Composition for preventing or treating degenerative neurological diseases, comprising a compound that induces the expression of the anti-aging gene klotho

Abstract

The present invention relates to a composition for preventing or treating degenerative neurological diseases, comprising a compound that induces the expression of the anti-aging gene klotho. The compound represented by Chemical Formula 1 according to the present invention is an anti-aging compound that induces the expression of the anti-aging gene klotho. It has an excellent effect of increasing the expression level of the Klotho gene, and can be usefully used as a pharmaceutical composition or food composition for preventing, improving or treating degenerative neurological diseases.

Description

Detailed Description of the Invention

[0001] [Technical field] The present invention relates to a composition for preventing or treating degenerative neurological diseases, which comprises a compound that induces the expression of the anti-aging gene klotho.

[0002] [Background technology] Imbalances in neuroimmune system regulation are known to be a cause of various neurodegenerative diseases, and many studies have reported that they occur due to neuroinflammatory responses within the central nervous system in response to brain damage caused by Parkinson's disease, Alzheimer's disease, traumatic injury, stroke, and stroke.

[0003] Meanwhile, the fact that genes capable of regulating aging in animals exist was first discovered in 1981 with the discovery of senescence-accelerated mice (SAM). These mice, which were accidentally created during the breeding of mice, aged much faster than their inbred counterparts. It was confirmed that these mice carried mutations in various genes. The discovery of a single group of aging-related genes was subsequently reported in the 1990s. The reported gene was a member of the RecQ family, which expresses an enzyme called DNA helicase. Mutations in this gene were reported to cause premature aging and cancer, which is known to occur by affecting DNA repair. The klotho gene, discovered in 1997, is a single gene associated with aging. The klotho gene was discovered by chance while creating a genetically modified animal model of hypertensive mice. Mice lacking this gene expression exhibited premature aging and a shortened lifespan. Even more interesting is that mice with increased expression of this gene subsequently showed a 20.0-30.8% increase in lifespan in males and an 18.8-19.0% increase in lifespan in females. This marked the first time that the public was made aware of the fact that the expression of a single gene can either increase or decrease the lifespan of mice. It was also reported that the base sequence of the Klotho gene is highly similar between animals, with approximately 98% identity between mice and humans. This indicates that lifespan can also be regulated by the expression of the Klotho gene in humans.

[0004] In humans, α-klotho (hereafter referred to as klotho), a member of the klotho gene family known to be associated with aging, is located on chromosome 13 and produces a membrane protein with a base sequence similar to that of β-glucosidase. Klotho protein is primarily expressed in renal tubular epithelial cells and the choroid plexus of the brain, with some expression reported in the parathyroid gland. The klotho gene is associated with a variety of aging phenotypes, and mice lacking the klotho gene develop syndromes similar to the aging process, including reduced lifespan, decreased activity, growth retardation, atherosclerosis, arterial calcification, osteoporosis, genital immaturity, infertility, skin atrophy, and emphysema. Klotho mutant mice exhibit a syndrome similar to Monckeberg-type arteriosclerosis, which occurs with aging in humans. Atherosclerosis of this type is observed in all arteries, from the aorta to the small arteries, and angiogenesis and vasculogenesis are impaired.

[0005] Klotho mRNA is expressed significantly higher in kidney tissue than in other tissues, but is not expressed in hypertension, 2 In the kidneys of disease model mice with type 2 diabetes, diabetic nephropathy, and chronic renal failure, klotho mRNA was expressed. In mice with reduced Klotho expression, the expression of vascular endothelium-derived relaxing factor NO(N It reduces the production of thiamin mononitrate (HbO) and has many risk factors for cardiovascular disease. The klotho gene was introduced into Otsuka Long-Evans Tokushima fatty rat (OLETF) mice. When injected using a gene carrier, it improves the dysfunction of the vascular endothelium, increases NO production, suppresses vascular thickening and fibrosis, and lowers blood pressure. Statins, a typical anti-hypercholesterol drug, also affect glucose and insulin metabolism in the kidney, and increase klotho mRNA expression in renal proximal tubule cells. Klotho-deficient mice develop osteopenia with low bone turnover due to impaired differentiation of both osteoblasts and osteoclasts, a condition similar to age-related bone loss and senile osteoporosis in humans. Klotho mutant mice also exhibit abnormal elongation of trabecular bone at the epiphyseal region and abnormal trabecular tissue findings on micro-computed tomography, which are attributed to impaired bone resorption. The clinical phenotypes observed in humans due to Klotho gene mutations are diverse. The KL-VS (functional variant of klotho), which has a mutation in three sites in exon 2 of the Klotho gene, has been associated with lipid metabolism, blood pressure, lifespan, cognitive function, coronary artery disease, and cerebrovascular disease. Microsatellite polymorphisms and single-nucleotide polymorphisms in the Klotho gene have been associated with bone mineral density, and single-nucleotide polymorphisms in the Klotho gene have been associated with cardiovascular disease risk factors and bone mineral density in healthy adult women. Recently, the association between the Klotho gene and Alzheimer's disease has been reported in various papers. Overexpression of klotho in a mouse model of Alzheimer's dementia has been shown to increase lifespan by 30% and suppress cognitive decline. Furthermore, klotho expression has been observed to reduce amyloid beta protein production in the brain by 50%. In humans, klotho expression levels are inversely correlated with the progression of Alzheimer's disease, and klotho protein has been shown to reduce the amount of inflammatory cytokines in the blood of patients with Alzheimer's disease.

[0006] Efforts have been ongoing to develop substances that can induce the expression of the klotho gene, which has clear anti-aging effects. Known substances that have been reported to be able to induce klotho expression include rapamycin, vitamin D, and statins. In 2012, a research team at Boston University screened a compound library totaling 150,000 compounds for compounds that can induce klotho gene expression, and reported three compounds.

[0007] The inventor selected compound H from these compounds, which has a structure that is highly likely to be developed as a drug, and confirmed through actual experiments that this compound can express the klotho gene in cells, and published the research results on its mechanism of action in a paper. After that, he conducted an experiment to analyze the structure of compound H (Comparative Example 1) and found that it induces klotho expression. The inventors then identified the structural characteristics of compounds that could be induced and used them to create new compounds with more than 10-fold increased activity. Furthermore, the inventors experimentally confirmed that novel compounds that induce the expression of the anti-aging gene klotho are useful for the prevention or treatment of degenerative neurological diseases, thereby completing the present invention. [Summary of the Invention]

[0008] [Problem to be solved by the invention] The object of the present invention is to provide a degenerative disease comprising a compound of formula 1 or a pharmaceutically acceptable salt thereof. The present invention provides a pharmaceutical composition for preventing or treating neurological diseases.

[0009] Another object of the present invention is to provide a compound of formula 1 or a pharmaceutically acceptable salt thereof. The present invention provides a functional health food composition or food composition for preventing or improving neurological disorders.

[0010] [Means for solving the problem] In order to achieve the above purpose, The present invention relates to a compound represented by the following chemical formula 1 or a pharmaceutically acceptable salt thereof as an active ingredient. A pharmaceutical composition for preventing or treating a degenerative neurological disease comprising to provide.

[0011] [ka]

[0012] (In the above Chemical Formula 1, L 1 is a single bond or

[0013] [ka]

[0014] and; R 1 and R 2 are -H, -OH, and C, respectively. 1-10 or a straight or branched chain alkyl C 6-8 wherein the aryl of said arylamide is selected from the group consisting of halogen, —NO2 and C 1-10 One or more of the linear or branched alkyl halides are substituted. can be; R 1 and R 2 are C together with the carbon atoms to which they are connected. 6-8 can form an aryl of; R 3 , R 4 , R 5 , R 6 and R 7 are -H, halogen, -NO2 or C, respectively. 1-10 (straight or branched chain alkyl).

[0015] The present invention also provides a compound represented by Chemical Formula 1 or a pharmaceutically acceptable salt thereof. The present invention provides a functional health food composition containing the active ingredient for preventing or ameliorating degenerative neurological diseases. Furthermore, the present invention provides a compound represented by Chemical Formula 1 or a pharmaceutically acceptable salt thereof. The present invention provides a food composition for preventing or ameliorating degenerative neurological diseases, which contains the compound as an active ingredient.

[0016] Furthermore, the present invention provides a compound represented by Chemical Formula 1 or a pharmaceutically acceptable salt thereof. The present invention provides a method for preventing or treating a degenerative neurological disease, which comprises administering or taking to an individual a composition containing the compound as an active ingredient.

[0017] Furthermore, the present invention provides a compound represented by Chemical Formula 1 or a pharmaceutically acceptable salt thereof. The present invention provides a composition containing the compound as an active ingredient for use in preventing or treating degenerative neurological diseases.

[0018] [Effects of the invention] The compound represented by formula 1 of the present invention inhibits the expression of the Klotho gene, which is a gene associated with aging. The composition has an excellent effect of improving the amount of serotonin in the blood, and can be usefully used as a pharmaceutical composition or food composition for preventing, improving or treating degenerative neurological diseases. [Brief explanation of the drawings]

[0019] [Figure 1] Figure 1a shows the results of luciferase expression experiments using reporter genes comprising a promoter extending from the start site of the human klotho gene to 1.7 kbp before the gene in Comparative Examples 1 to 4. Figure 1b shows the results of luciferase expression experiments using reporter genes comprising a promoter extending from the start site of the human klotho gene to 240 bp before the gene in Comparative Examples 1 to 4. [Figure 2] FIG. 2 shows the results of luciferase expression experiments using a reporter gene containing a promoter spanning up to −2.1 kb upstream of the human klotho gene in Examples 1 to 6. [Figure 3]FIG. 3 shows the results of luciferase expression experiments using a reporter gene containing a promoter spanning up to −2.1 kb upstream of the human klotho gene in Examples 1 to 3. [Figure 4] FIG. 4 shows the results of confirming the mRNA expression level of the klotho (KL) gene by RT-PCR in Examples 1 and 2. [Figure 5] FIG. 5 shows the results of confirming the expression of the klotho gene in RPTEC cells treated with the compounds of Examples 1 to 2 and Examples 7 to 10. [Figure 6] FIG. 6 shows the results of confirming the cytotoxicity of HK2 cells treated with the compounds of Examples 1, 9, and 10. [Figure 7] FIG. 7 shows the results of confirming the inhibitory effect of the KS1 compound (Example 10) on neuronal aging in HT22 cells (neuronal cells derived from mouse hippocampus). [Figure 8] FIG. 8 shows the results of confirming the inhibitory effect of the KS1 compound (Example 10) on inflammation in HT22 cells (neuronal cells derived from mouse hippocampus). [Figure 9] FIG. 9 shows the results of confirming the effect of the KS1 compound (Example 10) in reducing the expression of proteins causing cognitive dysfunction in a 5xFAD cognitive dysfunction animal model. [Figure 10] FIG. 10 shows the results of confirming the effect of the KS1 compound (Example 10) on increasing the expression of the neuronal marker NeuN in a 5xFAD cognitive impairment animal model. [Figure 11] FIG. 11 shows the results of confirming the effect of the KS1 compound (Example 10) on improving object exploration ability in a 5xFAD cognitive impairment animal model. [Figure 12] FIG. 12 shows the results of a passive avoidance experiment using a 5xFAD cognitive impairment animal model to confirm the spatial learning and memory-enhancing effects of KS1 compound (Example 10). DETAILED DESCRIPTION OF THE INVENTION

[0020] [Best Mode for Carrying Out the Invention] The present invention will be described in detail below. The present invention relates to a compound represented by the following chemical formula 1 or a pharmaceutically acceptable salt thereof as an active ingredient. The present invention relates to a composition for preventing or treating / ameliorating degenerative neurological diseases, comprising the compound as a component (a).

[0021] The compound represented by the following formula 1 according to the present invention binds to the Klotho gene, which is a gene related to aging. It has an excellent effect of increasing the expression level of genes and can be usefully used as a pharmaceutical composition or food composition for preventing, improving or treating degenerative neurological diseases.

[0022] Pharmaceutical composition for preventing or treating degenerative neurological diseases The present invention relates to a regression analysis method comprising a compound represented by the following formula 1 or a pharmaceutically acceptable salt thereof: The present invention provides a pharmaceutical composition for preventing or treating neurological diseases.

[0023] [ka]

[0024] In the above Chemical Formula 1, L 1 is a single bond or

[0025] [ka]

[0026] and; R 1 and R 2 are -H, -OH, and C, respectively. 1-10 or a straight or branched chain alkyl C 6-8 wherein the aryl of said arylamide is selected from the group consisting of halogen, —NO2 and C 1-10 One or more of the linear or branched alkyl halides are substituted. can be; R 1 and R 2 are C together with the carbon atoms to which they are connected. 6-8 can form an aryl of; R 3 , R 4 , R 5 , R 6 and R 7 are -H, halogen, -NO2 or C, respectively. 1-10 of It can be a straight or branched chain alkyl.

[0027] In one embodiment according to the present invention, Said L 1 is a single bond or

[0028] [ka]

[0029] and; R 1 and R 2 are -H, -OH, and C, respectively. 1-5 straight or branched chain alkyl, or C 6-7 wherein the aryl of said arylamide is selected from the group consisting of halogen, —NO2 and C 1-5 wherein one or more of the linear or branched alkyl halides may be substituted; R 1 and R 2 can form a C6-7 aryl together with the carbon atom to which they are attached; R 3 , R 4 , R 5 , R 6 and R 7 are -H, halogen, -NO2 or C, respectively. 1-5 It can be a straight or branched chain alkyl.

[0030] In one embodiment according to the present invention, Said L 1 is a single bond or

[0031] [ka]

[0032] and; R 1 and R 2 are -H, -OH, -CH3, or phenylamide, respectively, The phenyl of the phenylamide may have one of -Cl, -NO2 and -CH2Cl. More than one species can be substituted; R 1 and R 2 can form a phenyl together with the carbon atom to which they are attached; R 3 , R 4 , R 5 , R 6 and R 7 can each be -H, -F, -Cl, -NO2, or -CH2CH3.

[0033] In one embodiment according to the present invention, Said L 1 is a single bond or

[0034] [ka]

[0035] and; R 1 are -H, -OH, -CH3,

[0036] [ka]

[0037] and; R 2 is -H; R 1 and R 2can form a phenyl together with the carbon atom to which they are attached; R 3 is -H or -Cl; R 4 is -H, -F or -Cl; R 5 is -F, -Cl, -NO2, or -CH2CH3; R 6 is -H; R 7 can be -H.

[0038] Preferred examples of the compound represented by Chemical Formula 1 according to the present invention include the following compound group: can be done. 1) N-(benzo[d]oxazol-2-yl)-2-chloro-4-nitrobenzamide; 2) 8-methyl-2-[N-(3,4-dichlorophenyl)]aminobenzoxazole; 3) 2-((3,4-dichlorophenyl)amino)benzo[d]oxazol-5-ol; 4) N-(2-(4-ethylphenylamino)benzo[d]oxazol-5-yl)-2-chloro-5-nitrobenzamide; 5) N-(2-(4-ethylphenylamino)benzo[d]oxazol-5-yl)-3,4-dichlorobenzamide; 6) N-(2-(4-ethylphenylamino)benzo[d]oxazol-5-yl)-3-(chloroisothiazolinone) (chloromethyl)benzamide; 7) 2-[N-(3,4-dichlorophenyl)]aminobenzoxazole; 8) N-(3,4-dichlorophenyl)naphtho[2,3-d]oxazol-2-amine; 9) N-(3,4-difluorophenyl)-5-methylbenzo[d]oxazol-2-amine ; and 10) N-(3,4-difluorophenyl)benzo[d]oxazol-2-amine.

[0039] The compound of the present invention represented by Chemical Formula 1 may be used in the form of a pharmaceutically acceptable salt. As the salt, an acid addition salt formed with a pharmaceutically acceptable free acid is useful. The term "pharmaceutically acceptable salt" refers to a salt that is relatively non-toxic and innocuous to a patient at concentrations that have an effective effect, and the side effects attributable to the salt do not diminish the beneficial effects of the base compound of Formula 1. The term "addition salt" refers to any organic or inorganic addition salt of the base compound of formula 1, which does not include the base compound of formula 1. These salts include As free acids, inorganic acids and organic acids can be used. Inorganic acids include hydrochloric acid, bromic acid, nitric acid, sulfuric acid, perchloric acid, and phosphoric acid. Organic acids include citric acid, acetic acid, lactic acid, maleic acid, fumaric acid, gluconic acid, methanesulfonic acid, succinic acid, tartaric acid, galacturonic acid, embonic acid, glutamic acid, aspartic acid, oxalic acid, (D) or (L) malic acid, maleic acid, methanesulfonic acid, ethanesulfonic acid, and 4-toluenesulfonic acid. Acids such as carboxylic acids, salicylic acids, citric acids, benzoic acids, and malonic acids can be used. These salts include alkali metal salts (sodium salts, potassium salts, etc.) and alkaline earth metal salts (calcium salts, etc.). For example, acid addition salts include acetate, , aspartate, benzoate, besylate, bicarbonate / carbonate, bisulfate / sulfate, borate, camsylate, citrate, edisylate, esylate, formate, fumarate, gluceptate, gluconate, glucuronate, hexafluorophosphate, hyphenate, hydrochloride / chloride, hydrobromide / bromide, hydroiodide / iodide, isethionate, lactate, malate, maleate, malonate, mesylate, methylsulfate, naphthylate, 2- These may include napsylate, nicotinate, nitrate, iolotate, oxalate, palmitate, pamoate, phosphate / hydrogen phosphate / dihydrogen phosphate, saccharate, stearate, succinate, tartrate, tosylate, trifluoroacetate, aluminum, arginine, benzathine, calcium, choline, diethylamine, diolamine, glycine, lysine, magnesium, meglumine, olamine, potassium, sodium, tromethamine, zinc salts, and the like, of which the hydrochloride or trifluoroacetate is preferred.

[0040] In addition, the compound represented by Chemical Formula 1 of the present invention may be used in the form of a pharmaceutically acceptable salt, All salts, isomers, hydrates and solvates which can be prepared by conventional methods are included. The addition salts according to the present invention can be prepared by conventional methods, for example by reacting a compound of formula 1 In order to prepare the salt, the compound (I) is dissolved in a water-miscible organic solvent such as acetone, methanol, ethanol, or acetonitrile, and an excess amount of an organic acid or an aqueous solution of an inorganic acid is added, followed by precipitation or crystallization. The solvent or excess acid is then evaporated from the mixture, followed by drying to obtain the addition salt, or the precipitated salt is filtered off under suction.

[0041] Method 1 for producing the compound The present invention relates to a method for producing a compound of formula (I) as shown in the following reaction scheme 1: Step 1: dissolving compound 2 in an organic solvent, adding compound 3, and reacting at 10-50°C for 12-20 hours to obtain compound 4; and Step 2: adding dropwise the organic solvent in which the compound 4 obtained in Step 1 is dissolved to an organic solvent in which potassium superoxide is dissolved, and then reacting the mixture at 15 to 30°C for 10 to 16 hours to obtain compound 1A; The present invention provides a method for preparing a compound represented by formula 1A, comprising:

[0042] [ka]

[0043] In the reaction formula 1, R 1 , R 2 , R 3 , R 4 , R 5 , R 6 and R 7 is the same as defined in Chemical Formula 1 of Claim 1 represents the The compound 1A is included in the formula 1 of claim 1.

[0044] In the production method of the present invention, examples of the organic solvent include methanol (MeOH), dimethylformamide (DMF), acetonitrile (MeCN), tetrahydrofuran (THF), dichloromethane (DCM), 1,2-dimethoxyethane, benzene, toluene, xylene, dichloromethane, toluene ... Methyl sulfoxide (DMSO) or dioxane can be used alone or in mixture.

[0045] In the production method of the present invention, examples of compounds that can be produced by the production method include 8 -methyl-2-[N-(3,4-dichlorophenyl)]aminobenzoxazole, 2-[N-(3,4-dichlorophenyl)]aminobenzoxazole, N-(3,4-dichlorophenyl)na The compound may be N-(3,4-difluorophenyl)-5-methylbenzo[d]oxazol-2-amine, N-(3,4-difluorophenyl)-5-methylbenzo[d]oxazol-2-amine, or N-(3,4-difluorophenyl)benzo[d]oxazol-2-amine.

[0046] Method 2 for producing the compound The present invention relates to a method for producing a compound of formula (I) comprising the steps of: Step 1: dissolving compound 5 in an organic solvent, adding compound 3, and reacting at 10 to 50°C for 12 to 20 hours to obtain compound 6; Step 2: Dropwise adding the organic solvent containing the compound 6 obtained in step 1 to an organic solvent containing potassium superoxide, and then reacting for 12 to 24 hours to obtain compound 7; and Step 3: dissolving compound 7 in an organic solvent, adding boron tribromide (BBr3), and reacting at room temperature for 20-28 hours to obtain compound 1B; The present invention provides a method for preparing a compound represented by formula 1B, comprising:

[0047] [ka]

[0048] In the reaction scheme 2, R 3 , R 4 , R 5 , R 6 and R 7 represents the same as that defined in Chemical Formula 1 of Claim 1. death, The compound 1B is included in the formula 1 of claim 1.

[0049] In the production method of the present invention, examples of the organic solvent include methanol (MeOH), dimethylformamide (DMF), acetonitrile (MeCN), tetrahydrofuran (THF), dichloromethane (DCM), 1,2-dimethoxyethane, benzene, toluene, xylene, dichloromethane, toluene ... Methyl sulfoxide (DMSO) or dioxane can be used alone or in mixture.

[0050] In the production method of the present invention, examples of compounds that can be produced by the production method include: -((3,4-dichlorophenyl)amino)benzo[d]oxazol-5-ol.

[0051] Method 3 for producing the compound The present invention provides a method for producing a compound of formula (I) comprising the steps of: Compound 8, carbon disulfide, iodomethane, and sodium hydride were dissolved in an organic solvent. After dissolving, reacting at 10-50°C for 2-8 hours to obtain compound 9 (Step 1); and Compound 9 and compound 2 are dissolved in an organic solvent and reacted for 2 to 8 hours to obtain compound 1C. Stage (Stage 2); The present invention provides a method for preparing a compound represented by formula 1C, comprising:

[0052] [ka]

[0053] In the reaction scheme 3, R 1 , R 2 , R 3 , R 4 , R 5 , R 6 and R 7 is the same as defined in Chemical Formula 1 of Claim 1 represents the The compound 1C is included in the formula 1 of claim 1.

[0054] In the production method of the present invention, examples of the organic solvent include methanol (MeOH), dimethylformamide (DMF), acetonitrile (MeCN), tetrahydrofuran (THF), dichloromethane (DCM), 1,2-dimethoxyethane, benzene, toluene, xylene, dichloromethane, toluene ... Methyl sulfoxide (DMSO) or dioxane can be used alone or in mixture.

[0055] In the production method of the present invention, an example of a compound that can be produced by the production method is N-(benzo[d]oxazol-2-yl)-2-chloro-4-nitrobenzamide. do.

[0056] Method 4 for producing the compound The present invention provides a method for producing a compound of formula (I) comprising the steps of: Compound 10 and compound 3 are dissolved in an organic solvent and reacted at 10 to 50°C for 20 to 28 hours to form the compound. Obtaining Compound 11 (Step 1); The organic solvent in which the compound 11 obtained in step 1 is dissolved is added dropwise to the organic solvent in which potassium superoxide is dissolved, and the mixture is then heated at 10 to 50°C for 12 to 24 hours. reacting to obtain compound 12 (Step 2); Step 3: Adding compound 12 to an organic solvent together with a catalyst, and then injecting hydrogen gas and reacting at 10-50°C for 12-20 hours to obtain compound 13; and Step 4: dissolving Compound 13 and Compound 14 in an organic solvent and then reacting them at 10 to 50°C for 12 to 24 hours to obtain Compound 1D; The present invention provides a method for preparing a compound represented by Compound 1D, which comprises:

[0057] [ka]

[0058] In the reaction formula 4, R 3 , R 4 , R 5 , R 6 and R 7 represents the same as that defined in Chemical Formula 1 of Claim 1. death; R 8 are halogens, -NO2 and C 1-10 and one or more of the linear or branched alkyl halides: The compound 1D is included in the formula 1 of claim 1.

[0059] In the production method of the present invention, examples of the organic solvent include methanol (MeOH), Dimethylformamide (DMF), acetonitrile (MeCN), tetrahydrofuran (THF), dichloromethane (DCM), 1,2-dimethoxyethane, benzene, toluene, xylene, dichloromethane Methyl sulfoxide (DMSO) or dioxane can be used alone or in mixture.

[0060] In the production method of the present invention, examples of compounds that can be produced by the production method include N-(2-(4-ethylphenylamino)benzo[d]oxazol-5-yl)-2-chloro-5-methyl-2-benzo[d]oxazol-5-yl -Nitrobenzamide, N-(2-(4-ethylphenylamino)benzo[d]oxazole The compound may be N-(2-(4-ethylphenylamino)benzo[d]oxazol-5-yl)-3,4-dichlorobenzamide or N-(2-(4-ethylphenylamino)benzo[d]oxazol-5-yl)-3-(chloromethyl)benzamide.

[0061] In the present invention, the composition can increase the expression level of the Klotho gene. In the present invention, the degenerative neurological disease may include, but is not limited to, one or more diseases selected from the group consisting of stroke, paralysis, memory loss, memory impairment, dementia, amnesia, cognitive impairment, Parkinson's disease, Alzheimer's disease, Pick's disease, Creutzfeldt-Jakob disease, Huntington's disease, and Lugelig's disease. do not have.

[0062] The compound of the present invention can be administered in various oral and parenteral dosage forms when clinically administered, and when formulated, it is produced using commonly used diluents or excipients such as fillers, extenders, binders, wetting agents, disintegrants, surfactants, etc.

[0063] Solid preparations for oral administration include tablets, pills, powders, granules, capsules, lozenges, etc., and are prepared by mixing one or more compounds of the present invention with at least one excipient, such as starch, calcium carbonate, sucrose, lactose, or gelatin. In addition to simple excipients, lubricants such as magnesium, stearate, and talc are also used. Liquid preparations for oral administration include suspensions, oral solutions, emulsions, and syrups. In addition to commonly used simple diluents such as water and liquid paraffin, various excipients, such as wetting agents, sweeteners, flavoring agents, and preservatives, may be included.

[0064] Formulations for parenteral administration include sterile aqueous solutions, non-aqueous solvents, suspensions, emulsions, freeze-dried preparations, suppositories, etc. Examples of non-aqueous solvents and suspensions include propylene glycol, polyethylene glycol, vegetable oils such as olive oil, and injectable esters such as ethyl oleate. Examples of suppository bases include witepsol. l), macrogol, tween 61, cocoa butter, lauric butter, glycerol, Lathin etc. can be used.

[0065] The effective dosage of the compound of the present invention for the human body varies depending on the patient's age, weight, sex, dosage form, health condition, and disease severity, but is generally about 0.001 to 100 mg / kg / day, preferably 0.01 to 35 mg / kg / day. For an adult patient weighing 70 kg, the effective dosage is generally 0.07 to 7000 mg / day, preferably 0.7 to 2500 mg / day. Alternatively, the doctor or pharmacist may decide to administer the medicine once or several times a day at regular intervals.

[0066] Food composition or functional health food composition for preventing or improving degenerative neurological diseases The present invention relates to a method for producing a regression line comprising the compound represented by Formula 1 or a pharmaceutically acceptable salt thereof. The present invention provides a food composition or a functional health food composition for preventing or improving neurological diseases.

[0067] In the present invention, the composition can increase the expression level of the Klotho gene. In the present invention, the degenerative neurological disease includes stroke, paralysis, memory loss, memory impairment, etc. The conditions may include, but are not limited to, one or more diseases selected from the group consisting of dementia, amnesia, cognitive impairment, Parkinson's disease, Alzheimer's disease, Pick's disease, Creutzfeldt-Jakob disease, Huntington's disease, and Lugelig's disease. do not have.

[0068] There are no particular limitations on the type of food, and examples of foods to which the active substance of the present invention can be added include drinks, meat, sausages, bread, biscuits, mochi, chocolate, candies, snacks, confectionery, pizza, ramen, other noodles, gums, dairy products including ice cream, various soups, beverages, alcoholic beverages, vitamin complexes, dairy products and dairy processed products, etc., which include all health foods and health functional foods in the usual sense.

[0069] The health food and health functional food compositions containing the active substance according to the present invention can be added to food directly or used together with other foods or food ingredients, and can be used appropriately in a conventional manner. The amount of the active substance to be mixed can be determined appropriately depending on the purpose of use (prevention or improvement). Generally, the amount of the composition in health foods and health functional foods can be added in an amount of 0.1 to 90 parts by weight of the total food weight. However, when the purpose is to maintain health or to improve health, In the case of long-term intake for the purpose of health regulation, the amount may be less than the above range without any problem from the standpoint of safety, and the active substance may be used in an amount greater than the above range.

[0070] The health food and health functional food compositions of the present invention contain the active substance of the present invention as an essential ingredient in the indicated ratio, but other ingredients are not particularly limited, and may contain various flavoring agents or natural carbohydrates as additional ingredients along with ordinary beverages. Examples of the above-mentioned natural carbohydrates are monosaccharides such as glucose, fructose, etc.; disaccharides such as maltose, sucrose, etc.; and polysaccharides such as ordinary sugars such as dextrin, cyclodextrin, etc., and sugar alcohols such as xylitol, sorbitol, erythritol, etc. Flavoring agents other than those mentioned above include natural flavoring agents (sodium phosphate, sorbitol, erythritol, etc.). Natural carbohydrates, such as maltodextrin, stevia extract (e.g., rebaudioside A, glycyrrhizin, etc.), and synthetic flavoring agents (e.g., saccharin, aspartame, etc.) can be advantageously used. The ratio of the natural carbohydrates is generally about 1 to 20 g, preferably about 5 g, per 100 g of the health functional food composition of the present invention. ~12g.

[0071] In addition to the above, the health food and health functional food compositions containing the active substances of the present invention may contain various nutrients, vitamins, minerals (electrolytes), flavors such as synthetic flavors and natural flavors, colorants and enhancers (cheese, chocolate, etc.), pectinic acid and its salts, alginic acid and its salts, organic acids, protective colloid thickeners, pH adjusters, stabilizers, preservatives, glycerin, alcohol, carbonation agents used in carbonated drinks, etc. In addition, the health food and health functional food compositions of the present invention may contain fruit pulp for producing natural fruit juices and fruit juice drinks and vegetable drinks.

[0072] These ingredients can be used independently or in combination. The ratio of these additives is not particularly important, but is generally selected in the range of 0.1 to about 20 parts by weight per 100 parts by weight of the health food and functional health food composition containing the active substance of the present invention.

[0073] The present invention will be described in more detail with reference to the following examples, but the following examples are merely illustrative of the present invention and are not intended to limit the scope of the present invention.

[0074] Example 1: N-(Benzo[d]oxazol-2-yl)-2-chloro-4-nitrobenzamide Production of obenzamide (FCCS-17064)

[0075] [ka]

[0076] Step 1: Preparation of Dimethyl(2-chloro-4-nitrobenzoyl)carbonimidodithioate (17064-2-1) 2-Chloro-4-nitrobenzamide De (500 mg, 2.49 mmol), carbon disulfide (CS2) (759 mg, 9.97 mmol), and iodomethane (1.13 g, 7.97 mmol) were dissolved in N,N-dimethylformamide (7 mL). After the mixture was cooled, 60% sodium hydride (200 mg, 4.98 mmol) was added, and the mixture was stirred at room temperature for 5 hours.

[0077] Ice-cold water was slowly added to the reaction mixture, and the mixture was extracted with ethyl acetate. The organic layer was washed with brine, dried over Na2SO4, and the solvent was removed under reduced pressure. The reaction mixture was purified by silica gel column chromatography ( The product was purified by silica gel column chromatography (10% ethyl acetate / n-hexane) and purified as dimethyl(2-chloro-4-nitrobenzoyl)carbonimidodithioate (Dimethyl(2-chloro-4-nitrobenzoyl)carbonimidodithioate). (robenzoyl)carbonimidodithioate, 17064-2-1) pale yellow This was obtained as a coloured solid (160 mg, 21%).

[0078] 1 H NMR (400MHz, acetone-d6); δ8.34 (d, 1H, J=2.0Hz), 8.29 (dd, 1H, J=2.4, 8.8Hz), 8.20 (d, 1H, J=8.4Hz), 2.65 (s, 6H).

[0079] Step 2: Preparation of N-(Benzo[d]oxazol-2-yl)-2-chloro-4-nitrobenzamide (FCCS-17064) Dimethyl(2-chloro-4-nitrobenzoyl)carbonimide dithiocarbamate obtained in step 1 Dimethyl(2-chloro-4-nitrobenzoyl)carbo nimidodithioate, 17064-2-1) (150 mg, 0.49 mmol) After dissolving the solution in N,N-dimethylformamide (15 mL), 2-aminophenol (53 mg, 0.49 mmol) was added.

[0080] The reaction mixture was refluxed for 6 hours, and then the solvent was removed under reduced pressure. Diethyl ether was added, and the precipitated solid was filtered. The solid obtained was then subjected to silica gel column chromatography. aphy) (40% Ethyl acetate / n-hexane) Compound N-(Benzo[d]oxazol-2-yl)-2-chloro-4-nitrobenzamide zamide, FCCS-17064) was obtained as a brown solid (70 mg, 30%).

[0081] 1 H NMR (400MHz, acetone-d6); δ8.36 (d, 1H, J=2.0Hz), 8.3 3(dd, 1H, J=2.0, 8.4Hz), 8.09(d, 1H, J=8.4Hz), 7.62-7.56(m, 2H) , 7.40-7.33(m, 2H).

[0082] Example 2: Preparation of 8-methyl-2-[N-(3,4-dichlorophenyl)]aminobenzoxazole (FCCS-17065)

[0083] [ka]

[0084] Step 1: 1-(3,4-Dichlorophenyl)-3-(2-hydroxy-5-methylphenyl)thiourea (phenyl)thiourea (17065-2-1) 2-Amino-p-cresol (300 mg, 2.44 mmol) was dissolved in methanol (12 mL), and then 3,4-dichlolrophenyl isothiocyanate (497 mg, 2.44 mmol) was added and stirred at room temperature for 18 hours. After confirming the completion of the reaction by chromatography, the mixture was cooled in a refrigerator (0-4°C). The precipitated solid was filtered to obtain 1-(3,4) as a white solid (346 mg). 1-(3,4-Dichlorophenyl)-3-(2-hydroxy-5-methylphenyl)thiourea (17065-2-1) was obtained and used in the next step without further purification.

[0085] 1 H NMR (400MHz, acetone-d6); δ7.98 (dd, 1H, J=0.4, 2.0Hz), 7.55-7.50 (m, 2H), 7.43 (br s, 1H), 6.94-6.90 (m, 1H), 6.85 (d, 1H, J=8.4Hz) 2.24 (s, 3H).

[0086] Step 2: Preparation of 8-Methyl-2-[N-(3,4-dichlorophenyl)]aminobenzoxazole (FCCS-17065) The 1-(3,4-dichlorophenyl)-3-(2-hydroxy-5-methylphenyl)thiourea obtained in Step 1 was added to a solution of potassium superoxide (KO2) (375 mg, 5.29 mmol) and acetonitrile (MeCN) (15 mL). A solution of (346 mg, 1.06 mmol) thylphenylthiourea (17065-2-1) in acetonitrile (MeCN) (25 mL) was slowly added. After addition, the mixture was stirred at room temperature for 18 hours.

[0087] The reaction mixture was extracted with dichloromethane and water. The organic layer was washed with brine, dried over Na2SO4, and the solvent was removed under reduced pressure. The reaction mixture was purified by silica-gel column chromatography. The desired product was purified with 10% ethyl acetate / n-hexane. The compound 8-methyl-2-[N-(3,4-dichlorophenyl)]aminobenzoxazole (8- Methyl-2-[N-(3,4-dichlorophenyl)]aminobenzo xazole, FCCS-17065) as a white solid (170 mg, 24%, 2 steps).

[0088] 1 H NMR (400MHz, acetone-d6); δ8.29(d, 1H, J=2.8Hz), 7.73(dd, 1H, J=2.8, 8.8Hz), 7.76(d, 1H, J=8.8Hz), 7.32-7.20(m, 1H) , 7.28(d, 1H, J=8.0Hz), 7.00-6.970(m, 1H), 2.41(s, 3H).

[0089] Example 3: 2-((3,4-dichlorophenyl)amino)benzo[d]oxazol-5-ol -5-ol, FCCS-17066)

[0090] [ka]

[0091] Step 1: 1-(3,4-Dichlorophenyl)-3-(2-hydroxy-5-methoxyphenyl)thiourea (hoxyphenyl)thiourea (17066-3-1) 2-Amino-4-methoxyphenol (1.13 g, 8.12 mmol) was dissolved in methanol (40 mL), and then 3,4- Dichlorophenyl isothiocyanate (3,4-dichlolrophenyl isothiocyanate) (1.99 g, 9.74 mmol) was added and stirred at room temperature for 18 hours. After confirming the completion of the reaction by TLC (thin layer chromatography), the mixture was refrigerated. The mixture was cooled in a refrigerator (0-4°C). The precipitated solid was filtered to give 1-(3,4-dichlorophenyl)-3-(2-hydroxy-5-methoxyphenyl)thiourea as a brown solid (2g). oxyphenyl)thiourea (17066-3-1) was obtained without further purification. , which was used in the next step.

[0092] 1 H NMR (400MHz, methanol-d4); δ7.82 (d, 1H, J=2.4Hz), 7.48-7.44 (m, 2H), 7.39 (dd, 1 H, J=1.4, 8.8Hz), 6.81(d, 1H, J=8.8Hz), 6.66(dd, 1H, J=1.6, 8.8Hz), 3.73(s, 3H).

[0093] Step 2: N-(3,4-dichlorophenyl)-5-methoxybenzo[d]oxazol-2-amine Manufacture of oxazol-2-amine (17066-3-2) Potassium superoxide (KO2) (540 mg, 7.6 m A solution of 17066-3-1 (525 mg, 1.52 mmol) obtained in step 1 in acetonitrile (MeCN) (30 mL) was slowly added to a solution of 17066-3-1 (525 mg, 1.52 mmol) in acetonitrile (MeCN) (20 mL), and the mixture was stirred at room temperature for 18 hours. Dichloromethane and water were added to the reaction mixture, and the mixture was extracted. The organic layer was washed with brine, dried over Na2SO4, and the solvent was removed under reduced pressure. The reaction mixture was purified by silica gel column chromatography. The compound was purified with 20% ethyl acetate / n-hexane to give N-(3,4-dichlorophenyl)-5-methoxybenzo[d]oxazol-2-amine (N-(3,4 -dichlorophenyl)-5-methoxybenzo[d]oxazol-2-amine, 17066-3-2) as a brown solid (230 mg, 35%).

[0094] 1 H NMR (400MHz, acetone-d6); δ8.29(d, 1H, J=2.4Hz), 7.70(dd, 1H, J=2.4, 8.8Hz), 7.55(d, 1H, J= 8.8Hz), 7.30(d, 1H, J=8.8Hz), 7.08(d, 1H, J=2.8Hz), 7.74(dd, 1H, J=2.4, 8.8Hz), 3.84(s, 3H).

[0095] Step 3: Preparation of 2-((3,4-dichlorophenyl)amino)benzo[d]oxazol-5-ol (FCCS-17066) Under an Ar gas atmosphere, 17066-3-2 (200 mg, 0.65 mmol) obtained in Step 2 was added to dichloromethane. The mixture was dissolved in dichloromethane (15 mL, anhydrous) and cooled in an ice bath. Boron tribromide (BBr3) (3.23 mL, 1.0 M in dichloromethane) was slowly added, and the mixture was allowed to warm to room temperature and then stirred for 24 hours. Sodium hydroxide (NaOH) solution (8 mL, 1.0 M in w The reaction mixture was slowly added to terminate the reaction, and the mixture was transferred to a separatory funnel to separate the organic and aqueous layers. The aqueous layer was extracted with ethyl acetate, dried over Na2SO4, and the solvent was removed under reduced pressure. Silica-gel column chromatography aphy) (40% Ethyl acetate / n-hexane) Compound 2-((3,4-dichlorophenyl)amino)benzo[d]oxazol-5-ol , FCCS-17066) was obtained as a brown solid (97 mg, 50%).

[0096] 1 H NMR (400MHz, acetone-d6); δ8.29(br s, -OH), 8.26(d, 1H, J=2.4Hz), 7.72(dd, 1H, J=2.4, 8.8Hz), 7.56(d, 1H, J=8.8H z), 7.21(dd, 1H, J=2.0, 7.2Hz), 6.95(d, 1H, J=2.0Hz), 6.66(dd, 1H, J=2.4, 8.8Hz).

[0097] Example 4: Preparation of N-(2-(4-Ethylphenylamino)benzo[d]oxazol-5-yl)-2-chloro-5-nitrobenzamide (FCCS-17067)

[0098] [ka]

[0099] Step 1: 1-(4-ethylphenyl)-3-(2-hydroxy-5-nitrophenyl)thiourea l) Production of thiourea, Interm-3-1) 2-Amino-4-nitrophenol (1.88 g, 12.25 mmol) and 4-ethylphenyl isothiocyanate (4-ethylphenyl (isothiocyante) (2 g, 12.25 mmol) was dissolved in methanol (80 mL) and stirred at room temperature for one day. The solvent was removed under reduced pressure, and the resulting product was purified by chromatography. The product was purified by silica gel column chromatography (20% ethyl acetate / n-hexane) to give 1-(4-ethylphenyl)- 1-(4-ethylphenyl)-3-(2-hydroxy-5-nitrophenyl)thiourea (Interm-3-1) was obtained as a brown solid (2.9 g, 65%).

[0100] 1 H NMR (400MHz, methanol-d4); δ9.24 (d, 1H, J=2.8Hz), 7.88 (dd, 1H, J=2.0, 9.2Hz), 7.36 (d, 2H, J=8 .4Hz), 7.25(d, 2H, J=8.8Hz), 6.94(d, 1H, J=9.2Hz), 2.66(q, 2H, J=7.6Hz), 1.24(t, 3H, J=7.6Hz).

[0101] Step 2: N-(4-ethylphenyl)-5-nitrobenzo[d]oxazol-2-amine ( N-(4-ethylphenyl)-5-nitrobenzo[d]oxazol-2- amine, Interm-3-2) Potassium superoxide (KO2) (2.8g, 39.38m A solution of Interm-3-1 (2.5 g, 7.88 mmol) obtained in Step 1 in acetonitrile (MeCN) (170 mL) was slowly added and stirred at room temperature for 18 hours. The mixture was extracted with dichloromethane and water. The organic layer was washed with brine, dried over Na2SO4, and the solvent was removed under reduced pressure. The reaction mixture was purified by silica gel column chromatography (10% Ethyl acetate / n-hexane) to give compound Interm-3-2 as a brown solid (1.78 g, 80%).

[0102] 1 H NMR (400MHz, methanol-d4); δ8.20 (d, 1H, J=1.0Hz), 8.08 (dd, 1H, J=0.8, 9.6Hz), 7.59 (d, 2H, J=8 .8Hz), 7.51(d, 1H, J=8.8Hz), 7.22(d, 2H, J=8.8Hz), 2.64(q, 2H, J=7.6Hz), 1.24(t, 3H, J=7.6Hz).

[0103] Step 3: Preparation of N-(4-ethylphenyl)benzo[d]oxazole-2,5-diamine (Interm-3-3) Pd / C (Palladium on carbon) (1.70 g, 0.80 mmol, 10 wt.%, wet support) was weighed into a round flask. After that, the mixture was purged with Ar gas. A solution of erm-3-2 (1.58 g, 5.30 mmol) dissolved in methanol (80 mL) was slowly added, and the mixture was then purged with H2(g). The mixture was stirred at room temperature for 18 hours while bubbling with H2(g). After confirming the completion of the reaction by TLC (thin layer chromatography), the mixture was filtered through a Celite pad and the solvent was removed under reduced pressure. The reaction mixture was then analyzed by silica gel column chromatography (silica gel column chromatography). Matrography) (40% Ethyl acetate / n-hexane) Compound Interm-3-3 was obtained as a pale brown solid (1.21 g, 90%).

[0104] 1 H NMR (400MHz, Acetone-d6); δ7.71(m, 2H), 7.19(m, 2H), 7.03(dd, 1H, J=0.8, 8.4Hz), 6.75(dd, 1H, J=0.8, 2.0Hz), 6.44 (dd, 1H, J=2.0, 8.4Hz), 2.60 (q, 2H, J=7.6Hz), 1.19 (t, 3H, J=7.6Hz).

[0105] Step 4: N-(2-(4-ethylphenylamino)benzo[d]oxazol-5-yl)-2 -Chloro-5-nitrobenzamide (N-(2-(4-Ethylphenylamino)b Manufacture of enzo[d]oxazol-5-yl)-2-chloro-5-nitrobenzamide (FCCS-17067) Interm-3-3 (253 mg, 1 mmol) obtained in Step 3, 2-chloro-5-nitrobenzoate 2-chloro-5-nitrobenzoyl chloride de) (220 mg, 1 mmol) in dimethylformamide (N,N-dimethylformamide After dissolving the mixture in 4 mL of 2-chloro-5-nitrobenzoyl chloride (DMF), 129 mg of diisomethylpropylethylamine (DIPEA) (129 mg, 1 mmol) was added and the mixture was stirred at room temperature for 18 hours. After 18 hours, 0.5 equivalents each of 2-chloro-5-nitrobenzoyl chloride and diisomethylpropylethylamine (DIPEA) were added, and the mixture was stirred for 8 hours. The reaction mixture was further stirred for 1 hour. 10% HCl (aq.) was added to the reaction mixture, and the mixture was extracted with ethyl acetate. The organic layer was washed successively with saturated aqueous NaHCO3 solution and brine. The organic layer was dried over Na2SO4, and the solvent was removed under reduced pressure. The reaction mixture was subjected to chromatography (Silica-gel column chromatography). phy) (40% Ethyl acetate / n-hexane) to obtain the target compound. N-(2-(4-Ethylphenylamino)benzo[d]oxazol-5-yl)-2-chloro-5-nitrobenzamide [d]oxazol-5-yl)-2-chloro-5-nitrobenzamide, FCCS-17067) was obtained as a pale yellow solid (120 mg, 27%).

[0106] 1 H NMR (400MHz, DMSO-d6); δ10.71(s, 1H), 10.53(s, 1H), 8.48(d, 1H, J=2.8Hz), 8.34(dd, 1H, J=2.4 , 8.8Hz), 7.90(d, 1H, J=8.8Hz), 7.82(d, 1H, J=2.0Hz), 7.64(d, 2H, J=8.8Hz), 7.46(d, 1H, J=8.8 Hz), 7.40 (dd, 1H, J=2.0, 8.4Hz), 7.21 (d, 1H, J=8.8Hz), 2.58 (q, 2H, J=7.6Hz), 1.18 (t, 3H, J=7.6Hz).

[0107] Example 5: N-(2-(4-Ethylphenylamino)benzo[d]oxazol-5-yl)-3,4-dichlorobenzamide zo[d]oxazol-5-yl)-3,4-dichlorobenzamide, FC CS-17068)

[0108] [ka]

[0109] Interm-3-3 (253 mg, 1 mmol) obtained in Step 3 of Example 4, 3,4-dichloro- 3,4-Dichlorobenzoyl chloride (209 mg, 1 mmol) was dissolved in N,N-dimethylformamide After dissolving the residue in 4 mL of DMF, diisopropylethylamine (DIPEA) (129 mg, 1 mmol) was added and stirred at room temperature for 18 hours. 10% HCl (aq.) was added to the reaction mixture, and the mixture was extracted with ethyl acetate. The organic layer was washed with saturated aqueous NaHCO3 and brine in turn. The organic layer was dried over Na2SO4, and the solvent was removed under reduced pressure. The reaction mixture was purified by silica gel column chromatography (40 % Ethyl acetate / n-hexane) to obtain the target compound FCCS. -17068 was obtained as an off-white solid (270 mg, 64%).

[0110] 1H NMR (400MHz, Acetone-d6); δ8.18(d, 1H, J=2.4Hz), 7.99(t, 1H, J=2.4Hz), 7.97(d, 1H, J=2.0Hz), 7.80-7.20(m, 3 H), 7.70-7.50(m, 1H), 7.35(d, 1H, J=8.8Hz), 7.24(d, 1H, J=8.8Hz), 2.63(q, 2H, J=7.6Hz), 1.22(t, 3H, J=7.6Hz).

[0111] Example 6: N-(2-(4-Ethylphenylamino)benzo[d]oxazol-5-yl)-3-(chloromethyl)benzamide enzo[d]oxazol-5-yl)-3-(chloromethyl)benzam ide, FCCS-17069)

[0112] [ka]

[0113] Interm-3-3 (253 mg, 1 mmol) obtained in Step 3 of Example 4, 3-(chloromethyl)benzoyl chloride ride) (189 mg, 1 mmol) in dimethylformamide (N,N-dimethylformamide After dissolving the compound in 4 mL of methyl methyl amine (DMF), diisopropylethylamine (DIPEA) (129 mg, 1 mmol) was added and stirred at room temperature for 18 hours. 10% HCl (aq.) was added to the reaction mixture, and the mixture was extracted with ethyl acetate. The organic layer was washed with saturated aqueous NaHCO3 and brine in turn. The organic layer was dried over Na2SO4, and the solvent was removed under reduced pressure. The reaction mixture was then chromatographed using a silica-gel column. aphy) (30% Ethyl acetate / n-hexane) Compound FCCS-17069 was obtained as an off-white solid (170 mg, 40%).

[0114] 1 H NMR (400MHz, Acetone-d6); δ8.08(t, 1H, J=1.2Hz), 8.03(d, 1H, J=2.0Hz), 7.98(dt, 1H, J=1.2, 7.6Hz), 7.80-7.75(m, 2H) , 7.69-7.65(m, 1H), 7.57-7.52(m, 3H), 7.34(d, 1H, J=8.8Hz), 7.26-7.22(m, 2H), 2.62(q, 2H, J=7.6Hz), 1.22(t, 3H, J=7.6Hz).

[0115] Example 7: 2-[N-(3,4-dichlorophenyl)]aminobenzoxazole (2-[N -(3,4-dichlorophenyl)]aminobenzoxazole, FCC Manufacturing of S-17065-A

[0116] [ka]

[0117] Step 1: Preparation of 1-(3,4-dichlorophenyl)-3-(2-hydroxyphenyl)thiourea (FCCS-17065-A-2-1) Under an Ar gas atmosphere, 2-aminophenol (300 mg, 2.749 mmol) was dissolved in anhydrous MeOH (8 mL), and then 3,4-dichlorophenyl isothiocyanate was added. Add 0.47 mL of thiocyanate (3.299 mmol) dropwise and stir at room temperature for 14 hours. After confirming that the starting material has completely disappeared by TLC (thin layer chromatography), reduce the pressure to remove the solvent, add silica to the crude and adsorb it, then use silica gel flash column chromatography (Silica -gel Flash Column Chromatography)(30% EtOAc / hexane, R f =0.4) to obtain 793 mg of 1-(3,4-dichlorophenyl)-3-(2-hydroxyphenyl)thiourea (FCCS-17065-A-2-1) (light brown foamy solid, 92%).

[0118] 1 H NMR (400MHz, CD3OD); δ7.82(d, 1H, J=2.8Hz), 7.63(d, 1H , J=7.6Hz), 7.45(d, 1H, J=8.8Hz), 7.39(dd, 1H, J=8.6, 2.2Hz), 7.11-7.06(m, 1H), 6.90(dd, 1H, J=8.0, 1.2Hz), 6.85(td, 1H, J=7.6, 1.2Hz).

[0119] Step 2: Preparation of 2-[N-(3,4-dichlorophenyl)]aminobenzoxazole (FCCS-17065-A) Under an Ar gas atmosphere, FCCS-17065-A-2-1 (400 mg, 1.277 mmol) and potassium superoxide (KO2) (454 m g, 6.386 mmol), acetonitrile (MeCN) (48 mL) was added and the mixture was stirred at room temperature for 14 hours. After confirming by TLC (thin layer chromatography) that all the starting material had disappeared, the crude was added to the silica gel. Add a to adsorb and reduce pressure. Silica-gel flash column chromatography (S ilica-gel Flash Column Chromatography)(20% EtOAc / hexane, R f =0.4), the target compound, 2-[N-(3,4-dichlorophenyl)]aminobenzoxazole (FCCS-17065-A), 231 mg (w A solid (65%) was obtained.

[0120] 1 H NMR (400MHz, CD3OD); δ8.06 (d, 1H, J=2.8Hz), 7.55 (dd, 1 H, J=8.6,2,6Hz), 7.48-7.45(m, 2H), 7.39(d, 1H, J=8.0Hz), 7.24(td, 1H, J=7.6, 1.2Hz), 7.16(td, 1H, J=7.8, 1.2Hz).

[0121] Example 8: Preparation of N-(3,4-dichlorophenyl)naphtho[2,3-d]oxazol-2-amine (FCCS-17065-B)

[0122] [ka]

[0123] Step 1: Preparation of 1-(4,5-dichlorophenyl)-3-(3-hydroxynaphthalen-2-yl)thiourea (FCCS-17065-B-2-1) 3-Amino-2-naphthol under Ar gas atmosphere (350 mg, 2.119 mmol) was mixed with anhydrous MeOH (7 mL) and chloroform. Chloroform (CHCl3) (2 mL) was added and stirred at room temperature for 5 minutes, and then 3,4- Dichlorophenyl isothiocyanate (3,4-dichlorophenyl isothiocyanate) (0.38 mL, 2.638 mmol) was slowly added dropwise and stirred at room temperature for 13 hours. After confirming that the starting material had completely disappeared by TLC (thin layer chromatography), the solvent was removed under reduced pressure, and dichloromethane (dichl Add 8 mL of tetrafluoromethane and stir for 5 minutes. Filter the insoluble solids. , 1-(4,5-dichlorophenyl)-3-(3-hydroxynaphthalen-2-yl)thiourea (1 -(3,4-dichlorophenyl)-3-(3-hydroxynaphthalen-2-yl)thiourea,FCCS-17065-B-2-1), 792mg(white so lid, 99%).

[0124] 1 H NMR (400MHz, DMSO-d6); δ10.48(s, 1H), 10.34(s, 1H), 9.57(s, 1H), 8.59(s, 1H), 8.05(d, 1H, J=2.0Hz), 7.73(d, 1H, J=8.0Hz), 7.6 7(d, 1H, J=7.6Hz), 7.60(d, 1H, J=8.4Hz), 7.52(dd, 1H, J=8.6, 2.2Hz), 7.35(t, 1H, J=7.2Hz), 7.27(t, 1H, J=7.6Hz), 7.24(s, 1H).

[0125] Step 2: N-(3,4-dichlorophenyl)naphtho[2,3-d]oxazol-2-amine (N -(3,4-dichlorophenyl)naphtho[2,3-d]oxazol-2- amine, FCCS-17065-B) Under an Ar gas atmosphere, 400 mg of FCCS-17065-B-2-1 (1.101 mg, ... mmol) and potassium superoxide (KO2) (391m g, 5.505 mmol), acetonitrile (MeCN) (42 mL) was added and the mixture was stirred at room temperature for 14 hours. After confirming by TLC (thin layer chromatography) that all the starting material had disappeared, the crude was added to the silica gel. Add a to adsorb and reduce pressure. Silica-gel flash column chromatography (S ilica-gel Flash Column Chromatography)(20% EtOAc / hexane, R f =0.5) to obtain 236 mg of the target compound, N-(3,4-dichlorophenyl)naphtho[2,3-d]oxazol-2-amine (FCCS-17065-B), a white solid (65%).

[0126] 1 H NMR (400MHz, DMSO-d6); δ11.22(s, 1H), 8.20(d, 1H, J=2.0Hz), 7.98-7.95(m, 4 H), 7.72(dd, 1H, J=8.8,2.4Hz), 7.66(d, 1H, J=8.4Hz), 7.47-7.41(m, 2H).

[0127] Example 9: N-(3,4-difluorophenyl)-5-methylbenzo[d]oxazol-2-amine ]oxazol-2-amine, FCCS-17065-C)

[0128] [ka]

[0129] Step 1: 1-(3,4-difluorophenyl)-3-(2-hydroxy-5-methylphenyl)thiourea (Hylphenyl)thiourea (FCCS-17065-C-2-1) Under an Ar gas atmosphere, 2-amino-p-cresol (300 mg, 2.436 mmol) was added to anhydrous MeOH (8 mL). After dissolving, 3,4-difluorophenyl isothiocyanate (3,4-difluorophenyl Benzyl isothiocyanate (0.37 mL, 2.923 mmol) was slowly added dropwise and the mixture was stirred at room temperature for 13 hours. Check by (hy) that all the starting material has disappeared, remove the solvent under reduced pressure, and then The column was adsorbed onto silica gel and subjected to silica-gel flash column chromatography (30% EtOAc / hexane, R f=0.4) to obtain 710 mg of 1-(3,4-difluorophenyl)-3-(2-hydroxy-5-methylphenyl)thiourea (FCCS-17065-C-2-1) (white foamy solid, 99%).

[0130] 1 H NMR (400MHz, CD3OD); δ7.57-7.52(m, 1H), 7.40(s, 1H), 7.25 -7.13(m, 2H), 6.91(dd, 1H, J=8.0, 1.6Hz), 6.79(d, 1H, J=8.0Hz), 2.25(s, 3H).

[0131] Step 2: N-(3,4-difluorophenyl)-5-methylbenzo[d]oxazol-2-amine Manufacture of xazol-2-amine (FCCS-17065-C) Under an Ar gas atmosphere, FCCS-17065-C-2-1 (400 mg, 1.359 mmol) and potassium superoxide (KO2) (483m g, 6.795 mmol) was added, and acetonitrile (MeCN), M Add 52 mL of ethanol (ECN) and stir at room temperature for 14 hours. After checking by TLC (thin layer chromatography) that all the starting material has disappeared, Add silica gel to the column to adsorb the sample, then reduce the pressure. aphy) (20% EtOAc / hexane, R f =0.45) to achieve the goal The compound N-(3,4-difluorophenyl)-5-methylbenzo[d]oxazol-2-amine (FCCS-17065-C), 224 mg (white solid, 63%) was obtained.

[0132] 1 H NMR (400MHz, CD3OD); δ=7.83-7.78(m, 1H), 7.33-7.29(m, 1H), 7.27-7.20(m, 3H), 6.97-6.95(m, 1H), 2.41(s, 3H).

[0133] <Example 10> N-(3,4-difluorophenyl)benzo[d]oxazol-2-amine ( Synthesis of N-(3,4-difluorophenyl)benzo[d]oxazol-2-amine (FCCS-19025)

[0134] [ka]

[0135] Step 1: Preparation of 1-(3,4-difluorophenyl)-3-(2-hydroxyphenyl)thiourea (FCCS-19025-2-1) 2-Aminophenol (150 mg, 1.37 mmol) was dissolved in methanol (8 mL) under an Ar gas atmosphere, and then 3,4-difluorophenyl After slowly adding 3,4-difluorophenyl isothiocyanate (224 μl, 1.65 mmol), the mixture was stirred at room temperature for 13 hours. After confirming the completion of the reaction by thin layer chromatography, The reaction mixture was purified by chromatography (Si The product was purified by lica-gel column chromatography (20% acetone / n-hexane) to give 1-(3,4-difluorophenyl)-3-(2-hydroxyphenyl)thiourea. (xyphenyl)thiourea, FCCS-19025-2-1) pale yellow solid (354 mg) , 92%).

[0136] 1 H-NMR (400MHz, MeOH-d4) δ7.62(d, J=8.0Hz, 1H), 7.55(ddd,J=2.4Hz, 1H), 7.25-7.13(m, 2H), 7.11-7.05(m, 1H), 6.92-6.82(m, 2H);ESI-(+)281.3[M+H] + .

[0137] Step 2: Preparation of N-(3,4-difluorophenyl)benzo[d]oxazol-2-amine (FCCS-19025) Under an Ar gas atmosphere, FCCS-19025-2-1 (224 mg, 0.80 mmol) obtained in Step 1 and potassium superoxide (KO2) (284 mg, 4.00 mmol) were dissolved in acetonitrile (MeCN) (25 mL). After that, the mixture was stirred at room temperature for 14 hours. After confirming the completion of the reaction with acetonitrile (M The reaction mixture was purified by silica gel column chromatography (10-20% ethyl acetate / n-hexane) to obtain the target compound, N-(3,4-difluorophenyl)benzo[d]oxazol-2-amine. azol-2-amine, FCCS-19025) was obtained as a white solid (160 mg, 82%).

[0138] 1 H-NMR (400MHz, MeOH-d4) δ7.82(ddd,J=2.8Hz, 1H), 7.42(d , J=7.6Hz, 1H), 7.36(d, J=8.0Hz, 1H), 7.34-7.29(m, 1H), 7.28-7.18(m, 2H), 7.16-7.10(m, 1H);ESI-(+)247.2[M+H] + .

[0139] Table 1 below shows the chemical structural formulas of Examples 1 to 10.

[0140] [Table 1]

[0141] <Comparative Example 1> N-(2-chlorophenyl)-1H-indole-3-carboxamide was used as Comparative Example 1. Used.

[0142] [ka]

[0143] <Comparative Example 2> Purchase 2'-Chloroacetanilide (C0621) The resulting mixture was used as Comparative Example 2.

[0144] [ka]

[0145] <Comparative Example 3> N-methyl-1H-indole-3-carboxamide (FCCS-16030) was purchased and used as Comparative Example 3. Ta.

[0146] [ka]

[0147] Comparative Example 4: Preparation of N-(2-((2-chlorophenyl)amino)-2-oxoethyl)-1H-indole-3-carboxamide (FCCS-16031)

[0148] [ka]

[0149] Step 1: Methyl 2-(1H-indole-3-carboxamido)acetate (CCS-16031-3 -1) Manufacturing Indole-3-carboxylate was placed under an Ar gas atmosphere. ic acid) (600 mg, 3.72 mmol) and glycine methyl ester (glycine methyl ester) (467 mg, 3.72 mmol) in chloroform Dissolve in 11 mL of HCl and cool in an ice bath. Triethylamine (1.04 mL, 7.446 mmol) and N,N-diisopropylcarbodiimide were added. After adding the mixture, the mixture was stirred at 0°C for 14 hours. After washing with 10% NaHCO3 aqueous solution, the mixture was washed with 5% HCl The mixture was washed with an aqueous solution, passed through an anhydrous Na2SO4 pad to remove residual water, and then the solvent was removed under reduced pressure. Methyl 2-(1H-indole-3-carboxamido)acetate was obtained by HPLC-gel Flash Column Chromatography (70% ethyl aceate / n-hexane). 430 mg (white solid, 50%) of oxamido)acetate, CCS-16031-3-1) was obtained in a mixture state. This was carried on to the next step without further purification. ESI-MS: 231.2 [MH] -

[0150] Step 2: 2-(1H-indole-3-carboxamido)acetic acid (2-(1H-indole-3- Manufacture of (carboxamido)acetic acid (FCCS-16031-3-2) 2-(1H-indole-3-carboxamide)acetate (meth) obtained in step 1 yl 2-(1H-indole-3-carboxamido)acetate, CCS-16031-3-1 (220 mg, 0.947 mmol) in tetrahydrofuran ran) (6 mL), and then lithium hydroxide hydrate (LiOH monohydra A solution of te) (131 mg, 3.126 mmol) in water (2 mL) was added and stirred at room temperature for 1 hour. After adjusting the pH to 2 with 1.0N HCl aqueous solution, The extract was passed through an anhydrous Na2SO4 pad to remove residual water. After that, the solvent was removed under reduced pressure. 2-(1H-indole-3-carboxamido)acetic acid was isolated by lica-gel Flash Column Chromatography (10% methanol / dichloromethane). o)acetic acid, FCCS-16031-3-2)147mg(yellow foam y solid, 71%).

[0151] 1 H NMR (400MHz, CD3OD); δ8.10-8.08(m, 1H), 7.92(s, 1H), 7.43(dt, J=8.0, 1.2Hz, 1H), 7.17(quint d, J=7.2, 1.6Hz, 2H), 4.12(s, 2H).

[0152] Step 3: N-(2-((2-chlorophenyl)amino)-2-oxoethyl)-1H-indole -3-carboxamide (N-(2-((2-chlorophenyl)amino)-2-oxoethyl)-1H-indole-3-carboxamide, FCCS-16031) Under an Ar gas atmosphere, 2-(1H-indole-3-carboxamido)acetic acid (FCCS-16031-3-2) (200 mg, 0.917 mmol) obtained in Step 2 above and TSTU (N,N,N',N'-Tetramethyl-O-(N-succinimidyl)uronium tetrafluoroborate) (290 mg, 0.962 mmol) were dissolved in dimethylformamide (N,N-dim ethylformamide) (4 mL, anhydrous) and After adding methylpropylethylamine (DIEA) (0.4 mL, 2.293 mmol), the mixture was stirred at room temperature for 3 Add 2-chloroaniline (0.29 mL, 2.751 mmol) and N,N-diisomethylpropylethylamine (DIEA) (0.64 mL, 3.668 mmol) and heat at 60°C for 4 hours. Remove the solvent under reduced pressure and add dichloromethane (dichl The organic layer was extracted with saturated aqueous NH4Cl and anhydrous N The remaining water was removed by passing through a SO4 pad, and the solvent was then removed under reduced pressure. By performing column chromatography (70% ethyl acetate / n-hexane), 20 mg of the target compound, N-(2-((2-chlorophenyl)amino)-2-oxoethyl)-1H-indole-3-carboxamide (FCCS-16031) (white solid, 6.6%) was obtained.

[0153] 1 H NMR (400MHz, CD3OD); δ8.15-8.12(m, 1H), 8.04(dd,J=8.0, 1.2Hz, 1H), 7.97( s, 1H), 7.46-7.41(m, 2H), 7.33-7.28(m, 1H), 7.23-7.12(m, 3H), 4.26(s, 2H).

[0154] <Experimental Example 1-1> Luciferase expression experiment (Comparative Examples 1 to 4) To evaluate the expression of the klotho gene through luciferase activity, human renal proximal tubule epithelial cells (RPTECs) were used. Cells (ATCC CRL-4031) were purchased from Lonza, USA.

[0155] For culture, Renal Epithelial Growth Medium (REGM) from the same company, Lonza, was used. TM The cells were cultured at 37°C and 5% CO2 using a Bulletkit. The plasmid used for luciferase expression was one in which the promoter region of the human KL (klotho) gene was positioned to regulate the expression of the firefly luciferase gene.

[0156] Plasmids were transfected using Roche's X-treme GENE transfection The compounds were introduced into cells using a reagent. Luciferase activity expressed in the cells was measured using a Promega Dual-Luciferase reporter assay system. Cultured cells were treated with the indicated concentrations of each compound for 24 hours, and then luciferase activity was measured. High luciferase activity indirectly indicates increased klotho gene expression.

[0157] Comparative Examples 1 to 4 were treated at a concentration of 5 μM with RPTEC cells to induce the expression of the human klotho gene. Reporter genes containing promoters up to 1.7 kbp before the start site or human klotho Using a reporter gene containing a promoter up to 240 bp before the start site of the gene, The expression of the reporter gene was confirmed.

[0158] As a result, as shown in FIG. 1, it was confirmed that the compound of Comparative Example 1 had the highest luciferase activity. <Experimental Example 1-2> Luciferase expression experiment (Examples 1 to 6) Based on the results of Experimental Example 1-1, Examples 1 to 6 having a chemical structure similar to that of Comparative Example 1 were prepared. was synthesized and Experimental Example 1-2 was carried out.

[0159] The epithelium of the proximal tubule of the human kidney m) RPTEC cells were treated with Examples 1 to 6 at concentrations of 0.5, 1 and 5 μM, respectively, and the ratio Comparative Example 1 was treated at a concentration of 5 μM, and the -2.1 kb upstream of the human klotho gene was The reporter gene (pHKP-luc) containing the promoter contained in (1) was used to confirm the expression of the reporter gene, and the results are shown in FIGS.

[0160] As shown in FIG. 2, the expression of the reporter gene of the compounds of Example 1 and Example 2 was higher than that of Comparative Example 1. It was confirmed that the levels were similar. As shown in FIG. 3, Comparative Example 1 and Examples 1 to 3 were treated at a concentration of 5 μM to RPTEC cells. The promoter region of the human klotho gene up to -2.1 kb upstream was included. The reporter gene (pHKP-luc) was used to confirm the expression of the reporter gene, and it was confirmed that the compound of Example 2 had a similar level to that of Comparative Example 1.

[0161] <Experimental Example 2> Real-time PCR analysis of klotho (KL) gene expression levels Quantitative evaluation The proximal tubules of human kidneys treated with the compounds of Comparative Example 1 and Examples 1 and 2 for 6 hours were RPTEC cells, which are epithelial cells of the mal tubule, The RNeasy kit from Qiagen was used to extract RNA. The extracted RNA was used to prepare cDNA using the Superscript II kit from Thermo, and the KL (klotho) gene-specific kit was used for Taqman Gene Expression assays from Applied Biosystems. The results are shown in Figure 4.

[0162] As shown in Figure 4, it was confirmed that the compound of Example 2 had a similar level to that of Comparative Example 1. did. Based on the results of Experimental Example 2, compounds of Examples 7 to 10 having a similar chemical structure to the compound of Example 2 were prepared. The compound was synthesized and used in the following Experimental Example 3.

[0163] <Experimental Example 3> Quantitative evaluation of klotho (KL) gene expression using a general PCR experiment RPTEC cells, which are epithelial cells of the proximal tubule of the human kidney, were treated with Examples 7 to 10 at 2.5 μM each for 6 hours, and RNA was extracted from the cells. The extracted RNA was used to prepare cDNA using Thermo's Superscript II kit, followed by general PCR.

[0164] The information on the primers used in the experiment is as follows: KL-F GATAGAGAAAAATGGCTTCCCTCC (SEQ ID NO: 1) KL-R GGTCGGTAAACTGAGACAGAGTGG (SEQ ID NO: 2) GAPDH-F TGACAACTTTGGTATCGTGGAAGG (SEQ ID NO: 3) GAPDH-R AGGGATGATGTTCTGGAGAGCC (SEQ ID NO: 4) The PCR-amplified DNA was electrophoresed on an agarose gel and then purified with ethidium bromide ( The amount of DNA in the band was confirmed by staining with Sp Quantitative comparison was performed using the eedyQuant program and is shown in Figure 5 .

[0165] As shown in FIG. 5, the expression level of the klotho (KL) gene in Examples 8 to 10 was higher than that in Comparative Example 1. It was confirmed that the efficiency was high, and in particular, Example 10 showed an improvement of about 10 times compared to Comparative Example 1. .

[0166] <Experimental Example 4> Toxicity test Cultured HK2 (Human kidney-2) cells were treated with Comparative Example 1, Example 2, and Examples 9 and 10 at a concentration of 25 μM or 12.5 μM, and after 24 hours, EZ-Cytox k EZ-Cytox was used to measure cytotoxicity. EZ-Cytox produces formazan, which has an absorbance at 450 nm, by the mitochondrial enzymes of living cells. Live cells show a higher absorbance at 450 nm. The toxicity of cells treated with the same volume of DMSO as the compound treated was considered to be 1. We then examined how much the toxicity of the cells was reduced by compound sample treatment, and the results are shown in Figure 6.

[0167] As shown in FIG. 6, when treated at a concentration of 12.5 μM or 25 μM, all of the The compound showed the lowest toxicity, with a 20% or greater improvement in toxicity compared to Comparative Example 1. did.

[0168] <Experimental Example 5> Analysis of the inhibitory effect of KS1 compound (Example 10) on neuronal aging 1) Cell culture and compound treatment HT22 cells, which are neurons derived from mouse hippocampus, were cultured in DMEM culture medium supplemented with 10% FBS. The cells were cultured in a 37°C incubator under 5% CO2 conditions. When the cells grew to 80% saturation on the surface of the culture dish, they were treated with 0.05% trypsin and transferred to a new culture dish for subculture. The compound was maintained at a final concentration of 2.5 μM. DMSO was added to the medium at each subculture to ensure senescence. Cells containing only the solvent, DMSO, were used as a negative control, and cells (#5) that had been subcultured three times were used as a control group in which senescence did not progress. All cells in which senescence was induced were cells (#25) that had been subcultured 20 times.

[0169] 2) Check the degree of aging To confirm the degree of cell senescence, we used Cell Signaling Technology's Senescence β-galactosidase staining kit. On the day of the experiment, the staining solution was added to the cells, and after 8 hours, The stained cells were identified. The number of stained cells was identified and expressed as a ratio to the total number of cells observed under a 200x microscope. The number of stained cells in three different locations per sample was counted and averaged. The expression of the β-galactosidase enzyme increases as the cells become senescent. Therefore, stained cells can be judged to be cells that have progressed to a greater degree of senescence than unstained cells.

[0170] 3) Experimental results The experimental results showed that cells subcultured 20 times showed an increased degree of senescence compared to cells subcultured 5 times. When observed under a microscope at 200x magnification, the cells that had been subcultured 20 times were 50% of the cells. In the cells subcultured 20 times, approximately 5% of the cells were stained, whereas in the cells subcultured 5 times, only 5% of the cells were stained. Similarly, in the cell group cultured in the medium containing the KS1 compound (Example 10), staining was observed. The degree of staining decreased, and about 40% of the cells were stained. Cells cultured in DMSO-containing medium showed a 20% reduction in senescence over a 20-passage period compared to cells grown in DMSO-containing medium (Figure 7).

[0171] Experimental Example 6: Analysis of the inhibitory effect of KS1 compound (Example 10) on nerve cell inflammation 1) Cell culture and compound treatment HT22 cells, which are neuronal cells derived from mouse hippocampus, were cultured in DMEM culture medium supplemented with 10% FBS. The cells were cultured in a 37°C incubator under 5% CO2 conditions. When the cells grew to approximately 80% saturation on the surface of the culture dish, they were treated with 0.05% trypsin and transferred to a new culture dish for subculture. The compound was maintained at a final concentration of 2.5 μM. DMSO was added to the medium at each subculture to ensure optimal senescence. Cells containing only the solvent, DMSO, were used as a negative control, and cells (#5) that had been subcultured three times were used as a control group in which senescence did not progress. Cells (#25) that had been subcultured 20 times were used for all senescence-induced cells.

[0172] 2) Inflammation induction experiment The cells were dispensed into each well of a 96-well plate so that 10,000 cells were in 160 μl of medium, and cultured in an incubator at 37°C under 5% CO2 for 24 hours. At this time, the compound was added to a final concentration of 2.5 μM. After culturing, Cell Application's LPS (lipopolysaccharide) was added at a concentration of 1 μg / mL and the cells were further cultured for 24 hours. After that, 20 μl of the Cyto X cell viability assay kit, a product of the same company, was added to each well and the cells were cultured for 1 to 4 hours. The color change was measured at 450 nm.

[0173] 3) Experimental results The experimental results showed that cells subcultured 20 times showed a greater reduction in LPS-treated cells compared to cells subcultured 5 times. The increase in cell toxicity was observed using a spectrophotometer. When measured with DMSO, approximately 80% of cells cultured 20 times were resistant to LPS toxicity. However, cells cultured five times were relatively toxic, with only 50% of the cells appearing dead. Cell death occurred more frequently in senescent cells. In the case of cells cultured in a medium containing the KS1 compound (Example 10), it was found that the percentage of cells that died upon LPS treatment was 60% for cells that had been subcultured 20 times, and 45% for cells that had been subcultured 5 times. In other words, it was confirmed that the cytotoxicity caused by LPS was reduced in cells subcultured in the presence of the KS1 compound (Example 10), and more cells survived, which indicates that the KS1 compound (Example 10) has a devastating effect on the cells. This shows that it is effective in suppressing inflammation in transcellular areas (Figure 8).

[0174] <Experimental Example 7> Experiment to confirm the therapeutic effect of KS1 compound in an animal model of cognitive dysfunction 1) Animal Model and Administration Method of KS1 Compound (Example 10) In this experiment, 4- or 6-month-old 5xFAD mice were used. The Alzheimer's mice were genetically mutated to overproduce beta-amyloid (Aβ) and were provided by the KIST Research Animal Resource Center, which maintains and sells them. Normal controls (WT) were normal mice not genetically mutated to overproduce beta-amyloid (Aβ) and were provided by the KIST Research Animal Resource Center. Experimental animals underwent a one-week acclimatization period before the experiment. During the experiment, mice were housed in an animal room maintained at a temperature of 22±2°C and humidity of 40-60%, with a diet ad libitum. The light-dark cycle was controlled with 12-hour intervals. All animal experiments were conducted in accordance with the animal experiment operating regulations of the Korea Institute of Science and Technology (KIST) Institutional Animal Care and Use Committee.

[0175] Animal model mice and normal control mice were treated with vehicle (5% DMSO) for 4 or 12 weeks. + 65% PEG400 + 30% Saline), or a vehicle containing KS1 (Example 10) was orally administered every 24 hours. The mice were administered at a dose of 10 mg / kg per day. Three mice were used in each experimental group. Body weight was measured weekly during the administration period, and cognitive function was evaluated after the administration period. After the mice were sacrificed, their organs were removed and changes in their condition were confirmed by biochemical methods.

[0176] 2) Experimental method to confirm cognitive function 2-1) Novel Object Recognition Test (NOR) The Novel Object Recognition Test is a modified version of an existing method. The experiment consisted of an adaptation period, an exploration period, and a new object recognition period. On the day before the experiment, the mice were placed in the open area for 30 minutes to allow them to adapt, and then two identical objects were placed at regular intervals. The experimental animals were then placed in the open area for 10 minutes. The animals were allowed to explore freely, and the time they spent on each object was measured using Ethovision. They were then returned to their cages for one day. The next day, one of the objects was replaced with a new substance, and the behavior of the experimental animals was monitored. The object preference (recognition index (%)) was calculated by converting the time spent on each object into a percentage of the total exploration time.

[0177] 2-2) Passive avoidance experiment The manual avoidance experiment mechanism is divided into two areas: a light-filled area and a dark area. During training, the experimental animals were placed in the light zone, and as soon as they moved to the dark zone, the door was closed and they received a foot shock of 0.45 mA for 2 seconds. The test was conducted one day after training, and the time it took for the experimental animals to move to the dark zone again after being placed in the light zone was measured (maximum time). (The interval was set to 600 seconds.) This manual avoidance experiment was used to evaluate spatial learning and memory.

[0178] 2-3) Statistical processing All data are presented as mean (SEM), and differences between groups were analyzed using one-way ANOVA and Tuke The results were confirmed using a multiple comparisons test. In these cases, the results were indicated as p<0.05*, p<0.01**, and p<0.001***.

[0179] 3) Experimental results 3-1) Decreased expression of proteins associated with cognitive dysfunction Brain tissue sections isolated from the control group (CTL) and the 1-month and 3-month KS1-administered groups of the 5xFAD cognitive impairment animal model and normal control animal model were analyzed in each region (HPC: hippocampus; CTX: neurite outgrowth). The phospho-Tau fluorescence level measured in the cortex was examined by immunofluorescence. The results showed that the expression of phospho-Tau protein was statistically significantly reduced in mice administered KS1 (Example 10) compared to mice administered vehicle. In the hippocampus (HPC) region, tumors were only observed in mice administered for 3 months. A decrease in protein expression was observed in the primary somatosensory cortex (CTX) in both 1-month and 3-month-treated mice (Figure 9).

[0180] 3-2) Increased expression of the neuronal marker NeuN 5xFAD cognitive impairment animal model and normal control group. Control group (CTL) and KS1 1 month. Immunohistochemistry was used to measure NeuN fluorescence levels in various regions (CTX: neocortex, CA: cornu ammonis, DG: dentate gyrus) of brain tissue sections isolated from the 3-month treatment group. Results confirmed that the expression of the neural marker protein NeuN was increased to a statistically significant level in mice treated with KS1 (Example 10) compared to vehicle-treated mice (Figure 10). While no significant increase in NeuN was observed in the primary somatosensory cortex (CTX) or dentate gyrus (DG) with KS1, an increase in NeuN was observed in the cornu ammonis (CA) in the KS1-treated group.

[0181] 3-3) Novel Object Recognition Test (NOR) When mouse behavior was examined using the NOR method, cognitively impaired (5xFAD) mice administered KS1 showed statistically significantly higher object exploration ability than vehicle-administered mice. This was confirmed (Figure 11).

[0182] 3-4) Passive Avoidance Experiment The results of spatial learning and memory tests using manual avoidance experiments showed that cognitively impaired (5xFAD) mice exhibited positive Although it was confirmed that the ability was significantly reduced compared to normal mice, it was confirmed that the mice administered KS1 for 4 weeks retained the same level of ability as normal mice (Figure 12).

[0183] The present invention has been described above with reference to its preferred embodiments. Those skilled in the art will understand that the present invention can be embodied in various modified forms without departing from the essential characteristics of the present invention. Therefore, the disclosed embodiments should be considered from an illustrative rather than a restrictive perspective. The scope of the present invention is particularly indicated in the appended claims, rather than the foregoing description, and all variations within the scope of equivalents thereto should be construed as being within the scope of the present invention.

Claims

1. A pharmaceutical composition for preventing or treating Alzheimer's disease, comprising a compound represented by the following chemical formula or a pharmaceutically acceptable salt thereof: 【Chemical 1】

2. The pharmaceutical composition according to claim 1, wherein the composition enhances the expression level of the Klotho gene.

3. A functional health food composition for preventing or ameliorating Alzheimer's disease, comprising a compound represented by the following chemical formula or a pharmaceutically acceptable salt thereof: 【Chemistry 2】

4. A food composition for preventing or ameliorating Alzheimer's disease, comprising a compound represented by the following chemical formula or a pharmaceutically acceptable salt thereof: 【Chemistry 3】

Images