank accession no. NG_012575.1). Synthesis of CCaTaTggaaaCaggggg (ACE2ASO7) (Example 7) The compound of Example 7, which has the same target sequence as the compound of Example 1, was synthesized. This compound was identified by negative ion MALDI-TOFMS (calculated value: 6513, measured value: 6513). The base sequence of this compound is complementary to nucleotides 36837-36854 of Homo sapiens angiotensin I converting enzyme 2 (ACE2), RefSeqGene on chromosome X (Gene Bank accession no. NG_012575.1). Synthesis of CaCaaCTCCaaaaaCaaT (ACE2ASO8) (Example 8) The compound of Example 8 having the target sequence similar to that of the compound of Example 1 was synthesized. This compound was identified by negative ion MALDI-TOFMS (calculated value: 6407, measured value: 6407). The base sequence of this compound is complementary to nucleotides 36858-36875 of Homo sapiens angiotensin I converting enzyme 2 (ACE2), RefSeqGene on chromosome X (Gene Bank accession no. NG_012575.1). Synthesis of aaTgCCaaCCaCTaTCaC (ACE2ASO9) (Example 9) The compound of Example 9, which has the same target sequence as the compound of Example 1, was synthesized. This compound was identified by negative ion MALDI-TOFMS (calculated value: 6428, measured value: 6429). The base sequence of this compound is complementary to nucleotides 36882-36899 of Homo sapiens angiotensin I converting enzyme 2 (ACE2), RefSeqGene on chromosome X (Gene Bank accession no. NG_012575.1). Synthesis of CgggaCaTCcTaTTTgCa (ACE2ASOIn16Ex17) (Example 10) The compound of Example 10 having the target sequence similar to that of the compound of Example 1 was synthesized. This compound was identified by negative ion MALDI-TOFMS (calculated value: 6452, measured value: 6452). The base sequence of this compound is complementary to nucleotides 36734-36751 of Homo sapiens angiotensin I converting enzyme 2 (ACE2), RefSeqGene on chromosome X (Gene Bank accession no. NG_012575.1). Synthesis of gCCacTTacTTcTTCCga (ACE2ASOEx17In17) (Example 11) The compound of Example 11 having the target sequence similar to that of the compound of Example 1 was synthesized. This compound was identified by negative ion MALDI-TOFMS (calculated value: 6375, measured value: 6377). The base sequence of this compound is complementary to nucleotides 36929-36946 of Homo sapiens angiotensin I converting enzyme 2 (ACE2), RefSeqGene on chromosome X (Gene Bank accession no. NG_012575.1). Synthesis of CggCTCCgggaCaTccTa (ACE2ASO4+5) (Example 12) The compound of Example 12, which has the same target sequence as the compound of Example 1, was synthesized. This compound was identified by negative ion MALDI-TOFMS (calculated value: 6440, measured value: 6440). The base sequence of this compound is complementary to nucleotides 36740-36757 of Homo sapiens angiotensin I converting enzyme 2 (ACE2), RefSeqGene on chromosome X (Gene Bank accession no. NG_012575.1). Synthesis of CggaAAgcATCaTTgaTA (ACE2ASO4-13) (Example 13) The compound of Example 13 having the target sequence similar to that of the compound of Example 1 was synthesized. This compound was identified by negative ion MALDI-TOFMS (calculated value: 6493, measured value: 6492). The base sequence of this compound is complementary to nucleotides 36758-36775 of Homo sapiens angiotensin I converting enzyme 2 (ACE2), RefSeqGene on chromosome X (Gene Bank accession no. NG_012575.1). Synthesis of CTCTaggcTgTTgTcaTT (ACE2ASO5-5) (Example 14) The compound of Example 14 having the target sequence similar to that of the compound of Example 1 was synthesized. This compound was identified by negative ion MALDI-TOFMS (calculated value: 6433, measured value: 6434). The base sequence of this compound is complementary to nucleotides 36780-36797 of Homo sapiens angiotensin I converting enzyme 2 (ACE2), RefSeqGene on chromosome X (Gene Bank accession no. NG_012575.1). Synthesis of TCcaagTgTTggCTgTAT (ACE2ASO6+7) (Example 15) The compound of Example 15 having the target sequence similar to that of the compound of Example 1 was synthesized. This compound was identified by negative ion MALDI-TOFMS (calculated value: 6482, measured value: 6482). The base sequence of this compound is complementary to nucleotides 36807-36824 of Homo sapiens angiotensin I converting enzyme 2 (ACE2), RefSeqGene on chromosome X (Gene Bank accession no. NG_012575.1). Synthesis of AgggggcTGgTTAggagG (ACE2ASO6-11) (Example 16) The compound of Example 16 having the target sequence similar to that of the compound of Example 1 was synthesized. This compound was identified by negative ion MALDI-TOFMS (calculated value: 6482, measured value: 6482). The base sequence of this compound is complementary to nucleotides 36825-36842 of Homo sapiens angiotensin I converting enzyme 2 (ACE2), RefSeqGene on chromosome X (Gene Bank accession no. NG_012575.1). Synthesis of TTgTCaTTCagaCggaaa (ACE2ASO5+5) (Example 17) The compound of Example 17, which has the same target sequence as the compound of Example 1, was synthesized. This compound was identified by negative ion MALDI-TOFMS (calculated value: 6474, measured value: 6474). The base sequence of this compound is complementary to nucleotides 36770-36787 of Homo sapiens angiotensin I converting enzyme 2 (ACE2), RefSeqGene on chromosome X (Gene Bank accession no. NG_012575.1). Synthesis of TgTCaTTCagaCggaaag (ACE2ASO5+6) (Example 18) The compound of Example 18 having the target sequence similar to that of the compound of Example 1 was synthesized. This compound was identified by negative ion MALDI-TOFMS (calculated value: 6487, measured value: 6489). The base sequence of this compound is complementary to nucleotides 36769-36786 of Homo sapiens angiotensin I converting enzyme 2 (ACE2), RefSeqGene on chromosome X (Gene Bank accession no. NG_012575.1). Synthesis of gTCaTTCagaCggaaagC (ACE2ASO5+7) (Example 19) The compound of Example 19, which has the same target sequence as the compound of Example 1, was synthesized. This compound was identified by negative ion MALDI-TOFMS (calculated value: 6486, measured value: 6488). The base sequence of this compound is complementary to nucleotides 36768-36785 of Homo sapiens angiotensin I converting enzyme 2 (ACE2), RefSeqGene on chromosome X (Gene Bank accession no. NG_012575.1). Synthesis of TCaTTCagaCggaaagCa (ACE2ASO5+8) (Example 20) The compound of Example 20, which has the target sequence similar to that of the compound of Example 1, was synthesized. This compound was identified by negative ion MALDI-TOFMS (calculated value: 6470, measured value: 6474). The base sequence of this compound is complementary to nucleotides 36767-36784 of Homo sapiens angiotensin I converting enzyme 2 (ACE2), RefSeqGene on chromosome X (Gene Bank accession no. NG_012575.1). Synthesis of aTTCagaCggaaagCaTC (ACE2ASO5+10) (Example 21) The compound of Example 21 having the target sequence similar to that of the compound of Example 1 was synthesized. This compound was identified by negative ion MALDI-TOFMS (calculated value: 6470, measured value: 6472). The base sequence of this compound is complementary to nucleotides 36765-36782 of Homo sapiens angiotensin I converting enzyme 2 (ACE2), RefSeqGene on chromosome X (Gene Bank accession no. NG_012575.1). Synthesis of TCagaCggaaagCaTCaT (ACE2ASO5+12) (Example 22) The compound of Example 22, which has the same target sequence as the compound of Example 1, was synthesized. This compound was identified by negative ion MALDI-TOFMS (calculated value: 6470, measured value: 6472). The base sequence of this compound is complementary to nucleotides 36763-36780 of Homo sapiens angiotensin I converting enzyme 2 (ACE2), RefSeqGene on chromosome X (Gene Bank accession no. NG_012575.1). Synthesis of GgcTgtTgtCaTtCagaC (ACE2ASO5c) (Example 23) The compound of Example 23 having the target sequence similar to that of the compound of Example 1 was synthesized. This compound was identified by negative ion MALDI-TOFMS (calculated value: 6403, measured value: 6399). The base sequence of this compound is complementary to nucleotides 36775-36792 of Homo sapiens angiotensin I converting enzyme 2 (ACE2), RefSeqGene on chromosome X (Gene Bank accession no. NG_012575.1). (Table 1) The sequence of the ASO synthesized in this example. Uppercase letters indicate ENA nucleic acid, and lowercase letters indicate 2'OMe. JPEG0007722666000001.jpg198167

[0051] [Test example] Experimental Method Assessment of ACE2 mRNA Changes in the splicing pattern of ACE2 after ASO introduction were evaluated by RT-PCR in human hepatoma cells (HepG2, ATCC). cell culture Human hepatoma cells (HepG2) were cultured in E-MEM medium (051-07615, Fujifilm Wako Pure Chemical Industries) containing 10% FBS (10270-106, Gibco). ASO transfection 1) 100 μl of Opti-MEM medium (31985070, Thermo Fisher Scientific) was mixed with 2 μl of each ASO (prepared at 50 pmol / μl with Nuclease-Free Water (AM9932, Thermo Fisher Scientific)). For the non-ASO treatment, 2 μl of Nuclease-Free Water was added. 2) In a separate tube, 100 μl of Opti-MEM medium was mixed with 4 μl of Lipofectamine 3000 Transfection Reagent (L3000015, Thermo Fisher Scientific). 3) Liquids 1) and 2) were mixed and left to stand at room temperature for 15 minutes. 4) Human hepatoma cells (HepG2) cultured in a 12-well plate were washed once with PBS, and then 800 μl of Opti-MEM medium was added to the wells. 5) Solution 3) was added to solution 4) (final ASO concentration: 100 nM), and the cells were cultured at 37°C under 5% CO2 for 3 hours. The medium was then replaced with E-MEM medium containing 10% FBS, and the cells were further cultured. RNA preparation 1) Cells transfected with each ASO were cultured for 24 hours, washed once with PBS, and 300 μl of RNA extraction reagent from the High Pure RNA Isolation Kit (#11828665001, Roche Life Science) was added to the cells. 2) After leaving it at room temperature for 10 minutes, the RNA extraction reagent in the wells was collected into a tube. 3) RNA was extracted according to the High Pure RNA Isolation Kit protocol, and 50 μl of RNA lysate was finally obtained. Reverse transcription reaction 1) Random primers (#48190011, Thermo Fisher Scientific) and dNTP mixture (2.5 mM each) (#4030, Takara) were added to 500 ng of RNA and incubated at 65°C for 5 minutes and then at 25°C for 10 minutes. 2) M-MLV Reverse Transcriptase (#28025013, Thermo Fisher Scientific), RNaseOUT Recombinant Ribonuclease Inhibitor (#10777-019, Thermo Fisher Scientific), DTT (supplied with M-MLV), and 5x First Strand Buffer (supplied with M-MLV) were added to solution 1), and the mixture was incubated at 37°C for 55 minutes and then at 70°C for 10 minutes to obtain cDNA. PCR reaction and confirmation of reaction products 1) To 2 μl of the obtained cDNA, 1 μl of primer ACE2F2 (5'-ctgttccgatcatctgttgc-3': SEQ ID NO: 18), 1 μl of primer ACE2R2 (5'-gagaccaaatacacactttccc-3': SEQ ID NO: 19), 0.1 μl of Takara Ex Taq DNA polymerase (#RR001A, Takara), 1.6 μl of dNTP mixture (2.5 mM each), 2 μl of 10x Ex Taq buffer, and 12.3 μl of nuclease-free water were added. 2) Heated to 94°C for 3 minutes. 3) 30 cycles of 94°C for 0.5 minutes, 60°C for 0.5 minutes, and 72°C for 1.5 minutes were performed. 4) Heated at 72°C for 3 minutes. 5) PCR reaction products were electrophoresed and quantified using an Agilent 2100 Bioanalyzer Electrophoresis System (Agilent Technologies, Inc.). 6) For GAPDH, steps 1) to 5) above were carried out using primers GAPDH H_F (5'-cccttcattgacctcaac-3': SEQ ID NO: 20) and GAPDH H_R (5'-ttcacacccatgacgaac-3': SEQ ID NO: 21) (3) was carried out for 18 cycles). Experimental results To induce exon 18 skipping of ACE2, we constructed 23 18-nt ASOs complementary to exon 18 of ACE2 pre-mRNA (Figures 1, 3, 5, 7, 9, 11, and 13). Each ASO was designed based on predicted splicing factor binding in ACE2 pre-mRNA. After treating human hepatoma cells (HepG2) with each ASO for 24 hours, ACE2 mRNA was analyzed by RT-PCR. Treatment with ACE2ASOs 3, 4+5, 4, 4-13, 5, 5-5, 5+5, 5+7, 5+8, 5+10, 5+12, and 5c significantly increased the proportion of exon 18-skipped ACE2 compared to total ACE2 (Figures 2, 4, 8, 10, 12, and 14). Consideration Because ACE2 acts as a viral receptor and is necessary for viral infection, inhibiting ACE2 receptor function has attracted attention as a preventive and therapeutic approach against viruses. In fact, it has been reported that inhibiting ACE2 function in cells using ACE2 antibodies or peptides reduces viral infection. A method for inhibiting viral infection by reducing ACE2 expression using siRNA has also been investigated. ACE2 consists of 18 exons, and it was predicted that skipping exon 18 would enable the creation of ACE2 lacking the transmembrane domain. Therefore, in this study, we used ASOs to skip exon 18 of ACE2, resulting in a decrease in receptor-type ACE2 due to the loss of the transmembrane domain and an increase in free ACE2. This is expected to have the dual effect of inhibiting viral uptake into cells by reducing receptor-type ACE2 and increasing free ACE2 that can bind to the virus, thereby capturing the virus outside the cell. The ACE2ASO3, 4+5, 4, 4-13, 5, 5-5, 5+5, 5+7, 5+8, 5+10, 5+12, and 5c of the present invention are expected to be effective in preventing viral infections because they increase the proportion of ACE2 with exon 18 skipping in total ACE2. All publications, patents, and patent applications cited herein are hereby incorporated by reference in their entirety. [Industrial Applicability]

[0052] This invention can be applied as a preventive therapy using ASO. It has been revealed that ASO induces exon skipping of the ACE2 gene. This result is expected to inhibit viral entry into the body by reducing ACE2 protein, and to exert virus neutralizing and Ang(1-7) effects by producing a viral decoy through soluble ACE2 production. Therefore, intranasal administration as a preventive and therapeutic method for viral infections and intravenous administration as a therapeutic method to prevent the infection from becoming severe are considered. The advantages of this preventive and therapeutic method using ASO include: 1. The administration route is easily accessible: residual drug evaluation at the administration site is necessary 2. Dual effect: 1) Decrease in ACE2 2) Increase in virus bait 3) Increase in Ang(1-7) 3. Large-scale synthesis is possible This is what happens. [Sequence List Free Text]

[0053] <SEQ ID NO: 1> Shows the nucleotide sequence of exon 18 of the angiotensin-converting enzyme 2 gene. gatgtcccggagccgtatcaatgatgctttccgtctgaatgacaacagcctagagtttctggggatacagccaacacttggacctcctaaccagccc cctgtttccatatggctgattgtttttggagttgtgatgggagtgatagtggttggcattgtcatcctgatcttcactgggatcagagatcggaagaa <SEQ ID NOS: 2 to 17 and 22 to 28> These show the base sequences of the ASOs synthesized in the Examples. The nucleotides constituting the antisense oligonucleotides may be natural DNA, natural RNA, DNA / RNA chimeras, or modified forms thereof, and at least one of them may be a modified nucleotide. <SEQ ID NOs: 18 to 21> Shows the base sequences of the primers used in the test examples.

Claims

1. An antisense oligonucleotide, a salt or solvate thereof, which has a base sequence complementary to a target site in exon 18 of the angiotensin-converting enzyme 2 gene and is capable of inducing exon skipping of the angiotensin-converting enzyme 2 gene, and which has a base sequence selected from the group consisting of SEQ ID NOs: 4 to 6, 13 to 16, 22, and 24 to 28 (wherein t may be u, and u may be t).

2. The antisense oligonucleotide, its salt, or solvate according to claim 1, wherein the base sequence of exon 18 of the angiotensin-converting enzyme 2 gene is the base sequence of SEQ ID NO: 1, and the target site of exon 18 of the angiotensin-converting enzyme 2 gene is located within the region of base numbers 1 to 195 of the base sequence of SEQ ID NO:

1.

3. The antisense oligonucleotide, salt or solvate thereof according to claim 1 or 2, wherein at least one nucleotide is modified.

4. The antisense oligonucleotide, its salt or solvate according to claim 3, wherein the sugar constituting the modified nucleotide is D-ribofuranose, and the hydroxyl group at the 2'-position of the D-ribofuranose is modified.

5. The antisense oligonucleotide, salt or solvate thereof according to claim 4, wherein the D-ribofuranose is 2'-O-alkylated and / or 2'-O,4'-C-alkylenated.

6. A medicine comprising the antisense oligonucleotide according to any one of claims 1 to 5, or a pharmaceutically acceptable salt or solvate thereof.

7. The pharmaceutical composition of claim 6 for suppressing the infectivity of the SARS-CoV-2 virus.

8. The pharmaceutical composition according to claim 7, which has the effect of inhibiting viral uptake into cells by reducing receptor-type angiotensin-converting enzyme 2 and / or capturing viruses outside cells by increasing soluble angiotensin-converting enzyme 2 that can bind to viruses.

9. The pharmaceutical according to any one of claims 6 to 8 for preventing and / or treating SARS-CoV-2 infection.

10. A drug for inhibiting the expression of angiotensin-converting enzyme 2 protein and / or promoting the expression of soluble angiotensin-converting enzyme 2, comprising the antisense oligonucleotide, its salt or solvate according to any one of claims 1 to 5.

Images